TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3065-3p
miRNA Sequence: UCAGCACCAGGAUAUUGUUGGAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000044chrX----1274 --
NM_000061chrX1403 ------
NM_000081chr111281 --11158 --
NM_000084chrX86502 4987 4366 2390 1293 1127 940 119 --11181 16470
NM_000088chr1731061 929 886 ------
NM_000090chr23688 614 248 1889 ----
NM_000093chr922529 558 --11801 --
NM_000104chr222391 92 ------
NM_000109chrX22409 1959 ------
NM_000112chr584078 3999 3636 2032 1970 1468 866 381 25534 4843 --14342
NM_000138chr1531912 677 422 1237 ----
NM_000163chr521768 274 ------
NM_000165chr6177 --157 --
NM_000168chr723009 797 --12915 --
NM_000176chr523028 684 --12749 --
NM_000192chr121399 ------
NM_000208chr1974601 3923 3835 3207 3035 1652 1642 12979 13618 --
NM_000210chr241966 1575 658 467 --11926 --
NM_000212chr172329 197 ----11537
NM_000214chr2011466 ------
NM_000217chr12--23432 3241 11848 --
NM_000237chr841802 1340 262 100 ----1767
NM_000259chr1575882 4857 4759 4322 4275 4230 191 ----14751
NM_000264chr943042 2094 969 755 1998 ----
NM_000272chr211186 ------
NM_000276chrX21788 223 ----11587
NM_000280chr111330 ------
NM_000310chr111203 --11209 1196
NM_000314chr1033121 1038 682 ------
NM_000332chr667062 6250 4906 4872 4558 2385 --1768 --
NM_000337chr521832 1355 ------
NM_000345chr42225 178 ----1829
NM_000368chr943481 1353 742 263 --14405 --
NM_000378chr1121056 143 ----11199
NM_000379chr221605 33 --11485 --
NM_000386chr171100 ----1780
NM_000390chrX1558 13243 ----
NM_000399chr101845 ------
NM_000408chr223095 2507 --1147 --
NM_000411chr211170 ------
NM_000421chr171238 ------
NM_000430chr171882 ------
NM_000435chr191620 ------
NM_000461chr323962 92 ------
NM_000480chr1121217 663 ------
NM_000484chr2131088 741 139 ------
NM_000489chrX22641 2582 1736 ----
NM_000495chrX3434 393 112 ------
NM_000503chr821829 1647 ------
NM_000516chr201316 ------
NM_000520chr151475 --2146 25 --
NM_000533chrX11601 --1736 --
NM_000554chr1933149 1015 137 ----1296
NM_000555chrX56867 6431 5185 4810 95 17757 27740 621 --
NM_000610chr1132893 1892 706 ------
NM_000617chr1242249 2176 1424 669 ------
NM_000618chr121907 --1321 --
NM_000618chr121907 --1321 --
NM_000627chr22661 263 ------
NM_000663chr1612844 --12086 1183
NM_000673chr4128 ------
NM_000719chr1211447 --24152 2530 1683
NM_000721chr132577 2389 2271 --1699 2751 606
NM_000801chr20----2842 377 --
NM_000806chr521394 405 ------
NM_000811chr51572 ------
NM_000813chr515245 ------
NM_000817chr211018 ------
NM_000818chr102521 377 --1182 --
NM_000824chr41587 ------
NM_000826chr422599 798 ------
NM_000829chr1132329 1785 1600 ------
NM_000841chr64883 715 705 333 ----1130
NM_000859chr511406 --1524 --
NM_000868chrX22566 597 ------
NM_000875chr1534903 4538 730 --36069 4768 2144 --
NM_000876chr621290 1206 1975 ----
NM_000885chr21845 ------
NM_000891chr1732942 2293 1008 1465 ----
NM_000899chr1233843 1766 1743 ----11030
NM_000901chr43705 667 45 ------
NM_000912chr833215 2290 1100 11174 ----
NM_000926chr1149224 8274 7924 6241 38837 7233 7023 ----
NM_000944chr412306 12393 11611 --
NM_000945chr231550 1509 507 ------
NM_000950chrX12392 ------
NM_001001323chr1252306 2073 1015 861 474 12042 --13104
NM_001001331chr312275 ------
NM_001001349chr1721387 1148 168 ----
NM_001001389chr1132893 1892 706 ------
NM_001001390chr1132893 1892 706 ------
NM_001001391chr1132893 1892 706 ------
NM_001001392chr1132939 1938 752 ------
NM_001001395chr1222844 2568 12728 ----
NM_001001396chr154380 4229 2923 1034 165 ------
NM_001001419chr554704 3604 1108 1098 205 ------
NM_001001420chr554704 3604 1108 1098 205 ------
NM_001001438chr21186 --1269 --
NM_001001502chr51499 ------
NM_001001521chr2--1114 ----
NM_001001549chr722495 1065 ------
NM_001001550chr722495 1065 ------
NM_001001552chr12326 37 ------
NM_001001555chr722495 1065 ------
NM_001001701chr412005 --11572 --
NM_001001787chr11404 ------
NM_001001890chr2134095 1471 1446 1799 ----
NM_001001924chr811854 ------
NM_001001925chr811854 ------
NM_001001931chr811854 ------
NM_001001938chr953594 3152 2645 1302 365 --43295 1507 762 164 --
NM_001001971chr101561 ------
NM_001002032chr173701 663 624 ------
NM_001002033chr173801 763 724 ------
NM_001002243chr21249 ------
NM_001002259chr12136 ------
NM_001002860chr1444365 3895 3787 1294 --11351 --
NM_001002909chr1732066 1701 1694 1760 --167
NM_001003406chr2253297 2376 2113 1327 1070 ------
NM_001003407chr1054959 3874 1981 1786 1252 1331 11351 --
NM_001003408chr1054959 3874 1981 1786 1252 1331 11351 --
NM_001003652chr1868202 8073 7620 2481 2345 346 ------
NM_001003674chr18107006 6383 6058 4944 2587 1888 965 559 503 80 --14991 --
NM_001003675chr18107006 6383 6058 4944 2587 1888 965 559 503 80 --14991 --
NM_001003688chr41344 ------
NM_001003698chr621400 1383 --1262 --
NM_001003699chr621400 1383 --1262 --
NM_001003712chr1212849 1872 ----
NM_001003792chr31173 1790 ----
NM_001003793chr31173 1790 ----
NM_001003800chr953062 2828 2677 1291 77 13412 1979 --
NM_001003810chr4--1827 ----
NM_001003927chr17179 ------
NM_001003940chr1543562 3364 3202 1391 ------
NM_001003942chr1543562 3364 3202 1391 ------
NM_001003943chr1543566 3368 3206 1395 ------
NM_001004051chrX167 ------
NM_001004065chr963789 3436 3340 3294 977 33 24004 3603 1468 --
NM_001004196chr3--11255 ----
NM_001004317chr644236 4160 3046 1807 ----14091
NM_001004342chr125706 5520 --21805 430 --
NM_001004360chr221299 179 11305 ----
NM_001004419chr1221582 254 ------
NM_001005209chr21255 --1579 --
NM_001005353chr111045 --167 --
NM_001005353chr111045 --167 --
NM_001005360chr19----1226 --
NM_001005361chr19----1226 --
NM_001005362chr19----1226 --
NM_001005366chr122869 167 ----1210
NM_001005404chr1734502 3801 1138 --13182 --
NM_001005463chr1022069 336 ------
NM_001005473chr524947 1578 16397 ----
NM_001005476chr21204 ------
NM_001005505chr321513 187 ------
NM_001005609chrX41494 1310 498 76 --1102 --
NM_001005739chr23809 587 146 ------
NM_001005782chr2175 1174 ----
NM_001005910chr32447 145 ------
NM_001005911chr32447 145 ------
NM_001006115chr342734 2300 2222 853 12517 ----
NM_001006600chr561997 1942 1907 971 473 265 --1526 --
NM_001006617chr911142 ------
NM_001006619chr911142 ------
NM_001006620chr911142 ------
NM_001006621chr911142 ------
NM_001006944chr112726 460 ------
NM_001006946chr241515 1312 721 159 ------
NM_001007024chr1743525 1570 1553 184 1313 ----
NM_001007025chr1743525 1570 1553 184 1313 ----
NM_001007097chr965044 4638 4057 143 107 40 14685 24454 3222 11969
NM_001007098chr1--1888 ----
NM_001007156chr151163 --11414 --
NM_001007237chr122693 981 11806 22298 1151 --
NM_001007257chr111397 ------
NM_001007466chr654923 4636 2032 684 652 ------
NM_001007471chr91136 ------
NM_001007559chr1821882 779 ------
NM_001007565chr31135 ------
NM_001008220chr563798 3707 3700 2513 2428 1260 ------
NM_001008392chr323095 2904 --13239 1555
NM_001008530chr141472 156 ----
NM_001008539chr824509 309 ----13721
NM_001008541chr1011903 1925 ----
NM_001008541chr1011903 1925 ----
NM_001008564chr1322208 1835 ------
NM_001008660chr1121168 1006 ------
NM_001008738chr532003 1124 324 ------
NM_001008777chr171442 1201 ----
NM_001008895chr131976 ------
NM_001009899chr321146 428 ------
NM_001009993chr284587 4216 3670 3396 3350 2911 1629 1376 --166 --
NM_001010861chr12629 243 ------
NM_001010888chrX53943 3397 676 613 92 ------
NM_001010891chr566589 5822 5346 2764 1251 1167 ------
NM_001010986chrX21537 254 22365 757 ----
NM_001011537chr342313 2291 1876 644 2588 434 ----
NM_001011551chrX2208 48 ------
NM_001011553chr71187 ------
NM_001011645chrX----1274 --
NM_001011666chr731587 451 227 15924 26268 1812 --
NM_001011718chr205744 602 324 253 61 ------
NM_001012329chr152369 2035 1846 471 356 ------
NM_001012393chr1133833 1892 1132 --13501 --
NM_001012755chrX43449 1654 1449 710 13523 11720 --
NM_001012977chrX41093 904 564 464 ------
NM_001013031chr1063385 3363 3076 2617 1208 204 --12450 --
NM_001013438chr31148 ------
NM_001013620chr1247328 3282 3088 790 23144 696 ----
NM_001013635chr1231189 987 764 --1900 --
NM_001013693chr152358 1915 1125 467 382 --22048 1148 1566
NM_001013693chr152358 1915 1125 467 382 --22048 1148 1566
NM_001013843chr15--1587 ----
NM_001014797chr1058125 7435 6346 2583 972 --26972 2965 --
NM_001014809chr42677 236 ----1100
NM_001014839chr11684 ------
NM_001014841chr11684 ------
NM_001015877chrX32885 1044 881 ------
NM_001015887chr341215 1151 139 79 ------
NM_001017395chr322883 955 ------
NM_001017434chr12164 84 ------
NM_001017440chr73755 652 27 17255 ----
NM_001017979chr4--122 ----
NM_001017999chr11277 --1131 --
NM_001017999chr11277 --1131 --
NM_001018000chr11277 --1131 --
NM_001018000chr11277 --1131 --
NM_001018001chr11277 --1131 --
NM_001018057chr112541 197 --1145 --
NM_001018067chr155062 5010 4680 1704 1660 ------
NM_001018068chr155062 5010 4680 1704 1660 ------
NM_001018069chr155062 5010 4680 1704 1660 ------
NM_001018074chr523028 684 --12749 --
NM_001018075chr523028 684 --12749 --
NM_001018076chr523028 684 --12749 --
NM_001018077chr523028 684 --12749 --
NM_001018090chr1512558 11102 ----
NM_001018102chr1512558 11102 ----
NM_001018111chr723191 225 --13839 --
NM_001020825chr51503 --1224 --
NM_001024094chr523028 684 --12749 --
NM_001024226chr12325 128 2364 276 ----
NM_001024227chr12325 128 2364 276 ----
NM_001024228chr12325 128 2364 276 ----
NM_001024380chr81208 ------
NM_001024381chr81208 ------
NM_001024401chr1632546 1028 506 --22311 2258 --
NM_001024460chr62852 192 ------
NM_001024649chr512256 1870 ----
NM_001024660chr311063 11443 11516 --
NM_001024808chr1232781 2593 294 --1672 1973
NM_001024912chr1931843 1484 731 1163 ----
NM_001024934chr6155 1466 ----
NM_001024935chr6155 1466 ----
NM_001024936chr6155 1466 ----
NM_001024956chr1154544 3750 1965 1478 1036 ------
NM_001025076chr1075012 4232 3970 1509 1360 972 789 ------
NM_001025077chr10106370 5590 5328 4577 2867 2718 2330 2147 1243 479 ------
NM_001025201chr21213 ------
NM_001025203chr21139 ------
NM_001025204chr21139 ------
NM_001025266chr344460 3976 1840 353 ------
NM_001025389chr1121217 663 ------
NM_001025390chr1121217 663 ------
NM_001025580chrX22658 715 ------
NM_001025595chr41489 11393 ----
NM_001025596chr111422 1161 ----
NM_001025616chr421461 517 ------
NM_001029858chr622590 580 ----11048
NM_001029863chr612047 --11017 --
NM_001030001chr14--1305 ----
NM_001030007chr1653769 3284 2816 1132 728 --22853 1206 --
NM_001030055chr1424773 1127 --14236 --
NM_001030272chr111348 ------
NM_001030273chr111348 ------
NM_001031681chr1721687 842 1929 197 --
NM_001031684chr21527 --1352 --
NM_001031685chr11223 ------
NM_001031695chr2224286 3696 ----1424
NM_001031700chr4126 ------
NM_001031710chr7194 1848 ----
NM_001031717chr33769 164 91 --123 --
NM_001031746chr10--11395 ----
NM_001031804chr162544 468 --23938 3429 --
NM_001032221chr951437 1360 1230 716 388 ------
NM_001032380chr1021920 637 ------
NM_001033047chr42810 317 --2405 238 --
NM_001033057chr31840 ------
NM_001033059chr6----22017 390 --
NM_001033081chr121773 216 ------
NM_001033082chr121773 216 ------
NM_001033112chr51718 1153 ----
NM_001033117chr323162 227 --14226 --
NM_001033507chr131580 704 639 ------
NM_001033557chr221215 129 ------
NM_001033561chr17185 ------
NM_001033602chr1322691 1725 1423 ----
NM_001033723chr822415 521 12373 168 --
NM_001034845chr41504 11123 ----
NM_001034850chr521587 245 ------
NM_001034954chr1022265 137 23230 200 ----
NM_001034955chr1022265 137 23230 200 ----
NM_001034956chr1022265 137 23230 200 ----
NM_001034957chr1022265 137 23230 200 ----
NM_001035254chr912436 1866 1820 --
NM_001037172chr331385 1301 1247 ------
NM_001037174chr2145 --12001 --
NM_001037317chr12629 243 ------
NM_001037332chr5--12542 ----
NM_001037333chr5--12542 ----
NM_001037334chr1862162 864 800 498 474 199 ------
NM_001037872chr2----1632 --
NM_001037954chr11----1834 1561
NM_001038707chr122219 1707 ------
NM_001038707chr122219 1707 ------
NM_001039350chr731578 1204 113 21622 1306 ----
NM_001039395chr91287 1101 ----
NM_001039457chr1199 ------
NM_001039467chr202585 150 --165 --
NM_001039479chr14----11679 11573
NM_001039538chr2----1881 --
