TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-30c-1-3p
miRNA Sequence: CUGGGAGAGGGUUGUUUACUCC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr5160 ----167
NM_000021chr143902 354 142 2696 135 21049 905 --
NM_000024chr52507 436 ------
NM_000033chrX5944 853 740 184 110 ------
NM_000037chr862515 1966 1824 921 758 613 11748 42457 2196 2170 927 2791 432
NM_000063chr62205 100 --2281 103 --
NM_000075chr123230 188 45 ------
NM_000080chr174628 609 270 213 --2228 23 --
NM_000081chr141521 1306 434 320 --1286 --
NM_000084chrX136728 5864 5856 5809 5412 5370 1997 1805 1772 1557 1095 723 204 34359 2648 1164 25867 819 14226
NM_000088chr1781288 1221 1210 1171 1127 419 47 31 21268 408 --1162
NM_000089chr7197 1626 1708 --
NM_000092chr263958 2970 1228 882 865 140 24608 204 ----
NM_000093chr9102189 2127 2114 1906 1556 967 726 413 116 106 22278 24 ----
NM_000109chrX1848 ------
NM_000110chr111045 ------
NM_000115chr1322315 276 11870 ----
NM_000125chr673160 2711 899 772 729 237 85 23599 3572 24024 1230 --
NM_000129chr641178 974 253 209 1219 1482 11422
NM_000138chr153988 304 66 11615 22424 1848 --
NM_000141chr1061119 1036 498 245 182 77 1944 ----
NM_000163chr542000 1835 1729 1592 11761 11942 1140
NM_000167chrX--31465 1325 25 2687 338 --
NM_000168chr772830 2639 2329 768 502 443 426 22808 2115 32172 973 202 12433
NM_000170chr93477 214 43 --180 --
NM_000176chr543458 3220 1170 1101 --13388 1635
NM_000188chr10270 43 --2696 192 --
NM_000192chr123569 363 310 1983 ----
NM_000202chrX123296 2697 2673 2612 2532 2521 2451 2426 1562 1526 232 43 12770 23255 1026 --
NM_000208chr1964537 3949 3554 1574 755 37 --44119 3522 1400 517 --
NM_000212chr1771966 1926 638 546 482 408 290 1850 2902 742 --
NM_000216chrX73823 3150 1433 789 568 315 78 --1116 --
NM_000217chr12125222 5175 4935 4415 4062 3819 3654 3352 2104 1958 1854 640 --54188 4178 3662 3454 1783 --
NM_000222chr431589 1382 55 21990 209 ----
NM_000232chr442672 2394 2376 2194 22542 2409 --11156
NM_000237chr831520 710 364 --11206 --
NM_000248chr332396 2021 1928 22361 779 ----
NM_000259chr1595024 4627 4546 1933 1914 1012 906 366 143 --56372 4161 2484 2417 2249 35745 5441 115
NM_000264chr963360 3342 2216 902 896 821 --11175 --
NM_000266chrX4993 252 202 196 1265 1114 --
NM_000267chr17122944 2862 2667 2589 2426 2162 2140 1121 952 882 385 80 --12749 --
NM_000268chr22153707 3682 3473 3467 3187 2876 2858 1383 1304 1122 984 784 253 128 38 53025 2993 2891 1398 1017 1200 --
NM_000276chrX62129 1447 855 784 353 300 ----12173
NM_000278chr10132223 2002 1890 1712 1659 1639 1624 1608 862 855 806 561 110 --1840 --
NM_000280chr111687 ------
NM_000281chr10289 28 1104 1320 --
NM_000284chrX61712 1461 1285 653 282 115 --11564 --
NM_000303chr1691321 1266 587 511 308 234 171 149 78 11454 1950 --
NM_000304chr172878 416 ------
NM_000310chr131243 991 882 --1506 148
NM_000314chr1032425 921 281 ------
NM_000319chr123370 249 69 ------
NM_000321chr1311279 --279 54 2456 262
NM_000322chr631077 128 66 21163 26 --21596 99
NM_000330chrX31508 651 440 ----11526
NM_000332chr6156711 6511 6211 6168 5952 5676 4761 2868 2325 1970 661 609 509 325 34 1915 36128 2429 1165 --
NM_000333chr32395 165 ----1106
NM_000334chr17132087 2032 1937 1904 1896 1868 1799 1784 1760 714 673 413 178 --21787 1750 --
NM_000335chr391771 1567 846 787 733 655 631 527 485 21872 1612 11536 --
NM_000345chr41867 --1127 --
NM_000346chr1751965 1946 1919 359 143 ------
NM_000353chr1641082 416 200 145 1844 --1979
NM_000361chr207752 571 559 521 466 448 194 11405 ----
NM_000362chr22153422 3126 2937 2268 1424 1394 1248 1214 832 823 414 399 370 353 68 23324 2909 33407 2217 388 --
NM_000368chr9104693 4367 1912 1665 715 457 376 292 286 221 21253 405 24101 1038 --
NM_000369chr1441934 1783 1636 1398 ------
NM_000378chr11--21261 126 ----
NM_000379chr22366 47 ------
NM_000386chr172229 29 ------
NM_000390chrX12478 11001 23052 937 --
NM_000393chr241934 742 466 363 12020 ----
NM_000394chr212431 81 --1420 --
NM_000399chr103195 169 101 132 ----
NM_000404chr31136 ------
NM_000408chr242374 1128 665 526 1951 ----
NM_000411chr2172454 1304 1229 1196 667 253 232 22150 531 11309 --
NM_000412chr31263 ------
NM_000423chr121171 --146 132
NM_000424chr12--128 1226 1268
NM_000427chr1173 1196 ----
NM_000428chr1482632 2223 1777 1745 1018 990 895 139 2498 309 1142 --
NM_000430chr1753723 3431 3307 3096 838 22947 821 13063 --
NM_000435chr199867 746 297 281 261 250 218 179 75 1968 ----
NM_000439chr582557 2272 2058 763 736 186 136 43 22126 2019 21615 814 21832 1569
NM_000445chr85769 306 225 90 48 196 1774 --
NM_000448chr1152497 2006 1012 389 44 33105 573 149 32709 2669 71 --
NM_000449chr141063 942 536 115 11359 ----
NM_000450chr141474 326 222 78 --21466 684 1270
NM_000452chr1331968 1760 1312 11716 21771 1518 1732
NM_000458chr175917 744 631 194 166 --2681 226 --
NM_000461chr354279 2888 1232 1154 291 1586 44362 1140 792 525 1880
NM_000462chr1511286 11155 --1411
NM_000474chr71230 ------
NM_000484chr212293 200 ------
NM_000488chr1275 27 ------
NM_000489chrX63065 2477 1026 795 265 172 --42826 1099 778 124 12919
NM_000500chr65397 371 156 53 41 ------
NM_000503chr821716 1327 --11506 --
NM_000505chr5123 ------
NM_000508chr43824 327 288 ----2728 629
NM_000516chr202235 116 ------
NM_000522chr71217 ----3913 840 141
NM_000523chr261175 866 474 387 268 136 1759 ----
NM_000530chr12358 268 ------
NM_000533chrX111706 1611 1485 1440 1382 762 475 348 309 175 162 1258 171 --
NM_000539chr351514 1439 1228 492 433 2982 266 31014 518 41 --
NM_000542chr27695 609 327 251 169 129 76 ------
NM_000544chr6_cox_hap1103123 2745 2444 2428 2400 2250 1152 1004 919 73 23235 1088 33285 2476 1291 1747
NM_000546chr1751132 1022 128 49 37 ------
NM_000555chrX247651 7629 7546 7010 7002 6996 6977 6107 5625 5608 5576 5020 5002 4934 4854 3137 3085 2776 2701 2052 1960 710 340 176 47820 5902 5178 2595 37125 6669 2406 15035
NM_000557chr202363 22 ----1353
NM_000567chr14897 104 80 32 2965 827 1891 --
NM_000598chr721508 1354 --11258 --
NM_000599chr2184477 4313 4102 3984 3562 3482 3468 3188 3163 2993 2856 1169 1022 638 612 565 36 23 23744 2919 53471 3247 831 553 497 11123
NM_000602chr781179 1015 616 600 342 311 301 171 ------
NM_000609chr1062918 2665 2079 1267 708 454 12849 32993 2731 2209 11217
NM_000610chr1172545 2179 997 819 416 335 249 12119 21930 358 --
NM_000615chr1172902 2418 1845 1063 892 584 187 --12421 --
NM_000618chr12116346 5835 5641 5399 5114 4659 4256 4222 2465 2007 130 45548 2620 1067 298 22332 2027 15789
NM_000618chr12116346 5835 5641 5399 5114 4659 4256 4222 2465 2007 130 45548 2620 1067 298 22332 2027 15789
NM_000619chr12--1486 ----
NM_000620chr12102011 1893 1867 1534 1503 739 504 410 246 126 12027 21908 1432 1722
NM_000633chr1855043 4824 3419 3378 3193 24057 835 11670 --
NM_000635chr1961579 1051 453 447 198 136 ------
NM_000668chr421176 1152 --31364 1170 1146 --
NM_000679chr52517 26 1439 ----
NM_000684chr105810 435 425 316 39 ------
NM_000689chr93407 346 48 ------
NM_000693chr1551202 422 252 161 154 --11575 --
NM_000700chr91196 ------
NM_000719chr12166315 6225 5705 5673 5531 5200 4446 4420 4302 2506 2146 2136 1908 611 457 407 15782 45002 2632 791 253 --
NM_000721chr182683 2525 2330 2090 1891 1675 435 313 --32121 2084 36 --
NM_000723chr1791639 1251 496 448 362 289 275 167 106 11406 2433 258 1370
NM_000724chr1021435 1240 --11386 --
NM_000725chr125940 640 332 264 216 ------
NM_000726chr21976 1955 21064 316 --
NM_000738chr115940 902 843 181 113 ------
NM_000739chr7171 --1589 --
NM_000757chr17893 741 333 323 299 255 36 ------
NM_000767chr1941424 1412 1396 327 31152 1121 477 21070 1004 --
NM_000773chr10----1121 --
NM_000793chr14124940 4926 4538 4026 3920 3340 3314 1452 1326 1142 890 555 31607 1275 442 23395 3369 14621
NM_000795chr1161119 942 932 923 265 35 ------
NM_000800chr51358 1671 11346 --
NM_000801chr203942 200 190 ------
NM_000806chr531628 1282 74 ------
NM_000809chr4147655 6854 5762 5694 3604 3580 3551 3199 2645 1630 1541 1181 756 578 36543 6119 2589 38214 6341 376 --
NM_000810chr15139 ------
NM_000811chr51674 --1284 --
NM_000813chr544330 1630 507 369 25021 1188 12132 --
NM_000814chr1583940 3928 3914 3595 3398 3253 1240 955 13889 ----
NM_000817chr241062 294 240 42 ------
NM_000818chr102527 475 1368 ----
NM_000826chr441861 959 605 164 ----198
NM_000827chr551920 1842 1833 1592 429 21872 912 32003 1805 1615 --
NM_000831chr1156059 6043 5946 5925 5531 5491 5294 5232 4116 1806 1627 1156 394 296 168 --2375 266 --
NM_000833chr1671387 1283 1266 1158 1122 1010 557 --1172 --
NM_000834chr1281297 897 267 242 215 207 187 99 ----1406
NM_000836chr194939 742 654 313 --1636 --
NM_000837chr85364 210 166 132 92 1531 ----
NM_000838chr642589 1016 627 564 --21094 47 --
NM_000839chr31339 ------
NM_000849chr143017 2231 2144 202 --12988 13111
NM_000855chr111338 ------
NM_000864chr12959 822 --2825 795 --
NM_000868chrX42526 300 288 256 ----1843
NM_000870chr55998 630 559 401 238 ----1225
NM_000872chr1061373 1323 1078 555 312 147 --1489 --
NM_000875chr15216448 6003 5873 5842 4749 4418 4326 2606 2156 1854 1726 1582 1486 1405 1396 1337 956 610 333 325 295 --45957 4616 959 813 --
NM_000876chr63448 377 70 ------
NM_000891chr1763631 3335 3286 2931 2860 586 --13601 --
NM_000899chr1234426 813 608 11254 ----
NM_000901chr4138 ------
NM_000902chr362952 2899 2280 2136 2077 1068 33123 1974 485 22914 2824 1700
NM_000917chr10----125 --
NM_000919chr5158 --1465 --
NM_000922chr1131047 170 110 197 2423 164 --
NM_000924chr1251293 1133 865 321 233 --21354 1270 --
NM_000926chr11188782 8680 8501 8254 8228 8140 7942 6761 5963 2090 1999 1573 1458 1297 1228 1126 1055 972 --73757 3436 2857 1385 1160 1045 838 47076 3115 2043 1139
NM_000933chr201315 21494 1437 11652 --
NM_000935chr321020 954 ------
NM_000944chr431693 1655 1556 ------
NM_000945chr241704 1387 1318 542 ----1180
NM_000949chr52625 110 --1962 --
NM_000961chr20133794 3728 3664 3539 3407 3186 3007 2891 2873 2488 343 270 67 53468 3335 3039 996 252 1133 --
NM_000962chr962305 2158 2061 2018 1017 933 --1182 --
NM_000965chr311287 11032 ----
NM_000966chr12101041 978 936 756 742 711 432 300 221 105 1117 164 --
NM_000971chr8--159 ----
NM_000983chr131444 1174 528 --1374 --
NM_001001132chr2161369 1337 1031 541 298 113 21254 1180 11290 --
NM_001001323chr1232873 2651 140 ----1174
NM_001001331chr332526 2311 276 --22219 1931 1254
NM_001001342chr1051298 1281 1018 979 264 11063 ----
NM_001001389chr1172545 2179 997 819 416 335 249 12119 21930 358 --
NM_001001390chr1172545 2179 997 819 416 335 249 12119 21930 358 --
NM_001001391chr1172545 2179 997 819 416 335 249 12119 21930 358 --
NM_001001392chr1172591 2225 1043 865 462 381 295 12165 21976 404 --
NM_001001395chr1222558 962 --12237 --
NM_001001396chr1183983 3949 3825 3543 3460 3428 3200 3069 2911 1795 1784 1754 1514 948 860 618 603 304 13883 1768 --
NM_001001433chr2022647 2555 13052 21071 43 22830 2390
NM_001001436chr16174 1735 ----
NM_001001481chr843419 3151 2232 22 ------
NM_001001484chr102498 298 ----12425
NM_001001502chr53390 108 91 ------
NM_001001523chr151203 846 539 424 28 1920 2245 87 --
NM_001001549chr762150 2021 2004 1792 604 530 1582 12009 --
NM_001001550chr762150 2021 2004 1792 604 530 1582 12009 --
NM_001001552chr12330 315 ------
NM_001001555chr762150 2021 2004 1792 604 530 1582 12009 --
NM_001001557chr872227 1520 1495 661 554 277 172 ----11681
NM_001001560chr226748 718 611 534 158 127 ------
NM_001001664chr242647 2562 1114 1052 --1362 --
NM_001001684chr1752351 1793 869 327 226 32136 1787 1700 1790 --
NM_001001701chr452185 2137 1486 667 634 193 ----
NM_001001740chr1195 ------
NM_001001740chr1195 ------
NM_001001890chr21124174 4086 3993 3478 2982 2942 2855 2824 2812 2798 2786 746 --13000 12840
NM_001001924chr841714 1482 1387 325 21784 1688 11355 --
NM_001001925chr841714 1482 1387 325 21784 1688 11355 --
NM_001001931chr841714 1482 1387 325 21784 1688 11355 --
NM_001001936chr102481 27 1914 11144 --
NM_001001938chr9143980 3799 3475 3461 3443 3348 3188 2615 1287 1091 980 524 290 202 2438 343 23719 3553 21442 277
NM_001001974chr1011999 12329 --12141
NM_001001995chrX2549 161 1555 ----
NM_001002009chr7128 ----1182
NM_001002010chr7128 ----1182
NM_001002026chr372284 931 522 450 336 297 39 21765 1564 2372 302 --
NM_001002032chr173595 507 61 ------
NM_001002233chr862125 1862 1824 1586 1446 114 1197 22128 1865 --
NM_001002245chr171263 ------
NM_001002246chr171263 ------
NM_001002247chr171263 ------
NM_001002248chr171263 ------
NM_001002249chr171263 ------
NM_001002252chr12265 29 ------
NM_001002255chr62355 137 ------
NM_001002265chr102684 662 --1157 --
NM_001002266chr102684 662 --1157 --
NM_001002269chr91455 ------
NM_001002295chr101827 ----1831
NM_001002811chr141589 1328 428 322 1166 --1474
NM_001002812chr141589 1328 428 322 1166 --1474
NM_001002812chr141589 1328 428 322 1166 --1474
NM_001002814chr863795 3618 3089 1446 908 114 22912 197 23629 2669 13672
NM_001002838chrX61676 693 611 440 101 77 ------
NM_001002843chr152845 346 1199 ----
NM_001002860chr1464288 2967 2922 1499 1083 551 13129 14049 11865
NM_001002909chr17102142 2073 1918 1910 1738 1716 1663 1488 594 343 1210 11593 --
NM_001002919chr2----1128 --
NM_001003406chr22133221 3179 2966 2933 2859 2853 1252 1225 698 590 452 320 190 11305 ----
NM_001003652chr18108303 7402 7384 2333 2304 2222 1002 939 748 448 16362 58496 8041 6296 2365 207 28176 6847
NM_001003674chr18226880 6466 5909 5816 5806 5619 5468 5455 4914 4705 4685 4349 2816 2665 2345 2311 2221 1796 1198 1139 1128 193 12490 --1451
NM_001003675chr18226880 6466 5909 5816 5806 5619 5468 5455 4914 4705 4685 4349 2816 2665 2345 2311 2221 1796 1198 1139 1128 193 12490 --1451
NM_001003676chr114798 643 363 260 1736 ----
NM_001003681chr2241576 1568 1489 260 --11389 --
NM_001003682chr141249 1183 535 514 ------
NM_001003694chr32566 45 --1578 --
NM_001003698chr631780 1236 1229 ------
NM_001003699chr631780 1236 1229 ------
NM_001003760chr673489 3232 2499 1090 672 526 410 1722 11114 22526 289
NM_001003792chr33447 417 74 ------
NM_001003793chr33447 417 74 ------
NM_001003800chr9113558 3387 1511 1485 1327 1301 1223 1177 1141 862 573 --21249 1108 --
NM_001003810chr42723 256 ----1621
NM_001004051chrX--141 ----
NM_001004065chr932920 517 424 --42860 1561 559 439 13646
NM_001004106chr54952 684 677 81 ------
NM_001004127chr136847 830 722 691 368 180 ------
NM_001004196chr32316 204 ----1977
NM_001004304chr1293009 2785 2413 2038 1048 929 681 488 310 32252 1285 876 12206 --
NM_001004317chr623741 624 --31644 1225 356 1572
NM_001004356chr451547 1366 1267 1048 602 ------
NM_001004358chr451547 1366 1267 1048 602 ------
NM_001004360chr221676 320 1586 21702 1433 --
NM_001004419chr12104369 4363 4333 4315 4160 4027 3699 3576 1533 441 11333 34071 560 273 11252
NM_001004439chr1531113 1012 835 1492 1464 1133
NM_001004441chr5--21376 1175 --1203
NM_001005209chr22680 100 2191 183 ----
NM_001005217chr4----175 --
NM_001005271chr1761088 994 353 304 278 185 --21081 198 1264
NM_001005273chr1761088 994 353 304 278 185 --21081 198 1264
NM_001005290chr12389 210 1486 1109 --
NM_001005335chr19------1211
NM_001005353chr121078 362 ------
NM_001005353chr121078 362 ------
NM_001005354chr122572 520 --149 --
NM_001005366chr122769 739 ------
NM_001005375chrY21396 97 11527 11183 --
NM_001005386chr22515 101 ------
NM_001005404chr17123667 3503 3373 3011 2844 1565 1277 644 542 224 177 130 163 --24289 4268
NM_001005408chr172355 147 ------
NM_001005463chr1032089 1841 862 --21048 716 --
NM_001005473chr586309 5842 5672 4694 2436 2301 338 83 24924 4838 25699 198 14336
NM_001005502chr12135037 4920 4902 4421 3442 1703 1693 1234 1173 1159 967 951 118 25075 4935 --11179
NM_001005505chr331248 458 30 --157 --
NM_001005609chrX103848 3632 3444 3026 2566 2418 807 738 602 60 33453 1424 1085 33465 3353 2488 --
NM_001005739chr22638 244 ------
NM_001005743chr1471176 1120 546 486 367 254 85 ------
NM_001005744chr1471176 1120 546 486 367 254 85 ------
NM_001005745chr1471176 1120 546 486 367 254 85 ------
NM_001005746chr21976 1955 21064 316 --
NM_001005747chr21976 1955 21064 316 --
NM_001005753chr262063 1924 1704 1476 721 666 140 11862 --
NM_001005782chr22218 28 ------
NM_001005845chr83287 216 39 --11701 --
NM_001005849chr172561 134 ------
NM_001005910chr32498 61 ------
NM_001005911chr32498 61 ------
NM_001006115chr3112687 2387 2127 1885 1749 916 877 831 722 406 196 --1686 --
NM_001006600chr52431 378 --1381 --
NM_001006605chr11907 --11179 11119
NM_001006605chr11907 --11179 11119
NM_001006612chrX1382 ------
NM_001006613chrX1382 ------
NM_001006614chrX1382 ------
NM_001006626chr7171 --1589 --
NM_001006627chr7171 --1589 --
NM_001006628chr7171 --1589 --
NM_001006629chr7171 --1589 --
NM_001006630chr7171 --1589 --
NM_001006631chr7171 --1589 --
NM_001006632chr7171 --1589 --
NM_001006636chr21679 1853 1821 --
NM_001006641chr951631 1570 1508 518 397 21198 533 1335 --
NM_001006642chr951631 1570 1508 518 397 21198 533 1335 --
NM_001006643chr951631 1570 1508 518 397 21198 533 1335 --
NM_001006657chr292964 2840 2579 2421 2254 2053 1998 911 245 --22458 236 --
NM_001006665chr14765 581 168 60 ------
NM_001006933chrX158 ------
NM_001006945chr11655 ------
NM_001006946chr251650 1460 1226 299 59 --11393 --
NM_001007023chr14124940 4926 4538 4026 3920 3340 3314 1452 1326 1142 890 555 31607 1275 442 23395 3369 14621
NM_001007024chr17134166 3735 3116 845 719 549 476 459 448 442 436 429 255 32703 741 617 13042 13462
NM_001007025chr17134166 3735 3116 845 719 549 476 459 448 442 436 429 255 32703 741 617 13042 13462
NM_001007075chr421071 38 ------
NM_001007097chr9134484 4077 4022 3873 3822 3695 3503 3339 3161 3125 3093 1900 218 11834 44532 4202 3514 3506 11960
NM_001007098chr11117 --1301 --
NM_001007102chr6--183 --11137
NM_001007156chr15111842 1686 1642 1475 1264 748 680 422 399 228 168 11766 21224 433 --
NM_001007226chr1711028 11047 ----
NM_001007227chr1711028 11047 ----
NM_001007228chr1711028 11047 ----
NM_001007229chr1711028 11047 ----
NM_001007230chr1711028 11047 ----
NM_001007237chr162146 1939 1871 589 141 50 ----1463
NM_001007246chr2111548 --11273 --
NM_001007257chr141416 1410 1043 1031 ------
NM_001007259chr21126 ------
NM_001007267chr2182 --1707 1135
NM_001007271chr1041071 374 304 189 ------
NM_001007277chr1171118 777 447 428 253 195 182 ------
NM_001007466chr6115154 4790 3877 1842 1631 1475 1184 1136 1055 478 27 24992 1835 41965 1897 1807 1109 --
NM_001007471chr9271 54 ------
NM_001007544chr12350 76 ------
NM_001007559chr1841725 1707 698 91 11875 11434 --
NM_001007794chr1----2642 584 --
NM_001008220chr5143629 3275 3132 2663 2542 1033 980 910 884 559 233 155 142 123 1202 33787 3608 553 --
NM_001008222chrX51194 1000 560 501 299 1382 21185 1059 --
NM_001008225chr71578 ------
NM_001008239chr18153715 3257 2753 2527 2505 1390 1008 786 699 661 594 426 216 147 39 12417 ----
NM_001008272chr32289 93 ------
NM_001008273chr32289 93 ------
NM_001008388chr42328 107 1412 --2211 94
NM_001008392chr372640 1439 1347 1279 832 800 23 12857 23379 2880 --
NM_001008397chr51230 ------
NM_001008405chr731813 1296 586 31540 1488 68 ----
NM_001008407chr751809 1190 677 662 40 --21336 557 21504 656
NM_001008495chr811736 ------
NM_001008541chr1031773 595 93 1196 ----
NM_001008541chr1031773 595 93 1196 ----
NM_001008564chr131121 --11449 --
NM_001008660chr1131441 1357 66 --1115 --
NM_001008701chr19162975 2946 2866 2829 2575 2503 1246 877 848 816 766 666 616 317 308 111 12781 42744 2028 325 202 --
NM_001008738chr572928 2359 2161 1909 1892 102 89 32059 1059 756 ----
NM_001008801chr1931567 1549 29 11716 11442 11582
NM_001008925chr433272 1147 602 12791 --1865
NM_001008938chr111174 ------
NM_001009183chr141520 1425 147 --
NM_001009184chr85364 210 166 132 92 1531 ----
NM_001009185chr52704 568 1737 ----
NM_001009552chr82501 400 ------
NM_001009554chr451763 1583 534 174 102 31510 980 930 11871 --
NM_001009554chr451763 1583 534 174 102 31510 980 930 11871 --
NM_001009555chr431437 711 608 --11331 11248
NM_001009566chr161412 1118 1064 379 292 256 --161 --
NM_001009571chr731557 1495 1488 --11356 21199 1117
NM_001009880chr22134545 4375 3999 3587 1942 1804 1564 1173 886 830 655 190 140 11755 34812 1253 939 --
NM_001009899chr3136267 6017 5848 5738 5022 4405 2267 1979 1552 1435 1417 871 687 54580 4565 2232 2097 1584 14435 15950
NM_001009955chr13529 134 112 1229 --1162
NM_001009955chr13529 134 112 1229 --1162
NM_001009959chr232574 1978 395 22640 482 1602 --
NM_001009960chr752837 2540 1950 1057 906 22039 919 12163 11954
NM_001009993chr2114327 4199 4110 4086 3735 3029 3011 2840 1604 1304 1034 --14363 --
NM_001010861chr142485 2049 715 152 12089 1821 --
NM_001010862chrX113100 2874 2608 2602 2493 2151 734 413 307 143 95 ----12651
NM_001010867chr1176491 6209 6182 5391 5245 4393 2633 2323 2070 1653 1597 1583 815 627 468 202 74 25703 4122 46580 5942 1392 619 25059 4074
NM_001010877chr6--1169 ----
NM_001010888chrX64080 3750 3740 3642 1580 533 34086 1255 669 ----
NM_001010891chr596955 6444 5338 5188 5170 5054 2605 2331 560 65203 4515 2757 2620 1371 349 15636 --
NM_001010895chr94698 456 390 49 1423 1183 --
NM_001010898chr1113718 3712 2655 2409 1107 1002 802 690 347 294 29 --13217 11171
NM_001010908chr101645 1592 ----
NM_001010911chr1041068 943 719 212 1309 11056 --
NM_001010924chr101332 ----1459
NM_001010934chr71385 ------
NM_001010986chrX21834 78 1403 --1429
NM_001011513chr493929 3173 2863 2855 2777 1112 1100 1057 932 --13120 13950
NM_001011546chr202811 31 ------
NM_001011658chrX71810 1674 1393 689 671 358 340 31408 704 505 ----
NM_001011663chr101290 ------
NM_001011666chr7126094 5999 5866 4760 4447 2466 1791 1574 1437 1264 680 574 35958 5054 1580 35046 1966 492 --
NM_001011705chr131270 ----1288
NM_001011708chr262792 2761 2020 1127 1104 271 137 11130 12563
NM_001011713chr14----11005 --
NM_001012264chr141633 3788 645 118 4774 737 692 244 --
NM_001012267chr931976 1714 149 11633 21456 543 --
NM_001012329chr182226 2154 2094 1734 1718 1583 1577 1538 --1660 --
NM_001012393chr11114168 3242 2045 1817 1492 1227 1013 956 887 627 293 23219 310 24339 1016 11352
NM_001012398chr161960 --1897 --
NM_001012415chr93729 640 216 ------
NM_001012420chr1532350 845 572 --171 11887
NM_001012423chr1532350 845 572 --171 11887
NM_001012426chr6233346 3290 3084 3076 2997 2843 2648 2630 2483 2127 2115 1332 1298 1175 1076 962 899 796 507 325 142 66 46 42801 2769 2663 88 11084 --
