TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3065-5p
miRNA Sequence: UCAACAAAAUCACUGAUGCUGGA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr541650 1328 133 65 --1743 11698
NM_000112chr585555 4576 3586 1695 1685 837 689 491 ------
NM_000168chr752777 2278 1320 466 68 ----1953
NM_000264chr983283 3141 2992 2978 2254 677 530 159 ------
NM_000332chr696179 5386 5228 4769 4372 2531 2481 2469 1854 --14352 --
NM_000346chr1741941 1902 117 104 --11386 11396
NM_000430chr1741514 1089 979 592 13222 13717 13175
NM_000618chr1296033 5096 4869 4406 4393 1961 1721 922 453 34848 4569 4358 ----
NM_000618chr1296033 5096 4869 4406 4393 1961 1721 922 453 34848 4569 4358 ----
NM_000633chr18105197 5187 5015 4964 4939 4897 3438 2011 1838 385 --14011 --
NM_000809chr4108918 8672 8586 8273 7906 6262 2065 1644 941 628 --12124 --
NM_000875chr1596816 6534 6436 6287 5476 4877 4598 1679 1286 ----11120
NM_000959chr173961 2931 2692 2626 2570 652 519 --12971 --
NM_001001419chr565205 4285 3229 2035 1013 167 --25074 3521 --
NM_001001420chr565205 4285 3229 2035 1013 167 --25074 3521 --
NM_001001481chr853090 1251 1041 995 974 32561 1318 1264 21257 710 --
NM_001001890chr2193747 3655 3424 3390 3368 3315 1647 865 685 --23413 3259 --
NM_001003652chr1877977 6935 6341 5446 2804 672 662 38476 6773 5546 25539 2292 12873
NM_001003674chr1897012 6626 6540 5577 2694 1983 777 473 136 --36350 5521 4923 --
NM_001003675chr1897012 6626 6540 5577 2694 1983 777 473 136 --36350 5521 4923 --
NM_001006610chr164973 900 854 326 1315 1295 --
NM_001007257chr131050 1001 949 --51465 1402 1192 536 390 --
NM_001007466chr6104930 4714 4606 4500 4064 3493 1584 1578 1572 1438 --21560 1547 --
NM_001007559chr1841621 1614 1607 1601 --12048 --
NM_001008239chr18103711 3470 3316 3123 3070 1351 1345 1330 1314 666 --13460 --
NM_001008660chr1151540 1498 1370 1297 1269 ----11475
NM_001009899chr366298 5176 4000 1765 1127 1114 1346 14818 --
NM_001010891chr5106240 5927 5492 5088 4525 2667 2533 2265 1377 39 --14360 --
NM_001010923chr651534 1497 1075 401 236 ----11127
NM_001012393chr11104568 4110 3583 2069 1592 146 138 132 121 97 ------
NM_001012968chrX32739 2545 2447 22747 611 1913 12247
NM_001015877chrX93024 2936 2888 2631 2483 2471 1932 342 154 ------
NM_001017930chrX61345 1332 1233 1220 170 119 ----1209
NM_001018089chr1573921 3903 3179 2689 2631 608 433 13989 13348 --
NM_001018090chr1542283 1920 918 648 190 1641 --
NM_001018091chr1542393 2030 1028 758 1200 1751 --
NM_001018102chr1542283 1920 918 648 190 1641 --
NM_001024649chr572952 2824 2635 2163 655 520 286 ----12003
NM_001025076chr1096170 5874 3978 1888 1571 1499 1280 1258 1233 --25466 4481 1839
NM_001025077chr10147528 7232 5336 4708 4614 2929 2857 2638 2616 2591 1081 648 252 203 --46824 5839 4733 1351 22197 1146
NM_001030055chr1473699 3079 3071 2882 1237 982 399 --1929 --
NM_001032380chr1051460 560 285 250 154 --21996 498 1374
NM_001037165chr7128940 8921 8898 8857 8341 8334 7650 7327 7312 6592 1162 582 --17320 --
NM_001039395chr942336 1663 472 244 1172 31997 463 91 --