NM_001039547chr356137 5934 5079 1877 1814 --16410 --
NM_001039577chr134036 3369 1177 13659 --13690
NM_001039590chrX1369 ------
NM_001039591chrX1369 ------
NM_001039618chr1155268 4954 4772 3995 453 ------
NM_001039690chr162563 266 ------
NM_001039693chr283811 3645 3558 1160 879 289 173 122 ------
NM_001039711chr121116 961 ------
NM_001039712chr121116 961 ------
NM_001039802chr121003 950 11351 ----
NM_001039840chrX2280 141 11992 ----
NM_001039916chr1221199 276 --1798 --
NM_001039917chr1221199 276 --1798 --
NM_001039918chr1221199 276 --1798 --
NM_001039919chr1221199 276 --1798 --
NM_001039920chr1221199 276 --1798 --
NM_001040101chr431422 1264 1192 31409 545 467 ----
NM_001040110chr731841 1336 1211 ----21323 716
NM_001040135chr72768 524 --1101 --
NM_001040142chr232129 653 405 ------
NM_001040143chr232129 653 405 ------
NM_001040144chr162563 266 ------
NM_001040146chr162563 266 ------
NM_001040151chr1144562 3740 1594 344 11263 23372 950 --
NM_001040153chr13--1623 ----
NM_001040157chr422698 885 2657 288 11022 --
NM_001040158chr52371 364 ------
NM_001040159chr41561 ------
NM_001040167chr751206 1167 841 804 405 ------
NM_001040202chr42898 418 1281 ----
NM_001040214chr61954 1312 ----
NM_001040284chr1644587 1077 887 346 --15641 --
NM_001040402chr41133 ------
NM_001040429chr1352914 2523 2418 1155 1116 ------
NM_001040440chr51205 ------
NM_001040441chr165412 4528 4282 4073 395 191 ------
NM_001040450chr1522394 718 1228 ----
NM_001040453chr1522394 718 1228 ----
NM_001040455chr113973 263 77 ------
NM_001040624chr81230 --12633 --
NM_001040625chr81230 --12633 --
NM_001040626chr81230 --12633 --
NM_001040627chr81230 --12633 --
NM_001040628chr81230 --12633 --
NM_001040629chr81230 --12633 --
NM_001040630chr81230 --12633 --
NM_001040708chr821149 736 ------
NM_001040709chr132569 2539 1976 ------
NM_001040875chr811893 --12427 --
NM_001040876chr42601 333 ------
NM_001042355chr1675367 4559 4001 3535 1169 1144 217 11655 1601 --
NM_001042388chr182801 722 ------
NM_001042404chr1--170 ----
NM_001042412chr1675367 4559 4001 3535 1169 1144 217 11655 1601 --
NM_001042413chr923608 3082 --1941 --
NM_001042473chr1041478 819 583 70 ------
NM_001042494chr1533130 2960 2779 ------
NM_001042495chr1533130 2960 2779 ------
NM_001042496chr1533130 2960 2779 ------
NM_001042497chr1533130 2960 2779 ------
NM_001042498chrX----154 --
NM_001042506chrX41103 904 564 464 ------
NM_001042537chrX12282 12457 ----
NM_001042539chr161899 1412 ----
NM_001042555chr1231871 1192 864 ------
NM_001042576chr20------1474
NM_001042603chr1265106 2036 1490 1440 401 137 --11534 --
NM_001042604chr324756 4484 13857 1590 --
NM_001042632chr2022040 257 --2759 650 --
NM_001042633chr2022040 257 --2759 650 --
NM_001042646chr321964 1266 ------
NM_001042669chr421461 517 ------
NM_001043318chr1453334 3160 2877 999 298 ------
NM_001043351chr142269 1800 922 586 ------
NM_001044305chr62506 142 ------
NM_001046chr532259 1930 1869 22571 485 --12737
NM_001050chr171149 ------
NM_001068chr3144 ------
NM_001071775chr1311914 ------
NM_001083620chr422597 797 ------
NM_001083621chr121691 1213 ------
NM_001087chr21303 ----134
NM_001106chr398953 7557 6268 3905 3396 2687 2381 2226 1511 19383 22212 584 1260
NM_001113490chrX41427 824 628 425 ------
NM_001116chr1642444 2181 111 29 --2926 816 --
NM_001128chr1653769 3284 2816 1132 728 --22853 1206 --
NM_001144chr16------1250
NM_001146chr821539 448 ------
NM_001173chr1424773 1127 --14236 --
NM_001174chrX22311 141 ------
NM_001178chr111348 ------
NM_001204chr211860 --17249 --
NM_001220chr7138 ------
NM_001222chr101205 --21587 692 --
NM_001237chr41836 11151 ----
NM_001237chr41836 11151 ----
NM_001238chr192489 346 ------
NM_001241chr222305 228 ------
NM_001241chr222305 228 ------
NM_001256chr171454 32931 687 46 11848 --
NM_001258chr171176 ------
NM_001259chr721322 285 --12109 --
NM_001260chr131225 ------
NM_001290chr4--1310 ----
NM_001294chr191431 ------
NM_001313chr42677 236 ----1100
NM_001329chr1011592 1138 ----
NM_001351chr311580 1195 ----
NM_001356chrX12445 1990 ----
NM_001379chr191109 ------
NM_001387chr563025 2658 1094 818 722 308 2496 291 1483 --
NM_001390chr1843559 3366 2986 1169 ------
NM_001396chr2132324 395 51 11737 ----
NM_001399chrX41494 1310 498 76 --1102 --
NM_001406chr1721212 48 11179 21630 1503 --
NM_001408chr121227 1171 ------
NM_001415chrX31983 1509 549 11730 ----
NM_001419chr1943526 3251 2995 749 --13124 13044
NM_001427chr71460 12094 ----
NM_001430chr221825 654 --11722 --
NM_001431chr611049 --2396 377 --
NM_001438chr122309 958 --13272 12628
NM_001444chr81158 ------
NM_001448chrX11286 1146 ----
NM_001463chr21688 ------
NM_001494chr101577 ------
NM_001495chr81293 ------
NM_001497chr962742 2668 2572 878 397 214 1779 ----
NM_001542chr122693 981 11806 22298 1151 --
NM_001543chr534759 1407 729 13757 1989 --
NM_001554chr11511 --1172 --
NM_001565chr41253 1713 ----
NM_001587chrX21788 223 ----11587
NM_001604chr111330 ------
NM_001608chr21265 ------
NM_001616chr252550 908 796 768 506 ------
NM_001620chr112548 528 ----1592
NM_001621chr722390 493 11125 1223 --
NM_001621chr722390 493 11125 1223 --
NM_001634chr6----22017 390 --
NM_001649chrX22290 412 11668 12310 --
NM_001650chr1833037 2585 1627 ------
NM_001656chr511757 --11578 --
NM_001658chr12325 128 2364 276 ----
NM_001663chr1422747 921 ------
NM_001668chr121939 863 2301 291 ----
NM_001677chr111042 --1858 --
NM_001679chr32626 38 ------
NM_001681chr122730 38 ----1495
NM_001682chr1252020 1787 729 575 188 ----12818
NM_001683chr312275 ------
NM_001684chr144097 3946 2640 751 ----11612
NM_001690chr332410 1679 193 12468 12015 --
NM_001693chr84493 225 152 90 ------
NM_001704chr62209 135 ------
NM_001709chr1112266 --1501 --
NM_001718chr62915 340 ------
NM_001731chr121647 ------
NM_001746chr512256 1870 ----
NM_001754chr2134095 1471 1446 1799 ----
NM_001755chr1641855 1583 727 71 --11775 --
NM_001759chr1221768 1128 25107 3726 --1914
NM_001761chr1631599 1498 321 1682 11804 --
NM_001788chr71187 ------
NM_001791chr121003 950 11351 ----
NM_001822chr21213 ------
NM_001826chr11141 --1360 --
NM_001830chrX43963 3307 2473 1418 1385 23939 3889 --
NM_001839chr12596 190 ------
NM_001851chr63508 487 174 ------
NM_001854chr11328 --1281 --
NM_001858chr643409 1904 842 415 14184 11807 --
NM_001875chr21816 ----1297
NM_001880chr22325 307 ------
NM_001895chr2011226 ------
NM_001904chr31969 ------
NM_001918chr178151 7791 6668 6406 3289 3254 923 ----1245
NM_001924chr1--1211 ----
NM_001933chr1431117 1072 325 --1509 --
NM_001936chr731578 1204 113 21622 1306 ----
NM_001938chr121710 237 --1417 --
NM_001939chrX43823 3138 2640 884 ------
NM_001945chr521144 482 ----1959
NM_001946chr121837 ------
NM_001949chr623091 76 ------
NM_001980chr121629 1116 1907 --
NM_001986chr171477 --3534 69 38 --
NM_001987chr1243886 844 753 313 --13183 --
NM_001999chr53960 952 505 11349 ----
NM_002006chr431687 1251 752 ------
NM_002015chr131220 12372 ----
NM_002025chrX29144 6723 18626 ----
NM_002040chr2112625 1607 ----
NM_002054chr21144 ------
NM_002063chrX21253 41 ------
NM_002072chr92999 956 ------
NM_002074chr141555 1414 1095 202 ------
NM_002076chr1212860 --22592 646 --
NM_002077chr92811 246 ------
NM_002087chr172260 238 ------
NM_002106chr4161 ------
NM_002107chr12486 379 ------
NM_002111chr44647 513 493 252 --11066 --
NM_002119chr632597 2219 274 1107 2528 333 --
NM_002126chr171593 --23144 1341 --
NM_002128chr1342510 2262 2112 1712 ------
NM_002130chr511558 ----11217
NM_002131chr61981 --1526 --
NM_002137chr732103 841 637 ------
NM_002138chr4--1827 ----
NM_002139chrX1248 ------
NM_002140chr91146 ------
NM_002214chr735710 4603 1426 ------
NM_002221chr15883 797 398 387 187 ------
NM_002228chr121130 1089 ------
NM_002247chr1031699 395 61 ------
NM_002253chr4168 1215 149 1401
NM_002254chr242127 498 466 214 --12308 --
NM_002264chr365070 4584 1964 1510 1446 1013 11975 ----
NM_002267chr1321943 1567 ------
NM_002268chr321640 1208 --1596 --
NM_002270chr575113 5050 4764 4449 4345 1209 987 12013 1170 --
NM_002271chr133880 157 104 ------
NM_002296chr121687 1133 ------
NM_002309chr2231102 1038 22 ------
NM_002310chr566186 5592 5098 4667 1206 57 ------
NM_002313chr1054959 3874 1981 1786 1252 1331 11351 --
NM_002317chr52384 44 ------
NM_002336chr1234894 4863 3740 13795 44789 3892 1742 607 --
NM_002355chr1211386 ------
NM_002356chr61796 ----11793
NM_002359chr1742883 1712 1692 1200 12662 33184 551 292 --
NM_002360chr722504 697 ------
NM_002371chr2139 --1167 --
NM_002373chr1521293 856 ------
NM_002374chr2----1881 --
NM_002381chr22823 662 ------
NM_002383chr161722 1235 ----
NM_002390chr17--1670 21698 480 --
NM_002399chr1511429 ------
NM_002401chr1712496 --11926 --
NM_002402chr7151 ----11076
NM_002425chr11131 ------
NM_002442chr1221686 1389 ------
NM_002451chr931109 542 464 ------
NM_002473chr2211313 --1161 --
NM_002480chr1221128 174 ------
NM_002499chr152452 331 ------
NM_002501chr1933466 2798 746 13548 11160 --
NM_002515chr141244 ------
NM_002519chr11131 ------
NM_002522chr1721426 897 12634 1260 --
NM_002537chr1511096 ------
NM_002539chr21302 ------
NM_002545chr1133833 1892 1132 --13501 --
NM_002547chrX44040 3466 2922 183 1100 1557 --
NM_002578chrX1338 ------
NM_002581chr912013 12051 11844 --
NM_002582chr161269 --133 --
NM_002583chr12--1428 ----
NM_002586chr641272 1016 159 151 ------
NM_002588chr521623 1611 ----1413
NM_002590chr13175 ------
NM_002595chr1221803 1428 ------
NM_002607chr731080 413 100 --1465 --
NM_002609chr531913 526 145 ------
NM_002612chr741633 1626 1427 53 ------
NM_002618chr21119 ------
NM_002635chr12--148 ----
NM_002641chrX21291 504 ----1311
NM_002657chr2033501 730 562 --13372 --
NM_002670chr311610 ------
NM_002687chr141850 ------
NM_002698chr1912394 --122 --
NM_002706chr21498 ------
NM_002707chr21247 ------
NM_002709chr221104 360 ------
NM_002710chr123792 383 251 ------
NM_002716chr1143261 3165 2771 2399 ------
NM_002717chr81184 ------
NM_002731chr133059 385 332 ------
NM_002736chr722137 507 ------
NM_002737chr1764940 4659 4618 2441 862 642 11027 ----
NM_002742chr141198 ------
NM_002745chr2274350 3529 3361 1685 1289 960 51 21738 873 ----
NM_002768chr1641404 1314 470 44 188 --21458 203
NM_002814chrX137 ------
NM_002840chr121555 1045 1581 ----
NM_002843chr111371 13299 ----
NM_002844chr621392 272 ------
NM_002855chr1113655 --23446 219 --
NM_002868chr1221699 613 --12358 --
NM_002886chr334809 4353 1344 ------
NM_002892chr141318 ------
NM_002897chr24523 507 484 24 ------
NM_002906chr1142346 701 604 225 ------
NM_002911chr1931586 1059 538 ------
NM_002912chr6271 29 --1244 --
NM_002922chr12580 468 ------
NM_002923chr11103 ----1571
NM_002940chr42601 333 ------
NM_002948chr3169 ------
NM_002955chr621400 1383 --1262 --
NM_002968chr162789 275 ----1381
NM_002996chr1651623 1573 1546 548 465 1650 ----
NM_002997chr241515 1312 721 159 ------
NM_003010chr174804 353 205 123 --11736 1767
NM_003015chr10192 ------
NM_003016chr1732032 1652 116 11287 ----
NM_003017chr6----21396 1276 --
NM_003027chr152450 74 ------
NM_003035chr1----1684 --
NM_003042chr311919 ------
NM_003043chr311171 --1426 11353
NM_003045chr1313463 24326 3209 11826 --
NM_003046chr824509 309 ----13721
NM_003054chr10--1212 ----
NM_003070chr9----1848 --
NM_003071chr311280 ------
NM_003074chr342208 1580 1426 178 ----1556
NM_003075chr121276 ------
NM_003079chr173342 182 70 ------
NM_003085chr51499 ------
NM_003107chr611767 ------
NM_003108chr221797 1543 17064 --1112
NM_003112chr733090 2892 32 1160 ----
NM_003128chr241028 339 316 293 ------
NM_003131chr622103 2022 ------
NM_003150chr1731709 923 299 ------
NM_003151chr21173 ------
NM_003155chr842151 1859 1721 462 11954 --155
NM_003156chr1121304 48 ------
NM_003161chr17--1346 11052 --
NM_003174chr102598 86 ------
NM_003178chr332138 1902 1541 1840 ----
NM_003179chrX11329 ------
NM_003182chr71512 ------
NM_003182chr71512 ------
NM_003188chr6--1741 ----
NM_003194chr62430 233 --191 --
NM_003199chr1844924 4682 4459 3747 12168 ----
NM_003201chr101396 ------
NM_003204chr171589 11240 ----
NM_003211chr1221423 549 ----1424
NM_003215chr411083 ------
NM_003216chr221951 --13057 --
