TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-30d-3p
miRNA Sequence: CUUUCAGUCAGAUGUUUGCUGC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr562047 2009 1589 709 673 139 11820 --192
NM_000052chrX53374 504 408 285 199 32862 2265 885 32752 2414 2099 --
NM_000055chr32441 102 --1387 --
NM_000068chr1921451 1169 11531 ----
NM_000070chr15--1508 ----
NM_000080chr17--154 ----
NM_000081chr131792 206 102 21176 154 --11594
NM_000084chrX106375 6354 5751 5430 5267 1911 1681 1077 954 831 35509 4976 165 36796 5521 419 21309 326
NM_000089chr7189 140 183 1289
NM_000091chr272803 2403 1991 691 539 490 422 --11116 12145
NM_000092chr233891 368 237 1753 13802 34001 3542 331
NM_000093chr932368 2165 208 11912 --1805
NM_000103chr1541290 1160 1134 1093 ----11302
NM_000104chr262475 2188 499 344 275 21 11191 11158 2994 987
NM_000108chr781722 1315 1274 1229 590 244 106 31 --1687 --
NM_000112chr5104275 3830 3444 3375 1652 1144 787 622 263 97 14846 74972 4881 4867 4753 4608 1844 1115 15445
NM_000115chr1352039 1966 1695 798 707 1603 --1551
NM_000125chr6103938 3689 3604 3277 3217 1086 1022 974 677 287 24230 3588 33292 2828 1658 --
NM_000138chr1532501 2342 1929 32436 1641 247 21749 624 --
NM_000141chr1031013 936 57 1169 11179 --
NM_000151chr1721770 1754 31852 494 428 1313 1581
NM_000153chr1431102 556 311 31635 482 458 1375 --
NM_000163chr53381 297 150 21840 339 ----
NM_000165chr621417 1152 --21132 388 --
NM_000167chrX41807 1589 1489 505 1581 21296 601 --
NM_000176chr553735 3474 2914 2756 1070 43161 2861 1335 456 --11487
NM_000189chr271744 1698 1617 800 597 448 126 11781 --12177
NM_000208chr1984525 2980 1630 1568 1543 1289 528 61 24799 72 34731 1515 982 14392
NM_000210chr221618 1496 21918 138 ----
NM_000214chr2051805 1721 1179 704 425 11489 11658 --
NM_000216chrX53759 3277 2857 1225 292 33014 1454 847 12657 --
NM_000217chr12145261 5066 4555 3824 3555 3537 3262 3243 1927 945 808 695 539 454 55137 1710 1620 1420 908 44141 1910 403 326 --
NM_000222chr461927 1864 1658 1640 1559 637 42128 2009 1749 417 21959 1404 --
NM_000223chr173422 166 146 ------
NM_000232chr452698 2199 1178 583 313 13087 23078 2141 1792
NM_000240chrX82190 2130 2015 851 717 703 262 105 --12245 12118
NM_000245chr732187 316 141 --11744 11847
NM_000248chr352314 758 661 245 73 12841 3804 638 384 --
NM_000252chrX4953 383 253 207 --21543 327 --
NM_000255chr61115 1446 ----
NM_000259chr15156237 6073 5982 5596 5570 5561 4996 4948 4524 3965 1604 1384 737 621 337 26023 2410 26123 2550 45418 788 137 79
NM_000267chr1752776 2500 2279 2237 702 22325 943 1524 1289
NM_000283chr41544 1525 1452 2554 114
NM_000304chr172398 155 ----1735
NM_000314chr1063159 2617 2571 2538 1275 855 22095 192 32481 2059 368 158
NM_000321chr132638 175 --1676 1208
NM_000328chrX1403 154 1283 --
NM_000332chr6187034 6672 6658 6231 6112 5848 5460 5331 5260 5207 5189 4963 4790 4623 2618 2609 2089 1612 55087 1765 1694 1410 1286 21450 1300 26822 2123
NM_000337chr5176362 6303 6190 6120 5661 5119 5015 4712 4487 4366 2275 1795 1507 1204 968 789 469 14217 11188 --
NM_000338chr1521174 786 2987 870 --11147
NM_000340chr351480 1424 1381 1031 301 21089 993 ----
NM_000351chrX73364 2657 1743 1528 171 137 67 33331 2960 1751 --34165 3128 1095
NM_000358chr51442 ------
NM_000368chr9124657 4328 4276 4173 3593 3402 1886 1726 1317 995 539 148 34337 3871 3179 23474 179 --
NM_000376chr1273060 2778 2219 2188 746 598 570 12670 22952 2876 --
NM_000390chrX73336 3245 3114 2724 2123 1125 356 --12508 1540
NM_000393chr251829 1342 829 284 89 1435 ----
NM_000408chr283193 3040 2650 1244 658 632 599 85 13311 43205 489 421 74 1354
NM_000421chr17131 1218 ----
NM_000430chr1793592 3413 2451 2360 952 765 424 302 284 33503 1283 1196 13209 23642 930
NM_000439chr592423 2278 2159 1680 1620 1012 743 602 72 22389 362 ----
NM_000441chr752190 1480 1448 639 447 32291 595 488 2729 114 --
NM_000448chr1133305 2429 232 --32681 2062 939 12634
NM_000449chr111301 ------
NM_000461chr384505 3552 3509 1413 890 406 221 176 24384 1487 ----
NM_000462chr1531504 526 194 1542 ----
NM_000480chr1131540 1235 275 21578 115 ----
NM_000489chrX83028 2788 2596 2379 1060 737 559 512 12673 52513 923 546 505 479 --
NM_000492chr711223 21417 280 1393 21052 435
NM_000493chr651071 1060 886 797 116 2159 92 ----
NM_000503chr831701 1637 569 --2706 384 11789
NM_000509chr4--1132 ----
NM_000533chrX21556 293 11837 21893 630 1490
NM_000534chr2----135 1144
NM_000555chrX187508 7240 6655 6375 5304 5268 4928 2994 2972 2836 2567 1920 1599 1559 1381 853 717 476 57760 7363 6947 5989 133 --21312 880
NM_000599chr283988 3657 2974 1592 1211 854 680 140 1930 23352 1487 11106
NM_000603chr71357 ------
NM_000610chr11103016 2375 2320 2132 1872 1863 936 580 449 201 32771 2550 770 --11989
NM_000617chr1242268 1492 198 155 2439 219 --22193 707
NM_000618chr12156515 6446 6360 6336 6086 5871 5803 5233 5083 4360 2607 1993 1864 1471 1414 36557 6407 1808 15756 35263 2089 1017
NM_000618chr12156515 6446 6360 6336 6086 5871 5803 5233 5083 4360 2607 1993 1864 1471 1414 36557 6407 1808 15756 35263 2089 1017
NM_000633chr18124749 4714 4532 4424 3826 3635 2001 1690 1432 1089 1018 874 53176 1940 1519 571 405 25006 659 --
NM_000678chr201174 ------
NM_000686chrX51251 572 466 308 121 21471 1094 ----
NM_000689chr93506 194 174 1439 ----
NM_000719chr12105983 5170 5073 5015 4957 2323 1659 1625 1353 1321 12567 16210 --
NM_000726chr231207 921 516 1325 11464 21198 432
NM_000740chr11152 ------
NM_000756chr82392 118 ------
NM_000773chr10--1107 ----
NM_000780chr831263 964 276 1798 --1923
NM_000788chr41501 --21300 395 11494
NM_000791chr562198 664 591 452 343 206 42732 2643 1739 46 1523 32598 598 442
NM_000793chr1454223 3464 1737 619 67 44193 2033 1780 1160 54475 4213 3793 914 103 13756
NM_000794chr51765 2856 845 ----
NM_000800chr531681 1539 367 --11487 11573
NM_000807chr42689 523 --1702 --
NM_000809chr4239243 8842 8530 8513 8390 8324 7761 7298 7238 6820 6517 6267 5825 5804 3457 3069 2534 1831 1555 1487 1156 1046 621 108939 8472 8463 5709 2728 2084 1774 1732 315 249 36632 6295 5601 39148 8604 7258
NM_000813chr554888 4398 3950 3597 1715 11756 23576 476 14670
NM_000814chr1593875 3690 3604 3431 3386 2854 1140 654 42 33649 700 471 43855 2988 1543 331 1848
NM_000826chr472503 1763 1646 834 640 409 63 --12087 --
NM_000827chr552383 2177 895 745 292 2847 151 1307 1159
NM_000828chrX51664 852 696 603 188 1237 21894 216 --
NM_000829chr1152148 2087 1727 1471 112 22105 466 21687 576 --
NM_000860chr41482 129 11248 11644
NM_000861chr372576 2533 1855 450 418 197 105 1626 --2428 393
NM_000864chr15998 992 800 167 85 11138 1719 1206
NM_000866chr34714 633 561 23 21290 1190 --1266
NM_000868chrX12064 31888 889 108 1762 22092 2018
NM_000872chr1041600 1486 1421 230 11557 11282 --
NM_000875chr1577002 5059 5008 4281 1564 835 793 36518 5384 5084 24686 4607 12317
NM_000882chr32451 47 1416 ----
NM_000885chr282002 1499 826 621 343 325 310 294 12116 ----
NM_000891chr1793022 2692 2576 2322 1194 1149 790 124 22 33406 2383 385 1477 --
NM_000899chr1283891 3789 3683 3667 921 756 693 201 44139 1033 479 364 34255 3715 3200 13519
NM_000902chr342582 1018 811 649 11240 21995 1118 12946
NM_000910chr451595 1489 695 431 330 1144 31340 571 179 11604
NM_000912chr873440 2947 2879 1330 1175 885 138 23570 1376 --22507 759
NM_000925chr3239 28 ------
NM_000926chr11179396 9121 8454 8438 7234 7224 7025 6803 6069 5808 3345 3333 1697 1551 847 804 98 56448 6181 3373 2737 1758 46767 6062 2690 1277 36645 1979 239
NM_000933chr201115 --11425 --
NM_000935chr331148 459 208 51196 443 265 143 80 126 --
NM_000944chr451570 1561 822 533 375 --1743 11823
NM_000945chr262102 1504 1464 1345 210 165 154 --11679
NM_000950chrX73317 3220 3059 1040 968 451 362 22445 1270 ----
NM_000956chr1451115 325 254 54 41 --1864 1835
NM_000959chr163976 3412 3143 3106 2538 150 1714 23933 245 195
NM_000963chr141763 547 408 341 12487 --22207 1601
NM_000971chr8----166 --
NM_000972chr9----141 --
NM_001001323chr1263144 2763 2398 1191 468 298 33057 2246 1112 43087 2035 871 338 --
NM_001001330chr1071173 1066 855 531 520 318 282 ------
NM_001001389chr11103016 2375 2320 2132 1872 1863 936 580 449 201 32771 2550 770 --11989
NM_001001390chr11103016 2375 2320 2132 1872 1863 936 580 449 201 32771 2550 770 --11989
NM_001001391chr11103016 2375 2320 2132 1872 1863 936 580 449 201 32771 2550 770 --11989
NM_001001392chr11103062 2421 2366 2178 1918 1909 982 626 495 247 32817 2596 816 --12035
NM_001001395chr1242503 2113 1062 96 22323 1726 22274 1042 21018 477
NM_001001396chr154367 3957 3696 3450 1177 63606 2936 1604 1568 1449 777 14391 14487
NM_001001419chr5115181 5102 4920 4805 4231 4157 3773 3417 1907 1453 1192 34480 4211 319 24333 268 192
NM_001001420chr5115181 5102 4920 4805 4231 4157 3773 3417 1907 1453 1192 34480 4211 319 24333 268 192
NM_001001433chr2042671 1945 1082 303 1505 --23170 2845
NM_001001481chr862955 2563 2142 1320 734 604 23037 1267 21033 94 22423 45
NM_001001484chr1041532 693 555 152 21747 911 1601 --
NM_001001549chr74816 508 342 46 42259 617 258 25 1268 --
NM_001001550chr74816 508 342 46 42259 617 258 25 1268 --
NM_001001555chr74816 508 342 46 42259 617 258 25 1268 --
NM_001001556chr1561541 1205 575 366 150 21 --1255 --
NM_001001557chr8--1238 21878 1483 1421
NM_001001664chr254022 3267 3046 1042 870 74094 3939 3817 3023 2678 125 23 11266 21537 337
NM_001001668chr1953932 3799 3677 1361 742 22989 225 1435 33563 960 524
NM_001001701chr462100 2041 1652 1617 1526 269 21896 53 12250 --
NM_001001787chr12112 55 1348 ----
NM_001001890chr2153211 2686 1488 1040 901 33969 2776 294 13850 13876
NM_001001933chr11498 1245 1465 172
NM_001001938chr973423 2630 1496 1077 971 539 167 21383 1245 21009 235 13741
NM_001001971chr1021305 468 1972 ----
NM_001001974chr1051907 1833 1656 516 238 1669 1640 11616
NM_001001994chrX--3444 391 211 --1474
NM_001001996chrX--3444 391 211 --1474
NM_001002009chr74563 438 71 45 --2158 125 1487
NM_001002010chr74563 438 71 45 --2158 125 1487
NM_001002243chr22914 316 --1177 --
NM_001002257chr272939 2705 1398 880 675 384 346 12298 13232 --
NM_001002258chr221866 697 --11917 --
NM_001002259chr12154 ------
NM_001002814chr873398 3254 3041 2807 2488 1409 698 23681 403 23806 357 --
NM_001002843chr1541232 1152 876 801 --1401 1928
NM_001002860chr14104265 4178 3700 3666 3554 3168 3104 1471 647 30 14117 1889 --
NM_001002926chr752748 2006 1999 644 529 42051 1888 819 656 ----
NM_001003407chr1084946 4785 4488 3956 3686 3669 1915 1693 24918 3758 ----
NM_001003408chr1084946 4785 4488 3956 3686 3669 1915 1693 24918 3758 ----
NM_001003652chr18208677 8310 8163 7941 7778 7290 7062 7019 6656 6026 5661 3378 3221 3201 2517 1905 1837 1599 602 266 57099 6822 6385 2959 2669 --23102 719
NM_001003674chr18146437 6322 6283 4626 4276 2740 2279 2159 1896 1776 1464 1103 812 386 26186 601 46252 5646 1452 178 11501
NM_001003675chr18146437 6322 6283 4626 4276 2740 2279 2159 1896 1776 1464 1103 812 386 26186 601 46252 5646 1452 178 11501
NM_001003681chr2231915 1627 427 ----1469
NM_001003712chr1293749 3529 3514 3249 1342 1327 1260 1094 342 23104 757 1168 12739
NM_001003722chr931048 844 809 11117 --161
NM_001003760chr683501 3023 2869 2486 2382 1454 1075 557 23105 1428 22715 2404 --
NM_001003792chr34336 318 282 57 ------
NM_001003793chr34336 318 282 57 ------
NM_001003794chr3102550 2303 2157 1244 911 793 642 589 366 185 22886 2707 --21946 275
NM_001003800chr963352 2796 2490 2315 912 688 33623 2471 899 ----
NM_001003803chr14139 ------
NM_001004065chr923310 2753 33619 3139 675 2327 69 33682 2971 925
NM_001004196chr361239 292 267 257 100 23 --1460 --
NM_001004317chr683397 3054 1623 1478 1296 599 441 429 14079 24414 1794 2972 385
NM_001004328chr1281945 1893 1587 838 814 734 389 21 1916 21616 254 --
NM_001004329chr1231356 1115 954 21375 428 --2593 227
NM_001004342chr186094 5147 5113 4591 1555 1040 985 386 65574 4317 2153 1529 1300 493 24219 616 35910 4143 1012
NM_001004346chr41788 --2476 29 3509 494 485
NM_001004360chr271971 1954 1873 1750 1533 1271 118 --31884 1328 26 --
NM_001004419chr1274096 3466 3442 2821 2796 861 299 31108 1003 822 34603 4180 3542 34565 3723 3090
NM_001004720chr211021 ------
NM_001004722chr211190 ------
NM_001005353chr171169 1039 997 988 860 484 120 1408 ----
NM_001005353chr171169 1039 997 988 860 484 120 1408 ----
NM_001005375chrY2617 435 --51557 369 327 246 193 11817
NM_001005404chr1753202 3002 2992 1514 482 34020 903 247 53845 3419 2812 1656 1477 --
NM_001005463chr1042505 1594 646 220 22331 256 22003 121 32417 1610 513
NM_001005473chr5146313 6283 6264 5939 5347 4384 2202 1293 1273 1241 582 423 104 95 45750 4395 2653 829 34617 2395 2161 36123 1912 820
NM_001005474chr321178 584 --21226 1204 --
NM_001005476chr2--1516 188 --
NM_001005502chr12114256 4145 3982 3301 3212 1814 1751 888 585 100 38 22096 124 14623 --
NM_001005611chrX1417 ------
NM_001005746chr231207 921 516 1325 11464 21198 432
NM_001005747chr231207 921 516 1325 11464 21198 432
NM_001005781chr2----2479 469 2400 108
NM_001005782chr22413 114 --2928 918 2849 92
NM_001006118chrY--1219 298 62 --
NM_001006120chrY--1219 298 62 --
NM_001006600chr572395 2253 1501 582 496 435 315 --11806 --
NM_001006610chr161804 1318 --1210
NM_001006623chr262288 2113 1747 783 564 294 21581 810 31903 1894 215 1969
NM_001006938chrX2700 676 ----1660
NM_001007023chr1454223 3464 1737 619 67 44193 2033 1780 1160 54475 4213 3793 914 103 13756
NM_001007024chr1774129 3223 2677 1561 905 164 54 44244 1059 1020 787 --23962 2891
NM_001007025chr1774129 3223 2677 1561 905 164 54 44244 1059 1020 787 --23962 2891
NM_001007094chr1094132 3782 3574 3379 3347 2750 1544 167 84 1364 22946 1227 --
NM_001007097chr9105083 4464 4437 4169 2012 1176 655 508 446 354 53759 1405 1312 986 331 1296 13914
NM_001007099chr12674 359 127 186 1630
NM_001007100chr12674 359 127 186 1630
NM_001007157chr7--126 ----
NM_001007189chr5133 1118 ----
NM_001007214chr13677 400 152 11640 21929 1185 21866 1312
NM_001007237chr162587 2569 2552 2335 2258 638 42902 1753 488 125 ----
NM_001007246chr2191874 1813 1720 1494 511 373 304 234 142 21558 425 --21619 735
NM_001007257chr121226 1081 1980 21425 1359 --
NM_001007464chr61139 ------
NM_001007466chr684294 3997 3898 3550 3386 1168 1081 717 44270 3565 3167 1038 25140 864 44669 4257 1388 217
NM_001007526chrY--1219 298 62 --
NM_001007527chr53688 532 171 ----1131
NM_001007559chr1821421 472 11342 32002 507 305 21448 1306
NM_001007565chr33429 159 82 --1143 --
NM_001008239chr1863808 3496 3438 2939 1527 756 13159 ----
NM_001008391chr11----141 1546
NM_001008392chr362892 2595 2336 2222 87 39 1806 11177 12958
NM_001008397chr51461 2686 508 1452 --
NM_001008405chr751556 1479 680 482 112 2519 171 ----
NM_001008407chr751765 1586 488 419 325 31785 1480 1416 --11440
NM_001008408chr766328 2286 2035 1491 932 805 34664 2084 545 44594 2178 2097 1059 21485 1152
NM_001008539chr884945 4937 3771 2002 1966 1483 395 53 12094 1377 11463
NM_001008541chr101610 32200 928 558 ----
NM_001008541chr101610 32200 928 558 ----
NM_001008564chr132162 131 --21912 1888 22167 1659
NM_001008566chr222177 155 ----1165
NM_001008707chr1441360 488 410 222 11421 ----
NM_001008711chr861125 534 340 165 63 43 21442 182 ----
NM_001008738chr54969 749 672 184 22700 252 12573 --
NM_001008740chr1----190 --
NM_001008779chr23266 116 40 1214 ----
NM_001008801chr1992089 1726 1391 677 593 324 240 155 71 ------
NM_001008895chr1331244 1229 1171 31310 424 403 ----
NM_001008925chr463381 2931 2372 375 201 171 12992 1710 1894
NM_001009183chr14------1389
NM_001009552chr8----2429 192 1452
NM_001009554chr4104388 4272 3769 3543 3414 3382 2991 1837 1329 811 23000 915 1168 1725
NM_001009554chr4104388 4272 3769 3543 3414 3382 2991 1837 1329 811 23000 915 1168 1725
NM_001009555chr451794 1679 1148 683 139 11690 --196
NM_001009569chr1041297 1207 1122 457 157 1235 11461
NM_001009881chr11574 ------
NM_001009882chr11574 ------
NM_001009894chr1231331 481 261 21627 604 ----
NM_001009899chr3125892 5857 5239 5034 5002 4797 4643 4509 4173 2107 1281 897 46088 1692 1261 278 12242 1383
NM_001009909chr1173941 3655 3362 1301 734 343 190 23155 900 43748 3135 917 433 23495 1123
NM_001009960chr731031 254 56 --12754 --
NM_001010000chr1823007 2764 21238 941 33139 2422 185 --
NM_001010861chr11451 12538 --22822 2384
NM_001010862chrX83309 2498 2056 2008 1083 1025 364 298 1616 1962 --
NM_001010891chr5166908 6615 6426 5692 5422 5349 4883 4823 4583 2443 1807 1631 1608 1439 1096 405 --34204 2181 838 --
NM_001010986chrX32050 898 198 31575 681 451 --22227 2004
NM_001011513chr493899 3857 3333 3196 2834 2721 1366 327 119 1101 ----
NM_001011657chrX41096 442 297 155 21192 197 1453 136
NM_001011663chr103959 758 239 ------
NM_001011666chr7156248 6085 5798 5516 4871 2416 2334 2292 1723 1293 1207 333 326 270 93 36128 4571 1047 35153 4400 1377 15785
NM_001011708chr262323 1958 1096 897 801 469 31879 919 75 1655 1772
NM_001011885chr1541734 1507 1313 79 11130 21743 517 --
NM_001012393chr1174552 4517 3820 3721 3637 3203 2011 21526 388 ----
NM_001012398chr163997 951 872 2988 86 --1788
NM_001012418chr6124266 3748 3496 2589 1291 916 902 812 797 582 398 158 170 ----
NM_001012420chr1542708 2653 2169 1040 32603 2183 30 22881 1843 1561
NM_001012423chr1552708 2653 2169 1040 370 22603 2183 22881 1843 1561
NM_001012425chr11101 ------
NM_001012507chr6124 ------
NM_001012751chr1041407 1268 182 134 21938 1470 1480 --
NM_001012755chrX135108 5092 4116 3344 3084 2000 1679 1315 1150 786 732 655 383 1546 21947 1605 --
NM_001012756chr1942886 451 329 279 12225 31043 439 433 12911
NM_001012761chr542411 2214 1856 520 ------
NM_001012968chrX42516 2453 2303 594 22811 838 11849 --
NM_001013399chr61726 ------
NM_001013437chr18----121 --
NM_001013438chr31826 2620 305 1683 2866 162
NM_001013620chr12106740 6711 6542 6192 2956 2871 2713 1748 1410 68 68270 8189 7636 7232 6303 5648 66311 2900 2078 1987 1432 404 35562 2632 497
NM_001013746chr761424 458 378 294 211 43 21998 1983 1190 3793 628 544
NM_001013843chr152949 254 1242 141 --
NM_001014797chr10258131 8103 7676 6629 6444 6381 6232 6058 5511 5482 5455 5368 5299 5087 5066 3292 3201 2859 2740 2371 2105 1152 1083 743 211 37903 7284 1333 15310 15175
NM_001015048chr1473241 2271 1206 1165 1157 859 118 ------
NM_001015049chr1473241 2271 1206 1165 1157 859 118 ------
NM_001015877chrX92910 2809 2524 2431 2105 1153 1072 308 130 --22698 236 --
NM_001015880chr1051373 1285 1257 567 29 21217 335 11174 21579 194
NM_001015881chrX11262 11022 1918 --
NM_001015882chr921013 58 ----1841
NM_001015887chr321676 1173 1736 31140 377 175 11794
NM_001017368chr1782578 2282 2190 1898 1752 1087 1077 966 21744 918 ----
NM_001017369chr451104 1060 768 327 25 --1800 --
NM_001017395chr363256 2941 973 903 563 82 12332 43670 3521 2379 2355 --
NM_001017405chr41810 2237 184 ----
NM_001017440chr7107030 6623 6438 6243 6102 5913 5607 2977 2530 1296 33145 2921 2474 47021 6652 2687 2269 15858
NM_001017523chr1251340 1188 708 257 213 31686 363 148 1237 --
NM_001017535chr1273060 2778 2219 2188 746 598 570 12670 22952 2876 --
NM_001017926chr821639 596 1739 --21297 91
NM_001017930chrX2260 45 41227 1080 332 212 ----
NM_001017963chr141337 ------
NM_001017970chr1482131 1009 692 680 622 462 280 251 --12506 12678
NM_001017975chr1--1193 ----
NM_001017979chr43528 235 177 ----1519
NM_001017999chr1--2820 407 ----
NM_001017999chr1--2820 407 ----
NM_001018000chr1--2820 407 ----
NM_001018000chr1--2820 407 ----
NM_001018001chr1--2820 407 ----
NM_001018008chr156524 444 252 177 138 28 2488 95 ----
NM_001018037chr941472 1266 1199 237 ------
NM_001018064chr941986 1908 1385 53 11393 31957 1855 1667 --
NM_001018065chr965111 4671 4363 4300 2279 479 32106 2047 436 36017 3690 1870 11343
NM_001018066chr965111 4671 4363 4300 2279 479 32106 2047 436 36017 3690 1870 11343
NM_001018067chr165121 4425 3985 3374 313 136 14239 13552 23709 2132
NM_001018068chr165121 4425 3985 3374 313 136 14239 13552 23709 2132
NM_001018069chr165121 4425 3985 3374 313 136 14239 13552 23709 2132
NM_001018072chr1251340 1188 708 257 213 31686 363 148 1237 --
NM_001018074chr553735 3474 2914 2756 1070 43161 2861 1335 456 --11487
NM_001018075chr553735 3474 2914 2756 1070 43161 2861 1335 456 --11487
NM_001018076chr553735 3474 2914 2756 1070 43161 2861 1335 456 --11487
NM_001018077chr553735 3474 2914 2756 1070 43161 2861 1335 456 --11487
NM_001018090chr1542183 1880 927 811 2622 177 --11852
NM_001018091chr1542293 1990 1037 921 3732 287 113 --11962
NM_001018102chr1542183 1880 927 811 2622 177 --11852
NM_001018111chr773921 3703 3368 2914 1168 1016 532 43029 1301 485 325 13931 23942 3097
NM_001018115chr32606 70 ------
NM_001018159chr16----139 --
NM_001018160chr16----139 --
NM_001023567chr1512095 12393 22273 1864 1564
NM_001024094chr553735 3474 2914 2756 1070 43161 2861 1335 456 --11487
NM_001024593chr102919 135 3656 84 26 1607 1624
NM_001024647chr12137576 6282 4781 2481 1694 1511 1003 836 755 524 279 259 53 56562 5416 1552 1519 1354 55950 5581 1993 1927 561 144
NM_001024649chr552692 2612 2604 2295 569 32006 1816 962 ----
NM_001024680chr241265 641 623 35 11189 1504 11340
NM_001024948chr183161 3007 2895 2804 2735 1218 970 390 31294 748 77 ----
NM_001024959chr31261 ------
NM_001024960chr31261 ------
NM_001025076chr10116064 6044 4545 3863 2230 2036 1460 1265 683 366 199 15243 24820 277 --
NM_001025077chr10157422 7402 5903 5221 4833 2818 2623 2041 1724 1557 1148 1034 971 766 398 26601 4651 26178 1635 --
NM_001025079chr343476 3231 721 485 34045 3510 2927 1981 11149
NM_001025107chr142548 690 469 281 22289 569 --1141
NM_001025107chr142548 690 469 281 22289 569 --1141
NM_001025108chr2133953 3883 3761 3565 3496 3340 3148 3031 2765 1050 773 556 128 43539 3468 1523 1435 2746 76 13526
NM_001025266chr3104406 4350 3660 3129 1906 1531 1191 1067 561 461 23548 1432 24586 2985 --
NM_001025356chr1252796 2537 2036 1993 1979 1905 42866 2581 2249 1917 1170
NM_001025389chr1131540 1235 275 21578 115 ----
NM_001025390chr1131540 1235 275 21578 115 ----
NM_001025580chrX94088 3885 3823 3396 3383 3083 2766 1623 554 11017 ----
NM_001025595chr421395 161 2334 277 ----
NM_001025603chr111301 ------
NM_001025780chr94544 376 77 43 21257 398 --1179
NM_001029839chr341265 1252 558 433 1567 --21436 188
NM_001029840chr341265 1252 558 433 1567 --21436 188
NM_001029858chr652781 2627 2386 169 25 21068 498 --21120 926
NM_001029863chr662814 2695 2511 2500 1105 750 --13221 12864
NM_001029875chr5102760 2727 2695 2055 1984 1029 882 831 168 74 42885 2286 1865 38 1824 32248 444 28
NM_001029883chr272366 2005 1143 451 156 129 108 1120 22683 2081 --
NM_001029884chr662496 1852 1701 828 428 260 1595 22617 848 --
NM_001030006chr1772314 2211 1888 1751 1687 919 102 12569 41673 467 390 65 --
NM_001030007chr1694006 3510 3387 1572 1465 1428 1414 674 557 42827 1615 1295 114 33446 1155 1121 23259 1515
NM_001030055chr1474222 3786 3321 3027 522 497 193 34160 3506 3340 12903 13495
NM_001031679chr1253081 2743 2404 1275 595 33503 3352 3250 1530 22902 1387
NM_001031684chr221527 1402 2417 194 1345 --
NM_001031685chr14642 584 154 115 1851 1592 --
NM_001031695chr22105286 4179 1923 1834 1371 1142 837 658 534 425 13809 --13516
NM_001031700chr421912 493 51606 784 745 301 189 22326 1886 --
NM_001031710chr7--1228 ----
NM_001031716chr24870 844 828 724 --1745 1205
NM_001031723chr42127 111 ----2175 101
NM_001031732chr453443 3299 2925 2238 441 11406 --1174
NM_001031743chr61184 ----1191
NM_001031804chr1664234 2708 1555 1274 846 287 23692 3311 23392 1217 34022 2871 1744
NM_001032221chr951758 1718 1457 469 171 --21767 1475 --
NM_001032282chr82952 399 1888 --1833
NM_001032283chr122414 238 3719 291 56 --1135
NM_001032284chr122414 238 3719 291 56 --1135
NM_001032363chr182233 1697 1399 750 616 344 185 148 1334 21627 66 --
NM_001032363chr182233 1697 1399 750 616 344 185 148 1334 21627 66 --
NM_001032380chr1021823 376 11552 1521 --
NM_001032394chr652517 2297 2015 1928 399 --21894 346 --
NM_001032395chr652384 2164 1882 1795 266 --21761 213 --
NM_001032999chr2074462 4413 4337 3328 1494 940 764 34400 4042 1065 25045 269 14427
NM_001033002chr17----1105 --
NM_001033057chr342048 776 145 66 ------
NM_001033059chr632035 1614 246 11893 1494 21669 1463
NM_001033087chr2061123 1103 977 900 607 307 32926 2883 2485 --12834
NM_001033112chr53920 686 155 1858 --1194
NM_001033117chr354408 3785 3662 1874 1799 24117 2964 23191 1631 21791 310
NM_001033506chr111377 ------
NM_001033569chr17----2147 26 --
NM_001033570chr17----2147 26 --
NM_001033571chr17----2147 26 --
NM_001033572chr17----2147 26 --
NM_001033578chr842161 958 921 487 11622 21494 55 --
NM_001033925chr1021807 738 164 3574 563 113 12037
NM_001033953chr112141 38 ----1122