NM_001039585chr174218 3188 2949 2883 2827 909 776 --13228 --
NM_001039618chr1111560 24898 984 34132 1614 1002 24884 2053
NM_001039937chr1373806 3258 2678 1578 651 499 101 --1720 --
NM_001040284chr1665560 5365 2144 1933 685 550 22173 1219 12135 --
NM_001042404chr161975 1949 1476 1411 727 422 ----1583
NM_001106chr3129582 9349 8096 7212 3246 2647 1623 1501 1009 531 346 70 --28723 3774 --
NM_001160chr1282629 2114 1967 1902 583 435 259 102 --1609 --
NM_001173chr1473699 3079 3071 2882 1237 982 399 --1929 --
NM_001201chr441430 1324 186 106 --13072 13923
NM_001204chr276661 5042 4709 502 477 216 194 --27419 6418 --
NM_001241chr241855 1631 955 109 21597 1560 31905 947 448 --
NM_001241chr241855 1631 955 109 21597 1560 31905 947 448 --
NM_001259chr7116164 1363 1332 1100 971 965 945 755 546 232 212 --2952 933 --
NM_001332chr581388 1135 1100 493 481 399 98 72 ------
NM_001412chrX83270 1149 1143 1136 1130 203 126 108 2944 714 --12372
NM_001650chr1843551 1286 930 83 12858 1110 21099 1019
NM_001690chr352176 1877 655 184 137 --12185 11994
NM_001695chr872859 1125 932 836 627 378 317 ----12666
NM_001709chr1172578 2537 2258 2172 887 580 554 --1248 --
NM_001746chr572952 2824 2635 2163 655 520 286 ----12003
NM_001754chr2193747 3655 3424 3390 3368 3315 1647 865 685 --23413 3259 --
NM_001759chr12114293 3514 3479 3357 2042 1881 1662 1516 1364 1334 72 --13402 --
NM_001858chr665000 3543 3535 3423 1571 663 ----23613 1935
NM_001949chr663179 2790 2784 2377 2216 651 --22830 2806 12229
NM_001987chr1264172 2962 722 331 325 319 ------
NM_002006chr495521 4870 4429 3769 3555 2254 1554 1188 62 ------
NM_002024chrX61729 1400 751 745 290 71 --1757 --
NM_002025chrX109149 6930 5764 5754 5707 2567 1161 661 131 114 --39196 9139 1791 13309
NM_002040chr2182553 2541 2420 2323 1012 910 839 829 --11277 --
NM_002092chr4114964 4841 4156 4150 4144 1886 1880 771 292 270 230 --11617 --
NM_002128chr1351843 471 357 270 113 ----32284 960 422
NM_002158chr233841 3593 492 --22634 511 1787
NM_002270chr585116 4932 3855 3513 2137 2112 1587 1418 ------
NM_002395chr621219 372 --1458 1362
NM_002545chr11104568 4110 3583 2069 1592 146 138 132 121 97 ------
NM_002737chr1786649 6463 5392 4713 4312 4281 4275 1199 ----16199
NM_002821chr65794 788 782 765 753 ------
NM_002834chr1263475 3371 3311 3296 406 276 --13230 13401
NM_002886chr373751 3622 1274 1249 940 934 776 --13191 --
NM_002890chr55923 838 824 746 696 ----1656
NM_003030chr381816 1736 1730 1724 1632 1607 1588 1366 ------
NM_003031chr164973 900 854 326 1315 1295 --
NM_003034chr1267272 6391 5279 3169 833 42 25506 1925 --26368 567
NM_003199chr18145042 4234 4228 4222 4211 4200 4124 3921 3908 3681 2003 818 699 691 --21320 466 12222
NM_003247chr671656 1407 1386 1380 1374 1257 297 --21626 1396 --
NM_003468chr254326 4124 651 471 55 --1279 14201
NM_003566chr12103450 3040 3033 2683 2605 2538 1021 683 619 408 --1420 --
NM_003574chr1885624 4322 4194 4046 1930 1917 816 62 1533 ----
NM_003590chr293484 2751 1268 1258 931 686 598 329 257 ------
NM_003607chr164204 3863 3493 3246 2979 478 ----11170