NM_003217chr1211968 ------
NM_003234chr332215 919 768 161 ----
NM_003239chr142891 875 ------
NM_003246chr1531623 741 323 ------
NM_003247chr641777 1653 786 432 ------
NM_003250chr17--1479 ----
NM_003253chr2121786 1370 ------
NM_003257chr1521182 473 ------
NM_003274chr2122839 1172 ------
NM_003291chr131200 ------
NM_003298chr365886 5688 4196 2376 1693 991 --12282 12430
NM_003320chr1122792 283 --13213 --
NM_003330chr121391 ------
NM_003336chrX4792 415 330 116 ------
NM_003338chr101352 ------
NM_003339chr52151 144 ------
NM_003340chr411067 11303 ----
NM_003344chr721635 1449 ------
NM_003345chr162526 446 ------
NM_003347chr2222261 262 ------
NM_003352chr2175 1174 ----
NM_003371chr9------1143
NM_003374chr51589 ------
NM_003378chr7287 68 ------
NM_003387chr231953 971 235 ------
NM_003392chr332817 1686 1055 --11259 --
NM_003400chr22683 637 ------
NM_003409chr1821061 172 ------
NM_003410chrX22142 2036 ------
NM_003418chr31208 1576 ----
NM_003445chr191117 ------
NM_003452chr92636 276 ------
NM_003459chr2--1272 2670 563 --
NM_003463chr622222 623 ------
NM_003468chr213077 --199 --
NM_003469chr2--175 ----
NM_003471chr32871 67 --11787 --
NM_003472chr611546 21324 1175 ----
NM_003474chr1062347 1646 838 750 165 148 ------
NM_003477chr11125 --1259 --
NM_003478chr1132590 2208 74 13155 ----
NM_003482chr1222570 692 ------
NM_003489chr2133295 1081 548 1459 ----
NM_003502chr161106 ------
NM_003507chr231874 1519 787 ------
NM_003566chr1232112 1199 562 ------
NM_003574chr1845666 1346 1044 21 ------
NM_003583chr1212658 --1473 --
NM_003586chr16170 ------
NM_003589chr131976 ------
NM_003590chr243283 791 382 248 21194 359 ----
NM_003597chr21402 ----12117
NM_003603chr41774 ------
NM_003615chr353652 1611 1134 444 370 ------
NM_003621chr111479 ------
NM_003622chr1242642 2506 1865 260 ------
NM_003628chr21204 ------
NM_003629chr142755 2484 905 894 ------
NM_003630chr6--1665 ----
NM_003663chr323036 789 159 ----
NM_003671chr922505 1139 ------
NM_003677chr1221589 695 --11562 --
NM_003692chr92881 796 ------
NM_003701chr131915 ------
NM_003705chr21572 2653 214 ----
NM_003735chr521623 1611 ----1413
NM_003736chr521623 1611 ----1413
NM_003750chr1011009 1879 1222 --
NM_003758chr152151 122 ------
NM_003758chr152151 122 ------
NM_003766chr171555 ------
NM_003774chr1232646 1045 180 --11208 --
NM_003794chr331128 1087 842 ----1219
NM_003800chr631838 772 189 ------
NM_003818chr204920 811 291 192 ------
NM_003829chr92878 835 ------
NM_003831chr1841816 1324 408 112 ------
NM_003850chr13131 ------
NM_003861chr1471083 854 818 748 483 442 199 --11165 --
NM_003870chr152330 285 ------
NM_003872chr2----12051 --
NM_003873chr10--1103 1611 1246
NM_003877chr121166 ------
NM_003887chr221856 776 ------
NM_003899chr132717 513 12559 ----
NM_003908chr2041211 1170 968 227 --11044 --
NM_003913chr631329 1156 561 ------
NM_003927chr181815 ------
NM_003931chr6155 1466 ----
NM_003934chr9----1890 --
NM_003936chr22793 177 ----11072
NM_003941chr71945 ------
NM_003942chr112726 460 ------
NM_003948chr422665 803 172 ----
NM_003953chr142495 2288 1898 201 --12303 12021
NM_003955chr1731376 1202 187 ------
NM_003968chr32527 92 --1173 --
NM_003972chr1021262 283 ------
NM_003983chr1632782 1396 1099 --13121 --
NM_003994chr1233843 1766 1743 ----11030
NM_004006chrX22409 1959 ------
NM_004007chrX22409 1959 ------
NM_004009chrX22409 1959 ------
NM_004010chrX22409 1959 ------
NM_004011chrX22409 1959 ------
NM_004012chrX22409 1959 ------
NM_004013chrX22409 1959 ------
NM_004014chrX22409 1959 ------
NM_004015chrX22409 1959 ------
NM_004016chrX22323 1873 ------
NM_004017chrX22409 1959 ------
NM_004018chrX22323 1873 ------
NM_004020chrX22409 1959 ------
NM_004021chrX22323 1873 ------
NM_004022chrX22323 1873 ------
NM_004023chrX22323 1873 ------
NM_004028chr1833037 2585 1627 ------
NM_004036chr21475 ------
NM_004040chr22533 208 ------
NM_004047chr1199 ------
NM_004080chr711264 ------
NM_004087chr331847 1287 747 ------
NM_004093chr1332796 285 85 ------
NM_004094chr1422785 2250 ------
NM_004096chr1021314 482 ------
NM_004100chr61650 ------
NM_004114chrX2885 449 --152 --
NM_004119chr131663 ------
NM_004124chr1423568 2661 ------
NM_004136chr1562457 975 949 230 194 56 1308 ----
NM_004161chr21223 --11091 --
NM_004162chr321322 1239 ------
NM_004171chr1158189 2328 2203 1659 1027 26224 6101 1176 17331
NM_004229chrX12205 ------
NM_004242chr62343 284 ------
NM_004272chr541709 1313 644 600 ------
NM_004274chr14----1638 --
NM_004293chr92611 283 13829 ----
NM_004295chr172315 167 ----11026
NM_004311chr1033088 2434 1065 --1464 --
NM_004319chr153141 2871 2265 1188 1062 ------
NM_004321chr263230 3220 2778 2762 2504 922 ------
NM_004326chr11314 ------
NM_004330chr1531119 1036 53 2877 40 ----
NM_004331chr812114 12267 ----
NM_004338chr18107006 6383 6058 4944 2587 1888 965 559 503 80 --14991 --
NM_004349chr831140 1122 1085 ------
NM_004352chr161515 ------
NM_004360chr1621323 37 ----11934
NM_004369chr23674 260 172 ------
NM_004370chr642029 1453 673 25 ----11402
NM_004379chr2--2454 351 ----
NM_004380chr1612629 ------
NM_004381chr61152 ------
NM_004393chr331744 896 583 --2725 59 --
NM_004397chr1132661 1577 1171 1216 ----
NM_004411chr72810 505 ------
NM_004420chr1182441 2139 2029 2007 1829 945 752 655 ------
NM_004432chr91360 1102 ----
NM_004449chr211534 11442 ----
NM_004458chrX22499 448 --11977 --
NM_004469chrX186 ------
NM_004472chr5174 ------
NM_004475chr172917 125 --21068 866 --
NM_004481chr142462 1852 903 789 ------
NM_004491chr1954253 4130 3880 1703 1151 ----11159
NM_004494chr121115 54 ------
NM_004499chr51179 ------
NM_004500chr1421367 459 ------
NM_004501chr123665 1629 ------
NM_004504chr2--11966 1396 --
NM_004505chr1712020 11906 ----
NM_004506chr61179 ------
NM_004514chr1722958 2222 1843 12546 --
NM_004516chr19179 11055 1886 --
NM_004521chr10125 ------
NM_004525chr21541 11477 ----
NM_004538chrX2659 268 1280 ----
NM_004561chr1121823 23 ------
NM_004575chr411155 --11566 --
NM_004586chrX23855 723 ------
NM_004587chr20------1474
NM_004593chr33805 696 187 ------
NM_004595chrX4429 388 182 29 ------
NM_004598chr522024 1122 --1198 --
NM_004602chr2021170 188 ------
NM_004612chr943803 3567 941 316 ------
NM_004630chr1111148 ------
NM_004643chr141681 ------
NM_004645chr173716 637 346 ------
NM_004657chr2129 1435 ----
NM_004690chr6157 ------
NM_004694chr17132 ------
NM_004698chr1----1170 --
NM_004705chr112803 319 ------
NM_004715chr183231 213 163 ------
NM_004718chr22593 216 ------
NM_004719chr1222841 1767 11074 ----
NM_004726chrX45763 4384 4253 2093 ------
NM_004730chr511696 --12165 --
NM_004734chr1352885 2764 2422 2095 990 --1537 --
NM_004739chr111157 ------
NM_004742chr311829 ------
NM_004744chr422893 1573 13280 ----
NM_004745chr845922 5765 1231 451 ------
NM_004747chr101575 --1425 --
NM_004748chr151837 --12673 --
NM_004761chr6137 ------
NM_004768chr11885 --1249 --
NM_004772chr51560 --1640 --
NM_004776chr2052837 2555 1308 559 490 ------
NM_004788chr1122156 386 ------
NM_004796chr1432002 897 714 ------
NM_004798chr2043076 2632 2569 163 ------
NM_004804chr211734 ------
NM_004805chr21353 --11347 --
NM_004821chr53715 663 106 ------
NM_004822chr1713019 ------
NM_004834chr252619 2489 1312 259 132 22093 444 1236 --
NM_004845chrX33227 956 77 ----14073
NM_004856chr151540 ------
NM_004859chr1742526 2413 799 680 ------
NM_004863chr1433935 1883 821 --13411 --
NM_004871chr1743525 1570 1553 184 1313 ----
NM_004884chr1521515 1279 ------
NM_004893chr52371 364 ------
NM_004904chr731587 451 227 15924 26268 1812 --
NM_004911chr71140 --1487 --
NM_004926chr1411470 ------
NM_004945chr19----1226 --
NM_004947chr331875 1865 164 ------
NM_004956chr723690 1406 ------
NM_004958chr1------1801
NM_004965chr212560 522 ------
NM_004976chr1154789 3546 3533 3344 1774 13857 1339 --
NM_004985chr1234464 3132 1076 ----1979
NM_004992chrX37396 6960 2201 27999 1088 --17103
NM_004992chrX37396 6960 2201 27999 1088 --17103
NM_004995chr141301 --11471 --
NM_004999chr644384 1623 1072 678 ------
NM_005011chr731841 1336 1211 ----21323 716
NM_005028chr1031942 436 235 ------
NM_005029chr101111 ------
NM_005045chr7145 ------
NM_005056chr1255350 1734 1684 645 381 --11778 --
NM_005067chr32960 616 ------
NM_005078chr1521409 392 --1369 --
NM_005088chrX1872 ------
NM_005096chrX11218 ------
NM_005121chr1713377 ------
NM_005134chr182801 722 ------
NM_005135chr1533130 2960 2779 ------
NM_005151chr1862162 864 800 498 474 199 ------
NM_005155chr64688 616 548 248 ------
NM_005156chr954929 3927 3536 1235 554 13858 ----
NM_005168chr21319 11405 ----
NM_005180chr1021640 1392 ------
NM_005188chr1157966 6891 6439 2371 647 11891 12477 --
NM_005194chr201225 ------
NM_005197chr1424851 1567 24555 4101 26059 5192 --
NM_005207chr2253471 3288 2988 2810 837 13035 11397 --
NM_005230chr12--1258 ----
NM_005238chr1123371 56 ------
NM_005241chr31936 ------
NM_005249chr142775 659 ------
NM_005261chr81254 ------
NM_005277chr421262 43 ------
NM_005281chr11135 ------
NM_005284chr61389 ------
NM_005311chr722495 1065 ------
NM_005313chr151229 ------
NM_005324chr1721329 843 ------
NM_005329chr1651713 740 703 566 95 ------
NM_005330chr11124 ------
NM_005339chr444006 3828 2756 1056 1688 1387 --
NM_005340chr51175 ------
NM_005347chr921595 1098 ------
NM_005358chr132328 80 ------
NM_005374chr1711869 136 1214 --
NM_005375chr62920 738 ------
NM_005378chr22849 340 173 ----
NM_005381chr21167 ------
NM_005397chr723191 225 --13839 --
NM_005400chr231056 475 64 ------
NM_005402chr721765 340 ------
NM_005407chr1421598 558 ------
NM_005418chr112710 254 ------
NM_005426chr11223 ------
NM_005429chr4151 ------
NM_005436chr1032704 171 140 14117 13627 --
NM_005442chr32629 57 ------
NM_005455chr111854 ------
NM_005461chr2021761 1567 11836 ----
NM_005477chr1522221 324 ------
NM_005477chr1522221 324 ------
NM_005488chr22182 ------
NM_005494chr71651 ------
NM_005497chr1723922 2453 --14959 --
NM_005502chr9172 ------
NM_005503chr1511119 ------
NM_005504chr1244322 1966 1471 189 14408 ----
NM_005509chr531789 1208 273 11529 ----
NM_005520chr51671 ------
NM_005521chr102803 780 ------
NM_005523chr731585 1545 1248 --11347 --
NM_005544chr21844 ------
NM_005561chr133817 262 179 ------
NM_005563chr11209 ------
NM_005576chr151207 ------
NM_005578chr324851 390 13446 13801 --
NM_005596chr935261 1766 1328 --1544 11312
NM_005599chr1--1369 ----
NM_005606chr141472 156 ----
NM_005610chr12635 151 ------
NM_005613chr13641 604 175 ------
NM_005627chr62737 227 ------
NM_005637chr1821882 779 ------
NM_005638chrX1440 1645 1500 --
NM_005647chrX13418 ------
NM_005650chr2221169 987 ------
NM_005660chrX1245 ------
NM_005668chr533387 3333 920 --13513 --
NM_005711chr52994 147 ------
NM_005715chr612797 1860 ----
NM_005717chr111100 11331 ----
NM_005724chr15----1117 --
NM_005737chr23931 721 678 22137 1115 12830 --
NM_005746chr7123 ------
NM_005748chr1213188 ------
NM_005754chr511214 ------
NM_005759chr254024 3987 3784 3414 711 14308 1887 --
NM_005776chr14------1252
NM_005786chr182843 236 ------
NM_005789chr1721853 399 ------
NM_005796chr16----1148 --
NM_005806chr211419 11337 ----
NM_005808chr323095 2904 --13239 1555
NM_005819chr12666 331 ------
NM_005822chr632207 323 97 ------
NM_005828chr1754896 4115 1021 692 190 1304 ----
NM_005840chrX65267 3053 1971 1898 1740 700 1944 16594 26647 1475
NM_005873chr202585 150 --165 --
NM_005888chr12--148 ----
NM_005898chr1122181 1161 ------
NM_005900chr41344 ------
NM_005901chr1868202 8073 7620 2481 2345 346 ------
NM_005902chr1534007 3156 2995 24427 2809 ----
NM_005903chr554704 3604 1108 1098 205 ------
NM_005904chr1821450 1434 ------
NM_005906chr6--1203 ----
NM_005909chr514109 11124 ----
NM_005911chr221287 199 ------
NM_005920chr143775 2691 987 641 --1665 --
NM_005933chr112640 24 ------
NM_005934chr1932208 1896 534 --11959 1264
NM_005937chr1733440 2912 1624 1123 ----
NM_005944chr3--11255 ----
NM_005955chr1105429 4914 4259 3805 2106 1512 867 574 566 405 11413 2547 412 --
NM_005962chr1011903 1925 ----
NM_005962chr1011903 1925 ----
NM_005966chr22199 88 ------
NM_005986chr1342773 2540 2502 238 ------
NM_006007chr934423 1235 158 ------
NM_006011chr152853 196 --11005 --