NM_001034841chr1665176 4243 1778 1416 893 737 35206 3402 780 1495 --
NM_001034850chr541416 1253 1127 90 21593 445 1590 21453 383
NM_001035003chr431328 1043 202 --21386 105 --
NM_001035004chr431328 1043 202 --21386 105 --
NM_001035260chr1041671 297 91 80 11611 21098 305 --
NM_001035511chr151672 666 626 533 224 11619 1391 --
NM_001035512chr151779 773 733 640 331 11726 1498 --
NM_001035513chr151779 773 733 640 331 11726 1498 --
NM_001037131chr211182 11299 ----
NM_001037132chr722220 393 11925 31723 762 182 1601
NM_001037133chr722220 393 11925 31723 762 182 1601
NM_001037164chr741763 1673 550 293 21862 1381 11802 --
NM_001037277chr121239 189 11559 21354 477 11254
NM_001037278chr121239 189 11559 21354 477 11254
NM_001037317chr11451 12538 --22822 2384
NM_001037339chr151397 1294 734 336 223 2519 268 1288 --
NM_001037340chr151397 1294 734 336 223 2519 268 1288 --
NM_001037341chr151397 1294 734 336 223 2519 268 1288 --
NM_001037341chr151397 1294 734 336 223 2519 268 1288 --
NM_001037553chr2184126 3577 3301 2002 1810 1461 1168 964 43535 2034 1033 711 14097 24957 4367
NM_001037558chr111213 ------
NM_001037663chr2----140 --
NM_001037954chr1152536 1388 951 780 562 2809 338 --12980
NM_001038702chr562314 2257 1852 1031 419 173 186 --12352
NM_001038707chr1102046 1919 1777 466 409 368 305 281 256 33 51639 1611 877 426 266 ----
NM_001038707chr1102046 1919 1777 466 409 368 305 281 256 33 51639 1611 877 426 266 ----
NM_001039199chr20125038 4787 4262 3646 3529 3233 1920 1186 926 566 516 132 45057 3188 1583 1118 14892 13759
NM_001039465chr14--1180 ----
NM_001039479chr141562 22351 646 1832 3910 725 616
NM_001039538chr251286 1266 1259 332 311 13016 123 --
NM_001039547chr3138054 7945 7605 6694 6160 5661 5051 4997 3186 2103 1958 778 484 48013 4929 1980 662 --2671 467
NM_001039577chr1104436 4366 3661 3220 3192 2800 1220 810 375 318 1455 13888 --
NM_001039580chr4104651 4459 3284 1624 1297 1280 1115 1026 659 460 34472 4386 1917 23905 3191 11961
NM_001039585chr164233 3669 3400 3363 2795 407 1971 24190 502 1352
NM_001039590chrX73476 3135 2948 2446 1439 1140 493 ----13020
NM_001039591chrX73476 3135 2948 2446 1439 1140 493 ----13020
NM_001039615chr892015 1944 1892 1586 837 813 733 389 21 1915 11615 --
NM_001039618chr11125904 4596 3680 2312 2257 1933 1881 1815 1247 1049 490 124 54901 3805 2387 2171 440 65231 5059 4062 1952 968 594 14937
NM_001039709chr2074462 4413 4337 3328 1494 940 764 34400 4042 1065 25045 269 14427
NM_001039762chr102240 47 32142 1644 840 11991 11799
NM_001039840chrX115653 5633 5039 4705 4311 4304 1776 1578 1042 829 396 55952 2164 1813 1331 967 24694 795 11149
NM_001039937chr1394170 3740 3641 3308 1489 1180 938 893 112 13489 22526 1327 33181 1507 1353
NM_001040001chr642083 1998 1529 690 ------
NM_001040020chr751374 538 299 204 22 --11180 --
NM_001040057chr751466 1299 1100 1093 323 ------
NM_001040092chr8177 ------
NM_001040100chr331009 863 156 2312 102 --1512
NM_001040102chr1042211 1681 585 127 150 22502 38 22347 683
NM_001040103chr1042211 1681 585 127 150 22502 38 22347 683
NM_001040142chr252256 1783 1674 541 188 22305 243 32108 1827 174 --
NM_001040143chr252256 1783 1674 541 188 22305 243 32108 1827 174 --
NM_001040151chr11164458 3498 3275 2806 1544 1508 1479 1326 1265 927 901 579 489 380 305 48 44608 4514 4183 1313 1806 21672 233
NM_001040152chr7115032 4554 4312 3141 1647 1639 1452 1352 1276 905 684 34435 3252 1841 24518 4147 --
NM_001040157chr421083 152 42940 2658 2577 2068 --32255 546 473
NM_001040158chr5--1499 ----
NM_001040159chr421090 353 1133 11397 --
NM_001040202chr451846 1751 944 787 283 11580 ----
NM_001040214chr641448 692 261 94 11669 2899 219 --
NM_001040284chr16105818 5327 4681 4450 3787 2325 2175 1940 1576 1450 45663 4098 1500 619 75293 4535 4114 3639 2123 1748 701 31812 1660 837
NM_001040402chr442649 2477 490 143 22331 323 13145 --
NM_001040409chr21975 1823 3699 129 97 --
NM_001040429chr1373637 3486 3439 2480 2411 1436 137 1493 43144 1329 483 347 --
NM_001040441chr1135404 5190 3568 2036 1388 1298 1221 983 976 856 596 580 514 13996 14353 1203
NM_001040446chr562489 2453 2380 1813 889 806 ----12604
NM_001040450chr1592876 2711 2511 2351 2092 1027 972 414 385 ------
NM_001040453chr1592876 2711 2511 2351 2092 1027 972 414 385 ------
NM_001040619chr141292 518 490 285 31334 271 75 1291 --
NM_001040633chr75738 684 265 221 140 2975 721 1851 11051
NM_001040665chr7165007 4731 4400 4305 4299 4254 4115 4088 3748 3720 3678 1775 1735 1409 603 106 21470 392 14311 --
NM_001040708chr821117 763 --2754 246 1951
NM_001040712chr932534 328 238 2707 201 --13414
NM_001040876chr451569 1281 1225 169 106 2356 201 21928 1881 --
NM_001042355chr16135131 4661 4542 3728 3677 3488 2094 2047 1838 1521 484 257 171 13272 33819 3321 33 --
NM_001042357chr1061307 992 977 152 82 29 11065 ----
NM_001042358chr1061307 992 977 152 82 29 11065 ----
NM_001042360chr1061307 992 977 152 82 29 11065 ----
NM_001042361chr1061338 1023 1008 183 113 60 11096 ----
NM_001042363chr1061307 992 977 152 82 29 11065 ----
NM_001042364chr1061338 1023 1008 183 113 60 11096 ----
NM_001042365chr1061338 1023 1008 183 113 60 11096 ----
NM_001042383chr393379 3261 3141 2552 1258 815 738 212 64 31074 343 141 23093 316 13128
NM_001042387chr1061338 1023 1008 183 113 60 11096 ----
NM_001042389chr1061307 992 977 152 82 29 11065 ----
NM_001042390chr1061307 992 977 152 82 29 11065 ----
NM_001042392chr1061307 992 977 152 82 29 11065 ----
NM_001042393chr1061338 1023 1008 183 113 60 11096 ----
NM_001042395chr1061307 992 977 152 82 29 11065 ----
NM_001042396chr1061338 1023 1008 183 113 60 11096 ----
NM_001042397chr1061338 1023 1008 183 113 60 11096 ----
NM_001042404chr132016 394 264 ----11635
NM_001042406chr631131 981 148 163 21266 1212 --
NM_001042412chr16135131 4661 4542 3728 3677 3488 2094 2047 1838 1521 484 257 171 13272 33819 3321 33 --
NM_001042413chr953570 1265 983 843 151 23178 362 11502 13790
NM_001042437chr23334 230 42 123 1867 --
NM_001042453chrX21647 178 11762 11526 1121
NM_001042473chr1051813 825 790 627 60 22039 1636 135 --
NM_001042492chr1752776 2500 2279 2237 702 22325 943 1524 1289
NM_001042493chr681879 1478 1443 1280 695 501 467 44 ------
NM_001042494chr1593613 3375 2638 2358 1096 1016 1008 559 124 --33764 2707 806 33856 3196 329
NM_001042495chr1593613 3375 2638 2358 1096 1016 1008 559 124 --33764 2707 806 33856 3196 329
NM_001042496chr1593613 3375 2638 2358 1096 1016 1008 559 124 --33764 2707 806 33856 3196 329
NM_001042497chr1593613 3375 2638 2358 1096 1016 1008 559 124 --33764 2707 806 33856 3196 329
NM_001042510chr81852 21794 828 22029 858 --
NM_001042511chr81852 21794 828 22029 858 --
NM_001042533chr392482 2345 2249 2088 1233 1046 947 575 290 --53113 2772 2697 2160 870 --
NM_001042550chr961331 1324 769 554 436 274 11707 1535 --
NM_001042555chr12104785 4735 4709 4501 4475 4228 3277 935 770 398 23452 748 24681 618 21444 1140
NM_001042585chr11199 --1637 --
NM_001042599chr2127799 7165 6776 6625 5809 5587 2587 1637 1041 1022 516 389 77810 7200 5371 2405 1750 935 451 33146 1028 184 16984
NM_001042601chr383179 3107 3021 2711 2689 2190 1085 1061 42719 2380 2221 940 --1423
NM_001042603chr1274989 4559 3903 2067 1953 1523 861 54900 4643 4609 3769 745 1396 13696
NM_001042604chr374492 3067 3008 1121 1048 449 335 11875 34835 4589 118 1925
NM_001042632chr2072566 2440 2356 2282 2247 976 425 22479 1703 12066 --
NM_001042633chr2072566 2440 2356 2282 2247 976 425 22479 1703 12066 --
NM_001042683chr621653 378 11229 21561 1545 21336 600
NM_001043351chr162059 1837 789 685 355 88 --32308 1958 107 12227
NM_001044385chr2104064 3257 3092 2779 2642 1491 1244 508 455 422 1559 2432 122 --
NM_001046chr572599 2270 2254 1183 733 342 131 12917 42761 716 233 62 --
NM_001049chr1432231 1757 515 21843 792 11928 12184
NM_001050chr1721444 171 --1219 1328
NM_001068chr31293 ------
NM_001079874chr151420 1401 1379 628 157 1832 21331 85 1487
NM_001082971chr72352 33 151 157 --
NM_001083620chr472501 1761 1645 833 639 408 63 --12085 --
NM_001099678chr396286 5641 5514 5345 4662 4235 1340 1053 40 22324 1201 --26223 5360
NM_001100108chr1188306 7908 7051 6980 6803 6690 6603 6507 6276 5324 2511 2467 2441 1830 1662 1324 1026 306 77645 2839 2765 1800 1405 882 645 11051 45862 3284 665 251
NM_001106chr3159626 9279 8602 6977 6475 6438 6279 6146 6080 5900 3454 999 809 682 628 89374 9081 8378 8303 6915 1408 293 43 --47489 3474 2490 1826
NM_001111chr142548 690 469 281 22289 569 --1141
NM_001113490chrX63606 2884 1027 753 556 348 1519 --13295
NM_001117chr181533 41764 1569 943 445 22352 406 1316
NM_001121chr102573 117 21551 623 11581 1133
NM_001128chr1694006 3510 3387 1572 1465 1428 1414 674 557 42827 1615 1295 114 33446 1155 1121 23259 1515
NM_001128144chr2----135 1144
NM_001144chr1651402 1352 1166 255 53 11272 --11283
NM_001146chr82800 296 176 22358 1653 --
NM_001148chr472148 1960 1669 1400 653 562 378 21361 808 ----
NM_001167chrX126366 6192 6114 4857 4698 2435 1984 1489 576 263 87 49 --24750 224 35037 5028 4549
NM_001173chr1474222 3786 3321 3027 522 497 193 34160 3506 3340 12903 13495
NM_001174chrX52220 1681 1664 893 394 --11903 --
NM_001177chr1272389 2369 2360 2180 1708 1562 25 11796 ----
NM_001186chr2193009 2694 2543 2078 1241 427 346 62 43 11114 13167 --
NM_001187chr21----1452 --
NM_001191chr2021435 361 1336 ----
NM_001198chr621645 135 1571 22103 164 1425
NM_001201chr473434 3138 2500 1572 1045 1003 894 3831 436 326 13131 22792 156
NM_001204chr2207509 7260 7169 7048 6518 6196 6169 6090 5942 5844 5816 5503 2953 2946 2719 2393 1916 1438 757 719 22470 1173 44900 3041 2814 1287 16360
NM_001206chr992676 2667 2557 2094 1993 1253 960 724 81 32750 1151 652 ----
NM_001219chr762112 868 837 564 404 167 32047 772 715 183 --
NM_001237chr421171 423 --1925 --
NM_001237chr421171 423 --1925 --
NM_001238chr191174 ------
NM_001241chr252386 2379 2291 884 863 1249 2825 749 11605
NM_001241chr252386 2379 2291 884 863 1249 2825 749 11605
NM_001256chr1731944 74 29 --12868 22788 807
NM_001259chr7136330 6224 6028 5875 5707 4909 2256 1871 1140 1052 909 744 174 76073 5593 4877 4305 3850 1943 247 35608 2395 554 14254
NM_001271chr1563280 2863 2589 1225 776 133 --22925 888 --
NM_001282chr1772314 2211 1888 1751 1687 919 102 12569 41673 467 390 65 --
NM_001289chrX21217 284 11068 21615 1397 --
NM_001304chr1793412 3269 2831 2816 2702 2644 1417 737 453 11208 11063 1944
NM_001310chr1262833 2583 1167 993 967 30 2941 266 ----
NM_001329chr1061541 1197 576 520 190 140 ----21360 164
NM_001331chr1142364 2354 913 304 12339 22445 2410 --
NM_001332chr531438 613 281 ------
NM_001333chr92272 63 ------
NM_001343chr591743 1643 1610 1568 1269 523 298 275 198 1607 --21185 1092
NM_001345chr12----1205 --
NM_001351chr361471 1254 519 336 208 197 --21531 232 --
NM_001356chrX82378 2365 2061 1851 1802 843 402 285 --2906 127 --
NM_001358chr41110 1291 121 --
NM_001364chr1163838 3717 3415 1530 1432 842 --44183 1236 794 679 --
NM_001390chr1873433 3065 2344 1458 1254 907 430 32513 591 363 12584 12238
NM_001396chr2142822 660 172 109 2926 152 --1764
NM_001401chr91224 ----1178
NM_001402chr651700 1449 651 553 499 2380 369 21948 1913 11897
NM_001412chrX83481 3105 3015 2732 1472 661 631 170 31047 947 38 11266 --
NM_001415chrX71786 713 662 651 599 420 220 ------
NM_001417chr1251643 342 192 183 46 2671 111 21651 1225 --
NM_001418chr11----1680 --
NM_001418chr11----1680 --
NM_001419chr19124524 3999 3730 3243 3196 3151 3084 1764 1648 299 177 55 23437 742 14868 13401
NM_001429chr221776 1986 --167
NM_001430chr241320 705 221 165 ----21876 1486
NM_001432chr463925 3834 3773 1209 894 542 23434 130 33906 1161 258 23897 699
NM_001438chr162821 2541 1005 716 537 401 140 --22814 564
NM_001451chr1651228 1221 1088 476 287 ------
NM_001455chr664754 4675 3931 3316 1866 641 23114 1347 ----
NM_001460chr173607 3105 2841 2824 1266 1019 99 32585 812 136 175 23636 2456
NM_001482chr152985 344 ------
NM_001483chr76970 835 678 253 217 96 1310 ----
NM_001490chr9123538 3477 3355 3205 3020 2820 2573 1092 1029 835 616 468 53573 3316 3062 2598 2457 --23330 2713
NM_001491chr672684 2568 2534 2367 799 792 157 12513 21071 28 11817
NM_001498chr621136 1019 --31365 490 403 --
NM_001511chr43538 263 41 --1499 --
NM_001530chr14--1389 ----
NM_001542chr162587 2569 2552 2335 2258 638 42902 1753 488 125 ----
NM_001543chr5144677 4498 4066 3945 3923 3567 3339 3003 1673 1553 1428 749 440 25 ------
NM_001560chrX3881 472 215 --22568 94 --
NM_001584chr113407 329 186 ------
NM_001609chr10103859 3769 3055 2886 1668 1412 1098 868 633 398 11260 ----
NM_001616chr233243 3155 46 62888 929 807 313 242 143 12514 32460 977 627
NM_001621chr732549 2408 389 52862 2633 1927 1894 814 11950 --
NM_001621chr732549 2408 389 52862 2633 1927 1894 814 11950 --
NM_001627chr341743 1715 280 52 1707 12439 11479
NM_001634chr632035 1614 246 11893 1494 21669 1463
NM_001650chr1863966 3630 3613 3063 968 408 1661 32901 2729 360 23348 2749
NM_001655chr1162087 2023 1522 842 400 97 41951 1759 69 23 ----
NM_001656chr581921 1706 1619 755 692 437 230 210 11718 ----
NM_001663chr14122582 2522 2501 2403 2361 2321 2189 2177 2141 727 705 27 31709 1105 885 1980 22375 492
NM_001682chr1262858 2477 2112 1137 905 182 42771 1960 1092 826 32801 585 52 --
NM_001684chr154084 3674 3413 3167 894 63323 2653 1321 1285 1166 494 14108 14204
NM_001689chr221866 697 --11917 --
NM_001695chr854107 3369 3320 978 418 21587 918 14243 --
NM_001707chr75938 907 823 805 131 ------
NM_001709chr1142227 1947 925 733 22274 2023 --32790 2674 268
NM_001718chr631275 1160 108 ------
NM_001723chr63566 335 233 ----1172
NM_001729chr42384 329 161 ----
NM_001730chr132484 199 21150 631 11263 1120
NM_001730chr132484 199 21150 631 11263 1120
NM_001742chr751533 1270 350 332 33 31234 640 148 31346 474 241 --
NM_001746chr552692 2612 2604 2295 569 32006 1816 962 ----
NM_001753chr791798 1340 1309 1295 596 323 293 274 106 2736 122 --11622
NM_001754chr2153211 2686 1488 1040 901 33969 2776 294 13850 13876
NM_001755chr1632030 320 145 22125 1446 11521 --
NM_001759chr12104350 4304 3854 3799 3728 2000 1827 1312 1026 520 35287 4791 979 24057 466 11862
NM_001762chr75900 871 161 145 97 1314 1190 --
NM_001777chr343476 3231 721 485 34045 3510 2927 1981 11149
NM_001797chr163802 286 208 ------
NM_001799chr52229 31 ----1243
NM_001806chr1952238 1083 988 385 82 22056 1849 --1145
NM_001813chr41136 --1275 --
NM_001830chrX83782 3705 3338 3296 2531 1495 1410 463 23676 499 22760 1474 --
NM_001854chr131479 1286 1255 21326 181 21434 1384 --
NM_001855chr92669 652 3820 644 281 2787 63 1169
NM_001858chr6105044 4688 4587 4515 4324 4276 3436 1683 1146 49 24126 1207 1653 11479
NM_001866chrX2118 98 ------
NM_001870chr31257 ------
NM_001874chr12114256 4145 3982 3301 3212 1814 1751 888 585 100 38 22096 124 14623 --
NM_001880chr21121 ------
NM_001881chr102473 338 1141 1488 --
NM_001884chr52430 392 --1456 --
NM_001896chr161445 ------
NM_001918chr1138616 8488 8039 7405 7323 7033 3582 3025 2883 1974 1527 525 269 53639 3492 3214 1360 856 17454 37245 2477 169
NM_001924chr14521 213 50 25 1411 141 --
NM_001931chr1151327 487 455 369 154 1979 ----
NM_001933chr1431310 490 380 ----145
NM_001938chr111578 ----1193
NM_001939chrX73623 2335 1186 1162 986 808 779 33855 798 511 32857 2723 2437 --
NM_001941chr1853925 2478 738 653 432 12684 42525 1146 1019 224 --
NM_001945chr521359 945 31213 522 48 1408 1356
NM_001955chr62926 24 ----2849 445
NM_001959chr2----140 --
NM_001964chr541156 1041 226 143 ----1989
NM_001969chr1463872 3720 2469 1200 647 338 1236 33549 1548 788 --
NM_001977chr431388 1318 53 1653 --1254
NM_001980chr1261601 1555 868 668 277 262 12244 12004 --
NM_001981chr141918 1628 1476 321 12098 2946 55 --
NM_001987chr12104221 3671 3577 3202 3078 1446 1228 883 199 67 1558 --13822
NM_001992chr541607 770 717 523 --11473 --
NM_001993chr11190 1360 ----
NM_002006chr4125577 5103 4647 4527 4242 3935 3871 3737 2119 1043 1036 517 35264 3986 1521 11894 11153
NM_002009chr1542787 2194 2014 1118 2195 117 --1128
NM_002015chr1372374 2134 1147 915 796 536 512 33198 2446 2407 160 --
NM_002024chrX4844 490 273 209 22224 1569 21369 765 --
NM_002025chrX169291 8422 7857 7779 6633 6607 6034 3592 2383 2217 1967 1870 1826 1592 1334 1184 98360 8052 7107 6705 6114 3033 1064 882 355 27837 7597 27493 6342
NM_002026chr231042 331 60 1780 ----
NM_002028chr1411317 ------
NM_002035chr1863174 2548 1579 1211 1171 875 32434 1278 815 --23245 3032
NM_002040chr2132876 608 77 2380 325 --1797
NM_002044chr1561541 1205 575 366 150 21 --1255 --
NM_002069chr721348 392 21248 738 3607 212 156 --
NM_002076chr1263147 2731 804 501 323 100 3892 812 135 2762 654 --
NM_002089chr42227 41 --1504 --
NM_002114chr6--2442 58 ----
NM_002128chr134775 663 491 371 32557 2094 902 190 22204 725
NM_002130chr561713 1218 1118 691 621 614 21581 527 ----
NM_002135chr121535 ------
NM_002137chr721983 1715 21690 393 21835 1539 --
NM_002140chr91261 2931 47 31057 253 76 --
NM_002158chr233269 1364 392 22489 248 33338 2401 467 1543
NM_002165chr20--1260 --1353
NM_002182chr31798 2652 440 --21951 562
NM_002192chr71428 ------
NM_002202chr53955 104 68 ----1266
NM_002203chr5104125 3645 3317 2668 1665 1407 1343 941 899 664 14148 33742 3554 1295 --
NM_002210chr283378 3368 3146 2533 2319 2273 2176 1279 33342 2969 2192 --21259 1022
NM_002211chr102777 31 2159 115 31142 313 271 --
NM_002214chr7135446 4827 4796 4259 4077 3616 3488 1722 1492 1208 793 710 402 25288 289 43934 1778 889 35 24508 2144
NM_002223chr1253868 2717 1028 388 56 43839 2663 498 102 32560 1604 69 23165 476
NM_002226chr142945 786 1192 ----
NM_002239chr251030 976 942 793 89 31064 891 306 ----
NM_002242chr271834 1721 1387 1302 375 327 209 41906 1706 1575 171 ----
NM_002247chr101479 21610 555 ----
NM_002264chr394539 4056 4038 3718 1977 1680 1529 1143 1053 33094 666 165 21384 549 --
NM_002265chr173437 94 69 2133 61 --2149 43
NM_002267chr1331931 845 571 ------
NM_002269chr6168 --2319 127 --
NM_002270chr5125558 5341 4812 4793 4294 4174 3735 2216 1954 1104 899 776 23976 1351 12036 --
NM_002271chr1372085 2031 1898 1865 655 269 209 1474 1197 1234
NM_002285chr2133953 3883 3761 3565 3496 3340 3148 3031 2765 1050 773 556 128 43539 3468 1523 1435 2746 76 13526
NM_002294chrX2103 72 ------
NM_002296chr131600 510 479 21777 267 11151 1603
NM_002303chr1--1107 ----
NM_002310chr5156299 6134 6079 5758 5380 5134 4943 4887 4196 4164 2551 2412 2036 1948 1494 21419 647 26341 142 --
NM_002312chr132999 786 1165 1953 --
NM_002313chr1084946 4785 4488 3956 3686 3669 1915 1693 24918 3758 ----
NM_002317chr54387 307 162 50 196 1368 --
NM_002336chr12115051 4755 4530 4095 3864 3309 1759 1703 798 306 147 14374 --13495
NM_002349chr241535 537 432 219 --1225 11370
NM_002351chrX71754 1643 1370 671 544 187 154 21702 610 ----
NM_002356chr6102528 2323 2310 2123 2103 1970 1915 1860 1094 441 --12006 --
NM_002358chr45514 432 133 55 39 ------
NM_002360chr712270 ----12533
NM_002372chr51491 ------
NM_002374chr251286 1266 1259 332 311 13016 123 --
NM_002381chr23895 840 137 125 1408 --
NM_002395chr6----11288 --
NM_002398chr221434 235 --1477 21244 1118
NM_002399chr1521107 238 1547 1516 11245
NM_002407chr111126 ------
NM_002408chr143845 303 67 --1181 --
NM_002411chr111125 ------
NM_002440chr1------1109
NM_002481chr1167920 7821 7408 7351 6943 5726 5176 4949 3045 2899 2601 1996 1517 861 501 224 46084 5598 1743 1110 17242 --
NM_002486chr962375 1833 944 647 511 407 1170 2841 494 12212
NM_002489chr7--1282 2368 175 1375
NM_002499chr1551731 954 730 190 40 31952 1924 63 --1749
NM_002505chr661471 1124 1047 530 453 177 21516 1149 21377 1109 --
NM_002508chr1----21933 1668 21305 77
NM_002515chr1451720 1653 1454 740 302 1479 ----
NM_002519chr1181399 603 378 363 295 152 88 56 --1117 --
NM_002522chr17103928 3616 3599 3203 2743 1226 925 754 631 250 23872 3053 23584 3087 --
NM_002524chr13763 736 325 1308 1868 1363
NM_002539chr23333 251 89 ------
NM_002545chr1174552 4517 3820 3721 3637 3203 2011 21526 388 ----
NM_002547chrX113477 3422 3056 1220 1007 793 519 487 380 372 53 33726 1544 952 32990 2686 427 14073
NM_002556chr1141434 694 606 68 21319 777 2199 193 --
NM_002570chr1541265 1250 482 312 --11088 --
NM_002572chr112320 274 ------
NM_002577chr393697 3623 3064 3030 2863 2618 1456 600 224 1141 23536 3382 --
NM_002581chr9125188 5160 5139 4031 3491 2091 2053 1661 1629 1078 871 224 31266 1051 719 21182 1090 --
NM_002582chr161866 ------
NM_002583chr12148 ------
NM_002590chr131427 --1409 --
NM_002594chr2041945 1542 461 126 42011 1571 335 276 --12353
NM_002595chr1271657 1477 1282 1217 750 473 359 1369 166 1285
NM_002600chr151397 1294 734 336 223 2519 268 1288 --
NM_002610chr2103159 2841 2565 2489 2196 1037 839 760 215 138 12832 --22807 688
NM_002613chr16115163 4641 4372 4319 4262 3735 3369 994 981 763 456 13879 11588 --
NM_002628chr31223 ------
NM_002629chr101629 ------
NM_002633chr1162 ------
NM_002635chr122161 26 ------
NM_002645chr1163158 3112 2936 2908 2695 1024 2474 281 11164 --
NM_002655chr874839 1966 1809 1472 1132 1082 163 1560 23968 3465 --
NM_002670chr341430 1223 1041 66 ------
NM_002699chr111440 11050 --11479
NM_002703chr441786 1204 664 176 1152 21689 1351 --
NM_002706chr2--1613 ----
NM_002709chr243067 2935 2545 2321 53250 3145 3035 2763 280 ----
NM_002711chr73762 237 222 1695 1664 1794
NM_002716chr1182931 2372 1307 1023 962 678 631 340 11049 33179 2298 1060 --
NM_002718chr362649 2333 771 763 517 423 2956 431 32428 1873 322 --
NM_002719chr1432023 716 434 11687 --12222
NM_002730chr19179 11392 ----
NM_002731chr152817 2597 2441 119 71 43131 2947 2926 2542 12513 --
NM_002734chr174821 710 666 315 11584 1133 --
NM_002736chr7----1253 22002 64
NM_002737chr17126213 5766 5413 5032 4538 4306 2208 1857 1408 933 737 539 1123 --26438 4328
NM_002745chr2263564 3366 2785 1739 303 31 13295 22809 1438 14331
NM_002748chr1541198 1093 1046 320 ----1456
NM_002750chr10--1202 ----
NM_002758chr17--1417 ----
NM_002760chrY195727 5709 5674 5175 4822 4717 4497 4407 3835 1884 1684 1638 1568 1265 664 484 347 234 205 53744 1777 1755 1276 407 159 135
NM_002767chr17--1226 --2376 39
NM_002786chr111194 ------
NM_002806chr14----1268 --
NM_002814chrX3764 616 240 ----2682 563
NM_002816chr171270 ------
NM_002822chr1221485 594 21679 420 3718 647 68 --
NM_002834chr1283519 3403 2975 2812 1434 558 281 158 23429 1110 13000 1703
NM_002835chr72666 194 --156 138
NM_002837chr12104283 4015 3854 3731 3672 3175 3063 1307 570 394 54391 3961 1745 1597 1342 --21537 779
NM_002838chr12798 465 --11151 --
NM_002839chr932534 328 238 2707 201 --13414
NM_002843chr1133138 3019 580 33428 2615 2557 ----
NM_002851chr73725 560 217 ------
NM_002857chr142717 1984 1788 576 22427 641 12282 --
NM_002859chr1231206 724 321 21768 1391 2109 103 1628
NM_002874chr962489 2344 1799 638 423 60 ----12032
NM_002886chr3105072 4270 4082 4040 3994 3768 3483 1934 1158 676 55103 4628 4252 564 339 14386 --
NM_002890chr51658 ------
NM_002892chr142533 376 --21548 1408 1584
NM_002894chr18--1241 ----
NM_002895chr201718 ------
NM_002902chr151196 ------
NM_002906chr112929 38 11726 --22099 1510
NM_002912chr62966 599 1119 --2920 325
NM_002923chr11455 2574 260 1511 --
NM_002927chr1----140 --
NM_002931chr61317 ------
NM_002940chr451569 1281 1225 169 106 2356 201 21928 1881 --
NM_002941chr341443 646 525 334 11504 --21616 1036
NM_002942chr32499 34 ----11381
NM_002951chr201265 2258 29 ----
NM_002956chr1221328 915 1433 1422 --
NM_002959chr154455 3495 883 867 798 23532 209 23702 3026 11181
NM_002968chr1631021 792 735 --1741 --
NM_002970chrX--1255 ----
NM_002979chr12674 359 127 186 1630
NM_002990chr1622387 970 22583 1777 ----
NM_002994chr41269 ----1389
NM_003001chr151779 773 733 640 331 11726 1498 --
NM_003003chr171264 ------
NM_003010chr1771859 1631 1552 908 599 377 39 --31608 846 346 --
NM_003016chr1731542 1303 679 ----1153
NM_003017chr671351 1047 1022 359 248 182 146 1497 ----
NM_003027chr151335 --140 --
NM_003030chr381995 1974 1781 1377 698 472 308 292 ------
NM_003031chr161804 1318 --1210
NM_003034chr12127501 7210 5908 4964 3178 3118 2762 2526 1853 1193 674 26 25813 5546 37771 5211 5182 25779 2274
NM_003046chr884945 4937 3771 2002 1966 1483 395 53 12094 1377 11463
NM_003048chr262470 1981 540 298 277 63 21885 247 31987 1901 654 --
NM_003051chr151870 1633 784 495 341 32021 1308 54 21763 467 1813
NM_003054chr101214 ------
NM_003059chr5--1253 178 --
NM_003068chr81907 2965 733 1929 1365
NM_003070chr93662 651 33 --1235 --
NM_003071chr352057 2007 1341 1267 220 --11937 --
NM_003099chr15126472 6347 6177 6094 5655 5125 5008 4416 4150 1845 1345 454 45336 5114 4198 537 46279 6269 5678 4248 --
NM_003101chr14452 364 249 175 1565 184 135
NM_003106chr321108 879 ------