NM_003759chr452787 352 208 196 190 --2828 175 --
NM_003831chr1831749 1572 1377 --11579 1579
NM_003955chr1751404 1299 1293 1287 1281 ------
NM_004028chr1843551 1286 930 83 12858 1110 21099 1019
NM_004061chr53630 259 246 --1252 --
NM_004124chr1483556 3224 3052 2569 2518 806 289 107 ------
NM_004338chr1897012 6626 6540 5577 2694 1983 777 473 136 --36350 5521 4923 --
NM_004454chr352159 2132 765 737 75 --11900 1413
NM_004457chr211581 21219 488 1503 11396
NM_004464chr454271 421 411 401 133 --11262 --
NM_004480chr143523 517 511 ------
NM_004504chr241206 1166 1109 1099 ----13034
NM_004627chr213520 135 80 ----2538 124
NM_004685chr1342217 728 577 546 --12764 12105
NM_004719chr1232689 658 145 1761 11836 1726
NM_004726chrX75240 4389 4065 3537 1837 1698 1082 25693 1591 1918 --
NM_005160chr2275980 5660 5606 4304 1395 1383 1144 15886 ----
NM_005197chr14115754 5288 4017 1545 1524 1518 1511 1505 1499 174 150 ------
NM_005238chr1143474 2861 663 560 --22828 2196 13093
NM_005339chr433649 2933 381 --24012 3193 1334
NM_005497chr1786074 4725 4711 3769 1568 1389 986 440 25783 284 ----
NM_005596chr954751 3998 1945 475 357 --25169 4283 12396
NM_005637chr1841621 1614 1607 1601 --12048 --
NM_005665chr194225 1651 1624 1445 1039 954 497 423 79 ------
NM_005839chr17912 895 758 688 679 364 334 --1100 --
NM_005841chr45279 79 73 67 61 --1766 --
NM_005901chr1877977 6935 6341 5446 2804 672 662 38476 6773 5546 25539 2292 12873
NM_005903chr565205 4285 3229 2035 1013 167 --25074 3521 --
NM_005935chr4105213 4566 3957 3650 3643 3515 949 600 497 78 ------
NM_006007chr994527 4144 3800 3629 3276 2841 756 162 32 ------
NM_006047chr2073518 3455 2214 1023 579 435 307 --1622 --
NM_006106chr1173444 3364 2205 736 727 705 396 --22911 716 --
NM_006251chr563274 1343 1278 970 503 414 --22611 195 --
NM_006252chr187382 6981 2907 2873 1382 1319 1229 1012 17281 12351 12723
NM_006561chr1096170 5874 3978 1888 1571 1499 1280 1258 1233 --25466 4481 1839
NM_006599chr1698148 5625 2409 2160 1707 1686 1656 374 167 11571 13126 --
NM_006614chr343467 3397 2534 1089 11185 --1572
NM_006620chr634086 3757 666 ----23393 3376
NM_006777chrX42526 1886 1069 29 ----1139
NM_006815chr1251194 953 539 328 305 ----1430
NM_006884chr381816 1736 1730 1724 1632 1607 1588 1366 ------
NM_006885chr16154062 3852 3314 2969 2902 2896 2890 2686 1618 1502 1419 867 601 582 525 --24170 3802 --
NM_006922chr282397 2047 2041 1856 1793 1581 625 373 ------
NM_007106chr1342574 1765 974 718 ----21908 215
NM_007166chr1151540 1498 1370 1297 1269 ----11475
NM_007249chr13119465 8175 8012 7212 7199 3415 1690 689 668 648 322 18047 38111 1681 1158 17775
NM_012120chr652942 2367 786 173 98 --11929 12535
NM_012141chr1373806 3258 2678 1578 651 499 101 --1720 --
NM_012214chr286271 5412 5274 4594 4450 2254 171 40 --35706 4643 2570 --
NM_012234chr393524 3412 3346 2893 2320 1203 1111 335 329 --23351 341 --
NM_012382chr584485 3937 3639 1633 1543 1387 1285 357 13990 ----
NM_012388chr1552955 2045 2024 590 431 ----12938
NM_012395chr743349 2903 2177 301 ----12610
NM_012464chr452837 1848 1076 924 271 1939 1907 --
