TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-30d-5p
miRNA Sequence: UGUAAACAUCCCCGACUGGAAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000081chr121789 413 ----21285 379
NM_000216chrX63647 3543 2945 2714 900 246 ----12878
NM_000232chr431963 323 259 --1577 33232 722 31
NM_000259chr1546393 4460 617 581 21877 245 --1709
NM_000264chr972994 2789 2252 1355 606 532 439 12358 12845 11257
NM_000267chr1782897 2356 2207 2171 757 480 447 132 11340 --1978
NM_000314chr1043236 2910 2844 2785 1440 22704 654 11292
NM_000332chr697173 7114 5599 5536 5230 5186 2857 1921 974 11549 27030 6182 26256 1011
NM_000362chr2273197 2542 1267 1127 1000 977 160 --12405 13536
NM_000390chrX92830 2514 908 896 799 617 560 353 78 ------
NM_000555chrX87722 7558 6195 6045 5247 1590 383 158 45556 3124 1413 681 11503 1361
NM_000615chr113760 744 462 1202 --2881 728
NM_000618chr1296628 6539 6035 4891 4777 4651 4560 451 403 26193 4208 ----
NM_000618chr1296628 6539 6035 4891 4777 4651 4560 451 403 26193 4208 ----
NM_000809chr458967 8584 6264 2008 22 19098 43484 2520 696 406 26917 6224
NM_000875chr1556650 6558 5764 5696 2268 55898 5705 5635 2342 1043 15804 16867
NM_000899chr1273801 1373 1220 1195 1152 1103 488 14199 23898 59 2870 847
NM_000950chrX63177 3095 2984 2801 2504 2496 33569 3287 3239 13440 13604
NM_000963chr162301 1981 1812 590 405 303 --12502 1858
NM_001001323chr1273176 2816 2012 1153 1092 966 594 --13210 33014 739 718
NM_001001419chr564972 4611 4359 3971 1937 169 14012 35221 5087 790 13537
NM_001001420chr564972 4611 4359 3971 1937 169 14012 35221 5087 790 13537
NM_001001481chr833140 2747 951 ----3978 613 509
NM_001001664chr2103857 3813 2959 2739 1614 1374 972 653 616 166 1665 11604 23793 1561
NM_001001890chr2153615 3410 3317 3290 469 1562 43658 3371 2988 406 1962
NM_001001928chr2298279 7577 6647 6044 5417 3161 2628 989 586 ----22609 437
NM_001001971chr1051299 1137 1113 336 52 11352 31049 956 358 --
NM_001002257chr232878 2678 994 --11157 23111 2616
NM_001002860chr1443811 1784 1296 652 13007 44489 4142 469 147 --
NM_001003652chr1866572 5283 2741 2705 1768 282 21247 369 58725 8642 6344 3354 86 21509 352
NM_001003674chr18117010 6806 6319 5747 5253 5187 4563 1985 1836 1069 918 25999 789 1220 --
NM_001003675chr18117010 6806 6319 5747 5253 5187 4563 1985 1836 1069 918 25999 789 1220 --
NM_001003712chr1253804 3190 3161 1444 1201 23344 620 13493 34006 2853 854
NM_001003760chr653098 1369 696 399 371 1984 11283 --
NM_001004065chr963866 3467 3279 3010 1291 758 --11395 23334 981
NM_001004346chr41898 --31161 237 46 21246 334
NM_001005404chr1733805 3746 202 23632 1043 --24322 795
NM_001005473chr566623 5341 4327 1639 1320 1238 --32611 1922 302 21905 1582
NM_001007466chr674932 4766 4062 4050 3363 2014 1613 15090 44611 3352 1366 1346 24718 4565
NM_001008239chr1883314 3053 2984 2790 1332 959 578 102 ----1630
NM_001008539chr884530 4511 1998 1839 900 628 458 101 --24604 1598 14255
NM_001008925chr442974 2516 1294 750 --1448 23515 3190
NM_001010861chr12107 78 21001 97 --12559
NM_001010891chr596591 6046 4858 2096 1557 1492 1355 707 450 46349 6301 4497 2378 35825 4540 4312 --
NM_001011666chr766423 6329 2508 2369 839 715 14949 14225 25459 263
NM_001012393chr1133356 1522 148 --3913 153 141 --
NM_001012755chrX24834 3965 11902 24953 1921 24896 4659
NM_001013620chr1298502 8224 8185 7177 6801 3158 2825 2043 306 --48377 6495 5192 2172 21117 623
NM_001013699chr121357 ----2154 88
NM_001015508chr8------3784 717 530
NM_001017923chr1451644 1589 514 181 135 1394 --21350 1138
NM_001017930chrX----2948 350 31363 1251 1131
NM_001018067chr165280 4823 1829 1423 799 663 --13936 15188
NM_001018068chr165280 4823 1829 1423 799 663 --13936 15188
NM_001018069chr165280 4823 1829 1423 799 663 --13936 15188
NM_001018090chr153893 650 202 12835 --22287 469
NM_001018091chr1531003 760 312 12945 --22397 579
NM_001018102chr153893 650 202 12835 --22287 469
NM_001024647chr12147621 7504 7312 7259 7163 6377 6178 6167 5632 4748 1269 1145 1121 922 --1172 11093
NM_001024956chr11105820 5735 5712 4694 3730 2072 1950 1650 1616 871 15593 1361 11282
NM_001025076chr1074683 3805 3791 1278 1027 864 75 --45370 4897 2424 911 --
NM_001025077chr10146041 5163 5149 4737 4706 4616 4593 2636 2385 2222 1433 1083 1060 176 11106 36728 6255 2269 --
NM_001025079chr393876 3257 3090 2947 1643 1517 1272 1258 66 --1219 --
NM_001025108chr233012 596 158 21640 1297 --21325 1249
NM_001030055chr1444484 4434 3081 519 --24346 2871 11088
NM_001031679chr1233429 3375 3292 --13544 1198
NM_001031700chr42553 319 --22189 2133 1218
NM_001031732chr483398 3145 1325 1231 1046 650 320 27 ----170
NM_001031804chr1674411 3449 3423 2839 1656 1571 503 23247 1643 11612 --
NM_001031812chr512323 11814 11658 12009
NM_001032282chr81817 ----21328 335
NM_001033057chr31527 11984 11332 21826 1646
NM_001037132chr731949 1819 60 --21609 44 1378
NM_001037133chr731949 1819 60 --21609 44 1378
NM_001037164chr731898 592 85 ----21581 1252
NM_001037317chr12107 78 21001 97 --12559
NM_001037535chrX21485 1278 ----21529 265
NM_001037536chrX21485 1278 ----21529 265
NM_001037540chrX21485 1278 ----21529 265