NM_003107chr622648 2141 --41627 840 817 619 12310
NM_003108chr2147066 5635 5430 5180 4798 4426 2928 1630 1582 1546 1358 872 477 375 57247 6845 5519 1730 715 26399 911 27121 1235
NM_003112chr742263 1145 573 361 31211 64 56 22583 1980 1199
NM_003133chr12240 211 1306 2990 719 --
NM_003135chr53366 285 108 ------
NM_003137chr642213 1848 1682 689 1319 12049 --
NM_003139chr111848 ------
NM_003161chr1763595 3414 3067 2840 1325 207 23207 967 22740 826 1895
NM_003162chr24785 374 205 110 1416 --1923
NM_003165chr961857 1817 1556 568 270 71 --21866 1574 164
NM_003188chr64743 672 565 26 ------
NM_003199chr1895052 4843 1926 1799 1602 507 500 293 275 52171 2088 1395 443 381 34875 3590 1822 14742
NM_003201chr1051059 861 854 221 68 11017 ----
NM_003206chr6--1430 ----
NM_003211chr1211737 --21716 82 --
NM_003222chr2031188 1131 288 2779 463 21083 361 --
NM_003234chr372198 1889 1650 548 492 427 353 --2872 748 --
NM_003246chr1541875 1700 1541 61 1257 41679 767 552 21 --
NM_003253chr2151870 1578 715 387 139 41767 1624 652 485 --1306
NM_003262chr384986 4200 3332 3200 1771 1310 74 22 13248 34771 624 115 --
NM_003269chr671336 1209 991 846 334 319 307 ----1231
NM_003270chrX41039 804 300 282 --1308 11062
NM_003274chr2161850 978 956 696 639 64 43002 2444 2277 1992 --22857 630
NM_003275chr971421 1378 1345 1303 568 516 34 31522 484 163 21087 560 1268
NM_003291chr132848 691 --1744 --
NM_003292chr151787 1720 1637 892 852 22167 567 42078 2035 1975 918 12261
NM_003298chr3126076 5986 5691 5043 4660 4466 4389 4042 2082 1831 615 338 23856 1078 35297 4970 328 15763
NM_003304chr31391 --196 --
NM_003305chr42416 407 176 ----
NM_003334chrX1167 ------
NM_003338chr1041979 591 315 142 21281 291 --1501
NM_003339chr541535 1432 1057 52 ------
NM_003340chr431128 516 40 31219 352 163 21342 1185 --
NM_003342chr1753137 2641 1173 1154 130 21242 782 22507 618 1819
NM_003344chr731458 427 287 11719 ----
NM_003350chr82399 214 ------
NM_003352chr22413 114 --2928 918 2849 92
NM_003356chr112855 243 ------
NM_003360chr42227 44 ------
NM_003374chr5----1851 --
NM_003375chr101347 ------
NM_003387chr272425 2330 2228 792 771 669 360 --12523 1460
NM_003390chr113943 145 56 21040 371 ----
NM_003392chr364209 3974 3566 2982 1032 397 1240 23180 1677 --
NM_003400chr2--1222 ----
NM_003403chr141635 ------
NM_003404chr2081766 1678 1294 781 692 615 445 272 21800 660 1387 --
NM_003410chrX53034 2376 2158 775 372 11201 22553 1126 1687
NM_003411chrY41715 730 252 94 11126 ----
NM_003413chrX41881 1528 750 667 --163 --
NM_003421chr1094132 3782 3574 3379 3347 2750 1544 167 84 1364 22946 1227 --
NM_003431chr13607 202 132 1195 1423 2493 216
NM_003440chr122872 672 2821 661 ----
NM_003441chr431337 900 252 21161 98 --21148 984
NM_003463chr662808 2587 2541 1247 962 900 32183 756 649 3465 117 26 13182
NM_003466chr2122338 2272 2262 2241 2032 1856 1654 1605 1536 937 268 29 21664 255 1915 --
NM_003468chr243863 3574 2965 851 21406 1318 11016 12984
NM_003469chr22393 353 --1334 --
NM_003471chr332038 2002 219 21614 174 --12100
NM_003472chr61508 11327 --1992
NM_003477chr111559 ------
NM_003478chr1173291 2732 2720 2339 1304 1254 580 42574 1081 726 712 13237 1403
NM_003489chr2131045 200 149 3798 124 86 23256 106 --
NM_003498chr1682741 2615 2133 975 907 859 351 88 --21928 1884 12775
NM_003505chr721493 746 11918 --11247
NM_003506chr84999 503 438 363 2407 198 148 1132
NM_003558chr92619 224 --1460 --
NM_003574chr18155551 5295 4920 4598 4218 2092 2012 1473 1403 1105 930 673 538 379 193 44722 2066 1868 1380 2737 704 24009 1714
NM_003580chr8132 --1162 --
NM_003581chr211021 ------
NM_003583chr12131 21093 65 11314 23711 2988
NM_003589chr1331244 1229 1171 31310 424 403 ----
NM_003590chr233825 3558 1460 31197 908 464 --23573 2519
NM_003595chr222177 155 ----1165
NM_003603chr441857 1331 632 64 1857 ----
NM_003607chr194003 3403 2967 1745 1725 1048 1019 562 96 33521 2858 1592 ----
NM_003615chr393754 3573 3104 3086 2640 2529 1591 1382 378 --14011 --
NM_003616chr141179 ----1358
NM_003620chr1731079 1055 936 1399 --1440
NM_003628chr2--1516 188 --
NM_003629chr161318 1260 938 832 243 224 2635 347 1572 12997
NM_003644chr17166446 5961 5539 5267 4750 4655 4423 4408 1710 1621 1118 672 337 280 264 107 66535 2423 1462 1282 719 228 --12491
NM_003659chr251149 951 944 836 417 ------
NM_003663chr3133471 2924 2869 2793 2653 2594 2285 2205 1285 382 367 278 237 11243 ----
NM_003668chr12--138 ----
NM_003671chr993472 3200 3099 2448 2341 1273 219 149 25 23553 75 52315 1436 1377 1087 448 2758 46
NM_003672chr14788 774 613 93 1161 21232 199 --
NM_003677chr1221838 480 21477 767 42281 2013 1489 39 --
NM_003679chr163297 3284 2624 2389 276 126 --13329 --
NM_003685chr19----2877 668 1675
NM_003702chr81614 2674 195 1790 --
NM_003722chr322524 1834 22402 1739 --12410
NM_003725chr122397 46 ------
NM_003743chr252306 2178 1810 1653 75 1764 1178 1222
NM_003749chr1372372 1884 1868 1790 1738 1694 1609 2741 265 2724 561 --
NM_003750chr103935 350 209 ------
NM_003758chr1541648 1550 1216 465 1534 --11557
NM_003758chr1541648 1550 1216 465 1534 --11557
NM_003759chr4103724 3676 3555 3413 2802 2741 1379 1277 801 736 196 1683 21731 609
NM_003760chr12704 175 2800 681 1612 --
NM_003763chr2042671 1945 1082 303 1505 --23170 2845
NM_003772chr114340 317 208 129 1964 31221 1084 327 --
NM_003774chr1252487 1242 1112 885 873 --3925 277 161 1129
NM_003787chr184383 339 188 26 1663 31591 1201 377 --
NM_003794chr33689 376 287 ------
NM_003796chr19193 1154 ----
NM_003800chr632239 1713 492 2361 257 22245 263 186
NM_003803chr181278 ------
NM_003816chr871296 1211 593 404 232 156 42 21505 79 ----
NM_003822chr151093 842 438 276 139 22286 1144 1444 12652
NM_003825chr1521411 54 21447 1348 ----
NM_003831chr1861643 1183 1135 650 252 81 --11427 --
NM_003870chr1511931 --21320 513 --
NM_003872chr262726 2311 1152 1058 952 86 1454 --1717
NM_003884chr351763 1597 424 178 96 2563 132 11698 11467
NM_003887chr23889 493 225 --11474 22328 248
NM_003895chr2141850 1726 432 197 31928 799 308 ----
NM_003896chr23334 230 42 123 1867 --
NM_003902chr1--1145 ----
NM_003905chr16----139 --
NM_003913chr6104345 3815 3168 3068 2834 2751 1659 1384 959 895 34250 4205 3389 32878 1398 531 148
NM_003927chr1831032 887 59 --1424 1291
NM_003930chr732513 2194 1944 31880 1813 466 21741 1731 --
NM_003934chr941190 1133 1083 521 --11143 --
NM_003939chr1052881 2794 2737 2648 1137 33569 2852 709 23838 608 13254
NM_003941chr762501 2297 2166 1572 830 770 1748 12469 11855
NM_003948chr482609 2533 1931 863 504 409 194 24 22203 878 12374 22490 2336
NM_003951chrX------1272
NM_003958chr693420 3395 3285 916 391 193 96 52 26 21438 457 13211 22808 108
NM_003966chr5137369 7304 6682 6666 6616 5947 5837 4728 2931 2263 1316 795 394 67651 5968 5723 5467 1407 830 67843 6732 2134 1770 998 180 57402 1494 1476 990 948
NM_003983chr1694281 3218 2974 2770 1675 946 607 437 30 11122 ----
NM_003994chr1283891 3789 3683 3667 921 756 693 201 44139 1033 479 364 34255 3715 3200 13519
NM_004024chr141201 427 399 194 31243 180 75 1200 --
NM_004028chr1863966 3630 3613 3063 968 408 1661 32901 2729 360 23348 2749
NM_004035chr1795199 4119 3244 3164 1536 1426 1104 467 313 55021 4429 3324 1485 1253 2939 197 11827
NM_004036chr27763 584 504 491 225 85 54 --160 --
NM_004061chr5----1656 --
NM_004065chrX8302 284 212 202 195 113 85 67 --2229 30 --
NM_004079chr182551 2441 2427 2347 2223 1933 886 372 1722 11997 --
NM_004081chrY2617 435 --51557 369 327 246 193 11817
NM_004087chr321761 1724 --11835 1221
NM_004089chrX11262 11022 1918 --
NM_004093chr1373253 844 779 541 385 215 208 22194 1211 1100 12584
NM_004094chr1433051 103 72 22128 1220 1642 22172 90
NM_004100chr672598 1864 1757 1017 817 156 49 32681 2586 2087 1277 --
NM_004109chr1142036 1756 162 145 1741 1462 --
NM_004113chr361337 824 528 473 376 174 ------
NM_004124chr1493418 3205 3156 2478 2343 1246 1134 917 368 --33074 422 53 --
NM_004132chr10--11229 ----
NM_004133chr8112728 2441 2371 2186 1718 878 753 618 606 272 57 22460 1838 --1377
NM_004136chr1542946 2689 2611 2021 12520 2403 155 --
NM_004156chr8----2429 192 1452
NM_004161chr231372 1345 1252 1353 11532 1581
NM_004170chr951827 1710 1603 1581 723 --11447 126
NM_004171chr11239588 9359 9253 8922 8319 7836 7513 7042 6456 6267 6226 3564 3407 2613 2484 1805 1729 1649 1615 1457 1094 683 269 79288 9204 6591 6347 6104 2728 2672 17709 19608
NM_004172chr531314 1250 370 11643 1201 21682 132
NM_004202chrY1112 ------
NM_004229chrX52153 1857 1726 648 423 12070 ----
NM_004232chr1822368 974 43572 3387 2945 2885 23132 53 23762 488
NM_004261chr11381 ------
NM_004268chr113776 181 49 --11109 --
NM_004272chr571997 1805 1642 815 603 141 109 21679 495 1556 --
NM_004273chr1084646 4489 4247 4053 1263 970 860 434 54955 3582 1673 1656 1196 ----
NM_004274chr1443098 2463 809 671 23004 1067 32649 480 41 --
NM_004277chr641704 1640 1545 374 2323 156 149 --
NM_004282chr61213 ------
NM_004290chr551223 918 886 555 420 21147 364 --2454 161
NM_004293chr993258 3061 2927 2708 2498 872 649 528 497 53298 3183 983 485 325 23491 1080 2448 398
NM_004311chr1063159 2633 2207 883 752 439 43060 2303 2192 54 1237 11023
NM_004319chr173191 3066 2817 2781 2714 2569 1967 1299 12019 --
NM_004331chr862592 2529 2317 1993 1678 986 41870 1003 206 23 12065 11898
NM_004337chr842121 887 694 627 12236 2906 104 --
NM_004338chr18146437 6322 6283 4626 4276 2740 2279 2159 1896 1776 1464 1103 812 386 26186 601 46252 5646 1452 178 11501
NM_004342chr751726 1593 492 470 305 22095 805 --1915
NM_004349chr81385 ----2981 244
NM_004359chr191511 ------
NM_004362chr41587 --1474 1743
NM_004365chr51240 ------
NM_004370chr662182 1684 1568 1404 294 62 ----12216
NM_004379chr24549 400 124 62 ----1608
NM_004380chr1692617 2378 1959 1794 1731 1059 751 602 434 12534 11768 156
NM_004388chr11359 2404 150 ----
NM_004392chr1362685 2126 1976 1935 1046 656 5645 562 491 356 209 21657 681 --
NM_004396chr171248 ------
NM_004397chr1164025 3640 2624 1628 639 221 2432 170 14335 14109
NM_004407chr44984 679 261 126 155 ----
NM_004412chr10125977 5844 5654 5567 4915 4627 3802 2001 1863 639 425 64 15906 55833 5363 4772 4521 1235 55560 2288 2121 1660 534
NM_004430chr872442 2091 2052 1727 709 593 60 --32675 2388 332 --
NM_004432chr941753 966 706 587 --21823 1612 11786
NM_004434chr1441360 488 410 222 11421 ----
NM_004438chr2123091 2819 1075 767 655 337 328 212 162 102 64 32 73313 2893 2760 2499 2078 986 592 1422 12990
NM_004440chr631418 561 526 1248 --11647
NM_004447chr121201 11123 --1188
NM_004457chr221691 62 ------
NM_004458chrX61659 902 800 754 691 200 1763 --2793 208
NM_004464chr493780 3709 3306 3100 1594 1270 333 118 86 24151 74 31063 180 148 --
NM_004468chr11405 ------
NM_004482chr2--3743 81 25 ----
NM_004490chr2132 ------
NM_004491chr1954248 1114 982 388 232 43970 3865 2801 417 13998 --
NM_004496chr1411208 --2520 474 --
NM_004500chr1451871 1784 1626 1387 409 ------
NM_004501chr153844 3805 3576 2837 1326 43551 3464 2899 747 12756 1598
NM_004502chr17171 ----1217
NM_004504chr242771 2610 2210 1979 23055 2627 33082 1131 24 1450
NM_004505chr173638 431 276 --31916 1509 83 --
NM_004516chr1931132 208 137 11251 ----
NM_004523chr1051438 1430 1293 1131 57 ------
NM_004525chr22289 230 11526 1220 11511
NM_004529chr921322 1076 21132 279 ----
NM_004537chr1241548 1460 1160 1058 21096 61 11336 11180
NM_004538chrX1654 3683 539 70 1588 1769
NM_004540chr211647 --4806 617 283 275 --
NM_004571chr2193373 3357 3193 2599 2580 2352 585 466 407 ------
NM_004576chr5137 ----1404
NM_004582chr11425 ------
NM_004586chrX105399 4751 4288 3935 3902 1922 1002 296 246 79 12156 ----
NM_004588chr1194017 3681 3334 2571 1614 1592 1526 1492 514 14081 33963 1345 705 13525
NM_004593chr32308 151 2326 264 --1855
NM_004598chr563261 2896 2702 1109 792 778 12726 1893 12163
NM_004600chr151357 1346 1249 1092 420 ----1139
NM_004602chr2031495 1291 1213 31488 1137 70 158 150
NM_004612chr994848 4143 3745 1815 1763 1536 1286 692 354 33257 3082 818 43540 3362 1500 88 24681 4161
NM_004615chrX3684 607 68 ------
NM_004622chr231753 1520 922 --1150 12138
NM_004641chr1041297 1207 1122 457 157 1235 11461
NM_004650chrX51801 1439 589 477 401 1521 1407 --
NM_004654chrY31400 1094 1069 ----185
NM_004655chr1731220 314 254 --1202 --
NM_004660chrY82246 2233 1986 1781 1732 877 714 283 ------
NM_004663chr1551283 1182 1155 229 55 21030 484 ----
NM_004664chr12152 --1282 --
NM_004670chr1051373 1285 1257 567 29 21217 335 11174 21579 194
NM_004673chr141527 1146 505 484 --11274 11004
NM_004685chr1322903 2529 22401 915 22659 705 12566
NM_004687chr1751708 1674 1438 238 149 ----11718
NM_004690chr64540 233 71 46 1562 ----
NM_004703chr1752428 1804 1773 974 119 2650 589 42537 1945 676 577 189
NM_004707chr531524 1480 438 31642 281 65 31408 595 334 --
NM_004709chrX81715 1689 1534 1442 1431 1183 1108 521 1355 185 --
NM_004713chr144605 556 314 265 1727 ----
NM_004719chr1242753 2568 2387 1794 12429 32851 2077 96 2285 74
NM_004726chrX135474 5437 5224 5179 5114 4778 3510 3494 1796 1463 1232 628 208 45696 5027 1635 1246 13679 --
NM_004730chr52552 277 ----1143
NM_004731chr1231599 1394 96 11253 --11219
NM_004734chr1392746 2521 2347 2133 1137 1004 549 273 156 --1233 13300
NM_004736chr152212 2047 1476 901 400 21935 1451 1360 12224
NM_004742chr341849 1344 1190 106 11710 11224 --
NM_004745chr896945 6120 5781 4727 1915 1692 462 322 99 24766 1889 16467 15534
NM_004748chr1574194 3680 3241 3052 875 618 366 21190 1087 33349 108 88 33502 3128 1622
NM_004755chr143392 248 169 ------
NM_004760chr742035 1841 1645 670 11800 190 142
NM_004763chr25930 905 829 66 36 1114 6812 760 704 424 368 312 --
NM_004770chr8----126 1221
NM_004775chr1832245 1840 189 41980 1568 1481 111 ----
NM_004776chr2031343 188 175 32915 2219 1215 23231 2448 --
NM_004779chr541249 930 484 313 ----1149
NM_004788chr1182685 2166 1972 1933 1768 980 891 153 --22653 2398 --
NM_004795chr1361270 532 374 179 151 33 ------
NM_004797chr3123404 3150 2937 2928 2910 2535 1445 1418 887 509 500 344 12736 11350 --
NM_004801chr261278 1168 534 508 270 54 1424 --21560 1325
NM_004805chr241194 1159 453 367 --1543 11402
NM_004808chr1063348 2596 919 702 109 63 11325 23420 2761 --
NM_004815chr1104795 4703 4692 4649 4580 3982 3803 1473 1006 161 14192 2955 204 14299
NM_004827chr451563 662 279 165 58 1288 --2451 437
NM_004834chr262966 2633 2094 1065 445 75 22142 53 12665 1292
NM_004836chr23895 658 236 188 ----
NM_004837chr121239 189 11559 21354 477 11254
NM_004840chrX52270 1683 758 59 47 32100 1866 1662 22108 1726 --
NM_004842chr641660 1562 1336 161 11576 ----
NM_004849chr671703 1427 1308 1196 1073 486 278 --1250 --
NM_004857chr1424548 3758 44235 4000 1894 1278 44028 1850 1447 178 1754
NM_004859chr1792296 1239 995 929 905 877 812 515 351 12061 142 1542
NM_004863chr1465209 4703 3598 1831 1165 579 42010 1349 1222 955 1127 --
NM_004866chr554944 4550 1942 1338 1114 33370 1934 1422 1423 1289
NM_004867chrX3643 261 204 --1210 --
NM_004871chr1774129 3223 2677 1561 905 164 54 44244 1059 1020 787 --23962 2891
NM_004873chr1473241 2271 1206 1165 1157 859 118 ------
NM_004893chr5--1499 ----
NM_004896chr1021586 212 11526 21013 220 --
NM_004898chr462687 1778 1122 1012 654 134 22045 905 ----
NM_004904chr7156248 6085 5798 5516 4871 2416 2334 2292 1723 1293 1207 333 326 270 93 36128 4571 1047 35153 4400 1377 15785
NM_004921chr141641 554 436 160 153 1604 1233
NM_004926chr141223 1747 --11523
NM_004929chr831525 967 360 11094 --1200
NM_004956chr773421 1469 1146 846 697 636 70 23489 1564 23453 1533 --
NM_004965chr211238 1665 2752 675 --
NM_004985chr1274258 3906 3877 3844 3522 1503 240 24185 3762 44431 4294 2790 433 1802
NM_004992chrX98509 8037 7984 7301 5835 2792 2373 1588 1028 28174 7564 48397 7283 7177 104 22725 2097
NM_004992chrX98509 8037 7984 7301 5835 2792 2373 1588 1028 28174 7564 48397 7283 7177 104 22725 2097
NM_004999chr663553 2933 2890 1272 815 380 1459 11576 24491 3038
NM_005006chr2--2179 147 --11071
NM_005010chr722220 393 11925 31723 762 182 1601
NM_005023chr521331 1306 1467 11238 --
NM_005025chr31239 ------
NM_005028chr1052347 1992 1556 651 496 1912 ----
NM_005030chr161251 ------
NM_005032chrX2943 224 11057 1750 --
NM_005044chrX184283 4265 4230 3694 3579 3344 3236 3016 2926 1815 1127 974 724 534 322 164 51 22 1224 1197 --
NM_005056chr1275233 4803 4147 3446 2197 1767 1105 65144 4887 4853 4013 989 120 1640 13940
NM_005058chrY--1219 298 62 --
NM_005063chr1093857 3837 3642 3013 2434 1396 1320 1164 75 23106 1288 23024 154 --
NM_005065chr14125378 5299 5153 4566 4200 4104 4012 3366 1374 1316 194 128 75178 4151 1939 1481 499 453 262 14639 33563 1271 525
NM_005066chr15822 725 603 523 272 1736 ----
NM_005068chr641350 1121 201 40 21004 260 --1499
NM_005074chr6148 ------
NM_005086chr1241410 480 249 122 --1686 --
NM_005093chr2074462 4413 4337 3328 1494 940 764 34400 4042 1065 25045 269 14427
NM_005095chr131446 773 170 --11409 31928 1690 191
NM_005105chr172148 2051 1935 1681 1556 1354 250 21899 1848 1193 --
NM_005121chr1783754 3587 3531 3454 3134 1115 991 189 13345 --1781
NM_005126chr332271 263 233 11548 1248 --
NM_005135chr1593613 3375 2638 2358 1096 1016 1008 559 124 --33764 2707 806 33856 3196 329
NM_005137chr2292344 2190 1899 1614 944 822 622 615 77 1631 --1541
NM_005141chr4--1129 ----
NM_005156chr9104794 4747 3859 2157 2085 1910 1538 1470 1108 31 13893 34406 3261 68 --
NM_005159chr1532178 792 421 1377 22259 822 1465
NM_005160chr22166678 6295 6079 5795 5592 5528 5371 4793 4325 4289 4219 2657 2097 1666 713 667 36204 5256 4368 36334 5709 4604 2972 194
NM_005164chr1262108 1624 953 551 358 308 32683 861 339 --22485 2117
NM_005168chr221201 573 31361 590 225 ----
NM_005180chr101428 11233 --1184
NM_005188chr11117946 7325 7010 6851 6749 2896 2506 2352 2100 849 688 67588 6555 6311 5680 1689 319 --17164
NM_005190chr61726 ------
NM_005197chr14126231 6217 5216 4281 3878 2109 2080 745 636 468 332 212 42481 1723 797 270 25298 576 --
NM_005201chr331143 334 319 ----1836
NM_005207chr2253511 3396 3104 2339 1000 33260 1468 986 21340 960 1239
NM_005221chr71221 ----1104
NM_005230chr121451 --1587 --
NM_005233chr322132 1050 1626 --1156
NM_005235chr2127799 7165 6776 6625 5809 5587 2587 1637 1041 1022 516 389 77810 7200 5371 2405 1750 935 451 33146 1028 184 16984
NM_005238chr1163391 3209 2316 1003 941 34 33334 3247 491 1749 22717 483
NM_005241chr351289 383 286 229 141 --11033 --
NM_005249chr141617 ------
NM_005254chr1551277 1092 957 408 199 1499 ----
NM_005256chr11--186 --1131
NM_005259chr241554 1342 1236 584 --1938 --
NM_005261chr8178 ------
NM_005277chr431905 492 234 2513 368 ----
NM_005278chrX--3444 391 211 --1474
NM_005296chrX21071 292 21017 722 --2912 91
NM_005311chr74816 508 342 46 42259 617 258 25 1268 --
NM_005314chrX3665 631 168 ------
NM_005316chr11--2844 65 1172 11015
NM_005318chr221802 ------
NM_005327chr42560 37 2732 25 --1745
NM_005333chrX3824 386 74 1306 1995 --
NM_005334chrX11787 ------
NM_005339chr464182 4027 2747 1378 689 540 21228 484 11402 33968 1153 143
NM_005347chr961718 1464 1433 1251 122 39 11051 170 11215
NM_005348chr141337 ------
NM_005359chr18126444 5301 5139 4635 4242 4027 2613 1761 1696 1300 945 161 34498 123 76 14959 15777
NM_005375chr621126 350 1823 ----
NM_005378chr21869 ------
NM_005381chr2135 ------
NM_005385chr362722 2551 1958 1675 1668 994 --12308 --
NM_005388chr961647 1474 1395 579 349 158 1670 --11559
NM_005389chr6--1121 ----
NM_005397chr773921 3703 3368 2914 1168 1016 532 43029 1301 485 325 13931 23942 3097
NM_005399chr1104365 3350 3176 2967 2933 1363 965 919 78 62 34383 3148 651 21545 84 11383
NM_005400chr222421 574 32606 1157 702 --11164
NM_005402chr741760 1299 284 68 1401 2509 85 1616
NM_005406chr1821549 162 --21410 438 11364
NM_005426chr14642 584 154 115 1851 1592 --
NM_005433chr1842789 2671 2360 618 1697 42653 785 660 122 --
NM_005436chr10104118 3539 2926 2877 2535 1174 951 399 252 110 23863 479 12899 43598 3281 1659 1369
NM_005443chr4------1450
NM_005445chr101248 ------
NM_005455chr121601 616 ----1485
NM_005465chr151922 1502 1333 582 550 --21603 728 21253 50
NM_005487chr2231915 1627 427 ----1469
NM_005493chr63524 234 77 ------
NM_005497chr17135697 5332 5205 4615 4405 3953 2255 2230 1473 1149 875 360 59 34080 1356 667 12055 25918 544
NM_005499chr191130 1110 3459 423 181 --
NM_005502chr972862 2347 1311 844 588 116 28 23131 1996 33121 2713 2332 --
NM_005504chr12176441 6271 5743 5507 5037 5009 4413 4179 2325 1929 1692 1238 957 898 664 481 383 --14936 --
NM_005520chr51476 ------
NM_005524chr3--1306 ----
NM_005544chr23875 384 192 11009 --1822
NM_005565chr52154 94 1449 ----
NM_005570chr1811096 11013 11109 --
NM_005575chr52748 171 1564 --1654
NM_005578chr375170 5065 3136 1117 471 403 187 23642 1107 54734 1692 1430 1231 1157 34218 4072 31
NM_005584chr134777 768 677 597 2756 258 ----
NM_005595chr11647 2850 192 ----
NM_005596chr9135581 4902 4893 4120 2398 2338 2221 2124 1498 699 284 186 113 45923 5461 4213 1315 26404 2020 1224
NM_005599chr141090 425 371 321 21347 1182 --1520
NM_005603chr1851989 1306 792 387 110 22038 639 ----
NM_005604chr652374 2255 2213 541 179 12391 1328 21632 1598
NM_005607chr81850 2960 139 ----
NM_005613chr152006 1994 1445 1376 1352 21475 51 11465 --
NM_005622chr161161 ------
NM_005637chr1821421 472 11342 32002 507 305 21448 1306
NM_005638chrX21211 201 --11275 11788
NM_005639chr1231835 747 536 --21322 401 11622
NM_005648chr81165 ----1212
NM_005655chr82952 399 1888 --1833
NM_005665chr1114908 4642 4282 3895 3707 3520 1351 1076 344 322 263 11866 24704 870 34391 1879 1311
NM_005667chr21175 ------
NM_005668chr5124485 4212 4054 3841 3503 3476 3409 3185 1362 1278 584 538 43210 1848 62 42 24514 110 --
NM_005718chr31261 ------
NM_005719chr121187 ------
NM_005721chr241131 977 207 107 11024 11061 --
NM_005725chr142438 2416 1552 231 31836 930 676 2198 86 1408
NM_005738chr741763 1673 550 293 21862 1381 11802 --
NM_005741chr16--2865 809 --2817 172
NM_005746chr731069 955 730 2560 476 32050 1093 660 21687 282
NM_005748chr1263267 3086 2717 2385 1084 740 --13031 --
NM_005749chr17--1660 1714 --
NM_005752chr1621152 361 1936 ----
NM_005759chr274408 3825 3665 3209 3032 595 60 43730 3685 1368 831 21702 225 11593
NM_005772chr91753 ------
NM_005779chr5103404 3184 2895 2557 1430 1073 863 618 592 172 --11084 23320 1110
NM_005797chr1161583 1512 1420 1285 568 22 11570 21317 1169 --
NM_005802chr92715 680 ------
NM_005807chr11276 ----162
NM_005808chr362892 2595 2336 2222 87 39 1806 11177 12958
NM_005810chr122237 109 ------
NM_005813chr261768 1646 1611 845 535 176 --22436 2128 --
NM_005819chr1103398 3277 2964 2773 2242 1194 1184 1134 497 175 33383 2801 105 ----
NM_005822chr652346 2005 1591 1570 642 22304 1942 ----
NM_005826chr11542 1131 --1460
NM_005828chr17144948 4925 4666 4505 4102 3940 3295 1870 1582 1559 894 841 791 698 14378 ----
NM_005840chrX207396 7303 7221 7114 6708 6616 6548 6303 5567 5530 4834 2730 2462 2102 1888 1259 1215 1158 1100 287 45647 5409 2389 1648 46071 5187 1679 1283 --
NM_005841chr411095 ------
NM_005842chr131777 ------
NM_005843chr271716 1671 1239 1224 683 492 25 21543 71 --1484
NM_005857chr141061 420 340 183 21085 1046 --125
NM_005863chr1051287 934 915 413 368 11155 3887 535 480 --
NM_005868chr762334 2107 808 768 428 126 12361 --1118
NM_005871chr102824 337 ------
NM_005880chr164616 375 227 100 11436 11121 11350
NM_005882chr41810 2237 184 ----
NM_005888chr122161 26 ------
NM_005898chr1162848 1288 1151 1034 964 501 2694 328 12063 --
NM_005899chr171383 11077 2484 316 --
NM_005901chr18208677 8310 8163 7941 7778 7290 7062 7019 6656 6026 5661 3378 3221 3201 2517 1905 1837 1599 602 266 57099 6822 6385 2959 2669 --23102 719
NM_005902chr1574111 3931 2998 2811 1716 1146 150 21238 722 23218 125 11405
NM_005903chr5115181 5102 4920 4805 4231 4157 3773 3417 1907 1453 1192 34480 4211 319 24333 268 192
NM_005906chr661445 1392 1254 233 103 95 21585 1099 ----
NM_005907chr661607 1547 1474 1267 1057 289 --11397 --
NM_005909chr5103782 3740 3706 3304 3089 1526 1495 253 105 62 14072 21210 896 24046 3879
NM_005910chr1773760 3009 2809 1296 945 451 352 33898 2899 1515 --13146
NM_005911chr21285 1359 ----
NM_005924chr71378 ----2444 291
NM_005935chr495120 4299 3469 2069 1161 964 707 617 365 23276 1201 11395 13860
NM_005937chr1744079 3893 3827 3425 --2171 165 23814 1655
NM_005941chr872966 1434 1336 1276 950 498 359 11289 24047 3555 22928 2839
NM_005944chr361239 292 267 257 100 23 --1460 --
NM_005955chr185322 5149 4712 4014 3513 3494 1216 112 25134 3909 34755 4524 4116 25516 4695
NM_005957chr1114882 4313 3841 3677 3298 3128 3038 1881 1416 1104 146 54230 3799 3428 1812 289 21086 509 24247 3522
NM_005962chr101610 32200 928 558 ----