NM_013229chr1282629 2114 1967 1902 583 435 259 102 --1609 --
NM_013255chr798870 8629 8187 7819 6290 5720 2103 2056 403 ------
NM_014112chr885398 2068 2057 956 715 430 410 139 ----13681
NM_014155chr1187544 7040 6517 5328 2078 2027 1176 298 15880 ----
NM_014181chr282704 2191 791 482 476 470 464 457 1514 ----
NM_014243chr431414 322 176 --12127 1678
NM_014333chr1141853 469 309 212 22509 2141 1318 --
NM_014423chr535206 5182 136 24752 3647 35289 4760 868 --
NM_014615chr1652630 1359 916 890 512 --1921 13585
NM_014705chr721326 547 11528 11332 11941
NM_014812chr161975 1949 1476 1411 727 422 ----1583
NM_014826chr164204 3863 3493 3246 2979 478 ----11170
NM_014836chr1051460 560 285 250 154 --21996 498 1374
NM_014877chr17107731 6574 6270 5905 5712 4810 2997 802 593 101 ------
NM_014904chr1043711 2534 862 656 ----1906
NM_014999chr1251417 1159 239 229 218 ------
NM_015092chr1653875 3726 3361 1509 483 23777 1098 24171 3998 --
NM_015206chr1553726 3550 3390 3012 2364 --13324 191
NM_015225chr992981 2904 2777 2376 2078 1956 533 355 151 ------
NM_015265chr262619 143 96 90 83 75 --21013 173 --
NM_015282chr243004 2961 2892 1889 11956 11967 11874
NM_015291chr163460 3201 3159 2601 2337 1110 13043 22858 592 --
NM_015310chr887515 5635 5169 2901 2018 1175 745 144 1567 28298 5758 11555
NM_015313chr1174714 3364 3116 2992 870 400 34 --14165 --
NM_015315chr562904 2464 2458 2452 2446 882 ------
NM_015349chr672984 2667 983 966 296 288 167 1522 2971 512 --
NM_015532chr1542283 1920 918 648 190 1641 --
NM_015554chr1562879 2427 2421 1820 1787 548 1669 2558 540 --
NM_015866chr131050 1001 949 --51465 1402 1192 536 390 --
NM_015879chr1898222 6729 2771 2605 2544 2261 1920 1512 1420 ------
NM_016009chr123917 3783 ----24047 1099
NM_016078chr1741063 230 107 25 ----1993
NM_016090chr112904 309 ----21034 77
NM_016131chr242145 551 141 103 --11969 11598
NM_016132chr15113373 3365 3359 3151 3136 3068 1324 999 291 263 167 --21127 975 --
NM_016206chr3158383 7380 7372 7362 6459 6366 5930 5558 3412 1217 1038 601 287 251 202 1482 --16724
NM_016217chr643233 3072 2724 2229 --22675 121 13567
NM_016248chr1363899 3620 1047 1002 752 35 --23627 2992 --
NM_016260chr2107338 6822 5945 5602 2807 1279 919 863 543 473 --25757 5460 --
NM_016374chr121300 366 --11340 21485 1435
NM_016374chr121300 366 --11340 21485 1435
NM_016396chr1552993 2441 2413 702 636 ----13006
NM_016441chr282359 2353 2136 2015 1809 1729 883 869 --32070 1610 859 1904
NM_016831chr172344 2311 2096 953 775 360 186 --12084 --
NM_017447chr2184440 4298 4116 3818 3438 3160 1558 704 --22788 1440 --
NM_017628chr464847 3629 1649 1636 1629 1125 --44837 3285 1733 1064 --
NM_017633chr673908 3602 3330 2970 2617 1351 798 13460 13453 1987
NM_017637chr9129272 9250 9066 7570 3780 2936 2577 2511 2427 2310 1668 591 --63456 2197 1821 1384 1061 388 --
NM_017644chr3105224 5124 4941 4811 4684 4654 4559 4476 4441 202 --24094 475 --
NM_017650chr7106064 6026 5983 5348 5310 4293 1920 1343 1174 650 ------
NM_017709chr164149 2760 1054 1048 896 521 ----13334