NM_001039840chrX95650 5281 2416 2265 1872 1389 1213 287 147 31235 673 605 11760 11653
NM_001039937chr1353154 3082 2551 649 180 22903 1343 24065 1581 --
NM_001040142chr251933 1512 616 484 64 --31795 445 361 21939 42
NM_001040143chr251933 1512 616 484 64 --31795 445 361 21939 42
NM_001040152chr744321 1518 1433 530 14162 23662 3405 --
NM_001040159chr41165 11514 21502 1158 1547
NM_001040284chr1675929 5363 4380 2146 1533 763 581 --44334 2017 927 782 --
NM_001040402chr463244 1022 772 472 267 73 12835 32642 650 136 1901
NM_001040424chr2142940 1040 57 46 --22220 68 --
NM_001040429chr1363610 2766 2605 2335 1304 1253 12209 1403 11005
NM_001040441chr194906 4762 4446 3685 3620 3465 1117 577 422 ----23362 1570
NM_001042355chr1653986 1092 1069 212 143 15041 13909 13932
NM_001042357chr1041251 1198 128 120 147 1188 21411 72
NM_001042358chr1041251 1198 128 120 147 1188 21411 72
NM_001042360chr1041251 1198 128 120 147 1188 21411 72
NM_001042361chr1041282 1229 159 151 178 1219 21442 103
NM_001042363chr1041251 1198 128 120 147 1188 21411 72
NM_001042364chr1041282 1229 159 151 178 1219 21442 103
NM_001042365chr1041282 1229 159 151 178 1219 21442 103
NM_001042387chr1041282 1229 159 151 178 1219 21442 103
NM_001042389chr1041251 1198 128 120 147 1188 21411 72
NM_001042390chr1041251 1198 128 120 147 1188 21411 72
NM_001042392chr1041251 1198 128 120 147 1188 21411 72
NM_001042393chr1041282 1229 159 151 178 1219 21442 103
NM_001042395chr1041251 1198 128 120 147 1188 21411 72
NM_001042396chr1041282 1229 159 151 178 1219 21442 103
NM_001042397chr1041282 1229 159 151 178 1219 21442 103
NM_001042412chr1653986 1092 1069 212 143 15041 13909 13932
NM_001042481chr142937 828 1756 42172 378 302 41 12330
NM_001042492chr1782897 2356 2207 2171 757 480 447 132 11340 --1978
NM_001042555chr1244467 961 914 866 34056 1433 968 33387 3027 1064 126
NM_001042604chr32943 161 --11542 23382 1167
NM_001042749chrX21993 716 22027 1957 1164 2815 405
NM_001042750chrX21993 716 22027 1957 1164 2815 405
NM_001042751chrX21993 716 22027 1957 1164 2815 405
NM_001044722chr512323 11814 11658 12009
NM_001044723chr512323 11814 11658 12009
NM_001071775chr1311189 --1427 21807 196
NM_001099678chr365978 5528 5172 1616 853 186 1241 46404 4271 4121 1624 --
NM_001100108chr158340 7683 7641 5957 2335 28025 151 37619 6811 114 --
NM_001106chr3129311 9179 8195 8094 7819 6360 2649 1850 1706 1625 1488 348 27065 1595 13102 16116
NM_001167chrX86400 6337 2693 2603 2588 2508 1565 1306 26372 1652 14872 --
NM_001173chr1444484 4434 3081 519 --24346 2871 11088
NM_001198chr612080 22389 414 --22377 300
NM_001201chr463643 1185 609 540 305 46 33570 1586 637 1491 --
NM_001204chr2137782 7537 6663 6415 6162 6038 5136 4687 2422 2401 504 218 64 25021 522 27158 1087 --
NM_001237chr42327 318 11003 --11098
NM_001237chr42327 318 11003 --11098
NM_001241chr23944 600 111 1912 11514 1560
NM_001241chr23944 600 111 1912 11514 1560
NM_001259chr761788 1256 949 230 214 164 --31850 1325 1206 --
NM_001407chr31694 --1611 31190 1157 1121
NM_001455chr6114886 4527 4272 4258 3403 3008 1827 1338 611 393 363 1115 1660 11941
NM_001682chr1272890 2530 1145 867 806 680 308 --12924 32728 453 432
NM_001695chr881680 1466 1309 1233 575 261 241 39 21057 1038 --13253
NM_001709chr1142514 2270 582 556 2403 130 1840 1686
NM_001730chr1331376 581 179 --11298 21606 1456
NM_001730chr1331376 581 179 --11298 21606 1456
NM_001754chr2153615 3410 3317 3290 469 1562 43658 3371 2988 406 1962
NM_001755chr1622283 1684 1637 1512 21794 572
NM_001769chr126162 94 87 80 62 33 ------
NM_001777chr393876 3257 3090 2947 1643 1517 1272 1258 66 --1219 --
NM_001858chr675002 4783 3411 3208 3184 1713 417 13901 44141 2068 2052 1473 13698
NM_001938chr12586 543 1309 1240 11265
NM_001977chr421691 1160 --1170 1132
NM_002025chrX67421 6463 3041 2103 1163 112 --27902 6713 11916
NM_002092chr4104955 4935 4167 3779 3168 984 769 232 168 90 ----13696
NM_002126chr1733569 597 465 --21380 1256 22596 1423
NM_002137chr722107 1842 22211 873 --12255
NM_002158chr233786 3299 558 23220 2653 --13778
NM_002203chr583981 3918 3067 2891 1107 866 742 52 22709 276 23785 59 --
NM_002210chr231176 760 462 ----22901 639
NM_002214chr775698 4122 3745 899 690 605 213 14325 35637 4174 598 --
NM_002245chr11433 1448 --2555 128
NM_002270chr565709 5237 3969 1589 1445 995 11090 24935 1376 --
NM_002285chr233012 596 158 21640 1297 --21325 1249
NM_002310chr5136204 6053 4073 2574 2153 2066 2011 1473 1456 572 449 434 349 --16040 15913
NM_002336chr1254485 4365 3896 1143 996 14153 34804 3454 732 --
NM_002356chr652307 1939 1772 755 52 2856 554 1744 1963
NM_002481chr177917 7787 6929 5108 2738 2012 1907 ----26952 5623
NM_002526chr631617 1433 241 ----21449 335
NM_002545chr1133356 1522 148 --3913 153 141 --
NM_002581chr965147 4475 4239 3821 2061 335 --35367 3814 3642 13926
NM_002612chr72527 68 41766 1580 439 248 --1844
NM_002655chr864870 4004 3889 3872 521 195 --45274 4400 1775 953 --
NM_002657chr2023271 2419 21198 584 13925 2749 662
NM_002703chr431838 1358 1273 2674 311 11244 1123
NM_002709chr273043 2228 1268 959 534 402 372 12952 1515 --