NM_005962chr101610 32200 928 558 ----
NM_005966chr242258 1892 790 394 129 --11701
NM_005973chr11334 ------
NM_005977chr1331017 813 43 --1686 1738
NM_005999chr141528 1451 1257 327 11564 11416 --
NM_006007chr974325 3192 3039 2834 2752 1605 812 32893 1804 217 125 24124 3478
NM_006009chr12------163
NM_006011chr1594128 4031 3649 2801 1566 1474 1088 997 879 43973 2845 2819 774 13263 --
NM_006016chr61296 1904 2856 54 1804
NM_006022chr135878 869 856 405 43 2932 268 2899 719 --
NM_006036chr222556 792 22521 1672 3753 685 38 --
NM_006037chr244854 3860 721 601 13409 24404 1341 --
NM_006047chr2073338 3214 3097 2400 2378 1012 482 42483 2243 1334 381 11006 --
NM_006054chr1131496 1090 287 --1638 --
NM_006060chr794350 3766 3733 3271 3145 1352 1224 267 93 34257 1004 182 11459 --
NM_006061chr631123 284 259 21049 96 21257 329 --
NM_006070chr33429 159 82 --1143 --
NM_006079chr63766 242 104 1817 1531 --
NM_006080chr742946 2097 509 369 2893 300 --159
NM_006094chr872140 2049 2003 888 575 483 95 1269 3528 392 203 --
NM_006095chr464335 4291 3902 3809 1447 437 34276 1410 1316 13538 31096 1089 245
NM_006106chr1133100 2611 515 33263 3170 529 --13049
NM_006107chr17--1356 --2502 70
NM_006113chr151420 1401 1379 628 157 1832 21331 85 1487
NM_006136chr711364 11205 --1198
NM_006139chr232494 2160 177 22468 2377 --22579 269
NM_006152chr12----1253 --
NM_006162chr1881593 1483 695 540 447 177 163 124 --21383 398 11717
NM_006166chr1282597 2575 1779 776 687 581 331 58 --1904 --
NM_006178chr1731027 551 90 31641 537 342 1174 11587
NM_006180chr941986 1908 1385 53 11393 31957 1855 1667 --
NM_006183chr124553 499 399 125 --1417 --
NM_006191chr124857 774 745 243 ----3982 835 371
NM_006194chr1441329 382 241 115 ------
NM_006195chr931370 1294 397 ----21389 1127
NM_006196chr2--1367 ----
NM_006197chr842057 679 336 168 1688 1602 --
NM_006203chr5155272 5157 4856 4829 4684 4673 3872 3622 3612 3510 2233 2206 1047 720 519 32181 2098 1588 --24875 2144
NM_006206chr482182 2120 1085 1027 954 905 456 175 32514 1177 420 ----
NM_006209chr8177 ------
NM_006212chr1175385 5283 5012 4856 4824 4513 4171 4128 3746 3467 2045 1954 1891 1831 1474 629 198 ----14113
NM_006226chr251337 869 486 389 204 11270 11422 --
NM_006237chr1342064 1866 1763 613 1802 22235 1746 21951 1697
NM_006241chr381974 1652 1512 935 589 452 415 355 22089 1560 --2501 166
NM_006246chr141866 11222 --11211
NM_006251chr573067 2636 2552 2140 2077 625 300 12467 32933 2860 2750 11211
NM_006252chr1157618 7283 7238 6890 6651 6557 5515 5474 5366 5320 4712 2326 2195 723 490 67198 4846 4782 2620 1446 1076 21754 141 47264 7097 2891 151
NM_006256chr132029 1108 698 12084 22350 123 22635 212
NM_006258chr1071567 1301 582 356 306 233 50 21511 35 ----
NM_006264chr41384 1147 1162 --
NM_006265chr851419 1218 1187 1050 501 21510 369 11166 1351
NM_006267chr271852 1524 1387 742 415 294 50 193 ----
NM_006281chr841071 1001 849 59 1295 1329 11026
NM_006281chr841071 1001 849 59 1295 1329 11026
NM_006282chr20124569 3942 3548 1845 1792 1613 1475 1210 1155 1099 525 345 23794 1025 11739 --
NM_006283chr8114353 4034 3712 3550 3500 1797 1442 1299 625 559 173 33766 3063 1108 --11240
NM_006287chr242452 1931 843 684 12643 12442 --
NM_006305chr15--122 ----
NM_006306chrX114379 1641 1107 1098 1050 977 687 514 424 230 213 14941 35633 4411 4303 14180
NM_006310chr1741282 888 833 275 1926 --1177
NM_006313chr1251696 1239 1199 391 95 11325 ----
NM_006315chr483832 3636 1805 1386 1140 1088 875 412 34033 692 336 22886 1047 1433
NM_006320chr41347 1233 1810 1978
NM_006330chr821135 1060 21246 318 11613 --
NM_006345chr411264 31369 395 222 31330 978 88 11147
NM_006352chr162104 1640 1367 1358 580 486 2778 99 --11344
NM_006353chr641423 1328 190 50 1563 21306 196 1958
NM_006364chr1441277 440 340 169 --1946 --
NM_006366chr621313 172 21065 444 ----
NM_006371chr374825 4283 4170 3529 3416 1737 1522 45272 5254 2115 1715 34433 4076 1832 34563 3444 875
NM_006379chr732046 315 123 --1144 1105
NM_006380chr1773212 3199 1168 596 304 122 90 --21726 102 13338
NM_006386chr22102402 2363 2182 2061 1918 1606 1558 685 416 215 1874 1269 1653
NM_006390chr1271645 1521 1515 1353 1276 269 179 21450 689 --11311
NM_006393chr10114480 4371 3954 3673 3010 1416 1189 1013 830 344 269 52809 1829 1740 906 171 11795 11107
NM_006407chr361231 1183 1167 934 220 87 1942 --11248
NM_006420chr20103369 3021 2294 2132 1226 1085 1059 834 766 358 43119 2754 351 126 --1608
NM_006431chr12156 ------
NM_006439chr41113 2554 22 ----
NM_006451chr52443 261 31081 351 279 ----
NM_006457chr493899 3857 3333 3196 2834 2721 1366 327 119 1101 ----
NM_006460chr1751829 1769 1736 1711 1153 31267 656 333 --1201
NM_006464chr284467 4048 3888 3575 3506 3214 868 156 44195 3193 1355 24 --13259
NM_006466chr204820 787 249 93 ------
NM_006467chr541990 922 583 386 1437 --11860
NM_006469chr151553 1353 1263 600 571 --1419 --
NM_006475chr131212 --195 --
NM_006482chr12131 21093 65 11314 23711 2988
NM_006486chr221538 1217 ----
NM_006489chr1451720 1653 1454 740 302 1479 ----
NM_006496chr131800 1493 1313 41922 1285 1228 481 ----
NM_006524chr751034 873 789 201 180 ----11115
NM_006526chr2041864 1793 761 740 21839 338 1107 1253
NM_006534chr2033031 2731 161 1903 33365 2882 2416 --
NM_006538chr273656 2978 2959 2682 1221 594 446 32903 1524 939 --13286
NM_006540chr83971 316 203 ------
NM_006544chr14126069 5995 5943 5855 5033 4894 4869 1451 1076 950 609 221 11369 24900 134 --
NM_006546chr17116312 5764 5312 5262 4704 4514 4395 2310 2046 1206 834 46459 4628 4462 80 26696 741 16476
NM_006547chr731737 520 188 61687 1652 1632 1315 741 616 ----
NM_006557chr9--21625 1278 ----
NM_006558chr82465 146 ------
NM_006561chr10116064 6044 4545 3863 2230 2036 1460 1265 683 366 199 15243 24820 277 --
NM_006572chr17103386 2875 2404 2393 2362 2141 1156 592 317 167 32865 2753 128 22837 1358 12452
NM_006575chr1411060 1166 151 --
NM_006577chr241254 1232 288 274 --1494 --
NM_006595chr1172053 1875 1839 1629 1537 417 56 11681 ----
NM_006599chr16168042 7600 6856 6291 6276 5984 5766 5371 2698 2194 2008 1808 1141 1064 630 49 43191 2662 1026 426 38296 7757 532 1233
NM_006601chr12--2990 807 31103 943 414 --
NM_006609chr252835 2176 2103 2039 598 23012 2549 1668 --
NM_006614chr323199 2889 53643 2826 1062 392 145 13319 23016 499
NM_006620chr694673 4612 3139 1313 1051 1044 590 300 231 1293 23913 1397 11432
NM_006625chr13353 161 143 1103 ----
NM_006625chr13353 161 143 1103 ----
NM_006625chr13353 161 143 1103 ----
NM_006628chr1584630 3767 3256 3239 3172 1557 1516 483 1230 24537 899 --
NM_006629chr1862739 2022 2008 1886 608 61 12365 --22347 2313
NM_006633chr5--2781 140 187 1524
NM_006636chr21975 1823 3699 129 97 --
NM_006646chr1342975 2344 2194 577 1247 12289 --
NM_006654chr12104785 4735 4709 4501 4475 4228 3277 935 770 398 23452 748 24681 618 21444 1140
NM_006691chr1151034 922 872 441 370 --31198 388 127 --
NM_006699chr151082 833 325 302 166 186 22204 629 12009
NM_006704chr132101 88 ------
NM_006716chr751350 1227 979 158 51 3445 391 242 1536 1277
NM_006720chr1084946 4785 4488 3956 3686 3669 1915 1693 24918 3758 ----
NM_006722chr352314 758 661 245 73 12841 3804 638 384 --
NM_006729chrX135071 5016 4779 3703 1925 1859 1682 1640 1513 1017 971 604 295 85535 5297 4329 3471 1708 1077 839 89 11323 --
NM_006731chr9125455 4718 4368 2223 2134 2066 2041 1422 1256 802 561 167 55773 5530 3787 3687 404 24892 358 14787
NM_006734chr631585 443 196 --11141 --
NM_006745chr451104 1060 768 327 25 --1800 --
NM_006750chr16157871 7665 6990 6701 6204 6117 5965 5485 5182 2616 2307 1948 1916 697 134 33243 1485 704 12470 46364 6124 1866 908
NM_006751chr221015 984 1127 ----
NM_006754chr741296 899 803 204 ------
NM_006761chr174814 802 553 335 1566 2850 635 184
NM_006766chr842014 982 971 648 --1691 --
NM_006775chr642546 2503 715 239 22454 648 1907 22889 2486
NM_006777chrX102514 2430 1865 1796 1024 877 381 317 167 115 3587 472 309 --12207
NM_006790chr5169 ------
NM_006793chr105718 695 568 493 53 --135 --
NM_006823chr851420 1050 378 208 61 133 --1965
NM_006828chr6293 25 ------
NM_006832chr14193 --1240 1234
NM_006836chr122545 533 164 --1170
NM_006852chr1732311 2271 612 42427 456 377 317 22550 762 12333
NM_006854chr741818 486 479 348 2819 727 --1655
NM_006873chr263517 2950 515 489 461 343 23383 1206 21409 251 --
NM_006874chr431104 495 229 ----1140
NM_006884chr381995 1974 1781 1377 698 472 308 292 ------
NM_006885chr1644203 3811 1256 695 24219 2764 1886 34144 3629 3149
NM_006888chr1463210 2658 2326 922 129 49 23392 1045 13365 22871 450
NM_006895chr251526 849 771 313 261 11515 31837 1713 614 --
NM_006897chr121647 ------
NM_006902chr182728 2440 2418 2297 1003 780 157 102 32467 750 665 22549 108 12681
NM_006914chr91205 ----1990
NM_006915chrX22292 558 ------
NM_006922chr231921 601 72 ------
NM_006924chr17104421 4158 3873 3729 3542 3465 3401 3265 2715 1430 1377 24332 3511 13911
NM_006925chr14--1180 ----
NM_006930chr551931 1726 1666 1352 410 11638 1388 --
NM_006939chr14----2938 31 1310
NM_006940chr1231780 1669 1340 --41623 734 281 226 --
NM_006947chr4--1368 2584 419 21509 221
NM_006948chr2142194 2166 1967 1519 ----11777
NM_006952chr351117 1016 859 228 58 1242 1451 --
NM_006956chr742150 1891 1605 65 42408 599 388 143 21763 1595 11739
NM_006965chr182307 167 1418 2354 199 --
NM_006981chr972963 2354 2085 2004 1988 855 833 22228 447 ----
NM_006996chr141798 1699 1336 1199 21278 1171 ----
NM_006999chr52741 452 ----1486
NM_007007chr1284096 3940 3802 3614 1338 907 726 91 24206 1724 --24829 3155
NM_007011chr15186702 6649 6599 6236 6067 5853 5740 4720 2756 2582 2407 2118 1504 1329 1067 599 569 42 41750 479 453 363 86153 5123 5112 4502 2474 1819 1592 800 --
NM_007013chr831039 934 192 ------
NM_007017chr52703 360 ------
NM_007027chr32207 158 1106 2173 50 --
NM_007030chr575003 4944 4816 4652 4623 4131 1803 53985 3277 1856 1693 748 ----
NM_007035chr122785 715 ------
NM_007038chr2195987 5745 5715 4692 3947 3714 2365 225 36 65833 5507 5046 4573 655 645 35353 4410 2415 45600 4281 1290 542
NM_007039chr142593 151 3930 815 178 42018 1814 697 315 2576 564
NM_007042chr372672 2231 1954 1626 626 518 246 22092 118 178 --
NM_007043chr1262056 1611 734 588 523 339 32137 1479 176 11951 --
NM_007050chr20108108 7165 7130 5845 5713 5533 5423 5284 2437 1058 36343 1188 1084 26137 4891 --
NM_007054chr573177 3125 1539 1397 819 716 709 21554 620 --1133
NM_007068chr22184 149 1279 --
NM_007073chr693380 3261 3125 2979 1693 1276 1066 1059 210 33485 1073 56 21458 1243 --
NM_007078chr10102605 2203 1192 1165 1008 719 462 414 370 117 1682 1236 --
NM_007106chr1341917 710 584 121 --2865 452 12301
NM_007107chr351675 1481 486 443 178 1869 1193 12102
NM_007111chr132720 121 2317 294 2897 845 --
NM_007114chr3123330 3253 2803 2672 2551 2215 2206 1017 572 420 203 31 22521 619 21150 412 --
NM_007124chr611950 11555 1141 --
NM_007129chr1311078 1229 ----
NM_007137chrX84885 4580 3451 3380 1201 576 547 185 53404 2032 1596 919 22 24958 1963 11288
NM_007145chr1941317 1012 83 22 ----1157
NM_007146chr1732271 413 192 12900 22549 1994 12500
NM_007159chr331623 515 451 1679 11358 --
NM_007174chr1252201 2109 1885 1874 1751 21995 710 --11928
NM_007187chr13------1343
NM_007197chr121140 1639 1165 --
NM_007203chr923310 2753 33619 3139 675 2327 69 33682 2971 925
NM_007204chr12255 229 1115 ----
NM_007212chr142062 1669 233 23 21579 715 11768 --
NM_007214chr621022 127 1178 21117 197 --
NM_007216chr1141206 420 266 85 1243 1469 --
NM_007217chr33328 103 45 ------
NM_007222chr821639 596 1739 --21297 91
NM_007236chr1552493 2151 731 269 52 2862 295 145 --
NM_007246chr431010 898 216 ----3409 158 73
NM_007249chr13208736 7226 7022 6792 6783 6382 6067 3488 2609 2431 1932 1842 1467 1300 1136 1046 635 163 122 69 148544 8260 8134 7583 7381 6364 6015 3292 3229 3161 2172 1215 621 236 59313 6321 3341 2755 2627 --
NM_007257chr862740 2462 2437 631 621 437 32361 1149 744 179 12729
NM_007276chr71128 ------
NM_007282chr31841 --2882 136 --
NM_007283chr3102550 2303 2157 1244 911 793 642 589 366 185 22886 2707 --21946 275
NM_007287chr342582 1018 811 649 11240 21995 1118 12946
NM_007288chr342582 1018 811 649 11240 21995 1118 12946
NM_007289chr342582 1018 811 649 11240 21995 1118 12946
NM_007292chr1795199 4119 3244 3164 1536 1426 1104 467 313 55021 4429 3324 1485 1253 2939 197 11827
NM_007325chrX51664 852 696 603 188 1237 21894 216 --
NM_007345chr1841649 1439 221 38 32190 2174 509 11794 1363
NM_007347chr1543075 2790 2152 913 33198 2660 702 33065 2036 1072 1288
NM_007349chr71365 ------
NM_007350chr1263985 3593 3225 1222 534 238 44499 3262 3088 1437 11536 41209 1107 1032 146
NM_007353chr772850 2094 549 450 435 201 117 13010 12681 22835 229
NM_007358chr121905 1843 1803 3491 473 273 --
NM_007365chr172132 1949 755 334 180 158 89 52201 1726 632 396 218 ----
NM_007375chr162068 2011 1958 781 227 211 11898 1582 11861
NM_012072chr20164394 4229 4144 4051 3893 3706 3505 2857 1709 1120 1105 1044 810 191 101 94 1684 44067 1448 398 107 1500
NM_012081chr563454 3308 3221 1418 743 104 33569 2553 1385 13529 --
NM_012089chr131092 317 150 31008 528 108 21256 223 1467
NM_012096chr3123389 3243 2864 2378 2359 2341 1161 1028 426 244 150 82 --23395 874 11152
NM_012104chr1153324 2976 2356 971 278 22764 586 1924 12562
NM_012104chr1153324 2976 2356 971 278 22764 586 1924 12562
NM_012120chr632567 1853 266 42431 1844 797 256 22034 304 --
NM_012137chr121174 465 32349 1051 337 1672 --
NM_012141chr1394170 3740 3641 3308 1489 1180 938 893 112 13489 22526 1327 33181 1507 1353
NM_012156chr2093454 3249 2610 2164 1349 1065 810 609 287 12087 ----
NM_012157chr33998 901 360 ------
NM_012164chr9176719 6376 5918 5558 5334 4735 4667 4628 2886 2735 2136 2004 1495 1450 776 747 576 45463 4876 1861 1333 1873 16628
NM_012175chr112870 696 ------
NM_012177chr62523 102 ------
NM_012193chr11144490 4320 4281 4223 3711 3644 3521 3497 3486 1802 1302 1227 969 961 45129 5059 4852 4329 11976 1459
NM_012214chr2196396 6234 6124 5857 5807 5690 5591 5462 5403 4667 4246 4186 2107 1936 1753 1488 669 643 176 35558 2211 518 26069 4719 26322 1884
NM_012219chr393061 2679 2450 2312 2148 1133 612 597 536 33182 1281 840 22167 76 --
NM_012223chr221320 963 ------
NM_012224chr41202 11096 ----
NM_012234chr383252 3176 2293 1211 696 613 571 516 12707 11011 13160
NM_012238chr1051719 1697 1460 1391 443 ----11585
NM_012242chr101552 ------
NM_012243chr14679 242 194 107 190 ----
NM_012249chr273239 3161 2859 2409 1268 195 110 11202 12654 --
NM_012252chr7125160 5003 4950 4179 3906 2084 1850 1671 1525 1090 720 543 54437 3900 1351 1332 257 34104 358 327 21025 32
NM_012257chr71136 1271 ----
NM_012259chr661374 1227 551 337 77 33 2267 231 ----
NM_012262chr1135206 5050 4794 4358 4162 3604 2040 1693 1295 1188 716 426 400 21492 1378 43953 1570 1105 805 13261
NM_012281chr712370 12421 1462 12009
NM_012287chr373746 3576 3553 3412 2800 901 111 33339 3133 1198 11760 --
NM_012297chr442600 1992 1960 289 1995 --1231
NM_012301chr751814 1640 1366 831 435 --2442 397 --
NM_012307chr18--1883 ----
NM_012308chr1161868 1776 1730 1034 780 727 1862 --22029 1615
NM_012309chr11144665 4640 4316 3604 3142 3067 1935 1630 1116 934 562 382 142 62 --14348 14870
NM_012316chr1115344 4793 4532 4476 3406 1927 1843 1468 1411 1364 759 33776 2124 896 23974 1588 --
NM_012330chr101356 11748 ----
NM_012334chr584255 3722 3455 3301 3226 3193 1872 117 34646 4523 793 24781 344 --
NM_012343chr52457 382 ----2199 127
NM_012345chr1371794 1258 623 610 558 312 218 --21842 31 11487
NM_012347chr652581 2156 497 415 248 11957 1887 12250
NM_012382chr594450 4383 4313 4002 3701 2778 939 575 525 72806 1714 1443 868 538 397 295 43896 3139 1132 338 13103
NM_012388chr1562961 2773 2479 2440 2393 109 32941 2083 473 42861 2005 942 70 1260
NM_012408chr201254 2793 106 1669 --
NM_012428chr154986 819 640 32 ------
NM_012432chr11347 ------
NM_012463chr1251715 1658 1459 411 382 21367 313 ----
NM_012464chr462260 1923 1083 653 600 283 31937 1857 1063 21006 974 32666 399 73
NM_012465chr1042720 2340 462 261 43286 743 511 78 --132
NM_013230chrY51824 1793 1222 576 69 1327 11288 --
NM_013231chr14114331 4304 4134 3473 1411 1097 944 898 636 556 254 23574 3284 14216 13007
NM_013233chr221038 332 21195 1012 ----
NM_013243chr155964 450 205 182 116 31006 936 273 --11343
NM_013255chr7168373 7932 6388 6199 6014 5390 3374 2845 2784 2243 2161 766 679 656 608 119 58541 7132 7066 5361 2302 12525 37634 7515 2257
NM_013257chr842161 958 921 487 11622 21494 55 --
NM_013269chr1264023 3393 3369 2748 788 226 31035 930 749 34530 4107 3469 34492 3650 3017
NM_013275chr161658 2646 299 1576 --
NM_013281chr2051407 1204 459 451 307 11228 --2106 93
NM_013282chr1931198 1104 825 2236 36 --1835
NM_013293chr74600 538 481 68 ------
NM_013309chr1552065 1867 737 434 390 1384 11658 12072
NM_013316chr72855 771 2405 104 1713 1965
NM_013322chr721212 308 11619 1527 11345
NM_013341chr262323 1958 1096 897 801 469 31879 919 75 1655 1772
NM_013357chr81247 ------
NM_013363chr32102 47 ------
NM_013372chr1582955 2909 2620 2134 1362 1096 1020 723 22081 759 --22422 872
NM_013374chr353170 2284 291 229 114 ----1257
NM_013381chr1242321 1962 1679 1568 --11540 --
NM_013386chr151785 1618 701 565 533 31635 280 209 277 34 --
NM_013391chr5254 26 1365 ----
NM_013396chr2111479 1177 --1962
NM_013410chr171169 1039 997 988 860 484 120 1408 ----
NM_013411chr162772 2706 2257 981 963 498 --22213 553 --
NM_013436chr22767 201 3316 248 90 1211 --
NM_013447chr1993533 3442 2964 2553 2537 1161 638 392 260 13606 ----
NM_013449chr1231960 1869 777 ------
NM_013450chr23892 805 310 1508 ----
NM_013943chr142113 2038 1301 117 12577 ----
NM_013951chr2122338 2272 2262 2241 2032 1856 1654 1605 1536 937 268 29 21664 255 1915 --
NM_013952chr2132415 2349 2339 2318 2109 1933 1731 1682 1613 1591 1014 345 106 21741 332 1992 --
NM_013953chr2132415 2349 2339 2318 2109 1933 1731 1682 1613 1591 1014 345 106 21741 332 1992 --
NM_013989chr1454223 3464 1737 619 67 44193 2033 1780 1160 54475 4213 3793 914 103 13756
NM_013992chr2132415 2349 2339 2318 2109 1933 1731 1682 1613 1591 1014 345 106 21741 332 1992 --
NM_013995chrX52230 1901 1805 701 240 21961 340 ----
NM_014011chr252241 1974 1033 974 376 22148 2017 21777 663 1324
NM_014016chr32267 55 31385 1228 1062 11494 --
NM_014021chr182907 2768 2368 2163 443 274 152 60 11071 22609 673 11018
NM_014023chr10112931 2425 2182 2164 2105 1968 1038 991 984 790 682 22636 107 --22517 2007
NM_014028chr683220 2755 2637 2256 2124 945 696 532 32837 401 358 11089 --
NM_014033chr1262288 2205 1984 926 736 25 11737 ----
NM_014034chr64487 371 223 63 11057 ----
NM_014035chr52465 188 --1371 2530 348
NM_014048chr1695131 4247 3852 3486 1649 1214 1162 147 23 3547 222 161 34496 3940 1362 34049 1208 724
NM_014053chr1--1121 ----
NM_014057chr961612 1405 1158 1055 379 179 2547 421 21543 1253 --
NM_014079chr33983 406 123 ------
NM_014089chr132162 131 --21912 1888 22167 1659
NM_014106chr1532179 2054 100 --42852 2251 375 82 1268
NM_014112chr8104915 4595 4486 1966 1539 1417 1261 480 389 354 --14191 24832 3824
NM_014117chr1692738 2691 2635 2377 2022 1849 1743 616 37 11089 ----
NM_014140chr2----151 --
NM_014141chr7144408 4342 3663 3591 3584 3349 2038 1601 1288 843 834 719 673 268 13317 24362 1975 --
NM_014153chr161648 1591 155 --
NM_014154chr361015 625 535 265 145 72 --11382 --
NM_014155chr11146599 6410 5916 5882 5162 4560 2569 1817 1568 1138 786 489 426 72 35143 2686 2449 37321 856 451 22411 1753
NM_014157chr1653706 3208 1328 1297 185 --1200 11096
NM_014181chr242916 2677 1967 62 ----22309 1815
NM_014241chr101289 ------
NM_014243chr431621 1471 275 --32135 860 292 --
NM_014250chr2231915 1627 427 ----1469
NM_014253chrX31895 1625 416 22068 1725 --11937
NM_014255chr12----191 1102
NM_014278chr4--2394 136 ----
NM_014283chr131170 548 496 11429 1395 1574
NM_014294chr811444 31367 500 88 --1945
NM_014296chr311640 --31074 1022 333 --
NM_014309chr22105276 4169 1913 1824 1361 1132 827 648 524 415 13799 --13506
NM_014322chr151192 965 910 399 78 ------
NM_014325chr1251835 1567 1479 1444 502 31650 661 574 ----
NM_014331chr4137720 7091 6578 6007 5511 5341 3130 3109 2054 1890 981 338 75 57815 7190 2014 1875 430 21275 346 17162
NM_014333chr1142498 2143 1069 761 22271 1862 ----
NM_014351chr2261435 1254 1108 593 498 99 11184 --1342
NM_014352chr113210 181 48 1939 ----
NM_014363chr1341171 384 259 175 ------
NM_014372chr141489 406 322 66 1585 42004 1792 1679 681 --
NM_014382chr331673 1538 1481 --21738 1431 1604
NM_014388chr1115776 5498 5395 5023 5004 4925 4369 4161 787 666 503 35907 241 169 14467 11420
NM_014393chr882280 2259 2192 1503 906 883 811 589 1871 12400 --
NM_014399chr74930 226 209 193 2183 106 1936 1396
NM_014415chr32308 46 21720 1191 --1198
NM_014423chr5115673 5050 4125 4043 3817 2249 1913 1825 1733 1014 541 34904 4695 1640 2297 264 15035
NM_014445chr321591 1486 182 1447 12087
NM_014447chr421394 161 2334 277 ----
NM_014458chr1--2496 334 ----
NM_014461chr3136 ------
NM_014487chr41232 ------
NM_014488chr11--1496 ----
NM_014491chr71332 1253 ----
NM_014517chr361871 1861 1851 1451 1314 66 11573 --2713 119
NM_014547chr152229 183 ----1103
NM_014547chr152229 183 ----1103
NM_014554chr1252191 1876 1829 1570 522 52287 2101 1532 1464 240 --1327
NM_014569chr741326 1259 309 117 1539 1992 --
NM_014572chr1321149 130 31792 242 174 11281 1402
NM_014574chr143642 248 237 11480 ----
NM_014584chr1481536 1373 1255 1236 1066 1015 567 246 ------
NM_014602chr3--1309 --1296
NM_014607chr241466 499 379 70 31882 1717 647 --21378 682
NM_014613chr532568 2230 1918 --22551 2249 33041 2857 2420
NM_014615chr1693135 2963 2750 2706 2648 1400 1325 1006 185 32535 595 475 22819 638 --
NM_014616chr383391 3199 2923 2890 885 496 417 89 33352 3022 2548 --22907 1377
NM_014636chr984376 4217 3914 3527 1428 1419 784 744 34074 3366 1393 ----
NM_014637chr821444 1400 21226 266 ----
NM_014646chr1883051 3004 2543 2227 855 590 464 194 22282 1209 1516 12688
NM_014655chr172335 2231 2165 1483 1465 905 323 41752 1545 332 168 12115 12213
NM_014660chr731078 921 323 1315 1426 1416
NM_014666chr52323 25 11273 2313 259 1277
NM_014679chr1121282 1223 1393 ----
NM_014683chr1731530 1511 537 1141 ----
NM_014686chr1971669 1620 745 706 521 375 186 --22534 2152 --
NM_014700chr1611355 ------
NM_014701chr1563358 3305 2813 2378 1136 309 --12974 12903
NM_014702chr671087 1081 885 764 385 323 234 63341 2923 2527 2398 2256 437 23220 3015 22302 1220
NM_014705chr782127 2061 1347 818 801 554 362 204 ----1537
NM_014707chr722116 557 1837 --1174
NM_014710chrX3374 251 170 2958 185 ----
NM_014711chr1611613 21736 1441 --1321
NM_014717chr191622 ------
NM_014719chr73936 360 100 31128 1086 206 157 21066 222
NM_014720chr1041773 1513 1295 1166 31762 1499 285 ----
NM_014721chr676923 6719 6320 5984 4780 1646 452 31838 493 65 26796 2138 1381
NM_014729chr892255 1978 1955 1495 1415 1402 221 154 29 1598 1481 12130
NM_014730chr1285002 3979 1406 803 560 425 392 268 33486 3451 1448 34662 1370 464 --
NM_014730chr1285002 3979 1406 803 560 425 392 268 33486 3451 1448 34662 1370 464 --
NM_014732chr16174564 4307 4289 3984 3572 3559 2251 2158 2116 2028 1565 1475 1419 899 790 757 33 --15883 --
NM_014733chr591943 1835 1742 1633 1465 1408 906 111 68 22262 2223 11547 --
NM_014739chr663154 2795 949 826 392 361 23972 180 33255 651 191 1622
NM_014743chr472843 2294 2224 2122 875 473 221 22600 2553 22268 859 1662
NM_014746chr2104400 4285 4200 3379 2999 1584 1342 640 559 509 22859 1266 13642 --
NM_014747chr1164756 4176 4070 4055 2290 2022 1618 1428 1395 995 712 679 599 569 541 257 55834 5334 4578 509 290 ----
NM_014751chr851846 1579 717 260 127 21670 571 12079 --
NM_014752chr1171881 1775 1402 1309 527 128 42 ------
NM_014755chr234137 3269 1136 54047 3928 3778 3737 1320 ----
NM_014766chr782992 2659 1386 984 878 709 335 122 32611 2530 615 13844 13311
NM_014782chrX--165 171 --
NM_014783chr1531782 718 559 21196 584 --1125
NM_014787chr152606 2599 1885 993 570 2686 350 ----
NM_014790chr5--2520 172 ----
NM_014795chr211374 21401 62 --21264 1205
NM_014803chr1042619 533 202 106 2926 173 42790 2699 738 430 --
NM_014810chr151477 1160 383 338 197 53037 2950 2330 1310 1035 23665 2472 1697
NM_014812chr132016 394 264 ----11635
NM_014820chr362018 1601 1491 709 468 57 --22029 1951 --
NM_014822chr42632 445 ------
NM_014824chr1141802 1420 770 687 11385 --21476 526
NM_014826chr194003 3403 2967 1745 1725 1048 1019 562 96 33521 2858 1592 ----
NM_014827chr161453 1139 688 404 80 47 1620 21407 274 --
NM_014828chr1451949 1791 1755 176 68 1465 1988 --
NM_014830chr12113943 3158 2847 2812 2693 2450 2436 2386 1136 577 85 ------
NM_014832chr1331555 1354 92 41993 1755 801 427 1342 --
NM_014835chr2092260 1801 1784 1631 1602 1583 1426 395 109 21896 631 11927 --