NM_001012427chr6233346 3290 3084 3076 2997 2843 2648 2630 2483 2127 2115 1332 1298 1175 1076 962 899 796 507 325 142 66 46 42801 2769 2663 88 11084 --
NM_001012454chr72135 24 1150 ----
NM_001012512chr18------1210
NM_001012513chr18------2221 30
NM_001012732chr42158 146 ------
NM_001012751chr1031751 1258 508 --21671 427 --
NM_001012755chrX184670 4572 4385 3567 3228 3074 2039 1582 1376 1290 1272 1142 1087 984 772 496 213 44 31407 1305 139 21639 1009 11442
NM_001012756chr1922443 191 32719 2687 2592 32238 982 578 --
NM_001012968chrX7735 567 529 519 397 386 347 ------
NM_001012977chrX131173 1161 1000 986 494 486 321 287 208 189 177 155 131 ------
NM_001012989chrX3268 55 35 ------
NM_001013031chr1092670 2420 2405 1340 815 697 480 250 234 2988 867 23128 1106 --
NM_001013398chr721508 1354 --11258 --
NM_001013415chr41623 ------
NM_001013438chr31702 --11015 --
NM_001013439chr31548 --1861 --
NM_001013620chr12137540 5994 5910 2931 2726 2337 1972 1733 1593 1558 1550 1020 754 66383 6048 6008 3081 2946 1421 37977 7604 3210 --
NM_001013624chr1771019 983 970 908 286 197 51 2955 163 2355 228 21028 32
NM_001013635chr1281216 1117 1054 1046 830 297 289 265 ------
NM_001013642chr171159 1107 907 715 471 465 205 1152 ----
NM_001013690chr12152460 2399 2363 2046 1741 1664 1636 1618 877 571 462 407 373 363 334 11602 32049 1746 936 --
NM_001013693chr162445 2240 890 321 258 210 22476 650 32157 735 215 --
NM_001013693chr162445 2240 890 321 258 210 22476 650 32157 735 215 --
NM_001013843chr15147 1827 ----
NM_001014283chr1321825 1451 --11946 --
NM_001014434chr12188 35 1775 1826 --
NM_001014442chr13131 1134 134 --
NM_001014797chr10267840 7730 7687 7608 7446 7235 7196 7042 5646 5477 3026 2769 2352 2341 2327 2257 1833 1791 1632 1217 1050 965 510 436 300 136 13156 22293 1461 12944
NM_001014809chr44892 756 295 135 ------
NM_001014839chr13887 840 64 ------
NM_001014841chr13887 840 64 ------
NM_001015053chr17141542 1492 1473 1265 1228 1212 1163 1041 1028 557 519 415 212 163 --21125 107 --
NM_001015877chrX13006 22228 817 11140 1524
NM_001015880chr1031368 1058 495 ----1380
NM_001015881chrX4902 458 451 268 ------
NM_001015887chr331521 621 441 ----1445
NM_001017368chr1782337 2214 1732 854 676 443 306 162 2715 113 21839 1125 1887
NM_001017371chr221086 946 --1876 --
NM_001017395chr363355 3078 2487 802 521 418 ----11436
NM_001017415chr11118 ------
NM_001017416chr11118 ------
NM_001017424chr141577 526 279 273 --1580 --
NM_001017425chr141577 526 279 273 --1580 --
NM_001017440chr7327958 7911 7613 7532 7449 7394 7388 7101 6741 6607 6422 5759 5469 3300 2838 2648 2519 2156 1917 1737 1629 1613 1601 1523 1479 1092 1062 888 848 656 181 69 27525 1828 77990 6517 6413 5583 2944 2096 737 17798
NM_001017523chr1231744 131 46 11862 21921 1616 --
NM_001017916chr1791878 1714 1702 1611 1568 1391 706 217 176 --21587 817 --
NM_001017917chr1791878 1714 1702 1611 1568 1391 706 217 176 --21587 817 --
NM_001017920chr21126 ------
NM_001017923chr1421203 30 1672 149 11412
NM_001017926chr821729 1682 ------
NM_001017930chrX1993 --31429 1070 1037 --
NM_001017962chr10----125 --
NM_001017975chr12427 111 --1171 --
NM_001017977chr12261 117 ------
NM_001017992chr53134 107 34 1592 ----
NM_001017995chr5154230 3678 3130 3049 3007 2953 1823 1625 1589 1483 1151 760 648 193 138 44570 4029 479 98 21935 372 13631
NM_001017999chr162275 2095 543 378 368 182 --11477 --
NM_001017999chr162275 2095 543 378 368 182 --11477 --
NM_001018000chr162275 2095 543 378 368 182 --11477 --
NM_001018000chr162275 2095 543 378 368 182 --11477 --
NM_001018001chr162275 2095 543 378 368 182 --11477 --
NM_001018004chr153540 530 204 ------
NM_001018006chr153540 530 204 ------
NM_001018007chr153540 530 204 ------
NM_001018020chr153540 530 204 ------
NM_001018050chr2273252 3185 2739 2702 2694 2108 767 --12604 --
NM_001018052chr2273252 3185 2739 2702 2694 2108 767 --12604 --
NM_001018054chr111235 ------
NM_001018056chr9193 ------
NM_001018064chr94283 227 215 101 130 1844 --
NM_001018065chr9185908 5853 5722 5686 5039 4896 4838 4795 3964 3887 3873 3825 2411 2010 1677 620 242 140 --35860 576 373 22262 1426
NM_001018066chr9185908 5853 5722 5686 5039 4896 4838 4795 3964 3887 3873 3825 2411 2010 1677 620 242 140 --35860 576 373 22262 1426
NM_001018070chr114235 124 47 30 ------
NM_001018072chr1231744 131 46 11862 21921 1616 --
NM_001018074chr543458 3220 1170 1101 --13388 1635
NM_001018075chr543458 3220 1170 1101 --13388 1635
NM_001018076chr543458 3220 1170 1101 --13388 1635
NM_001018077chr543458 3220 1170 1101 --13388 1635
NM_001018108chr1591827 1819 919 905 726 596 217 192 175 --1338 --
NM_001018111chr782839 2674 1274 1125 923 631 585 149 31538 545 124 23530 560 --
NM_001020658chr121385 440 ------
NM_001020658chr121385 440 ------
NM_001023567chr1531906 349 187 --2459 71 --
NM_001023587chr3126 --2374 318 --
NM_001024024chr14138 ------
NM_001024070chr14134 ------
NM_001024094chr543458 3220 1170 1101 --13388 1635
NM_001024218chr14186 ------
NM_001024226chr14937 215 48 21 ------
NM_001024227chr14937 215 48 21 ------
NM_001024228chr14937 215 48 21 ------
NM_001024401chr16172551 2433 2184 2111 2084 2072 2017 2005 1987 1928 1895 1040 1003 962 775 401 352 --21880 1095 --
NM_001024460chr651203 985 446 267 147 --11020 --
NM_001024463chr152229 129 ------
NM_001024647chr12147418 6930 6407 6048 6001 5097 5008 4848 4787 4676 2493 1954 1058 110 ----27466 2547
NM_001024649chr572773 2480 1836 914 693 528 37 1546 1859 --
NM_001024666chrX2541 180 ------
NM_001024680chr251469 1456 1379 632 601 --11156 --
NM_001024807chr195345 317 309 72 47 ------
NM_001024808chr1282748 2653 2525 2321 915 732 537 309 --2984 865 --
NM_001024845chr1145 1810 ----
NM_001024934chr62559 205 ------
NM_001024935chr62559 205 ------
NM_001024936chr62559 205 ------
NM_001024937chr177774 696 587 253 183 81 45 1203 ----
NM_001024947chr5196 ----21120 1006
NM_001024948chr122153 614 1712 12855 --
NM_001025076chr10135925 5236 5215 5000 4916 4273 4265 3959 2211 1530 1289 393 28 34164 1910 463 35003 2012 169 --
NM_001025077chr10227283 6594 6573 6358 6274 5631 5623 5317 4992 2888 2647 1751 1399 1387 1327 1211 1162 1127 1092 270 247 28 25522 1821 26361 1527 --
NM_001025079chr3112922 2708 2657 2543 2528 1511 1000 780 662 623 418 ------
NM_001025081chr1821179 1035 31251 1081 488 1480 --
NM_001025090chr1821179 1035 31251 1081 488 1480 --
NM_001025092chr1821179 1035 31251 1081 488 1480 --
NM_001025101chr1821179 1035 31251 1081 488 1480 --
NM_001025105chr521227 59 11383 ----
NM_001025108chr273290 3183 1221 881 710 629 82 44054 3194 2981 2840 11081 --
NM_001025205chr32297 90 ------
NM_001025232chr12168 --1144 --
NM_001025233chr1252706 1807 1072 1035 624 --12089 --
NM_001025252chr832672 655 378 12884 11104 --
NM_001025253chr832672 655 378 12884 11104 --
NM_001025266chr3154234 3820 3802 3286 1900 1687 1607 1513 1486 1276 741 502 488 419 158 13969 44487 4401 1957 1247 --
NM_001025366chr651703 1411 1356 606 518 --152 --
NM_001025366chr651703 1411 1356 606 518 --152 --
NM_001025367chr651703 1411 1356 606 518 --152 --
NM_001025367chr651703 1411 1356 606 518 --152 --
NM_001025368chr651703 1411 1356 606 518 --152 --
NM_001025368chr651703 1411 1356 606 518 --152 --
NM_001025369chr651719 1427 1372 622 534 --168 --
NM_001025369chr651719 1427 1372 622 534 --168 --
NM_001025370chr651703 1411 1356 606 518 --152 --
NM_001025370chr651703 1411 1356 606 518 --152 --
NM_001025579chr174983 761 478 78 ----1868
NM_001025580chrX104123 4097 3480 3205 3074 1387 378 359 332 47 --1615 --
NM_001025595chr41138 --11598 --
NM_001025596chr111143 ------
NM_001025603chr141063 942 536 115 11359 ----
NM_001025616chr461944 1733 1672 1642 621 423 --11566 --
NM_001025777chr231583 1219 379 11470 --21381 520
NM_001029835chr72355 57 ------
NM_001029858chr652997 2909 2842 2120 1299 33014 1314 1031 ----
NM_001029860chr8185 ------
NM_001029863chr622375 991 ------
NM_001029864chr2062447 2131 2023 822 371 276 2970 836 --11863
NM_001029871chr20141748 1731 1713 651 439 337 317 293 281 218 206 91 76 68 --2429 193 --
NM_001029875chr552592 2014 1169 1161 1115 --52807 2037 1199 1185 553 --
NM_001029976chr8185 ------
NM_001029998chr451314 1127 583 459 286 11189 ----
NM_001030001chr14------1329
NM_001030007chr16143731 3630 3088 2821 2714 2545 2472 1449 1228 893 267 241 232 186 33567 917 751 22837 761 --
NM_001030055chr1442972 1478 874 833 31511 1433 580 --11482
NM_001030272chr112498 420 ------
NM_001030273chr112498 420 ------
NM_001030287chr13381 164 88 1787 ----
NM_001031628chr121414 ------
NM_001031677chr53428 398 345 1392 ----
NM_001031679chr1283284 3152 2725 2425 2224 1248 357 300 --22575 2527 12498
NM_001031680chr192153 2068 2008 1918 827 658 363 344 22 1423 1368 --
NM_001031685chr1--1372 ----
NM_001031690chr7173068 2927 2405 2339 2118 2100 2087 2043 1998 1223 1189 1138 941 135 125 33 27 11148 32732 835 377 22259 437
NM_001031695chr22205266 5146 5087 5077 4996 4932 4924 4720 4607 4466 3905 3643 3399 1872 1385 949 881 828 711 602 --24504 1221 11564
NM_001031702chr3189 --2772 233 1247
NM_001031709chr10------1289
NM_001031723chr41314 ------
NM_001031732chr452894 2848 2440 726 494 --22997 1180 --
NM_001031740chr11443 1226 11133 --
NM_001031804chr16104418 4166 3986 3263 2916 1147 778 638 595 445 34086 3182 1207 ----
NM_001031812chr52944 558 1772 ----
NM_001032221chr991650 1572 1503 1493 1463 1199 520 304 58 21509 1353 1595 --
NM_001032280chr651521 1476 1180 238 27 ------
NM_001032282chr821182 73 ------
NM_001032283chr12----2952 36 --
NM_001032284chr12----2952 36 --
NM_001032288chr206585 400 393 381 284 126 21236 551 ----
NM_001032293chr171118 ------
NM_001032296chr1382845 2498 2373 2279 840 707 678 216 --2966 188 --
NM_001032363chr181978 1921 1877 1789 1661 404 367 180 31935 1903 1804 ----
NM_001032363chr181978 1921 1877 1789 1661 404 367 180 31935 1903 1804 ----
NM_001032380chr1031843 213 128 ----1529
NM_001032393chrX2776 169 ------
NM_001033025chr131250 1231 1223 --1531 --
NM_001033044chr151517 277 213 60 34 --31197 353 70 --
NM_001033045chr222737 146 14188 1702 14021
NM_001033056chr151517 277 213 60 34 --31197 353 70 --
NM_001033057chr331452 664 333 ------
NM_001033059chr642004 667 656 649 --1550 --
NM_001033081chr17694 615 455 244 197 191 66 31504 622 406 ----
NM_001033082chr17694 615 455 244 197 191 66 31504 622 406 ----
NM_001033087chr2062501 2158 2083 1254 675 28 1562 12263 --
NM_001033117chr3194300 4112 4040 3471 1616 1603 1592 1570 1494 1458 814 751 691 665 489 332 321 83 72 33700 1882 845 2545 293 --
NM_001033507chr151613 1488 709 314 33 21494 304 ----
NM_001033551chr17194071 4058 2588 1436 1280 1211 1184 1127 1090 1070 989 595 430 258 227 219 150 141 76 12672 23822 577 --
NM_001033557chr21466 ------
NM_001033561chr173831 798 772 ------
NM_001033566chr171926 ----1283
NM_001033568chr171926 ----1283
NM_001033576chr17132234 2007 944 835 775 764 520 442 243 215 197 163 69 --32298 769 445 22564 600
NM_001033578chr832167 2033 300 ------
NM_001033602chr1332430 2401 507 12323 12368 --
NM_001033723chr892517 2481 2341 1994 1742 1089 952 765 742 --1484 --
NM_001033756chr651637 1345 1290 540 452 ------
NM_001033756chr651637 1345 1290 540 452 ------
NM_001033925chr10--1663 11756 --
NM_001034025chr122350 63 1267 1916 --
NM_001034837chr53262 197 28 1746 1626 --
NM_001034838chr53262 197 28 1746 1626 --
NM_001034841chr16114779 4461 4454 4260 4211 3709 1733 1423 1165 663 376 54656 4494 4274 4139 37 23635 48 11435
NM_001034850chr531305 319 132 ------
NM_001034852chr1471986 1528 1406 1274 734 410 235 --22004 1846 --
NM_001034915chr82447 311 --1551 --
NM_001034954chr1032669 361 264 --1778 --
NM_001034955chr1032669 361 264 --1778 --
NM_001034956chr1032669 361 264 --1778 --
NM_001034957chr1032669 361 264 --1778 --
NM_001035235chr51461 --137 --
NM_001035254chr9102394 2142 1991 1883 828 663 589 227 169 78 2750 359 ----
NM_001035260chr101212 ------
NM_001035267chr121282 ------
NM_001035511chr1112111 1875 1862 1405 754 720 661 219 167 80 25 --22128 793 22143 1768
NM_001035512chr1132218 1982 1969 1512 861 827 768 326 274 187 132 96 28 --22235 900 22250 1875
NM_001035513chr1132218 1982 1969 1512 861 827 768 326 274 187 132 96 28 --22235 900 22250 1875
NM_001035521chr23736 666 204 2606 219 --1786
NM_001037131chr271273 1257 845 404 141 127 107 ------
NM_001037132chr732226 2142 72 12163 22038 651 --
NM_001037133chr732226 2142 72 12163 22038 651 --
NM_001037164chr731786 1320 202 ------
NM_001037165chr7248927 8366 7363 7087 7068 5897 5780 5762 5615 3478 3278 2898 2454 2215 2166 1786 1635 1536 1428 1249 1043 1006 274 254 47238 7102 5929 5795 12218 --
NM_001037174chr241822 604 250 172 1638 11760 --
NM_001037277chr141453 1059 455 321 --11605 --
NM_001037278chr141453 1059 455 321 --11605 --
NM_001037317chr142485 2049 715 152 12089 1821 --
NM_001037332chr552196 2170 480 284 259 42581 560 349 336 52084 586 522 364 171 --
NM_001037333chr552196 2170 480 284 259 42581 560 349 336 52084 586 522 364 171 --
NM_001037334chr182626 480 ------
NM_001037339chr131205 676 540 11473 ----
NM_001037340chr131205 676 540 11473 ----
NM_001037341chr131205 676 540 11473 ----
NM_001037341chr131205 676 540 11473 ----
NM_001037553chr21144864 4292 3383 3332 1895 1652 1266 763 654 496 311 268 253 187 1285 12078 --
NM_001037631chr22154 29 ------
NM_001037738chr51291 ------
NM_001037872chr2----1532 --
NM_001037954chr1153397 2305 2237 1346 890 ------
NM_001038493chr27569 562 309 226 208 197 108 ------
NM_001038640chr153915 644 256 --1147 --
NM_001038702chr521883 788 --22409 2183 --
NM_001038707chr182145 2019 1726 636 571 452 321 118 12009 1748 --
NM_001038707chr182145 2019 1726 636 571 452 321 118 12009 1748 --
NM_001039029chr1291857 1353 796 783 447 362 251 152 70 ----1451
NM_001039140chr203538 404 138 --1191 --
NM_001039199chr20134526 4468 4084 3849 3786 3202 3160 3151 3057 1657 1637 1177 847 13117 --1683
NM_001039348chr231033 1001 801 ------
NM_001039349chr231033 1001 801 ------
NM_001039459chr771139 883 763 471 464 295 227 130 ----
NM_001039465chr14--161 ----
NM_001039479chr1471852 1836 1657 971 809 628 29 --11702 --
NM_001039538chr252913 2716 1031 923 865 12601 11034 --
NM_001039547chr3157538 7277 7142 6355 6282 6192 6072 2701 2413 1856 1652 1299 557 294 180 42868 2735 1870 1217 13002 22925 2019
NM_001039550chr23750 180 88 ------
NM_001039577chr1124392 3763 3523 3141 2874 2813 2738 1334 1302 1285 738 699 13711 11447 11342
NM_001039580chr484524 4508 4450 4420 4381 4368 3750 3539 13718 14513 --
NM_001039590chrX43836 3207 2941 2879 --23454 3222 --
NM_001039591chrX43836 3207 2941 2879 --23454 3222 --
NM_001039618chr1175852 4632 4388 4357 2225 306 203 34837 4670 176 14753 --
NM_001039690chr1682167 2064 1814 1584 1516 490 256 209 22235 592 1449 1336
NM_001039697chr961758 1556 1407 1260 636 618 1446 11219 1308
NM_001039711chr15922 910 827 204 35 21061 88 ----
NM_001039712chr15922 910 827 204 35 21061 88 ----
NM_001039762chr1031949 281 116 ------
NM_001039771chr1491059 1032 977 954 946 889 435 219 106 --1898 --
NM_001039802chr13892 425 183 21321 1042 11312 --
NM_001039840chrX55924 4163 959 890 82 34918 548 205 14837 15069
NM_001039877chr198816 761 741 563 549 246 150 76 ------
NM_001039888chr12794 651 1618 1694 --
NM_001039916chr1251025 1019 394 114 89 1246 ----
NM_001039917chr1251025 1019 394 114 89 1246 ----
NM_001039918chr1251025 1019 394 114 89 1246 ----
NM_001039919chr1251025 1019 394 114 89 1246 ----
NM_001039920chr1251025 1019 394 114 89 1246 ----
NM_001039937chr1364132 2861 2601 2517 740 287 --13876 11498
NM_001039938chr1321507 177 11135 11193 --
NM_001039960chr1251167 482 398 303 252 --21384 81 --
NM_001040001chr64544 519 345 336 11639 1339 --
NM_001040002chr1771065 330 230 222 204 117 82 --1344 11252
NM_001040057chr721253 449 --1207 --
NM_001040100chr3182 21059 324 ----
NM_001040110chr761474 1466 753 597 576 90 --11848 --
NM_001040113chr163914 835 827 1765 ----
NM_001040134chr1941046 381 257 64 --11484 --
NM_001040142chr2181 --12018 --
NM_001040143chr2181 --12018 --
NM_001040144chr1682167 2064 1814 1584 1516 490 256 209 22235 592 1449 1336
NM_001040146chr1682167 2064 1814 1584 1516 490 256 209 22235 592 1449 1336
NM_001040151chr11113998 3927 3772 3682 3637 3230 3122 2951 1641 821 313 44308 3204 1255 827 53935 3444 3383 3000 272 --
NM_001040152chr785096 5024 4092 1970 651 476 342 94 12050 31856 1795 1385 --
NM_001040153chr13199 ------
NM_001040157chr432059 566 405 11949 32643 2211 2035 --
NM_001040158chr52426 78 ------
NM_001040159chr4179 --21379 302 --
NM_001040172chr55998 630 559 401 238 ----1225
NM_001040173chr55998 630 559 401 238 ----1225
NM_001040181chr32397 64 174 ----
NM_001040182chr32397 64 174 ----
NM_001040183chr32397 64 174 ----
NM_001040199chr32397 64 174 ----
NM_001040200chr32397 64 174 ----
NM_001040202chr452054 884 557 94 83 --11671 --
NM_001040272chr952343 1658 731 454 101 3839 293 129 ----
NM_001040284chr1645176 4734 965 953 13616 34348 3695 132 25259 4738
NM_001040402chr433133 2799 110 --22802 401 --
NM_001040409chr21675 ----1335
NM_001040429chr1342531 2244 1208 365 ------
NM_001040439chr16111427 1310 1160 1122 1013 967 925 341 258 235 202 1111 ----
NM_001040441chr183957 1937 1623 1294 1280 762 626 61 --21599 1150 --
NM_001040446chr541854 843 684 152 12113 ----
NM_001040458chr551685 608 477 355 110 --1441 --
NM_001040619chr13614 538 128 11237 31140 122 115 --
NM_001040624chr882346 2340 2265 2080 2039 1860 536 510 ------
NM_001040625chr882346 2340 2265 2080 2039 1860 536 510 ------
NM_001040626chr882346 2340 2265 2080 2039 1860 536 510 ------
NM_001040627chr882346 2340 2265 2080 2039 1860 536 510 ------
NM_001040628chr882346 2340 2265 2080 2039 1860 536 510 ------
NM_001040629chr882346 2340 2265 2080 2039 1860 536 510 ------
NM_001040630chr882346 2340 2265 2080 2039 1860 536 510 ------
NM_001040633chr71672 --1128 1775
NM_001040697chr111507 ------
NM_001040709chr1102481 2282 2087 909 817 753 539 170 77 62 21636 883 ----
NM_001040712chr922527 431 11209 22739 989 --
NM_001040715chr1671170 1029 998 991 461 427 371 --11051 --
NM_001040876chr411375 21391 262 ----
NM_001042353chr203554 473 411 ------
NM_001042357chr1051494 1048 557 226 22 --1428 --
NM_001042358chr1051494 1048 557 226 22 --1428 --
NM_001042360chr1051494 1048 557 226 22 --1428 --
NM_001042361chr1051525 1079 588 257 53 --1459 --
NM_001042363chr1051494 1048 557 226 22 --1428 --
NM_001042364chr1051525 1079 588 257 53 --1459 --
NM_001042365chr1051525 1079 588 257 53 --1459 --
NM_001042387chr1051525 1079 588 257 53 --1459 --
NM_001042388chr185354 332 273 112 33 ------
NM_001042389chr1051494 1048 557 226 22 --1428 --
NM_001042390chr1051494 1048 557 226 22 --1428 --
NM_001042392chr1051494 1048 557 226 22 --1428 --
NM_001042393chr1051525 1079 588 257 53 --1459 --
NM_001042395chr1051494 1048 557 226 22 --1428 --
NM_001042396chr1051525 1079 588 257 53 --1459 --
NM_001042397chr1051525 1079 588 257 53 --1459 --
NM_001042404chr141589 1322 373 286 --11543 --
NM_001042413chr9134060 2535 1594 1587 1136 1103 1090 1034 820 521 267 200 71 --12981 --
NM_001042424chr4102744 2290 1274 1095 1075 651 637 418 343 291 12236 12835 1372
NM_001042425chr651521 1476 1180 238 27 ------
NM_001042430chr143446 366 119 2207 183 ----
NM_001042437chr23878 679 153 ------
NM_001042473chr1011989 31471 1439 1337 1322 11664
NM_001042481chr1442180 967 447 401 --1672 --
NM_001042486chr2061245 1219 468 415 293 173 11152 ----
NM_001042492chr17122944 2862 2667 2589 2426 2162 2140 1121 952 882 385 80 --12749 --
NM_001042494chr1593639 3448 2613 2437 1249 1109 902 169 85 32772 2740 2628 13159 --
NM_001042495chr1593639 3448 2613 2437 1249 1109 902 169 85 32772 2740 2628 13159 --
NM_001042496chr1593639 3448 2613 2437 1249 1109 902 169 85 32772 2740 2628 13159 --
NM_001042497chr1593639 3448 2613 2437 1249 1109 902 169 85 32772 2740 2628 13159 --
NM_001042506chrX121183 1107 986 494 486 321 287 208 189 177 155 131 ------
NM_001042537chrX52030 1681 828 582 489 1835 1680 --
NM_001042539chr167986 357 272 266 243 152 103 1168 2945 256 --
NM_001042543chr411041 --11014 --
NM_001042555chr1284773 4168 4146 4132 3032 1845 1211 766 13192 1782 13129
NM_001042599chr2207621 7590 7062 6733 6716 6443 6327 6187 5511 5443 5160 5041 3038 2161 1911 538 349 114 79 49 26908 2812 46790 6485 5739 2528 15980
NM_001042601chr322173 37 ------
NM_001042603chr12105116 4846 4769 3279 1788 1545 619 463 418 236 1100 23970 1395 --
NM_001042604chr384328 4314 4145 3464 3080 1720 1640 1074 33553 3175 1552 ----
NM_001042632chr20102314 1981 1928 1902 1712 1663 1618 534 117 42 ------
NM_001042633chr20102314 1981 1928 1902 1712 1663 1618 534 117 42 ------
NM_001042646chr391711 1577 1388 1228 262 223 72 58 46 2340 122 ----
NM_001042669chr461944 1733 1672 1642 621 423 --11566 --
NM_001042681chr172617 2250 2154 2055 2042 827 204 --42283 1874 877 570 --
NM_001042682chr172617 2250 2154 2055 2042 827 204 --42283 1874 877 570 --
NM_001042682chr172617 2250 2154 2055 2042 827 204 --42283 1874 877 570 --
NM_001042683chr621213 718 1222 ----
NM_001042728chr12101041 978 936 756 742 711 432 300 221 105 1117 164 --
NM_001042729chr13544 401 228 --1198 170
NM_001042747chr13544 401 228 --1198 170
NM_001042749chrX1759 --11372 --
NM_001042750chrX1759 --11372 --
NM_001042751chrX1759 --11372 --
NM_001042762chr71879 --1833 --
NM_001043318chr14123196 3167 2712 1598 1273 1264 1095 1035 886 794 752 576 12870 13282 11509
NM_001043351chr131501 176 121 32014 1653 1516 ----
NM_001044305chr6--1287 21283 225 11085
NM_001044385chr263805 3706 3073 1331 1205 753 --12963 33671 1465 132
NM_001044722chr52944 558 1772 ----
NM_001044723chr52944 558 1772 ----
NM_001046chr521922 849 --32320 467 431 --
NM_001048183chr1103771 3735 3043 3024 2680 2574 1086 618 250 87 43188 2847 2815 2713 12699 --
NM_001071775chr1311708 ------
NM_001074chr4194 ------
NM_001079874chr141890 1868 1446 269 1142 1440 --
NM_001083620chr441859 958 604 164 ----198
NM_001083621chr1184605 4497 4461 4183 4032 3537 3394 3370 3352 3272 3169 2997 1393 1321 1181 990 785 775 34630 4130 660 13583 --
NM_001092chr1782191 1627 495 489 474 452 438 423 31952 131 94 ----
NM_001095chr12101687 1284 1271 1223 519 487 369 286 260 164 --1552 --
NM_001096chr172304 47 1784 ----