NM_002716chr1183565 2798 2648 1474 1441 1055 774 435 1387 1985 --
NM_002737chr1756465 6246 2635 1907 1508 26635 2477 12202 11259
NM_002822chr1221323 219 11720 11391 11329
NM_002834chr1283962 3448 2723 2558 1556 726 278 88 13211 23853 3623 --
NM_002837chr1264397 3554 2936 1197 226 135 23753 1624 11362 --
NM_002874chr922447 2255 --42183 910 806 756 1705
NM_002886chr363877 1909 1755 1498 1276 1186 15065 1779 11882
NM_002892chr1451443 1398 1107 435 32 --21196 658 1669
NM_002942chr321216 426 11177 --11417
NM_002977chr2103399 3392 3258 2468 2146 1135 1084 1008 947 475 12980 --23344 27
NM_003034chr1268020 7270 2561 2486 1997 835 37164 2493 96 47318 6214 5624 3172 34983 1585 780
NM_003046chr884530 4511 1998 1839 900 628 458 101 --24604 1598 14255
NM_003112chr753010 2735 2209 306 240 1327 11269 2864 44
NM_003199chr1854979 4202 3923 3683 1353 11517 --35576 1107 491
NM_003274chr2152910 2205 1878 1131 477 --32173 1972 1087 --
NM_003298chr376132 5559 4399 1908 1529 1001 561 26240 1434 16035 14062
NM_003345chr161533 ----3553 507 59
NM_003412chr363055 2872 2408 973 902 538 12234 23021 780 13110
NM_003463chr673148 2204 2128 1297 959 543 439 --22855 942 2721 508
NM_003468chr251578 1480 1464 86 57 21268 547 23921 1562 1655
NM_003478chr1123093 87 --32211 857 837 1877
NM_003489chr2121092 218 --43439 2625 2483 551 13299
NM_003566chr1263469 2841 2785 2114 947 577 --33277 2330 686 --
NM_003574chr1844003 2194 1293 624 --165 15401
NM_003590chr221432 199 --12486 22896 935
NM_003603chr41482 2500 435 31532 539 414 1675
NM_003615chr373727 3352 3134 2996 2800 2581 596 1734 32955 1153 98 43262 2604 357 349
NM_003672chr161918 1891 1394 628 618 461 --2431 209 --
NM_003692chr971002 921 883 758 723 647 164 ----1370
NM_003716chr31933 --1116 2808 209
NM_003759chr4103350 3283 3021 2707 1480 1291 832 206 198 150 --1211 --
NM_003799chr1824483 4244 11289 34573 3930 3593 1347
NM_003842chr832317 1951 40 ----2982 772
NM_003887chr272297 2287 2008 1610 645 508 92 1763 1929 1318
NM_003958chr622574 1559 11566 23273 712 11517
NM_003966chr587082 6073 5930 5009 2582 2430 2375 1701 47531 6537 4735 3018 12326 --
NM_003994chr1273801 1373 1220 1195 1152 1103 488 14199 23898 59 2870 847
NM_004133chr822698 160 --11916 2224 145
NM_004136chr1551174 726 542 378 344 --22953 2369 12322
NM_004161chr241633 1285 589 328 1230 --1316
NM_004171chr11129396 8420 8316 7716 7471 7346 6964 2563 2307 1319 896 838 38949 7632 1630 26907 114 11568
NM_004232chr182178 141 23715 64 11386 1999
NM_004331chr862422 2398 2335 817 243 234 12657 --12357
NM_004338chr18117010 6806 6319 5747 5253 5187 4563 1985 1836 1069 918 25999 789 1220 --
NM_004384chr512323 11814 11658 12009
NM_004415chr63703 665 551 --2781 617 1726
NM_004432chr952399 1521 464 429 199 31511 487 436 11487 --
NM_004440chr621505 615 --2641 433 31453 798 469
NM_004458chrX42637 2601 2149 164 22657 1037 52615 2066 1768 1003 781 --
NM_004464chr484145 4120 2932 1506 1396 649 627 423 21492 851 21213 513 1533
NM_004537chr1221134 112 11435 41484 522 492 117 --
NM_004586chrX94977 4855 4497 3697 1907 1026 704 522 383 1415 ----
NM_004612chr963913 3805 3635 1896 902 721 13943 13683 14009
NM_004685chr1392835 2087 1897 1157 1004 730 711 579 280 ------
NM_004745chr896353 6116 5721 4851 4708 2117 1734 996 989 11089 26829 2698 14423
NM_004775chr1852389 2291 2281 1591 374 --21726 730 2881 136
NM_004796chr1441672 758 444 410 11679 21663 618 11582
NM_004834chr293181 2837 2621 2242 1148 1032 872 270 175 11004 1949 13135
NM_004842chr661767 1703 1559 1471 476 88 --11332 11546
NM_004866chr544483 3718 3558 3422 23274 748 --33437 1972 1596
NM_004904chr766423 6329 2508 2369 839 715 14949 14225 25459 263
NM_004956chr7104300 4216 3960 3435 1780 1466 744 570 331 94 --24413 360 --
NM_004985chr1234024 3443 3121 23645 1766 14252 14451
NM_004992chrX128543 7720 7198 7169 7023 6591 5291 3148 3016 2409 2396 2361 --36967 2734 1181 12060
NM_004992chrX128543 7720 7198 7169 7023 6591 5291 3148 3016 2409 2396 2361 --36967 2734 1181 12060
NM_005010chr731949 1819 60 --21609 44 1378
NM_005036chr2298279 7577 6647 6044 5417 3161 2628 989 586 ----22609 437
NM_005065chr1495199 2148 1787 1608 1487 1096 779 751 205 --14364 11428
NM_005121chr1753656 2809 2536 1175 1015 23792 521 --21536 772
NM_005171chr1221193 931 1357 1366 21095 835
NM_005207chr2243094 2844 569 176 --23228 379 23292 3181
NM_005233chr362529 2432 1956 891 522 358 --12493 --
NM_005238chr1133476 3281 2729 12708 23481 2561 32411 2294 712
NM_005339chr483281 3068 2781 1737 1469 1423 318 289 --11690 23310 957
NM_005359chr1895668 5367 5184 5088 2415 1766 1097 1071 512 15854 34021 1628 132 167
NM_005504chr12156649 5739 5108 4849 4790 4583 4324 4244 2461 2316 2236 1587 1550 380 322 ------
NM_005596chr956435 4111 4032 2426 1947 24728 1243 25656 480 --
NM_005655chr81817 ----21328 335
NM_005725chr131821 164 147 --2261 187 1724
NM_005738chr731898 592 85 ----21581 1252
NM_005746chr742040 539 151 110 --22614 48 1353
NM_005748chr12--11064 32998 668 632 11168
NM_005807chr1--2699 107 1216 1186
NM_005901chr1866572 5283 2741 2705 1768 282 21247 369 58725 8642 6344 3354 86 21509 352