NM_014836chr1021823 376 11552 1521 --
NM_014839chr152357 2024 1910 1717 845 ----11734
NM_014840chr1263214 2479 2383 1364 1157 1110 --11025 23034 107
NM_014850chr354408 3785 3662 1874 1799 24117 2964 23191 1631 21791 310
NM_014864chr1114139 3993 3944 3902 3589 3000 2753 1506 960 676 205 24390 2663 21002 902 1686
NM_014873chr194248 4221 3870 3618 2957 1956 604 587 303 23844 775 11944 13178
NM_014877chr17137391 7346 6650 6351 5698 5413 4734 3049 2969 1837 1281 1172 668 66985 5767 5384 3099 1831 786 15523 16786
NM_014885chr4180 ------
NM_014888chr751374 538 299 204 22 --11180 --
NM_014893chrY41978 1852 1518 691 ------
NM_014897chr1773211 2594 1286 799 661 214 133 21248 1020 22867 1147 --
NM_014900chr231078 962 462 ----1843
NM_014903chr1262363 1970 1657 577 309 280 12303 --1255
NM_014904chr1083867 3460 3353 2851 2809 1366 1294 908 2964 601 31507 1384 80 23894 212
NM_014906chr1794106 3267 3192 3142 1226 1053 426 380 363 33828 3712 3574 12860 11089
NM_014912chr1073443 2572 2486 2206 386 171 31 32536 2336 90 33147 3069 2468 --
NM_014914chr211182 11299 ----
NM_014918chr1541144 626 231 195 11623 11007 --
NM_014920chr643740 2546 1389 771 1373 1927 22640 2492
NM_014923chr1342095 768 543 520 21510 1473 ----
NM_014924chr1472819 2695 2665 2413 791 370 99 --12890 --
NM_014932chr33599 503 321 1149 --21418 58
NM_014935chr163105 2518 1192 1171 262 63 12613 13801 23860 1409
NM_014936chr632241 867 98 1602 --12316
NM_014939chr1841524 1468 1456 590 2345 209 123 21162 168
NM_014945chr581971 1786 1723 1519 1512 1505 1478 1463 1317 2255 63 --
NM_014947chr152758 2341 2270 893 422 22202 2128 2494 383 12665
NM_014953chr1361462 1156 1136 222 143 58 34122 3890 546 24039 1234 1608
NM_014961chr441682 310 233 68 1617 ----
NM_014962chr2052689 1926 1763 1058 447 42327 858 802 314 ----
NM_014969chr141104 864 746 55 179 1361 --
NM_014970chr11253 1262 --1278
NM_014978chr1021831 314 21841 1497 21720 177 --
NM_014982chr14115423 4958 4490 4278 3292 2149 2112 2059 1905 590 203 25217 3695 21465 1200 25150 122
NM_014988chr462126 1725 993 565 128 115 22773 1847 32656 452 45 --
NM_014991chr463082 3063 2597 1290 1095 147 23156 1151 --2751 80
NM_014997chr762399 2119 2052 815 531 280 22200 453 --131
NM_015000chr1242703 2388 2009 1126 32722 2191 97 32176 241 85 12021
NM_015008chr363256 2941 973 903 563 82 12332 43670 3521 2379 2355 --
NM_015009chr3----1691 --
NM_015011chr13--11130 ----
NM_015020chr1673839 3276 3083 2912 2426 1337 1328 21478 1063 --12539
NM_015026chr1264763 4755 3728 1641 789 21 14005 34795 1815 879 --
NM_015027chr1691643 1634 1609 1537 1467 1406 1351 144 31 21942 759 ----
NM_015032chr1361925 1051 780 647 295 79 52517 1108 1095 368 115 ----
NM_015035chr20176679 6546 6066 5610 5574 5496 5132 4859 4753 4098 2576 2163 1733 1646 1408 941 525 56263 4954 2254 2185 1337 15075 --
NM_015040chr272739 2447 2264 865 472 415 21 12491 13295 --
NM_015045chr102647 414 11843 ----
NM_015046chr952586 2215 2028 303 281 ----2238 50
NM_015049chr253160 2190 888 582 327 --51080 788 468 188 62 --
NM_015055chr1172785 1913 1108 1084 698 577 323 2562 511 ----
NM_015062chr10----1194 --
NM_015064chr12123465 3439 3348 3294 2960 2858 1394 1174 1156 1129 762 353 33082 2778 615 33065 2460 2326 13237
NM_015068chr7113884 3406 3164 1601 1443 1180 499 491 304 204 128 33287 1024 693 23370 2999 --
NM_015071chr5156465 5409 5260 5129 5048 4762 4692 4250 2513 1856 1707 1593 1161 414 361 64517 1822 1782 1678 1357 1255 --192
NM_015076chr684538 4482 3496 3412 3157 1228 709 139 21042 846 34165 1192 669 21751 68
NM_015077chr17103567 3393 3037 2997 1526 1220 296 92 72 57 43603 3560 1332 938 ----
NM_015090chr1155251 5139 4834 4746 4031 2495 2168 2136 1956 1931 1578 1224 1176 777 504 4810 662 439 425 14973 --
NM_015092chr1654462 4246 3141 2917 618 24589 4277 23594 1144 1568
NM_015093chr651493 338 218 190 104 11299 21408 1327 11288
NM_015097chr321995 1449 32354 1634 584 22242 750 12012
NM_015101chr122725 213 12802 1612 2540 446
NM_015110chr951791 1763 889 647 69 22328 1680 --22494 702
NM_015115chr442649 2477 490 143 22331 323 13145 --
NM_015132chr731818 1408 500 ------
NM_015137chr832624 2221 770 32560 1024 103 21635 343 --
NM_015143chr421361 357 2180 171 ----
NM_015144chr1673168 2877 2569 1289 1167 1016 132 53486 3469 2523 2488 558 33709 3452 595 24013 70
NM_015147chr293272 3124 2891 2841 2596 2199 2129 1105 1031 22759 2511 42308 1300 821 102 21123 413
NM_015153chr62767 560 ------
NM_015155chr1052933 2865 2463 1241 228 53343 2615 1309 1069 167 23267 2539 --
NM_015161chr1631579 1186 262 11049 ----
NM_015163chr1451943 1464 581 457 359 ----1563
NM_015170chr842110 1945 428 113 51890 1874 585 476 158 ----
NM_015176chr161690 507 472 387 276 173 1482 --11233
NM_015191chr1132640 515 212 12736 42244 2011 422 133 12084
NM_015192chr2072420 2093 2011 1921 951 796 417 1626 12374 12594
NM_015198chr73924 851 165 ----11095
NM_015199chr382827 2319 1105 610 550 490 210 196 52248 1905 1037 843 539 22016 453 --
NM_015200chr422496 465 21828 133 11646 1404
NM_015206chr15103681 3420 3345 2930 2625 1307 1064 1017 280 93 32448 1554 776 ----
NM_015208chr1893617 1533 1442 1422 1410 1214 980 487 301 --11299 13168
NM_015209chr1--2820 407 ----
NM_015215chr1103078 2998 2552 2422 2339 1932 1057 1003 619 474 23113 2857 22700 297 --
NM_015216chr541217 1125 981 526 1153 21026 396 --
NM_015225chr942814 2010 67 52 --11156 --
NM_015226chr1673421 3227 3152 2138 775 767 583 1700 23447 2146 --
NM_015230chr451768 1199 522 173 75 ----1479
NM_015239chr92514 220 2382 365 2492 347 --
NM_015247chr16135131 4661 4542 3728 3677 3488 2094 2047 1838 1521 484 257 171 13272 33819 3321 33 --
NM_015250chr931654 792 617 21925 773 --1286
NM_015251chr1642348 846 311 92 --22237 1761 --
NM_015252chr23942 365 232 ------
NM_015260chr1911616 1459 ----
NM_015263chr152802 297 21135 458 21017 381 193
NM_015265chr252167 1818 1754 277 197 11052 1914 --
NM_015267chr1281944 1927 1845 1749 1713 1588 1476 1418 1283 1443 --
NM_015268chr34674 557 511 29 ------
NM_015269chr11574 ------
NM_015271chr484271 3847 1226 1192 1048 876 714 213 23403 732 53215 1645 1209 803 50 22839 2734
NM_015282chr271066 839 782 597 503 273 172 32808 2220 548 21099 249 --
NM_015285chr1862585 2540 2453 2285 682 392 --1458 --
NM_015288chr573351 3186 2902 2671 2378 1539 541 11189 1579 33548 3537 3250
NM_015291chr153313 2892 2548 678 237 43367 2175 607 496 13496 2922 254
NM_015294chr1721104 126 --1984 11007
NM_015310chr8258032 7724 7304 7296 7187 6787 6554 6233 6160 5993 5597 3130 3089 3074 2743 2590 2505 2242 2197 1951 1434 1140 1104 585 388 47984 7449 6943 2480 11403 17949
NM_015313chr11104521 3864 3771 3714 3193 1337 1067 1056 466 367 24358 774 11802 13270
NM_015314chr742113 661 370 359 52584 908 542 440 115 ----
NM_015315chr583398 3225 2994 2637 2351 2150 1304 941 33502 2525 757 1714 --
NM_015317chr231890 1775 1054 22645 1859 --1940
NM_015323chr611422 ------
NM_015326chr132572 2243 658 21996 96 32895 2761 2401 22666 1842
NM_015328chr772573 2360 2269 902 870 380 292 13055 13020 --
NM_015329chr19--11850 ----
NM_015335chr1262682 2496 2208 2197 826 678 1210 11043 --
NM_015344chr861889 1779 1772 256 173 87 --1803 1639
NM_015346chr1461746 1653 1390 1368 678 36 1383 11384 --
NM_015347chr1262191 990 937 786 270 206 ----139
NM_015349chr652900 2764 2153 1213 770 42710 1123 1052 382 23076 1199 --
NM_015352chr2083212 3041 2840 1231 1111 451 413 317 53791 2855 2769 1210 405 11480 --
NM_015355chr1741994 530 467 419 11828 136 --
NM_015358chr2141167 537 213 181 11193 11242 1106
NM_015365chrX94088 3885 3823 3396 3383 3083 2766 1623 554 11017 ----
NM_015367chr2251638 1567 1207 488 58 --11168 --
NM_015387chr231849 1623 771 22108 753 21821 1473 1691
NM_015396chr321084 499 --11248 11343
NM_015429chr331049 802 159 ----154
NM_015441chr1------1315
NM_015443chr172496 293 11294 --21537 1322
NM_015444chr32469 208 2549 149 ----
NM_015446chr141393 507 387 290 11309 ----
NM_015455chr593808 3603 3490 2805 1095 811 779 531 83 1294 ----
NM_015458chr8105199 4977 4640 4398 4385 3640 3631 3380 1371 550 11462 --23735 1451
NM_015475chr21768 1357 1993 --
NM_015485chr12302 107 --181 --
NM_015520chr372746 1780 843 764 700 614 157 ------
NM_015523chr11----1298 --
NM_015532chr1542183 1880 927 811 2622 177 --11852
NM_015535chr284153 4065 4057 3342 2803 2700 542 475 2444 280 ----
NM_015541chr371433 1411 1314 1174 1020 390 152 ----31394 1189 1033
NM_015542chr103424 296 72 ----1788
NM_015550chr73454 260 56 2619 525 11216 13525
NM_015553chr695211 5144 4573 4502 3568 3304 2064 587 226 23965 1990 2475 95 45031 4776 4558 1884
NM_015554chr1552770 706 593 403 229 1354 22654 2129 11924
NM_015564chr583456 3245 3021 2320 2172 1442 1354 899 63556 3118 3075 2960 2554 525 11251 1327
NM_015565chr215917 586 560 69 30 1125 31881 845 408 --
NM_015568chr20114180 3443 3293 2978 2667 1668 1139 908 762 530 47 --13388 --
NM_015569chr1114849 3856 3645 1593 1450 1372 1177 1066 976 818 294 13763 31435 1325 1169 --
NM_015571chr632654 1715 1630 32573 2487 2379 32169 1986 79 11725
NM_015576chr383006 2685 2585 2069 2018 827 339 56 22845 2422 1157 11916
NM_015577chr5----11387 11767
NM_015602chr131155 580 89 21646 41 1610 --
NM_015605chr1061338 1023 1008 183 113 60 11096 ----
NM_015608chr102615 541 ------
NM_015609chr1--1456 ----
NM_015635chr952146 2071 1444 702 435 288 59 1493 --
NM_015640chr165121 4425 3985 3374 313 136 14239 13552 23709 2132
NM_015641chr71331 177 ----
NM_015652chr101521 ------
NM_015678chr1351589 1489 1449 183 38 1400 11083 --
NM_015691chrX102803 2752 2138 1182 1091 988 707 477 299 70 22934 219 1408 --
NM_015693chr43282 115 63 1337 ----
NM_015711chr192726 621 ------
NM_015713chr8113533 3433 3157 2918 2265 2230 1451 1158 963 916 794 --23091 211 11131
NM_015714chr11372 ------
NM_015723chr73733 650 97 2292 126 ----
NM_015840chr142548 690 469 281 22289 569 --1141
NM_015841chr142548 690 469 281 22289 569 --1141
NM_015852chr7152710 2330 1461 1314 1131 1047 963 795 627 543 459 375 207 123 39 12463 --23663 1298
NM_015866chr121226 1081 1980 21425 1359 --
NM_015872chr131274 1228 541 --124 --
NM_015878chr852236 2153 2017 622 30 ------
NM_015879chr18198612 8437 8248 7788 7591 7432 7395 6965 6683 6444 6422 6370 3457 1549 1408 1207 564 188 58 46361 5794 5693 418 67834 7625 7045 5297 1984 1228 18263
NM_015886chr885326 4840 2150 1845 1742 1268 184 175 23906 564 12008 --
NM_015888chr11522 43284 2071 895 636 --2929 94
NM_015891chr631831 1484 1321 21506 694 41901 1542 818 278 --
NM_015902chr81840 1313 ----
NM_015906chr1114813 4766 4411 3896 3806 3572 1932 1700 1339 520 95 34333 1914 1308 63127 2999 1204 1188 677 160 14857
NM_015912chr852040 1732 799 689 60 12320 32348 831 328 --
NM_015914chr16----174 --
NM_015938chr32945 822 1982 ----
NM_015952chr61139 ------
NM_015995chr15115576 5246 5082 4881 4618 4314 4302 4239 3405 1504 570 15054 1723 --
NM_016002chr1167 1513 122 --
NM_016009chr1104107 4094 3957 3849 3141 3133 1808 820 605 296 34238 1682 644 --33475 923 110
NM_016018chr842449 2411 2058 1108 42583 2472 1034 736 --32328 2272 1017
NM_016021chr682351 2143 2131 1870 1152 816 600 316 32480 791 433 32278 901 494 22845 2606
NM_016023chr852073 1588 1484 779 44 22052 1544 11611 191
NM_016038chr71538 1497 1221 --
NM_016040chr162705 2660 708 539 454 232 2434 272 --131
NM_016045chr2031815 206 190 11612 11769 21163 714
NM_016047chr21122 ------
NM_016061chr231519 1128 636 11567 --147
NM_016072chr1262400 2348 1973 831 818 435 --1221 --
NM_016073chr152744 474 11025 ----
NM_016075chr1363122 2615 2353 1107 865 650 23080 2790 2962 384 --
NM_016076chr1--33088 3050 947 13209 --
NM_016078chr1711071 --1712 146
NM_016083chr673954 3408 2999 2407 1579 879 229 --2642 499 11032
NM_016087chr731672 1224 132 31694 517 216 --21301 479
NM_016090chr111917 21037 80 1761 11095
NM_016094chr32639 138 1752 ----
NM_016096chr81852 21794 828 22029 858 --
NM_016100chr202379 367 1328 ----
NM_016104chr61139 ------
NM_016107chr511375 ----185
NM_016131chr232216 1986 1600 11927 12382 --
NM_016132chr1572859 2117 1289 1021 962 688 43 23286 992 1720 12495
NM_016200chr7194 2716 248 1500 1157
NM_016203chr75738 684 265 221 140 2975 721 1851 11051
NM_016205chr441438 977 577 145 21168 1016 ----
NM_016206chr3128642 8442 8347 8247 8059 6392 3290 2301 2193 1048 666 182 56900 6822 2610 2464 730 16060 36793 6026 2400
NM_016213chr15178 ------
NM_016217chr643451 2237 589 530 11090 23611 3469 --
NM_016220chr761424 458 378 294 211 43 21998 1983 1190 3793 628 544
NM_016221chr542159 924 547 231 2882 320 --1541
NM_016227chr131170 548 496 11429 1395 1574
NM_016228chr42505 487 ------
NM_016231chr1771498 1416 1261 1207 1073 284 49 11554 11569 127
NM_016247chr31458 ------
NM_016248chr1342635 1503 1413 941 33503 2962 1014 1345 --
NM_016252chr22757 308 1739 1107 --
NM_016255chr6102735 2596 2360 1311 1003 774 569 320 301 136 ----12977
NM_016257chr183413 2900 2429 2223 1189 643 579 521 33521 3434 925 ----
NM_016260chr286520 5499 5351 4688 2500 1776 1690 436 26486 293 47530 7228 3050 1720 25401 4629
NM_016264chr19155 ------
NM_016271chr1841488 786 726 316 22082 504 --1135
NM_016275chr332814 1837 1772 1331 1905 288 22
NM_016277chr66566 556 418 383 117 26 1300 2496 448 11029
NM_016279chr51102 ------
NM_016289chr252108 2045 867 469 441 11778 32169 906 541 --
NM_016300chr31411 ------
NM_016304chr151585 138 ----
NM_016308chr131982 791 26 1120 --11366
NM_016312chr121203 ------
NM_016315chr21312 41897 1851 395 125 1254 --
NM_016322chr943126 3084 2295 1146 1890 12009 --
NM_016353chr84869 682 653 527 51970 1568 635 377 118 11850 --
NM_016357chr1231239 971 414 --1779 --
NM_016376chr17134374 4191 3427 3292 3181 3043 2755 1608 1363 1071 900 655 510 1608 2630 122 --
NM_016377chr641660 1562 1336 161 11576 ----
NM_016395chr1551750 1670 643 622 513 21927 499 --31481 1399 716
NM_016396chr1553008 2132 1982 1921 86 --22601 27 --
NM_016422chr1182998 2901 2590 903 549 480 402 344 53179 2350 2234 890 721 12259 1426
NM_016424chr171157 11861 --42007 1752 1575 294
NM_016436chr2072347 2329 1869 937 735 287 91 21779 1690 --12094
NM_016441chr252431 1835 1602 1568 770 32303 1888 421 11580 --
NM_016453chr32527 137 ----2637 591
NM_016467chr231240 1088 39 1207 ----
NM_016472chr1431010 497 152 21307 1052 1601 --
NM_016480chr53920 686 155 1858 --1194
NM_016485chr662216 2183 2052 1897 255 149 2754 507 --11694
NM_016489chr74563 438 71 45 --2158 125 1487
NM_016507chr1742854 2510 932 24 42786 2614 1259 1214 --1282
NM_016513chr643740 2546 1389 771 1373 1927 22640 2492
NM_016519chr41189 ------
NM_016530chr1583699 2504 845 827 642 117 106 58 13612 23630 545 23016 2512
NM_016531chr454063 4003 3530 3133 3065 33975 3166 1633 23920 3577 11401
NM_016542chrX21647 178 11762 11526 1121
NM_016559chr331334 1174 439 ----154
NM_016577chr3124331 3676 2888 1765 1611 1589 1558 1069 964 635 474 333 71339 1320 1303 1122 871 715 572 13421 --
NM_016584chr121267 ------
NM_016586chr141177 --1432 1195
NM_016587chr71128 ------
NM_016589chr35503 431 351 36 28 ----1375
NM_016603chr542258 705 443 399 --2514 293 41710 675 436 372
NM_016607chrX61487 1434 1247 490 458 145 31385 357 197 1235 1564
NM_016618chr2--2551 460 --138
NM_016620chr131245 147 50 --11136 --
NM_016621chr1153888 3079 1403 956 699 34223 874 91 --160
NM_016626chr181266 --31399 1210 1109 --
NM_016627chr17----2147 26 --
NM_016628chr102594 188 --1749 --
NM_016641chr1631337 1232 301 2228 214 ----
NM_016654chr1551277 1092 957 408 199 1499 ----
NM_016824chr102573 117 21551 623 11581 1133
NM_016831chr162320 1923 1676 1613 646 101 --22304 2123 --
NM_016834chr1773760 3009 2809 1296 945 451 352 33898 2899 1515 --13146
NM_016835chr1773760 3009 2809 1296 945 451 352 33898 2899 1515 --13146
NM_016841chr1773760 3009 2809 1296 945 451 352 33898 2899 1515 --13146
NM_016937chrX1324 2274 39 --2702 408
NM_016946chr192940 2696 1142 1071 966 958 698 463 217 11154 13457 12608
NM_016950chr421090 353 1133 11397 --
NM_016952chr1194064 3668 3617 3581 3508 3299 2544 1365 755 33708 2939 745 --13365
NM_016953chr2146000 5270 4765 4017 3820 3743 1568 1505 1476 1344 1184 337 252 43 55137 1967 1673 1451 1442 13989 --
NM_017410chr1221227 1146 ------
NM_017412chr811299 11135 11087 1131
NM_017415chr5124589 4322 4303 3527 3404 3234 2981 1512 494 469 384 80 24513 609 --24315 844
NM_017420chr1443812 3746 1300 620 52845 2812 1525 1106 591 1874 32403 727 426
NM_017423chr44518 339 117 70 2699 374 11954 160
NM_017440chr124669 539 228 110 2624 492 ----
NM_017443chr941172 568 216 43 21536 116 ----
NM_017447chr2154202 3310 1602 1335 1019 34343 1349 932 --23015 1491
NM_017452chr2031495 1291 1213 31488 1137 70 158 150
NM_017453chr2031495 1291 1213 31488 1137 70 158 150
NM_017454chr2031495 1291 1213 31488 1137 70 158 150
NM_017455chr154986 819 640 32 ------
NM_017544chrX3942 656 629 3893 685 287 --2824 387
NM_017548chr351782 841 595 441 314 22009 609 --21949 1840
NM_017563chr3145922 5140 5101 2500 2399 2053 1920 1647 982 820 566 461 396 215 21870 1430 24354 941 16293
NM_017577chr331671 260 56 --1388 11689
NM_017583chr1151640 722 656 428 360 ----1545
NM_017599chr1241811 1714 1333 154 --1684 170
NM_017610chr1522125 105 --11910 21940 858
NM_017628chr475083 4384 3677 1611 1479 840 46 1991 --13914
NM_017633chr643422 2637 2458 1378 1839 ----
NM_017634chr831980 1748 404 21860 1834 --11385
NM_017635chr1121570 1551 1303 177 11015
NM_017637chr988986 6764 6061 3624 2556 2489 1612 490 56466 3502 2775 1515 1474 27658 6997 17457
NM_017641chr1241009 344 256 29 21137 1106 --2419 113
NM_017643chr1772962 1991 1259 1013 486 335 233 11915 4924 714 633 290 --
NM_017644chr393794 3438 3393 3256 1871 1634 1143 575 512 24868 1234 24109 3148 1186
NM_017645chr993031 2816 2714 2707 2328 2194 928 399 42 22846 580 22142 211 1533
NM_017650chr7106098 4941 4352 4016 2294 1665 885 742 447 394 65757 5667 4471 4264 2174 1637 23705 2098 22193 662
NM_017655chr141545 1388 637 136 21479 23 ----
NM_017657chr22914 316 --1177 --
NM_017658chr1484408 4325 4019 3332 1273 416 245 77 14065 21302 273 --
NM_017661chr1541232 1152 876 801 --1401 1928
NM_017667chr72219 59 1476 1145 1129
NM_017693chr1331567 1388 325 11550 21622 1582 11111
NM_017694chr231837 1302 307 11799 21589 1544 --
NM_017709chr1134172 3879 2991 2632 1727 1463 1385 1265 1144 916 889 707 624 1720 24139 2714 1982
NM_017719chr361709 1659 1017 426 405 273 1621 1933 2633 544
NM_017736chr1642500 2148 2016 2002 1609 --22187 1097
NM_017737chr181870 1716 1604 1513 1444 736 723 668 --1788 --
NM_017742chr1871903 1565 1268 1257 741 316 289 1380 --21919 702
NM_017745chrX------1684
NM_017752chrX52091 1913 1777 1634 110 31491 750 404 31921 1724 525 --
NM_017754chr6154834 4745 4571 4375 4148 4023 3867 3266 1992 1726 1571 974 743 177 88 25050 452 34657 3733 1321 --
NM_017762chr1582483 2255 2201 795 737 553 465 301 1974 ----
NM_017770chr6122896 2628 2186 1950 1915 1077 944 885 843 258 172 67 ----12475
NM_017778chr821421 978 ------
NM_017779chr142646 2192 2111 366 3440 291 63 1853 --
NM_017798chr20--31110 426 44 1434 --
NM_017799chr1481942 1818 1755 1467 1415 282 59 52 3542 428 241 ----
NM_017803chr16--1224 ----
NM_017811chr973010 2972 2416 907 758 729 705 12456 --12881
NM_017813chr8115592 5395 4364 4113 3781 1547 935 521 61 53 38 41747 1703 1694 1291 44882 4625 4028 910 24690 424
NM_017816chr4124 ------
NM_017824chr1022222 1996 22580 2491 12269 --
NM_017826chr133763 540 88 1727 ----
NM_017832chr931168 990 872 ----11052
NM_017841chr112630 509 ----1655
NM_017848chrX61641 1535 1482 1445 1191 249 13593 --13402
NM_017866chr81107 1172 ----
NM_017896chr2052682 2607 1207 295 249 42899 836 697 241 --12814
NM_017902chr1075265 5036 1679 1580 1214 442 115 15681 25713 1708 15458
NM_017905chr13----1667 --
NM_017910chr2--1138 1355 166
NM_017911chr22--31475 1155 31 ----
NM_017919chr9145786 5200 5124 5100 4779 4666 4652 3741 2224 2170 2029 1972 282 130 35395 1060 269 13857 24546 1324
NM_017922chr14------1218
NM_017925chr971834 1230 616 343 208 165 109 158 ----
NM_017929chr2231269 1251 360 31241 1208 260 --1892
NM_017935chr41728 4564 548 289 233 ----
NM_017938chrX62131 2083 1923 1872 1643 187 22167 525 1692 11366
NM_017952chr2114397 4046 3877 3818 3793 2823 1263 1027 820 696 47 160 166 14356
NM_017978chr5------195
NM_017987chr1031754 664 384 1587 --1391
NM_017994chr762664 2246 2084 900 411 59 12479 21136 35 --
NM_018000chr23337 272 123 21768 1671 1190 21629 1468
NM_018015chrX------2769 193
NM_018017chr1082865 2640 2544 2393 1781 790 537 237 12517 2796 185 32926 2768 2315
NM_018019chr1781608 1502 1484 1136 541 489 467 234 1351 ----
NM_018025chr192220 155 ------
NM_018027chr10113159 3125 2917 2450 2429 2408 2320 583 280 266 147 2888 256 ----
NM_018036chr1474288 3431 3250 2708 1285 1235 707 --23629 2943 21692 402
NM_018040chr11476 ------
NM_018045chr182959 2681 2655 2108 1998 721 681 539 42720 2283 289 138 1880 --
NM_018046chr551780 667 522 500 186 --1679 --
NM_018061chr141489 1153 247 30 1275 1388 --
NM_018063chr10170 ------
NM_018064chr6--1276 ----
NM_018084chr292862 2754 2121 1243 1038 746 279 212 84 42144 2102 1312 628 --22472 2371
NM_018086chr241373 691 672 194 ------
NM_018094chrX1417 ------
NM_018098chr351155 849 437 152 104 ----1943
NM_018117chr103317 228 34 3759 513 277 ----
NM_018119chr161244 ------
NM_018120chr831232 414 166 2477 374 21325 469 --
NM_018121chr1072905 2344 1282 1166 1020 490 171 ----12517
NM_018159chrX71710 1647 1435 1066 337 325 32 --1357 21733 1537
NM_018169chr123546 501 70 --1139 --
NM_018176chr441494 1310 506 102 2432 242 1118 --
NM_018178chr151780 1488 524 473 65 --31884 1435 459 --
NM_018191chr1341556 1497 607 248 11738 12092 --
NM_018211chr122201 1548 12212 ----
NM_018214chr6--1522 ----
NM_018221chr21343 ------
NM_018225chr994871 4392 4361 3964 3719 1810 1760 1452 304 35050 4975 1209 --33537 1250 1086
NM_018227chr422668 1194 12829 32105 342 236 1154
NM_018243chr463596 1176 1155 624 373 151 13822 --13721
NM_018246chr882553 2414 2393 2365 1767 365 83 30 3481 351 319 12108 11012
NM_018247chr652847 2201 1236 979 230 --12296 12257
NM_018254chr172202 1689 1651 1511 797 661 104 1823 ----
NM_018257chr2052360 2334 676 524 514 12227 2380 305 --
NM_018263chr262635 2161 971 872 739 619 --1572 1347
NM_018287chr1041018 451 339 302 ----11009
NM_018293chr362922 2914 2627 2587 1886 834 --32656 2207 2103 1630
NM_018299chr862955 2563 2142 1320 734 604 23037 1267 21033 94 22423 45
NM_018302chr421670 621 21848 448 21660 1535 11890
NM_018313chr362366 1762 1671 1635 923 573 --1310 1915
NM_018325chr941686 1437 1259 313 --11092 1440
NM_018326chr72849 560 2629 581 ----
NM_018339chr921853 1550 ----188
NM_018340chr1684734 3134 1728 1595 1577 1428 571 86 2679 217 34808 2009 699 --
NM_018342chr441709 1647 1423 1277 176 11113 --
NM_018351chr1284607 4309 3379 3202 1696 1578 244 235 23548 3194 3978 933 556 13508
NM_018361chr8103799 3780 3504 3370 3202 2883 1465 1240 212 119 1796 23973 626 --
NM_018362chr1193435 2752 2716 2566 1547 1540 1238 1189 923 --33701 1254 667 11347
NM_018364chr153606 1457 1422 1330 294 13058 22612 960 13219
NM_018371chr811261 11312 3323 297 56 --
NM_018373chr14106486 6068 5122 4806 4466 2556 1822 1597 1055 772 34766 4194 2424 2868 721 52278 2147 1397 623 201
NM_018374chr7123926 3847 3595 3370 3362 3317 1443 1067 906 635 531 95 --24540 395 24407 326
NM_018383chr252027 1911 1715 1530 833 2679 601 ----
NM_018387chr92524 28 1178 ----
NM_018394chr351365 1134 1117 438 426 1391 ----
NM_018400chr11164458 3498 3275 2806 1544 1508 1479 1326 1265 927 901 579 489 380 305 48 44608 4514 4183 1313 1806 21672 233
NM_018403chr383953 3930 3544 3433 3374 3322 3255 101 1789 --1927
NM_018429chr512794 12289 12076 31996 978 928
NM_018431chr201627 1669 1203 1469
NM_018440chr8208574 8556 8350 8076 7469 7400 7159 7136 6714 6370 6184 3196 3073 2723 2698 1587 1391 935 450 165 47664 1175 782 115 48510 2711 2506 1897 --
NM_018444chr852039 1956 1533 697 254 1281 3630 570 397 21836 1573
NM_018452chr6_random73251 2996 2898 1268 1125 132 119 11388 11303 --
NM_018471chr2149 ----1217
NM_018482chr82820 343 --11833 1400
NM_018489chr132360 2139 1969 11700 11988 1955
NM_018490chr111229 2597 248 --21781 401
NM_018534chr21610 ------
NM_018557chr241645 1241 533 441 1494 ----
NM_018566chr185024 1810 1701 908 795 513 484 276 24895 4720 2898 143 11888
NM_018571chr25667 543 513 242 117 199 ----
NM_018584chr12945 89 ------
NM_018590chr1041358 1094 591 519 21305 1295 2490 229 11316
NM_018638chr12114880 4725 4363 4234 3948 2046 1438 892 485 164 155 65333 4599 4143 3927 1822 1482 24855 4149 35256 4765 4207
NM_018640chr1242503 2113 1062 96 22323 1726 22274 1042 21018 477