NM_001100108chr1148239 7851 7653 7471 6442 3120 2426 2150 1152 1097 834 793 506 337 16223 56819 3007 2201 1210 708 11616
NM_001106chr3129708 8060 8002 3644 3382 3302 3038 2960 2397 498 386 332 27479 1391 17305 --
NM_001112808chr12109 36 2100 80 ----
NM_001113490chrX62864 2700 2459 839 774 55 --33231 581 573 13376
NM_001116chr16122316 2143 2045 1244 1238 1207 972 914 796 768 615 181 --1378 --
NM_001117chr18102023 2004 1910 760 741 704 684 672 652 390 --1548 11719
NM_001121chr1011364 --1172 --
NM_001122631chr111572 --1446 --
NM_001122679chr5160 ----167
NM_001123chr102693 66 ------
NM_001126chr12935 235 ----1689
NM_001127chr226984 885 402 365 201 73 ------
NM_001128chr16143731 3630 3088 2821 2714 2545 2472 1449 1228 893 267 241 232 186 33567 917 751 22837 761 --
NM_001130chr192179 113 1640 ----
NM_001140chr174466 232 222 98 183 ----
NM_001144chr161198 ------
NM_001146chr831937 1676 103 ------
NM_001148chr452128 1501 767 749 320 1531 11814 11831
NM_001149chr101118 ------
NM_001153chr22379 128 ------
NM_001160chr1242667 2225 1867 680 41129 993 826 695 --2442 170
NM_001167chrX45896 4662 2534 400 36290 2385 2111 14606 45726 1790 1504 1175
NM_001172chr142505 143 ------
NM_001173chr1442972 1478 874 833 31511 1433 580 --11482
NM_001174chrX42303 1966 270 115 ------
NM_001177chr1251856 1512 385 301 47 1814 ----
NM_001178chr112498 420 ------
NM_001186chr2173218 2161 702 644 280 157 39 2568 443 ----
NM_001191chr2071122 944 482 453 442 379 31 ------
NM_001198chr692177 958 829 804 750 552 311 122 104 22153 2050 22228 2191 --
NM_001200chr20------1110
NM_001202chr14177 ------
NM_001204chr2135371 5215 4791 3018 1732 1488 1323 1300 1186 683 556 177 111 35320 1146 780 3892 609 578 11799
NM_001206chr992781 2199 1218 1212 1188 908 307 152 57 12350 22059 474 --
NM_001219chr741402 1396 904 640 11511 11743 --
NM_001232chr14951 891 223 110 --1132 --
NM_001238chr191336 --1119 --
NM_001241chr2--12372 ----
NM_001241chr2--12372 ----
NM_001256chr1722502 273 --22156 548 --
NM_001257chr164500 441 223 186 131 ----
NM_001259chr7106309 6217 6104 4625 1938 1190 1025 921 365 112 --24187 1128 --
NM_001260chr131242 ------
NM_001263chr42432 128 ------
NM_001265chr133336 127 94 --2210 192 --
NM_001268chr13139 ------
NM_001270chr521028 288 ------
NM_001271chr1592990 2779 2316 2225 719 648 368 306 241 --32522 739 684 11280
NM_001273chr122383 71 --1115 --
NM_001274chr11163 ----1145
NM_001275chr141271 ------
NM_001278chr10170 ------
NM_001280chr191105 131 ----
NM_001290chr43894 194 183 ------
NM_001292chr153892 202 130 ------
NM_001293chr11--135 164 --
NM_001294chr192381 89 ------
NM_001304chr1743617 3300 2496 2490 --22733 24 13304
NM_001310chr1272443 2106 2100 1239 1061 536 49 1704 12985 12489
NM_001313chr44892 756 295 135 ------
NM_001329chr101556 ------
NM_001331chr11162186 2021 1961 1860 1747 1739 1731 1111 1099 1033 941 743 623 500 299 171 1163 --2595 230
NM_001332chr5182 ------
NM_001343chr551232 1211 692 541 268 --1645 1621
NM_001347chr461261 1063 336 310 142 44 ------
NM_001351chr321370 1188 11501 ----
NM_001364chr11194601 4469 4372 4300 3962 3706 3624 3517 3313 3264 3194 3174 3122 1919 956 937 919 855 393 34347 3609 1515 63782 3760 3342 3222 2938 1550 --
NM_001380chr10158 --1995 --
NM_001386chr8132013 1785 1602 1585 900 822 781 773 766 349 330 313 73 --1175 --
NM_001387chr5103066 2925 2914 2623 2336 1241 1235 1037 917 791 12892 22123 675 --
NM_001389chr212542 166 --1447 --
NM_001390chr1822559 1127 131 1985 --
NM_001391chr1811108 ------
NM_001396chr2132711 1791 551 --2700 645 1747
NM_001397chr162021 1969 1824 1038 932 503 1162 12260 --
NM_001399chrX103848 3632 3444 3026 2566 2418 807 738 602 60 33453 1424 1085 33465 3353 2488 --
NM_001400chr1--1297 ----
NM_001401chr931289 1182 500 ------
NM_001402chr651907 1664 1629 1283 429 21439 1323 11309 --
NM_001406chr17151639 1519 1476 1158 565 534 507 465 439 416 408 374 195 172 128 11150 21129 501 11308
NM_001408chr1111497 1485 1307 1297 1287 1231 1102 403 394 382 357 1364 2601 413 --
NM_001412chrX63196 3064 2997 2955 2879 298 --43709 3533 3393 2597 --
NM_001417chr1251780 1774 1201 106 36 11747 21469 27 --
NM_001418chr111666 ------
NM_001418chr111666 ------
NM_001419chr1984125 3842 3613 3607 3147 3036 1749 1589 24730 3369 34010 1867 836 --
NM_001420chr19112880 2856 2579 2556 2522 2147 1227 1206 387 255 22 ------
NM_001421chrX51684 1444 1434 1397 1337 --21671 1262 11401
NM_001427chr771726 791 742 727 692 562 425 --11541 --
NM_001429chr223904 406 235 ------
NM_001430chr261497 660 470 310 298 60 ------
NM_001432chr483190 3166 2834 1446 1409 646 310 61 ------
NM_001438chr1133681 2880 524 476 464 447 358 320 308 301 250 219 24 --22281 853 --
NM_001439chr131250 1231 1223 --1531 --
NM_001448chrX31545 1510 503 ------
NM_001449chrX2362 118 --1134 --
NM_001451chr163976 503 122 ------
NM_001453chr671687 1259 394 384 367 361 352 1564 ----
NM_001461chr13214 188 80 ------
NM_001478chr127972 945 820 795 610 344 130 --1222 1961
NM_001482chr154773 720 116 70 1205 ----
NM_001489chr91111 ------
NM_001493chrX5505 228 212 89 48 1775 ----
NM_001495chr861033 922 907 301 287 141 --1118 1987
NM_001520chr16128 --1158 --
NM_001521chr23736 666 204 2606 219 --1786
NM_001533chr19------1211
NM_001542chr162146 1939 1871 589 141 50 ----1463
NM_001543chr5224216 4123 4083 4003 3870 3576 3265 3083 1923 1780 1570 1520 1395 1283 894 811 782 705 581 540 448 241 1915 23472 3423 33360 1810 471
NM_001555chrX247 33 ------
NM_001560chrX72550 2290 1938 1874 1762 1746 49 12231 12419 --
NM_001584chr1111025 --31105 1033 876 --
NM_001587chrX62129 1447 855 784 353 300 ----12173
NM_001604chr111687 ------
NM_001605chr16122 1104 ----
NM_001609chr1094288 4111 3671 3659 3596 3467 3397 1647 100 31780 516 388 13995 12920
NM_001610chr115779 677 517 182 32 ------
NM_001616chr233320 832 823 2868 559 ----
NM_001617chr291232 1125 958 440 423 367 252 244 38 11269 159 --
NM_001619chr1171009 975 259 233 224 107 64 --1404 --
NM_001621chr7----12537 --
NM_001621chr7----12537 --
NM_001634chr642004 667 656 649 --1550 --
NM_001642chr111294 1320 ----
NM_001643chr1------124
NM_001650chr1862696 2591 1654 613 557 60 1684 11079 11526
NM_001654chrX3395 354 335 ------
NM_001655chr1161888 1882 1771 1540 1480 460 1609 179 --
NM_001658chr14937 215 48 21 ------
NM_001659chr12142572 2539 2505 2444 2210 2078 1996 1815 1686 1070 747 416 362 274 1799 1279 --
NM_001660chr34645 512 237 201 ------
NM_001663chr1432695 288 178 ------
NM_001664chr35992 985 946 923 232 ------
NM_001668chr161520 867 596 268 133 96 --1684 --
NM_001674chr13381 164 88 1787 ----
NM_001677chr1----122 --
NM_001678chr17111775 1729 1233 1207 636 560 497 451 423 305 26 --2486 193 1207
NM_001679chr32145 71 ------
NM_001681chr12--1128 ----
NM_001682chr1222587 2365 ------
NM_001683chr332526 2311 276 --22219 1931 1254
NM_001684chr1203700 3666 3542 3260 3177 3145 2917 2786 2628 1656 1649 1512 1501 1471 1231 665 577 335 320 21 13600 1485 --
NM_001686chr12128 ------
NM_001690chr372502 2293 727 709 212 141 49 32035 876 742 11653 --
NM_001695chr853584 3117 2983 617 281 23131 1222 1134 1771
NM_001699chr1971728 1641 1372 243 118 74 29 2669 534 21750 82 --
NM_001701chr921295 82 --21335 1283 160
NM_001702chr83554 455 436 ------
NM_001706chr3----1234 --
NM_001709chr1172705 2667 2547 880 859 775 601 ------
NM_001720chr181616 875 869 796 645 635 160 144 1735 1263 --
NM_001730chr1311514 ------
NM_001730chr1311514 ------
NM_001731chr121922 --1277 --
NM_001742chr741525 1216 1205 86 --1202 --
NM_001743chr22150 90 ------
NM_001746chr572773 2480 1836 914 693 528 37 1546 1859 --
NM_001748chr1163 1377 --1943
NM_001754chr21124174 4086 3993 3478 2982 2942 2855 2824 2812 2798 2786 746 --13000 12840
NM_001755chr1621815 782 --1349 --
NM_001759chr12134927 4118 4093 3504 3436 3373 3325 2134 1414 1263 1247 1171 552 --45049 4945 3761 1646 2715 510
NM_001760chr61339 --1807 1245
NM_001762chr7----1109 --
NM_001773chr161182 1167 1154 1100 1059 64 21364 1026 2122 86 --
NM_001777chr3112922 2708 2657 2543 2528 1511 1000 780 662 623 418 ------
NM_001781chr12----191 1142
NM_001783chr19182 1387 1254 --
NM_001791chr13892 425 183 21321 1042 11312 --
NM_001792chr18--158 ----
NM_001798chr124802 733 235 41 ------
NM_001802chr163933 188 50 --155 --
NM_001806chr1952867 2528 2469 2011 550 1300 12725 11058
NM_001825chr51133 ------
NM_001829chr43874 256 226 --1794 --
NM_001830chrX83291 3068 3051 2824 2455 982 871 739 13510 13161 --
NM_001838chr176915 852 619 385 296 122 1628 136 --
NM_001839chr13661 166 88 ------
NM_001842chr91504 ------
NM_001843chr12126 178 ----
NM_001852chr15603 567 542 264 100 1641 ----
NM_001854chr11254 1240 ----
NM_001855chr93753 719 548 ------
NM_001858chr644990 3709 3189 831 13778 24156 805 1196
NM_001874chr12135037 4920 4902 4421 3442 1703 1693 1234 1173 1159 967 951 118 25075 4935 --11179
NM_001882chr51112 ------
NM_001885chr11144 ------
NM_001891chr4124 ------
NM_001892chr521227 59 11383 ----
NM_001895chr206976 779 370 362 277 55 1284 --1793
NM_001901chr61132 ------
NM_001903chr51727 --1673 1920
NM_001904chr32694 308 ------
NM_001915chr1791878 1714 1702 1611 1568 1391 706 217 176 --21587 817 --
NM_001918chr1139300 9039 8411 7693 6990 6681 6643 5967 5672 5612 3677 3322 194 37023 3076 38 --16697
NM_001921chr42158 146 ------
NM_001923chr112200 103 ------
NM_001932chr173825 790 653 ------
NM_001933chr1461013 903 462 317 187 58 1423 1284 --
NM_001935chr21978 1139 11004 --
NM_001937chr12905 118 21032 707 186 --
NM_001938chr121423 44 ------
NM_001945chr561100 1033 1003 990 143 89 ------
NM_001946chr121285 ------
NM_001949chr692133 2089 1012 1006 725 399 247 95 23 --22098 291 13048
NM_001951chr81128 1231 ----
NM_001964chr5--21199 966 ----
NM_001965chr21127 1474 --183
NM_001970chr175592 475 243 142 108 ------
NM_001973chr11272 ------
NM_001975chr126817 791 765 544 240 226 ------
NM_001977chr441182 615 377 47 ------
NM_001978chr84790 277 172 57 ----1830
NM_001981chr151735 1520 707 411 43 ------
NM_001982chr1251117 319 108 84 71 1989 3368 247 89 1209
NM_001990chr15151 139 131 119 97 ------
NM_001995chr44992 975 321 52 ------
NM_001999chr5--11338 ----
NM_002006chr495839 5437 5426 5270 4099 1752 1680 663 198 1730 35487 832 526 21466 1130
NM_002009chr1532171 1059 869 --12296 --
NM_002015chr1353061 2323 2194 2120 1321 12927 --12354
NM_002017chr1121414 1238 --1236 --
NM_002024chrX21785 880 ------
NM_002025chrX198785 8738 8350 8046 7965 7536 7518 7442 6943 6814 6683 6586 6171 6068 1892 1705 1150 1100 1050 18692 49258 7390 5693 2263 13407
NM_002026chr231021 1013 37 ------
NM_002033chr11143760 3303 3035 2776 2628 2610 1625 1238 962 905 899 338 265 73 32643 1497 379 --1802
NM_002037chr61143 ------
NM_002039chr42229 82 ----1318
NM_002045chr34352 149 56 43 --1128 --
NM_002048chr931067 896 50 2257 123 ----
NM_002051chr101827 ----1831
NM_002054chr21410 ------
NM_002055chr1771613 1592 1554 1286 1165 390 90 --1655 --
NM_002056chr2----1185 1794
NM_002062chr661590 1575 1533 549 148 74 1231 21157 213 1512
NM_002063chrX2982 236 ------
NM_002065chr151517 277 213 60 34 --31197 353 70 --
NM_002074chr131390 1345 179 ------
NM_002076chr1283142 2706 2681 2535 1116 1097 876 223 32853 2721 2224 ----
NM_002077chr942063 1518 1489 844 1514 --1542
NM_002082chr54915 647 640 44 ------
NM_002083chr14----130 --
NM_002086chr17112044 1941 1884 1853 1792 1668 604 531 375 249 135 ------
NM_002091chr18------1210
NM_002092chr484806 4790 4631 4239 3754 3219 2009 879 34646 4407 3330 13933 --
NM_002094chr163356 331 103 ------
NM_002103chr194815 773 752 263 2842 75 2993 933 --
NM_002107chr1162 ------
NM_002111chr4133512 3223 3142 2429 1301 1134 1007 701 542 535 434 284 230 12385 13588 12788
NM_002126chr1773802 3771 3590 2577 790 242 126 --31082 379 314 --
NM_002135chr123415 398 38 ------
NM_002138chr42723 256 ----1621
NM_002139chrX1607 ----1449
NM_002140chr9--11205 ----
NM_002146chr171533 21320 505 1181 1514
NM_002147chr178944 799 354 306 229 170 154 103 2820 238 ----
NM_002148chr21609 ------
NM_002157chr2--1172 ----
NM_002167chr12352 74 ------
NM_002181chr25752 289 240 118 55 1274 2683 243 --
NM_002193chr23612 563 369 --21865 61 --
NM_002199chr42736 78 --1226 --
NM_002202chr53816 772 28 ------
NM_002205chr123927 120 23 --1771 --
NM_002207chr3--1699 162 --
NM_002211chr102986 258 ------
NM_002214chr7124670 3526 3483 1894 1742 1469 1418 1269 1251 1044 644 334 33563 2047 55 22063 1074 --
NM_002221chr172888 2869 2632 1160 1008 710 551 --32668 2525 2291 12208
NM_002223chr1273943 3437 3224 3044 1536 1328 615 1519 ----
NM_002226chr142718 340 --1762 --
NM_002227chr12385 48 ------
NM_002229chr194188 160 140 59 ------
NM_002232chr17963 850 228 214 208 146 140 --1200 --
NM_002235chr1271646 1469 1230 1202 1057 670 108 --11253 --
NM_002240chr21282 32 1255 2171 59 --
NM_002241chr1133145 2341 2191 2087 1223 968 940 816 634 606 435 349 177 1420 22269 790 150
NM_002247chr1062241 1572 800 90 81 50 ------
NM_002249chr12445 60 ------
NM_002250chr19134 ------
NM_002253chr421017 995 --1208 --
NM_002254chr252053 2045 2037 1571 883 2830 650 21728 410 --
NM_002264chr3104798 4554 4464 4135 3704 3607 1936 1344 1237 1019 1686 34409 3122 486 24232 904
NM_002265chr1731053 827 305 --150 --
NM_002267chr1342157 2048 254 226 --127 --
NM_002268chr32755 555 --1764 --
NM_002270chr544209 4040 1669 1381 14014 1493 13443
NM_002271chr1351821 1814 781 582 442 --3836 629 538 --
NM_002283chr125771 297 247 228 94 ------
NM_002285chr273290 3183 1221 881 710 629 82 44054 3194 2981 2840 11081 --
NM_002293chr152618 2498 2412 497 248 --52164 1777 1111 487 218 --
NM_002294chrX162 ------
NM_002309chr22133002 2875 2778 2728 2594 2382 2245 2055 1131 847 726 714 197 11168 12444 --
NM_002310chr5125444 4677 2404 2257 1974 1883 1850 1815 1360 1048 747 504 15501 15421 --
NM_002319chr74932 301 218 33 ------
NM_002334chr11111960 1721 1606 1515 1486 1309 693 685 316 115 40 --11990 --
NM_002336chr1254820 4199 3404 2035 1231 ----1941
NM_002350chr821158 293 ------
NM_002355chr1231109 1103 28 --1571 --
NM_002356chr63254 176 41 12459 ----
NM_002359chr17143940 3893 3825 3469 3136 3050 3044 2825 1716 1613 1514 1253 119 106 1394 --13008
NM_002372chr51578 1289 1224 --
NM_002373chr1541335 1271 1089 503 --2490 271 --
NM_002374chr252913 2716 1031 923 865 12601 11034 --
NM_002375chr311624 540 368 344 226 206 82 69 54 32 25 --1167 --
NM_002381chr2--1816 --1182
NM_002382chr1441041 941 178 118 ------
NM_002383chr169809 369 349 327 301 180 95 89 66 --2768 79 --
NM_002384chr18--1396 1156 --
NM_002385chr1821179 1035 31251 1081 488 1480 --
NM_002387chr574568 4130 1268 752 416 293 209 23508 1918 34223 1271 922 --
NM_002390chr1732077 1900 275 --1104 --
NM_002395chr611020 ------
NM_002397chr521539 780 ------
NM_002399chr15----11020 --
NM_002401chr1742360 1868 1763 459 1415 2647 86 --
NM_002403chr1179 ------
NM_002404chr173688 239 135 --1337 --
NM_002406chr57944 861 833 704 356 300 93 --2372 171 --
NM_002429chr1271352 1210 1163 1097 632 359 68 2299 180 ----
NM_002430chr22112059 1934 1740 1728 994 916 825 730 723 710 43 --12114 --
NM_002442chr1271727 1592 1573 1328 1294 453 436 --31127 1114 244 --
NM_002444chrX71666 1314 643 576 499 376 56 11336 ----
NM_002448chr41596 1679 1499 --
NM_002451chr983556 3333 3296 3262 3240 3111 1199 277 ------
NM_002455chr1139 ------
NM_002465chr12131 1239 1202 --
NM_002473chr2291268 994 866 518 512 199 150 82 60 11179 ----
NM_002479chr12600 535 2489 82 ----
NM_002480chr1221417 396 ------
NM_002486chr92705 271 1599 ----
NM_002487chr151670 1711 ----
NM_002489chr72316 93 --145 --
NM_002495chr5------195
NM_002499chr1532049 1634 697 --1872 --
NM_002500chr2----1425 --
NM_002501chr19164119 3919 3729 3221 3208 2972 2553 1603 1595 1392 1214 876 869 617 551 184 1632 23241 1560 --
NM_002505chr641418 1270 483 396 ----2543 72
NM_002508chr171679 1620 1569 1271 1226 666 143 1340 11955 1306
NM_002509chr206694 682 608 295 218 173 ------
NM_002515chr1451746 1639 1606 1476 1274 ------
NM_002516chr19560 53 45 33 21 ------
NM_002518chr2------11171
NM_002519chr11----1975 11061
NM_002520chr51104 ------
NM_002522chr17103856 3149 3046 2703 1129 977 836 178 89 80 11379 32761 674 227 --
NM_002524chr13995 957 141 --2848 264 --
NM_002526chr62579 113 11758 1428 --
NM_002537chr152791 379 ------
NM_002542chr32210 61 ------
NM_002545chr11114168 3242 2045 1817 1492 1227 1013 956 887 627 293 23219 310 24339 1016 11352
NM_002546chr82237 170 ------
NM_002547chrX94015 2899 1290 1273 947 743 339 193 140 --23921 514 --
NM_002556chr1161989 1771 1454 731 302 111 31859 1844 1401 --1823
NM_002558chr1771055 1025 909 311 299 268 109 11146 1101 --
NM_002569chr1541330 1307 222 130 --11410 --
NM_002570chr156876 402 369 229 121 36 1203 ----
NM_002576chr112291 90 1229 31124 330 106 --
NM_002577chr3163521 3504 3123 2850 1613 1541 1530 1494 1010 905 895 808 792 779 760 410 12744 23715 989 --
NM_002579chr1941046 381 257 64 --11484 --
NM_002581chr9105350 3766 3683 2151 1476 1447 1229 1042 443 209 31926 263 32 35570 5063 1481 1436
NM_002585chr14290 260 132 71 --1309 175
NM_002586chr6171645 1570 1487 1298 1288 1162 1102 1089 395 375 352 318 305 239 213 67 36 --1329 --
NM_002588chr5101718 1704 1300 542 501 484 440 390 59 39 1648 21669 1397 1324
NM_002594chr2032052 707 309 1206 21595 22 --
NM_002595chr121412 11871 ----
NM_002599chr1151058 378 364 325 39 1185 --1289
NM_002600chr131205 676 540 11473 ----
NM_002601chr21326 --1197 1183
NM_002605chr15----21203 357 --
NM_002607chr731041 890 130 ------
NM_002608chr22121510 1494 1482 1401 1274 563 532 404 262 187 173 94 11526 --11245
NM_002609chr54553 437 319 61 --1268 --
NM_002610chr262362 2314 2285 1263 1250 391 2892 166 12895 --
NM_002613chr16184670 4394 3931 3924 3453 3422 3353 3256 2116 2104 1908 1862 1416 1291 1034 547 442 79 1946 34688 2019 2010 --
NM_002616chr172370 229 --3375 117 51 --
NM_002622chr59732 686 622 243 217 163 84 38 24 --1634 --
NM_002628chr341143 490 449 385 ------
NM_002636chr65429 420 89 68 43 ------
NM_002645chr1122223 883 --1753 --
NM_002646chr1112174 2156 2149 2002 1738 1480 856 797 498 183 64 21646 1513 21809 1499 --
NM_002648chr641199 947 428 222 1173 ----
NM_002649chr72475 143 1466 11141 --
NM_002651chr15887 866 837 585 321 1675 2897 336 --
NM_002655chr833913 2000 1153 ------
NM_002657chr20173656 3596 3418 3242 3184 2908 2865 2522 2493 2466 2372 1545 1361 1144 801 681 287 1482 33166 1301 852 --
NM_002668chrX4337 100 85 22 --1149 --
NM_002669chr4122 ------
NM_002670chr321540 1461 --11251 --
NM_002677chr822086 61 22584 669 ----
NM_002698chr19172716 2599 2526 2377 2351 2341 2321 2300 2281 2262 1185 1141 1033 1015 319 188 178 12118 12607 12355
NM_002699chr13529 499 428 --1502 --
NM_002705chr162279 82 --148 --
NM_002709chr243207 3201 507 443 ------
NM_002710chr121126 ------
NM_002713chr13885 263 121 1414 21112 284 --
NM_002714chr66982 890 857 131 98 91 --1974 --
NM_002715chr52914 339 ------
NM_002716chr11133625 3521 3507 3495 3449 3400 3091 2835 2777 872 723 405 193 1759 52496 2281 2237 1451 1433 1255
NM_002718chr362693 2568 1865 896 368 215 2621 240 11641 --
NM_002719chr1452120 1760 1705 613 181 12112 --1319
NM_002725chr1184401 4265 3901 3845 3799 3331 2686 1353 1298 1278 1240 1194 1111 605 463 301 251 82 --33584 998 101 --
NM_002726chr61171 --153 --
NM_002730chr19101267 1256 1249 1193 1164 924 912 276 247 235 --1227 --
NM_002731chr152347 682 660 276 256 12624 32962 775 262 --
NM_002734chr1741527 914 74 30 --11538 --
NM_002740chr352347 2324 1007 358 196 --12053 --
NM_002742chr141661 ------
NM_002745chr2284457 4171 4100 3210 505 387 327 59 --14023 --
NM_002747chr1841508 562 507 467 11522 1648 --
NM_002748chr151955 --1276 --
NM_002752chr5143 --1401 --
NM_002753chr42298 48 1848 1824 --
NM_002760chrY134196 4129 2200 2005 1907 1723 1592 1488 1451 1289 774 639 66 22097 103 15581 --
NM_002763chr1----1157 --
NM_002764chrX5887 803 628 187 54 1913 ----
NM_002772chr21----142 2529 391
NM_002776chr195603 165 159 106 83 --41648 1453 707 697 --
NM_002791chr141114 --1105 --
NM_002802chr14--1195 ----
NM_002819chr1931020 521 43 11000 11153 --
NM_002821chr66559 546 309 249 236 163 1814 ----
NM_002823chr2--1219 ----
NM_002827chr2061692 1371 729 418 203 156 11443 ----
NM_002829chr92349 272 --1824 2878 34
NM_002833chr1551338 1202 414 349 153 21418 1398 3357 326 122 --
NM_002834chr1273996 3420 2991 1053 998 974 54 21074 205 12994 --
NM_002839chr922527 431 11209 22739 989 --
NM_002840chr151377 667 370 276 93 ------
NM_002843chr11123269 3048 2705 2422 2217 2110 1141 745 737 541 493 255 22271 1234 12886 --
NM_002847chr741506 1335 1091 1000 --1122 --
NM_002850chr1951057 965 794 456 57 1248 21216 974 --
NM_002855chr11163557 3222 2560 1489 1447 1438 1408 1034 937 828 581 572 460 254 198 80 --23282 3006 --
NM_002859chr1261712 1242 551 543 333 219 11806 11820 --
NM_002865chr8163 ------
NM_002866chr196499 452 231 38 29 22 ------
NM_002868chr12122407 2172 2105 1981 1956 1677 912 773 744 414 312 200 2251 117 32314 1994 1909 22415 807
NM_002869chr1172067 1782 1768 1484 400 380 98 ----1860
NM_002872chr222524 22 ------
NM_002874chr931982 885 874 ------
NM_002881chr271264 1013 420 239 231 102 95 41406 940 246 35 ----
NM_002886chr394803 4601 1872 1863 1253 1132 1093 269 244 11641 ----
NM_002888chr3143 ------
NM_002890chr5173 ------
NM_002892chr142153 23 --1607 21318 1226
NM_002893chrX--2342 306 ----
NM_002906chr113710 411 373 --1414 --
NM_002911chr1941460 1452 1428 653 ------
NM_002912chr61306 ------
NM_002918chr196782 763 356 321 305 286 --11062 --
NM_002924chr13234 206 161 ------
NM_002926chr431149 439 43 --11174 --
NM_002930chr18299 87 ------
NM_002940chr411375 21391 262 ----
NM_002941chr31250 1427 ----
NM_002942chr31272 11340 ----
NM_002945chr173856 131 62 ------
NM_002953chr14765 581 168 60 ------
NM_002955chr631780 1236 1229 ------
NM_002956chr1231271 1018 166 --11213 --
NM_002959chr1154174 4117 4059 3489 3073 3062 2913 2723 1585 1191 894 679 614 400 126 13350 2955 91 11436
NM_002970chrX--152 ----
NM_002971chr311019 --2370 77 --
NM_002994chr42656 142 --135 --
NM_002997chr251650 1460 1226 299 59 --11393 --
NM_002998chr82544 407 ------
NM_003001chr1132218 1982 1969 1512 861 827 768 326 274 187 132 96 28 --22235 900 22250 1875
NM_003009chr193264 102 46 ------
NM_003010chr1781960 1919 1848 1819 1808 1684 934 704 1368 ----