NM_017758chr176114 107 100 82 76 62 --1150 --
NM_018011chr135586 207 90 84 78 ------
NM_018121chr1053055 2662 1158 979 722 --11187 11130
NM_018247chr642959 2685 2540 2397 --22938 139 1519
NM_018254chr152181 1544 914 843 295 ----1795
NM_018299chr853090 1251 1041 995 974 32561 1318 1264 21257 710 --
NM_018312chr1172209 2101 1997 1349 827 815 809 ------
NM_018362chr11123808 3563 3169 3163 3156 3091 3004 2676 2665 2649 1141 1118 --13773 --
NM_018403chr333972 1093 603 1842 22561 984 11536
NM_018440chr8128698 8522 8434 7893 7016 6989 3053 2786 2439 2314 1059 667 ------
NM_018638chr1265444 5339 2236 1716 1228 1209 23720 590 14541 --
NM_018999chr1074715 4079 3644 1912 1898 1467 752 ----24060 3269
NM_019022chr1873214 2840 2641 2261 2191 542 26 13171 ----
NM_019027chr431757 926 914 --3897 887 292 11701
NM_020245chr6104836 4620 4512 4406 3970 3399 1490 1484 1478 1344 --21466 1453 --
NM_020403chr1351588 1417 1278 1139 195 --2662 650 11095
NM_020673chr2087778 7620 7599 7147 7067 5805 1773 1442 1292 27754 7607 --
NM_020734chr12113353 3324 3129 1337 1323 1138 946 887 745 554 331 --13360 --
NM_020772chr17118391 8032 6925 6661 6098 5968 5634 5328 3244 2211 289 18680 46648 6416 6046 2843 21985 1623
NM_020774chr18166200 6118 5426 5150 4945 4570 4411 3932 3818 2175 1087 802 556 195 189 24 --1323 --
NM_020782chr1254710 3925 3886 526 193 ----1886
NM_020794chr141420 258 252 240 ------
NM_020801chr542658 2107 907 809 22172 2028 31627 887 775 --
NM_020860chr421045 276 ----2994 306
NM_020935chr2104616 4610 4380 3890 3571 3060 759 706 577 42 --1631 12834
NM_021030chr194289 264 257 250 1780 1773 --
NM_021033chr1373376 3156 3129 3107 2820 1256 682 --23117 2532 12484
NM_021038chr363322 2537 2155 2100 1267 516 --1735 12330
NM_021097chr283073 2796 1067 388 354 346 300 283 --12511 --
NM_021252chr1071970 1717 1653 1545 1347 1284 559 --21886 1878 --
NM_021813chr6135296 4284 4278 4272 2342 2232 1961 815 809 803 793 775 768 ------
NM_021964chr376330 5609 4676 4180 2142 1663 1498 --11289 --
NM_022166chr1676217 5867 5779 5767 4768 4048 4034 ------
NM_022459chr13126033 5692 5488 4931 4875 4855 2489 2430 1876 931 852 497 --1672 13917
NM_022650chr55923 838 824 746 696 ----1656
NM_022898chr1474815 4246 1863 1394 667 606 337 --24544 316 --
NM_023929chr892559 2418 2271 2261 2209 1778 1091 969 436 168 ----
NM_024345chr934273 1144 754 1472 --26151 358
NM_024408chr143698 3161 2747 2721 --1856 12930
NM_024496chr144703 660 580 562 --2627 555 --
NM_024611chr1573921 3903 3179 2689 2631 608 433 13989 13348 --
NM_024613chr8101863 1698 1675 1640 1423 715 312 286 234 92 ----1551
NM_024665chr3124645 4335 3830 3821 3454 3049 1020 1006 794 763 755 463 11649 22876 1000 --
NM_024930chr582793 2526 730 264 226 220 214 208 --2638 279 --
NM_024947chr3149508 9478 8895 8871 8706 8054 7672 7197 6670 6309 5803 3372 2335 1525 11257 29361 5888 19406
NM_024989chr2127772 7491 5911 5844 5257 5167 2172 2102 1745 1633 1619 183 13051 16502 --
NM_025191chr183402 3107 2871 2452 1423 1142 1136 986 11372 21343 1284 --
NM_030579chr1643709 1246 1061 664 --12411 11067