NM_018650chr112246 51628 1391 521 416 347 31951 1884 1717 --
NM_018684chrX11298 ------
NM_018685chr71922 ----2777 456
NM_018695chr572395 2253 1501 582 496 435 315 --11806 --
NM_018698chrX41918 1830 781 96 11977 31662 510 49 --
NM_018704chr161632 1329 548 394 166 104 1684 1204 --
NM_018710chr8--11137 11091 --
NM_018712chr113356 87 33 11286 1390 --
NM_018717chr4132785 2605 2495 2032 1991 1914 1101 1055 1037 858 550 506 112 ----12913
NM_018838chr12122 ------
NM_018841chr183880 3461 3324 942 890 868 684 139 1803 1376 --
NM_018844chr751798 1721 1339 724 354 2761 413 ----
NM_018846chr7--1228 ----
NM_018847chr971802 1528 1446 1278 774 691 674 51769 1464 1431 648 171 ----
NM_018896chr171314 ------
NM_018940chr521052 1008 1435 2822 297 --
NM_018947chr774627 3167 1646 1537 1393 1171 312 54766 4489 1691 1511 1297 1552 23832 1331
NM_018948chr121295 69 21108 169 --1407
NM_018963chr2131192 1110 612 21253 33 --11176
NM_018970chr7123081 2912 2797 2780 2454 2340 2043 967 861 785 667 224 --32102 1144 989 --
NM_018975chr16--2800 529 ----
NM_018976chr1232896 2542 409 11946 21086 810 12551
NM_018979chr1222375 2035 22166 1795 --21860 1040
NM_018993chr2041516 1023 246 46 21185 84 ----
NM_018999chr10114358 4283 4062 4024 3464 3437 1699 1506 1031 511 155 34933 4495 1679 43833 1685 1354 828 14695
NM_019000chr541416 1253 1127 90 21593 445 1590 21453 383
NM_019001chr374492 3067 3008 1121 1048 449 335 11875 34835 4589 118 1925
NM_019004chr752007 1666 512 337 202 --11893 --
NM_019022chr1863149 2795 2685 681 197 61 1862 --13238
NM_019024chr2------1385
NM_019027chr482425 2406 2096 1877 1808 1709 630 102 22548 438 145 3689 655 518
NM_019035chr42130 75 12055 21741 399 21767 583
NM_019036chr631131 981 148 163 21266 1212 --
NM_019044chr2154337 3847 3598 3284 3270 3108 2958 1859 1779 1709 1138 805 525 385 83 13536 1637 2701 373
NM_019045chrX2834 633 1930 1103 160
NM_019050chr422002 1880 ----1470
NM_019054chr102604 63 1762 146 1514
NM_019063chr21230 31665 436 320 1468 2290 198
NM_019072chr544160 457 328 221 24092 628 --24313 1309
NM_019084chr1052414 2179 2026 1806 139 1441 ----
NM_019094chr1262998 2965 2808 2406 1161 905 --33206 2780 1073 1987
NM_019095chr20------1158
NM_019114chr992522 2467 2303 1882 1792 1667 634 569 23 --32483 548 367 --
NM_019116chr1673586 3462 2995 1289 1172 850 93 11134 32503 387 144 --
NM_019556chrX31100 104 26 21126 43 1934 --
NM_019593chr2082818 2635 2534 847 588 362 303 69 12595 ----
NM_019600chr152210 145 ----1176
NM_019610chr122028 494 11458 22193 463 11494
NM_019842chr62322 89 ------
NM_019857chrX71789 1523 1245 510 431 58 50 184 ----
NM_019859chr1041631 1517 1452 261 11588 11313 --
NM_019860chr1041679 1565 1500 309 11636 21361 50 --
NM_019903chr102573 117 21551 623 11581 1133
NM_020116chr461673 1541 1444 1214 617 24 11387 ----
NM_020122chr2115977 5630 4414 3720 2355 2343 2294 1888 1594 1102 963 34687 3847 1573 45672 5314 4005 293 1281
NM_020123chr1021156 507 ----1425
NM_020130chr82488 168 31257 253 136 --1153
NM_020132chr2184126 3577 3301 2002 1810 1461 1168 964 43535 2034 1033 711 14097 24957 4367
NM_020135chr61180 ------
NM_020139chr431653 220 193 --11581 --
NM_020141chr152373 1601 879 355 95 22415 1867 ----
NM_020144chr761974 1872 529 371 335 273 22108 675 ----
NM_020148chr1862872 2624 1148 234 154 61 1602 1216 --
NM_020159chr451464 1455 604 365 160 21059 221 --11419
NM_020177chr563036 2657 2141 1011 820 644 12413 52340 1284 996 763 358 --
NM_020193chr1161297 975 906 448 393 348 1939 1930 --
NM_020198chr172400 172 2989 184 11354 1118
NM_020205chr142912 2595 2175 1244 2539 125 33453 3288 2150 12879
NM_020228chr1161842 720 548 499 382 59 22461 2341 1870 11831
NM_020235chr31261 ------
NM_020239chr1102046 1919 1777 466 409 368 305 281 256 33 51639 1611 877 426 266 ----
NM_020240chr562314 2257 1852 1031 419 173 186 --12352
NM_020245chr684200 3903 3804 3456 3292 1074 987 623 34176 3471 944 25046 770 44575 4163 1294 123
NM_020307chr33274 138 113 1156 ----
NM_020336chr20103846 3697 3609 3559 3015 2720 2611 2351 1008 647 23201 872 ----
NM_020337chr452934 2673 2471 2035 59 2290 90 32740 2071 569 --
NM_020341chr2021375 609 --1342 11644
NM_020342chr252522 2032 1973 1743 488 22549 1662 2968 639 --
NM_020353chr352008 1643 1483 1452 144 2222 40 --1434
NM_020357chr33616 454 157 21278 1063 31642 1084 467 --
NM_020381chr632011 1698 663 139 21716 1377 --
NM_020382chr1231011 570 73 11599 1497 --
NM_020386chr3129 ------
NM_020390chr373678 3545 3303 1487 940 640 367 24134 3335 23663 3467 21793 1279
NM_020403chr1321681 1097 --11476 1344
NM_020420chrY2617 435 --51557 369 327 246 193 11817
NM_020424chr16149 3854 755 632 1353 1691
NM_020425chr681879 1478 1443 1280 695 501 467 44 ------
NM_020429chr72613 96 33059 2648 682 --1537
NM_020432chr772308 2137 1668 669 404 232 65 --22203 926 --
NM_020440chr183022 2898 2191 1099 717 693 563 408 12747 1679 --
NM_020443chr1156932 6780 6228 4930 4578 2809 2378 2295 1919 1874 1817 1726 1539 1312 388 86909 6788 6384 6061 5500 4695 4460 711 15058 24402 1249
NM_020455chr652517 2297 2015 1928 399 --21894 346 --
NM_020466chr6174970 4898 4765 4636 4423 4366 4028 3903 3780 1756 1743 1731 1684 1351 1194 1086 603 63966 3761 1619 1316 866 184 24481 1165 23251 163
NM_020474chr1841749 1733 694 365 22045 707 41380 462 282 244 --
NM_020630chr101655 ------
NM_020640chr371942 1610 822 500 493 118 87 42275 2237 1701 638 11722 194
NM_020647chr862282 1627 909 599 291 232 21821 1691 --1363
NM_020648chr18122768 2291 2128 1786 1767 1755 998 932 903 410 346 276 12701 22890 2210 --
NM_020651chr24672 327 308 195 21392 227 ----
NM_020665chrX2137 68 --1176 --
NM_020666chr54908 309 243 218 ----1649
NM_020673chr20147127 6913 6433 2789 1726 1577 1564 1420 1285 974 737 558 486 48 56753 6306 5779 1139 252 35538 4943 2851 --
NM_020676chr3------2902 281
NM_020696chr3133 ------
NM_020699chr174790 2168 2160 1972 1648 1407 749 13571 44569 3741 818 687 --
NM_020704chr752554 1848 491 445 403 --22525 2124 1908
NM_020715chr1451972 1768 1436 909 297 22128 1490 12252 --
NM_020717chrX74912 4888 4706 3690 1374 1201 1182 64483 4334 4011 3427 1748 1463 --34096 3437 535
NM_020718chr16186548 6532 6391 6259 6217 6180 5818 5551 5239 4918 2393 2185 2112 1758 933 828 343 200 55629 4697 4534 2072 898 26239 246 15114
NM_020724chr472568 2131 1642 814 579 514 225 12111 1290 1909
NM_020727chr2173810 3296 3205 2680 1618 248 126 22668 2563 11317 23931 870
NM_020728chr761963 726 672 530 329 176 1519 22300 997 --
NM_020734chr1293066 2997 2834 2596 2166 1032 907 767 589 23083 464 12957 --
NM_020739chr1574194 3680 3241 3052 875 618 366 21190 1087 33349 108 88 33502 3128 1622
NM_020742chrX31919 706 363 21746 1001 ----
NM_020747chr53913 87 34 ------
NM_020752chr1052852 2678 2415 2381 2187 --1393 12745
NM_020755chr62566 374 31483 465 50 21450 1163 11047
NM_020760chr24440 338 161 69 21907 1886 11362 21974 1307
NM_020766chrX94414 3770 3361 1645 1035 1025 975 915 507 23478 3119 34017 3595 707 --
NM_020768chr572982 2731 2409 2097 931 302 45 12770 33132 2135 1277 23222 2649
NM_020771chr631569 1378 1170 1952 21346 241 --
NM_020772chr17128251 7622 7412 7199 6500 6278 2328 2072 1521 705 688 259 66769 5420 2711 2413 1232 835 77512 6608 2652 2107 2040 435 187 75946 5702 3301 3101 2083 769 389
NM_020774chr1876031 5849 4766 4534 2169 1509 207 46128 6105 1698 411 26253 4679 1727
NM_020776chr1872553 2377 2334 719 508 417 137 ----1385
NM_020782chr1264479 3676 3628 1839 1262 1086 32962 1919 165 11126 11252
NM_020783chr182652 135 42140 1828 774 610 12097 --
NM_020786chr1641778 738 704 610 1345 --11589
NM_020791chr1721220 481 2411 222 11098 11439
NM_020792chr341930 1849 685 639 1546 1141 2971 298
NM_020794chr121491 551 11514 11255 21554 1208
NM_020796chr552459 2440 2432 878 858 --3820 785 397 --
NM_020801chr532563 2262 180 31771 469 319 ----
NM_020802chr1162628 2488 1207 1068 387 356 1201 13111 --
NM_020805chr181704 --11466 1519
NM_020810chr14133657 3604 3561 3546 3409 3046 2914 1309 836 774 283 155 98 1510 33324 2664 1385 --
NM_020813chr1982878 2419 690 632 598 553 276 72 2997 888 --12865
NM_020818chr141368 ------
NM_020819chr651040 903 845 485 25 ----1451
NM_020830chr233014 2305 862 22029 220 2885 226 --
NM_020839chr341523 1456 626 142 ------
NM_020841chr1293749 3529 3514 3249 1342 1327 1260 1094 342 23104 757 1168 12739
NM_020844chr8137131 6924 6037 5912 5224 5058 2882 2446 1512 1447 1344 842 536 46459 1807 1247 236 35955 420 184 36404 6007 1947
NM_020850chr16102978 2565 2306 2175 2016 1101 986 740 323 266 32237 1012 965 ----
NM_020854chr1821434 1027 31515 1488 1232 21522 1128 1969
NM_020856chr191548 11088 1577 --
NM_020858chr1552173 1945 1915 1758 735 2331 200 ----
NM_020860chr461136 958 822 812 475 308 --1231 1221
NM_020861chr651384 1313 1152 1019 182 --31260 983 315 --
NM_020866chr134731 309 137 59 ------
NM_020868chr271971 1954 1873 1750 1533 1271 118 --31884 1328 26 --
NM_020871chrX52593 2466 2224 191 161 --1141 1896
NM_020872chr32420 176 --21525 696 21742 342
NM_020873chr31554 ------
NM_020909chr274145 3794 3432 2767 1381 931 372 22657 652 24162 169 33639 1557 957
NM_020917chr1943380 2528 615 506 13289 12541 13791
NM_020918chr1083681 3477 3436 3386 3190 2610 362 129 32818 2530 2476 22586 661 11420
NM_020919chr24926 456 95 25 21183 278 1200 11162
NM_020921chr143960 782 113 1168 142 1442
NM_020925chr141342 557 434 213 157 2400 368 11016
NM_020935chr273901 3733 3483 3245 1722 1602 74 23855 433 22859 1048 23433 542
NM_020940chr1042209 1881 519 124 11995 1883 --
NM_020943chr2246 24 1191 ----
NM_020948chr153182 977 711 681 447 31250 523 106 ----
NM_020960chr994928 4284 4259 4160 3781 1658 1264 604 429 24363 1528 24444 733 --
NM_020977chr472148 1960 1669 1400 653 562 378 21361 808 ----
NM_020980chr1551754 1310 575 512 231 11363 21117 430 --
NM_021005chr1511111 1303 31157 1057 963 --
NM_021007chr252256 1783 1674 541 188 22305 243 32108 1827 174 --
NM_021032chr361337 824 528 473 376 174 ------
NM_021033chr1363408 2935 1085 789 437 271 21412 1263 22889 1225 12427
NM_021038chr363224 2562 2260 998 888 792 32738 2673 345 ----
NM_021061chr8234512 4457 4192 3336 3303 3295 3178 3139 3127 3052 3021 2973 2907 2899 2880 2817 2778 2747 1822 1750 1568 1482 427 11201 44560 3961 3389 3328 13272
NM_021069chr441857 1331 632 64 1857 ----
NM_021072chr51875 32536 2437 999 42237 1624 1613 47 --
NM_021083chrX83294 2868 2816 2630 1239 682 379 285 53302 3150 3062 1307 1255 ----
NM_021097chr242781 2082 1185 1027 --12302 12479
NM_021101chr33903 105 32 42482 2285 1877 837 ----
NM_021111chr941230 1138 1110 513 21271 53 --11372
NM_021116chr7239079 9056 8966 8908 8784 8342 8291 7959 7529 6971 6473 6222 3520 3168 3022 2306 2031 1760 1355 598 431 403 380 35541 3259 2852 29010 5926 13099
NM_021121chr2----140 --
NM_021140chrX2908 150 1105 1729 --
NM_021153chr181177 ----1443
NM_021159chr441680 1274 405 126 --1587 21151 667
NM_021176chr251911 1886 1542 1441 1250 1245 ----
NM_021183chrX72470 1688 949 765 681 661 103 1838 11824 --
NM_021190chr121356 1234 --1514 --
NM_021194chr1195 --166 --
NM_021205chr1102618 2288 2158 2082 1951 1907 1887 925 458 66 32882 504 245 ----
NM_021220chr204414 374 353 131 ------
NM_021238chr1262101 1843 798 729 470 397 154 ----
NM_021239chr1411391 21433 1263 1352 1393
NM_021244chr6127 ------
NM_021255chr1493911 3720 3470 3372 1332 866 805 538 210 21059 118 --14049
NM_021572chr62363 30 31081 1060 887 1461 1404
NM_021622chr1051907 1833 1656 516 238 1669 1640 11616
NM_021629chr3104916 4867 4132 4107 4008 3616 3558 3411 634 193 23746 455 ----
NM_021637chrX41400 1185 1065 258 11002 ----
NM_021638chr484948 4754 4017 3989 950 341 261 127 13557 11633 --
NM_021647chr4104388 4272 3769 3543 3414 3382 2991 1837 1329 811 23000 915 1168 1725
NM_021705chr661471 1124 1047 530 453 177 21516 1149 21377 1109 --
NM_021813chr6105818 5800 4450 3655 2299 1860 1598 1363 865 382 13974 15743 24343 524
NM_021818chr142449 162 1414 --11480
NM_021821chr121841 ----181
NM_021871chr4----179 --
NM_021911chr554888 4398 3950 3597 1715 11756 23576 476 14670
NM_021912chr1593875 3690 3604 3431 3386 2854 1140 654 42 33649 700 471 43855 2988 1543 331 1848
NM_021914chr1492355 2267 2184 1834 1742 1559 678 348 338 ------
NM_021942chr43337 250 204 2874 792 1708 --
NM_021943chr641565 1377 510 174 32210 662 563 21606 1492 --
NM_021945chr683097 2995 2966 2956 2593 2229 772 664 1863 23075 1202 12398
NM_021947chr171868 21318 1136 1173 149
NM_021954chr1353161 1473 1348 119 94 32612 2329 1061 33684 2623 2541 --
NM_021960chr142015 728 204 188 22793 978 --11982
NM_021961chr11116631 6136 6032 5911 5529 5460 4838 4582 2999 959 592 36719 5831 2939 26229 5481 1860
NM_021964chr3106662 6210 6194 5995 5893 4808 4741 4694 4040 1871 55952 4838 4821 2275 1429 55532 5449 5211 4104 2609 --
NM_021977chr6133880 3585 3506 3399 3348 3117 2968 2662 2415 1325 1090 731 504 33843 3625 456 23102 2631 --
NM_021998chrX--3476 334 177 21500 940 1534
NM_022037chr22818 315 --1331 1648
NM_022041chr1662623 1704 1675 974 339 84 32049 1014 189 2689 596 --
NM_022048chr1565955 5506 4730 1958 1562 1523 31999 1067 1020 21548 1166 --
NM_022051chr1------2583 239
NM_022058chr241917 551 468 341 31612 651 434 134 --
NM_022114chr194498 4472 3643 3584 3367 1163 1029 565 317 13474 13634 14263
NM_022118chr132410 170 ------
NM_022130chr531487 1462 1012 --1502 --
NM_022133chr831286 588 533 ------
NM_022143chr741504 379 302 293 ------
NM_022153chr10113651 3396 2762 2627 2300 1385 1159 741 328 247 226 23596 575 12777 --
NM_022166chr1696039 6029 5977 5368 5120 4698 4527 4317 626 45543 5432 4649 901 25695 1665 --
NM_022173chr22818 315 --1331 1648
NM_022334chr25930 905 829 66 36 1114 6812 760 704 424 368 312 --
NM_022351chr883559 3411 3319 3000 2776 2565 1242 1159 32948 1218 849 ----
NM_022366chr11385 172 ----
NM_022456chr12137576 6282 4781 2481 1694 1511 1003 836 755 524 279 259 53 56562 5416 1552 1519 1354 55950 5581 1993 1927 561 144
NM_022459chr13115939 5893 4761 4330 4083 2348 2008 1598 124 58 50 11733 24916 1992 1577
NM_022461chr341341 1232 915 218 --182 1470
NM_022465chr1243069 2465 2095 246 --32552 2344 675 1646
NM_022474chr1442419 2311 2165 1777 --1995 11064
NM_022476chr163997 951 872 2988 86 --1788
NM_022482chr2082065 1734 829 624 508 458 344 49 12156 21883 1707 1551
NM_022483chr531881 420 328 2760 317 2700 428 --
NM_022484chr711258 21326 900 1947 --
NM_022491chr1283582 3216 3117 3074 1389 748 679 615 22492 309 1632 --
NM_022494chr101159 149 ----
NM_022497chr372770 2725 2482 1338 832 299 175 1111 23247 1401 13338
NM_022550chr5--1340 1135 --
NM_022650chr51658 ------
NM_022659chr83497 445 385 ------
NM_022716chr162572 2284 2262 2141 847 624 32311 594 509 12393 12525
NM_022726chr61144 1451 21694 415 11346
NM_022733chr1--21115 441 1485 --
NM_022735chr161895 1443 640 599 397 253 --11256 --
NM_022753chr182684 2206 1930 990 909 675 287 269 --22750 574 --
NM_022755chr972625 2174 973 591 152 49 25 --1437 --
NM_022757chr35958 381 315 158 58 1835 ----
NM_022763chr3102941 2862 2459 2317 2272 2000 1008 962 190 162 12803 22982 1948 --
NM_022771chr1241104 678 77 62 4933 397 314 70 1265 --
NM_022776chr331025 500 81 --2424 111 11587
NM_022781chr952895 2209 1225 662 68 22857 1026 ----
NM_022783chr82311 156 ------
NM_022787chr142752 2507 2032 47 11099 ----
NM_022802chr1061541 1197 576 520 190 140 ----21360 164
NM_022810chrX------1272
NM_022826chr231161 403 175 ------
NM_022841chr1552697 1898 1095 921 442 21799 1036 22318 909 12530
NM_022845chr1631984 274 99 22079 1400 21475 884 --
NM_022893chr252928 2297 1060 1035 449 --11221 23189 588
NM_022894chr241588 499 492 480 ----1422
NM_022898chr14134317 3990 3919 3450 3240 1912 1842 1661 1486 1341 1151 546 447 11608 1679 11242
NM_022900chr721100 260 ------
NM_022912chr292993 2859 2755 2691 2544 1870 1136 940 394 12600 12408 22300 1098
NM_022970chr1031013 936 57 1169 11179 --
NM_022977chrX61659 902 800 754 691 200 1763 --2793 208
NM_023000chr142533 376 --21548 1408 1584
NM_023001chr142533 376 --21548 1408 1584
NM_023016chr282719 2234 2122 1880 934 646 526 51 --22399 508 --
NM_023925chr12154 ------
NM_023929chr862636 2149 2081 1123 923 624 --32396 2232 936 --
NM_023934chrX41923 706 414 335 ----1554
NM_024007chr542945 2717 2620 811 22565 679 21103 167 12486
NM_024052chr1772467 2394 2308 2042 1142 958 34 11128 1298 1881
NM_024077chr92661 611 3268 117 51 --1278
NM_024086chr1793828 3716 3662 2658 2486 1204 1026 762 665 23898 2993 13302 13030
NM_024306chr1621054 326 11206 --11221
NM_024312chr1241587 1384 639 42 --11637 31099 617 188
NM_024344chr15--1508 ----
NM_024345chr965178 4590 4298 2366 433 248 32204 1501 475 --12421
NM_024416chr961612 1405 1158 1055 379 179 2547 421 21543 1253 --
NM_024423chr1864139 2692 2593 952 867 646 22898 2663 42739 1360 1233 438 --
NM_024429chr75738 684 265 221 140 2975 721 1851 11051
NM_024430chr1881723 1691 1628 1344 746 644 625 461 1223 ----
NM_024496chr141186 ------
NM_024525chr14588 580 136 127 1615 ----
NM_024532chr2--148 ----
NM_024539chrX41209 1171 481 435 3988 883 855 1111 --
NM_024541chr1081899 1813 1506 1344 601 571 466 366 21256 394 ----
NM_024546chr1351268 1206 862 301 38 21126 176 ----
NM_024548chr331753 1320 256 21669 390 2467 228 --
NM_024573chr64924 813 646 146 1949 1930 --
NM_024576chr61169 ------
NM_024582chr421010 155 191 --1780
NM_024596chr884765 4336 4306 3280 1928 1654 1424 177 24081 3941 1516 34481 1843 597
NM_024612chr171366 ------
NM_024613chr851579 1569 1394 1312 1185 51759 1740 554 115 43 ----
NM_024627chr22104726 4573 4342 4012 3586 3140 724 616 499 389 23237 1405 --23786 1942
NM_024635chr91222 ------
NM_024638chr352186 918 560 214 36 ----22317 773
NM_024640chr12612 234 ----1310
NM_024665chr364713 4384 3912 3153 1817 219 21592 170 23279 3218 --
NM_024668chr5------195
NM_024670chr1061341 1221 1183 490 346 310 1162 --11635
NM_024674chr163085 2660 2302 959 904 294 1977 22020 1039 --
NM_024692chr251724 1549 1495 1250 668 1101 1622 --
NM_024713chr1551425 1307 1177 304 181 31213 471 86 2530 479 --
NM_024715chr54686 275 141 101 11421 ----
NM_024721chr862616 2263 1064 779 625 560 32659 2575 1940 ----
NM_024740chr1133363 1332 356 43794 3609 495 402 43709 1262 480 121 1343
NM_024744chr242687 2497 2175 963 22649 430 --3806 689 103
NM_024749chr152206 1902 1830 846 197 21599 129 31458 629 264 --
NM_024755chr152949 254 1242 141 --
NM_024761chr994239 4112 4072 3315 2008 1253 553 140 84 --2357 337 --
NM_024770chr2126688 6539 5123 4741 4234 4226 2554 1034 873 824 544 523 24519 200 36369 5546 4492 16232
NM_024817chr15156005 5898 5610 5252 4792 4613 4375 2337 1458 1023 859 674 352 270 188 11495 24601 1478 1822
NM_024824chr1461544 1441 649 481 144 91 21629 537 ----
NM_024834chr1071962 1782 1645 1502 342 335 124 11312 31788 1344 1278 --
NM_024837chr1561293 1206 630 495 340 53 31926 570 396 11394 --
NM_024854chr1241523 1498 505 166 11319 --21247 106
NM_024871chr32358 272 ------
NM_024884chr14114476 4468 4343 3432 3159 2988 2825 1658 271 264 239 23408 1693 11699 --
NM_024913chr751731 1699 1239 1215 21 --1554 1401
NM_024920chr461582 1538 1263 1164 127 111 11235 --2175 101
NM_024921chrX41792 617 561 452 --1240 --
NM_024945chr921121 867 1172 --1920
NM_024947chr3168626 7873 7432 6755 3760 3688 3517 3286 2888 2644 2181 1572 1472 1417 1000 565 39227 5946 5930 46942 3523 2372 233 48430 7625 1705 621
NM_024948chr10146 ------
NM_024953chr1232803 1806 368 32609 1862 921 22713 2443 12418
NM_024989chr2107751 7517 6784 6720 6663 6405 5887 5016 4972 1256 47036 5681 5044 221 25978 5792 21687 130
NM_024993chr261506 1472 1465 1239 323 194 ----11554
NM_024996chr3291 35 1382 2938 264 1234
NM_025040chr1931756 1600 1570 1311 --1499
NM_025054chr883141 2902 2645 1473 1228 1166 1119 228 22796 344 11204 24121 4066
NM_025073chr173663 3534 3515 3034 1202 304 198 14201 13055 --
NM_025074chr482994 2498 2389 2347 2278 1984 1931 150 1619 2782 681 1180
NM_025076chr23597 563 131 --2708 118 --
NM_025107chr662277 2248 1537 885 760 121 --151 --
NM_025134chr1612320 ----1898
NM_025141chr154448 190 169 153 ----1606
NM_025146chr372744 2546 1930 1033 916 328 147 --12290 32577 2369 2015
NM_025147chr22329 290 --11162 1136
NM_025152chr1441686 1289 254 209 11267 ----
NM_025160chr194072 3411 1450 1423 1255 900 798 278 134 44124 3905 3205 428 64012 3939 3712 3161 2888 1101 12682
NM_025179chr1124973 4376 4321 4223 3860 1681 1423 1072 669 571 532 115 13119 14736 1756
NM_025180chr393378 3260 3141 2552 1258 815 738 212 64 31074 343 141 23093 316 13128
NM_025181chr23824 288 126 1103 ----
NM_025191chr172656 2638 2577 1374 1072 825 281 21177 743 12778 --
NM_025208chr1182350 2333 2165 2120 1750 1540 441 33 --1947 1965
NM_025221chr431328 1043 202 --21386 105 --
NM_025238chr1531531 1304 1110 --21540 314 --
NM_030579chr1693686 3374 2845 2805 2269 1170 617 385 156 12377 ----
NM_030621chr1463543 3497 3115 1429 461 109 23003 2728 23512 3402 1843
NM_030623chr241689 1561 1386 571 11169 --1675
NM_030625chr1072653 2309 2110 950 650 510 439 12382 12401 --
NM_030627chr563881 3422 1395 784 641 604 2895 251 11078 --
NM_030634chr131549 149 80 3296 258 23 --2635 250
NM_030647chr776321 6282 6001 5418 5115 4461 1812 26298 2292 26213 4713 1244
NM_030648chr4135530 5232 4729 4404 2141 1858 1784 1402 1394 1318 1159 979 32 11472 2314 215 14908
NM_030650chr273499 2788 2776 1377 1301 451 28 21678 915 11579 11184
NM_030661chr781589 1520 1486 1477 1043 556 458 210 ------
NM_030664chr1041532 693 555 152 21747 911 1601 --
NM_030674chr12195534 5414 5249 5152 4740 4369 4232 3649 2361 1788 1631 1572 1513 1233 910 601 552 527 368 55186 4041 1447 682 322 25021 4315 31752 1424 1415
NM_030755chr1473022 2221 871 858 797 176 130 3964 297 227 32074 781 771 12160
NM_030791chr1441882 1725 726 493 11803 11587 1205
NM_030806chr1239140 8086 7906 7884 7134 6823 6790 6752 6615 6547 5925 3711 3145 2951 2660 2511 2300 1198 970 918 598 469 63 49363 9352 8184 5722 12724 --
NM_030809chr1231813 1600 240 42450 2085 1623 902 21860 265 1459
NM_030816chr163353 2909 2299 1392 321 115 12859 22795 2619 23345 1417
NM_030820chr63990 894 874 191 ----
NM_030881chr22102402 2363 2182 2061 1918 1606 1558 685 416 215 1874 1269 1653
NM_030885chr372144 1999 1925 1875 898 867 133 ------
NM_030893chr11199 --1637 --
NM_030906chr111154 ------
NM_030915chr21186 32398 234 104 --12248
NM_030918chr1134508 3904 3492 1841 1775 1602 1350 1038 989 577 400 343 246 34350 3592 1418 21871 1148 --
NM_030920chr121563 1526 11900 21758 363 --
NM_030934chr141555 588 411 137 1714 31167 705 249 --
NM_030939chr62309 129 --1290 --
NM_030940chr931271 995 372 2115 93 ----
NM_030953chr51115 2630 391 --11580
NM_030964chr563722 3099 2710 762 449 223 22825 36 --1600
NM_030965chr13305 241 61 ----1811
NM_030966chr172274 29 ------
NM_031216chr185448 283 272 218 209 11792 11826 --
NM_031226chr1541290 1160 1134 1093 ----11302
NM_031243chr721983 1715 21690 393 21835 1539 --
NM_031262chr91204 1874 21000 196 --
NM_031263chr91261 2931 47 31057 253 76 --
NM_031268chr16115163 4641 4372 4319 4262 3735 3369 994 981 763 456 13879 11588 --
NM_031271chr821405 332 31367 1302 1095 123 --
NM_031291chr4--1674 1574 1581
NM_031296chr412001 --22678 1685 32566 1903 206
NM_031314chr1451871 1784 1626 1387 409 ------
NM_031362chr272729 2329 1917 617 465 416 348 --11042 12071
NM_031365chr272865 2465 2053 753 601 552 484 --21178 64 12207
NM_031366chr272865 2465 2053 753 601 552 484 --21178 64 12207
NM_031372chr441202 1132 545 64 2654 534 1484 11165
NM_031419chr321178 584 --21226 1204 --
NM_031426chr972644 2531 2431 1105 912 801 677 22403 413 --1875
NM_031427chr14105330 5194 5122 4503 4083 3712 2135 2099 1588 408 35835 4555 387 35105 2006 627 --
NM_031435chr12113156 2908 2896 2819 2775 2691 2547 1411 1108 245 119 3593 459 178 12379 --
NM_031442chrX12108 31119 1086 478 11069 22320 1034
NM_031445chr273419 3318 722 355 338 332 155 22907 1340 22674 2350 --
NM_031453chr1021906 1617 22444 1779 21808 304 12023
NM_031461chr821891 346 11923 1407 --
NM_031468chr7107030 6623 6438 6243 6102 5913 5607 2977 2530 1296 33145 2921 2474 47021 6652 2687 2269 15858
NM_031469chr6124059 3465 3435 3238 1559 1545 808 743 733 681 402 143 23010 247 33315 1449 288 12779
NM_031476chr1622388 1919 1955 32394 940 174 12863
NM_031483chr2063419 2531 1402 1274 929 551 12319 12695 --
NM_031844chr153844 3805 3576 2837 1326 43551 3464 2899 747 12756 1598
NM_031845chr251286 1266 1259 332 311 13016 123 --
NM_031847chr251286 1266 1259 332 311 13016 123 --
NM_031858chr171383 11077 2484 316 --
NM_031862chr171383 11077 2484 316 --
NM_031866chr101194 --1919 --
NM_031889chr441738 1716 1605 167 21565 1343 1356 11894
NM_031911chr462710 2094 567 220 165 38 22107 1865 1923 12549