NM_003011chr941327 660 587 97 11384 --1664
NM_003013chr43591 96 77 ------
NM_003016chr1771855 1849 1771 770 297 276 101 ----11690
NM_003017chr621256 509 ------
NM_003026chr931335 485 155 1428 --11082
NM_003027chr15164 ------
NM_003028chr9283683 3597 3587 3332 3158 3128 2920 2711 2635 2626 2605 2541 2513 2502 2372 1543 1496 1470 1425 1359 1291 1255 1064 987 772 754 284 235 --1408 --
NM_003029chr11196 1402 122 --
NM_003030chr331406 1334 113 ------
NM_003034chr12106833 6445 6311 6279 6019 5268 5087 3154 2736 632 36612 6266 4992 ----
NM_003035chr12786 45 ------
NM_003036chr121242 1159 ------
NM_003042chr381802 1758 620 606 537 415 85 32 1543 ----
NM_003043chr3104002 3757 3446 3243 3060 2957 2869 1323 1203 1188 21641 513 23430 947 13934
NM_003045chr13124865 3176 3119 3060 1541 924 801 693 422 367 338 252 14143 24525 3179 --
NM_003047chr151093 979 959 903 174 1966 2276 45 --
NM_003051chr131951 1699 652 ----11550
NM_003060chr52877 400 11232 --1818
NM_003068chr82316 86 1842 1408 --
NM_003069chrX1196 ------
NM_003070chr92746 740 --1716 --
NM_003071chr321435 1382 --11361 1296
NM_003072chr191359 --1132 --
NM_003074chr352280 1918 1407 255 161 ----11886
NM_003076chr12141694 1679 1657 1525 1432 1414 1406 1043 1036 669 505 450 222 187 --21184 612 --
NM_003077chr172623 21 ------
NM_003079chr172402 371 1984 ----
NM_003081chr2051155 977 268 178 22 1152 --1415
NM_003085chr53390 108 91 ------
NM_003091chr202241 211 ------
NM_003096chr22170 38 ------
NM_003099chr15156056 5921 5470 5241 5075 1957 1819 1506 1462 767 703 678 605 554 175 25945 463 15934 12184
NM_003106chr31938 ------
NM_003107chr651618 927 673 446 196 1374 ----
NM_003108chr286680 6368 6178 1877 1806 1767 1037 28 36375 5389 2086 36553 5645 5063 1336
NM_003111chr221086 946 --1876 --
NM_003112chr732937 1152 275 ------
NM_003120chr114321 312 306 90 1340 ----
NM_003128chr252223 1949 1939 1132 401 11053 12408 --
NM_003131chr6122107 1965 1959 1768 675 665 654 525 505 222 208 146 ------
NM_003137chr652022 484 280 95 73 --22086 907 --
NM_003139chr115770 685 677 52 36 3785 670 140 1221 --
NM_003142chr2----1230 --
NM_003144chr671875 842 617 589 351 325 107 11656 ----
NM_003145chr14375 149 130 107 --1310 251 29
NM_003146chr114342 262 126 79 ------
NM_003149chr351241 1226 1102 497 406 ----11399
NM_003150chr1722395 1680 --1132 --
NM_003155chr8112424 2327 2229 2095 2086 2075 1730 886 274 226 192 12461 11038 --
NM_003156chr1161177 1158 1146 382 287 57 ----1997
NM_003161chr1733161 2880 2193 --43464 2396 1262 1201 --
NM_003165chr991749 1671 1602 1592 1562 1298 619 403 157 21608 1452 1694 --
NM_003173chrX41378 1098 188 128 ------
NM_003178chr392017 1727 1593 1518 1483 555 448 408 87 11767 11802 1274
NM_003179chrX81445 1362 1199 1131 983 372 247 69 1397 --21452 1386
NM_003184chr81916 --1111 --
NM_003188chr61832 ------
NM_003189chr192839 2569 2427 2154 925 675 359 255 248 32441 404 277 12081 --
NM_003194chr62452 371 ------
NM_003199chr1871849 1672 1612 849 809 716 90 21099 166 14516 --
NM_003200chr1992078 2018 1851 1827 1609 1572 1562 933 665 --11654 --
NM_003203chr242184 901 243 81 1915 ----
NM_003204chr1731662 1438 1334 ------
NM_003205chr155845 645 301 182 53 --21430 571 --
NM_003214chr631055 1019 44 ------
NM_003215chr451419 1161 1095 403 24 133 1178 --
NM_003216chr22203213 3030 2807 2336 2257 2085 2041 1312 1115 1072 979 718 657 644 505 499 469 340 311 199 --11118 12115
NM_003217chr1251442 659 249 199 39 --2622 326 123
NM_003220chr651521 1476 1180 238 27 ------
NM_003221chr6143762 3399 3382 3373 3347 3076 2863 2848 2566 1592 1484 1344 822 304 13122 --23543 495
NM_003223chr163644 286 24 --2623 583 --
NM_003234chr372144 2026 1782 1545 958 325 21 ----1736
NM_003244chr181349 ------
NM_003246chr1531947 140 98 11660 --1222
NM_003247chr631527 637 87 ------
NM_003250chr171123 --152 1392
NM_003253chr2111522 --31291 475 398 --
NM_003255chr176999 537 509 473 285 150 --32371 2092 341 --
NM_003257chr1511061 ------
NM_003275chr921484 535 --1379 --
NM_003286chr201443 --31098 786 446 --
NM_003289chr93193 57 38 ------
NM_003292chr11529 --11744 11694
NM_003298chr3176015 5710 5262 4946 4676 4503 3961 3828 2319 2313 1495 1407 1208 1047 797 128 41 24589 975 24608 3836 --
NM_003300chr141329 ------
NM_003304chr31372 11484 --11016
NM_003309chr681749 1646 709 691 570 506 322 193 1724 138 1151
NM_003319chr21685 ------
NM_003324chr1271398 1071 915 593 390 217 30 ------
NM_003325chr222526 77 ------
NM_003326chr182698 2521 2476 2146 2078 683 144 98 --22327 653 --
NM_003334chrX3199 69 55 ------
NM_003336chrX3927 162 128 11086 ----
NM_003337chr531348 1194 55 11713 ----
NM_003338chr101542 1163 ----
NM_003339chr551497 1404 626 209 110 1610 ----
NM_003340chr41445 --1179 --
NM_003342chr1772717 2021 966 954 852 825 484 --12259 11102
NM_003344chr731342 1091 206 ------
NM_003345chr161196 --1133 --
NM_003347chr2292358 2066 1995 910 838 602 530 377 359 ------
NM_003348chr1261626 1427 1209 406 268 35 11707 11419 --
NM_003349chr206585 400 393 381 284 126 21236 551 ----
NM_003352chr22218 28 ------
NM_003359chr44915 324 207 189 2356 222 ----
NM_003363chr32555 458 ------
NM_003368chr11118 ------
NM_003369chr1142617 2294 529 501 --12390 --
NM_003370chr196745 739 217 118 63 30 ------
NM_003371chr94859 748 469 107 1604 21712 115 --
NM_003372chrX2351 325 ------
NM_003373chr1021499 378 31524 1297 453 51761 1752 1416 635 390 11442
NM_003374chr52632 160 --1776 --
NM_003376chr651703 1411 1356 606 518 --152 --
NM_003376chr651703 1411 1356 606 518 --152 --
NM_003381chr62632 40 ------
NM_003383chr9193 ------
NM_003385chr23796 349 272 2946 747 ----
NM_003387chr262799 2419 1876 1858 947 84 --21881 374 --
NM_003390chr113825 731 311 ------
NM_003392chr364056 3936 1346 627 102 32 13419 11313 --
NM_003394chr124593 543 276 179 182 1640 --
NM_003400chr21169 ------
NM_003403chr14176 --144 --
NM_003404chr2031444 1361 591 ----11498
NM_003406chr851744 1678 1649 1621 317 11381 1140 --
NM_003407chr192577 221 ------
NM_003409chr1831130 313 247 ------
NM_003410chrX42415 2000 1229 399 --22433 797 --
NM_003413chrX2408 247 ------
NM_003418chr32326 101 ------
NM_003439chr752767 721 597 187 29 1758 11399 --
NM_003457chr171118 ------
NM_003458chr3153848 3830 3812 3736 3556 3450 3244 3210 1507 1302 1122 976 947 933 370 --1724 --
NM_003459chr26651 293 246 139 115 55 ------
NM_003463chr662676 2652 2634 303 259 103 1987 32670 920 515 --
NM_003468chr252897 1395 1133 498 112 34331 3647 707 ----
NM_003470chr1671872 1630 1560 1269 1163 541 501 ------
NM_003472chr62524 31 ------
NM_003473chr103181 150 108 ------
NM_003474chr1031640 1613 561 12267 ----
NM_003478chr1122375 934 12833 --23082 2740
NM_003482chr12142646 2490 2473 2172 2045 1118 1111 977 755 555 529 380 199 51 ----22760 991
NM_003483chr1272777 2190 2067 1063 1057 1041 1025 --22195 2070 --
NM_003487chr172201 178 ------
NM_003489chr2122192 1172 22416 585 11052 --
NM_003490chr224856 846 163 64 1788 ----
NM_003496chr72800 74 ------
NM_003507chr24601 585 567 105 --31944 328 26 --
NM_003528chr151447 1338 1324 331 273 --11738 --
NM_003559chr17143539 3435 3099 3071 2986 1128 1010 994 927 860 608 487 435 247 --32789 2757 2737 12639
NM_003563chr1711028 11047 ----
NM_003564chr15239 233 171 80 31 1100 1430 --
NM_003566chr1252698 2231 1217 921 767 --22692 212 1364
NM_003567chr1142 ------
NM_003569chr61113 ------
NM_003575chr751371 1340 1083 1034 517 11099 1976 --
NM_003576chr1382845 2498 2373 2279 840 707 678 216 --2966 188 --
NM_003583chr1253572 2399 852 795 402 --11045 --
NM_003590chr253797 1500 1223 634 342 --23596 446 1657
NM_003593chr172697 185 --1527 --
NM_003603chr452021 1627 389 371 82 ------
NM_003607chr193790 3460 3451 1611 1012 964 159 70 56 21150 281 23657 1379 12786
NM_003613chr152646 599 ------
NM_003615chr333698 829 806 --23004 928 13721
NM_003616chr141489 1394 ----
NM_003617chr1104559 3636 3619 3106 1894 1626 1512 211 197 83 --74503 4246 3809 3100 1960 890 65 14290
NM_003620chr17--21072 841 ----
NM_003624chr191383 11329 21203 548 --
NM_003629chr141243 1101 1091 433 12850 12942 --
NM_003631chr104959 329 35 24 --1141 --
NM_003632chr173834 225 60 ------
NM_003633chr572166 1757 1033 1025 636 409 329 ------
NM_003636chr171469 1223 1189 535 524 407 43 31818 348 316 2585 296 1147
NM_003644chr17266380 6026 5860 5673 5617 5565 4956 4467 4349 4292 4189 4177 2468 2180 2122 1350 1262 1256 788 712 598 353 242 179 94 53 --76325 5086 4037 2065 1485 958 513 11272
NM_003648chr282637 1869 1859 1718 981 903 696 64 --31937 1779 635 --
NM_003654chr111499 --196 --
NM_003655chr176592 585 576 539 229 200 1755 ----
NM_003657chr20366 53 32 ------
NM_003660chr194639 538 66 42 ------
NM_003663chr332931 2127 274 --12548 --
NM_003664chr55407 357 182 136 92 ----1543
NM_003670chr331092 1051 300 1454 ----
NM_003671chr993091 2912 2775 2297 2271 1206 948 851 819 32836 1308 213 53132 3094 2931 1073 556 --
NM_003672chr1--11273 11738 11925
NM_003673chr17--1168 ----
NM_003680chr12569 252 --291 29 1504
NM_003684chr17762 740 444 407 319 164 148 ------
NM_003685chr194791 624 228 178 ------
NM_003688chrX------1217
NM_003692chr9----1319 --
NM_003711chr52216 84 ------
NM_003713chr131202 1174 555 1157 ----
NM_003714chr582955 2768 2458 2368 2196 2121 1151 1002 ------
NM_003716chr31718 ------
NM_003722chr352290 1672 268 85 22 ----136
NM_003726chr17366 29 22 ------
NM_003735chr5101718 1704 1300 542 501 484 440 390 59 39 1648 21669 1397 1324
NM_003736chr5101718 1704 1300 542 501 484 440 390 59 39 1648 21669 1397 1324
NM_003740chr62145 41 ------
NM_003741chr32130 84 ------
NM_003743chr241760 1600 870 581 ------
NM_003744chr1471176 1120 546 486 367 254 85 ------
NM_003749chr1341663 1594 914 189 --12314 --
NM_003759chr4113370 3232 3220 2843 1622 1165 1103 816 281 271 44 --11486 13149
NM_003760chr11553 ------
NM_003763chr2022647 2555 13052 21071 43 22830 2390
NM_003768chr171636 1575 1560 1554 1444 303 244 11547 2734 557 --
NM_003774chr1221267 1233 --21057 962 12342
NM_003779chr14339 189 138 57 --1311 --
NM_003783chr11766 ----1192
NM_003787chr1841125 1085 620 119 ----169
NM_003794chr31366 ------
NM_003795chr61486 ------
NM_003797chr111171 ------
NM_003800chr641845 1533 922 779 11595 11828 --
NM_003812chr21271 ------
NM_003819chr11250 ----1296
NM_003827chr194547 509 462 31 --193 --
NM_003829chr941127 1106 456 46 ------
NM_003831chr1831418 199 126 1327 ----
NM_003850chr13----1246 1710
NM_003861chr1472710 2346 2326 2141 2029 1050 867 12200 22572 592 --
NM_003862chr52251 50 ----1340
NM_003870chr1522008 1983 22052 129 2541 240 --
NM_003872chr272709 2664 2235 1195 1024 874 197 --12752 11168
NM_003873chr1051839 1833 1663 1002 299 1747 ----
NM_003877chr121892 --1930 --
NM_003883chr54408 394 174 78 ----1180
NM_003887chr21337 ----1233
NM_003888chr1561607 1236 387 366 276 75 1346 21327 1315 1424
NM_003893chr10----1323 --
NM_003896chr23878 679 153 ------
NM_003902chr11645 ------
NM_003908chr201487 11371 ----
NM_003913chr664173 4050 2692 2675 1052 493 24037 3340 ----
NM_003919chr7------177
NM_003924chr431377 326 190 1635 ----
NM_003927chr183775 321 34 --2447 368 --
NM_003930chr7194 186 21833 795 --
NM_003931chr62559 205 ------
NM_003934chr921167 27 ------
NM_003936chr281098 774 427 417 396 380 289 245 ------
NM_003938chr195988 771 758 200 77 ------
NM_003939chr10173426 3328 3144 1529 1496 1056 1007 901 891 869 740 654 479 404 370 284 117 13813 33281 1395 314 22950 1339
NM_003941chr711936 --12011 --
NM_003947chr341082 241 165 64 11214 ----
NM_003948chr432411 2368 973 22576 173 ----
NM_003949chr17111857 1835 1786 1683 1572 1264 719 573 423 250 190 21998 1601 52005 1918 1901 1384 1367 --
NM_003955chr1781485 1206 1032 605 539 278 153 55 ------
NM_003958chr6133814 3217 3200 3168 3070 1496 1007 988 885 868 527 160 71 11021 23660 3090 --
NM_003971chr172418 58 ------
NM_003972chr101305 ------
NM_003975chr1--172 1328 --
NM_003980chr611370 ------
NM_003983chr16104397 4328 4300 3843 1599 1302 1222 472 453 84 --33435 3291 983 --
NM_003987chr10132223 2002 1890 1712 1659 1639 1624 1608 862 855 806 561 110 --1840 --
NM_003988chr10132300 2079 1967 1789 1736 1716 1701 1685 939 932 883 638 187 --1917 --
NM_003989chr10132159 1938 1826 1648 1595 1575 1560 1544 798 791 742 497 46 --2876 776 --
NM_003990chr10132159 1938 1826 1648 1595 1575 1560 1544 798 791 742 497 46 --2876 776 --
NM_003994chr1234426 813 608 11254 ----
NM_003998chr41580 ------
NM_004006chrX1848 ------
NM_004007chrX1848 ------
NM_004009chrX1848 ------
NM_004010chrX1848 ------
NM_004011chrX1848 ------
NM_004012chrX1848 ------
NM_004013chrX1848 ------
NM_004014chrX1848 ------
NM_004015chrX1848 ------
NM_004016chrX1762 ------
NM_004017chrX1848 ------
NM_004018chrX1762 ------
NM_004020chrX1848 ------
NM_004021chrX1762 ------
NM_004022chrX1762 ------
NM_004023chrX1762 ------
NM_004024chr13523 447 128 11146 31049 122 115 --
NM_004028chr1862696 2591 1654 613 557 60 1684 11079 11526
NM_004035chr17144981 4875 4646 4394 3937 3731 3598 3449 3430 3232 1285 871 721 554 44561 3750 3464 406 34868 3617 3547 --
NM_004050chr1422201 612 22373 599 1874 --
NM_004061chr52525 83 --186 --
NM_004067chr721414 233 11436 ----
NM_004068chr32297 90 ------
NM_004071chr22271 23 ------
NM_004077chr1241108 996 495 178 --1476 --
NM_004080chr761484 1203 440 287 256 91 --1275 --
NM_004081chrY21396 97 11527 11183 --
NM_004083chr12176 --151 --
NM_004085chrX2510 97 ------
NM_004086chr141639 ------
NM_004087chr341545 1398 1348 155 1452 1618 --
NM_004089chrX4902 458 451 268 ------
NM_004090chr17113020 2352 1016 738 579 517 491 452 246 157 100 2666 379 ----
NM_004093chr1332377 415 267 --131 --
NM_004094chr1422625 435 1164 12037 --
NM_004096chr10111678 1539 1510 862 694 548 451 210 197 189 137 --11444 --
NM_004098chr102976 518 11261 ----
NM_004099chr961940 1750 775 546 274 113 3709 677 26 11622 --
NM_004102chr13582 151 78 ------
NM_004103chr87769 742 731 720 698 143 32 --187 --
NM_004105chr231033 1001 801 ------
NM_004113chr361825 1720 150 73 55 22 --21591 30 --
NM_004114chrX2986 927 --1335 --
NM_004116chr23411 139 51 ------
NM_004117chr661626 874 823 539 411 59 2616 147 11930 --
NM_004124chr1453374 3044 2724 2255 631 13199 12741 12188
NM_004130chr31458 ------
NM_004132chr105839 779 766 159 35 --1905 --
NM_004156chr82501 400 ------
NM_004157chr32905 283 ------
NM_004161chr22459 279 --11036 --
NM_004162chr331003 468 187 194 ----
NM_004171chr11139033 8654 8242 7814 6586 6426 3524 3326 2806 2164 2048 1706 1166 58961 3864 2333 2196 2063 39665 557 331 39099 1770 302
NM_004172chr531542 701 104 --1654 --
NM_004183chr112810 681 --1630 --
NM_004187chrX111287 1241 1052 1007 458 452 418 363 353 242 212 11106 ----
NM_004193chr103401 370 36 --1364 --
NM_004200chr11122901 2585 2276 2226 2157 1130 1062 993 916 791 780 244 12295 ----
NM_004209chr1651117 1109 431 288 85 ------
NM_004225chr821120 1006 ------
NM_004227chr753036 2654 950 933 822 --11956 --
NM_004229chrX11838 --11557 --
NM_004230chr19112335 2208 2102 2089 1945 1683 1665 1474 753 569 452 3928 601 467 ----
NM_004231chr74267 207 192 48 ------
NM_004232chr1831513 1317 277 ------
NM_004235chr92580 72 2705 126 ----
NM_004236chr15----1376 --
NM_004249chr4172 ------
NM_004254chr114366 281 94 22 ------
NM_004263chr291520 1484 1341 1244 725 521 501 199 149 ------
NM_004272chr52587 48 --1718 --
NM_004274chr1462830 390 341 300 158 82 21091 164 22760 261 23035 146
NM_004277chr62660 551 11625 --11204
NM_004279chr742193 2113 2039 538 11742 1738 --
NM_004283chr193972 880 34 1673 1604 --
NM_004290chr54300 106 49 40 1912 ----
NM_004293chr983466 3001 2864 1258 819 221 54 28 --12703 --
NM_004296chr14113815 3429 3399 3223 3031 2887 1448 1088 1025 897 462 ------
NM_004302chr12102612 2461 2396 2305 859 775 750 476 450 163 22510 204 22573 1113 --
NM_004308chr1181464 1422 1297 1181 559 322 124 55 11329 2613 263 21635 638
NM_004311chr10132939 2909 2757 2693 2563 2551 2321 2255 2214 2135 2087 1258 812 22490 344 12030 --
NM_004316chr123900 874 381 ------
NM_004319chr1162901 2726 2640 2627 2562 2538 2524 2438 2427 2421 2391 1994 682 558 547 293 --22894 2430 12450
NM_004321chr293353 3058 2857 2488 1123 779 469 177 90 ----1483
NM_004323chr9102481 2472 2286 2059 2048 1966 568 196 183 131 11987 22203 268 --
NM_004326chr181159 1036 977 909 846 840 782 761 11054 2998 358 --
NM_004330chr152986 958 ------
NM_004331chr842707 479 457 390 2614 140 ----
NM_004338chr18226880 6466 5909 5816 5806 5619 5468 5455 4914 4705 4685 4349 2816 2665 2345 2311 2221 1796 1198 1139 1128 193 12490 --1451
NM_004344chrX195 ------
NM_004349chr8------11115
NM_004350chr192153 2068 2008 1918 827 658 363 344 22 1423 1368 --
NM_004359chr193492 133 104 ------
NM_004369chr21217 --1485 --
NM_004370chr641827 649 594 519 11779 11460 --
NM_004379chr21199 --1655 --
NM_004380chr1631015 195 25 --1519 --
NM_004384chr52944 558 1772 ----
NM_004386chr1992135 1829 1701 1654 1460 804 699 511 161 --31506 818 35 --
NM_004391chr371501 1455 1446 1419 603 232 152 --61595 1488 1361 377 204 53 --
NM_004392chr1342256 1895 1643 557 --11833 12670
NM_004393chr371968 1851 1815 1543 798 695 576 32087 2054 168 21831 739 --
NM_004396chr17--1281 ----
NM_004397chr1153753 2999 1353 599 401 23736 797 13040 --
NM_004399chr123811 770 169 2706 634 ----
NM_004405chr26405 363 180 155 108 82 --1817 --
NM_004411chr71582 ------
NM_004414chr2131177 1096 489 --1625 --
NM_004416chr1261085 886 696 690 684 668 1779 1741 --
NM_004417chr51421 ------
NM_004419chr102713 241 ------
NM_004420chr11122408 2384 2223 2211 2113 2101 1946 1875 1743 841 426 287 ------
NM_004423chr3132594 2525 2457 2216 2142 1096 1009 653 378 371 249 59 34 42320 2263 2089 917 11099 --
NM_004427chr191037 1013 1007 460 444 414 288 163 114 144 ----
NM_004428chr12549 111 --2552 255 --
NM_004429chrX61335 1222 941 339 147 57 ------
NM_004430chr8102767 1757 1067 962 945 621 391 380 45 30 22145 158 31001 979 697 11048
NM_004431chr11203 1309 2727 335 --
NM_004432chr922163 393 ------
NM_004437chr1123236 2964 2409 2399 2299 2271 1164 1113 801 640 633 434 11422 139 22968 1051
NM_004438chr223202 353 ------
NM_004440chr611959 41777 1433 157 111 11726 --
NM_004441chr361290 1274 465 416 387 301 --1453 --
NM_004442chr1121589 1557 1448 1388 1363 1356 1272 1160 1151 636 358 28 --11592 --
NM_004443chr31609 ------
NM_004446chr1135 ------
NM_004451chr112169 159 1549 ----
NM_004454chr362239 2119 2099 1726 273 46 1667 ----
NM_004458chrX31654 379 218 31903 1692 364 11819 1472
NM_004459chr1711526 --21547 1261 --
NM_004463chrX3465 106 82 --1475 --
NM_004468chr14608 251 133 110 --129 --
NM_004474chr16694 405 397 391 377 287 --21034 49 --
NM_004475chr17121128 1014 959 838 478 463 277 241 193 187 162 154 ------
NM_004484chrX3334 306 50 --2309 267 --
NM_004494chr191240 1195 1183 1069 324 242 213 191 117 --51174 353 345 136 100 --
NM_004496chr145408 318 309 282 152 ------
NM_004497chr193684 608 540 ------
NM_004499chr52151 132 ------
NM_004500chr1472029 1925 1905 197 137 120 87 ------
NM_004501chr173587 3302 2797 2652 1549 1249 975 11118 1849 --
NM_004504chr232826 2759 55 ------
NM_004514chr17133003 2847 2812 2746 2608 2418 2319 2288 2086 993 272 111 65 ----2891 336
NM_004516chr1911121 1434 ----
NM_004525chr241258 1250 1194 112 --11317 --
NM_004527chr1771065 330 230 222 204 117 82 --1344 11252
NM_004529chr92340 236 ------
NM_004535chr2041437 1311 555 162 ------
NM_004555chr161178 184 --150
NM_004569chr141737 --134 1533
NM_004571chr21103207 3067 2946 2620 2316 1270 1245 969 773 568 ------
NM_004575chr431039 1009 53 --11199 --
NM_004576chr52151 103 ------
NM_004578chr12841 826 --1772 --
NM_004580chr1551635 1626 1352 719 706 ------
NM_004583chr175533 505 490 286 250 --1279 --
NM_004586chrX75154 5136 4054 2171 1949 1874 671 1653 24517 3379 --
NM_004588chr11194074 3710 3672 3607 3465 3453 3244 3197 3140 3099 3093 3057 2945 2645 661 469 246 39 26 23250 672 63206 2648 943 737 183 152 11089
NM_004594chr161316 1197 1975 --
NM_004598chr5102922 2316 2119 1098 1049 960 708 485 396 153 ------
NM_004602chr2031301 1272 338 11410 1284 1566
NM_004606chrX2308 64 ------
NM_004612chr964881 4751 4646 4200 150 26 33872 3559 1567 34577 831 217 14344
NM_004614chr16122002 1736 921 794 706 659 565 550 497 280 137 87 2913 633 22060 253 1616
NM_004615chrX4788 751 157 125 177 ----
NM_004620chr111148 ------
NM_004630chr1191049 1034 942 892 814 372 283 257 214 ------
NM_004631chr111235 ------
NM_004634chr32566 45 --1578 --
NM_004637chr381286 1174 1162 1026 1000 863 443 78 --2165 108 185
NM_004639chr61101 ------
NM_004643chr143740 610 289 ------
NM_004654chrY1996 ------
NM_004655chr1721207 392 ------
NM_004656chr351274 938 880 396 155 --2399 84 11265
NM_004658chr123121 86 79 ------
NM_004660chrY2233 120 11576 11495 --
NM_004661chr541227 1063 857 259 11092 ----
NM_004663chr15----31168 415 46 --
NM_004664chr121221 ------
NM_004670chr1031368 1058 495 ----1380
NM_004671chr182246 212 ------
NM_004673chr11993 --1479 1573
NM_004674chr83184 176 113 1610 --188
NM_004685chr1332320 597 497 ------
NM_004686chr861779 1383 726 637 351 308 21576 50 --1331
NM_004687chr1731343 388 276 ------
NM_004690chr61608 1744 ----
NM_004703chr1732498 2347 322 ------
NM_004705chr111624 1164 1190 --
NM_004711chr22193376 3305 3266 3162 3083 3045 2769 2747 2547 2534 2509 2331 2283 1281 1209 1170 675 657 48 12779 --1974
NM_004716chr114803 712 331 280 1921 --2788 41
NM_004717chr761384 569 527 373 262 108 ------
NM_004719chr1222276 421 ------
NM_004723chr13857 766 238 --1924 --
NM_004726chrX74629 4171 2239 1737 1677 1359 1228 11951 34259 2224 237 --
NM_004730chr531525 696 529 ------
NM_004731chr121473 --21427 284 --
NM_004734chr135923 877 843 264 166 134 22377 1276 12902
NM_004736chr152130 1743 1728 1417 129 11881 21858 865 --
NM_004739chr111670 ------
NM_004742chr351484 1256 1243 583 43 --11677 --
NM_004744chr41318 13656 ----
NM_004745chr8206920 6693 6311 6256 5957 5908 5173 5034 4904 2019 1944 1883 1666 1479 725 279 115 94 87 42 15210 26674 4283 --
NM_004755chr14190 1118 ----
NM_004759chr1112023 1776 1328 729 452 430 416 366 356 258 226 --2433 408 --
NM_004762chr1741858 1298 594 520 --41288 761 236 56 --
NM_004772chr521405 296 21167 348 1281 --
NM_004774chr1763130 2852 2148 1929 1035 341 --11029 --
NM_004779chr56918 490 433 241 215 72 --1882 --
NM_004781chr131486 390 306 ------
NM_004781chr131486 390 306 ------