NM_005903chr564972 4611 4359 3971 1937 169 14012 35221 5087 790 13537
NM_005935chr475241 4909 3513 3240 1819 951 499 ----13768
NM_005941chr814042 12772 23282 2782 11195
NM_006007chr984155 4142 3956 3641 1672 905 160 152 14084 --2760 322
NM_006037chr294762 4432 4157 4089 3980 3946 3849 907 426 14294 --13419
NM_006047chr203864 822 581 --22437 1135 33522 2908 154
NM_006089chrX41831 1533 1243 735 1305 11587 21875 1624
NM_006095chr4104381 4180 4142 3913 3701 1791 1356 735 597 339 23709 1762 54370 3772 3283 745 529 --
NM_006203chr545417 3889 797 321 24059 1451 54970 3692 3381 1886 1321 1358
NM_006206chr43598 385 109 12715 12225 1658
NM_006212chr184381 3849 3689 1917 1378 1318 1057 1019 --15032 1168
NM_006241chr371758 1717 1539 692 493 379 30 ----22413 575
NM_006252chr1137384 6662 6648 6214 5743 5380 4670 1598 1304 1231 1021 380 359 36677 5699 5659 25628 415 27511 6290
NM_006267chr221239 471 --1226 11444
NM_006275chr2072267 1788 992 940 892 823 482 --22400 361 21773 71
NM_006352chr172034 1817 1582 1547 1490 673 622 ----1837
NM_006364chr1431039 525 264 1885 21221 966 11059
NM_006393chr1064352 3475 3171 1678 1498 341 14186 14398 12984
NM_006544chr14105953 5584 4910 4849 1904 1837 1471 1434 886 690 --21890 1026 --
NM_006561chr1074683 3805 3791 1278 1027 864 75 --45370 4897 2424 911 --
NM_006572chr1743472 3010 1035 56 41349 621 516 83 21024 698 --
NM_006599chr1657512 6080 2914 2483 111 26604 1929 56711 6649 5477 2283 367 27194 1660
NM_006603chrX21993 716 22027 1957 1164 2815 405
NM_006609chr232059 870 154 22665 2186 21033 609 --
NM_006614chr363611 3593 3165 2983 1252 980 ----53336 2487 1227 858 332
NM_006626chr942589 2555 2285 2115 ----22711 2454
NM_006628chr1574416 3875 2943 1719 1618 1447 1211 1869 23759 1627 --
NM_006654chr1244467 961 914 866 34056 1433 968 33387 3027 1064 126
NM_006746chrX21485 1278 ----21529 265
NM_006750chr1677868 6371 2786 1007 270 254 149 16079 36343 6278 1511 17551
NM_006754chr72896 789 --2497 274 21185 291
NM_006766chr852223 2068 2058 2047 135 ----32494 824 383
NM_006805chr551545 1135 593 526 395 ----11475
NM_006838chr1231898 1254 127 --21816 1418 11856
NM_006912chr152497 2429 841 796 311 --122 2563 280
NM_006915chrX52448 2289 683 295 121 ----12553
NM_006918chr11105820 5735 5712 4694 3730 2072 1950 1650 1616 871 15593 1361 11282
NM_006920chr251801 1403 1366 774 317 21285 562 1434 2359 41
NM_006922chr24947 623 448 409 12127 --139
NM_006924chr1794146 4009 3951 3456 3231 1790 1025 304 213 --23572 338 --
NM_007006chr1693455 3109 2911 2705 2414 2371 1045 371 140 32953 2404 574 1199 --
NM_007007chr1284709 4689 4494 3134 1643 972 425 77 14366 34717 4190 1675 2469 361
NM_007038chr21105870 2219 1664 1638 1507 1375 1317 789 471 386 24986 2257 11044 --
NM_007107chr331551 470 221 --22136 151 1462
NM_007203chr963866 3467 3279 3010 1291 758 --11395 23334 981
NM_007249chr13119031 9009 8953 8357 8117 7657 3225 1211 1155 650 285 28693 3033 --37203 3553 3121
NM_007347chr152326 207 32056 125 45 23010 2043 --
NM_007358chr121739 391 --11632 21745 1467
NM_007373chr102514 250 --11833 21817 482
NM_012081chr563410 1460 1240 369 304 221 23079 2391 21425 649 22316 1404
NM_012141chr1353154 3082 2551 649 180 22903 1343 24065 1581 --
NM_012158chr134682 657 522 423 1274 1141 11828
NM_012431chr743233 3163 829 498 --42300 1418 1255 235 1956
NM_013255chr7128444 8025 7739 7610 5854 5426 2972 2184 2101 1720 913 313 1622 18190 26681 2461
NM_014021chr151361 430 333 248 117 --33289 2590 2350 32470 2242 602
NM_014043chr32299 220 11417 11534 11601
NM_014048chr1665276 5151 4437 3251 1855 598 24485 1598 --25122 4292
NM_014112chr874887 4674 3926 3367 2059 1376 958 1363 1718 23708 1623
NM_014141chr734930 3558 305 12094 1902 1485
NM_014155chr1167382 7333 7003 6452 5168 1167 35346 5257 2640 57270 6102 3013 1564 1021 --
NM_014372chr13594 306 224 --21740 1342 2629 492
NM_014415chr341392 1142 261 120 2624 98 1445 2293 67
NM_014445chr362033 1885 1732 1702 823 66 32079 1861 982 1775 --
NM_014458chr121298 309 ----21375 1315
NM_014494chr1672403 2364 2277 1600 1515 767 276 --2792 461 21559 753
NM_014548chr1551637 1575 1468 1364 358 --11684 1395
NM_014572chr1321576 1567 11613 --1280
NM_014606chr421212 1179 --11519 11185
NM_014607chr261874 1624 1328 437 326 154 --11462 1752
NM_014682chr832257 2101 816 --31781 1536 386 12067
NM_014701chr1553084 2727 1309 526 402 13410 53294 3100 2662 2175 355 --
NM_014702chr632702 1108 305 11189 2652 421 2455 73
NM_014721chr657061 6359 5109 2406 1500 17467 --11310
NM_014729chr842029 2021 2015 500 ----22211 355
NM_014739chr654128 3461 3217 446 342 --24172 1504 2407 112
NM_014755chr244071 1056 577 524 --11659 1611
NM_014774chr163196 3088 2130 800 440 135 --22976 2629 12231
NM_014803chr1052234 2122 1954 1893 826 --1940 11962
NM_014810chr163501 3378 971 747 650 511 ----13260
NM_014819chr562443 2330 1658 826 523 234 1165 --1362
NM_014820chr352015 1515 1350 113 41 21544 183 --1766
NM_014839chr122433 1874 ----22220 1624
NM_014873chr154770 4097 1700 1655 1573 21021 485 24646 835 1648