NM_006030chr321513 187 ------
NM_006035chr14183 ------
NM_006037chr243382 1313 805 416 14214 ----
NM_006040chr1631414 520 147 ------
NM_006047chr2022773 363 ------
NM_006049chr153339 269 154 ------
NM_006054chr111134 ------
NM_006064chrX1426 ------
NM_006070chr31135 ------
NM_006079chr6--1764 ----
NM_006080chr722071 766 --11894 --
NM_006089chrX31871 1577 517 ------
NM_006094chr8139 1370 ----
NM_006106chr1122547 2429 13098 ----
NM_006116chr2221315 363 --11581 --
NM_006141chr1622661 768 ------
NM_006148chr1711849 ----12335
NM_006154chr1532749 2037 188 12046 ----
NM_006156chr141192 ------
NM_006157chr111146 ------
NM_006166chr1221012 152 ------
NM_006183chr121199 ------
NM_006194chr141257 ------
NM_006197chr831934 1697 473 ------
NM_006201chrX1199 --21014 903 --
NM_006203chr544810 3897 1280 1040 15538 ----
NM_006211chr8291 75 ------
NM_006224chr1712114 --32308 2095 887 --
NM_006226chr21330 --1916 --
NM_006238chr611858 ----11957
NM_006239chr41569 --1166 --
NM_006241chr312272 ------
NM_006243chr12325 164 ------
NM_006245chr63964 754 189 ------
NM_006252chr146853 4767 2413 926 15956 16790 --
NM_006255chr142744 387 ------
NM_006258chr10--1569 --11352
NM_006282chr2024101 3297 14562 13178 --
NM_006283chr854845 4816 1973 1692 225 ------
NM_006290chr6164 11805 ----
NM_006306chrX34752 4443 4235 ----21106 224
NM_006312chr122665 238 ------
NM_006315chr433858 770 49 --11325 --
NM_006328chr111604 ------
NM_006330chr821623 1419 ------
NM_006350chr5--1370 ----
NM_006352chr132056 1662 210 2755 661 ----
NM_006359chrX12282 12457 ----
NM_006375chrX2210 46 11565 ----
NM_006379chr711929 ------
NM_006380chr1723911 2782 21502 606 ----
NM_006393chr1023602 1005 --1231 --
NM_006403chr611545 --1647 --
NM_006420chr2043162 2525 788 24 12513 ----
NM_006424chr411837 11901 ----
NM_006434chr1022265 137 23230 200 ----
NM_006454chr433068 2819 2737 --12319 --
NM_006459chr1031938 1340 138 ------
NM_006476chr11149 ------
NM_006482chr1212658 --1473 --
NM_006489chr141244 ------
NM_006494chr191562 ------
NM_006496chr1--144 21989 290 --
NM_006502chr6------1141
NM_006517chrX3666 359 157 ------
NM_006526chr2022211 633 ------
NM_006534chr2033196 2320 225 1470 --1524
NM_006538chr231351 989 291 --23347 891 --
NM_006540chr811382 11195 ----
NM_006544chr1411260 ------
NM_006546chr1721496 362 --12198 --
NM_006547chr711449 1519 21908 528 --
NM_006548chr311317 ------
NM_006549chr1232959 2722 636 --12291 --
NM_006560chr111422 1161 ----
NM_006561chr1075012 4232 3970 1509 1360 972 789 ------
NM_006565chr16--2252 240 ----
NM_006566chr182400 346 ------
NM_006574chr32268 225 ------
NM_006577chr211056 ------
NM_006587chr41313 1577 ----
NM_006599chr1646695 5667 2350 1364 35369 2888 1499 37342 1648 1056 --
NM_006601chr1221120 1087 ------
NM_006606chr2042852 2063 1277 710 --23157 3069 --
NM_006614chr333609 2800 220 ------
NM_006621chr11741 ------
NM_006624chr1011629 ----12020
NM_006625chr111048 --161 --
NM_006625chr111048 --161 --
NM_006625chr111048 --161 --
NM_006628chr1533873 3698 134 12976 ----
NM_006634chr2171 ------
NM_006640chr17--11893 1755 --
NM_006646chr1331217 359 205 140 11071 --
NM_006650chr563798 3707 3700 2513 2428 1260 ------
NM_006654chr1231871 1192 864 ------
NM_006668chr14--1569 ----
NM_006675chr1253086 3040 2466 2107 1183 1600 1919 --
NM_006681chr41118 ------
NM_006695chr17--152 ----
NM_006699chr11785 ------
NM_006700chr121158 1531 1310 --
NM_006703chr62436 161 ------
NM_006706chr51750 ------
NM_006711chr161169 1820 ----
NM_006720chr1054959 3874 1981 1786 1252 1331 11351 --
NM_006729chrX35572 5164 3431 ------
NM_006734chr611070 11424 ----
NM_006735chr7--1128 ----
NM_006738chr1554326 4163 3303 1510 724 ------
NM_006749chr81521 --2918 47 --
NM_006750chr1657250 5022 2211 437 388 ------
NM_006751chr21710 ------
NM_006758chr21139 ------
NM_006759chr2--1114 ----
NM_006763chr131664 1308 759 ------
NM_006772chr621100 293 --1217 --
NM_006805chr51156 1697 ----
NM_006807chr171900 ------
NM_006811chr202633 261 ------
NM_006813chr61269 ------
NM_006818chr11107 ----1117
NM_006823chr81110 --11118 --
NM_006826chr21923 ------
NM_006827chr1423186 2748 12132 ----
NM_006838chr1211427 --1383 --
NM_006852chr172491 116 12269 ----
NM_006854chr72784 40 21390 1374 --1724
NM_006885chr1634029 3461 2995 1777 --1856
NM_006888chr1432488 1232 901 ----12735
NM_006892chr2031208 1074 237 ------
NM_006892chr2031208 1074 237 ------
NM_006896chr711087 ------
NM_006897chr121201 1189 ----
NM_006898chr21641 ------
NM_006906chr111793 1828 ----
NM_006908chr711139 11344 ----
NM_006912chr142188 2114 82 40 ------
NM_006914chr91241 ------
NM_006918chr1154544 3750 1965 1478 1036 ------
NM_006922chr21503 ------
NM_006924chr1774186 4144 2973 2844 1170 814 302 1115 ----
NM_006931chr1241591 1317 656 409 ------
NM_006939chr1431091 404 227 ------
NM_006940chr12--1740 ----
NM_006943chr2033323 2788 1124 --12615 --
NM_006946chr111559 ------
NM_006947chr411216 1277 11307 --
NM_006965chr18--1831 11223 --
NM_006981chr92625 198 ------
NM_007005chr91518 ------
NM_007006chr162707 510 ------
NM_007007chr1221316 411 ------
NM_007010chr172770 656 ------
NM_007011chr1546707 6661 5065 1379 ----15818
NM_007026chr171129 ------
NM_007030chr525230 4354 23935 354 35098 818 560 --
NM_007034chr121035 917 ------
NM_007038chr2134912 3913 841 ------
NM_007039chr142894 204 ------
NM_007050chr2087888 7817 6692 6424 5492 2306 1511 691 --1353 --
NM_007064chr311063 11443 11516 --
NM_007067chr171337 --11182 --
NM_007084chr131458 ------
NM_007118chr51366 ------
NM_007124chr6143 1123 ----
NM_007129chr13--11076 ----
NM_007137chrX45056 4722 1733 459 ------
NM_007166chr1121168 1006 ------
NM_007174chr1221815 943 ------
NM_007182chr33657 522 117 ------
NM_007191chr12--167 1709 --
NM_007192chr141221 ------
NM_007200chr1554326 4163 3303 1510 724 ------
NM_007203chr963789 3436 3340 3294 977 33 24004 3603 1468 --
NM_007217chr31304 ------
NM_007232chr202944 322 ------
NM_007246chr4--1989 ----
NM_007249chr1399050 8390 6356 2259 1950 1504 1345 763 259 18884 ----
NM_007257chr852580 1921 771 483 420 --11133 --
NM_007260chr12756 519 ------
NM_007274chr11217 --1115 --
NM_007275chr3----1174 --
NM_007347chr1522621 2492 1500 11100 --
NM_007350chr1224060 3116 13365 ----
NM_007358chr11288 11725 1748 --
NM_007373chr1021718 1124 ------
NM_007375chr122227 591 ------
NM_012081chr553613 2504 1374 871 646 ------
NM_012089chr121117 50 ------
NM_012092chr231723 1676 125 ------
NM_012096chr323180 2429 ------
NM_012097chr2145 --12001 --
NM_012110chr42111 65 ------
NM_012120chr61217 --12856 --
NM_012137chr112773 12955 ----
NM_012153chr1122580 2094 ------
NM_012155chr192213 199 ------
NM_012156chr2033391 1156 985 --12288 --
NM_012157chr32972 687 ------
NM_012161chr41730 ------
NM_012180chr4185 1562 ----
NM_012183chr11598 ------
NM_012193chr1165015 4187 4126 2140 1334 580 --13407 --
NM_012197chr9--11300 ----
NM_012199chr134109 3503 2827 ------
NM_012207chr102990 267 ------
NM_012210chr931402 1057 238 ------
NM_012214chr245675 4759 4421 1787 11752 1995 --
NM_012215chr10----1748 1251
NM_012219chr33992 323 300 1261 ----
NM_012234chr31540 1612 ----
NM_012238chr1021090 641 ------
NM_012249chr211438 ------
NM_012252chr741259 205 116 51 ------
NM_012257chr73965 718 289 ------
NM_012262chr165203 4591 3749 3706 3224 909 24171 4081 ----
NM_012264chr2241761 1454 281 27 ------
NM_012264chr2241761 1454 281 27 ------
NM_012272chr121168 ------
NM_012279chr52762 648 ----1303
NM_012281chr712252 ------
NM_012287chr333624 3014 1497 1482 ----
NM_012288chr644776 2258 1076 265 25164 3898 --1545
NM_012293chr242001 1728 515 285 21937 890 1135 --
NM_012301chr71593 ------
NM_012308chr112309 250 --1535 --
NM_012316chr122061 231 15556 ----
NM_012325chr2021537 1080 ------
NM_012326chr23568 114 100 --2280 193 --
NM_012329chr1721685 1266 ----11306
NM_012330chr101505 ------
NM_012347chr632709 2578 242 ------
NM_012383chr92119 79 ------
NM_012396chr11653 151 ----
NM_012399chr2221251 585 1121 ----
NM_012416chr9158 ------
NM_012428chr151225 1746 ----
NM_012448chr1722089 235 ------
NM_012464chr442806 1099 760 540 ------
NM_012478chr174794 660 215 66 ------
NM_012479chr792553 2520 2294 2246 1961 1087 1002 893 199 ------
NM_013233chr211359 ------
NM_013253chr112541 197 --1145 --
NM_013255chr757339 7004 6702 6677 1218 28013 2844 17644 --
NM_013269chr1221509 181 ------
NM_013286chr342708 2641 1242 856 --12490 --
NM_013293chr71151 ------
NM_013302chr1644263 1240 553 113 ------
NM_013333chr19167 ------
NM_013357chr81895 ------
NM_013361chr191188 1117 ----
NM_013377chr121530 ------
NM_013381chr1242275 608 405 209 ------
NM_013382chr1422230 553 --1954 --
NM_013410chr111045 --167 --
NM_013444chrX2411 327 ------
NM_013446chr731145 271 178 --1114 --
NM_013448chr142496 485 ------
NM_013450chr221119 270 ------
NM_013958chr8----2367 21 --
NM_013959chr8----2367 21 --
NM_013961chr8----2367 21 --
NM_013962chr8----2367 21 --
NM_013996chr71512 ------
NM_013996chr71512 ------
NM_013997chr71512 ------
NM_013997chr71512 ------
NM_013998chr71512 ------
NM_013998chr71512 ------
NM_014011chr21204 1541 ----
NM_014016chr311218 ------
NM_014023chr1072219 1814 1170 892 493 428 114 12764 ----
NM_014035chr521134 169 ------
NM_014048chr1624918 3247 --34383 3280 590 --
NM_014071chr20----1191 --
NM_014089chr1322208 1835 ------
NM_014106chr1522160 831 ------
NM_014112chr844435 4019 2184 1960 15053 11287 --
NM_014117chr1632016 1875 583 1384 ----
NM_014141chr735153 4737 313 ------
NM_014153chr161262 ------
NM_014155chr1146855 2035 1173 1115 1217 ----
NM_014181chr232895 2416 1168 ------
NM_014210chr17179 ------
NM_014213chr23207 80 73 ------
NM_014232chr17----21585 1231 --
NM_014232chr17----21585 1231 --
NM_014240chr333525 3109 1252 --11631 --
NM_014243chr42261 141 ------
NM_014280chr11375 --1255 --
NM_014283chr111482 ------
NM_014284chr11684 ------
NM_014289chrX11109 ------
NM_014292chr2251833 1698 1478 707 348 --11363 1128
NM_014299chr191344 12188 ----
NM_014309chr2224276 3686 ----1414
NM_014325chr1231763 1625 769 --1602 --
NM_014333chr1122355 2344 ------
NM_014342chr111129 ------
NM_014345chr62856 407 ------
NM_014350chr531081 749 324 ------
NM_014363chr13140 --1867 --
NM_014376chr5--12542 ----
NM_014390chr72529 67 ------
NM_014392chr431422 1264 1192 31409 545 467 ----
NM_014393chr81348 ------
NM_014405chr1761929 1691 1652 599 233 165 ------
NM_014423chr524768 133 ------
NM_014426chr203715 699 483 ------
NM_014431chr1031554 1162 64 --21648 94 --
NM_014447chr41489 11392 ----
NM_014449chr121208 ------
NM_014489chr113650 265 157 ------
NM_014494chr162586 472 ------
NM_014498chr31347 ------
NM_014574chr142397 372 11559 ----
NM_014577chr221239 139 ----
NM_014606chr431568 285 229 ------
NM_014607chr221482 152 ------
NM_014615chr1633417 771 381 ------
NM_014616chr333243 3069 525 ------
NM_014620chr121260 ------
NM_014636chr933353 732 486 --1101 13763
NM_014646chr1842951 2643 2593 112 42542 2279 2100 1271 ----
NM_014647chr1662265 2253 1844 902 423 300 ----11659
NM_014660chr7--1759 ----
NM_014661chr1053275 1434 700 680 35 --23774 614 --
NM_014663chr1--11140 1366 --
NM_014677chr81414 ------
NM_014686chr1931879 1839 355 --32395 2348 1867 --
NM_014689chr21105 1196 ----
NM_014701chr152563 480 11135 ----
NM_014707chr722235 1557 1320 ----
NM_014710chrX2316 91 1113 ----
NM_014711chr1611945 ------
NM_014717chr192783 706 1122 ----
NM_014720chr102605 120 ------
NM_014721chr646147 1336 1059 1008 ------
NM_014726chr171363 --1945 --
NM_014729chr832205 351 271 12253 ----
NM_014730chr1224778 4481 ------
NM_014730chr1224778 4481 ------
NM_014732chr1685821 5644 4554 4182 3887 1519 912 828 --14788 --
NM_014735chrX1817 ------
NM_014738chr172955 943 ------
NM_014739chr623913 3122 13640 ----
NM_014743chr41238 ------
NM_014751chr82744 586 ------
NM_014754chr81840 1271 2874 596 --
NM_014755chr221306 506 ------
NM_014757chr522075 387 --1236 --
NM_014760chr361962 1868 1825 1571 1554 1406 ------
NM_014773chr521366 288 ------
NM_014779chr3164 ------
NM_014782chrX1252 1129 ----
NM_014803chr1011891 ------
NM_014807chr112790 317 ------
NM_014810chr112991 ------
NM_014812chr1--170 ----