NM_004783chr164631 599 483 242 ------
NM_004784chr4----1126 --
NM_004788chr1131807 288 68 --1915 21696 356
NM_004789chr91362 ------
NM_004792chr2270 24 ------
NM_004796chr141184 12453 ----
NM_004798chr2063008 1325 1222 568 334 309 --33217 2925 822 22582 629
NM_004799chr1------1314
NM_004801chr231399 1182 1163 ------
NM_004808chr1032844 2541 2285 12338 ----
NM_004815chr174428 4400 4355 4060 3990 3887 283 --14383 --
NM_004821chr54656 612 601 587 --1322 --
NM_004822chr1763702 1602 1034 913 529 284 33718 2826 1392 21401 105 --
NM_004824chr621148 393 ------
NM_004830chr64945 754 177 171 ------
NM_004831chr196778 760 426 168 157 30 --1724 --
NM_004834chr232866 1346 141 --12531 12989
NM_004837chr141453 1059 455 321 --11605 --
NM_004841chr131151 921 192 1176 2980 49 --
NM_004845chrX144136 3911 3718 3052 2920 2842 1632 1212 846 834 552 414 324 160 34154 3220 3085 33206 878 163 --
NM_004849chr611680 ------
NM_004850chr241457 522 267 152 --2245 48 11134
NM_004859chr1762601 2407 1940 609 530 252 12663 ----
NM_004863chr14114594 3735 3665 3323 3295 1873 808 650 450 439 33 23912 718 1339 1602
NM_004869chr1821147 181 ------
NM_004871chr17134166 3735 3116 845 719 549 476 459 448 442 436 429 255 32703 741 617 13042 13462
NM_004879chr117996 655 325 306 131 73 60 ------
NM_004884chr1561670 1653 575 569 536 447 11640 --11580
NM_004893chr52426 78 ------
NM_004896chr102595 127 ------
NM_004897chr103931 264 145 ------
NM_004898chr452917 2276 2176 627 476 --22549 2168 --
NM_004904chr7126094 5999 5866 4760 4447 2466 1791 1574 1437 1264 680 574 35958 5054 1580 35046 1966 492 --
NM_004922chr105997 845 773 109 40 ----2903 343
NM_004924chr196850 841 345 309 288 155 ------
NM_004926chr1471622 680 558 442 161 130 72 --1532 --
NM_004929chr821412 291 ------
NM_004930chr15590 273 220 212 145 --1531 --
NM_004932chr51663 1179 ----
NM_004936chr952130 2041 1001 348 168 12144 42449 1916 365 53 --
NM_004938chr94849 484 264 98 --21044 286 --
NM_004947chr3112589 2581 2341 2095 2082 1029 850 723 689 426 278 --3789 667 553 --
NM_004956chr773462 3212 3109 2889 876 631 441 --13042 --
NM_004958chr12219 64 1373 ----
NM_004960chr16--178 ----
NM_004961chrX41405 552 521 170 ----1344
NM_004965chr21139 1650 ----
NM_004968chr74632 473 456 251 ------
NM_004969chr101370 --151 --
NM_004972chr91743 ------
NM_004973chr611600 ------
NM_004976chr11174840 4763 4726 4084 3883 3594 3569 3561 2007 1673 1473 1355 1311 911 846 832 568 ----14853
NM_004977chr194568 386 160 142 ------
NM_004978chr181348 1249 1219 1116 503 419 385 180 ------
NM_004979chrX71088 1057 1010 812 323 235 191 11075 1287 --
NM_004985chr1254099 851 582 551 194 34516 3493 699 11803 --
NM_004992chrX377910 7888 7798 7688 7659 7076 7049 6933 6173 6009 5872 5379 5318 5280 3418 3180 3079 3069 3061 3005 2619 2567 2523 2491 2142 1816 1508 1268 1228 1222 1154 1002 954 393 342 328 64 37954 1758 457 66537 5777 1538 1492 1310 935 26314 3100
NM_004992chrX377910 7888 7798 7688 7659 7076 7049 6933 6173 6009 5872 5379 5318 5280 3418 3180 3079 3069 3061 3005 2619 2567 2523 2491 2142 1816 1508 1268 1228 1222 1154 1002 954 393 342 328 64 37954 1758 457 66537 5777 1538 1492 1310 935 26314 3100
NM_004993chr1421367 505 --2994 594 1182
NM_004995chr1471344 1029 472 194 128 88 27 ------
NM_004999chr694266 3695 3423 3172 1607 1594 1299 1243 225 2914 217 43224 1601 1386 1334 --
NM_005010chr732226 2142 72 12163 22038 651 --
NM_005011chr761474 1466 753 597 576 90 --11848 --
NM_005020chr73175 81 72 --2600 88 --
NM_005023chr51119 11429 ----
NM_005026chr141574 791 341 330 1316 21310 275 11446
NM_005027chr1951115 962 223 193 183 --1140 --
NM_005028chr1051903 1662 1466 745 619 --22167 183 --
NM_005032chrX5820 726 720 255 34 --2285 190 --
NM_005045chr71722 --2708 155 131
NM_005056chr12105360 5090 5013 3523 2032 1789 863 707 662 480 1344 24214 1639 --
NM_005057chr1111747 1613 671 658 644 590 497 479 464 220 112 --1371 --
NM_005060chr151203 846 539 424 28 1920 2245 87 --
NM_005063chr10113762 3245 2680 1422 1391 1130 991 678 280 267 213 21136 322 ----
NM_005065chr1475237 4540 1858 1648 919 639 99 23488 1663 11451 --
NM_005066chr11764 ------
NM_005076chr1124160 4141 3709 3586 3026 2762 1152 1125 1089 753 504 230 11318 41369 979 846 495 --
NM_005078chr15101742 1473 1176 1170 1147 601 503 466 411 327 ------
NM_005079chr832672 655 378 12884 11104 --
NM_005080chr227831 740 654 353 279 230 102 ------
NM_005086chr1241292 495 420 406 1677 ----
NM_005087chr31548 --1861 --
NM_005095chr142212 1834 895 874 ------
NM_005096chrX41084 1014 448 170 1839 21105 226 --
NM_005109chr382038 987 867 631 605 247 141 109 --1164 --
NM_005110chr52598 134 ------
NM_005114chr42562 515 ------
NM_005116chr20124607 4229 4141 3239 2900 1622 1470 1433 1002 376 321 188 --1521 --
NM_005119chr151284 1207 1168 931 403 --1167 --
NM_005121chr1742994 2705 2387 1522 23610 2351 ----
NM_005126chr342208 1772 310 197 ------
NM_005128chr211511 ------
NM_005134chr185354 332 273 112 33 ------
NM_005135chr1593639 3448 2613 2437 1249 1109 902 169 85 32772 2740 2628 13159 --
NM_005141chr4--2399 102 ----
NM_005151chr182626 480 ------
NM_005153chr162710 107 1187 ----
NM_005156chr994730 4558 4102 3701 3653 3520 3513 3428 198 --14576 124
NM_005166chr195345 317 309 72 47 ------
NM_005168chr21401 --21523 1377 --
NM_005180chr102364 167 ------
NM_005184chr19111280 1157 1146 1090 329 213 192 181 175 66 43 1995 1233 1247
NM_005187chr1661619 1343 1318 524 383 357 11657 11374 11441
NM_005188chr11277879 7751 7583 7496 7467 7366 7072 6913 6648 6538 5722 5712 5587 5489 5457 3131 3094 2925 2832 2274 1863 1817 1683 1142 616 492 235 25105 1308 46898 6639 6035 3080 --
NM_005197chr14116157 5537 5504 4993 4946 4548 4379 4277 3814 1739 1140 13997 56196 5082 5000 3788 2238 --
NM_005202chr181802 901 895 886 722 350 200 148 21873 1762 1725 --
NM_005203chr101163 ------
NM_005207chr223680 290 53 31443 830 695 179 --
NM_005214chr21117 ------
NM_005215chr18----1477 --
NM_005219chr591749 1388 624 496 489 365 286 132 108 1545 --1151
NM_005220chr1771443 1304 1129 469 343 153 114 --21433 316 --
NM_005229chrX11997 929 879 804 796 356 335 191 168 159 54 1147 1244 --
NM_005232chr7188 ------
NM_005233chr342346 2196 2186 171 --12004 2855 729
NM_005235chr2207621 7590 7062 6733 6716 6443 6327 6187 5511 5443 5160 5041 3038 2161 1911 538 349 114 79 49 26908 2812 46790 6485 5739 2528 15980
NM_005238chr1163037 2659 2579 2537 2478 743 142 12807 --
NM_005239chr2111735 ----12041
NM_005241chr3--11184 1297 --
NM_005245chr4--187 --1210
NM_005248chr13544 401 228 --1198 170
NM_005252chr143237 198 84 ------
NM_005254chr1531122 980 873 --1455 --
NM_005259chr23991 299 48 ------
NM_005261chr82849 102 --1346 --
NM_005264chr101952 ----1736
NM_005274chr1------128
NM_005276chr1251750 1408 706 625 94 --1589 --
NM_005276chr1251750 1408 706 625 94 --1589 --
NM_005277chr43663 322 215 ----1172
NM_005296chrX----140 --
NM_005308chr102503 52 ------
NM_005311chr762150 2021 2004 1792 604 530 1582 12009 --
NM_005312chr9112658 2579 2035 1950 1853 964 740 312 296 290 54 ------
NM_005313chr1541124 1101 1006 98 --139 --
NM_005316chr112951 134 --1945 --
NM_005328chr82700 590 ------
NM_005333chrX3768 210 65 --2923 240 --
NM_005335chr33301 277 123 --136 --
NM_005336chr292079 1845 1797 1737 1666 1495 432 404 113 --22170 411 11927
NM_005339chr454351 4307 3635 1679 851 13525 --11596
NM_005342chrX52767 2653 2121 267 22 42854 2357 2181 1107 12014 1140
NM_005347chr941668 1649 538 488 --1551 --
NM_005349chr42486 143 --1568 --
NM_005359chr18105346 5057 4651 4614 4304 2186 2168 1445 745 145 25730 2335 --16347
NM_005370chr1941249 835 515 86 2924 447 1527 --
NM_005374chr17112263 2159 2122 1788 1774 1527 606 435 428 388 130 ----11537
NM_005378chr21758 ------
NM_005380chr191280 1069 1035 860 516 504 492 260 28 --1868 --
NM_005381chr22124 21 ------
NM_005385chr342710 2503 2167 2062 --22172 2081 2901 183
NM_005386chr203814 734 575 2605 200 ----
NM_005387chr112608 237 --1240 --
NM_005389chr62681 673 --127 1689
NM_005392chr971727 1561 1185 493 129 114 70 ----11820
NM_005397chr782839 2674 1274 1125 923 631 585 149 31538 545 124 23530 560 --
NM_005398chr1021433 265 1276 ----
NM_005399chr1103579 2790 1317 1099 703 577 563 495 242 44 11262 31586 1448 868 11430
NM_005400chr252676 948 419 172 97 --12763 12686
NM_005401chr12230 189 ------
NM_005402chr711750 ------
NM_005407chr1491580 1507 1283 639 316 303 291 201 68 ------
NM_005409chr41197 ------
NM_005410chr51140 ------
NM_005412chr126449 423 146 140 111 44 ------
NM_005413chr29431 374 363 167 96 89 80 64 28 ------
NM_005415chr21747 ------
NM_005418chr114698 654 581 572 1241 ----
NM_005426chr1--1372 ----
NM_005430chr12111055 947 901 851 823 814 646 385 153 140 36 1418 1143 --
NM_005433chr1842166 1905 320 159 --12752 --
NM_005435chr71384 --1547 --
NM_005436chr1073583 2592 1644 1636 609 419 324 11451 22811 2569 --
NM_005437chr1041484 1041 917 119 ------
NM_005438chr11149 --1249 --
NM_005439chr127495 460 388 195 171 132 83 ------
NM_005442chr31105 ------
NM_005445chr101231 ------
NM_005458chr961669 1520 865 819 247 121 --2951 907 --
NM_005461chr2061664 1477 1314 535 287 227 ------
NM_005465chr131635 795 356 11806 ----
NM_005474chr17141542 1492 1473 1265 1228 1212 1163 1041 1028 557 519 415 212 163 --21125 107 --
NM_005475chr12102993 2739 2605 2457 1303 1202 975 510 206 92 --33076 2288 434 --
NM_005476chr95393 175 167 147 30 --21200 153 --
NM_005477chr1592522 2033 1910 1045 837 796 744 52 39 ------
NM_005477chr1592522 2033 1910 1045 837 796 744 52 39 ------
NM_005487chr2241576 1568 1489 260 --11389 --
NM_005493chr61781 ------
NM_005494chr71663 ------
NM_005497chr17125935 4938 4888 4803 3733 2237 1862 1700 1639 504 189 71 55835 5803 4817 4495 1876 1243 --
NM_005501chr1761209 1124 1077 343 172 48 ------
NM_005502chr922141 455 1219 ----
NM_005507chr114451 444 334 175 1205 ----
NM_005509chr52756 393 11744 1325 --
NM_005512chr1191997 1761 1555 1267 1259 756 741 720 578 --31482 1287 349 --
NM_005522chr73379 108 38 ------
NM_005524chr32325 50 127 ----
NM_005534chr211493 ------
NM_005536chr8138 ------
NM_005539chr10--1988 11111 --
NM_005542chr741711 699 641 194 1278 ----
NM_005544chr21118 1350 1915 --
NM_005558chr16925 670 392 182 93 72 ------
NM_005563chr13617 83 26 ------
NM_005566chr11----1371 1435
NM_005578chr384799 4793 4777 4761 3863 3778 3653 229 1220 21458 462 12064
NM_005581chr194331 111 104 97 ------
NM_005584chr134573 527 251 110 ------
NM_005596chr964026 2282 2203 994 848 812 --22501 2466 11802
NM_005598chr1121595 1564 1430 1332 1311 1188 603 484 410 198 162 24 11607 2504 324 --
NM_005599chr131046 482 155 --31038 485 338 --
NM_005602chr361158 1145 853 228 166 158 1511 ----
NM_005603chr1831860 1250 63 ------
NM_005604chr661966 583 460 261 123 64 ------
NM_005607chr82881 57 ------
NM_005611chr163920 204 159 --1529 --
NM_005613chr132188 2065 1807 2890 312 ----
NM_005619chr194322 134 111 79 ------
NM_005626chr11154 ------
NM_005627chr63313 212 177 1218 ----
NM_005637chr1841725 1707 698 91 11875 11434 --
NM_005638chrX11654 1611 1689 --
NM_005639chr1211707 ------
NM_005644chr12366 353 ------
NM_005647chrX92506 2264 1144 844 790 764 638 462 433 --2781 750 12510
NM_005649chr51473 ------
NM_005652chr1641198 1169 309 192 2341 207 21201 174 11017
NM_005655chr821182 73 ------
NM_005660chrX139 --1164 --
NM_005662chr8------1118
NM_005665chr144008 1616 990 584 3753 721 617 13613 --
NM_005668chr553039 1374 881 764 221 32867 913 747 13850 --
NM_005669chr51334 1824 11758 12065
NM_005677chr371509 1453 934 515 472 285 217 --11342 --
NM_005686chr181548 1452 1427 636 407 337 285 31 --11211 --
NM_005688chr331048 968 81 ------
NM_005697chr153183 153 35 ------
NM_005704chr151029 747 404 152 104 ------
NM_005708chr13------1159
NM_005715chr671772 1062 428 266 213 122 33 ----11008
NM_005717chr11476 --1105 --
NM_005722chr22515 101 ------
NM_005725chr161826 1806 1561 668 550 312 11508 21566 66 --
NM_005730chr12173499 3458 3288 3203 2788 2743 2611 2595 2373 2322 1292 1180 1083 1047 731 654 343 32961 1413 328 21358 47 --
NM_005731chr2----1274 1359
NM_005736chr1031421 1300 27 ------
NM_005737chr241833 525 383 334 12811 32719 788 467 --
NM_005738chr731786 1320 202 ------
NM_005739chr1531881 1545 325 ------
NM_005746chr722524 831 --12336 12700
NM_005748chr1232455 1247 1237 ------
NM_005749chr171210 ------
NM_005754chr53323 172 164 2765 202 ----
NM_005759chr2124614 3800 3636 3317 3295 3223 3023 1271 1116 1000 358 46 14142 44170 1800 562 453 1662
NM_005766chr1371014 352 281 189 165 129 118 ------
NM_005768chr124541 507 122 52 ------
NM_005776chr141537 --1585 --
NM_005779chr56949 854 769 731 268 28 23425 3362 12419 --
NM_005786chr1811119 ------
NM_005789chr17182147 2099 2064 1917 1895 1802 1539 1495 1473 1419 680 520 488 439 343 311 303 146 11384 12174 11339
NM_005795chr23819 760 221 22143 535 --142
NM_005796chr16162 151 ----
NM_005801chr173753 65 58 ------
NM_005808chr372640 1439 1347 1279 832 800 23 12857 23379 2880 --
NM_005813chr252020 1998 1621 993 303 11860 ----
NM_005814chr1101231 1121 981 949 586 517 336 129 91 72 --151 --
NM_005819chr163458 3435 3193 3057 1347 1090 --33461 2936 469 --
NM_005822chr672222 821 468 372 170 53 34 --2723 277 --
NM_005828chr17224750 4724 4226 4160 4153 3967 3778 3754 3730 3668 1855 1784 1678 1519 1317 1100 855 818 582 531 250 235 34281 1125 740 24031 447 11972
NM_005832chr31974 --1259 --
NM_005834chrX2182 77 --1185 --
NM_005839chr12658 318 ----1805
NM_005840chrX277533 6824 6670 6561 6523 6413 6286 5537 5404 5380 2097 1829 1714 1387 1303 1078 916 847 660 591 585 573 530 497 464 443 34 67345 6024 5448 5239 4790 1790 26416 6190 --
NM_005842chr132533 263 ------
NM_005843chr241326 624 457 89 195 --21942 1330
NM_005851chr113319 283 63 --1295 --
NM_005852chr1761088 994 353 304 278 185 --21081 198 1264
NM_005853chr161113 ------
NM_005859chr51342 ----11111
NM_005862chr321019 932 ------
NM_005864chr145718 283 162 145 111 ------
NM_005869chr5--172 ----
NM_005871chr1031020 882 279 ------
NM_005875chr31124 1373 ----
NM_005876chr25790 749 743 702 45 ------
NM_005877chr2232045 173 44 --152 --
NM_005883chr1992547 2383 2241 2217 2197 2166 964 133 32 12772 135 --
NM_005885chr551563 1263 429 168 60 --31075 88 77 --
NM_005895chr12153958 3725 3709 3628 3572 3234 2979 2966 2523 1298 1289 1086 771 655 637 23114 805 23218 1536 --
NM_005896chr22811 650 ------
NM_005898chr1142762 1065 417 93 ------
NM_005901chr18108303 7402 7384 2333 2304 2222 1002 939 748 448 16362 58496 8041 6296 2365 207 28176 6847
NM_005906chr61321 ------
NM_005907chr611366 ------
NM_005909chr5104092 3527 3407 2914 2713 1605 1591 1154 815 773 --14259 --
NM_005911chr241224 947 580 343 ----11185
NM_005920chr1193706 3587 3508 3492 3276 3225 3053 2733 2522 2514 2436 2419 2373 1164 1153 388 218 85 23 13059 13157 --
NM_005922chr62373 143 1105 ----
NM_005924chr73981 836 188 ------
NM_005927chr53923 469 45 --1314 1795
NM_005928chr153519 171 27 1687 1157 --
NM_005933chr11132912 2765 2247 2228 1951 1854 1081 734 728 517 504 225 90 13038 2759 703 1382
NM_005934chr19142393 2305 2017 1970 1789 1782 1725 942 928 783 771 740 546 170 22226 408 32251 1728 77 --
NM_005935chr433925 650 408 25002 150 21724 816 13722
NM_005937chr17163912 3748 3649 3598 3530 3415 3338 3039 2916 2865 2579 1291 1196 900 821 463 13789 23751 2599 23536 2717
NM_005938chrX41338 1081 276 255 ------
NM_005941chr853591 2694 893 504 188 1862 1577 13548
NM_005943chr641317 1244 1145 61 ------
NM_005944chr32316 204 ----1977
NM_005955chr1115317 4343 3985 3972 3369 2085 1935 1623 1378 905 772 55356 5000 2067 1965 1477 --12099
NM_005962chr1031773 595 93 1196 ----
NM_005962chr1031773 595 93 1196 ----
NM_005964chr1751459 1391 1047 998 485 --2488 451 --
NM_005966chr222317 1655 11985 --11978
NM_005967chr127635 556 525 519 295 272 116 ------
NM_005982chr142201 193 1234 ----
NM_005984chr224508 476 358 101 --1442 --
NM_005985chr202567 206 --1664 --
NM_005994chr171633 --1281 --
NM_005996chr1231536 344 287 ------
NM_006007chr994150 4135 3870 3734 3716 2959 2793 520 283 23902 3492 14470 --
NM_006015chr15917 167 156 145 128 --1356 --
NM_006016chr612067 21838 880 ----
NM_006020chr1431305 1125 504 --2489 265 --
NM_006022chr132417 347 1337 1966 --
NM_006030chr331248 458 30 --157 --
NM_006032chr142234 37 ------
NM_006036chr25849 521 426 296 178 32587 2176 60 ----
NM_006037chr294929 4105 4046 3772 3125 3092 1918 1461 69 11307 ----
NM_006039chr176731 695 415 311 218 173 1953 ----
NM_006040chr1651246 921 492 454 112 --11395 21069 925
NM_006043chr166766 647 255 80 64 48 125 --1114
NM_006047chr2052748 2516 1316 633 400 ----12533
NM_006048chr141212 499 428 421 ------
NM_006054chr1151389 1035 1012 486 151 --1142 --
NM_006055chr23510 223 159 --22450 2420 --
NM_006062chr2101103 1022 996 886 364 317 109 95 89 58 31066 773 371 21235 938 --
NM_006068chr4------1283
NM_006071chr221247 ------
NM_006078chr22--199 ----
NM_006079chr61290 ------
NM_006089chrX21363 103 ------
NM_006090chr1----2642 584 --
NM_006091chr15121721 1714 1649 570 563 493 416 403 366 226 66 35 11795 31553 1409 672 --
NM_006094chr852107 1933 1597 932 26 12063 12225 --
NM_006095chr453974 2850 1178 1025 602 33950 1777 1130 ----
NM_006099chr13899 684 597 1818 ----
NM_006106chr1172632 2504 1245 995 918 562 153 ----12897
NM_006108chr1172143 1826 879 730 492 278 217 ----22308 1707
NM_006113chr141890 1868 1446 269 1142 1440 --
NM_006129chr82233 98 --2534 385 --
NM_006133chr11112360 2275 2157 2116 1865 1749 1611 1546 975 690 348 --1373 --
NM_006134chr2141469 1185 625 321 31202 1120 604 166 --
NM_006135chr141251 1042 951 494 1395 11096 --
NM_006136chr741185 1011 467 368 ------
NM_006147chr1291 21 ------
NM_006148chr17122956 2650 2598 2266 2208 961 822 780 766 539 315 223 1683 22576 130 --
NM_006153chr31244 ------
NM_006154chr151105 12093 12507 --
NM_006156chr14161 ------
NM_006157chr111273 ------
NM_006158chr841654 1620 626 570 ----140
NM_006160chr1791599 1429 626 401 394 269 239 211 135 1306 --1243
NM_006161chr5127 ------
NM_006166chr1232620 2591 2550 ------
NM_006176chr114601 299 272 235 1266 1687 --
NM_006177chr1461015 984 829 789 763 335 --1847 --
NM_006180chr94283 227 215 101 130 1844 --
NM_006185chr113229 98 78 --3660 479 91 --
NM_006186chr21132 ------
NM_006187chr12153201 2993 2472 2180 2174 1978 1070 1024 946 458 414 402 308 273 201 --1177 1950
NM_006191chr124950 788 119 49 2205 156 1642 --
NM_006192chr2012910 795 344 281 271 226 206 196 183 166 145 108 11050 ----
NM_006195chr951397 1268 1261 990 514 ------
NM_006197chr851834 1581 246 216 139 ----1458
NM_006201chrX81156 1027 888 866 822 286 212 79 ------
NM_006202chr1981888 1401 1284 798 618 601 163 156 1356 21688 410 --
NM_006203chr575436 4840 4200 1617 1271 819 504 --35439 3982 3793 11125
NM_006206chr452358 2238 713 123 26 12823 ----
NM_006216chr22447 230 ------
NM_006218chr3162 ------
NM_006224chr17102248 1968 1911 1631 870 734 559 517 499 273 22378 72 --12524
NM_006226chr2----11361 --
NM_006228chr83288 121 21 ------
NM_006237chr1362147 2115 1648 855 697 547 --1704 11511
NM_006241chr332421 2391 619 --21526 906 --
NM_006243chr12735 362 2741 718 ----
NM_006245chr64384 374 342 178 1765 ----
NM_006246chr141518 ------
NM_006251chr553185 3171 938 582 68 2748 392 3601 485 454 --
NM_006252chr1137496 7460 7336 6544 6326 6269 6254 6246 6177 2854 2640 1541 663 16922 --25347 2563
NM_006256chr1--21714 787 ----
NM_006258chr10----1559 --
NM_006259chr42839 696 ------
NM_006265chr841388 966 483 467 ------
NM_006268chr119980 944 867 325 245 93 84 77 46 ------
NM_006275chr2022463 191 22489 805 21730 63 --
NM_006277chr2----1181 --
NM_006279chr12934 594 ------
NM_006282chr20154729 4715 3426 3409 3155 3141 3123 2934 1538 1518 1235 888 834 270 103 13290 --2763 320
NM_006283chr8144891 4765 4754 4417 4028 3858 3174 3012 1862 892 554 512 242 235 24018 460 --21077 324
NM_006292chr11153 ------
NM_006293chr151174 1124 --1664
NM_006300chr1921809 343 --1219 --
NM_006306chrX45923 5914 1465 643 33651 1952 75 35882 4612 4455 24555 53
NM_006313chr1221223 593 ------
NM_006317chr55604 114 89 77 46 --4786 641 130 108 --
NM_006320chr41390 ------
NM_006321chr331647 1388 234 1881 21525 52 21423 842
NM_006322chr13164 ------
NM_006325chr121308 ------
NM_006327chr102295 80 ------
NM_006328chr115627 589 255 249 232 ------
NM_006329chr144698 151 120 33 1686 ----
NM_006330chr82616 152 --166 1651
NM_006333chr2143 1662 ----
NM_006334chr9152 ----1317
NM_006336chr9101429 1348 1336 1243 1231 961 553 484 323 100 ----1536
NM_006345chr41241 --2972 80 --
NM_006352chr151946 1557 1290 563 335 ------
NM_006359chrX52030 1681 828 582 489 1835 1680 --
NM_006364chr141818 ------
NM_006367chr13963 824 782 ------
NM_006369chr13384 358 133 ------
NM_006372chr61105 ------
NM_006375chrX----11655 --
NM_006378chr931242 1024 71 --31340 576 466 --
NM_006379chr7129 1726 ----
NM_006380chr1753547 3529 3280 1459 33 11634 1406 --
NM_006383chr153466 234 192 --1490 --
NM_006386chr2272233 1905 790 639 612 285 127 ------
NM_006389chr1141013 896 881 213 --1414 --
NM_006390chr1221869 156 21506 742 21341 670 --
NM_006391chr11155 ------
NM_006393chr1043067 2834 868 747 --23660 629 --
NM_006400chr12175 ------
NM_006401chr91167 ------
NM_006405chr14132 --162 --
NM_006411chr611948 931 902 334 239 122 109 102 93 41 21 ------
NM_006416chr6--1738 ----
NM_006420chr2062692 1209 1126 1022 689 345 13132 ----
NM_006421chr811209 --1265 --
NM_006422chr12382 74 22 ------
NM_006424chr471610 1351 1291 726 429 66 58 21893 1509 1383 --
NM_006425chr53479 364 346 1511 ----
NM_006434chr1032669 361 264 --1778 --
NM_006439chr42517 355 --148 1218
NM_006449chr211547 --12041 21581 1532
NM_006454chr4132624 2546 2413 2281 2244 2186 1941 945 872 555 231 189 66 --11079 --
NM_006457chr493929 3173 2863 2855 2777 1112 1100 1057 932 --13120 13950
NM_006459chr1051908 1875 1648 1534 120 --1530 --
NM_006460chr1731577 1122 174 ------
NM_006464chr2154343 4054 4011 3999 3749 2953 2871 1703 1621 1611 1588 1471 730 450 283 --44494 1384 1119 964 --
NM_006465chr15122003 1997 1940 1731 802 509 421 377 356 293 35 21 --11701 21770 779
NM_006469chr12332 291 --11444 --
NM_006472chr161186 829 503 280 159 51 ------
NM_006482chr1253572 2399 852 795 402 --11045 --
NM_006489chr1451746 1639 1606 1476 1274 ------
NM_006494chr194769 689 122 103 --1641 --