NM_030647chr756277 6088 5870 5769 4662 --34822 1105 279 --
NM_030755chr1462474 2387 2381 2371 262 63 --22230 758 --
NM_030806chr169413 3414 2963 1368 995 241 --22448 221 --
NM_031371chr121300 366 --11340 21485 1435
NM_031371chr121300 366 --11340 21485 1435
NM_031435chr1273207 2997 2844 2436 836 517 258 ----21409 809
NM_032160chr1854252 3484 2763 214 77 --13645 13531
NM_032199chr10103163 2729 2628 2500 2409 894 727 692 686 670 ------
NM_032373chr1085923 5386 1756 1737 1692 1222 857 46 --15317 --
NM_032410chr861144 1092 934 397 163 97 ----1917
NM_032458chrX93354 3266 3218 2961 2813 2801 2262 672 484 ------
NM_032505chr362558 2438 2230 2184 1796 1790 ----11934
NM_032521chr2043111 2981 2319 787 ----12395
NM_032884chr12293 287 --1300 --
NM_032968chrX83467 2877 1092 751 484 421 326 179 1614 3507 489 292 --
NM_032969chrX83467 2877 1092 751 484 421 326 179 1614 3507 489 292 --
NM_032973chrY83463 2872 1092 751 484 421 326 179 1614 2507 292 --
NM_033143chr454602 752 742 732 464 --11593 --
NM_033285chr864299 4072 3917 2778 1119 791 ----12786
NM_033326chr1152467 2201 2170 998 200 --22377 185 --
NM_033505chr256664 1801 1670 538 312 --35417 4164 2291 11839
NM_033551chr562904 2464 2458 2452 2446 882 ------
NM_052832chr832118 979 185 12761 1773 11951
NM_053001chr84419 337 319 306 --1312 --
NM_058241chr231755 1531 855 21497 1460 31805 847 348 --
NM_058241chr231755 1531 855 21497 1460 31805 847 348 --
NM_133496chr1104100 2904 2895 2887 1441 672 545 318 307 301 24493 519 ----
NM_138576chr1474815 4246 1863 1394 667 606 337 --24544 316 --
NM_138713chr1698148 5625 2409 2160 1707 1686 1656 374 167 11571 13126 --
NM_138714chr1698148 5625 2409 2160 1707 1686 1656 374 167 11571 13126 --
NM_138731chr1483790 3749 3627 3483 3242 629 577 526 ------
NM_138771chr761558 1552 1546 476 410 182 ------
NM_138959chr186732 6426 5762 5313 2682 1826 598 513 --25676 521 --
NM_139207chr1251472 802 788 422 154 1375 1782 --
NM_139283chr1262293 2045 1998 595 508 477 --1931 1160
NM_144571chr476415 5821 5271 2682 2149 1146 316 11201 25928 632 --
NM_144578chr1464542 4279 1739 813 676 288 --25004 4588 11204
NM_144664chr1161982 891 740 542 364 353 ------
NM_144963chr892521 2443 2175 2085 1803 1784 1689 809 377 ------
NM_144973chr1255349 4961 3637 1972 928 ----11043
NM_145055chr18103711 3470 3316 3123 3070 1351 1345 1330 1314 666 --13460 --
NM_152557chr73264 257 250 ----11367
NM_152638chr1241038 925 907 334 ----11199
NM_152756chr553779 3412 1173 1077 413 --24267 665 1197
NM_152838chr2073518 3455 2214 1023 579 435 307 --1622 --
NM_153188chr585116 4932 3855 3513 2137 2112 1587 1418 ------
NM_170606chr761697 1411 1211 289 278 95 --11769 --
NM_170731chr1172578 2537 2258 2172 887 580 554 --1248 --
NM_170732chr1172578 2537 2258 2172 887 580 554 --1248 --
NM_170733chr1172578 2537 2258 2172 887 580 554 --1248 --
NM_170734chr1172578 2537 2258 2172 887 580 554 --1248 --
NM_170735chr1172578 2537 2258 2172 887 580 554 --1248 --
NM_172071chr1177293 7210 6748 6479 6469 5722 5716 5642 2995 2988 2508 2022 1078 1024 652 255 249 --15033 --