NM_014820chr321587 699 187 2155 121 --
NM_014827chr11325 ------
NM_014830chr122408 124 13391 168 --
NM_014832chr1311951 ----1121
NM_014836chr1021920 637 ------
NM_014839chr1------1459
NM_014840chr1231252 555 520 --12917 22534 1362
NM_014841chr621205 1155 11102 ----
NM_014849chr111288 ------
NM_014850chr323162 227 --14226 --
NM_014858chr121058 750 ------
NM_014862chr1524105 619 ------
NM_014870chr121691 1213 ------
NM_014871chr123476 453 139 ------
NM_014872chr952357 1773 741 219 158 ----1577
NM_014876chr2242224 2073 833 56 ------
NM_014877chr1766571 6336 6166 6105 807 590 ------
NM_014897chr1722724 776 11116 ----
NM_014900chr231192 1036 130 ------
NM_014901chr51537 11540 ----
NM_014903chr1231943 1837 477 --2814 448 --
NM_014904chr1023483 3209 --1264 --
NM_014906chr1723892 719 1361 --13709
NM_014909chr1443854 3682 2724 645 ------
NM_014912chr1022822 1165 12634 1365 12571
NM_014913chr183116 87 73 --1141 --
NM_014920chr623780 68 ------
NM_014924chr144954 352 246 118 ----1368
NM_014932chr32649 565 ------
NM_014938chr1232175 297 288 ----12379
NM_014946chr222625 322 ----12614
NM_014947chr143071 1968 1916 1176 ------
NM_014952chr15--11971 31289 769 613 --
NM_014962chr2012711 ------
NM_014964chr1732054 282 37 12411 ----
NM_014969chr13434 202 162 --1153 --
NM_014974chr1011675 21142 576 ----
NM_014978chr101625 ------
NM_014988chr411773 ------
NM_014990chr141934 ------
NM_014991chr422192 794 --12390 --
NM_014992chr141189 ------
NM_014994chr151875 --1267 --
NM_015000chr1252950 2714 472 315 107 ------
NM_015008chr322883 955 ------
NM_015017chr13485 281 274 ------
NM_015020chr1633232 3206 371 --1983 1324
NM_015024chr811441 ------
NM_015025chr212112 --12726 --
NM_015026chr1224152 383 ------
NM_015027chr1621859 1734 ------
NM_015032chr1321120 572 11105 ----
NM_015035chr2066281 2622 2409 2119 1609 1177 26514 831 34407 2101 1198 --
NM_015042chr1523374 3312 --1766 2103 69
NM_015051chr922521 1140 --12305 --
NM_015057chr131237 ------
NM_015064chr1242899 1134 1082 815 ------
NM_015071chr566205 5310 4979 4861 2276 1926 11644 11172 15047
NM_015074chr144518 3722 3308 402 23358 198 ----
NM_015075chrX11546 --1256 --
NM_015076chr653980 3598 3351 3000 2763 ------
NM_015079chr1553024 2672 2006 1017 413 13206 ----
NM_015090chr165704 5427 5350 4876 4094 1292 --11545 12493
NM_015091chr141730 1658 ----
NM_015092chr1613342 ------
NM_015093chr62304 123 11492 ----
NM_015094chr2223347 582 13037 1465 24285 1428
NM_015097chr312331 ------
NM_015107chrX11994 ----1102
NM_015115chr41133 ------
NM_015116chr1311646 11557 ----
NM_015130chr4--168 ----
NM_015138chr1512572 22625 2253 ----
NM_015143chr42474 374 ------
NM_015144chr1623564 113 ------
NM_015149chr132225 1365 86 ------
NM_015155chr1052703 1057 962 486 220 1510 ----
NM_015156chr1442934 2917 831 233 22829 1123 ----
NM_015170chr812369 ------
NM_015172chr121470 1313 11507 1493 --
NM_015191chr1152522 2493 2374 315 209 ------
NM_015192chr2021934 740 ------
NM_015197chr1433344 2099 1092 ----13445
NM_015198chr7198 11121 ----
NM_015200chr422483 952 ------
NM_015206chr1533756 3275 1314 ------
NM_015209chr11277 --1131 --
NM_015225chr92709 307 12045 ----
NM_015231chr112203 185 ------
NM_015233chr1322691 1725 1423 ----
NM_015234chr611122 ------
NM_015238chr5178 ------
NM_015247chr1675367 4559 4001 3535 1169 1144 217 11655 1601 --
NM_015250chr911364 11714 ----
NM_015252chr21287 ------
NM_015263chr151431 ------
NM_015277chr1821823 1562 1749 ----
NM_015282chr21393 ------
NM_015284chr111651 --11554 11505
NM_015288chr543877 3763 1554 182 --11038 --
NM_015291chr142302 1067 432 221 11251 23452 2869 --
NM_015310chr845729 2898 509 26 22240 657 ----
NM_015317chr2--32503 1856 871 --12055
NM_015326chr122311 767 12886 ----
NM_015328chr742142 2045 578 174 ------
NM_015339chr202893 865 1871 ----
NM_015344chr822078 123 ------
NM_015347chr122710 459 ------
NM_015365chrX22658 715 ------
NM_015375chr145028 3589 267 115 ------
NM_015381chr22--12043 ----
NM_015385chr1022265 137 23230 200 ----
NM_015443chr173938 493 409 ------
NM_015446chr111043 11238 ----
NM_015455chr543346 2671 1186 160 ------
NM_015458chr835261 4992 232 11395 ----
NM_015461chr181201 ------
NM_015469chr92105 61 1640 ----
NM_015483chr721079 464 1357 ----
NM_015497chr153854 844 284 ------
NM_015508chr311298 ------
NM_015509chr123657 593 173 ------
NM_015532chr1512558 11102 ----
NM_015534chr11451 ------
NM_015535chr243917 3430 434 308 ----157
NM_015542chr1011269 ------
NM_015550chr723349 1098 --1514 --
NM_015554chr1521076 430 ------
NM_015557chr132796 690 25 12526 12248 --
NM_015560chr322489 387 ------
NM_015567chr13187 ------
NM_015569chr11762 --14144 --
NM_015570chr711621 ------
NM_015575chr243078 2670 323 289 --11356 --
NM_015576chr3--22961 2641 1539 --
NM_015577chr531528 1457 1446 1343 ----
NM_015578chr1911564 1741 1522 --
NM_015584chr1711286 --1521 --
NM_015601chr10------1878
NM_015607chr11179 ------
NM_015630chr211092 130 1915 --
NM_015640chr155062 5010 4680 1704 1660 ------
NM_015686chrX11957 1769 11912 --
NM_015695chr611781 ------
NM_015719chr19----2670 163 160
NM_015866chr111397 ------
NM_015878chr821575 858 ------
NM_015879chr1877884 6024 5665 3178 3161 1601 935 23196 1124 ----
NM_015881chr112541 197 --1145 --
NM_015886chr845400 4203 4020 4006 24040 3506 --23903 1229
NM_015888chr132157 1126 1056 ------
NM_015892chr102464 26 --11533 --
NM_015898chr1931565 1558 748 ----11949
NM_015904chr2146 ------
NM_015906chr134773 4589 89 ------
NM_015912chr852298 2203 1819 984 149 --11020 --
NM_015948chr62382 294 ------
NM_015980chr531380 606 162 1253 ----
NM_015995chr1565161 4110 3857 2175 2086 1590 25036 1461 ----
NM_016021chr612109 --11171 --
NM_016025chr1631952 1856 1257 ------
NM_016040chr122729 2548 ------
NM_016061chr221183 497 ----1617
NM_016120chrX--1948 ----
NM_016127chr83622 197 124 ------
NM_016133chr211300 1266 ----
NM_016141chr3----1615 --
NM_016185chr173801 763 724 ------
NM_016201chr341666 1420 555 372 ------
NM_016205chr421199 943 1563 ----
NM_016219chr91458 ------
NM_016227chr111482 ------
NM_016248chr1362902 2792 2567 1038 812 327 ------
NM_016250chr14----1597 168
NM_016260chr247404 6031 5118 1087 12451 ----
NM_016269chr41781 11161 ----
NM_016271chr1811662 ------
NM_016284chr161919 ------
NM_016287chr122028 172 ------
NM_016308chr142082 1760 1573 217 ------
NM_016316chr2----1632 --
NM_016322chr922609 2423 --1862 --
NM_016339chr174661 622 584 559 --11504 --
NM_016424chr171402 --1646 --
NM_016436chr202943 430 --12344 --
NM_016441chr222236 1938 --1325 --
NM_016480chr51718 1153 ----
NM_016485chr62917 763 ------
NM_016512chr81242 --1102 --
NM_016513chr623780 68 ------
NM_016516chr23809 587 146 ------
NM_016522chr111480 11135 ----
NM_016525chr92382 305 ------
NM_016530chr1512690 --12813 --
NM_016544chr253760 2994 1501 1142 119 ------
NM_016575chr1294946 4874 4650 3731 3544 3461 2193 1017 81 --13388 14882
NM_016577chr334180 2826 49 --21046 808 --
NM_016592chr2011407 --148 --
NM_016605chr542531 2458 680 670 ------
NM_016623chr81450 ------
NM_016626chr1821100 424 ------
NM_016651chr14175 11030 ----
NM_016656chrX1426 ------
NM_016836chr24523 507 484 24 ------
NM_016839chr24523 507 484 24 ------
NM_016930chr42180 77 ------
NM_016936chr1632161 1812 101 ------
NM_016937chrX2764 624 ------
NM_016946chr153368 2930 1086 1048 49 --1997 --
NM_016950chr41561 ------
NM_017415chr5124432 4344 3971 3652 3258 1482 1094 787 333 268 198 108 --31678 149 44 --
NM_017420chr1413039 ------
NM_017450chr17--11418 2535 178 --
NM_017452chr2021170 188 ------
NM_017453chr2021170 188 ------
NM_017454chr2021170 188 ------
NM_017455chr151225 1746 ----
NM_017545chr201429 ------
NM_017551chr1032436 645 532 ------
NM_017558chr161343 ------
NM_017582chr131625 1222 731 --11281 --
NM_017583chr1131822 1429 633 --1554 --
NM_017590chr221189 --21797 1694 --
NM_017595chr1721387 1148 168 ----
NM_017602chrX------1910
NM_017622chr172712 111 ------
NM_017629chr141849 1717 595 329 ------
NM_017633chr623760 3001 ------
NM_017634chr8--11905 ----
NM_017635chr1121423 1046 ------
NM_017637chr935759 2614 189 18078 38014 2477 750 --
NM_017643chr1722681 215 ------
NM_017644chr344708 3974 3914 1082 14383 ----
NM_017645chr912473 ------
NM_017650chr731915 557 284 1140 25615 354 --
NM_017651chr62343 285 11453 ----
NM_017657chr21249 ------
NM_017658chr1434362 928 765 2806 435 23764 404 14051
NM_017667chr71158 ------
NM_017693chr1311395 ----11387
NM_017699chr331613 678 428 --21210 46 --
NM_017704chr11------1294
NM_017715chr72295 180 ------
NM_017719chr322574 1964 11987 ----
NM_017754chr644751 3749 3632 1416 31216 875 87 ----
NM_017768chr1----1215 --
NM_017778chr821319 598 ------
NM_017787chr1032864 2714 209 ------
NM_017793chr151237 ------
NM_017798chr201107 ------
NM_017811chr932309 2204 414 23073 2046 ----
NM_017813chr834212 2273 659 25581 3733 11610 --
NM_017824chr103947 555 54 ------
NM_017831chr1823002 683 --14177 13979
NM_017848chrX14048 ------
NM_017893chr103420 235 218 ------
NM_017896chr2043302 2149 1222 325 23038 857 1631 12156
NM_017902chr1021762 144 13925 ----
NM_017913chr92454 161 --186 --
NM_017915chr1211055 1757 ----
NM_017919chr9105821 5719 5653 5461 4100 3867 1237 1136 735 170 --13810 --
NM_017938chrX21430 339 ------
NM_017943chr141734 ------
NM_017944chr1122916 672 1477 ----
NM_017966chr1131026 242 102 ------
NM_017988chr121335 1759 ----
NM_018014chr221262 426 ------
NM_018027chr1033297 2989 1156 12915 ----
NM_018030chr18122 ------
NM_018032chr161375 --1785 --
NM_018036chr1443923 2903 1562 591 ------
NM_018061chr12473 177 ------
NM_018078chr41129 ------
NM_018084chr222703 312 1559 ----
NM_018086chr221199 365 3670 311 281 ----
NM_018092chr1611266 ------
NM_018120chr81995 11046 ----
NM_018126chr42206 84 ------
NM_018133chr31424 21821 490 ----
NM_018144chr101229 1119 ----
NM_018150chr11590 ------
NM_018157chr1232913 1043 933 ------
NM_018159chrX2479 424 131 ----
NM_018178chr111830 11497 ----
NM_018179chr121268 ------
NM_018181chr1821414 607 --11577 --
NM_018182chr1731501 458 376 --11696 --
NM_018184chr321530 1352 11424 ----
NM_018192chr331040 819 146 ------
NM_018195chr1121451 472 ------
NM_018198chr131425 1378 469 1307 1178 --
NM_018211chr152110 884 737 346 131 1481 ----
NM_018223chr123821 131 85 ------
NM_018237chr10131 ------
NM_018244chr201916 1144 ----
NM_018247chr622537 2163 1332 ----
NM_018254chr112036 --12018 --
NM_018257chr2052022 1945 399 71 60 ----1894
NM_018270chr201718 1898 ----
NM_018293chr322077 172 ------
NM_018312chr1122125 550 ------
NM_018313chr322005 664 1734 --12525
NM_018330chr1041372 1241 566 273 ------
NM_018334chr71358 ------
NM_018351chr121168 ------
NM_018364chr111021 ------
NM_018367chr113954 311 176 ------
NM_018369chr52309 25 ------
NM_018375chr1421219 455 ------
NM_018388chrX4534 481 471 107 ------
NM_018399chr61277 ------
NM_018400chr1144562 3740 1594 344 11263 23372 950 --
NM_018403chr321151 271 --12546 --
NM_018425chr1032216 1858 600 ------
NM_018440chr888338 7672 7272 6751 6090 5791 5676 523 ------
NM_018448chr1221267 1159 ------
NM_018486chrX----1488 --
NM_018488chr17136 ------
NM_018489chr122134 802 ------
NM_018553chr174719 661 629 435 ------
NM_018584chr11402 --1413 --
NM_018638chr1235301 4824 4097 ------
NM_018640chr1222844 2568 12728 ----
NM_018644chr1121442 277 ------
NM_018650chr121622 626 ------
NM_018657chr31711 ------
NM_018667chr1622813 86 ----12834
NM_018689chr1521645 259 1325 2215 166 --
NM_018695chr561997 1942 1907 971 473 265 --1526 --
NM_018697chr741816 673 544 242 --12080 --
NM_018700chr5----21208 301 --
NM_018704chr111356 --11704 1664
NM_018708chr1941661 610 179 162 --11284 --
NM_018840chr201138 ------
NM_018841chr133528 3375 449 ------
NM_018846chr7194 1848 ----
NM_018890chr711139 11344 ----
NM_018898chr522361 196 ------
NM_018899chr522361 196 ------
NM_018900chr522361 196 ------
NM_018901chr522361 196 ------
NM_018902chr522361 196 ------
NM_018903chr522361 196 ------
NM_018904chr522361 196 ------
NM_018905chr522361 196 ------
NM_018906chr522361 196 ------
NM_018907chr522361 196 ------
NM_018908chr522361 196 ------
NM_018909chr522361 196 ------
NM_018910chr522361 196 ------