NM_006496chr13691 545 330 ------
NM_006497chr174808 635 281 273 --2796 629 --
NM_006500chr114999 391 212 43 --166 1259
NM_006509chr19--1382 ----
NM_006517chrX172074 1984 1971 1963 1918 1671 1498 1465 917 626 613 580 217 182 135 95 39 2729 520 22159 31 --
NM_006520chrX21730 458 ------
NM_006521chrX51293 943 380 87 76 --132 --
NM_006527chr4----1244 --
NM_006532chr1971773 1484 1460 586 575 429 291 11406 1828 --
NM_006534chr2083203 2805 2606 2217 2179 2128 260 197 ----1564
NM_006538chr294077 3871 3630 3472 3338 2619 1241 311 78 --22925 1017 --
NM_006540chr84404 266 145 59 ----11375
NM_006544chr1466121 5392 5205 5128 1250 210 23726 1806 ----
NM_006546chr17246621 6521 6217 5965 5959 5950 5794 5215 4557 4389 4380 4360 4353 2645 2504 2439 2141 2094 1082 1040 875 747 421 65 54563 4223 4201 1423 1137 45164 2186 790 173 15781
NM_006547chr711870 1390 11745 --
NM_006548chr351489 1348 297 286 229 148 ----
NM_006549chr12132651 2579 2544 2492 2467 2435 2040 2023 922 822 700 485 456 12716 42662 2341 2309 2056 --
NM_006557chr931125 1104 269 --21495 1128 --
NM_006558chr81493 ------
NM_006559chr121136 138 11012 164 --
NM_006560chr111143 ------
NM_006561chr10135925 5236 5215 5000 4916 4273 4265 3959 2211 1530 1289 393 28 34164 1910 463 35003 2012 169 --
NM_006563chr194457 362 318 126 1142 2109 28 --
NM_006565chr163438 341 72 1364 1830 --
NM_006566chr182378 358 --1875 11015
NM_006572chr1763398 2187 605 461 324 260 ----12996
NM_006574chr3165 ------
NM_006587chr421501 1265 ------
NM_006589chr13561 426 134 ------
NM_006590chr21463 2336 27 ----
NM_006593chr26754 670 648 308 272 64 --1746 --
NM_006595chr1121351 438 ------
NM_006599chr16197570 7557 7547 7478 7414 7183 7142 6705 5730 5151 2578 1788 1757 1701 1232 1154 1080 1042 775 --48055 7577 6402 2506 --
NM_006601chr122356 315 11129 1236 --
NM_006603chrX1759 --11372 --
NM_006608chr12119 25 ------
NM_006609chr241928 199 59 38 --12160 --
NM_006614chr362677 2421 1307 1295 579 45 ----12748
NM_006618chr181483 1296 1152 527 430 371 335 272 1613 ----
NM_006621chr161606 1597 1345 1324 609 480 --21609 244 11302
NM_006624chr10196 ----1579
NM_006628chr15114219 3541 3192 1836 1742 1605 1391 1175 1096 748 47 54651 4240 4189 3691 3556 ----
NM_006633chr5--1723 ----
NM_006636chr21675 ----1335
NM_006644chr131570 --1573 --
NM_006646chr1342184 1870 1095 788 --12591 22579 404
NM_006650chr5143629 3275 3132 2663 2542 1033 980 910 884 559 233 155 142 123 1202 33787 3608 553 --
NM_006651chr451507 1397 1288 960 561 --11301 --
NM_006654chr1284773 4168 4146 4132 3032 1845 1211 766 13192 1782 13129
NM_006658chr73174 129 87 ------
NM_006675chr12112851 2807 2544 2483 2324 1138 1044 1025 993 984 628 --1552 --
NM_006690chr2092199 2060 2027 1971 1956 1832 861 539 396 12185 ----
NM_006694chr15361 282 272 258 116 ------
NM_006695chr172238 97 --184 --
NM_006698chr2061315 1256 1127 434 396 387 ------
NM_006699chr142723 2360 2345 401 22485 2172 ----
NM_006703chr6265 59 1414 ----
NM_006706chr51296 ------
NM_006708chr631083 991 129 ------
NM_006709chr62106 21 ------
NM_006721chr102693 66 ------
NM_006722chr332396 2021 1928 22361 779 ----
NM_006724chr62373 143 1105 ----
NM_006726chr4--11235 1327 --
NM_006727chr5--1208 ----
NM_006734chr621230 1110 --139 --
NM_006735chr71360 ------
NM_006736chr2101760 1510 1190 708 606 543 536 528 440 129 ------
NM_006742chr16131834 1780 1715 1591 1457 1337 785 588 571 458 440 337 318 --11412 --
NM_006749chr83981 829 135 --1110 --
NM_006750chr16197520 7307 7045 5762 5468 5339 4890 3185 3176 2067 2049 1803 818 606 578 519 431 372 92 32204 2172 112 23153 1999 13166
NM_006751chr24919 749 333 204 1363 1827 --
NM_006754chr7--1281 ----
NM_006756chr811291 ------
NM_006763chr1102003 1930 1755 1743 1683 1604 1301 860 563 431 --12006 11489
NM_006766chr8102652 2629 2586 1866 1803 1795 1646 752 605 370 1391 ----
NM_006772chr6131707 1664 1647 1616 1452 1407 1205 1076 676 668 562 206 29 --11272 --
NM_006775chr622011 433 --12001 --
NM_006777chrX82871 2690 2471 1969 1176 843 360 354 --1579 --
NM_006778chr661496 1330 1317 1263 187 24 1165 --1392
NM_006788chr1851875 559 465 127 84 ------
NM_006795chr1181574 1450 1409 1384 1372 1045 568 527 ------
NM_006801chr195650 575 547 517 21 --176 --
NM_006802chr12373 287 11164 --172
NM_006803chr831754 785 682 --21371 87 --
NM_006805chr541076 673 666 188 174 ----
NM_006807chr17--1363 ----
NM_006811chr202916 45 ----1839
NM_006814chr2052448 2140 833 435 43 2273 203 1401 --
NM_006815chr1221229 239 ------
NM_006818chr13249 95 44 3935 698 51 277 21 1180
NM_006819chr111110 --2338 275 --
NM_006822chr172790 34 ------
NM_006823chr841147 1073 312 181 --1869 --
NM_006825chr123954 831 720 11001 172 --
NM_006826chr211249 1253 ----
NM_006827chr1482869 2591 2266 2260 2237 966 373 24 22980 2741 1349 --
NM_006828chr6146 ------
NM_006836chr121105 1507 1189 --
NM_006838chr1231713 685 218 ------
NM_006842chr11------1142
NM_006851chr1232082 904 381 ------
NM_006852chr17112634 2564 2480 2456 2361 1995 823 706 692 595 451 11895 22730 139 12867
NM_006856chr1271156 1074 1036 872 369 197 79 --1766 --
NM_006861chr1241861 1317 494 113 ------
NM_006870chr202811 31 ------
NM_006873chr23598 443 363 12749 1603 11330
NM_006874chr431250 1217 1210 11223 ----
NM_006875chrX6885 756 641 357 300 217 1193 ----
NM_006884chr331406 1334 113 ------
NM_006885chr1673442 3040 2819 1678 1113 1042 728 13522 41519 1128 1106 157 --
NM_006888chr1453130 3069 3031 997 26 11003 --11199
NM_006896chr751139 1081 813 428 377 1183 ----
NM_006901chr151360 ------
NM_006906chr114810 774 395 168 ------
NM_006915chrX21817 1652 11967 --2993 42
NM_006922chr252423 872 660 575 345 11030 12600 22362 484
NM_006924chr1753766 3755 3651 2964 1730 1147 --11211
NM_006925chr14--161 ----
NM_006930chr541870 1848 1785 1422 ------
NM_006931chr1251580 1574 436 49 27 ------
NM_006937chr172561 134 ------
NM_006940chr1261597 1404 1250 1235 571 554 ------
NM_006941chr2261089 998 860 807 394 376 --21118 397 --
NM_006943chr2073304 3223 2814 2623 846 372 279 --42902 778 289 102 1743
NM_006946chr112550 424 2541 165 1232 --
NM_006948chr212356 49 ------
NM_006950chrX5687 601 595 296 127 --1104 --
NM_006951chr101629 ------
NM_006958chr8185 ------
NM_006981chr93655 597 518 12670 32811 2641 37 --
NM_006987chr1781307 1229 1172 526 489 483 254 175 1842 1322 --
NM_006990chr182433 2339 1875 1781 663 450 187 128 11861 11966 12084
NM_006996chr131694 699 630 ------
NM_006997chr101313 ------
NM_006999chr53596 242 232 ------
NM_007005chr931033 153 32 ------
NM_007006chr1642309 523 446 312 1497 23042 2699 --
NM_007008chr21589 1806 ----
NM_007011chr15286524 6468 6058 5848 5359 5077 5040 5016 5000 4962 4883 4583 4394 1998 1984 1961 1889 1570 830 635 578 565 492 438 357 303 163 83 12681 35810 1113 77 --
NM_007013chr81414 21013 116 1137 --
NM_007015chr131270 ----1288
NM_007017chr51721 ------
NM_007024chr33514 466 58 137 ----
NM_007026chr173566 474 104 ------
NM_007030chr5134529 4492 4302 3469 3294 3158 1662 1564 997 938 891 379 164 31483 227 192 --1974
NM_007034chr13883 359 221 ------
NM_007036chr52822 691 ------
NM_007038chr2196053 4288 4198 3829 2237 1012 910 401 299 12132 25882 2175 11283
NM_007039chr1452051 1656 1554 472 82 11596 --11623
NM_007040chr1961105 391 277 266 252 23 --3936 911 423 1365
NM_007042chr382542 2492 2469 2314 2109 1943 126 40 1617 32298 446 405 --
NM_007043chr1221473 34 ------
NM_007045chr61545 ------
NM_007050chr20167027 6640 5749 5736 5046 3113 2733 2576 1675 1616 1424 1035 993 386 293 175 --57284 7146 6805 6667 3137 --
NM_007067chr1741293 1220 1108 305 11282 2605 248 --
NM_007084chr1351234 1198 448 412 88 1618 11177 21202 605
NM_007106chr1322628 2166 11784 1754 --
NM_007107chr332310 960 431 ------
NM_007111chr133874 620 159 198 ----
NM_007114chr321188 21 22782 72 --32479 2074 1074
NM_007115chr21178 ------
NM_007124chr621766 218 11739 ----
NM_007125chrY1406 1119 ----
NM_007129chr133374 330 26 --1319 --
NM_007137chrX115525 5045 4270 4188 4097 3907 3658 2137 1953 1623 757 --55070 4493 4199 3825 3594 --
NM_007144chr175482 470 98 88 49 1951 126 1373
NM_007146chr1752793 2637 1098 934 380 1816 --1940
NM_007159chr321778 85 11108 ----
NM_007166chr1131441 1357 66 --1115 --
NM_007170chr14341 248 141 84 ----1917
NM_007172chr2283304 2996 2292 2048 1287 426 187 48 12976 --2332 320
NM_007174chr1261851 1594 806 699 629 572 --11527 --
NM_007175chr823647 356 1220 1104 --
NM_007178chr12171 ------
NM_007181chr19139 ----1147
NM_007185chr18809 795 751 432 407 223 159 52 ------
NM_007191chr121156 1476 ----
NM_007192chr1441114 276 245 33 ------
NM_007195chr1873196 3145 2949 2893 1272 1254 818 11421 33621 3133 901 --
NM_007197chr12------1695
NM_007202chr174772 682 155 56 ------
NM_007203chr932920 517 424 --42860 1561 559 439 13646
NM_007207chr13799 276 198 ------
NM_007212chr161752 830 626 417 256 153 --1543 --
NM_007214chr621099 551 ------
NM_007216chr112842 360 ------
NM_007219chr206963 947 936 926 660 286 --1667 --
NM_007221chr12405 321 ------
NM_007222chr821729 1682 ------
NM_007232chr202709 51 1330 138 --
NM_007236chr1532393 504 253 31834 1731 1596 21582 660 2446 102
NM_007245chr166759 751 599 367 208 189 --1843 --
NM_007247chr171833 ------
NM_007249chr13227879 7410 7391 7273 6861 6805 6686 6671 6163 5822 5757 2820 2794 2672 2596 2503 2401 2199 2079 1324 1290 849 39163 6217 595 69176 8530 7966 7462 6629 396 38973 7733 2363
NM_007270chr761437 1190 1120 1084 503 482 21397 1024 189 --
NM_007271chr661634 1232 1215 637 126 64 184 1156 --
NM_007275chr3275 51 --1396 2331 246
NM_007278chr171142 ------
NM_007281chr4----142 --
NM_007286chr5102037 2026 1872 816 722 619 334 326 293 177 11985 52008 1942 664 347 235 --
NM_007287chr362952 2899 2280 2136 2077 1068 33123 1974 485 22914 2824 1700
NM_007288chr362952 2899 2280 2136 2077 1068 33123 1974 485 22914 2824 1700
NM_007289chr362952 2899 2280 2136 2077 1068 33123 1974 485 22914 2824 1700
NM_007292chr17144981 4875 4646 4394 3937 3731 3598 3449 3430 3232 1285 871 721 554 44561 3750 3464 406 34868 3617 3547 --
NM_007294chr1741276 386 195 85 ------
NM_007295chr1741276 386 195 85 ------
NM_007296chr1741276 386 195 85 ------
NM_007297chr1741276 386 195 85 ------
NM_007298chr1741276 386 195 85 ------
NM_007299chr1741276 386 195 85 ------
NM_007300chr1741276 386 195 85 ------
NM_007302chr1741276 386 195 85 ------
NM_007303chr1741276 386 195 85 ------
NM_007304chr1741276 386 195 85 ------
NM_007305chr1741276 386 195 85 ------
NM_007308chr4----1127 --
NM_007324chr1------1314
NM_007345chr182588 260 ------
NM_007350chr1284396 3552 3246 3191 1778 1732 1617 101 --13619 --
NM_007353chr7102927 1969 1154 910 834 739 664 627 590 429 22384 561 1904 --
NM_007358chr121819 1655 ------
NM_007365chr1162118 2043 1976 1955 1916 1873 1708 1658 1599 1531 866 848 729 655 556 484 1537 1378 --
NM_007373chr1031778 1154 380 ------
NM_007375chr142107 492 429 291 ----1909
NM_012062chr121810 1624 1210 --
NM_012064chr12--1791 ----
NM_012069chrX82562 2077 1910 985 714 273 230 197 22706 406 ----
NM_012074chr145954 240 140 129 108 1844 ----
NM_012081chr542360 2329 820 695 13670 ----
NM_012083chr1041096 949 869 240 --21147 542 --
NM_012089chr121003 557 --11218 --
NM_012090chr11862 ------
NM_012095chr1063429 3305 2855 2672 549 319 11087 23515 1111 1323
NM_012097chr241822 604 250 172 1638 11760 --
NM_012102chr172617 2250 2154 2055 2042 827 204 --42283 1874 877 570 --
NM_012104chr11103465 3082 2369 1442 1427 1160 1032 1021 998 432 11457 33368 3226 2673 --
NM_012104chr11103465 3082 2369 1442 1427 1160 1032 1021 998 432 11457 33368 3226 2673 --
NM_012110chr4170 ------
NM_012120chr622878 950 ----12882
NM_012134chr131716 1228 57 ------
NM_012141chr1364132 2861 2601 2517 740 287 --13876 11498
NM_012158chr13----11531 --
NM_012161chr431180 1035 807 ------
NM_012164chr9146609 6508 6082 6071 5690 5671 5395 4648 2859 2313 2039 1665 516 491 22463 2328 36325 6254 550 --
NM_012168chr12115 22 1285 ----
NM_012175chr111800 --1225 --
NM_012177chr61131 ----1477
NM_012188chr521044 811 ----1903
NM_012193chr11154994 4901 4728 4719 4631 4471 4033 3353 2157 1865 1625 705 682 332 146 24180 569 34997 4806 3579 --
NM_012197chr941093 635 266 256 ------
NM_012199chr1144520 4114 4080 3828 3648 2956 2936 1307 1153 1094 1087 1076 749 671 24454 3612 23271 1648 --
NM_012207chr10--1257 ----
NM_012214chr276158 5767 5630 3954 2420 2319 1573 35015 2365 2344 1154 --
NM_012215chr103568 401 374 11485 ----
NM_012219chr3113237 2799 2716 2631 2515 2460 2393 1199 1142 388 287 1195 42727 2379 568 187 --
NM_012232chr1792184 2053 2033 2026 1849 1727 334 140 64 ------
NM_012234chr331505 1385 1066 --2676 439 --
NM_012238chr1021705 1472 11334 ----
NM_012244chr14111426 1369 1317 735 592 575 349 241 192 101 27 --21497 1165 --
NM_012247chr10150 ------
NM_012249chr252272 1097 1001 861 384 --32275 245 41 --
NM_012250chr11158 11109 ----
NM_012257chr71772 ----1232
NM_012264chr22111771 1744 1723 1604 1543 866 844 831 442 375 149 --12028 --
NM_012264chr22111771 1744 1723 1604 1543 866 844 831 442 375 149 --12028 --
NM_012272chr122407 82 1152 ----
NM_012278chrX1150 ------
NM_012279chr5101876 1595 1586 1527 1361 807 743 377 270 144 ----1280
NM_012281chr711763 22069 140 ----
NM_012288chr6224931 4895 4791 4745 4681 4642 4619 4522 4153 4044 3932 3877 3636 2025 2019 2008 1864 1256 767 703 536 226 24856 2215 44953 3669 2307 184 --
NM_012290chr2142 ------
NM_012294chr763397 3053 2770 2644 1433 1214 --13891 --
NM_012296chr11183426 3251 3091 3029 2963 2917 2682 2644 2535 1527 847 420 395 292 83 68 61 55 1270 33378 2629 76 --
NM_012297chr432083 1836 165 --11856 --
NM_012300chr572200 1818 1659 1642 701 479 188 1746 ----
NM_012301chr721772 1553 ------
NM_012302chr1----11087 --
NM_012304chr592363 2342 2178 1957 1852 668 328 298 109 --42335 1697 927 791 12262
NM_012306chr12183422 3377 3306 3169 3064 2590 2404 2347 2298 2274 2253 2228 1272 1179 829 739 658 376 13400 23050 2922 1237
NM_012307chr182681 174 ------
NM_012308chr11161834 1814 957 908 822 810 795 590 576 454 394 297 195 120 69 39 32601 1648 201 3873 643 472 21767 549
NM_012309chr11174114 3816 3574 1501 1489 1399 1341 1168 1049 916 606 598 526 498 462 413 121 14228 44240 4171 3577 3210 24197 3373
NM_012311chr101584 ------
NM_012316chr1154547 4494 3793 3768 3689 3640 1963 1676 1640 1099 982 821 755 401 243 32200 861 607 54170 2207 2055 1569 1106 1946
NM_012322chr71108 --171 --
NM_012323chr2251530 1077 988 374 148 ------
NM_012325chr2021259 424 ------
NM_012326chr24764 272 248 63 ------
NM_012327chr184329 275 241 42 ----11585
NM_012328chr72199 42 --11235 --
NM_012329chr1721543 1255 --21199 393 --
NM_012330chr102628 376 ------
NM_012333chr131562 1296 456 ------
NM_012334chr563971 3957 3891 1583 439 359 43094 1715 1598 428 13426 13466
NM_012340chr202242 176 --1193 --
NM_012384chr2082230 2022 1838 1773 973 880 556 512 22033 1987 149 --
NM_012395chr7133002 2996 2584 2355 2327 2308 2293 2263 2195 2108 1287 1082 310 --13122 --
NM_012398chr19112963 2569 2495 2485 2278 1896 1095 978 734 659 178 1230 --1792
NM_012399chr2221802 555 11449 21530 130 --
NM_012402chr114415 243 228 206 ------
NM_012406chr1231202 978 841 --21133 343 --
NM_012414chr1----1525 --
NM_012416chr93820 247 98 ----1185
NM_012417chr172604 408 ------
NM_012420chr1051967 1492 1428 54 36 1777 32158 1754 372 --
NM_012425chr1071736 559 420 142 60 41 29 12467 --176
NM_012428chr152146 86 ------
NM_012429chr2231236 559 41 1396 1522 1480
NM_012432chr13251 114 59 ------
NM_012446chr51143 ------
NM_012448chr17112236 2226 2161 2057 1675 1022 851 688 675 547 241 --11840 --
NM_012453chr7101519 1415 1336 1147 431 223 169 136 106 78 11190 11150 --
NM_012456chr11145 ------
NM_012461chr146652 585 466 251 137 78 1207 ----
NM_012464chr442231 2109 1171 1029 --32363 2027 2006 --
NM_012471chrX41841 1641 396 59 ----11203
NM_012473chr228680 594 572 515 508 222 216 63 --1266 --
NM_012478chr1711832 688 678 407 297 288 190 101 52 36 24 ------
NM_012479chr752187 1929 1848 396 109 --2720 61 --
NM_012482chr1--1646 ----
NM_013229chr1242667 2225 1867 680 41129 993 826 695 --2442 170
NM_013230chrY2465 429 ------
NM_013231chr1464289 3593 3302 3237 1532 1200 --11155 11145
NM_013233chr251229 969 397 104 90 ------
NM_013243chr151164 1986 1313 --
NM_013245chr167723 646 573 547 539 232 216 ------
NM_013246chr112160 45 1173 2717 683 --
NM_013252chr752669 2617 1854 515 477 1446 ----
NM_013257chr832167 2033 300 ------
NM_013259chr32289 93 ------
NM_013261chr453400 3017 2774 2285 747 --43243 917 680 102 --
NM_013262chr621124 356 ------
NM_013269chr12104296 4290 4260 4242 4087 3954 3626 3503 1460 368 11260 33998 487 200 11179
NM_013275chr162564 155 ------
NM_013277chr123177 165 25 --1931 --
NM_013279chr11122220 2209 2198 2127 2096 2055 1621 1527 904 612 500 361 21577 632 ----
NM_013286chr3123684 3674 3552 3441 3053 2712 2687 2352 1354 882 416 101 22556 452 ----
NM_013293chr7292 74 ------
NM_013305chr184916 868 114 43 1813 ----
NM_013316chr73800 134 55 ------
NM_013323chr174965 822 311 260 --1173 --
NM_013334chr3----138 --
NM_013341chr262792 2761 2020 1127 1104 271 137 11130 12563
NM_013346chrX170 ------
NM_013354chr851354 373 358 318 100 ------
NM_013357chr82867 204 ------
NM_013363chr3----163 --
NM_013365chr226748 718 611 534 158 127 ------
NM_013368chr192200 124 ------
NM_013372chr1542919 2807 893 360 --11082 12409
NM_013377chr121604 ------
NM_013382chr14102068 1818 1773 1734 874 827 798 627 565 41 12029 11605 --
NM_013396chr2121292 338 ------
NM_013403chr198816 761 741 563 549 246 150 76 ------
NM_013410chr121078 362 ------
NM_013411chr142405 2032 1080 656 ------
NM_013433chr1971960 1945 1930 1878 1332 1285 476 ------
NM_013434chr2121939 1891 1770 1742 1722 1477 1410 799 696 585 450 250 ------
NM_013434chr2121939 1891 1770 1742 1722 1477 1410 799 696 585 450 250 ------
NM_013436chr21639 ----1570
NM_013437chr8--11114 ----
NM_013438chr921605 1295 11329 21438 642 --
NM_013443chr931103 986 361 --2305 110 --
NM_013444chrX3225 187 165 --11002 --
NM_013446chr73185 164 85 1102 188 11446
NM_013449chr12172994 2716 2379 2133 2005 1990 1207 1123 1101 821 709 657 565 516 341 176 37 3846 474 49 42117 1132 591 558 1647
NM_013450chr231047 865 350 1361 ----
NM_013937chr62380 298 1307 158 --
NM_013943chr132868 2143 36 1173 1291 --
NM_013989chr14124940 4926 4538 4026 3920 3340 3314 1452 1326 1142 890 555 31607 1275 442 23395 3369 14621
NM_013995chrX21755 356 1883 ----
NM_013999chr1771102 367 267 259 241 154 119 --1381 11289
NM_014000chr1021499 378 31524 1297 453 51761 1752 1416 635 390 11442
NM_014005chr5112500 2431 2250 2232 2102 2084 1966 1948 1211 825 636 22116 1981 12235 --
NM_014007chr911253 ----1792
NM_014010chr95623 555 509 153 62 ------
NM_014011chr221822 966 1411 ----
NM_014015chr162259 26 ------
NM_014021chr153348 3231 2954 2314 137 13391 22222 1207 --
NM_014023chr1062234 1879 1134 1109 882 250 ----1657
NM_014028chr653347 3036 2951 1285 515 12597 ----
NM_014030chr1771138 1121 868 479 284 253 245 ------
NM_014034chr65969 405 334 261 58 ------
NM_014056chr362241 2171 2036 1732 1567 487 21895 1439 --12058
NM_014057chr961523 1354 1319 1292 1116 505 --1436 --
NM_014059chr131135 --1346 --
NM_014069chr66384 286 275 113 101 28 186 ----
NM_014089chr131121 --11449 --
NM_014106chr1522040 676 1824 22130 939 --
NM_014109chr83865 455 413 ------
NM_014110chr13885 263 121 1414 21112 284 --
NM_014112chr824738 3513 24980 517 23336 532 24766 4329
NM_014117chr1692363 2321 2265 2241 1898 1036 749 447 93 ----11059
NM_014141chr7124615 4579 4200 3929 3911 3791 3506 3496 1780 1241 431 209 25057 3944 14849 13636
NM_014149chr73593 202 150 ----1698
NM_014153chr161182 ------
NM_014154chr31607 1312 ----
NM_014155chr11166114 5973 5675 5656 5629 5074 4643 2322 2116 1505 1474 1354 1073 403 143 114 36803 6074 2784 36651 5852 551 15512
NM_014157chr16113321 3176 2867 1433 1343 925 831 628 278 137 80 32622 1443 108 32809 865 794 13271
NM_014166chr131808 ------
NM_014169chr14149 1243 ----
NM_014181chr252387 2329 2045 877 827 ------
NM_014182chr123724 477 242 1139 1130 --
NM_014190chr451711 1604 592 559 63 1107 ----
NM_014212chr121948 ----1827
NM_014217chr141577 526 279 273 --1580 --
NM_014223chr12725 510 --1640 --
NM_014231chr1262158 2029 1958 1700 1484 830 21671 260 21805 1605 173
NM_014232chr17131633 1492 1379 1036 423 386 359 345 292 284 264 70 41 ----1657
NM_014232chr17131633 1492 1379 1036 423 386 359 345 292 284 264 70 41 ----1657
NM_014234chr61171 ------
NM_014238chr1771708 404 379 302 221 136 36 142 ----
NM_014240chr373366 2869 2760 2640 1140 1051 414 23518 3380 32765 2667 1158 1686
NM_014243chr441955 1938 1538 53 11753 ----
NM_014248chr22156 ------
NM_014250chr2241576 1568 1489 260 --11389 --
NM_014251chr73818 810 694 ------
NM_014252chr131125 ------
NM_014253chrX21923 1775 12516 2717 513 --
NM_014267chr11----1786 --
NM_014268chr1841140 565 160 28 21114 104 1306 --
NM_014270chr19170 ------
NM_014275chr52751 567 --2893 811 --
NM_014282chr931121 495 109 --11227 1192
NM_014283chr12356 323 ------
NM_014284chr13887 840 64 ------
NM_014289chrX41123 448 354 121 21004 152 11080 --
NM_014292chr22121781 1759 1578 1229 1205 733 548 323 302 285 92 65 11572 ----
NM_014293chr22134000 3862 3797 3722 3470 3448 3282 3102 2747 767 567 132 126 12725 23164 660 13368
NM_014297chr19281 24 --187 --
NM_014299chr19122045 1819 1759 1594 1468 1402 712 578 384 301 83 53 ------
NM_014305chr132283 257 --1222 --
NM_014309chr22205256 5136 5077 5067 4986 4922 4914 4710 4597 4456 3895 3633 3389 1862 1375 939 871 818 701 592 --24494 1211 11554
NM_014313chr171419 1344 1113 629 616 602 458 169 --1533
NM_014319chr1221641 69 ----1446
NM_014323chr222415 386 ----1164
NM_014325chr1232263 2212 692 --11387 1178
NM_014331chr4137121 6460 6197 5905 5856 5843 5160 3006 2698 2503 2346 2232 2175 --15312 --
NM_014332chrX1154 ----1317
NM_014333chr1152736 2661 2254 335 237 --1396 11006
NM_014335chr152998 988 ------
NM_014342chr1131383 1321 473 --1511 11483
NM_014344chr112698 226 ------
NM_014345chr62178 172 --1276 1955
NM_014352chr1141160 1024 1015 226 21175 199 ----
NM_014368chr951900 1617 371 169 163 11623 1270 --
NM_014372chr11378 --21941 662 --
NM_014376chr552196 2170 480 284 259 42581 560 349 336 52084 586 522 364 171 --
NM_014382chr31455 ------