NM_014877chr17127529 6873 6634 6559 5714 5662 5093 1585 1080 1047 887 45 --11271 46818 6422 992 265
NM_014912chr1093370 2972 2963 2708 2677 2243 1238 620 351 13482 1871 --
NM_014923chr1342245 2209 650 355 --1677 11669
NM_014934chr1323470 214 1418 24016 3856 13828
NM_014946chr262846 1171 560 483 378 200 198 --12921
NM_014988chr412431 --31776 177 162 21923 389
NM_015009chr32329 278 ----2671 116
NM_015026chr1234393 1385 763 --34516 611 49 14043
NM_015071chr576494 6163 5019 4750 2446 1792 1012 ----3549 516 444
NM_015087chr1352431 2389 841 590 223 --11085 11908
NM_015097chr331897 775 279 ----32284 2143 790
NM_015115chr463244 1022 772 472 267 73 12835 32642 650 136 1901
NM_015137chr831004 136 74 1755 32424 2000 360 --
NM_015208chr1822580 455 --11221 12919
NM_015225chr952779 2323 2076 717 445 --3542 310 154 22946 1275
NM_015247chr1653986 1092 1069 212 143 15041 13909 13932
NM_015310chr8128069 5999 5637 5605 5574 5504 2548 2389 1872 1848 1706 1548 38096 6029 5368 48252 2133 1178 748 32381 2037 296
NM_015355chr1751593 1468 1388 1301 630 1683 11988 11744
NM_015387chr231940 132 105 ----2496 231
NM_015436chr442793 2335 1113 569 --1267 23334 3009
NM_015458chr8145195 5109 4755 4663 4563 3435 3287 1602 1301 1239 1206 1088 571 475 34818 3761 914 ----
NM_015509chr1241614 1332 292 156 ----2626 488
NM_015520chr3--12682 12030 22524 2344
NM_015532chr153893 650 202 12835 --22287 469
NM_015553chr684949 4212 3995 3548 3200 1056 1014 441 13259 23778 3769 24586 980
NM_015554chr1522905 215 --12320 22754 1824
NM_015605chr1041282 1229 159 151 178 1219 21442 103
NM_015626chr172957 762 --11166 11037
NM_015640chr165280 4823 1829 1423 799 663 --13936 15188
NM_015713chr843229 800 168 109 12829 --12442
NM_015879chr18147958 6689 6167 5676 3169 2542 2263 2205 2009 1918 1589 607 276 34 1444 --16733
NM_015886chr885323 4474 3836 3683 1692 1255 160 147 11712 ----
NM_015888chr163231 2831 994 697 391 103 --1978 --
NM_015906chr154810 3881 1480 811 28 23938 3163 14040 1213
NM_016023chr841943 1640 611 397 11391 12190 12116
NM_016076chr123046 485 --12504 33139 300 278
NM_016083chr663701 3444 659 482 219 148 1198 2942 462 --
NM_016206chr397890 6398 3178 2800 2380 1219 853 531 492 12702 38815 7866 205 16598
NM_016217chr683656 3387 3302 3235 2393 1086 644 507 22965 1392 ----
NM_016260chr297668 7212 7154 7080 6021 2809 1663 1359 865 15277 55930 5663 5062 559 238 --
NM_016322chr942681 1085 872 427 12721 --12283
NM_016377chr661767 1703 1559 1471 476 88 --11332 11546
NM_016422chr1173224 3097 2847 2669 2100 863 615 ----13048
NM_016613chr432689 553 319 --42756 2634 2189 2133 1218
NM_016620chr12405 211 --1359 21039 88
NM_016950chr41165 11514 21502 1158 1547
NM_017412chr831227 425 36 --11214 11080
NM_017420chr1463776 3567 2992 1418 765 747 --1403 11358
NM_017423chr411715 ----31796 228 192
NM_017447chr2143907 3616 3570 1302 ----23068 3045
NM_017551chr1042713 2633 2335 2313 ----22455 1922
NM_017599chr1251499 1469 433 92 54 --12094 1452
NM_017628chr475260 5242 5067 4027 3631 1941 956 23292 1082 1146 --
NM_017633chr683872 3110 2619 1533 1441 1353 1132 322 12388 23321 2985 13912
NM_017637chr9128290 7427 3569 2934 2835 2826 2544 1421 643 593 580 53 18370 39052 6138 2389 39070 2581 1691
NM_017650chr735753 2300 1176 14164 --35016 4297 2155
NM_017658chr1474684 4294 3538 3369 2978 1419 829 24155 4106 63747 1708 1562 1383 1314 671 24559 2869
NM_017709chr163399 1720 1688 1108 748 633 1641 23854 547 23954 1341
NM_017754chr624687 4594 ----23621 1420
NM_017824chr1032458 368 201 1821 22590 2238 12353
NM_017915chr124869 440 147 28 --11058 21145 1129
NM_017919chr933578 1528 1505 12157 25656 161 15300
NM_017925chr911526 ----21576 328
NM_018036chr1464179 3537 3070 1492 1399 205 13577 34102 3624 610 1805
NM_018155chr363288 2446 2341 2299 606 401 --42819 2504 2264 1269 23261 2968
NM_018211chr122198 2112 1108 21488 615 1763
NM_018257chr202981 327 12271 22528 2025 1194
NM_018293chr382682 2061 1850 889 507 296 243 78 32184 2118 389 12733 --
NM_018299chr833140 2747 951 ----3978 613 509
NM_018313chr372605 2572 2397 808 600 500 176 32690 471 424 --12346
NM_018362chr1163820 3668 3023 3002 2667 1446 --23748 1144 13567
NM_018374chr755032 4049 3703 3359 1785 1112 24014 1455 25049 4366
NM_018429chr571985 1138 1121 916 762 613 603 --12777 1263
NM_018440chr878387 7992 6545 1365 1242 840 778 28603 1072 ----
NM_018566chr174097 3287 1852 1792 1698 948 732 33955 3530 180 24049 1074 24680 3494
NM_018584chr11890 --1866 21122 450
NM_018638chr12105589 5560 5349 4321 4074 1649 1230 939 542 98 --35182 4802 1212 14587
NM_018650chr162200 2043 1821 1624 840 330 ----22181 620
NM_018945chr652426 1427 1149 933 373 12499 11264 2952 773
NM_018970chr71594 --12839 21161 1064
NM_018999chr1084755 4086 3756 3000 1910 1459 947 679 1232 13505 14473
NM_019001chr32943 161 --11542 23382 1167
NM_019022chr1842842 2693 961 168 12016 42264 2218 2086 1216 12035
NM_019072chr553767 815 182 168 39 --21695 1247 13978
NM_019091chr221143 1078 --11030 2869 186
NM_020116chr441332 593 353 64 193 --1455
NM_020245chr674838 4672 3968 3956 3269 1920 1519 14996 44517 3258 1272 1252 24624 4471