NM_018911chr522361 196 ------
NM_018912chr521623 1611 ----1413
NM_018913chr521623 1611 ----1413
NM_018914chr521623 1611 ----1413
NM_018915chr521623 1611 ----1413
NM_018916chr521623 1611 ----1413
NM_018917chr521623 1611 ----1413
NM_018918chr521623 1611 ----1413
NM_018919chr521623 1611 ----1413
NM_018920chr521623 1611 ----1413
NM_018921chr521623 1611 ----1413
NM_018922chr521623 1611 ----1413
NM_018923chr521623 1611 ----1413
NM_018924chr521623 1611 ----1413
NM_018925chr521623 1611 ----1413
NM_018926chr521623 1611 ----1413
NM_018927chr521623 1611 ----1413
NM_018928chr521623 1611 ----1413
NM_018929chr521623 1611 ----1413
NM_018945chr631425 297 105 13494 1710 --
NM_018948chr151223 1162 991 928 190 ------
NM_018951chr72469 92 --1195 --
NM_018952chr172541 180 ------
NM_018970chr71282 1391 ----
NM_018972chr811893 --12427 --
NM_018975chr161784 ------
NM_018976chr121946 147 ----
NM_018977chrX2965 356 ------
NM_018979chr1242306 1832 886 99 --12565 --
NM_018993chr2011427 ------
NM_018999chr1024271 1549 ------
NM_019000chr521587 245 ------
NM_019001chr324756 4484 13857 1590 --
NM_019004chr712119 1629 1867 --
NM_019006chr151703 1553 ----
NM_019045chrX1822 ------
NM_019063chr21189 --2622 545 --
NM_019066chr152282 83 ----1170
NM_019071chr71790 ------
NM_019074chr152740 106 --1771 --
NM_019091chr211120 ------
NM_019102chr71358 ------
NM_019102chr71358 ------
NM_019106chr2233435 2288 358 11332 ----
NM_019116chr1641328 736 657 446 ------
NM_019555chr331745 1721 213 ------
NM_019556chrX1469 ------
NM_019593chr2052701 2645 1223 816 766 ------
NM_019594chr921088 428 ------
NM_019605chr11657 --1492 --
NM_019858chr121208 ------
NM_019860chr101337 1505 ----
NM_019884chr19----1231 --
NM_019885chr222331 753 ------
NM_020116chr411204 --1403 --
NM_020122chr256059 3836 1859 1502 36 15874 ----
NM_020151chr22208 31 ----11381
NM_020177chr522647 287 1919 ----
NM_020193chr11--1455 --11296
NM_020225chr42354 128 ------
NM_020239chr122219 1707 ------
NM_020245chr654829 4542 1938 590 558 ------
NM_020248chr152369 2035 1846 471 356 ------
NM_020310chr1732205 948 362 --12110 --
NM_020311chr22599 233 1192 ----
NM_020338chr1023641 3317 ------
NM_020340chr63807 643 302 ------
NM_020341chr2021312 1251 ------
NM_020342chr231632 728 153 1245 1721 11802
NM_020346chr11--11686 ----
NM_020362chr11758 ------
NM_020403chr1351711 1186 681 479 411 11115 ----
NM_020416chr42899 756 ------
NM_020429chr722432 292 --22076 2052 --
NM_020432chr712299 ------
NM_020443chr136610 5998 5949 --22503 161 12294
NM_020445chr72768 524 --1101 --
NM_020452chr131342 790 488 ------
NM_020465chr1651941 1648 1337 540 168 11813 31917 561 372 --
NM_020473chrX21291 504 ----1311
NM_020474chr181372 ----21748 693
NM_020640chr32555 507 ------
NM_020651chr221746 653 1307 ----
NM_020654chr311442 ----1354
NM_020672chr11563 --131 --
NM_020686chr1612844 --12086 1183
NM_020689chr2041450 638 612 113 ------
NM_020699chr144807 4542 3938 646 ------
NM_020703chr11420 ------
NM_020708chr2032216 1830 940 ------
NM_020717chrX34575 3362 3206 ------
NM_020727chr2133628 3586 3007 ------
NM_020734chr1233286 2345 393 ------
NM_020739chr151837 --12673 --
NM_020742chrX4694 580 329 188 ------
NM_020747chr52645 78 ------
NM_020749chr811854 ------
NM_020752chr1012904 ------
NM_020760chr221758 118 ------
NM_020766chrX54518 3985 3035 648 186 1914 --12952
NM_020769chrX1674 ------
NM_020772chr1787764 6573 6123 5495 5402 2816 950 913 --1626 --
NM_020774chr1824892 1373 --1171 --
NM_020782chr1244504 3513 1900 1029 12959 13374 14478
NM_020791chr1711064 ------
NM_020795chr1711637 --21669 1447 --
NM_020799chr102256 201 ------
NM_020801chr521795 1724 ----12562
NM_020807chr161118 --11568 --
NM_020819chr611214 ----11039
NM_020825chr1623760 313 --22833 1296 --
NM_020841chr1212849 1872 ----
NM_020845chr122689 36 ----12150
NM_020858chr152834 45 --1215 --
NM_020868chr221299 179 11305 ----
NM_020871chrX31876 1826 1017 ------
NM_020888chr131549 1469 710 --1162 --
NM_020918chr1032338 583 391 --12791 1743
NM_020919chr211092 193 1902 --
NM_020951chr1931891 1589 1526 ------
NM_020952chr91136 ------
NM_020981chr2----161 --
NM_020993chr1232781 2593 294 --1672 1973
NM_021003chr141233 ------
NM_021007chr232129 653 405 ------
NM_021033chr1332895 1269 97 ------
NM_021069chr41774 ------
NM_021072chr52754 521 ------
NM_021096chr2253297 2376 2113 1327 1070 ------
NM_021111chr91198 11308 ----
NM_021136chr142297 243 ------
NM_021168chr1641306 1173 529 215 ------
NM_021174chr81542 1300 ----
NM_021183chrX21732 542 ------
NM_021190chr11326 ------
NM_021192chr21354 ------
NM_021202chr2022926 982 12935 12681 --
NM_021215chr2052042 1780 1616 892 869 --12481 --
NM_021249chr1411438 --11677 --
NM_021255chr1431172 414 180 --12815 --
NM_021620chr62713 308 ----1168
NM_021627chr311214 ------
NM_021629chr334737 4625 3763 ----13145
NM_021638chr474559 3647 1093 1075 858 752 256 --13823 --
NM_021643chr221868 524 --11765 --
NM_021644chr102990 267 ------
NM_021728chr141364 ------
NM_021738chr102598 86 ------
NM_021784chr20----196 --
NM_021813chr695516 5213 4351 4265 2324 1771 1338 673 199 14448 ----
NM_021814chr611645 ----1296
NM_021830chr104822 694 352 186 ------
NM_021911chr515245 ------
NM_021940chr62506 142 ------
NM_021943chr61374 ------
NM_021946chrX21462 595 ------
NM_021952chr11142 ------
NM_021958chr11257 ------
NM_021961chr1167388 7174 5037 2835 2781 2406 15254 --11288
NM_021964chr356499 2596 1987 1799 83 14807 12307 --
NM_021976chr62718 22 --1997 --
NM_021999chr131661 ------
NM_022041chr1622688 99 32481 1739 712 ----
NM_022048chr1536412 1652 657 13939 11520 --
NM_022058chr211643 ----174
NM_022072chr31222 ------
NM_022079chr10------1878
NM_022123chr141251 ------
NM_022130chr511348 ------
NM_022133chr821711 291 ------
NM_022140chr542306 822 775 407 1448 ----
NM_022153chr1043564 3539 3164 3030 13404 --31384 752 224
NM_022154chr4----122 --
NM_022166chr1635341 4558 1508 55918 5648 4500 4316 1242 21625 1077 1386
NM_022373chr72246 115 ------
NM_022451chr101590 ------
NM_022454chr81126 ------
NM_022459chr1365619 4923 1895 1823 978 774 ------
NM_022461chr31257 1913 ----
NM_022462chr1973716 3646 3532 3223 2882 2290 1147 --13430 --
NM_022465chr1232575 2361 2063 ------
NM_022491chr1243084 2727 2536 1162 1678 --13488
NM_022566chr15--1455 ----
NM_022648chr233252 3044 1200 --13973 --
NM_022652chr121837 ------
NM_022726chr621203 426 --21243 606 --
NM_022728chr71104 ------
NM_022735chr121518 1368 ----1226
NM_022745chr132294 2238 2227 ------
NM_022756chr121096 1018 ------
NM_022771chr121891 ------
NM_022780chr231620 1450 751 ------
NM_022781chr963089 2760 2526 1295 288 34 ------
NM_022802chr1011592 1138 ----
NM_022817chr252096 1863 1580 400 50 ------
NM_022826chr22848 170 ------
NM_022828chr521757 123 ------
NM_022845chr1641809 1537 681 25 --11729 --
NM_022893chr222778 2044 ------
NM_022898chr1444427 3406 2960 1018 23044 731 2777 436 --
NM_022910chr1651941 1648 1337 540 168 11813 31917 561 372 --
NM_022912chr222522 995 12361 ----
NM_022918chr1121329 515 ------
NM_022977chrX22499 448 --11977 --
NM_023000chr141318 ------
NM_023001chr141318 ------
NM_023012chr122171 164 --1100 --
NM_023079chr1711692 ------
NM_023925chr12136 ------
NM_023929chr812362 1601 ----
NM_024007chr512914 --1199 --
NM_024034chr202659 46 --1372 --
NM_024052chr1752933 2759 2654 1921 372 1570 ----
NM_024076chr1931750 1638 389 ------
NM_024081chr11--1699 ----
NM_024086chr1743819 3091 2500 389 130 ----
NM_024090chr421842 1194 ------
NM_024117chr911142 ------
NM_024293chr2157 1853 --1833
NM_024295chr82721 53 ------
NM_024308chr171392 ----172
NM_024345chr956031 5056 4625 1689 37 11117 ----
NM_024415chr51207 ------
NM_024423chr1823786 1182 1737 ----
NM_024424chr1121056 143 ----11199
NM_024425chr1121056 143 ----11199
NM_024426chr1121056 143 ----11199
NM_024496chr142696 681 1534 ----
NM_024524chr342930 2076 670 314 --2733 580 --
NM_024525chr11510 ------
NM_024539chrX31296 982 420 ------
NM_024545chr21301 ------
NM_024561chr1311147 ------
NM_024569chr142572 2365 1975 278 --12380 12098
NM_024630chr62553 511 1728 ----
NM_024636chr712258 11174 12015 12183
NM_024639chr61394 11157 12702 --
NM_024645chr821547 1326 ------
NM_024646chr12937 832 --13295 --
NM_024665chr334544 1250 216 14087 ----
NM_024674chr142895 2348 1301 537 --1491 --
NM_024686chr1194 --1498 --
NM_024692chr211832 ------
NM_024700chr16904 413 392 299 282 98 ------
NM_024715chr521371 168 194 ----
NM_024719chr13197 ------
NM_024742chr1611498 ------
NM_024744chr232630 2039 830 ------
NM_024749chr121463 39 ------
NM_024753chr23713 659 173 --123 --
NM_024755chr15--1587 ----
NM_024757chr9------1797
NM_024761chr91185 14676 13262 --
NM_024771chr1122021 687 ----1991
NM_024824chr1421343 197 21573 1420 ----
NM_024830chr531693 503 175 ------
NM_024837chr151482 ------
NM_024845chr1621422 148 11662 21367 1266 --
NM_024887chr122136 106 --11628 --
NM_024900chr442162 791 626 109 --1437 1556
NM_024900chr442162 791 626 109 --1437 1556
NM_024909chr621589 1003 --11180 --
NM_024915chr821993 129 --11772 --
NM_024922chr1621613 474 ------
NM_024939chr1631478 1121 633 ------
NM_024946chr162430 398 11311 ----
NM_024947chr388910 7564 6160 5974 5852 3053 2848 2314 11674 --29195 7240
NM_024953chr1232567 1095 150 ------
NM_024971chr91136 ------
NM_024989chr278195 8166 8063 6350 5369 2440 1737 16426 ----
NM_024991chr1022265 137 23230 200 ----
NM_025054chr81654 12595 ----
NM_025058chr11632 1710 ----
NM_025073chr144123 1872 1419 525 13527 ----
NM_025074chr422905 2004 --13012 --
NM_025099chr1731149 823 148 --1897 --
NM_025133chr22293 202 ------
NM_025134chr1622340 493 179 ----
NM_025146chr32924 808 ------
NM_025154chr721131 181 1230 --11198
NM_025160chr113725 14216 11276 --
NM_025179chr143817 3237 3144 1095 --14805 --
NM_025191chr1----33385 2166 1306 --
NM_025196chr4123 ------
NM_025219chr204785 715 590 264 --21783 426 --
NM_025222chr332922 2699 141 --1660 --
NM_025230chr1441529 1250 473 291 ------
NM_025238chr1511017 ------
NM_025248chr1742909 2665 2365 174 ------
NM_025263chr611680 --2313 165 --
NM_030594chr151523 ------
NM_030625chr1031004 406 289 --158 --
NM_030627chr533514 3284 157 11410 ----
NM_030640chr12----1309 --
NM_030647chr735112 2042 1286 ----16000
NM_030648chr445208 4347 2094 1974 11420 ----
NM_030650chr233968 2874 486 ------
NM_030674chr1244395 4091 2291 1285 15567 ----
NM_030780chr831695 1437 1400 ----1460
NM_030790chr162252 222 ------
NM_030795chr81147 --1459 --
NM_030802chr171889 ------
NM_030806chr179117 8144 7126 6695 3234 2614 2290 1494 47027 6294 3045 2247 17905
NM_030816chr143385 2920 697 283 ------
NM_030820chr62113 37 ------
NM_030918chr164077 3831 3796 2092 340 302 --11538 --
NM_030927chr1011037 ----1164
NM_030939chr62928 352 ------
NM_030940chr92131 89 ------
NM_030949chr631394 1142 570 11128 ----
NM_030962chr111172 --1503 --
NM_030963chr62562 196 ------
NM_030964chr553271 2831 1423 957 728 ------
NM_031216chr1821585 764 1483 ----
NM_031243chr732103 841 637 ------
NM_031244chr611110 ------
NM_031262chr9189 ------
NM_031263chr91146 ------
NM_031266chr51179 ------
NM_031292chr121661 ------
NM_031305chr421461 517 ------
NM_031314chr1421367 459 ------
NM_031369chr4--1827 ----
NM_031370chr4--1827 ----
NM_031372chr421576 562 ------
NM_031407chrX1483 1435 ----
NM_031411chr522361 196 ------
NM_031438chr51565 ------
NM_031442chrX11076 ----12152
NM_031445chr223178 1063 13216 13018 --
NM_031468chr73755 652 27 17255 ----
NM_031469chr633685 2609 136 14070 13195 1474
NM_031476chr1652618 2315 1779 673 194 --11773 --
NM_031844chr123665 1629 ------
NM_031845chr2----1881 --
NM_031847chr2----1881 --
NM_031849chr522361 196 ------
NM_031857chr522361 196 ------
NM_031860chr522361 196 ------
NM_031866chr101958 1107 ----
NM_031940chr81208 ------
NM_032041chr81230 --12633 --
NM_032047chr322185 591 ------
NM_032088chr521623 1611 ----1413
NM_032092chr521623 1611 ----1413
NM_032102chr1122674 1009 1649 12823 --
NM_032104chr1151 ------
NM_032105chr136860 5879 51 --12923 12715
NM_032156chr12136 ------
NM_032169chr32613 539 ------
NM_032199chr1043587 3478 3235 68 ------
NM_032208chr222758 647 ------