NM_014388chr1116034 5803 4987 4188 4122 3846 3759 3739 3685 1522 262 53710 2304 2172 2036 2004 55846 4615 4523 4391 340 --
NM_014393chr832060 731 371 --1314 --
NM_014400chr193456 78 23 --1346 --
NM_014405chr17102260 2201 2141 1964 1713 1590 543 535 337 35 12271 1263 --
NM_014409chr14990 973 849 115 --1302 --
NM_014410chr181344 ------
NM_014415chr311219 --21470 1386 --
NM_014418chr1451788 1583 1454 1373 1335 1662 --1120
NM_014421chr442140 1756 767 422 11394 11706 --
NM_014423chr594631 4585 4528 4304 1658 1135 1002 328 116 ------
NM_014431chr1051596 1331 578 361 347 --21146 369 --
NM_014445chr342206 2159 1582 32 12387 ----
NM_014447chr41138 --11597 --
NM_014452chr631073 185 179 1975 1383 --
NM_014458chr131280 1274 258 --1883 11107
NM_014469chr111294 1662 ----
NM_014494chr16112220 2074 2050 1999 1909 1850 1666 413 390 347 133 1215 1799 --
NM_014498chr32341 334 ------
NM_014501chr19241 21 ------
NM_014515chr1211076 ------
NM_014517chr371630 1588 1457 1267 1237 734 164 --11460 --
NM_014554chr1262294 1693 1675 1663 1448 87 --11412 --
NM_014563chrX71810 1674 1393 689 671 358 340 31408 704 505 ----
NM_014572chr13137 --21168 517 --
NM_014573chr1731172 437 283 21569 295 21483 171 --
NM_014574chr1411360 ------
NM_014577chr221117 ------
NM_014587chr1651472 590 539 267 200 ------
NM_014588chr20193 ------
NM_014591chr1091237 1047 391 374 332 296 225 215 79 1209 1893 --
NM_014592chr53262 197 28 1746 1626 --
NM_014600chr291543 1490 1300 1216 1103 356 271 263 225 ------
NM_014604chr174619 532 195 59 --1159 1541
NM_014607chr23827 618 514 ----1726
NM_014608chr153490 439 46 ------
NM_014613chr5142697 2542 2266 2168 2133 1226 1148 716 708 436 419 341 279 26 12372 12658 --
NM_014614chr231320 589 110 1408 --21205 185
NM_014615chr1683654 3162 2736 2505 2344 2334 2277 589 12791 1269 --
NM_014616chr332785 1323 1061 32949 275 177 13059 --
NM_014620chr124691 611 197 121 ------
NM_014621chr22212 26 ------
NM_014634chr22153578 3516 3262 3206 2840 2415 2333 1225 1108 641 262 255 119 51 35 11291 43217 2666 2594 440 13625
NM_014636chr9134124 3459 3437 3275 2735 2712 1745 1363 1356 980 887 756 201 23018 1733 23462 2738 --
NM_014637chr821340 560 --1563 11243
NM_014641chr63525 397 21 ------
NM_014646chr18102999 2962 2945 2832 2491 2087 1063 650 290 149 --12461 --
NM_014647chr1641476 567 353 194 --22157 404 --
NM_014659chr152229 129 ------
NM_014660chr71366 ------
NM_014661chr1083237 1551 1030 695 515 504 297 205 23226 1257 43895 1398 755 507 --
NM_014662chr221463 ------
NM_014665chr8173690 3360 3317 3296 3290 3201 2860 2527 2486 2442 2345 2287 922 843 704 367 184 ----13503
NM_014667chr362313 1895 1703 1679 684 413 11720 ----
NM_014670chr22297 84 ------
NM_014671chr721613 577 ----2511 107
NM_014674chr3163667 3596 3505 3489 3475 3184 3176 2662 2654 1464 1403 1331 933 872 639 176 1476 22770 1504 --
NM_014676chr121385 440 ------
NM_014677chr831058 1035 1012 --21113 1019 --
NM_014682chr831659 537 141 ------
NM_014683chr1772194 2127 1888 1738 1483 250 209 --11900 1579
NM_014686chr1952564 1851 821 504 415 12527 1695 --
NM_014690chr7173068 2927 2405 2339 2118 2100 2087 2043 1998 1223 1189 1138 941 135 125 33 27 11148 32732 835 377 22259 437
NM_014700chr1691589 1536 1261 1234 999 617 547 414 292 ------
NM_014701chr1523237 1001 33257 2630 116 11354 --
NM_014702chr683294 3106 3021 2565 2461 1400 161 92 ----13194
NM_014707chr732288 2260 484 --1347 --
NM_014711chr1631774 429 36 ------
NM_014712chr164504 412 180 59 ------
NM_014721chr6107360 6312 5763 5338 4894 4707 4688 1282 1155 882 34701 2803 1381 35362 2572 2176 11942
NM_014723chr20113203 3123 2796 2707 2640 2313 2003 1285 812 698 472 22965 883 176 22927 429
NM_014726chr176980 913 286 276 186 153 --31225 1154 42 --
NM_014729chr81215 1614 1437 11577
NM_014730chr12215242 5224 5060 4963 4856 4823 4767 4309 4197 3949 3651 3540 3446 3430 3420 1904 1184 895 814 627 228 1820 35051 4869 1512 --
NM_014730chr12215242 5224 5060 4963 4856 4823 4767 4309 4197 3949 3651 3540 3446 3430 3420 1904 1184 895 814 627 228 1820 35051 4869 1512 --
NM_014731chr20101445 1352 1334 1251 1238 497 478 407 163 79 ----11804
NM_014733chr51635 1811 ----
NM_014735chrX51665 1508 1453 1418 513 1710 --1768
NM_014739chr694063 4011 3659 2740 2731 1637 1538 1095 331 11689 ----
NM_014743chr492534 2305 2041 1186 1115 1107 741 610 593 --1195 --
NM_014747chr1185383 5055 4934 4919 4611 4438 4118 3970 3783 3732 3688 2163 2050 1938 1930 1594 797 589 34662 3710 1836 54540 3983 3652 728 486 --
NM_014751chr842147 2092 395 243 11429 2848 769 --
NM_014752chr1141942 1567 208 29 ------
NM_014754chr85826 791 637 624 353 1715 1160 --
NM_014755chr294123 3046 2862 1526 1437 1299 1287 1237 49 1905 11565 11693
NM_014756chr111174 ------
NM_014757chr571805 1621 945 831 752 701 618 32160 1667 727 32046 1835 1646 11764
NM_014761chr164823 747 150 71 ------
NM_014764chr1241228 517 400 354 --1507 --
NM_014765chr132534 719 614 --22078 174 --
NM_014766chr7143354 2827 2388 1373 1264 842 792 676 626 492 398 192 76 40 --1922 --
NM_014770chr1261297 997 499 306 184 157 --11042 --
NM_014771chr162815 60 2861 692 ----
NM_014779chr31160 --1307 --
NM_014786chr1141051 852 219 61 1421 1824 1194
NM_014791chr91268 ------
NM_014795chr21105 --1504 --
NM_014798chr1751781 1692 1289 1266 152 11552 21511 402 --
NM_014800chr771139 883 763 471 464 295 227 130 ----
NM_014803chr101868 22099 905 2365 299 1648
NM_014810chr183631 3155 2636 2609 1360 888 880 793 --1542 --
NM_014812chr141589 1322 373 286 --11543 --
NM_014819chr53946 776 272 ------
NM_014822chr4149 ------
NM_014824chr111156 11400 2598 214 --
NM_014826chr193790 3460 3451 1611 1012 964 159 70 56 21150 281 23657 1379 12786
NM_014827chr11255 11265 ----
NM_014830chr12113841 3754 3541 3431 3404 2806 2622 2580 2401 1574 735 43781 3457 3000 33 22880 928 --
NM_014836chr1031843 213 128 ----1529
NM_014838chr2262701 2655 2594 1864 168 116 --1625 --
NM_014839chr132317 882 384 1492 1926 --
NM_014840chr1282741 2442 2295 2174 1261 1146 419 247 ------
NM_014841chr61401 --1968 1133
NM_014846chr8146 ------
NM_014847chr13374 217 207 --121 --
NM_014848chr1562813 2685 2323 1804 954 243 12547 31935 600 591 11133
NM_014849chr171187 1172 970 884 483 475 280 --1233 --
NM_014850chr3194300 4112 4040 3471 1616 1603 1592 1570 1494 1458 814 751 691 665 489 332 321 83 72 33700 1882 845 2545 293 --
NM_014858chr151090 870 851 812 168 --1299 --
NM_014859chr1721182 470 ----11267
NM_014869chr361143 996 371 228 211 105 ------
NM_014870chr1184605 4497 4461 4183 4032 3537 3394 3370 3352 3272 3169 2997 1393 1321 1181 990 785 775 34630 4130 660 13583 --
NM_014871chr12299 32 --1572 --
NM_014872chr951936 1639 1554 732 90 --32070 1625 862 --
NM_014873chr153376 1839 1308 1290 474 11323 11188 --
NM_014876chr2241603 1529 297 115 3826 794 692 1472 --
NM_014877chr17127367 6010 5992 5620 5592 2883 2856 2554 2490 2017 1439 957 26159 6025 12051 --
NM_014880chr282301 2265 2055 2044 741 715 688 321 ----22452 2109
NM_014887chr134719 655 141 121 --1852 --
NM_014892chr6148 ------
NM_014893chrY42262 1574 882 22 32085 1946 343 ----
NM_014897chr1783079 2569 2311 2298 2292 2081 339 98 12584 --1542
NM_014899chr552700 835 591 291 248 12954 12711 --
NM_014900chr221013 35 ------
NM_014901chr561433 1426 1406 747 716 261 --12028 --
NM_014902chr2061245 1219 468 415 293 173 11152 ----
NM_014903chr1222112 2072 ------
NM_014904chr1053928 3795 3736 753 116 --11254 --
NM_014905chr271668 1654 1579 1545 790 488 193 --2491 279 --
NM_014906chr1741016 296 258 32 ------
NM_014909chr14113962 3942 3378 3360 3164 3072 993 917 710 375 162 --22570 413 --
NM_014912chr1022604 931 ------
NM_014913chr1831181 420 409 --1289 --
NM_014914chr271273 1257 845 404 141 127 107 ------
NM_014918chr1521299 532 ------
NM_014920chr663240 2619 2531 1503 52 28 1823 11343 11093
NM_014921chr19162975 2946 2866 2829 2575 2503 1246 877 848 816 766 666 616 317 308 111 12781 42744 2028 325 202 --
NM_014923chr1342270 948 246 240 ----22302 2279
NM_014924chr1463114 2519 2232 1950 983 615 33160 2120 1984 42240 1970 1100 51 --
NM_014925chr125776 657 366 238 207 1381 1757 --
NM_014926chr351033 796 744 181 175 --21036 799 --
NM_014931chr195670 214 123 42 33 --153 --
NM_014932chr321936 1466 --11469 --
NM_014936chr632722 856 719 --1980 1924
NM_014938chr1252016 1936 1681 497 110 --1224 11919
NM_014944chr161412 1118 1064 379 292 256 --161 --
NM_014945chr581286 644 598 442 418 332 325 55 21416 710 22009 1226 --
NM_014947chr162507 1168 1019 1001 786 205 21034 231 12398 --
NM_014948chr2062207 2141 2090 2049 976 121 11982 ----
NM_014949chr12759 293 --1766 --
NM_014950chr143602 123 110 ------
NM_014952chr15111802 1622 1372 1314 713 682 670 635 554 534 214 --11984 --
NM_014961chr431594 1377 190 --1829 --
NM_014962chr2052542 950 875 762 296 ----1277
NM_014963chr193586 418 48 1231 1468 --
NM_014969chr13821 428 414 1740 1187 --
NM_014977chr144435 406 212 157 --2470 219 --
NM_014978chr1061569 729 697 342 298 233 --1413 --
NM_014988chr442573 1134 980 860 11746 12186 1817
NM_014989chr661356 1293 619 561 395 336 ----1735
NM_014990chr1451184 275 106 59 30 1835 1375 --
NM_014991chr442331 2305 255 55 ------
NM_014992chr143681 330 291 ------
NM_014994chr15142040 1996 1900 838 782 679 660 631 624 516 489 472 178 136 ------
NM_014996chr351047 802 210 147 126 --1186 --
NM_014997chr772893 2602 1947 1874 1108 990 250 1925 32914 1950 180 --
NM_015000chr1233089 2262 2219 --22411 461 --
NM_015001chr14925 906 851 34 ------
NM_015002chr123660 167 140 11432 --146
NM_015008chr363355 3078 2487 802 521 418 ----11436
NM_015009chr3--1602 ----
NM_015020chr1673298 2880 1219 1133 609 544 212 33532 364 227 53726 3704 1390 1191 612 12388
NM_015023chr1151816 1716 1684 1523 1453 1437 1425 1274 1215 1134 648 616 263 115 90 1396 --1680
NM_015024chr841377 973 909 267 --11125 --
NM_015025chr232197 1006 897 1777 ----
NM_015027chr1651503 1238 794 671 228 --21785 633 --
NM_015032chr1321819 516 ----11950
NM_015033chr993287 2689 2676 1063 895 511 170 132 62 21213 1078 ----
NM_015035chr20206369 6034 5112 4942 4468 4229 4148 4085 2525 1962 1712 1629 1486 1388 1153 997 483 224 130 97 1258 14114 15641
NM_015039chr1174112 3851 3700 3514 3258 2885 2682 1449 1428 901 439 400 361 322 105 87 62 --33261 1633 283 13855
NM_015042chr15254287 4279 4110 3718 3680 3672 3661 3636 3609 3441 3431 3323 3261 3100 2893 2709 1496 1490 1432 1343 1080 851 609 489 196 23646 862 33226 881 242 11362
NM_015045chr1021505 1434 ------
NM_015049chr242740 1122 601 496 12556 --12767
NM_015050chr681200 1121 1018 968 954 344 223 84 ------
NM_015051chr942849 979 788 144 --13379 11265
NM_015052chr771214 507 350 197 91 76 70 11382 ----
NM_015057chr131183 ------
NM_015063chr19111346 1271 1143 938 490 383 343 192 108 86 80 ------
NM_015064chr12113110 2989 2699 2676 2611 2451 2255 1320 1097 701 609 --13025 2992 824
NM_015068chr753948 3876 2944 1171 822 1902 3708 647 237 --
NM_015071chr5135167 4714 4324 4153 2313 2286 1101 1081 1069 791 655 472 458 35205 4671 1042 35273 1477 566 25499 2295
NM_015074chr194746 4155 3714 3418 1972 1451 560 121 58 --43450 3154 3139 151 13388
NM_015075chrX132097 1575 1477 1448 844 795 735 729 453 416 357 337 141 11870 1197 --
NM_015076chr683810 2843 2825 1816 1798 1425 715 200 22993 2858 --14080
NM_015077chr17164589 4360 3866 3533 3298 3226 3062 1677 1614 1537 1362 1063 331 125 82 36 12898 13051 11139
NM_015079chr15123177 3030 2791 2774 2632 2272 2178 728 656 461 450 119 12551 41197 741 713 244 --
NM_015080chr115934 391 226 98 72 ------
NM_015082chr552108 2093 1660 484 134 32507 1844 441 22399 1851 --
NM_015085chr17154050 3790 3437 3395 1697 1656 1577 1390 1015 831 774 500 268 218 208 --2852 614 --
NM_015086chr1261371 1282 1170 1003 556 66 --21065 1050 --
NM_015087chr1322252 2232 --12054 --
NM_015090chr1126019 5892 5804 5178 4849 4717 2355 1375 1367 1130 462 384 55811 5680 5221 3843 178 45912 5200 4611 2470 --
NM_015092chr16104468 4360 4134 3909 3817 3528 3263 2844 1840 990 ----13624
NM_015093chr63649 523 321 1309 ----
NM_015094chr22134638 4472 4248 3936 3898 3603 3448 2989 1806 1512 1470 1312 1117 23674 1696 24335 3943 --
NM_015097chr342306 1522 1474 292 --1111 22310 32
NM_015099chr173246 171 159 ------
NM_015100chr161718 1646 804 615 604 362 --11567 --
NM_015107chrX31883 463 283 --1873 --
NM_015110chr932006 1988 496 22155 2021 --1415
NM_015113chr1771917 1705 733 573 499 161 107 --22053 1604 21721 337
NM_015115chr433133 2799 110 --22802 401 --
NM_015125chr195450 373 211 171 80 1470 ----
NM_015132chr721767 768 --1277 --
NM_015133chr16111427 1310 1160 1122 1013 967 925 341 258 235 202 1111 ----
NM_015138chr1551010 938 811 800 388 12675 22113 187 1824
NM_015143chr421071 565 --11277 --
NM_015144chr1673341 3264 3255 2457 1078 821 314 13428 33789 958 854 1287
NM_015150chr33152 128 83 ------
NM_015155chr1072330 1048 975 904 594 529 156 22268 2177 162 --
NM_015156chr14133361 1384 1302 1064 859 636 627 576 353 322 195 135 96 22700 643 1286 33635 2628 1568
NM_015157chr1161109 937 775 443 409 260 ------
NM_015163chr147509 386 273 267 208 181 167 ------
NM_015170chr841962 1540 779 615 ------
NM_015171chr162211 62 --2112 78 --
NM_015172chr121287 598 ------
NM_015176chr141309 1212 534 166 ------
NM_015178chr862377 2094 713 375 312 66 --12158 --
NM_015185chrX112740 2732 2450 2388 2315 1103 1010 958 942 558 514 1265 1846 --
NM_015187chr4121 ------
NM_015191chr1142384 1048 827 101 12558 --12027
NM_015192chr2052571 728 162 92 58 22746 1965 22989 1105 --
NM_015194chr17122076 1871 1821 1673 1360 1351 1327 628 619 505 172 113 21481 74 ----
NM_015200chr462433 1990 1769 709 433 235 ------
NM_015202chr1681601 1534 1446 1426 1367 1052 608 30 11399 21155 586 --
NM_015205chr13193736 3699 3660 3609 3564 3426 3412 3312 3205 1333 1258 1099 831 764 704 241 134 65 59 --13722 --
NM_015206chr1583740 3050 2712 2644 873 847 801 616 --12800 --
NM_015208chr183941 842 505 --33719 2895 1365 --
NM_015209chr162275 2095 543 378 368 182 --11477 --
NM_015213chr11------167
NM_015215chr143211 2852 2694 2586 22797 748 ----
NM_015225chr992895 2337 1988 1933 846 553 438 424 253 --22652 2031 --
NM_015230chr421798 1592 ------
NM_015233chr1332430 2401 507 12323 12368 --
NM_015235chr1041875 1367 115 107 1841 11988 1771
NM_015236chr42229 134 195 ----
NM_015239chr9----162 --
NM_015245chr682719 2575 2261 2059 2040 1751 766 57 11757 ----
NM_015250chr941860 1689 453 252 ------
NM_015252chr22595 24 151 1339 128
NM_015256chr52704 568 1737 ----
NM_015263chr152398 360 ------
NM_015264chr22134545 4375 3999 3587 1942 1804 1564 1173 886 830 655 190 140 11755 34812 1253 939 --
NM_015265chr222497 586 ------
NM_015267chr1241655 1424 599 64 11384 ----
NM_015268chr3195 ------
NM_015270chr1251672 1541 931 536 394 --1256 --
NM_015271chr463834 3171 2925 2859 1680 27 1372 ----
NM_015272chr1641645 1314 514 329 --21931 27 --
NM_015278chr642209 1363 655 167 22218 1378 11345 --
NM_015282chr2122687 2171 2057 2039 1226 705 664 652 408 142 64 52 ------
NM_015284chr181933 1884 1536 1344 1312 833 441 414 11574 32029 1897 567 --
NM_015286chr1571621 1578 1572 259 245 132 103 ----11001
NM_015288chr5113819 3783 3663 3392 2598 2589 2483 1293 967 697 207 2998 739 13297 12723
NM_015289chr1531925 597 544 11912 31829 600 46 --
NM_015294chr1711084 ------
NM_015296chr131401 ------
NM_015299chr14103780 3747 3555 3402 3301 3286 3245 919 893 374 1195 --13431
NM_015305chr1471980 1421 1288 604 387 272 208 --2140 33 --
NM_015310chr8147155 7024 6870 6597 6226 5474 3109 2802 2490 1946 1195 983 881 833 --16990 11236
NM_015313chr1194824 4799 4075 3634 3526 3343 3162 687 231 --22946 792 --
NM_015314chr732174 433 173 ------
NM_015315chr5143168 3150 2939 2782 2311 2170 2108 1332 989 862 641 560 549 211 12685 ----
NM_015317chr232706 2487 2370 22520 747 ----
NM_015321chr19154761 4558 4293 4179 4128 4087 3760 3681 3156 3031 1469 427 338 248 160 23548 3408 24036 1279 11254
NM_015326chr1132785 2709 2297 2078 2072 1155 783 729 664 542 185 179 64 32316 1101 1019 12810 1143
NM_015327chr141309 1254 373 44 11216 ----
NM_015328chr732695 597 259 22241 478 31223 1023 623 --
NM_015335chr1292158 1913 1847 998 519 508 216 41 22 --1198 --
NM_015338chr2081851 1559 1515 1431 1376 1261 305 240 --1391 11519
NM_015339chr2021009 300 ------
NM_015344chr821767 1395 1480 1855 --
NM_015346chr1441429 1325 1223 532 --11595 1609
NM_015349chr662257 2070 1952 1226 545 103 --11013 --
NM_015355chr1711764 ------
NM_015359chr892839 2512 2211 2170 1054 863 824 490 222 12030 1239 22751 530
NM_015361chr24751 718 694 100 1257 148 --
NM_015365chrX104123 4097 3480 3205 3074 1387 378 359 332 47 --1615 --
NM_015367chr2251663 647 636 481 360 ------
NM_015375chr194849 4524 3831 3599 3512 3181 1762 1546 140 33775 3204 102 23368 1412 13668
NM_015382chr141517 ------
NM_015385chr1032669 361 264 --1778 --
NM_015387chr231744 720 460 --1684 --
NM_015388chr62278 34 --1281 --
NM_015397chr981562 1388 737 698 384 293 194 39 --11497 --
NM_015401chr123819 722 256 ------
NM_015404chr92525 24 ------
NM_015415chr11171 ------
NM_015429chr321060 387 ------
NM_015435chr821341 444 --11330 --
NM_015436chr433091 966 421 12610 --1684
NM_015439chr6----188 --
NM_015443chr1751052 1007 541 435 218 ------
NM_015444chr34259 172 110 56 ------
NM_015446chr111576 ------
NM_015447chr92689 289 --1181 --
NM_015455chr544101 3292 2801 1514 13894 21080 388 11534
NM_015457chr113829 706 91 ------
NM_015460chr34622 566 291 217 1256 41534 1325 725 459 --
NM_015461chr181611 ------
NM_015464chr71828 ----1367
NM_015465chr53660 552 488 --1205 --
NM_015469chr9------174
NM_015470chr281201 1114 974 426 395 288 126 59 --41004 953 232 75 --
NM_015477chr153983 677 323 ----1221
NM_015481chr12111088 1018 1010 930 882 231 225 105 84 67 22 1289 ----
NM_015488chr241683 1489 1346 524 --11547 --
NM_015493chr1952105 2089 1689 137 60 ------
NM_015496chr81205 ------
NM_015508chr341558 1370 1243 979 11489 ----
NM_015509chr1241538 1155 558 209 --11140 --
NM_015511chr2061124 897 278 107 75 38 1863 ----
NM_015514chr143534 428 121 --1102 --
NM_015520chr332150 1031 360 ------
NM_015526chr1971130 1077 934 267 166 91 48 1486 ----
NM_015527chr168736 699 593 523 265 200 134 41 --1207 --
NM_015530chr21604 --1921 --
NM_015534chr12885 215 --197 --
NM_015535chr2113878 3761 3743 3512 2848 2585 1487 1203 1179 984 856 43910 3776 3014 2601 22968 210 --
NM_015541chr321285 114 ------
NM_015542chr102961 196 ------
NM_015548chr61793 ------
NM_015550chr793583 3552 2387 2275 2245 821 771 405 39 --53510 2984 2971 2732 379 --
NM_015553chr6135053 5000 4651 4627 4274 4141 3605 3383 3286 1488 1240 122 22 24156 3150 24742 849 14470
NM_015560chr352494 2385 953 771 489 --12666 --
NM_015564chr552954 2577 1365 986 549 13253 --1992
NM_015568chr20154286 4190 3917 3891 3878 3786 3681 3651 2851 1506 1323 1193 1183 992 888 23342 450 43686 3666 1678 1525 --
NM_015569chr174598 3872 1929 1443 1347 620 491 --1402 --
NM_015570chr72696 570 --1225 --
NM_015575chr283135 2774 2518 2283 2258 709 397 32 33398 2532 1205 42808 805 524 311 22382 2287
NM_015576chr322241 1985 --12261 --
NM_015578chr1911372 --11769 --
NM_015584chr1771150 501 451 413 350 82 53 --1483 --
NM_015605chr1051525 1079 588 257 53 --1459 --
NM_015609chr1112922 2651 2505 2490 2094 1903 1084 873 480 198 190 12173 ----
NM_015630chr211132 ------
NM_015635chr941727 1593 879 174 11759 ----
NM_015642chr31224 --1217 --
NM_015645chr113297 36 30 ------
NM_015649chr191351 --1124 --
NM_015652chr101631 ------
NM_015660chr72222 61 ------
NM_015670chr17195 161 ----
NM_015680chr25607 573 565 473 171 --2594 540 --
NM_015686chrX62088 2077 1831 402 254 81 2938 247 12222 --
NM_015689chr7130 ------
NM_015691chrX32906 1974 1821 12128 ----
NM_015695chr6152153 1887 1851 1823 1730 856 762 723 460 443 359 208 178 133 105 --2538 463 --
NM_015704chr22----1129 --
NM_015711chr197695 683 670 657 651 268 223 138 ----
NM_015713chr843115 3056 590 499 22897 1007 13106 --
NM_015716chr177774 696 587 253 183 81 45 1203 ----
NM_015726chr181687 1675 1311 1138 453 424 335 249 --31851 1704 1300 11872
NM_015831chr76884 680 598 378 340 160 ------
NM_015844chr18--1396 1156 --
NM_015846chr18--1396 1156 --
NM_015847chr18--1396 1156 --
NM_015850chr862443 2132 1797 352 248 173 ------
NM_015852chr723460 3093 ------
NM_015855chr114770 358 269 143 ------
NM_015866chr141416 1410 1043 1031 ------
NM_015872chr181764 1709 1461 1452 1387 1161 601 134 --11726 --
NM_015874chr42486 143 --1568 --
NM_015879chr18197972 7890 7425 7292 7030 6234 6216 5748 5332 5217 3431 3061 2810 2655 2645 2297 1389 468 301 37125 6678 6058 47633 2343 941 904 38279 7854 1427
NM_015891chr622045 461 --1787 --
NM_015892chr10102470 2199 2165 2147 1991 1650 820 731 612 438 ------
NM_015898chr19152452 2314 2260 2118 1933 1846 1746 1685 1651 884 652 589 577 215 193 ----1902
NM_015906chr184506 4487 3723 3660 3644 3349 882 793 1763 --13262
NM_015913chr16659 521 510 221 215 138 1547 ----
NM_015915chr14188 ------
NM_015926chr32266 78 ------
NM_015941chr81307 ----1124
NM_015974chr13231 22 ------
NM_015980chr551474 1451 1223 1185 262 --11339 --
NM_015981chr5152968 2917 2520 2500 2455 2228 2036 1224 610 549 422 281 225 210 201 --4428 412 103 78 --
NM_015982chr171345 --1100 --
NM_015986chr171289 ------
NM_015987chr12149 183 ----
NM_015990chr421071 38 ------
NM_015994chr14----1662 --
NM_015995chr15135419 5216 4902 4755 4567 4046 3807 3613 1350 1277 1242 495 30 23596 2224 1702 --
NM_015999chr11298 137 1188 --
NM_016009chr154727 4565 3713 1935 1735 33996 1653 1515 33811 3323 85 13123
NM_016019chr72384 334 ------
NM_016021chr632164 2073 1904 --2766 712 --
NM_016022chr15879 775 729 292 100 ------
NM_016025chr1642006 1980 1385 310 --11408 --
NM_016026chr1441178 565 118 73 1377 ----
NM_016032chrX51194 1000 560 501 299 1382 21185 1059 --
NM_016037chr151008 886 457 320 163 31040 901 471 11117 --
NM_016041chr171310 --1389 --
NM_016045chr203375 291 42 ------
NM_016057chr1261103 1056 995 954 213 89 --1524 --
NM_016059chr64958 791 357 183 --1723 --
NM_016061chr231452 553 37 --21110 29 --
NM_016071chr7295 31 ------
NM_016072chr1222325 1639 32430 1501 722 11991 --
NM_016076chr172849 2227 1232 697 621 601 110 1880 --11137
NM_016079chr262063 1924 1704 1476 721 666 140 11862 --
NM_016083chr621217 77 23566 2864 --13294
NM_016107chr5----21183 238 --
NM_016120chrX1437 --1350 --
NM_016131chr271823 1659 946 795 769 758 744 ------