NM_020432chr711619 12049 1864 2685 121
NM_020440chr113150 1294 22712 175 22727 320
NM_020673chr2097490 7470 5462 4875 3101 3090 2742 1775 629 27652 5751 15239 37798 7567 5809
NM_020748chr1721373 675 12164 2374 32 1729
NM_020768chr552790 2760 2424 1086 235 1507 31187 444 240 12543
NM_020771chr651151 1093 1043 983 181 --11139 21481 1463
NM_020772chr17118389 7914 7658 7618 7475 6582 6100 5552 5544 2999 2820 --13129 26831 1936
NM_020774chr18106085 5376 5095 5066 4943 1640 1551 1340 647 554 --26121 5267 25716 1377
NM_020841chr1253804 3190 3161 1444 1201 23344 620 13493 34006 2853 854
NM_020921chr1463378 3313 3028 2635 2461 1108 ----13558
NM_020940chr1022503 708 --21167 765 22947 963
NM_020964chr1853878 1829 1656 1483 720 1843 138 21304 45
NM_021007chr251933 1512 616 484 64 --31795 445 361 21939 42
NM_021038chr3113141 2910 2827 2652 2353 2248 2157 1208 1099 518 427 1444 ----
NM_021069chr41482 2500 435 31532 539 414 1675
NM_021116chr757901 7036 3365 2796 850 --23565 2224 19064
NM_021255chr1474140 4055 4012 2732 1654 1598 763 --42723 1066 854 92 --
NM_021629chr344874 3544 1006 515 14420 12040 34512 1018 326
NM_021813chr685063 4866 3697 2244 2109 1983 795 777 24644 1789 --14463
NM_021814chr661499 1425 1198 1184 1127 502 ----11525
NM_021961chr11157134 6826 6381 6193 6133 5244 5104 4907 2526 2484 2160 1386 1278 1262 156 15441 --1883
NM_022080chr2092141 2103 2039 1973 1103 1087 420 297 131 31114 688 451 1952 1836
NM_022121chr62935 471 1974 1180 1761
NM_022133chr841390 1349 745 701 1132 11551 2505 497
NM_022456chr12147621 7504 7312 7259 7163 6377 6178 6167 5632 4748 1269 1145 1121 922 --1172 11093
NM_022459chr1345453 4643 3961 1029 16307 34934 2465 2392 16142
NM_022753chr122800 217 --22663 1829 22655 700
NM_022826chr221169 886 --144 2861 221
NM_022831chr121667 210 21834 375 21374 1276 1514
NM_022832chr432010 1829 1690 12400 41588 1012 771 343 --
NM_022841chr1532441 2210 118 --22463 2377 11834
NM_022843chr1331459 1119 1057 21513 259 1542 21353 139
NM_022845chr1622237 1638 1591 1466 21748 526
NM_022898chr1434617 4148 293 --24549 514 24479 1398
NM_022912chr232788 1064 716 12222 22441 1891 12584
NM_022918chr1152065 1841 1666 828 820 1870 21660 1548 --
NM_022977chrX42637 2601 2149 164 22657 1037 52615 2066 1768 1003 781 --
NM_023000chr1451443 1398 1107 435 32 --21196 658 1669
NM_023001chr1451443 1398 1107 435 32 --21196 658 1669
NM_023039chr51358 1154 269 36 1424
NM_023929chr832273 1780 359 11969 1879 22448 615
NM_024524chr362479 2078 1248 353 316 102 12282 32770 2719 573 1404
NM_024665chr321004 609 --23438 1200 31534 1435 538
NM_024692chr231330 1256 72 ----21806 1232
NM_024744chr272675 2622 2596 2152 1796 385 297 11026 --32660 834 498
NM_024817chr1555306 4512 4397 4145 185 23760 1688 11269 25088 4088
NM_024899chr183498 151 35 ----1265
NM_024915chr862642 2621 2373 2186 1074 933 11863 32762 2191 694 1649
NM_024947chr3109402 8061 8033 6838 6268 6022 5892 1817 1458 1383 22824 1312 46163 2550 1872 309 19579
NM_024949chr4104869 4723 4638 4337 3883 3675 1952 1811 1007 89 --11156 --
NM_024989chr2178085 6328 5761 5637 4979 2174 2104 1887 1861 1743 1621 1126 795 472 423 155 40 36392 6250 802 25170 2081 27776 5303
NM_025054chr863761 1367 1321 958 833 429 --33253 1112 34 11294
NM_025191chr173416 2854 2605 1353 1201 932 186 --12726 12629
NM_025222chr332887 2744 1065 --12781 22971 915
NM_030579chr1663638 3520 2954 2944 1063 1025 33080 2459 629 22662 1130 --
NM_030621chr1483741 3142 3085 1536 1401 1199 334 252 --33606 1414 965 --
NM_030627chr552709 2671 1527 1336 725 24091 3006 11267 22858 928
NM_030647chr786279 6164 5904 5406 4932 4866 3996 1781 ----1979
NM_030648chr455086 4086 4068 1569 62 --25452 3811 25438 798
NM_030806chr1118317 8282 8146 7782 2961 2484 2292 2226 1341 1215 628 --39416 8714 1106 --
NM_031243chr722107 1842 22211 873 --12255
NM_032047chr341879 846 412 159 22318 224 --31937 1622 1577
NM_032105chr178050 7920 7062 5241 2871 2145 2040 ----27085 5756
NM_032186chr12405 211 --1359 21039 88
NM_032189chr1344946 4810 4196 1992 ----11917
NM_032199chr1043421 2991 2740 735 --23138 570 43564 2733 790 674
NM_032208chr231265 991 903 23334 2612 1650 12960
NM_032217chr41904 --1975 21274 398
NM_032268chr1652977 2576 927 825 523 --1380 2367 305
NM_032373chr1075303 4648 4528 4445 4213 400 328 --24894 49 --
NM_032435chr132045 569 23 --12050 22385 2008
NM_032446chr593754 3496 3110 3052 1170 722 622 405 52 13874 33587 3579 2976 --
NM_032457chr463779 3704 3647 2920 2545 488 --22773 2502 --
NM_032682chr383610 3538 3119 2999 2273 2235 1355 247 11317 13470 11238
NM_032900chr1072609 2488 1469 931 461 306 46 --1466 1179
NM_032968chrX114067 3968 3539 3469 2879 1527 564 486 408 397 181 ------
NM_032969chrX114067 3968 3539 3469 2879 1527 564 486 408 397 181 ------
NM_032973chrY114059 3960 3535 3465 2874 1527 564 486 408 397 181 ------
NM_033020chr154810 3881 1480 811 28 23938 3163 14040 1213
NM_033143chr484476 4451 3263 1837 1727 980 958 754 21823 1182 21544 844 1864
NM_033181chr663701 3444 659 482 219 148 1198 2942 462 --
NM_033285chr854399 3703 3437 3084 257 --12819 13039