NM_172127chr461991 1467 827 795 449 28 ----11445
NM_172128chr451947 1423 783 751 405 ----11401
NM_173214chr1698148 5625 2409 2160 1707 1686 1656 374 167 11571 13126 --
NM_173468chr485928 5333 4081 2395 2127 1631 76 66 1299 14618 --
NM_173511chr273938 3846 3745 3319 1436 1062 276 1567 11191 --
NM_173582chr11116051 5488 4680 4233 4115 2233 2201 2157 2079 2056 685 --11972 --
NM_173829chr5115865 5805 5748 5107 4964 4228 4166 1751 1688 669 40 ------
NM_174911chr883679 3600 3547 2944 1307 1275 1151 824 --13672 13784
NM_175856chr53598 59 52 --1118 1166
NM_176814chr731408 407 311 ----1329
NM_177966chr361301 361 333 327 321 307 ------
NM_178154chr143523 517 511 ------
NM_178155chr143523 517 511 ------
NM_178156chr143523 517 511 ------
NM_178157chr143523 517 511 ------
NM_181358chr1113659 3617 2880 2842 1448 1026 682 578 541 478 187 --23778 2915 --
NM_181481chr1897012 6626 6540 5577 2694 1983 777 473 136 --36350 5521 4923 --
NM_181482chr1897012 6626 6540 5577 2694 1983 777 473 136 --36350 5521 4923 --
NM_181483chr1897012 6626 6540 5577 2694 1983 777 473 136 --36350 5521 4923 --
NM_181504chr573185 1548 1516 935 919 904 779 13096 21095 888 --
NM_181523chr573185 1548 1516 935 919 904 779 13096 21095 888 --
NM_181524chr573185 1548 1516 935 919 904 779 13096 21095 888 --
NM_181861chr1282629 2114 1967 1902 583 435 259 102 --1609 --
NM_181868chr1282629 2114 1967 1902 583 435 259 102 --1609 --
NM_181869chr1282714 2199 2052 1987 668 520 344 187 --1694 --
NM_182485chr473193 2777 2533 2502 2454 861 457 13742 ----
NM_182646chr473193 2777 2533 2502 2454 861 457 13742 ----
NM_182762chr765792 4650 4321 1839 1565 308 ----15846
NM_194247chr284160 4059 3511 2785 1767 1636 1562 1387 13609 ----
NM_194434chr1885624 4322 4194 4046 1930 1917 816 62 1533 ----
NM_198225chr1051460 560 285 250 154 --21996 498 1374
NM_198268chr1113659 3617 2880 2842 1448 1026 682 578 541 478 187 --23778 2915 --
NM_198269chr1113659 3617 2880 2842 1448 1026 682 578 541 478 187 --23778 2915 --
NM_198401chr881627 1254 1137 704 627 592 408 58 --1397 --
NM_198504chr36891 883 843 73 66 57 ------
NM_198581chr277503 7149 7033 4874 4849 3003 1178 --34838 1722 1624 --
NM_199320chr432594 2471 1837 1196 1493 12898
NM_199320chr432594 2471 1837 1196 1493 12898
NM_199324chr433197 2355 264 ----2694 223
NM_199327chr45279 79 73 67 61 --1766 --
NM_203372chr211581 21219 488 1503 11396
NM_203487chr1351588 1417 1278 1139 195 --2662 650 11095
NM_206854chr664967 3262 831 506 345 87 --1836 --
NM_206855chr695932 4227 4021 1796 1471 1310 1052 365 111 1659 11801 --
NM_206907chr563274 1343 1278 970 503 414 --22611 195 --
NM_206909chr887515 5635 5169 2901 2018 1175 745 144 1567 28298 5758 11555
NM_207292chr363322 2537 2155 2100 1267 516 --1735 12330
NM_207293chr363322 2537 2155 2100 1267 516 --1735 12330
NM_207294chr363322 2537 2155 2100 1267 516 --1735 12330
NM_207295chr363322 2537 2155 2100 1267 516 --1735 12330
NM_207296chr363322 2537 2155 2100 1267 516 --1735 12330
NM_207297chr363347 2562 2180 2125 1292 541 --1760 12355