NM_016132chr1551268 875 509 350 121 1661 150 13337
NM_016133chr21109 --11549 --
NM_016138chr1671682 1563 1471 1352 1165 541 391 2555 424 --1606
NM_016139chr72276 40 ------
NM_016147chr1181098 453 358 321 270 235 118 83 --1948 11187
NM_016148chr19186 ----1134
NM_016151chr162344 319 1350 153 --
NM_016152chr311287 11032 ----
NM_016156chr1162216 2171 1970 1758 521 133 ------
NM_016162chr126317 227 214 148 140 130 --134 --
NM_016169chr10153262 3012 2791 2638 2477 2352 1249 1176 1119 1019 729 641 498 417 58 11166 11304 12813
NM_016192chr2----1252 --
NM_016201chr392181 2002 814 758 722 125 105 62 36 12069 12175 --
NM_016203chr71672 --1128 1775
NM_016206chr3198051 7799 7609 7475 7281 7275 7212 5452 3375 3359 3201 2456 1915 1822 1606 1520 1394 507 243 27641 7159 43276 2356 1596 1507 22236 788
NM_016224chr682078 1787 1512 1351 742 289 76 41 --31902 374 364 --
NM_016227chr12356 323 ------
NM_016231chr17--11225 ----
NM_016233chr16905 877 785 249 151 138 ------
NM_016240chr891604 1487 1389 1182 1168 1063 1037 562 520 11493 1649 --
NM_016242chr42210 110 --1219 --
NM_016248chr13101344 1335 1302 1284 1275 1262 1239 1084 624 552 1898 64002 3249 3226 1405 1338 1312 --
NM_016252chr21944 ------
NM_016255chr662746 2540 2286 1134 1108 880 12195 21091 496 --
NM_016256chr16145 ------
NM_016257chr193002 2331 1022 996 607 467 437 227 80 21406 52 22882 679 22443 1370
NM_016260chr2136590 6308 5637 5611 5581 5077 4669 2949 2552 2352 1170 1143 1082 22184 526 --26067 5679
NM_016269chr42345 322 130 ----
NM_016271chr1832373 2117 334 ------
NM_016272chr22122564 2433 2426 1957 1909 1876 1860 1741 1020 790 771 375 --12459 --
NM_016277chr61236 21574 104 ----
NM_016279chr5176 ------
NM_016281chr123978 111 104 ----1946
NM_016284chr163796 733 89 --1100 --
NM_016287chr172062 1916 1801 1605 1345 822 519 21377 837 --1325
NM_016289chr221950 1772 11605 --12295
NM_016298chr362774 2761 2679 2175 1075 999 22686 2540 12036 --
NM_016301chr121416 ------
NM_016303chrX1382 ------
NM_016308chr1--1611 ----
NM_016312chr12191 --1533 --
NM_016316chr2----1532 --
NM_016322chr982928 2357 899 797 581 382 241 212 11970 12640 --
NM_016333chr165332 194 140 100 63 ------
NM_016338chr52970 791 ------
NM_016340chr521087 821 --1932 --
NM_016357chr122917 827 1308 ----
NM_016374chr11250 ------
NM_016374chr11250 ------
NM_016376chr17124221 3709 3433 3204 2870 711 402 369 329 323 279 104 14285 12688 --
NM_016396chr1572885 2564 2516 2050 1146 1037 365 11119 12172 12985
NM_016418chr22163767 3742 3533 3527 3247 2936 2918 2322 1443 1364 1182 1044 844 313 188 98 63085 3053 2951 2336 1458 1077 1260 --
NM_016422chr1172819 2195 1056 694 297 165 107 11216 2731 174 --
NM_016424chr1711521 ------
NM_016436chr2041940 929 537 418 12050 --1815
NM_016441chr21178 ----1694
NM_016454chr151329 ------
NM_016456chr18890 684 329 304 138 103 82 52 ------
NM_016463chr5----1120 --
NM_016472chr141480 1122 ----
NM_016476chr171263 ------
NM_016483chr33322 230 222 --1249 --
NM_016484chrX2458 449 ----2557 462
NM_016486chr12183 141 ------
NM_016489chr7128 ----1182
NM_016505chr12118 98 1522 1512 --
NM_016506chr11140 ------
NM_016507chr1793100 3066 2270 858 792 778 685 596 49 --22282 2197 --
NM_016513chr663240 2619 2531 1503 52 28 1823 11343 11093
NM_016516chr22638 244 ------
NM_016519chr4144 ------
NM_016522chr1111540 --11474 1242
NM_016525chr94857 782 713 262 ------
NM_016531chr484186 1117 813 519 188 149 66 50 24106 1340 13996 --
NM_016532chr1741180 1141 165 132 --11043 --
NM_016544chr293798 1441 1217 1166 1159 1150 718 88 51 ------
NM_016545chr11882 ------
NM_016559chr321443 326 1603 --11399
NM_016569chr1231536 344 287 ------
NM_016574chr1161119 942 932 923 265 35 ------
NM_016575chr12135180 4987 4967 4844 3862 3796 3789 2091 1358 1340 991 432 192 53381 1507 1475 1373 515 1787 1149
NM_016577chr3164380 4369 4247 4031 3743 3357 3285 2967 1494 1349 709 699 691 440 121 25 13166 11282 --
NM_016578chr11146 ------
NM_016588chr63728 642 52 ------
NM_016592chr2051326 1242 1207 565 25 2886 340 ----
NM_016596chr123819 722 256 ------
NM_016598chr331482 418 266 ------
NM_016603chr51621 2556 177 ----
NM_016604chr551154 841 834 511 299 ------
NM_016605chr582585 2536 2059 1898 1878 1754 932 900 22173 1975 144 12766
NM_016618chr21420 ----124
NM_016620chr111454 ----1975
NM_016621chr11204649 4431 4350 4278 4076 3808 3769 3603 3478 3153 3018 2878 1584 1535 1500 1292 766 714 657 282 ------
NM_016623chr81130 ------
NM_016626chr181418 11090 --11171
NM_016628chr102636 570 ------
NM_016631chr211264 144 ----
NM_016652chr2031779 1631 1282 11690 21782 383 --
NM_016654chr1531122 980 873 --1455 --
NM_016819chr33517 368 214 1146 2138 39 --
NM_016824chr1011364 --1172 --
NM_016829chr32306 177 ------
NM_016830chr123520 391 62 133 1167 --
NM_016930chr43806 737 71 --1383 --
NM_016936chr1662067 1803 1549 1438 574 161 --162 11500
NM_016946chr1103412 2934 2725 2212 2199 1439 1290 1269 526 497 33361 3228 2347 ----
NM_016950chr4179 --21379 302 --
NM_016952chr1193574 3068 3046 2904 2710 824 526 277 196 1684 34021 2886 545 --
NM_016953chr255579 5071 3999 591 230 25305 4581 46025 5928 862 716 --
NM_017409chr124599 532 179 42 1145 1590 --
NM_017410chr1241114 1107 789 481 --1504 1874
NM_017412chr821405 970 ------
NM_017413chrX112165 1834 1814 1556 1010 967 766 681 228 100 51 1667 3948 941 203 --
NM_017415chr5114011 3514 3467 3389 3134 2777 1729 1285 1254 1227 127 33534 3106 1668 34564 953 705 11795
NM_017420chr1463192 2787 2710 2533 2470 2459 1893 180 --
NM_017423chr422039 785 ----21581 833
NM_017425chr11176 ------
NM_017432chr191440 ------
NM_017437chr1462379 2339 2318 2098 1864 492 32247 2215 215 2614 552 1893
NM_017447chr2124213 3833 31180 1117 872 33146 217 46 23952 1623
NM_017449chr1121589 1557 1448 1388 1363 1356 1272 1160 1151 636 358 28 --11592 --
NM_017450chr1731187 1068 985 ------
NM_017452chr2031301 1272 338 11410 1284 1566
NM_017453chr2031301 1272 338 11410 1284 1566
NM_017454chr2031301 1272 338 11410 1284 1566
NM_017455chr152146 86 ------
NM_017456chr1741858 1298 594 520 --41288 761 236 56 --
NM_017459chr1179 ------
NM_017481chr11----272 48 --
NM_017483chr291232 1125 958 440 423 367 252 244 38 11269 159 --
NM_017488chr271567 1460 1293 587 579 373 260 21604 253 1394 --
NM_017510chr53438 200 30 ----1679
NM_017519chr6----1312 --
NM_017522chr111235 ------
NM_017544chrX------1872
NM_017546chr22878 553 ------
NM_017548chr321902 1690 ----11917
NM_017550chr194842 824 339 75 ------
NM_017551chr1032143 1686 32 22561 193 ----
NM_017553chr1541285 917 397 275 ------
NM_017558chr16----2372 297 --
NM_017575chr1791589 1537 1524 1068 1037 644 514 303 292 1182 11023 1129
NM_017580chr1072357 2039 1961 1525 1496 906 873 21825 254 ----
NM_017582chr131504 1352 641 ------
NM_017586chr961987 1890 1626 771 744 467 1531 ----
NM_017590chr2292176 2107 1782 1643 540 412 392 249 150 2963 320 ----
NM_017594chr943064 2910 552 525 12625 ----
NM_017596chr1234231 4223 4154 4083 3950 3389 3382 1793 1782 1298 1283 869 763 727 715 698 399 127 121 64 54 38 25 13578 23455 987 --
NM_017602chrX7779 372 198 167 124 114 82 --1170 132
NM_017610chr1551865 1441 747 39 33 ------
NM_017612chr122416 99 ------
NM_017617chr931193 1040 458 ----137
NM_017622chr173616 270 198 1263 1123 --
NM_017626chr1081474 1463 1348 1337 1096 397 267 165 --3589 270 168 11414
NM_017629chr11759 --11521 --
NM_017633chr663721 3148 2862 336 282 203 12944 1219 --
NM_017635chr111476 ------
NM_017637chr9229029 8824 8713 8706 8208 8189 8065 7508 6604 6299 6277 6228 6035 5960 5748 3541 3104 3016 2599 1573 369 33 27101 6306 49036 8738 7214 6182 33474 2159 1551
NM_017640chr64593 231 81 24 --1578 --
NM_017643chr1742752 2334 1897 849 12175 12659 --
NM_017644chr394883 4836 3754 3508 1526 1253 1101 136 85 43907 3784 893 750 ----
NM_017650chr774807 4466 1502 933 861 69 55 35506 4209 4092 21519 1013 --
NM_017658chr1453947 1570 799 357 261 --33630 3060 1754 --
NM_017660chr19102818 2293 1230 761 477 458 443 258 250 236 --23043 2131 --
NM_017661chr152845 346 1199 ----
NM_017664chr1331091 406 149 ------
NM_017666chrX61532 1408 687 623 233 126 11564 --11423
NM_017667chr7------1423
NM_017668chr165254 115 97 79 49 1734 1106 --
NM_017672chr152309 66 1485 ----
NM_017686chr12346 31 --1811 1771
NM_017697chr82550 447 ------
NM_017709chr182932 2881 1628 1579 1313 965 906 54 23019 1253 12821 --
NM_017715chr75707 691 482 274 186 --1663 --
NM_017719chr312500 12484 1192 --
NM_017724chr31280 1666 ----
NM_017736chr1632382 1938 743 --32813 1947 261 --
NM_017737chr14862 352 346 222 --11564 --
NM_017740chr1651385 1344 578 179 40 ------
NM_017742chr1851867 1226 758 403 192 1579 ----
NM_017744chr171775 1664 1642 1538 986 744 217 ------
NM_017748chr171716 1875 ----
NM_017749chr112706 205 --2357 294 --
NM_017753chr911005 ----144
NM_017754chr6154737 4472 4391 4339 3968 3943 3880 3273 1764 1138 1021 946 893 719 437 23141 1472 2921 865 14087
NM_017758chr1761381 1275 952 543 463 431 ----11476
NM_017761chr111560 ------
NM_017770chr65745 719 576 249 236 ----12525
NM_017772chr661636 1611 1604 1142 441 434 21705 1595 ----
NM_017778chr851220 1191 993 516 501 ------
NM_017787chr1082566 2455 2322 1117 645 263 189 135 22444 1803 --1822
NM_017789chr25697 654 573 215 48 1800 1778 --
NM_017799chr1431724 1684 256 142 1115 --
NM_017801chr332596 1037 949 1342 ----
NM_017811chr9142901 2778 2716 2705 2499 2168 2037 2000 1948 1167 969 798 280 234 ------
NM_017813chr875414 5255 5068 2047 1122 735 149 45774 2199 2167 2062 11433 11276
NM_017816chr4145 ------
NM_017822chr122731 176 --175 1283
NM_017824chr1062058 921 877 767 614 109 --2928 32 12198
NM_017826chr131695 129 ----
NM_017848chrX104461 4398 4182 4163 3804 3184 1812 1144 279 146 2713 507 34455 4121 1132 --
NM_017849chr2143098 3085 2871 2719 2045 1946 1258 952 910 539 215 174 80 22 42797 2534 2502 881 2913 717 --
NM_017851chr1551138 350 232 169 68 ------
NM_017857chr114187 160 133 95 ------
NM_017860chr11611 1600 ----
NM_017866chr81803 ------
NM_017873chr9122930 2720 2387 2378 2313 2080 2045 1187 1169 957 720 451 1794 1191 --
NM_017893chr1041481 1140 931 539 1588 21323 357 2118 31
NM_017902chr10235381 4721 4638 4605 4502 4490 4473 4181 4134 4059 3979 1980 1890 1670 1649 1575 1543 1426 760 417 405 228 179 14156 45451 4384 4208 810 15196
NM_017906chr62102 77 ------
NM_017907chr113367 326 30 ------
NM_017910chr2178 ------
NM_017915chr123743 393 301 ------
NM_017919chr9115119 5020 4930 4184 2035 1465 1159 1142 1088 614 263 14498 74848 4045 2213 2079 1106 811 348 1588
NM_017921chr1782199 2122 1838 1635 1591 1561 799 582 --11778 --
NM_017922chr141110 ------
NM_017933chr2----1487 1271
NM_017935chr4----1241 --
NM_017938chrX21434 412 21395 622 21491 447 --
NM_017943chr14------1815
NM_017944chr1133021 627 23 ------
NM_017953chr15973 798 390 212 35 1404 ----
NM_017954chr731557 1495 1488 --11356 21199 1117
NM_017964chr22999 887 2708 48 ----
NM_017969chr2----1145 --
NM_017974chr261161 1127 381 280 181 109 2481 391 11057 --
NM_017982chr141056 1016 894 28 1521 --11172
NM_017983chr171170 ------
NM_017987chr1061523 852 711 494 486 85 ------
NM_017994chr742966 2535 1973 993 ------
NM_017998chr93897 884 338 1576 ----
NM_018010chr341621 1459 1123 247 ------
NM_018011chr132437 177 ------
NM_018014chr21147 1920 ----
NM_018027chr10102245 2102 2044 2019 1106 869 850 838 229 165 --21283 1109 12293
NM_018028chr1971198 988 919 505 342 269 179 11236 ----
NM_018030chr1851021 805 799 430 72 ------
NM_018032chr163616 384 56 --2778 623 --
NM_018037chr12267 261 ------
NM_018045chr1123069 2916 2743 2714 2687 2453 2375 2262 2255 2092 793 644 --1699 --
NM_018061chr131186 105 61 ------
NM_018063chr102310 54 ------
NM_018067chr12428 422 ------
NM_018070chr13529 134 112 1229 --1162
NM_018071chr1411732 717 669 602 339 307 262 196 177 106 37 --2767 274 --
NM_018072chr11183 ------
NM_018079chr23499 431 191 ------
NM_018084chr233278 2330 991 1789 2690 296 --
NM_018085chr1157866 7044 6876 6659 6429 5057 2981 2943 2804 2690 2460 2347 820 692 249 --27722 776 --
NM_018086chr241813 1630 1560 1319 --11507 --
NM_018092chr1611068 --2156 93 --
NM_018095chr11140 ------
NM_018107chr145858 752 728 368 323 --2722 65 --
NM_018110chr161931 21242 1196 1487 --
NM_018121chr1072714 2615 2237 2213 2005 1222 448 ----12192
NM_018128chr172985 303 --1523 --
NM_018131chr101741 ------
NM_018133chr32844 451 11994 ----
NM_018149chr17------195
NM_018150chr17904 844 833 653 254 213 74 1305 3813 614 577 --
NM_018154chr192154 53 --1319 1627
NM_018155chr333043 2317 459 --13186 1243
NM_018157chr1273037 3006 2779 2503 2482 622 382 124 13274 --
NM_018159chrX31380 535 126 2415 101 ----
NM_018164chr121243 1205 ----
NM_018167chr141745 149 --1619
NM_018168chr141553 2471 56 1451 21410 66
NM_018171chr122684 186 2860 52 ----
NM_018172chr1131425 1080 1054 11247 21356 1092 --
NM_018178chr181646 1305 801 701 201 191 28 22 --3635 429 258 1705
NM_018182chr17152213 2069 1963 1957 1926 1841 1770 909 797 319 311 287 259 232 48 11600 32216 1725 452 --
NM_018184chr32761 76 --121 --
NM_018195chr112612 553 11786 --11955
NM_018196chrX41365 279 214 102 --21376 1046 1346
NM_018200chr1562271 1938 1789 1588 1034 803 --42339 2182 565 247 --
NM_018206chr163520 483 68 --1112 --
NM_018207chr161497 1315 525 324 315 255 11225 31208 567 183 --
NM_018211chr11408 --21842 116 --
NM_018214chr62116 35 --3854 196 146 --
NM_018218chr241783 1774 1410 518 31417 1276 28 1253 --
NM_018227chr483084 2062 1257 1231 997 991 696 282 ------
NM_018231chr163939 763 649 --2260 127 --
NM_018240chr13843 704 113 --2348 146 --
NM_018244chr202479 228 1898 21151 214 1313
NM_018246chr842346 2249 1776 442 ------
NM_018247chr642887 2146 742 151 12250 ----
NM_018263chr242102 1929 1036 385 22478 2037 32546 1937 1781 11040
NM_018286chr172813 148 ----1852
NM_018287chr101334 ------
NM_018293chr32692 86 22288 205 ----
NM_018299chr843419 3151 2232 22 ------
NM_018302chr432135 1972 679 ------
NM_018307chr171926 ----1283
NM_018313chr342463 1990 1975 1887 ------
NM_018314chr111659 ------
NM_018315chr41623 ------
NM_018320chr1161244 993 951 412 374 60 ------
NM_018325chr91107 --11387 11655
NM_018327chr2061887 1858 1216 207 112 85 --21639 658 1216
NM_018330chr1011719 --11756 11555
NM_018351chr12104523 4434 4173 4142 3852 3686 3410 3174 2868 725 23759 1039 43981 3372 3315 3104 13924
NM_018362chr1163393 3275 2766 879 860 122 33425 3290 2780 23325 2708 --
NM_018364chr193740 3656 3635 3241 3070 2935 2818 2628 1275 13295 ----
NM_018371chr871135 1028 642 549 388 144 83 ------
NM_018372chr11655 ------
NM_018373chr14116033 5523 5234 4671 4367 3985 1174 397 298 87 81 25671 28 ----
NM_018374chr773978 2068 1620 1525 1413 1407 455 21916 58 13687 11472
NM_018375chr1441917 1189 755 437 ------
NM_018388chrX11509 ----1955
NM_018400chr11113998 3927 3772 3682 3637 3230 3122 2951 1641 821 313 44308 3204 1255 827 53935 3444 3383 3000 272 --
NM_018403chr373894 3232 2911 2717 2602 2593 1057 ------
NM_018409chr462982 2976 2861 2396 2125 722 --12341 --
NM_018416chr12132498 2290 2228 1999 1988 1958 1636 1032 950 566 445 278 193 --41867 1817 1015 965 --
NM_018423chr1231202 319 124 --182 --
NM_018424chr951841 1350 449 428 401 --123 --
NM_018440chr8167658 6721 6499 5993 5554 5538 5470 2452 2026 1560 1167 768 705 442 396 242 --52203 2141 2029 964 147 --
NM_018442chr12261 117 ------
NM_018448chr1241310 1250 1091 1083 --1152 --
NM_018452chr6_random63527 2687 2563 2478 1381 1070 --63728 3599 921 911 196 93 --
NM_018457chr122572 520 --149 --
NM_018462chr34602 594 334 91 ----1342
NM_018471chr21572 ------
NM_018482chr842338 2156 2065 255 --21579 984 --
NM_018489chr151798 1499 1471 531 501 ------
NM_018490chr1121211 25 21745 1479 ----
NM_018509chr1771515 1452 1304 687 670 651 28 --2623 604 --
NM_018534chr24546 118 104 79 ------
NM_018553chr1761843 1698 1565 1211 591 429 --1228 1413
NM_018557chr221116 507 11092 ----
NM_018566chr144330 1909 1894 1286 11228 21954 1371 --
NM_018571chr22474 45 ------
NM_018584chr111146 1442 ----
NM_018640chr1222558 962 --12237 --
NM_018644chr11121669 1466 1395 1371 737 722 580 538 522 205 58 49 192 11607 --
NM_018649chr101156 1499 ----
NM_018650chr131511 356 101 ------
NM_018652chr153915 644 256 --1147 --
NM_018660chr892449 2440 2296 2262 2015 1027 1007 779 210 11921 3397 294 160 23023 1904
NM_018667chr16122758 2360 2332 2155 2110 1945 1101 980 800 718 601 328 --1532 --
NM_018682chr71522 ------
NM_018684chrX61104 960 491 400 233 151 11064 3236 140 108 --
NM_018695chr52431 378 --1381 --
NM_018698chrX21960 1771 --11258 --
NM_018710chr82882 283 ------
NM_018711chr1221069 356 --21502 432 --
NM_018712chr1121010 290 ------
NM_018715chr1102090 1802 1737 1714 1567 1455 569 324 318 208 --12162 --
NM_018717chr432725 946 627 ------
NM_018718chr7101987 1961 1801 1683 722 347 232 158 132 36 ----165
NM_018723chr16--126 ----
NM_018837chr201134 --1745 1347
NM_018840chr201335 ------
NM_018841chr183477 3405 2454 1018 978 847 673 520 134 23360 1379 11568
NM_018844chr732055 1538 828 31782 1730 310 ----
NM_018898chr54286 262 209 57 --22060 60 --
NM_018899chr54286 262 209 57 --22060 60 --
NM_018900chr54286 262 209 57 --22060 60 --
NM_018901chr54286 262 209 57 --22060 60 --
NM_018902chr54286 262 209 57 --22060 60 --
NM_018903chr54286 262 209 57 --22060 60 --
NM_018904chr54286 262 209 57 --22060 60 --
NM_018905chr54286 262 209 57 --22060 60 --
NM_018906chr54286 262 209 57 --22060 60 --
NM_018907chr54286 262 209 57 --22060 60 --
NM_018908chr54286 262 209 57 --22060 60 --
NM_018909chr54286 262 209 57 --22060 60 --
NM_018910chr54286 262 209 57 --22060 60 --
NM_018911chr54286 262 209 57 --22060 60 --
NM_018912chr5101718 1704 1300 542 501 484 440 390 59 39 1648 21669 1397 1324
NM_018913chr5101718 1704 1300 542 501 484 440 390 59 39 1648 21669 1397 1324
NM_018914chr5101718 1704 1300 542 501 484 440 390 59 39 1648 21669 1397 1324
NM_018915chr5101718 1704 1300 542 501 484 440 390 59 39 1648 21669 1397 1324
NM_018916chr5101718 1704 1300 542 501 484 440 390 59 39 1648 21669 1397 1324
NM_018917chr5101718 1704 1300 542 501 484 440 390 59 39 1648 21669 1397 1324
NM_018918chr5101718 1704 1300 542 501 484 440 390 59 39 1648 21669 1397 1324
NM_018919chr5101718 1704 1300 542 501 484 440 390 59 39 1648 21669 1397 1324
NM_018920chr5101718 1704 1300 542 501 484 440 390 59 39 1648 21669 1397 1324
NM_018921chr5101718 1704 1300 542 501 484 440 390 59 39 1648 21669 1397 1324
NM_018922chr5101718 1704 1300 542 501 484 440 390 59 39 1648 21669 1397 1324
NM_018923chr5101718 1704 1300 542 501 484 440 390 59 39 1648 21669 1397 1324
NM_018924chr5101718 1704 1300 542 501 484 440 390 59 39 1648 21669 1397 1324
NM_018925chr5101718 1704 1300 542 501 484 440 390 59 39 1648 21669 1397 1324
NM_018926chr5101718 1704 1300 542 501 484 440 390 59 39 1648 21669 1397 1324
NM_018927chr5101718 1704 1300 542 501 484 440 390 59 39 1648 21669 1397 1324
NM_018928chr5101718 1704 1300 542 501 484 440 390 59 39 1648 21669 1397 1324
NM_018929chr5101718 1704 1300 542 501 484 440 390 59 39 1648 21669 1397 1324
NM_018945chr693387 3289 3120 1375 1040 820 260 134 30 12253 ----
NM_018948chr121182 1114 ------
NM_018951chr73884 128 113 ------
NM_018959chr192692 284 --1720 --
NM_018963chr212148 75 --11208 --
NM_018970chr732768 2407 2091 ------
NM_018976chr1232281 2217 1000 ------
NM_018977chrX3718 433 44 ------
NM_018979chr1232075 445 174 --2880 448 --
NM_018992chr1661669 1222 497 475 291 43 11189 ----
NM_018994chr13495 455 98 1123 ----
NM_018999chr10114926 4740 4602 4124 4041 1880 1849 1121 705 591 416 24246 258 24841 1872 11338
NM_019000chr531305 319 132 ------
NM_019001chr384328 4314 4145 3464 3080 1720 1640 1074 33553 3175 1552 ----
NM_019004chr742332 2126 1761 213 --1474 --
NM_019008chr22123801 3770 3730 3100 2964 2777 2663 2599 1405 1187 391 186 --2648 166 --
NM_019024chr2--1124 ----
NM_019027chr472352 2063 1795 874 760 697 636 21782 797 1769 --
NM_019032chr11692 ------
NM_019049chr11752 --1254 --
NM_019053chr1021007 981 ------
NM_019057chr5174 ------
NM_019058chr101252 --2732 152 --
NM_019063chr221983 478 11549 --1157
NM_019066chr15134 ------
NM_019072chr583774 3192 2747 1599 1581 1521 836 374 23314 1447 23456 3284 --
NM_019074chr154692 636 178 112 ------
NM_019083chr131476 453 350 --133 --
NM_019084chr1021608 671 ----12148
NM_019087chr54258 243 137 131 127 ----
NM_019096chr631008 980 846 --1808 --
NM_019098chr831656 1574 296 140 ----
NM_019106chr22193200 3012 2991 2682 2398 2321 2250 2175 1371 1248 1066 878 790 782 755 749 390 286 78 184 1811 13373
NM_019114chr972427 2228 1657 1646 1012 987 954 12365 --1182
NM_019116chr16103325 2817 2724 2598 1365 1267 720 649 555 541 1918 2938 760 --
NM_019117chrX53261 3041 2739 1399 823 12301 21135 482 13135
NM_019556chrX----11273 --
NM_019590chr1021485 1468 --1960 --
NM_019592chr97818 811 247 241 147 138 76 --1564 --
NM_019593chr2042925 2185 2147 2128 --22768 918 --
NM_019594chr961235 1181 454 273 189 88 1401 2368 79 --
NM_019595chr2----1181 --
NM_019597chrX2776 169 ------
NM_019600chr152632 105 --1529 --
NM_019606chr74360 352 222 143 ------
NM_019610chr151839 1814 1745 622 616 --2343 311 --
NM_019613chr174961 503 251 160 ------
NM_019624chr122318 176 1237 122 --
NM_019625chr122318 176 1237 122 --
NM_019845chr23155 117 32 --1714 --
NM_019849chr191192 ------
NM_019854chr126711 594 301 293 152 44 --1540 --
NM_019859chr1061404 1354 1109 586 343 178 --1520 --
NM_019860chr1061452 1402 1157 634 391 226 --1568 --
NM_019884chr193445 29 23 ------
NM_019885chr272490 1049 820 693 640 543 419 ------
NM_019891chr121079 1023 ------
NM_019895chr32397 64 174 ----
NM_019896chr21109 --1199 --
NM_019903chr1011364 --1172 --
NM_020039chr12101687 1284 1271 1223 519 487 369 286 260 164 --1552 --
NM_020062chr203878 288 39 --1853 1698
NM_020066chr11859 ------
NM_020116chr431702 1231 526 ------
NM_020120chr231583 1219 379 11470 --21381 520
NM_020122chr2145786 5519 5300 5210 4970 3971 3906 2006 1588 1507 1421 1410 1003 554 14533 15185 2477 259
NM_020123chr1051387 1162 395 178 126 2970 261 --1541
NM_020130chr821421 260 ----11310
NM_020131chr1111637 1615 1484 1369 600 433 420 221 211 104 29 --31492 1139 370 --
NM_020132chr21144864 4292 3383 3332 1895 1652 1266 763 654 496 311 268 253 187 1285 12078 --
NM_020141chr122431 2162 --11470 --
NM_020142chr124529 179 167 133 --