NM_033389chr17114513 4483 3921 3526 3195 1352 1073 992 865 211 40 --11496 13659
NM_033505chr296719 6662 5774 5421 5323 4767 1668 1113 703 1276 15885 --
NM_033656chr21115948 5816 5749 5563 5503 5052 1500 1385 1282 1198 1060 11316 11966 1425
NM_052917chr233039 778 438 --52273 1092 278 260 155 12262
NM_052937chr842675 2139 1948 975 --32406 2266 2244 1389
NM_053016chr967423 6696 5493 2631 1129 771 --15511 25420 1836
NM_054016chr161983 1666 1653 1240 190 60 21855 1768 --11733
NM_054016chr161983 1666 1653 1240 190 60 21855 1768 --11733
NM_054016chr161983 1666 1653 1240 190 60 21855 1768 --11733
NM_057749chr831368 1167 900 --21351 314 2483 220
NM_080821chr2021967 678 ----22328 843
NM_080836chr2064660 4077 3610 3262 703 162 --33707 3303 1767 13324
NM_080927chr362744 2695 2075 711 420 223 ----22720 702
NM_130809chr542702 2247 1030 939 --12142 1384
NM_130847chr11134808 4631 4394 4384 4353 4336 3840 2169 1331 1045 810 562 400 1242 15154 15319
NM_133370chr483398 3145 1325 1231 1046 650 320 27 ----170
NM_133433chr52656 271 ----2741 246
NM_133496chr193316 3274 2906 2831 1451 1402 555 543 316 --14103 --
NM_133646chr275416 4941 3651 3384 1343 1329 36 --21791 61 15098
NM_134265chr172957 762 --11166 11037
NM_138426chr772401 2375 1882 1704 974 747 414 --11002 1397
NM_138576chr1434617 4148 293 --24549 514 24479 1398
NM_138633chr661767 1703 1559 1471 476 88 --11332 11546
NM_138713chr1657512 6080 2914 2483 111 26604 1929 56711 6649 5477 2283 367 27194 1660
NM_138714chr1657512 6080 2914 2483 111 26604 1929 56711 6649 5477 2283 367 27194 1660
NM_138927chr213939 392 365 --1345 1337
NM_138959chr156645 6025 5705 5619 4429 24986 574 15133 22556 1791
NM_138970chr1441672 758 444 410 11679 21663 618 11582
NM_144571chr4106548 6541 4585 4376 2424 2281 1850 1188 802 738 --1128 --
NM_144578chr1495321 4710 4473 1670 1556 1395 1163 1037 290 --14864 11347
NM_144778chr1362457 638 632 364 274 251 ----12412
NM_144963chr831691 362 343 --12058 22713 296
NM_145055chr1883314 3053 2984 2790 1332 959 578 102 ----1630
NM_145307chr1044590 3581 1723 513 1528 11464 44083 3762 3575 3565
NM_145686chr293181 2837 2621 2242 1148 1032 872 270 175 11004 1949 13135
NM_145687chr293181 2837 2621 2242 1148 1032 872 270 175 11004 1949 13135
NM_145799chrX53033 1226 957 948 45 1174 12869 12438
NM_147150chr963866 3467 3279 3010 1291 758 --11395 23334 981
NM_147189chr821889 698 1533 --22188 263
NM_152261chr1252301 2058 680 261 99 --12024 11593
NM_152277chr582148 2080 2046 1995 1886 1767 1566 1499 ------
NM_152330chr142937 828 1756 42172 378 302 41 12330
NM_152409chr563492 2814 2420 2325 887 122 1828 32633 2586 635 --
NM_152424chrX34696 3399 95 11275 23512 1749 23555 3484
NM_152519chr221849 656 --41743 763 219 128 --
NM_152556chr742536 2136 872 131 3855 123 100 11863 12031
NM_152594chr1522296 2271 12066 --21905 509
NM_152608chr122260 452 --11856 32087 829 32
NM_152622chr542934 2875 972 879 3946 615 67 33142 2546 2266 21354 459
NM_152624chr5117434 7174 6591 6228 5427 5052 2213 1795 1670 1268 1018 22715 166 --27198 138
NM_152699chr373403 2655 1514 1441 1400 911 181 ----12548
NM_152756chr584303 4105 3714 1175 1112 925 538 411 23681 561 12824 --
NM_152787chrX52932 2807 2491 648 378 --13042 11008
NM_152793chr754645 1993 1943 1479 294 ----22045 759
NM_152836chr841390 1349 745 701 1132 11551 2505 497
NM_152837chr841390 1349 745 701 1132 11551 2505 497
NM_152838chr203864 822 581 --22437 1135 33522 2908 154
NM_153188chr565709 5237 3969 1589 1445 995 11090 24935 1376 --
NM_153371chr1352371 1711 829 145 79 1225 1151 1810
NM_153690chr32575 344 ----3900 788 616
NM_170606chr741409 1396 618 280 --11450 11415
NM_170665chr1274521 4293 708 518 278 58 29 --11225 1633
NM_170731chr1142514 2270 582 556 2403 130 1840 1686
NM_170732chr1142514 2270 582 556 2403 130 1840 1686
NM_170733chr1142514 2270 582 556 2403 130 1840 1686
NM_170734chr1142514 2270 582 556 2403 130 1840 1686
NM_170735chr1142514 2270 582 556 2403 130 1840 1686
NM_172071chr1137359 7163 7090 6339 5050 2510 1286 1272 1061 847 785 654 341 11424 45656 4757 2082 2025 27273 1644
NM_173214chr1657512 6080 2914 2483 111 26604 1929 56711 6649 5477 2283 367 27194 1660
NM_173468chr475930 5144 5126 4693 2411 516 124 --11182 16074
NM_173470chrX12842 11031 1862 22818 146
NM_173510chr2232047 1936 1893 1245 12797 2707 435
NM_173576chr1011535 11695 11934 21619 841
NM_173631chr19--1235 --21324 862
NM_173642chr167965 6675 6327 2157 1872 779 27508 6727 48071 7621 7325 2590 --
NM_173698chrX52023 808 222 144 30 1649 41660 703 505 149 1465
NM_173851chr874011 3977 3751 2733 2525 1364 273 --1630 12786
NM_175623chr12147621 7504 7312 7259 7163 6377 6178 6167 5632 4748 1269 1145 1121 922 --1172 11093
NM_175624chr12147716 7599 7407 7354 7258 6472 6273 6262 5727 4843 1364 1240 1216 1017 --1267 11188
NM_175625chr12147716 7599 7407 7354 7258 6472 6273 6262 5727 4843 1364 1240 1216 1017 --1267 11188
NM_175861chr1255838 4415 700 330 264 --45410 4643 4116 1936 11525
NM_175884chr7------31419 1327 91
NM_177438chr1483741 3142 3085 1536 1401 1199 334 252 --33606 1414 965 --
NM_178011chr1043195 2844 2289 1036 --12835 11293