NM_032221chr202464 193 ------
NM_032242chr373088 2855 2776 2749 2504 249 98 ------
NM_032246chr1521331 33 ------
NM_032268chr1673187 2615 2426 2401 1260 978 348 ------
NM_032288chr342313 2291 1876 644 2588 434 ----
NM_032295chr71247 11035 ----
NM_032345chr121375 ------
NM_032352chr141984 ------
NM_032373chr1025308 226 --2807 365 --
NM_032403chr521623 1611 ----1413
NM_032420chr51710 ------
NM_032439chr101348 ------
NM_032446chr51168 13794 --11414
NM_032458chrX33215 1374 1211 ------
NM_032466chr821396 364 ------
NM_032468chr821396 364 ------
NM_032471chr61141 127 ----
NM_032482chr1962357 1818 1763 819 691 372 --42311 1836 1694 704 1417
NM_032491chr121316 ------
NM_032505chr31722 174 --11719
NM_032539chrX1614 ------
NM_032547chr421409 335 ------
NM_032552chr931910 1266 490 ------
NM_032558chr9----21294 82 1473
NM_032575chr1621879 142 --11268 1223
NM_032582chr17--11918 ----
NM_032590chr1221041 339 ----1382
NM_032646chr1751654 1497 1448 1362 234 ------
NM_032682chr352247 1204 1009 722 289 ------
NM_032711chr1742883 1712 1692 1200 12662 33184 551 292 --
NM_032727chr102479 299 ------
NM_032765chr52810 35 ------
NM_032781chr111793 1828 ----
NM_032800chr111848 --12537 11983
NM_032804chr1022454 2204 ------
NM_032812chr10143 ------
NM_032826chr722089 1956 1104 ----
NM_032828chr1954260 3377 3244 1902 90 2397 148 ----
NM_032864chr11399 ----1155
NM_032866chr15--2859 780 1244 --
NM_032867chr111555 --1256 --
NM_032900chr1033015 1284 59 ------
NM_032932chr1796294 6043 5983 5360 5306 4771 4275 4021 1846 --14290 --
NM_032949chr13175 ------
NM_032961chr41549 ------
NM_032975chr1843559 3366 2986 1169 ------
NM_032980chr1843559 3366 2986 1169 ------
NM_032995chr211187 --1582 --
NM_032998chr121116 961 ------
NM_033012chr131915 ------
NM_033018chrX1199 --21014 903 --
NM_033020chr134773 4589 89 ------
NM_033023chr731056 389 76 --1441 --
NM_033030chr211341 ------
NM_033055chr1------1334
NM_033081chr20------11223
NM_033089chr202564 228 ------
NM_033121chr1231869 1452 381 1480 ----
NM_033132chr1321513 155 11810 11866 --
NM_033133chr1733294 1410 1090 ------
NM_033136chr5------21238 203
NM_033137chr5------21238 203
NM_033198chr17154 --1545 --
NM_033224chr726487 2800 ------
NM_033225chr82422 325 22524 895 12546 --
NM_033228chr5----1148 --
NM_033267chr5144 --1727 --
NM_033281chr5--1285 ----
NM_033316chr32522 451 1159 ----
NM_033326chr1112393 ------
NM_033331chr922505 1139 ------
NM_033360chr1234585 3253 1197 ----11100
NM_033380chrX3434 393 112 ------
NM_033381chrX3434 393 112 ------
NM_033389chr1754685 4185 1302 568 143 --14353 11310
NM_033394chr211157 144 ----
NM_033425chr11----1834 1561
NM_033449chr531537 748 532 --1606 --
NM_033480chr632709 2578 242 ------
NM_033481chr632709 2578 242 ------
NM_033503chr1543562 3364 3202 1391 ------
NM_033505chr256417 5545 4604 4408 2074 24659 1351 1959 --
NM_033515chr621192 159 ------
NM_033535chr41730 ------
NM_033549chr521005 112 ------
NM_033642chrX2885 449 --152 --
NM_044472chr12528 504 ------
NM_048368chr181282 ------
NM_052840chr1521335 1224 11246 ----
NM_052869chr1751654 1497 1448 1362 234 ------
NM_052879chr1224093 1437 13051 ----
NM_052885chr1244128 1882 1061 417 14143 ----
NM_052886chr812100 ------
NM_052906chr223721 605 270 13950 ----
NM_052907chr1223284 3207 --12859 1349
NM_052913chr621054 60 ------
NM_052918chr1073584 3562 3275 2816 2302 1407 403 --12649 --
NM_052927chr521991 159 1768 ----
NM_052937chr812403 12661 ----
NM_052950chr132294 255 ------
NM_052962chr621758 1253 ------
NM_053002chr33410 289 156 ------
NM_053023chr112831 680 11160 ----
NM_053053chr11146 1918 ----
NM_053064chr142735 724 ------
NM_054025chr1121442 277 ------
NM_057089chr72157 49 ------
NM_057161chr63221 142 132 ------
NM_057164chr23674 260 172 ------
NM_057165chr23674 260 172 ------
NM_057166chr23674 260 172 ------
NM_057167chr23674 260 172 ------
NM_057175chr452476 1962 974 648 599 ------
NM_057182chr192489 346 ------
NM_058241chr222205 128 ------
NM_058241chr222205 128 ------
NM_078469chr101530 ----11068
NM_078470chr1022204 299 1869 ----
NM_078473chr81208 ------
NM_078481chr19--1573 ----
NM_078485chr63508 487 174 ------
NM_078625chr63915 857 255 ------
NM_080425chr201316 ------
NM_080426chr201316 ------
NM_080546chr921616 918 ------
NM_080594chr161169 1820 ----
NM_080597chr18122 ------
NM_080599chr1011269 ------
NM_080629chr11328 --1281 --
NM_080630chr11328 --1281 --
NM_080645chr642029 1453 673 25 ----11402
NM_080653chr2--127 ----
NM_080664chr1431596 559 498 ------
NM_080669chr1754037 1886 1605 1186 525 --34275 4148 3820 --
NM_080679chr6----1625 --
NM_080680chr6----1625 --
NM_080681chr6----1625 --
NM_080717chr121399 ------
NM_080723chr62301 225 --1400 --
NM_080764chr223801 562 236 ------
NM_080792chr203857 835 705 1918 ----
NM_080872chr823955 3939 23668 942 ----
NM_080927chr31174 ------
NM_130436chr2132324 395 51 11737 ----
NM_130438chr2132901 972 628 12314 ----
NM_130439chr1011903 1925 ----
NM_130439chr1011903 1925 ----
NM_130440chr121555 1045 1581 ----
NM_130797chr731578 1204 113 21622 1306 ----
NM_130831chr322489 387 ------
NM_130832chr322489 387 ------
NM_130833chr322489 387 ------
NM_130834chr322489 387 ------
NM_130835chr322489 387 ------
NM_130836chr322489 387 ------
NM_130837chr322489 387 ------
NM_133170chr2087888 7817 6692 6424 5492 2306 1511 691 --1353 --
NM_133171chr202416 206 1426 1983 --
NM_133265chrX41427 824 628 425 ------
NM_133334chr445200 5012 2469 1549 --26405 1178 --
NM_133372chr532003 1124 324 ------
NM_133457chr721486 1199 --21265 264 --
NM_133468chr721678 277 1746 ----
NM_133474chr411537 ------
NM_133476chr1221199 276 --1798 --
NM_133477chr43795 513 277 ------
NM_133486chrX1136 ------
NM_133494chr1182 ------
NM_133496chr154175 3341 1398 1148 937 23166 1584 ----
NM_133638chr52320 153 ------
NM_133647chr1533130 2960 2779 ------
NM_134442chr2--2454 351 ----
NM_138270chrX22641 2582 1736 ----
NM_138288chr1431488 1427 166 --1850 --
NM_138333chr9--1229 ----
NM_138357chr101302 ------
NM_138396chr12190 1959 ----
NM_138423chr152698 36 1903 ----
NM_138426chr732238 745 412 --1840 --
NM_138437chrX167 ------
NM_138459chr652528 1267 695 624 514 ------
NM_138473chr1265102 4799 3590 3551 3430 3173 ----1120
NM_138492chr53383 318 127 ------
NM_138555chr151540 ------
NM_138559chr221252 416 ------
NM_138576chr1444427 3406 2960 1018 23044 731 2777 436 --
NM_138609chr52371 364 ------
NM_138610chr52371 364 ------
NM_138621chr231351 989 291 --23347 891 --
NM_138635chr751220 860 794 293 282 2111 80 1973 --
NM_138713chr1646695 5667 2350 1364 35369 2888 1499 37342 1648 1056 --
NM_138714chr1646695 5667 2350 1364 35369 2888 1499 37342 1648 1056 --
NM_138717chr64688 616 548 248 ------
NM_138730chr62368 309 ------
NM_138771chr72966 23 ------
NM_138927chr2111066 ------
NM_138970chr1432002 897 714 ------
NM_139014chr621848 1811 --1882 --
NM_139015chr1241604 1362 1150 631 --31692 1266 170 --
NM_139045chr9----1848 --
NM_139067chr121276 ------
NM_139136chr123430 234 38 ------
NM_139157chr112710 254 ------
NM_139168chr5--1679 ----
NM_139201chr123579 300 46 1711 ----
NM_139211chr43478 138 96 ------
NM_139212chr43478 138 96 ------
NM_139276chr1731709 923 299 ------
NM_139283chr1252564 2504 2459 2225 275 162 ----
NM_139319chr1221861 438 1565 1692 --
NM_139321chr2054082 3416 2846 2759 1540 ------
NM_144571chr446865 6570 6319 5681 --16040 --
NM_144579chr232758 2023 806 --32572 2048 1955 --
NM_144580chr1----1239 --
NM_144586chr221244 1086 ------
NM_144590chr1032828 2151 407 ------
NM_144595chr13--1623 ----
NM_144599chr1544797 3933 3417 98 11909 ----
NM_144635chr321243 1049 ------
NM_144636chr3--1278 --1549
NM_144657chrX1586 ------
NM_144671chr1241807 694 587 324 --1167 --
NM_144707chr23717 259 113 ------
NM_144726chr5--1332 ----
NM_144767chr1554326 4163 3303 1510 724 ------
NM_144778chr132630 164 ------
NM_144949chr21204 1541 ----
NM_144963chr812678 11950 ----
NM_144967chrX2744 242 ------
NM_145005chr91184 ------
NM_145012chr102888 757 1693 ----
NM_145049chr5185 1984 ----
NM_145113chr1411051 ------
NM_145117chr1153077 2439 631 539 527 ------
NM_145175chr2--11121 1253 --
NM_145185chr192697 361 --11293 --
NM_145259chr212549 ----14637
NM_145287chr182172 46 ------
NM_145296chr19----1157 --
NM_145307chr1024020 738 13726 ----
NM_145320chr723349 1098 --1514 --
NM_145321chr723349 1098 --1514 --
NM_145322chr723349 1098 --1514 --
NM_145331chr6--1741 ----
NM_145332chr6--1889 ----
NM_145333chr6--1889 ----
NM_145349chr1742014 1450 1443 590 ------
NM_145686chr252619 2489 1312 259 132 22093 444 1236 --
NM_145687chr252619 2489 1312 259 132 22093 444 1236 --
NM_145698chr1041478 819 583 70 ------
NM_145727chr62390 48 ------
NM_145733chr2221224 77 ------
NM_145753chr311605 ------
NM_145808chr733131 1916 1227 2931 343 --1435
NM_145859chr31304 ------
NM_145860chr31304 ------
NM_145899chr61981 --1526 --
NM_145901chr61981 --1526 --
NM_145902chr61981 --1526 --
NM_145903chr61981 --1526 --
NM_145904chr61981 --1526 --
NM_145905chr61981 --1526 --
NM_145909chr6----1213 --
NM_145912chr2224183 433 --44665 3392 1068 752 --
NM_147127chr4167 ------
NM_147150chr963789 3436 3340 3294 977 33 24004 3603 1468 --
NM_147189chr841654 696 103 79 ------
NM_147223chr2135 ------
NM_148174chr821575 858 ------
NM_148571chr1721685 1347 175 31821 1698 230 --
NM_148921chr1732054 282 37 12411 ----
NM_152227chr203715 699 483 ------
NM_152233chr1411438 --11677 --
NM_152253chr2243668 691 555 121 ------
NM_152261chr121641 1119 ----
NM_152263chr135817 5069 1329 11618 15515 --
NM_152265chr11234 ------
NM_152267chr22169 ------
NM_152277chr51601 --12076 --
NM_152280chr11489 1699 --12850
NM_152282chr331385 1301 1247 ------
NM_152300chr172770 656 ------
NM_152400chr441927 1673 709 114 ------
NM_152410chr61414 --141 --
NM_152422chr91284 1131 ----
NM_152423chrX21579 543 1186 ----
NM_152450chr1521855 405 ------
NM_152455chr1572690 2197 2056 2017 975 688 265 ------
NM_152470chr1833013 2840 459 --24108 1548 --
NM_152495chr121146 396 ------
NM_152515chr2130 ------
NM_152520chr22830 86 ------
NM_152538chr341215 1151 139 79 ------
NM_152549chr51205 ------
NM_152556chr712011 1334 ----
NM_152557chr731331 616 386 ------
NM_152608chr11742 1381 --11872
NM_152622chr512740 --12811 --
NM_152624chr586942 4982 2916 2624 2452 1542 1266 89 ----12007
NM_152629chr923608 3082 --1941 --
NM_152636chr1132452 2286 770 ------
NM_152665chr12932 438 ------
NM_152692chrX2208 48 ------
NM_152699chr343641 2947 2361 882 21424 1131 23229 110 --
NM_152733chr696532 6371 4953 4676 4316 4040 1148 509 326 --35854 5637 2027 --
NM_152739chr7--21118 268 ----
NM_152744chr713574 22742 2277 ----
NM_152756chr534103 3255 2647 ------
NM_152758chr821910 849 11050 ----
NM_152780chrX131 ------
NM_152787chrX23494 3029 ------
NM_152835chr122625 2464 ------
NM_152836chr821711 291 ------
NM_152837chr821711 291 ------
NM_152838chr2022773 363 ------
NM_152857chr61968 ------
NM_152858chr61968 ------
NM_152890chr13523 514 501 ------
NM_152896chr92565 22 1774 ----
NM_152914chr1754346 3774 2863 954 666 --1484 --
NM_152924chr1546707 6661 5065 1379 ----15818
NM_152988chr1931739 366 139 --11481 --
NM_152989chr12--1740 ----
NM_152994chr21137 ------
NM_153029chr1654155 3217 1343 543 380 --24030 1151 --
NM_153188chr575113 5050 4764 4449 4345 1209 987 12013 1170 --
NM_153207chr1232870 1220 672 12732 ----
NM_153223chr511481 ------
NM_153262chr122169 429 --12858 --
NM_153273chr342734 2300 2222 853 12517 ----
NM_153347chr1132472 384 296 1449 11701 1892
NM_153367chr1043685 3081 2466 861 1163 11034 --
NM_153456chr1336095 4121 1278 --14494 --
NM_153616chr152834 45 --1215 --
NM_153617chr152834 45 --1215 --
NM_153618chr152834 45 --1215 --
NM_153619chr1532439 1283 977 --11453 --
NM_153633chr121260 ------
NM_153649chr142269 1800 922 586 ------
NM_153675chr20----196 --
NM_153689chr211634 12146 ----
NM_153715chr72469 92 --1195 --
NM_153746chr62553 511 1728 ----
NM_153748chr123430 234 38 ------
NM_153757chr431266 298 223 ------
NM_153810chr1014915 --13129 --
NM_153836chr22613 27 12010 ----
NM_170665chr1244565 3873 3449 1287 ----14330
NM_170674chr1511429 ------
NM_170675chr1521105 370 ------