NM_031922chr61532 ------
NM_032012chr985285 4422 3250 1986 1335 1312 955 287 35116 4744 253 25041 620 --
NM_032042chr572204 2122 1932 1063 671 424 305 22746 690 ----
NM_032047chr351973 1605 1532 116 37 11899 --22446 2123
NM_032102chr1182801 2523 2398 2346 2215 2006 308 86 2843 705 --1107
NM_032105chr1178053 7954 7541 7484 7076 5859 5309 5082 3178 3032 2734 2129 1650 994 634 357 84 46217 5731 1876 1243 27375 64 --
NM_032121chrX22082 29 3532 200 70 1614 246 39
NM_032124chr1861172 1126 235 156 52 30 ----2335 207
NM_032138chr133398 188 129 ------
NM_032145chr671757 1563 1411 1329 1259 746 189 21654 1457 ----
NM_032153chr382666 2523 2297 2087 2034 1123 556 173 12616 32636 2398 165 --
NM_032154chr103959 758 239 ------
NM_032156chr12154 ------
NM_032160chr18104123 2937 2811 2771 2647 1178 1070 937 847 525 2446 222 12921 44311 4300 1596 991
NM_032182chr1031320 1105 389 11281 21636 54 --
NM_032186chr131245 147 50 --11136 --
NM_032189chr1354996 4804 4318 3916 1314 14901 24508 1897 --
NM_032199chr1083523 2873 2764 2677 2519 1381 917 797 23535 2695 ----
NM_032208chr273646 3029 1443 1210 1053 328 160 12456 12940 --
NM_032221chr2042010 1702 1296 363 2554 136 --11596
NM_032228chr1183383 3321 3231 3038 2949 2540 1045 321 12755 1955 --
NM_032236chr151104 1092 1074 956 932 1801 1844 --
NM_032256chr12----2822 658 1911
NM_032271chr161344 ------
NM_032291chr131953 1801 304 11362 --11892
NM_032293chr9----1255 --
NM_032307chr9--1129 ----
NM_032315chr1----192 140
NM_032321chr292933 2172 2157 847 683 604 256 223 216 33292 2552 2501 22532 2433 --
NM_032328chr1----128 --
NM_032352chr1431306 565 101 --21052 453 --
NM_032373chr10125624 5522 5252 5116 4569 1826 1624 1397 1377 1356 441 201 23630 1819 55041 4771 2215 694 26 22159 670
NM_032424chr1161590 1565 1321 1276 1047 621 21493 35 ----
NM_032434chr251459 1330 1178 1058 76 21097 1005 21422 559 --
NM_032435chr131801 1754 688 --42274 1469 764 549 12374
NM_032436chr131377 --1865 --
NM_032440chr1082932 2692 2586 2112 2088 2038 1941 934 12700 ----
NM_032441chrX41096 442 297 155 21192 197 1453 136
NM_032445chr1582428 2066 1697 406 314 129 54 38 ------
NM_032446chr5123796 3705 3490 3196 2661 2425 861 561 499 441 272 139 23233 339 21004 30 --
NM_032457chr463318 1428 1015 926 513 383 22608 1579 23333 1359 --
NM_032458chrX73240 3139 2854 2761 2435 638 460 --23028 566 --
NM_032466chr841352 1135 593 96 11090 ----
NM_032468chr841352 1135 593 96 11090 ----
NM_032505chr352207 1924 899 277 95 21995 693 1514 12494
NM_032509chr882484 2271 2215 1867 842 654 111 32 22152 948 11677 --
NM_032539chrX1625 1124 --2632 599
NM_032547chr44526 501 267 101 ------
NM_032557chr42868 328 ------
NM_032558chr951408 1380 1224 229 41 ------
NM_032580chr17----3552 469 457 --
NM_032622chr441269 337 298 57 1408 ----
NM_032632chr1421953 1524 21853 445 31746 603 102 12037
NM_032679chr1951095 1061 987 383 83 --1151 11013
NM_032682chr373654 2593 1380 1285 741 360 138 23519 209 --22893 1115
NM_032704chr12193 ------
NM_032727chr1031531 178 137 21577 1463 1335 --
NM_032737chr1942462 2358 2036 972 11944 --22707 49
NM_032772chr10--1234 1564 --
NM_032778chr392482 2345 2249 2088 1233 1046 947 575 290 --53113 2772 2697 2160 870 --
NM_032801chr113693 610 245 22336 1918 32387 1891 704 1785
NM_032804chr1052359 919 894 266 147 11886 22224 98 --
NM_032827chr211150 ------
NM_032828chr19104044 3849 3247 1936 1354 1138 466 398 70 31 24716 1328 --24616 4520
NM_032832chr661690 1312 1179 466 276 183 21274 253 ----
NM_032833chr142516 2043 1054 48 42113 1998 832 398 12286 1591
NM_032837chr1731565 1531 130 11329 41833 1503 523 479 --
NM_032842chr751331 1237 426 89 43 21255 1229 --11653
NM_032852chr1176 1134 142 --
NM_032857chr153236 95 51 1218 ----
NM_032859chr1383245 2964 2794 1310 847 637 614 116 21026 97 ----
NM_032869chr831906 440 432 1215 21810 501 134
NM_032870chr6265 48 ------
NM_032873chr11104474 3940 3657 3574 3430 3092 2789 1524 1183 913 2571 500 22781 395 --
NM_032876chr1452204 2178 2131 1873 620 21692 812 --12003
NM_032900chr1093922 3642 3375 2517 1512 1066 815 196 168 23153 327 --1674
NM_032949chr131427 --1409 --
NM_032968chrX84113 3733 2905 2887 2835 2746 2585 1695 13416 13494 21479 1115
NM_032969chrX84113 3733 2905 2887 2835 2746 2585 1695 13416 13494 21479 1115
NM_032973chrY64105 3725 2900 2882 2741 2584 13412 23490 2831 21479 1115
NM_032975chr1873433 3065 2344 1458 1254 907 430 32513 591 363 12584 12238
NM_032980chr1873433 3065 2344 1458 1254 907 430 32513 591 363 12584 12238
NM_033014chr961612 1405 1158 1055 379 179 2547 421 21543 1253 --
NM_033020chr1114813 4766 4411 3896 3806 3572 1932 1700 1339 520 95 34333 1914 1308 63127 2999 1204 1188 677 160 14857
NM_033030chr211352 ------
NM_033055chr1--2796 201 ----
NM_033067chr1----1808 --
NM_033081chr2031225 1004 71 ------
NM_033083chr393238 3196 3113 2874 2832 2743 2700 131 54 23009 1314 ----
NM_033084chr32232 152 ----1650
NM_033133chr1753349 2851 2769 2483 1402 1467 --33481 2824 2692
NM_033135chr1182350 2333 2165 2120 1750 1540 441 33 --1947 1965
NM_033136chr531862 1720 548 --11668 11754
NM_033137chr531862 1720 548 --11668 11754
NM_033138chr751726 1593 492 470 305 22095 805 --1915
NM_033139chr751726 1593 492 470 305 22095 805 --1915
NM_033140chr751726 1593 492 470 305 22095 805 --1915
NM_033143chr484111 4040 3637 3431 1601 664 449 417 34482 405 231 31394 511 479 172
NM_033157chr751726 1593 492 470 305 22095 805 --1915
NM_033181chr673954 3408 2999 2407 1579 879 229 --2642 499 11032
NM_033207chr1042211 1681 585 127 150 22502 38 22347 683
NM_033208chr16--1130 ----
NM_033211chr541287 821 464 124 21595 777 11903 1528
NM_033222chr951249 1177 947 71 59 1110 ----
NM_033224chr7127626 6861 6461 4936 2602 2511 1853 1595 1406 1384 1329 285 67786 5819 5609 3226 2758 2254 31353 1144 469 26455 5633
NM_033225chr882615 2339 2108 1972 905 849 484 331 1464 22129 1187 --
NM_033260chr62717 581 ----1594
NM_033280chr18--148 132 --
NM_033285chr894359 3903 3795 3674 3128 1498 1287 1253 536 44211 3938 232 148 13172 24143 3727
NM_033290chrX73010 2791 2642 2366 1481 1189 725 23593 3199 --31076 755 69
NM_033305chr941472 1266 1199 237 ------
NM_033331chr993472 3200 3099 2448 2341 1273 219 149 25 23553 75 52315 1436 1377 1087 448 2758 46
NM_033360chr1274379 4027 3998 3965 3643 1624 361 24306 3883 44552 4415 2911 554 1923
NM_033364chr341908 1574 1469 1305 52009 1745 1424 808 380 1643 1510
NM_033394chr211079 1416 --1209
NM_033396chr111429 ------
NM_033402chr82442 94 --127 --
NM_033425chr1152536 1388 951 780 562 2809 338 --12980
NM_033426chr1472965 2834 2600 1900 835 712 205 42156 2143 753 587 12671 --
NM_033427chr72865 204 ------
NM_033428chr911613 --11691 21259 140
NM_033429chr1572997 2888 2450 2245 2052 1990 697 42989 967 506 37 23020 2560 --
NM_033430chr483781 3485 3364 2778 665 545 307 209 13801 31121 952 215 22970 1083
NM_033437chr483781 3485 3364 2778 665 545 307 209 13801 31121 952 215 22970 1083
NM_033480chr652581 2156 497 415 248 11957 1887 12250
NM_033481chr652581 2156 497 415 248 11957 1887 12250
NM_033505chr2186652 6632 6624 6491 6190 5943 5815 5526 4927 4661 2312 2264 1765 1601 1263 1062 743 70 22061 527 25876 4706 26712 4725
NM_033546chr18------2209 179
NM_033551chr583398 3225 2994 2637 2351 2150 1304 941 33502 2525 757 1714 --
NM_033631chr153549 2739 2513 1465 628 43789 2730 1221 116 ----
NM_033637chr1052881 2794 2737 2648 1137 33569 2852 709 23838 608 13254
NM_033655chr93755 728 717 1170 ----
NM_033656chr2133936 1592 269 25042 1292 55019 4484 2299 1697 574 35112 3996 1837
NM_044472chr13748 663 95 ------
NM_052818chr1362194 1986 655 349 249 110 --11444 --
NM_052828chr641382 1205 361 240 2394 205 --11720
NM_052834chr1862585 2540 2453 2285 682 392 --1458 --
NM_052845chr12133270 3233 2827 2653 2473 2314 2213 1099 1058 854 733 664 622 32114 448 90 ----
NM_052867chr133959 483 98 1470 ----
NM_052879chr12123861 3703 3662 3638 3238 3052 2751 1010 1003 631 552 66 1589 21568 1274 21591 758
NM_052885chr1254898 3176 1425 1008 259 21707 1215 --13364
NM_052896chr112567 21917 212 11648 1673
NM_052897chr123909 723 553 ----1231
NM_052904chr61563 11267 1548 1163
NM_052907chr12104112 3163 1630 1597 1526 1496 529 517 434 215 44233 3333 2796 890 1996 22670 1335
NM_052910chr1352158 572 284 245 189 11696 11753 11491
NM_052911chr183901 881 40 1967 --1291
NM_052913chr62780 223 ----11134
NM_052917chr242517 750 548 84 --32440 340 90 13201
NM_052937chr822455 537 31876 1084 50 12090 --
NM_052953chr3197 ------
NM_052966chr141540 1101 929 159 43390 2555 1274 34 1737 1303
NM_053002chr33794 431 281 ----145
NM_053016chr9207895 7637 7400 7070 7039 6820 6771 6127 5957 5870 5125 3171 2362 2198 1936 1773 1707 1332 645 168 25912 1548 52573 2073 604 326 95 --
NM_053023chr1173086 3027 2743 2324 1162 1011 843 23208 2115 22832 106 --
NM_053042chr473149 2930 2506 278 255 199 159 12297 --12310
NM_053043chr766328 2286 2035 1491 932 805 34664 2084 545 44594 2178 2097 1059 21485 1152
NM_053064chr1442667 2125 562 349 4888 319 121 22 ----
NM_053067chr9--122 ----
NM_054027chr561557 1421 868 840 662 592 21874 1583 --21999 1825
NM_057159chr91224 ----1178
NM_057168chr731672 1224 132 31694 517 216 --21301 479
NM_057175chr472334 2293 2194 1706 994 422 409 22585 155 42186 2033 1909 673 --
NM_057178chr1782578 2282 2190 1898 1752 1087 1077 966 21744 918 ----
NM_057182chr191174 ------
NM_058170chr121664 1520 21060 1044 1653 1477
NM_058172chr411773 11343 --3601 577 245
NM_058241chr252286 2279 2191 784 763 2912 149 2725 649 11505
NM_058241chr252286 2279 2191 784 763 2912 149 2725 649 11505
NM_078474chr154448 190 169 153 ----1606
NM_080546chr941883 1806 1438 791 ----1908
NM_080599chr103424 296 72 ----1788
NM_080629chr131479 1286 1255 21326 181 21434 1384 --
NM_080630chr131479 1286 1255 21326 181 21434 1384 --
NM_080645chr662182 1684 1568 1404 294 62 ----12216
NM_080651chr81238 ------
NM_080654chr1151322 1049 832 547 426 --11368 --
NM_080676chr2061123 1103 977 900 607 307 32926 2883 2485 --12834
NM_080683chr41384 1147 1162 --
NM_080684chr41384 1147 1162 --
NM_080685chr41384 1147 1162 --
NM_080738chr181757 1571 1295 763 348 319 221 41 11282 --21648 1396
NM_080743chr632092 894 671 22507 1692 1283 11672
NM_080745chr15----150 --
NM_080759chr1362685 2126 1976 1935 1046 656 5645 562 491 356 209 21657 681 --
NM_080760chr1362685 2126 1976 1935 1046 656 5645 562 491 356 209 21657 681 --
NM_080792chr2052159 1440 825 647 537 1525 11431 1802
NM_080867chr1464299 3693 3496 1209 501 319 1813 11474 11884
NM_080872chr883989 3858 3694 2830 1166 1010 662 351 23965 3763 11311 --
NM_080921chr12798 465 --11151 --
NM_080927chr362732 2120 819 406 389 132 --23170 106 12395
NM_100264chr102594 188 --1749 --
NM_100486chr102594 188 --1749 --
NM_130385chr11113188 2945 2880 2844 2300 2264 841 617 598 454 35 53219 2924 2826 2797 959 22427 1145 --
NM_130386chr181230 ----3124 110 93
NM_130391chr932534 328 238 2707 201 --13414
NM_130392chr932534 328 238 2707 201 --13414
NM_130393chr932534 328 238 2707 201 --13414
NM_130395chr61180 ------
NM_130434chr153921 459 221 1127 11051 --
NM_130436chr2142822 660 172 109 2926 152 --1764
NM_130438chr2183399 2205 2140 2124 1237 749 686 26 1729 2588 488 11341
NM_130439chr101610 32200 928 558 ----
NM_130439chr101610 32200 928 558 ----
NM_130798chr1521411 54 21447 1348 ----
NM_130808chr34365 354 311 31 ------
NM_130838chr1531504 526 194 1542 ----
NM_130839chr1531504 526 194 1542 ----
NM_130847chr1195256 4505 4291 3904 3758 1964 1953 1917 269 14860 --1178
NM_133170chr20108108 7165 7130 5845 5713 5533 5423 5284 2437 1058 36343 1188 1084 26137 4891 --
NM_133263chr51134 ------
NM_133264chr17123727 3518 3415 3166 2753 2393 1539 1124 1003 967 821 78 --11103 1684
NM_133265chrX63606 2884 1027 753 556 348 1519 --13295
NM_133326chr12372 313 ------
NM_133329chr231313 736 551 31593 1582 450 11801 --
NM_133334chr4166393 5671 5583 5554 5224 4614 4377 2319 1897 1867 1631 1462 1427 1150 363 260 35765 5628 5488 15933 15753
NM_133367chr652306 1166 340 261 140 33259 2931 290 13162 22856 364
NM_133370chr453443 3299 2925 2238 441 11406 --1174
NM_133372chr54969 749 672 184 22700 252 12573 --
NM_133433chr5160 ------
NM_133446chr101290 ------
NM_133462chr32432 360 ------
NM_133468chr792577 2398 2305 2114 2034 1857 748 251 29 --151 --
NM_133473chr1941453 1333 583 417 31304 1283 522 ----
NM_133474chr461684 1529 1517 618 480 437 31290 1242 319 11565 1306
NM_133477chr443246 2872 2556 1102 42687 2528 2465 2436 13267 --
NM_133493chr674576 4533 4297 3505 3497 2834 583 195 11234 2702 518
NM_133494chr1----140 --
NM_133496chr154399 3362 3168 1267 401 33382 1616 425 23033 1374 14193
NM_133507chr12--1682 --1264
NM_133631chr341443 646 525 334 11504 --21616 1036
NM_133646chr284844 4513 4464 4016 3496 3387 1831 874 54546 2105 1976 1286 784 1730 23540 1948
NM_133647chr1593613 3375 2638 2358 1096 1016 1008 559 124 --33764 2707 806 33856 3196 329
NM_134442chr24549 400 124 62 ----1608
NM_134447chr19193 1154 ----
NM_138270chrX83028 2788 2596 2379 1060 737 559 512 12673 52513 923 546 505 479 --
NM_138316chr1051397 1375 1260 1159 905 2549 286 ----
NM_138319chr1541265 1250 482 312 --11088 --
NM_138333chr972208 2082 1945 1713 132 122 68 12118 2548 300 --
NM_138444chr13104462 4189 4108 4027 3940 3857 1070 570 416 364 44599 1442 1434 621 --14778
NM_138458chr251042 723 401 339 290 ------
NM_138459chr6113338 2754 2733 2599 1444 1139 1080 711 647 484 463 31426 749 738 52926 2747 770 469 297 --
NM_138468chr265874 4186 3949 1899 1587 901 21885 850 46186 6122 4358 279 --
NM_138473chr1254784 4269 2067 1891 1208 13917 64701 3744 3487 3255 1575 382 --
NM_138494chr731031 254 56 --12754 --
NM_138576chr14134317 3990 3919 3450 3240 1912 1842 1661 1486 1341 1151 546 447 11608 1679 11242
NM_138578chr2021435 361 1336 ----
NM_138609chr5--1499 ----
NM_138610chr5--1499 ----
NM_138621chr273656 2978 2959 2682 1221 594 446 32903 1524 939 --13286
NM_138633chr641660 1562 1336 161 11576 ----
NM_138635chr762406 2228 577 442 112 86 22908 2700 --22607 353
NM_138638chr1492355 2267 2184 1834 1742 1559 678 348 338 ------
NM_138713chr16168042 7600 6856 6291 6276 5984 5766 5371 2698 2194 2008 1808 1141 1064 630 49 43191 2662 1026 426 38296 7757 532 1233
NM_138714chr16168042 7600 6856 6291 6276 5984 5766 5371 2698 2194 2008 1808 1141 1064 630 49 43191 2662 1026 426 38296 7757 532 1233
NM_138731chr1453691 3292 1614 1128 139 1781 33933 1041 300 --
NM_138735chr261260 1168 534 508 270 54 1424 --21542 1307
NM_138770chr21241 ----1248
NM_138771chr73634 530 305 2517 449 1581 1321
NM_138779chr131212 1261 ----
NM_138782chr521474 401 1302 31895 179 164 --
NM_138799chr231334 502 284 --11817 21949 314
NM_138811chr711180 2356 196 11230 1348
NM_138820chr5121 ------
NM_138959chr154155 2734 2638 2421 2279 44669 1706 1665 188 66835 6231 5827 5580 1861 111 --
NM_138971chr1153324 2976 2356 971 278 22764 586 1924 12562
NM_138971chr1153324 2976 2356 971 278 22764 586 1924 12562
NM_138972chr1153324 2976 2356 971 278 22764 586 1924 12562
NM_138972chr1153324 2976 2356 971 278 22764 586 1924 12562
NM_138973chr1153324 2976 2356 971 278 22764 586 1924 12562
NM_138973chr1153324 2976 2356 971 278 22764 586 1924 12562
NM_139045chr93662 651 33 --1235 --
NM_139046chr10--1202 ----
NM_139057chr1552849 2450 981 416 45 1569 22214 1909 --
NM_139072chr21890 ------
NM_139078chr12--138 ----
NM_139126chr63721 641 172 ------
NM_139160chr11198 ------
NM_139168chr561565 444 383 341 302 35 --11624 --
NM_139182chr451768 1199 522 173 75 ----1479
NM_139201chr124712 481 206 83 --165 1101
NM_139207chr1252222 2134 1834 1732 253 21770 735 12010 11854
NM_139241chr121199 ------
NM_139244chr64893 721 165 104 ----1698
NM_139246chr962129 2122 1839 1518 754 187 21889 682 ----
NM_139279chr283535 3366 3355 2784 1406 1244 725 58 33285 2562 1308 ----
NM_139283chr123894 832 208 --12308 1323
NM_139319chr1231840 567 315 31801 1389 1300 --1652
NM_139321chr2094250 3873 3809 3685 3277 3242 2996 694 447 23939 2882 23518 1149 23016 114
NM_139323chr2081766 1678 1294 781 692 615 445 272 21800 660 1387 --
NM_144498chr2092260 1801 1784 1631 1602 1583 1426 395 109 21896 631 11927 --
NM_144567chr172701 2580 2424 1102 662 134 111 12278 ----
NM_144571chr4156727 6626 5861 5741 5734 5477 5110 5100 4988 4936 2050 1412 938 414 184 41254 1085 784 568 15791 12064
NM_144578chr1465032 4605 4059 3746 2028 266 55076 4886 3947 3912 1241 --11269
NM_144590chr1072901 2636 1886 1142 1122 455 47 42344 1918 1131 430 ----
NM_144599chr15135082 5046 5025 4666 3859 2166 1810 1762 1480 980 508 265 111 75280 5142 4982 4781 4252 2182 835 22018 1143 --
NM_144632chr242136 2014 714 259 12337 21632 573 --
NM_144643chr4----167 --
NM_144644chr4--1189 ----
NM_144657chrX3441 270 116 1233 --1546
NM_144664chr1121890 1687 --22524 1597 --
NM_144718chr352307 2146 2076 1936 21 42494 2377 2330 370 22348 1994 --
NM_144721chr462205 2103 1742 1041 922 398 42791 2636 538 158 --12222
NM_144766chr1----140 --
NM_144770chr213409 309 108 --1945 --
NM_144775chr1794847 4354 3991 3852 3712 3675 3218 1433 1235 44051 3897 3530 1362 13152 --
NM_144778chr132487 235 --12020 21976 694
NM_144949chr252241 1974 1033 974 376 22148 2017 21777 663 1324
NM_144969chrX4749 699 521 139 --2206 123 --
NM_144973chr12135248 5211 4728 4295 4172 4046 3946 1981 1849 1231 660 281 179 44479 3750 1420 690 --1667
NM_144979chr41685 1543 ----
NM_144982chr12----2788 767 --
NM_145000chr5--1426 --155
NM_145010chr1052052 2033 1985 1852 774 31640 763 23 --147
NM_145011chr1041777 1488 591 28 22008 1852 ----
NM_145049chr531017 434 27 1222 195 1701
NM_145055chr1863808 3496 3438 2939 1527 756 13159 ----
NM_145062chr62149 67 ------
NM_145102chr741326 1259 309 117 1539 1992 --
NM_145115chr791853 1813 1679 1443 880 813 437 422 255 --11598 --
NM_145117chr1162667 2334 2188 411 364 310 2884 74 12762 1278
NM_145159chr142945 786 1192 ----
NM_145165chr1452900 2022 983 578 474 22371 1012 2463 409 190
NM_145175chr211384 --11171 --
NM_145176chr642943 2388 441 131 32746 1298 1269 --22268 990
NM_145235chr101137 ------
NM_145251chr1421085 318 --11071 11010
NM_145259chr2166303 5932 5879 5239 4795 2572 2385 1810 1804 1784 1708 1589 695 675 379 219 47047 2501 2104 1010 11423 1684
NM_145261chr3----1852 1846
NM_145268chr731141 415 247 1350 ----
NM_145274chr173321 246 81 --1339 1120
NM_145277chr11155 ------
NM_145284chrX22247 2084 32395 2322 656 12055 12218
NM_145305chrX5995 903 520 451 343 11062 ----
NM_145307chr1063962 3435 1488 1219 637 474 24710 3708 13878 24645 3208
NM_145320chr73454 260 56 2619 525 11216 13525
NM_145321chr73454 260 56 2619 525 11216 13525
NM_145322chr73454 260 56 2619 525 11216 13525
NM_145331chr64743 672 565 26 ------
NM_145332chr64891 820 713 174 ------
NM_145333chr64891 820 713 174 ------
NM_145649chr672684 2568 2534 2367 799 792 157 12513 21071 28 11817
NM_145655chr672684 2568 2534 2367 799 792 157 12513 21071 28 11817
NM_145686chr262966 2633 2094 1065 445 75 22142 53 12665 1292
NM_145687chr262966 2633 2094 1065 445 75 22142 53 12665 1292
NM_145698chr1051813 825 790 627 60 22039 1636 135 --
NM_145719chr112267 249 1369 ----
NM_145733chr22------11169
NM_145735chr1372842 2545 1071 1061 955 857 825 32717 2645 2321 1352 --
NM_145753chr331408 1207 209 11700 ----
NM_145805chr151500 ------
NM_145808chr752753 1106 954 615 437 --22428 777 --
NM_145859chr33328 103 45 ------
NM_145860chr33328 103 45 ------
NM_145861chr181757 1571 1295 763 348 319 221 41 11282 --21648 1396
NM_145913chr122766 274 1414 --1346
NM_147147chr693380 3261 3125 2979 1693 1276 1066 1059 210 33485 1073 56 21458 1243 --
NM_147150chr923310 2753 33619 3139 675 2327 69 33682 2971 925
NM_147166chr71708 1722 1728 1260
NM_147175chrX21761 1651 11753 31776 1542 793 21899 48
NM_147181chr431328 1043 202 --21386 105 --
NM_147182chr431328 1043 202 --21386 105 --
NM_147183chr431328 1043 202 --21386 105 --
NM_147189chr862078 1779 789 541 387 192 22207 947 ----
NM_147223chr262489 2361 1993 1836 258 180 1947 1361 1405
NM_147233chr252306 2178 1810 1653 75 1764 1178 1222
NM_148174chr852236 2153 2017 622 30 ------
NM_148898chr71332 1253 ----
NM_148899chr71332 1253 ----
NM_148923chr18--1100 ----
NM_148955chr15126472 6347 6177 6094 5655 5125 5008 4416 4150 1845 1345 454 45336 5114 4198 537 46279 6269 5678 4248 --
NM_148957chr1382405 2351 2132 1863 602 185 76 39 12111 22631 958 1388
NM_148976chr111194 ------
NM_148977chr1051397 1375 1260 1159 905 2549 286 ----
NM_148978chr1051397 1375 1260 1159 905 2549 286 ----
NM_152253chr22104291 4257 4220 4213 3955 1727 1590 859 830 637 12851 23445 1293 1665
NM_152261chr1242241 1561 121 52 ----21738 248
NM_152271chr82472 211 ------
NM_152275chr232029 1463 847 11529 22331 800 1854
NM_152277chr571710 1631 1578 1320 792 693 232 21418 758 --21876 500
NM_152280chr163286 3089 2837 2579 723 700 23197 1326 22167 1030 1635
NM_152284chr83763 656 109 ------
NM_152288chr1621051 1028 ------
NM_152327chr141423 277 64 ----
NM_152332chr1422641 494 12723 12738 1647
NM_152349chr171293 ----1564
NM_152375chr152132 1626 1008 853 599 32002 1964 585 --12590
NM_152387chr231078 325 130 2745 734 --1811
NM_152388chr2104064 3257 3092 2779 2642 1491 1244 508 455 422 1559 2432 122 --
NM_152402chr41118 187 ----
NM_152409chr533045 1335 617 12831 22957 330 --
NM_152414chr831107 535 134 1499 ----
NM_152417chr81360 21210 1176 ----
NM_152422chr961822 1751 1570 1204 531 246 31830 201 134 11472 --
NM_152424chrX74721 4615 3896 3841 2883 1900 1714 22989 104 --13725
NM_152437chr1242155 1683 763 278 --21816 1766 --
NM_152448chr152518 421 ------
NM_152450chr1521920 256 2347 165 ----
NM_152475chr1982773 2732 2519 1822 772 265 70 31 12395 --12299
NM_152495chr1101118 1001 452 382 336 302 147 135 79 49 --133 --
NM_152522chr22947 817 2771 734 --193
NM_152538chr321676 1173 1736 31140 377 175 11794
NM_152556chr782242 1953 1928 884 846 743 540 349 12520 11749 189
NM_152581chrX31465 1417 948 1157 --1342
NM_152588chr1241321 516 323 144 21206 655 21777 1652 11501
NM_152594chr1551946 1642 859 574 477 ----22100 1767
NM_152622chr563332 2905 2465 1110 392 222 12775 23183 83 --
NM_152624chr5137309 6686 5640 2789 2447 2422 2360 1413 1240 1181 569 512 438 55404 5022 2815 1838 123 24689 1961 17261
NM_152629chr953570 1265 983 843 151 23178 362 11502 13790
NM_152632chrX1535 --195 --
NM_152641chr1272346 2231 2083 1949 1914 923 134 12882 --2666 66
NM_152666chr11735 1668 ----
NM_152678chr342070 1005 957 426 12439 22421 216 --
NM_152682chr43549 465 149 11518 21526 1400 --
NM_152685chr53395 364 81 1326 ----
NM_152688chr6--1712 --1214
NM_152699chr383522 3287 2648 2585 943 759 349 328 43769 1427 1180 418 1964 --
NM_152721chr183193 149 80 1694 1104 --
NM_152727chr161250 ------
NM_152737chr662063 1861 624 581 393 162 1729 11580 --
NM_152756chr554330 4117 2984 2699 276 23995 1698 44129 3599 1555 1549 --
NM_152758chr852504 2315 577 294 232 21002 54 --1707
NM_152765chr882204 1953 1867 1614 1513 695 634 225 11707 172 1941
NM_152774chr782757 2537 2445 2432 2408 1808 409 21 --12048 1359
NM_152787chrX83713 3352 3319 3052 1210 1049 230 28 21367 429 13450 --
NM_152789chr751466 1299 1100 1093 323 ------
NM_152793chr775152 4562 4348 4315 3988 598 384 34804 3955 1613 11901 11166
NM_152826chr15126472 6347 6177 6094 5655 5125 5008 4416 4150 1845 1345 454 45336 5114 4198 537 46279 6269 5678 4248 --
NM_152829chr71331 177 ----
NM_152835chr182971 2849 2472 2138 1102 1053 706 385 41132 909 295 75 21800 984 12489
NM_152836chr831286 588 533 ------
NM_152837chr831286 588 533 ------
NM_152838chr2073338 3214 3097 2400 2378 1012 482 42483 2243 1334 381 11006 --
NM_152857chr641046 814 770 412 ------
NM_152858chr641046 814 770 412 ------
NM_152889chr31689 ------
NM_152896chr93793 325 109 ------
NM_152919chr1993533 3442 2964 2553 2537 1161 638 392 260 13606 ----
NM_152924chr15186702 6649 6599 6236 6067 5853 5740 4720 2756 2582 2407 2118 1504 1329 1067 599 569 42 41750 479 453 363 86153 5123 5112 4502 2474 1819 1592 800 --
NM_152989chr1231780 1669 1340 --41623 734 281 226 --
NM_152995chr42348 61 1793 2639 217 --
NM_152999chr7165007 4731 4400 4305 4299 4254 4115 4088 3748 3720 3678 1775 1735 1409 603 106 21470 392 14311 --
NM_153013chr54594 384 322 199 32312 443 428 ----
NM_153035chr1103072 2898 2744 2459 2178 1300 1005 986 709 559 22724 1066 1381 22948 875
NM_153182chr392482 2345 2249 2088 1233 1046 947 575 290 --53113 2772 2697 2160 870 --
NM_153183chrX2391 36 ----1354
NM_153184chr32160 39 --1612 --
NM_153188chr5125558 5341 4812 4793 4294 4174 3735 2216 1954 1104 899 776 23976 1351 12036 --
NM_153207chr1283828 2974 2503 1326 1196 1129 920 252 42957 950 773 653 --13547
NM_153208chr161882 1797 ----