NM_178151chrX87722 7558 6195 6045 5247 1590 383 158 45556 3124 1413 681 11503 1361
NM_178152chrX87722 7558 6195 6045 5247 1590 383 158 45556 3124 1413 681 11503 1361
NM_178153chrX87722 7558 6195 6045 5247 1590 383 158 45556 3124 1413 681 11503 1361
NM_178313chr251672 1592 1397 407 146 --1205 1131
NM_178498chr1163932 3516 3427 3024 2497 1038 21576 1485 --13596
NM_178812chr851625 1594 1356 1245 543 1569 163 31576 294 33
NM_178815chr1041871 600 287 90 22638 863 31900 637 250 --
NM_180989chr133745 738 648 --1554 12036
NM_181351chr113760 744 462 1202 --2881 728
NM_181354chr841281 371 155 62 ----11581
NM_181358chr194186 4168 4054 3775 1028 697 680 480 206 11663 1544 1486
NM_181481chr18117010 6806 6319 5747 5253 5187 4563 1985 1836 1069 918 25999 789 1220 --
NM_181482chr18117010 6806 6319 5747 5253 5187 4563 1985 1836 1069 918 25999 789 1220 --
NM_181483chr18117010 6806 6319 5747 5253 5187 4563 1985 1836 1069 918 25999 789 1220 --
NM_181504chr553525 3413 3212 1550 625 --23346 1234 24000 2991
NM_181521chr1697289 6978 6971 5646 4849 4547 2797 1343 862 --16564 21801 1311
NM_181523chr553525 3413 3212 1550 625 --23346 1234 24000 2991
NM_181524chr553525 3413 3212 1550 625 --23346 1234 24000 2991
NM_181836chr522218 818 32314 663 579 --1263
NM_182485chr4103693 3613 3430 3420 3323 2960 2277 1390 863 24 --1744 --
NM_182503chr672022 1964 1369 1214 779 374 361 ----193
NM_182551chr232878 2678 994 --11157 23111 2616
NM_182646chr4103693 3613 3430 3420 3323 2960 2277 1390 863 24 --1744 --
NM_182715chr72896 789 --2497 274 21185 291
NM_182757chr653075 3045 2952 2380 1070 13412 11030 12553
NM_182762chr725129 387 14567 11278 26209 3832
NM_182898chr766423 6329 2508 2369 839 715 14949 14225 25459 263
NM_182899chr766423 6329 2508 2369 839 715 14949 14225 25459 263
NM_182907chr612080 22389 414 --22377 300
NM_183075chr422929 2117 12751 32803 1872 621 11925
NM_183078chr622480 1465 11472 23179 618 11423
NM_183393chr31933 --1116 2808 209
NM_183394chr31933 --1116 2808 209
NM_194247chr273917 3756 3671 1619 1389 1166 821 1210 1896 24426 640
NM_194259chr161533 ----3553 507 59
NM_194260chr161533 ----3553 507 59
NM_194261chr161533 ----3553 507 59
NM_194283chr52619 24 1687 1265 23910 3629
NM_194291chr892920 2430 2351 2206 934 903 415 312 188 --12854 --
NM_194314chr145051 4665 4322 1034 12212 24872 155 34066 3787 1420
NM_194356chr122950 886 ----22308 941
NM_194434chr1844003 2194 1293 624 --165 15401
NM_198066chr1412852 1627 21983 383 11046
NM_198215chr1051299 1137 1113 336 52 11352 31049 956 358 --
NM_198268chr194186 4168 4054 3775 1028 697 680 480 206 11663 1544 1486
NM_198269chr194186 4168 4054 3775 1028 697 680 480 206 11663 1544 1486
NM_198270chrX23254 390 23354 2393 23101 2651 32967 2935 542
NM_198273chr562468 2327 2197 326 290 240 12280 ----
NM_198281chr442863 2523 2423 996 1236 13150 1597
NM_198336chr761320 1202 730 655 646 381 11708 --1501
NM_198468chr663930 3221 1589 1212 871 100 34484 3517 638 1375 13364
NM_198581chr2127147 6823 4851 2519 2269 2234 1439 521 351 317 86 73 26076 1879 66040 2826 2544 2179 1260 751 11907
NM_198715chr196226 5325 4960 4917 1813 1328 634 599 577 --195 --
NM_198793chr393872 3253 3086 2943 1639 1513 1268 1254 62 --1215 --
NM_198889chr41904 --1975 21274 398
NM_198968chr1323470 214 1418 24016 3856 13828
NM_199324chr433195 316 219 1339 43643 3154 2751 383 --
NM_199436chr262846 1171 560 483 378 200 198 --12921
NM_199482chr231940 132 105 ----2496 231
NM_201269chr12405 211 --1359 21039 88
NM_201559chr6114886 4527 4272 4258 3403 3008 1827 1338 611 393 363 1115 1660 11941
NM_203394chr122916 803 32462 1668 520 --1572
NM_203459chr152440 2312 539 429 405 ----11615
NM_205768chr172034 1817 1582 1547 1490 673 622 ----1837
NM_206853chr664126 3843 2694 956 552 472 12996 1244 13953
NM_206854chr6105387 5104 3955 3264 1813 1733 833 763 510 385 14257 21505 437 15214
NM_206855chr6106352 6069 4920 4229 3919 1798 1728 1475 1350 587 25222 82 22470 1402 16179
NM_206876chr273043 2228 1268 959 534 402 372 12952 1515 --
NM_206909chr8128069 5999 5637 5605 5574 5504 2548 2389 1872 1848 1706 1548 38096 6029 5368 48252 2133 1178 748 32381 2037 296
NM_206933chr172864 2605 2201 1946 1889 1760 282 --1103 12650
NM_207015chr332100 1470 356 ----21755 34
NM_207292chr3113141 2910 2827 2652 2353 2248 2157 1208 1099 518 427 1444 ----
NM_207293chr3113141 2910 2827 2652 2353 2248 2157 1208 1099 518 427 1444 ----
NM_207294chr3113141 2910 2827 2652 2353 2248 2157 1208 1099 518 427 1444 ----
NM_207295chr3113141 2910 2827 2652 2353 2248 2157 1208 1099 518 427 1444 ----
NM_207296chr3113141 2910 2827 2652 2353 2248 2157 1208 1099 518 427 1444 ----
NM_207297chr3113166 2935 2852 2677 2378 2273 2182 1233 1124 543 452 1469 ----
NM_207303chr1021416 638 --11556 21481 323
NM_207304chr1362344 525 519 251 161 138 ----12299
NM_207361chr1356189 5288 3924 1859 1378 --44653 4626 474 402 2892 653
NM_207406chr4105950 4420 4392 3980 2547 1313 1230 832 605 161 22268 655 21569 1519 --
NM_207647chr9112413 2396 2037 893 816 706 509 307 249 99 22 --1558 --
NM_212460chr731898 592 85 ----21581 1252