NM_170676chr1521105 370 ------
NM_170677chr1511429 ------
NM_170712chr33657 522 117 ------
NM_170713chr33657 522 117 ------
NM_170714chr33657 522 117 ------
NM_170725chr12164 84 ------
NM_170731chr1112266 --1501 --
NM_170732chr1112266 --1501 --
NM_170733chr1112266 --1501 --
NM_170734chr1112266 --1501 --
NM_170735chr1112266 --1501 --
NM_170750chrX1183 ------
NM_170768chr1121777 1134 --21306 458 --
NM_171998chrX42320 567 485 176 ------
NM_172058chr821829 1647 ------
NM_172059chr821829 1647 ------
NM_172060chr821829 1647 ------
NM_172070chr221911 148 1437 ----
NM_172071chr134827 852 504 ------
NM_172078chr7138 ------
NM_172079chr7138 ------
NM_172080chr7138 ------
NM_172081chr7138 ------
NM_172082chr7138 ------
NM_172083chr7138 ------
NM_172084chr7138 ------
NM_172103chr61650 ------
NM_172105chr61650 ------
NM_172127chr4--11633 --11931
NM_172128chr4--11589 --11887
NM_172159chr32871 67 --11787 --
NM_172160chr32871 67 --11787 --
NM_172169chr101205 --21587 692 --
NM_172170chr101205 --21587 692 --
NM_172171chr101205 --21587 692 --
NM_172173chr101205 --21587 692 --
NM_172216chr1232959 2722 636 --12291 --
NM_172315chr1511429 ------
NM_172316chr1511429 ------
NM_172337chr141364 ------
NM_172373chr131935 --1539 --
NM_173054chr7145 ------
NM_173075chr411684 ------
NM_173078chrX1110 ------
NM_173156chr132034 1730 717 --1756 --
NM_173172chr211232 ------
NM_173198chr92625 198 ------
NM_173200chr92625 198 ------
NM_173214chr1646695 5667 2350 1364 35369 2888 1499 37342 1648 1056 --
NM_173354chr2132038 693 122 ------
NM_173468chr446040 3731 2272 281 ------
NM_173495chrX12271 ------
NM_173500chr1521321 1313 196 ----
NM_173505chr182881 77 ------
NM_173510chr2222925 2376 ------
NM_173511chr213379 13648 ----
NM_173515chr61394 --2687 198 --
NM_173552chr31505 11894 ----
NM_173557chr181602 1207 --1107
NM_173562chr612553 21236 661 1252 --
NM_173576chr10144 ------
NM_173591chr122972 892 ------
NM_173595chr1245013 5006 4832 4719 --11808 --
NM_173602chr1243430 3314 3159 2679 ------
NM_173618chr16186 ------
NM_173642chr127199 534 --1967 --
NM_173654chr32707 147 ------
NM_173667chr542115 951 541 497 --21893 24 --
NM_173683chr811284 --11687 2483 407
NM_173694chrX21603 320 22431 823 ----
NM_173808chr113112 147 ----
NM_173812chr121502 ------
NM_173851chr814007 ------
NM_174937chr101609 ------
NM_174938chr91102 ------
NM_175610chr1521182 473 ------
NM_175634chr831140 1122 1085 ------
NM_175635chr831140 1122 1085 ------
NM_175636chr831140 1122 1085 ------
NM_175848chr2031208 1074 237 ------
NM_175848chr2031208 1074 237 ------
NM_175849chr2031208 1074 237 ------
NM_175849chr2031208 1074 237 ------
NM_175850chr2031208 1074 237 ------
NM_175850chr2031208 1074 237 ------
NM_175852chr132472 762 607 ------
NM_175854chr1312383 ------
NM_175856chr51160 ------
NM_175866chr1----1261 --
NM_175876chr122754 2284 ------
NM_175921chr554249 3924 2921 1646 215 ------
NM_176812chr201623 ------
NM_176814chr7165 ------
NM_176863chr1721853 399 ------
NM_176871chr832835 2118 571 12885 12709 --
NM_177398chr131580 704 639 ------
NM_177399chr131580 704 639 ------
NM_177401chr19--11384 ----
NM_177524chr7151 ----11076
NM_177525chr7151 ----11076
NM_177559chr2011226 ------
NM_177560chr2011226 ------
NM_177949chrX1252 1129 ----
NM_177952chr141233 ------
NM_177969chr21498 ------
NM_177972chr1122792 283 --13213 --
NM_177974chr152698 36 1903 ----
NM_177983chr21247 ------
NM_177985chr2145 --12001 --
NM_177990chr2021312 1251 ------
NM_177995chr91284 1131 ----
NM_177996chr2033391 1156 985 --12288 --
NM_177999chr923671 3590 --11097 13132
NM_178010chr12--1740 ----
NM_178037chr1242899 1134 1082 815 ------
NM_178038chr1242899 1134 1082 815 ------
NM_178039chr1242534 769 717 450 ------
NM_178040chr1242534 769 717 450 ------
NM_178126chr1732273 2200 701 11897 1309 --
NM_178148chr61103 1449 1443 --
NM_178151chrX56867 6431 5185 4810 95 17757 27740 621 --
NM_178152chrX56867 6431 5185 4810 95 17757 27740 621 --
NM_178153chrX56867 6431 5185 4810 95 17757 27740 621 --
NM_178313chr232169 1964 754 ------
NM_178426chr122039 963 2401 391 ----
NM_178427chr121939 863 2301 291 ----
NM_178509chr1711655 1778 ----
NM_178562chr7--1951 --168
NM_178585chr422192 794 --12390 --
NM_178812chr811541 ------
NM_178860chr1711026 ------
NM_180976chr63964 754 189 ------
NM_180977chr63964 754 189 ------
NM_180989chr1321003 223 ------
NM_181050chr161106 ------
NM_181332chrX4694 580 329 188 ------
NM_181336chr63519 390 243 ----188
NM_181349chr722432 292 --22076 2052 --
NM_181354chr81317 21314 1231 ----
NM_181357chr1441529 1250 473 291 ------
NM_181358chr111239 21501 176 ----
NM_181442chr202893 865 1871 ----
NM_181443chr2012711 ------
NM_181457chr221315 1289 1175 ----
NM_181458chr231448 1422 915 1308 ----
NM_181459chr221214 1188 174 ----
NM_181460chr221261 1235 1121 ----
NM_181481chr18107006 6383 6058 4944 2587 1888 965 559 503 80 --14991 --
NM_181482chr18107006 6383 6058 4944 2587 1888 965 559 503 80 --14991 --
NM_181483chr18107006 6383 6058 4944 2587 1888 965 559 503 80 --14991 --
NM_181486chr121399 ------
NM_181492chr2221107 925 ------
NM_181521chr1642331 1773 860 450 45187 1562 1419 438 ----
NM_181532chrX2263 229 ------
NM_181659chr2033196 2320 225 1470 --1524
NM_181659chr2033196 2320 225 1470 --1524
NM_181670chr1211000 11487 ----
NM_181672chrX1749 ------
NM_181673chrX1749 ------
NM_181702chr81254 ------
NM_181714chr621224 412 ------
NM_181762chrX4792 415 330 116 ------
NM_181777chrX4792 415 330 116 ------
NM_181782chr612049 ------
NM_181783chr123679 358 270 ------
NM_181784chr221911 868 1316 ----
NM_181787chr853111 2606 1415 1351 1265 ------
NM_181794chr61141 127 ----
NM_181795chr61141 127 ----
NM_181807chr111343 ------
NM_181838chr52151 144 ------
NM_181839chr81110 --11118 --
NM_181864chr11217 --1115 --
NM_181865chr11217 --1115 --
NM_181866chr11217 --1115 --
NM_181876chr42899 756 ------
NM_181886chr411067 11303 ----
NM_181887chr411067 11303 ----
NM_181888chr411067 11303 ----
NM_181889chr411067 11303 ----
NM_181890chr411067 11303 ----
NM_181891chr411067 11303 ----
NM_181892chr411114 11350 ----
NM_181893chr411067 11303 ----
NM_182314chrX2210 46 11565 ----
NM_182485chr433509 2932 614 ------
NM_182511chr1831118 1050 962 ------
NM_182526chr1433142 2637 438 --42539 620 183 162 --
NM_182557chr1152218 1496 619 603 160 --11745 --
NM_182580chr11274 32012 1854 677 11961 --
NM_182643chr8139 1370 ----
NM_182646chr433509 2932 614 ------
NM_182648chr142496 485 ------
NM_182663chr122199 2037 ------
NM_182664chr122329 2167 ------
NM_182665chr122199 2037 ------
NM_182691chr731417 1390 266 ------
NM_182692chr731417 1390 266 ------
NM_182697chr721635 1449 ------
NM_182717chr1031080 1000 330 ----11192
NM_182720chr1031080 1000 330 ----11192
NM_182721chr1031080 1000 330 ----11192
NM_182722chr1031080 1000 330 ----11192
NM_182723chr1031080 1000 330 ----11192
NM_182729chr121391 ------
NM_182742chr121391 ------
NM_182743chr121391 ------
NM_182758chr1533438 2930 2896 ------
NM_182764chr202416 206 1426 1983 --
NM_182765chr1021837 732 ------
NM_182798chr51323 ------
NM_182799chr51323 ------
NM_182801chr51323 ------
NM_182853chr1031080 1000 330 ----11192
NM_182894chr1411719 --162 --
NM_182898chr731587 451 227 15924 26268 1812 --
NM_182899chr731587 451 227 15924 26268 1812 --
NM_182918chr211534 11442 ----
NM_182920chr32586 431 11217 ----
NM_182948chr133059 385 332 ------
NM_182964chr1153077 2439 631 539 527 ------
NM_182970chr2013858 --21671 835 --
NM_182972chr122153 623 22285 1053 11094 12495
NM_182975chr131186 389 138 ------
NM_182976chr11270 ------
NM_183011chr1031080 1000 330 ----11192
NM_183012chr1031080 1000 330 ----11192
NM_183013chr1031080 1000 330 ----11192
NM_183397chr2044881 3754 1469 330 --33197 3185 89 --
NM_194071chr734908 4673 3997 --24666 4560 --
NM_194247chr224472 455 13825 ----
NM_194259chr162526 446 ------
NM_194260chr162526 446 ------
NM_194261chr162526 446 ------
NM_194272chr151342 ------
NM_194278chr1453334 3160 2877 999 298 ------
NM_194282chr411205 --1334 --
NM_194285chr11--1749 13364 --
NM_194286chr1246249 4298 2222 1808 --14871 --
NM_194292chr121699 50 ------
NM_194301chr141762 ------
NM_194313chr931299 489 49 1669 ----
NM_194314chr154019 4007 3925 3586 531 ------
NM_194328chr963089 2760 2526 1295 288 34 ------
NM_194329chr963089 2760 2526 1295 288 34 ------
NM_194330chr963089 2760 2526 1295 288 34 ------
NM_194332chr963089 2760 2526 1295 288 34 ------
NM_194434chr1845666 1346 1044 21 ------
NM_194442chr121687 1133 ------
NM_194463chrX31296 982 420 ------
NM_197941chr522083 200 2980 734 ----
NM_197970chr211341 ------
NM_197977chr92636 276 ------
NM_198089chr191117 ------
NM_198128chr1811662 ------
NM_198195chr32527 92 --1173 --
NM_198215chr101561 ------
NM_198225chr1021920 637 ------
NM_198261chr122171 164 --1100 --
NM_198262chr122171 164 --1100 --
NM_198268chr111239 21501 176 ----
NM_198269chr111239 21501 176 ----
NM_198270chrX1149 11175 ----
NM_198337chr72444 23 ------
NM_198395chr511214 ------
NM_198400chr1532749 2037 188 12046 ----
NM_198446chr12152 44 ------
NM_198463chr3191 ------
NM_198513chr8----1397 --
NM_198570chr71348 ------
NM_198581chr297091 6674 5730 5402 5102 2359 2106 1901 1051 ------
NM_198595chr474559 3647 1093 1075 858 752 256 --13823 --
NM_198700chr111422 1161 ----
NM_198829chr711139 11344 ----
NM_198859chr321492 972 25016 273 ----
NM_198902chr15----1117 --
NM_198935chr2052628 2497 2453 2292 415 12774 1213 --
NM_199050chr2153410 2986 913 435 382 ------
NM_199188chr1224093 1437 13051 ----
NM_199190chr1224093 1437 13051 ----
NM_199205chr81542 1300 ----
NM_199320chr412636 ------
NM_199320chr412636 ------
NM_199324chr422883 2613 13627 12655 --
NM_199342chr1----150 --
NM_199436chr222625 322 ----12614
NM_199461chr10--1172 1795 --
NM_199462chr145028 3589 267 115 ------
NM_199478chrX11601 --1736 --
NM_199487chr201916 1144 ----
NM_201266chr2----12051 --
NM_201279chr2----12051 --
NM_201280chr61566 ------
NM_201413chr2131088 741 139 ------
NM_201414chr2131088 741 139 ------
NM_201428chr111134 ------
NM_201429chr111134 ------
NM_201430chr11160 ------
NM_201520chr1731595 1532 1432 ------
NM_201535chr14----1597 168
NM_201536chr14----1597 168
NM_201537chr14----1597 168
NM_201538chr14----1597 168
NM_201539chr14----1597 168
NM_201540chr14----1597 168
NM_201541chr14----1597 168
NM_201568chr132034 1730 717 --1756 --
NM_201569chr132034 1730 717 --1756 --
NM_201591chr421262 43 ------
NM_201592chr421262 43 ------
NM_201599chrX11218 ------
NM_201624chr13485 281 274 ------
NM_201995chr111719 ------
NM_201998chr111784 ------
NM_203303chrX1213 ------
NM_203305chr912436 1866 1820 --
NM_203350chr111749 ------
NM_203351chr1712496 --11926 --
NM_203399chr11209 ------
NM_203401chr11209 ------
NM_203434chr92945 283 ------
NM_203437chr21249 ------
NM_203446chr2123013 687 ------
NM_203459chr142567 2263 752 572 --1667 --
NM_203464chr111045 --167 --
NM_203487chr1351711 1186 681 479 411 11115 ----
NM_203494chr151133 ------
NM_205768chr132056 1662 210 2755 661 ----
NM_205846chr53383 318 127 ------
NM_205848chr121881 198 1670 ----
NM_205861chr122136 106 --11628 --
NM_206594chr122309 958 --13272 12628
NM_206595chr122309 958 --13272 12628
NM_206852chr142297 243 ------
NM_206853chr624015 1212 ------
NM_206854chr625276 1158 --1143 --
NM_206855chr636241 4075 2123 --11108 --
NM_206857chr142297 243 ------
NM_206876chr221104 360 ------
NM_206886chr1152 125 ----
NM_206909chr845729 2898 509 26 22240 657 ----
NM_206914chr1212080 --1133 --
NM_206943chr22661 263 ------
NM_206944chr91136 ------
NM_206945chr91136 ------
NM_206946chr91136 ------
NM_206947chr91136 ------
NM_207304chr132517 51 ------
NM_207311chr1211184 --1302 --
NM_207361chr1334184 780 318 14464 ----
NM_207371chr1021526 1132 ------
NM_207404chr342120 739 274 223 ------
NM_207406chr456483 4546 4275 2113 1199 26499 621 ----
NM_207435chr122966 28 ------
NM_207660chr1421343 197 21573 1420 ----
NM_207661chr1421343 197 21573 1420 ----
NM_207662chr1421343 197 21573 1420 ----
NM_213589chr274485 4094 1305 984 316 274 80 1763 ----
NM_213594chr121316 ------
NM_213611chr12--148 ----
NM_213618chr112710 254 ------