NM_153235chr622198 1595 ----1357
NM_153256chr1011804 21847 46 2586 259 1580
NM_153261chr1641312 1085 597 525 21401 1345 ----
NM_153262chr163157 2986 2734 2509 2057 769 22875 2345 --42009 897 515 213
NM_153280chrX1167 ------
NM_153321chr172398 155 ----1735
NM_153322chr172398 155 ----1735
NM_153332chr872156 1074 785 248 178 69 33 32853 2600 2454 32539 2381 613 1796
NM_153343chr442437 2365 1921 553 42303 2077 2036 1826 --12379
NM_153347chr1172535 2341 1937 502 284 225 194 2452 151 --11923
NM_153354chr531000 887 318 ------
NM_153371chr1362135 2108 1930 1684 344 52 11544 ----
NM_153456chr13125545 5438 4783 4217 2126 2109 1755 1464 1264 971 578 385 25068 720 15163 36295 5011 1500
NM_153464chr192725 157 1844 ----
NM_153487chr6154557 3462 3307 3088 1905 1716 1635 1581 1527 1434 1196 1054 624 499 177 44134 3286 793 746 ----
NM_153605chr361628 1510 522 275 144 114 1478 --11069
NM_153607chr532103 1048 761 23018 1255 --22315 228
NM_153616chr1552173 1945 1915 1758 735 2331 200 ----
NM_153617chr1552173 1945 1915 1758 735 2331 200 ----
NM_153618chr1552173 1945 1915 1758 735 2331 200 ----
NM_153619chr1583411 3183 3153 2996 2602 1222 668 169 31438 894 568 ----
NM_153631chr781589 1520 1486 1477 1043 556 458 210 ------
NM_153632chr781589 1520 1486 1477 1043 556 458 210 ------
NM_153646chr1472397 1648 1039 995 883 816 495 42620 2311 721 581 2589 128 --
NM_153647chr1472397 1648 1039 995 883 816 495 42620 2311 721 581 2589 128 --
NM_153648chr1472397 1648 1039 995 883 816 495 42620 2311 721 581 2589 128 --
NM_153649chr162059 1837 789 685 355 88 --32308 1958 107 12227
NM_153687chr1241485 1392 1281 197 1600 ----
NM_153689chr232168 1909 222 12149 21957 1452 --
NM_153712chr273584 3548 3530 2724 2321 1158 69 43321 1276 748 226 13136 11296
NM_153713chr11201 ------
NM_153756chr161920 1679 1316 550 323 176 2783 338 --11251
NM_153810chr1093862 3831 1857 1658 1503 1216 1194 215 47 34598 4554 33 24198 1824 13871
NM_153816chr61112 1321 134 --
NM_153831chr81850 2960 139 ----
NM_170587chr81614 2674 195 1790 --
NM_170606chr751813 1171 670 521 201 21305 119 2538 421 --
NM_170665chr12143831 3715 3694 3622 3351 3176 3153 3135 2907 2868 1738 1626 479 82 13703 ----
NM_170674chr1521107 238 1547 1516 11245
NM_170675chr151783 1223 1192 1921
NM_170676chr151783 1223 1192 1921
NM_170677chr1521107 238 1547 1516 11245
NM_170679chr551236 1031 971 381 237 1943 --1428
NM_170709chr842161 958 921 487 11622 21494 55 --
NM_170731chr1142227 1947 925 733 22274 2023 --32790 2674 268
NM_170732chr1142227 1947 925 733 22274 2023 --32790 2674 268
NM_170733chr1142227 1947 925 733 22274 2023 --32790 2674 268
NM_170734chr1142227 1947 925 733 22274 2023 --32790 2674 268
NM_170735chr1142227 1947 925 733 22274 2023 --32790 2674 268
NM_170750chrX2910 762 ----2828 709
NM_171998chrX82063 2026 2004 1735 1706 886 791 192 1854 --146
NM_172037chr821225 524 1512 1540 11135
NM_172058chr831701 1637 569 --2706 384 11789
NM_172059chr831701 1637 569 --2706 384 11789
NM_172060chr831701 1637 569 --2706 384 11789
NM_172070chr211780 21979 585 1639 --
NM_172071chr1137057 7021 6854 5514 5489 5410 5384 5067 2554 1887 1661 642 530 24851 4740 25447 4692 35808 1180 837
NM_172103chr672598 1864 1757 1017 817 156 49 32681 2586 2087 1277 --
NM_172105chr672598 1864 1757 1017 817 156 49 32681 2586 2087 1277 --
NM_172127chr432041 1480 737 --1540 1670
NM_172128chr431997 1436 693 --1496 1626
NM_172159chr332038 2002 219 21614 174 --12100
NM_172160chr332038 2002 219 21614 174 --12100
NM_172193chr1451216 1130 1049 517 233 --21281 1166 2907 284
NM_172240chr1221024 512 ------
NM_172315chr1521107 238 1547 1516 11245
NM_172316chr1521107 238 1547 1516 11245
NM_172344chr231313 736 551 31593 1582 450 11801 --
NM_172373chr1321139 41 ------
NM_172387chr1881546 1436 648 493 400 130 116 77 --21336 351 11670
NM_172388chr1881593 1483 695 540 447 177 163 124 --21383 398 11717
NM_172389chr1881593 1483 695 540 447 177 163 124 --21383 398 11717
NM_173075chr431227 517 464 21335 37 ----
NM_173082chr621390 115 --21298 1282 21073 337
NM_173083chr111178 198 31156 520 262 --
NM_173087chr15--1508 ----
NM_173088chr15--1508 ----
NM_173089chr15--1508 ----
NM_173090chr15--1508 ----
NM_173156chr141750 1561 500 444 42221 1760 1365 332 --1433
NM_173157chr121535 ------
NM_173198chr972963 2354 2085 2004 1988 855 833 22228 447 ----
NM_173199chr91112 ------
NM_173200chr972963 2354 2085 2004 1988 855 833 22228 447 ----
NM_173201chr16------1242
NM_173214chr16168042 7600 6856 6291 6276 5984 5766 5371 2698 2194 2008 1808 1141 1064 630 49 43191 2662 1026 426 38296 7757 532 1233
NM_173362chr52656 229 2664 43 1565 --
NM_173463chr4154480 4445 4076 3093 2978 2943 1616 1393 1167 853 826 774 241 216 80 33459 1128 866 23519 959 23550 1346
NM_173468chr4165342 5179 5094 4863 4473 4267 4139 3908 1576 1533 1269 811 714 442 430 304 25673 978 25173 698 25048 4955
NM_173470chrX52830 2235 1071 607 44 1290 ----
NM_173473chr1052120 1987 703 324 104 1360 12711 11877
NM_173485chr203103 94 57 ------
NM_173494chrX2701 112 163 1906 --
NM_173495chrX22569 1886 --31695 525 388 12239
NM_173496chr1063029 2748 2722 2009 1923 279 12909 1579 --
NM_173500chr1531368 288 24 1426 ----
NM_173508chr121114 353 11264 1946 1932
NM_173510chr2242886 2778 1879 87 32732 1987 1165 11808 --
NM_173511chr293712 3649 3197 1184 1019 640 455 138 58 42794 2709 1286 806 23452 225 --
NM_173515chr61971 2936 129 ----
NM_173519chr862030 1685 1507 495 460 222 1377 22077 1607 1290
NM_173542chr12--1559 ----
NM_173552chr322447 1593 31897 485 77 11730 --
NM_173557chr18----2670 479 --
NM_173562chr662786 2706 2639 1237 1143 1070 42775 2265 524 235 12312 1419
NM_173576chr104753 656 407 396 12217 1382 1495
NM_173582chr11136089 5717 5478 4836 4365 3921 2506 2177 1449 647 520 177 70 24030 1559 24959 1699 1966
NM_173602chr1293777 2946 2862 2820 2306 1308 1266 1227 99 31061 853 37 12988 --
NM_173632chr19143180 3136 2411 2302 2217 2205 2105 972 861 724 488 302 292 229 ----165
NM_173642chr1148978 7956 7682 6490 3514 3246 3145 3086 2605 2465 2130 1947 1019 592 77777 7458 6266 6253 3030 1983 745 68007 7166 6141 2082 1658 917 21590 1250
NM_173644chr2041922 1611 1445 620 --21713 1701 --
NM_173648chr22900 282 --153 1353
NM_173683chr81652 21315 1145 1413 1293
NM_173694chrX32116 964 264 31641 747 517 --22293 2070
NM_173698chrX92040 1959 827 752 717 526 315 225 183 --11565 --
NM_173797chr52516 280 21163 338 2928 849 --
NM_173808chr1164407 4330 4157 3935 3512 3465 3377 3337 3239 3026 1561 1177 1152 685 239 40 44433 4223 3968 3331 --54476 4085 3606 3249 3190
NM_173829chr5126226 5871 5822 5507 5452 4825 4463 4373 3811 2377 2238 1004 21901 1778 26074 2260 12101
NM_174911chr853850 3367 2563 1234 1179 12852 43191 3133 3071 1261 --
NM_174921chr41333 ------
NM_175052chr52187 157 1833 2860 774 1630
NM_175056chr332073 1907 491 21551 1427 11726 --
NM_175061chr762108 1666 1542 850 828 388 2640 56 22136 358 --
NM_175605chr13--1225 ----
NM_175607chr341571 1295 420 187 1393 1113 1218
NM_175612chr341571 1295 420 187 1393 1113 1218
NM_175623chr12137576 6282 4781 2481 1694 1511 1003 836 755 524 279 259 53 56562 5416 1552 1519 1354 55950 5581 1993 1927 561 144
NM_175624chr12137671 6377 4876 2576 1789 1606 1098 931 850 619 374 354 148 56657 5511 1647 1614 1449 56045 5676 2088 2022 656 1139
NM_175625chr12137671 6377 4876 2576 1789 1606 1098 931 850 619 374 354 148 56657 5511 1647 1614 1449 56045 5676 2088 2022 656 1139
NM_175634chr81385 ----2981 244
NM_175635chr81385 ----2981 244
NM_175636chr81385 ----2981 244
NM_175736chr12105527 5052 4975 3072 2802 2485 779 476 233 66 26214 5438 26627 4914 --
NM_175854chr1342552 962 156 69 22029 1979 1689 --
NM_175859chrX71789 1523 1245 510 431 58 50 184 ----
NM_175861chr12135569 4865 4331 4078 3897 3692 2055 937 626 365 221 163 47 24498 927 12394 35495 5362 1969
NM_175873chr561450 1119 385 311 265 169 --1459 --
NM_175876chr192815 2774 2527 2398 2225 2066 1896 780 253 1110 32170 633 191 11949
NM_175907chr182680 363 42431 2291 1018 700 12110 --
NM_175910chr194920 778 610 526 32000 1980 1610 1359 --
NM_175920chr52748 171 1564 --1654
NM_176081chr10125977 5844 5654 5567 4915 4627 3802 2001 1863 639 425 64 15906 55833 5363 4772 4521 1235 55560 2288 2121 1660 534
NM_176083chr10125977 5844 5654 5567 4915 4627 3802 2001 1863 639 425 64 15906 55833 5363 4772 4521 1235 55560 2288 2121 1660 534
NM_176814chr731494 1391 590 21377 352 ----
NM_176824chr421175 174 --1926 --
NM_177401chr1911386 ----11812
NM_177424chr141533 596 503 378 11589 --1279
NM_177438chr1463543 3497 3115 1429 461 109 23003 2728 23512 3402 1843
NM_177452chr1432456 2061 802 11646 --12239
NM_177538chr296360 6229 5836 3564 2869 2418 2372 2118 1377 22645 316 --1912
NM_177553chr11--186 --1131
NM_177925chr1252999 2711 2627 2426 976 ----11119
NM_177947chrX61487 1434 1247 490 458 145 31385 357 197 1235 1564
NM_177948chrX61487 1434 1247 490 458 145 31385 357 197 1235 1564
NM_177949chrX--165 171 --
NM_177951chr14----1900 --
NM_177966chr361854 1355 1248 290 247 22 21823 31 ----
NM_177968chr232242 691 248 31795 340 37 ----
NM_177969chr2--1613 ----
NM_177990chr2021375 609 --1342 11644
NM_177995chr961822 1751 1570 1204 531 246 31830 201 134 11472 --
NM_177996chr2093454 3249 2610 2164 1349 1065 810 609 287 12087 ----
NM_178010chr1231780 1669 1340 --41623 734 281 226 --
NM_178011chr1043247 2671 2657 2392 22854 241 22828 2080 1866
NM_178012chr62405 330 ------
NM_178014chr6--1347 --1980
NM_178037chr12123465 3439 3348 3294 2960 2858 1394 1174 1156 1129 762 353 33082 2778 615 33065 2460 2326 13237
NM_178038chr12123465 3439 3348 3294 2960 2858 1394 1174 1156 1129 762 353 33082 2778 615 33065 2460 2326 13237
NM_178039chr12123100 3074 2983 2929 2595 2493 1108 1029 809 791 764 397 42717 2413 1223 250 22700 2095 12872
NM_178040chr12123100 3074 2983 2929 2595 2493 1108 1029 809 791 764 397 42717 2413 1223 250 22700 2095 12872
NM_178140chr552575 2387 2257 306 81 1524 --12004
NM_178151chrX187508 7240 6655 6375 5304 5268 4928 2994 2972 2836 2567 1920 1599 1559 1381 853 717 476 57760 7363 6947 5989 133 --21312 880
NM_178152chrX187508 7240 6655 6375 5304 5268 4928 2994 2972 2836 2567 1920 1599 1559 1381 853 717 476 57760 7363 6947 5989 133 --21312 880
NM_178153chrX187508 7240 6655 6375 5304 5268 4928 2994 2972 2836 2567 1920 1599 1559 1381 853 717 476 57760 7363 6947 5989 133 --21312 880
NM_178169chr121408 ------
NM_178190chr1--174 ----
NM_178191chr111172 11415 11351 --
NM_178234chr8----1246 --
NM_178313chr22547 513 11925 1267 1658
NM_178326chr231375 204 45 21566 62 ----
NM_178335chr3--124 ----
NM_178423chr741165 1120 383 175 1860 --11000
NM_178424chr53440 234 97 ------
NM_178425chr741165 1120 383 175 1860 --11000
NM_178439chr2--170 1488 137
NM_178496chr351269 1094 600 558 160 --21443 954 --
NM_178505chr1053071 2776 847 495 162 43091 2575 345 270 21118 952 --
NM_178509chr1774150 3370 3005 1667 1229 236 68 23887 3855 11205 1363
NM_178527chr1----1135 1466
NM_178539chr1271938 1689 728 694 155 105 42 11670 1495 11993
NM_178554chr3113378 2889 2850 2825 1456 1397 813 636 201 173 95 53285 2812 2777 2639 1161 43535 3180 2399 1233 --
NM_178566chr931574 1460 244 11304 1632 21705 1408
NM_178585chr463082 3063 2597 1290 1095 147 23156 1151 --2751 80
NM_178586chr1432023 716 434 11687 --12222
NM_178812chr811097 11483 --1599
NM_178815chr1082512 1913 1083 940 716 311 143 116 22705 1941 1149 --
NM_178818chr1631968 1560 920 1307 31935 901 198 --
NM_178823chr66979 358 268 242 143 110 1128 ----
NM_180989chr1362347 2162 1671 984 239 189 --32504 788 495 2967 161
NM_181332chrX31919 706 363 21746 1001 ----
NM_181349chr72613 96 33059 2648 682 --1537
NM_181356chr621038 267 ----1814
NM_181358chr1104045 3471 3161 1502 1202 1128 1053 444 308 97 34037 3819 322 1137 --
NM_181443chr2052689 1926 1763 1058 447 42327 858 802 314 ----
NM_181458chr211161 178 1545 1539
NM_181481chr18146437 6322 6283 4626 4276 2740 2279 2159 1896 1776 1464 1103 812 386 26186 601 46252 5646 1452 178 11501
NM_181482chr18156437 6322 6283 4626 4276 4259 2740 2279 2159 1896 1776 1464 1103 812 386 26186 601 46252 5646 1452 178 11501
NM_181483chr18146437 6322 6283 4626 4276 2740 2279 2159 1896 1776 1464 1103 812 386 26186 601 46252 5646 1452 178 11501
NM_181504chr594215 3503 2784 2609 1531 787 369 355 30 41649 896 424 56 13517 --
NM_181507chr1141206 420 266 85 1243 1469 --
NM_181508chr1141206 420 266 85 1243 1469 --
NM_181521chr16116749 6341 6109 5701 4638 2871 2723 2529 2122 742 261 35088 1001 609 46716 5682 4979 2131 11981
NM_181523chr594215 3503 2784 2609 1531 787 369 355 30 41649 896 424 56 13517 --
NM_181524chr594215 3503 2784 2609 1531 787 369 355 30 41649 896 424 56 13517 --
NM_181527chr202379 367 1328 ----
NM_181528chr203434 422 52 2383 45 ----
NM_181552chr71784 ------
NM_181656chr1751018 911 682 211 95 ------
NM_181659chr2033031 2731 161 1903 33365 2882 2416 --
NM_181659chr2033031 2731 161 1903 33365 2882 2416 --
NM_181672chrX61759 1750 1548 1274 382 251 --11701 11981
NM_181673chrX61759 1750 1548 1274 382 251 --11701 11981
NM_181674chr5137 ----1404
NM_181675chr5137 ----1404
NM_181676chr5137 ----1404
NM_181677chr5137 ----1404
NM_181678chr5137 ----1404
NM_181702chr8178 ------
NM_181705chr5145101 4836 4783 4643 4598 3576 3561 2198 2021 1827 1272 1257 1123 1098 44856 594 418 72 35010 4232 1665 43776 232 166 106
NM_181714chr631389 562 289 1234 2612 41 --
NM_181723chr852038 1654 1574 241 147 22080 530 21791 518 11692
NM_181773chr22------1262
NM_181780chr352138 1774 1488 764 32 1388 ----
NM_181782chr671988 1750 637 567 524 190 164 31711 221 71 ----
NM_181783chr12--31792 1267 79 --1435
NM_181787chr852848 428 137 100 37 21474 492 2843 455 23338 2787
NM_181836chr532061 1968 1724 22641 2452 11679 32468 963 73
NM_181838chr541535 1432 1057 52 ------
NM_181839chr851420 1050 378 208 61 133 --1965
NM_181847chr1231325 548 111 --31343 1269 311 1669
NM_181886chr431128 516 40 31219 352 163 21342 1185 --
NM_181887chr431128 516 40 31219 352 163 21342 1185 --
NM_181888chr431128 516 40 31219 352 163 21342 1185 --
NM_181889chr431128 516 40 31219 352 163 21342 1185 --
NM_181890chr431128 516 40 31219 352 163 21342 1185 --
NM_181891chr431128 516 40 31219 352 163 21342 1185 --
NM_181892chr431175 563 87 31266 399 210 21389 1232 --
NM_181893chr431128 516 40 31219 352 163 21342 1185 --
NM_181897chr362649 2333 771 763 517 423 2956 431 32428 1873 322 --
NM_182398chr14--1365 --1127
NM_182481chr214475 367 337 305 31146 834 230 ----
NM_182482chr214475 367 337 305 31146 834 230 ----
NM_182485chr433351 2285 1008 32351 1479 66 --1650
NM_182493chr1684037 3724 3529 932 770 689 537 41 25363 746 34546 3753 1685 14180
NM_182503chr695360 4355 2104 1945 1935 1474 1275 1239 894 55469 4066 3784 1383 385 21719 62 35102 971 869
NM_182515chr1961619 1251 1210 1023 573 238 65960 5588 4962 1590 1569 512 22371 158 32061 685 407
NM_182551chr272939 2705 1398 880 675 384 346 12298 13232 --
NM_182568chr17136 ------
NM_182606chr41105 3917 889 220 --1349
NM_182643chr872140 2049 2003 888 575 483 95 1269 3528 392 203 --
NM_182646chr433351 2285 1008 32351 1479 66 --1650
NM_182662chr42505 487 ------
NM_182697chr731458 427 287 11719 ----
NM_182700chr761878 1788 1424 1288 536 368 11415 11902 --
NM_182703chr1541502 917 241 218 31463 1233 88 31494 1410 95 --
NM_182715chr741296 899 803 204 ------
NM_182717chr1061297 1128 375 367 333 129 --1428 --
NM_182720chr1061297 1128 375 367 333 129 --1428 --
NM_182721chr1061297 1128 375 367 333 129 --1428 --
NM_182722chr1061297 1128 375 367 333 129 --1428 --
NM_182723chr1061297 1128 375 367 333 129 --1428 --
NM_182757chr643331 2320 288 104 23345 2439 11062 12428
NM_182758chr1543793 1498 1072 26 22802 1574 21350 817 43766 3730 1171 197
NM_182762chr796033 5076 4602 4446 4412 3894 2002 1675 787 1649 36180 1652 1539 36285 6017 5880
NM_182763chr142004 717 193 177 22782 967 --11971
NM_182789chr52443 261 31081 351 279 ----
NM_182853chr1061297 1128 375 367 333 129 --1428 --
NM_182896chr351657 1424 1359 1275 139 31468 565 382 --1587
NM_182898chr7156248 6085 5798 5516 4871 2416 2334 2292 1723 1293 1207 333 326 270 93 36128 4571 1047 35153 4400 1377 15785
NM_182899chr7156248 6085 5798 5516 4871 2416 2334 2292 1723 1293 1207 333 326 270 93 36128 4571 1047 35153 4400 1377 15785
NM_182907chr621645 135 1571 22103 164 1425
NM_182943chr331148 459 208 51196 443 265 143 80 126 --
NM_182944chr141280 ------
NM_182948chr152817 2597 2441 119 71 43131 2947 2926 2542 12513 --
NM_182964chr1162667 2334 2188 411 364 310 2884 74 12762 1278
NM_182975chr161052 855 826 769 433 111 2970 306 --1330
NM_182977chr52457 382 ----2199 127
NM_183004chr1463872 3720 2469 1200 647 338 1236 33549 1548 788 --
NM_183011chr1061297 1128 375 367 333 129 --1428 --
NM_183012chr1061297 1128 375 367 333 129 --1428 --
NM_183013chr1061297 1128 375 367 333 129 --1428 --
NM_183043chr1331017 813 43 --1686 1738
NM_183044chr1331017 813 43 --1686 1738
NM_183047chr201254 2793 106 1669 --
NM_183048chr201254 2793 106 1669 --
NM_183050chr652181 2037 889 812 218 42374 2297 2255 2069 --11628
NM_183075chr472935 2791 2557 1859 932 821 510 32522 2074 1060 ----
NM_183078chr673326 3301 3191 1544 822 297 99 21344 363 13117 12714
NM_183079chr2061489 1440 1383 1350 332 176 --11582 1157
NM_183227chr66566 556 418 383 117 26 1300 2496 448 11029
NM_183238chr1283162 2861 1561 997 985 949 864 798 1111 2626 468 2972 421
NM_183323chr52443 261 31081 351 279 ----
NM_183376chr1532415 2144 1711 32366 665 98 52280 2205 1796 384 122 22422 528
NM_183381chr31841 --2882 136 --
NM_183383chr31841 --2882 136 --
NM_183384chr31841 --2882 136 --
NM_183397chr20165079 4959 4766 4735 4698 4527 4128 3839 3472 3154 1939 1774 1699 1399 663 353 13712 --12024
NM_183398chr551223 918 886 555 420 21147 364 --2454 161
NM_183399chr551223 918 886 555 420 21147 364 --2454 161
NM_183400chr551223 918 886 555 420 21147 364 --2454 161
NM_183401chr551223 918 886 555 420 21147 364 --2454 161
NM_183422chr135878 869 856 405 43 2932 268 2899 719 --
NM_184231chr32527 137 ----2637 591
NM_194071chr754298 4215 3695 1487 91 11781 25440 912 2928 777
NM_194247chr224110 3586 33974 979 920 24223 4176 23706 2864
NM_194250chr22408 133 ------
NM_194282chr482969 2552 2468 2175 522 213 123 72 12492 1137 --
NM_194283chr5103944 3183 2554 1391 1049 968 546 187 57 44 --163 --
NM_194285chr1183187 3106 2263 1231 1122 900 820 334 1503 --170
NM_194286chr12145722 4580 4446 4114 3929 3835 3821 2346 2331 2147 1919 908 550 459 35991 5091 4538 24934 3962 --
NM_194291chr8112747 2734 2596 2547 2338 2060 2024 937 814 790 214 12258 42701 2344 2195 2110 1533
NM_194292chr141347 1205 1141 124 41769 1366 1252 437 1523 --
NM_194314chr185621 5245 5122 4333 4303 3900 1565 159 --2642 486 32110 1640 737
NM_194317chr272486 2315 1994 509 500 470 335 ------
NM_194318chr1382478 2338 2181 1688 1009 711 583 45 --32257 1659 427 --
NM_194328chr952895 2209 1225 662 68 22857 1026 ----
NM_194329chr952895 2209 1225 662 68 22857 1026 ----
NM_194330chr952895 2209 1225 662 68 22857 1026 ----
NM_194332chr952895 2209 1225 662 68 22857 1026 ----
NM_194356chr1251724 1678 791 400 385 12367 12127 --
NM_194434chr18155551 5295 4920 4598 4218 2092 2012 1473 1403 1105 930 673 538 379 193 44722 2066 1868 1380 2737 704 24009 1714
NM_194442chr131600 510 479 21777 267 11151 1603
NM_194463chrX41209 1171 481 435 3988 883 855 1111 --
NM_197941chr562306 2044 775 735 661 362 12249 22459 991 12354
NM_197970chr211352 ------
NM_198047chr22104 56 1583 1509 --
NM_198057chrX11262 11022 1918 --
NM_198066chr1473113 2827 2548 810 370 106 65 --23013 620 1113
NM_198081chr672972 2894 1000 666 580 463 308 32435 507 478 ----
NM_198086chr1452204 2178 2131 1873 620 21692 812 --12003
NM_198128chr1841488 786 726 316 22082 504 --1135
NM_198158chr352314 758 661 245 73 12841 3804 638 384 --
NM_198159chr352314 758 661 245 73 12841 3804 638 384 --
NM_198177chr352314 758 661 245 73 12841 3804 638 384 --
NM_198178chr352314 758 661 245 73 12841 3804 638 384 --
NM_198181chr1542210 1913 1057 896 42760 1927 827 575 --122
NM_198225chr1021823 376 11552 1521 --
NM_198240chr1221328 915 1433 1422 --
NM_198256chr282021 1591 1546 828 301 257 170 29 21877 195 ----
NM_198268chr1104045 3471 3161 1502 1202 1128 1053 444 308 97 34037 3819 322 1137 --
NM_198269chr1104045 3471 3161 1502 1202 1128 1053 444 308 97 34037 3819 322 1137 --
NM_198270chrX22797 1321 12280 1702 12765
NM_198273chr573151 2177 2131 1945 1230 754 46 42800 2725 379 145 1636 --
NM_198320chr12114256 4145 3982 3301 3212 1814 1751 888 585 100 38 22096 124 14623 --
NM_198376chr171314 ------
NM_198377chr171314 ------
NM_198378chr171314 ------
NM_198379chr171314 ------
NM_198380chr171314 ------
NM_198382chr171314 ------
NM_198383chr171314 ------
NM_198384chr171314 ------
NM_198385chr171314 ------
NM_198386chr171314 ------
NM_198387chr171314 ------
NM_198388chr171314 ------
NM_198391chr2051407 1204 459 451 307 11228 --2106 93
NM_198396chr171314 ----1354
NM_198401chr821291 352 1576 11080 --
NM_198465chrX52960 2368 2267 2243 762 22992 2564 12904 --
NM_198468chr683558 3288 3108 3036 1609 985 574 272 1797 23662 168 --
NM_198485chr352028 1839 1748 1680 595 22521 52 186 --
NM_198503chr172403 2034 839 829 628 152 47 2974 221 11858 1819
NM_198512chrX--1572 ----
NM_198531chr184888 567 287 156 2832 650 1661 1590
NM_198549chr152643 572 272 230 176 13000 ----
NM_198569chr652384 2164 1882 1795 266 --21761 213 --
NM_198584chr882339 2134 2081 1929 1898 1846 1076 648 22186 1986 ----
NM_198595chr484948 4754 4017 3989 950 341 261 127 13557 11633 --
NM_198715chr1196194 5433 5356 5011 4847 4818 4754 4689 4586 4035 2185 1855 1759 1435 637 363 330 241 103 15500 11620 13940
NM_198793chr343472 3227 717 481 34041 3506 2923 1977 11145
NM_198794chr1411060 1166 151 --
NM_198859chr374641 4630 4086 3346 1592 1358 1210 33561 1168 654 1540 11238
NM_198900chr12105527 5052 4975 3072 2802 2485 779 476 233 66 26214 5438 26627 4914 --
NM_198904chr551965 1785 1441 803 40 --1614 11464
NM_198935chr2053133 2348 2313 1017 770 22962 2747 --12192
NM_198956chr761878 1788 1424 1288 536 368 11415 11902 --
NM_198990chr773221 2977 2537 2518 2133 1226 35 22888 2385 --12021
NM_198991chr181833 ------
NM_198992chr1231327 93 54 ------
NM_199000chr72347 101 32084 799 203 --2671 382
NM_199003chr851351 1330 1203 1092 264 2178 115 ----
NM_199040chr1262998 2965 2808 2406 1161 905 --33206 2780 1073 1987
NM_199053chr43359 272 226 2896 814 1730 --
NM_199072chr793177 2901 2873 2767 2354 1976 663 139 31 32935 2799 1259 2995 403 --
NM_199132chr1992089 1726 1391 677 593 324 240 155 71 ------
NM_199188chr12123861 3703 3662 3638 3238 3052 2751 1010 1003 631 552 66 1589 21568 1274 21591 758
NM_199190chr12123861 3703 3662 3638 3238 3052 2751 1010 1003 631 552 66 1589 21568 1274 21591 758
NM_199244chr91968 ------
NM_199320chr492855 2657 2583 2209 1812 598 523 456 255 12181 11146 12746
NM_199320chr492855 2657 2583 2209 1812 598 523 456 255 12181 11146 12746
NM_199324chr483483 2622 2504 2276 1226 1028 141 55 23121 816 11506 --
NM_199327chr411095 ------
NM_199355chr1641148 620 199 182 31607 641 209 3706 394 291 11222
NM_199416chr11334 ------
NM_199421chr1464299 3693 3496 1209 501 319 1813 11474 11884
NM_199437chr1161842 720 548 499 382 59 22461 2341 1870 11831
NM_199438chr1161842 720 548 499 382 59 22461 2341 1870 11831
NM_199439chr1161842 720 548 499 382 59 22461 2341 1870 11831
NM_199454chr194498 4472 3643 3584 3367 1163 1029 565 317 13474 13634 14263
NM_199461chr10103642 3609 3330 2438 1404 1319 718 423 194 173 21430 140 21194 269 --
NM_199478chrX21556 293 11837 21893 630 1490
NM_199482chr231849 1623 771 22108 753 21821 1473 1691
NM_201263chr162092 1662 1553 1349 740 609 11700 22009 341 22111 334
NM_201266chr262726 2311 1152 1058 952 86 1454 --1717
NM_201267chr21610 ------
NM_201269chr131245 147 50 --11136 --
NM_201279chr262726 2311 1152 1058 952 86 1454 --1717
NM_201428chr1131496 1090 287 --1638 --
NM_201429chr1131496 1090 287 --1638 --
NM_201430chr1131422 1016 213 --1564 --
NM_201432chr17166446 5961 5539 5267 4750 4655 4423 4408 1710 1621 1118 672 337 280 264 107 66535 2423 1462 1282 719 228 --12491
NM_201433chr17166446 5961 5539 5267 4750 4655 4423 4408 1710 1621 1118 672 337 280 264 107 66535 2423 1462 1282 719 228 --12491
NM_201435chr122665 85 1223 1110 1569
NM_201444chr12----1205 --
NM_201445chr12----1205 --
NM_201554chr12----1205 --
NM_201559chr664754 4675 3931 3316 1866 641 23114 1347 ----
NM_201568chr141750 1561 500 444 42221 1760 1365 332 --1433
NM_201569chr141750 1561 500 444 42221 1760 1365 332 --1433
NM_201591chr431905 492 234 2513 368 ----
NM_201592chr431905 492 234 2513 368