TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-31-3p
miRNA Sequence: UGCUAUGCCAACAUAUUGCCAU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000024chr51103 ------
NM_000037chr832504 1017 717 --12293 --
NM_000067chr8--1514 ----
NM_000084chrX76621 6048 2767 2296 1888 1741 665 12067 16556 --
NM_000111chr72309 295 ----1150
NM_000115chr134998 907 261 185 22403 2242 ----
NM_000163chr532231 952 319 1395 1571 --
NM_000165chr6--11114 ----
NM_000168chr742088 1150 1001 570 --13189 --
NM_000176chr563042 844 627 504 445 416 ------
NM_000214chr202589 346 ------
NM_000217chr1254831 3999 3367 1306 412 24243 1386 15296 1447
NM_000248chr322102 1985 23000 2124 22048 1923 --
NM_000252chrX21294 558 ------
NM_000259chr1566048 4390 4051 2298 1141 593 1207 13895 --
NM_000264chr932441 2129 1049 12656 13169 --
NM_000332chr6106771 5395 4920 4677 4569 2709 1950 799 648 470 ------
NM_000411chr2132765 1105 566 33175 2235 955 ----
NM_000444chrX1343 1329 ----
NM_000447chr1161 ------
NM_000461chr354623 4576 1393 741 137 21237 762 13707 11440
NM_000462chr1511407 --11172 --
NM_000474chr71500 ------
NM_000489chrX22342 834 11374 22708 668 --
NM_000555chrX87433 6905 6802 5873 5318 2979 2172 1443 1933 12484 --
NM_000618chr1254694 3997 2135 326 315 25997 1448 11452 --
NM_000618chr1254694 3997 2135 326 315 25997 1448 11452 --
NM_000636chr62514 59 ------
NM_000663chr1632954 1108 506 12129 --12895
NM_000688chr31118 ------
NM_000722chr7----126 --
NM_000726chr2--31282 89 47 ----
NM_000793chr1454297 1601 1246 848 416 43306 1947 1678 1132 13225 --
NM_000801chr201124 ------
NM_000806chr511961 --1520 --
NM_000807chr42557 126 ----134
NM_000809chr438903 6600 708 23423 2923 --29111 8071
NM_000811chr52627 597 ------
NM_000813chr535240 4520 675 ----11804
NM_000814chr1532716 902 310 11073 ----
NM_000817chr21257 ------
NM_000842chr11----179 --
NM_000868chrX41646 1020 630 126 22129 647 ----
NM_000875chr1536807 2401 650 ----26089 662
NM_000944chr422409 857 12119 ----
NM_000959chr163815 3501 2941 2517 1577 488 13770 1356 --
NM_000983chr11116 --11139 --
NM_001001132chr2131483 1022 594 ------
NM_001001323chr1232415 560 268 --12759 --
NM_001001791chr10----11585 --
NM_001001852chr221673 ------
NM_001001971chr102310 255 ------
NM_001001995chrX11934 ------
NM_001002006chr21924 ------
NM_001002031chr12125 ------
NM_001002243chr2--1152 ----
NM_001002255chr61114 ------
NM_001002258chr211764 11944 ----
NM_001002860chr1444721 4507 2881 923 21645 158 ----
NM_001002909chr1711533 ------
NM_001003652chr1878009 7657 6975 3111 1724 958 372 27959 58 ----
NM_001003674chr1846653 5102 5072 731 37067 5272 1022 1914 11365
NM_001003675chr1846653 5102 5072 731 37067 5272 1022 1914 11365
NM_001003679chr122075 1728 ------
NM_001003712chr1243537 2903 1544 1333 ------
NM_001003800chr963723 3640 1504 995 705 456 23097 633 1493 --
NM_001004065chr92857 307 23090 411 ----
NM_001004317chr653875 3078 1672 333 62 23320 1394 ----
NM_001004419chr1231311 346 336 21670 229 ----
NM_001004722chr21826 ------
NM_001005375chrY21594 603 ------
NM_001005473chr556567 6553 5962 2605 523 25692 4845 ----
NM_001005476chr21619 ------
NM_001005746chr2--31282 89 47 ----
NM_001005747chr2--31282 89 47 ----
NM_001005753chr242167 2057 1564 206 --11470 --
NM_001005782chr21801 ------
NM_001006600chr552379 1785 726 385 276 1236 ----
NM_001006612chrX141 ------
NM_001006613chrX141 ------
NM_001006614chrX141 ------
NM_001007023chr1454297 1601 1246 848 416 43306 1947 1678 1132 13225 --
NM_001007024chr1724389 2825 ------
NM_001007025chr1724389 2825 ------
NM_001007067chr8--3732 417 387 1736 --
NM_001007068chr8--3732 417 387 1736 --
NM_001007069chr8--3732 417 387 1736 --
NM_001007070chr8--3732 417 387 1736 --
NM_001007466chr644833 4649 3654 2067 13724 ----
NM_001007468chr221270 ------
NM_001008393chr432395 2247 1966 --11806 1350
NM_001008564chr1311487 21864 33 1649 --
NM_001008738chr522871 2415 ----22136 139
NM_001008925chr432753 1191 364 ----13035
NM_001008938chr11161 ----1432
NM_001009554chr433253 1672 382 --11048 --
NM_001009554chr433253 1672 382 --11048 --
NM_001009899chr376504 5093 4691 1812 1296 819 207 26224 5303 ----
NM_001009909chr1133859 3707 3547 ------
NM_001009960chr762725 2467 2269 2206 696 114 1575 ----
NM_001010867chr166714 2561 2554 1562 1236 1081 --34132 1004 737 --
NM_001010888chrX84486 3559 3140 1853 1124 1082 1075 876 13730 14146 11339
NM_001011513chr454101 3458 1279 1104 959 13696 ----
NM_001011537chr311909 --1838 --
NM_001011551chrX137 ------
NM_001011663chr102720 142 ------
NM_001011666chr744243 2300 908 287 14973 --12597
NM_001011713chr1411588 11610 --1166
NM_001012398chr1641025 412 393 138 ------
NM_001012420chr151104 ------
NM_001012423chr151104 ------
NM_001012977chrX----1995 --
NM_001012989chrX182 ------
NM_001013399chr6123 ------
NM_001013642chr12959 857 --1883 1422
NM_001013674chr11122 --1311 --
NM_001013746chr721871 1851 ------
NM_001014380chr1355871 5659 5006 1135 963 12022 23942 3739 --
NM_001014797chr1066030 5095 2196 1775 1553 57 12486 1363 --
NM_001015877chrX41912 584 257 204 11224 ----
NM_001017371chr23950 476 194 1169 ----
NM_001017424chr1--11348 129 --
NM_001017425chr1--11348 129 --
NM_001017977chr11316 ------
NM_001018064chr91351 --11686 --
NM_001018067chr125079 3860 34204 3382 1975 1685 --
NM_001018068chr125079 3860 34204 3382 1975 1685 --
NM_001018069chr125079 3860 34204 3382 1975 1685 --
NM_001018074chr563042 844 627 504 445 416 ------
NM_001018075chr563042 844 627 504 445 416 ------
NM_001018076chr563042 844 627 504 445 416 ------
NM_001018077chr563042 844 627 504 445 416 ------
NM_001018088chr15--1140 ----
NM_001018676chr81491 ------
NM_001018677chr81491 ------
NM_001020658chr11248 11091 11237 --
NM_001020658chr11248 11091 11237 --
NM_001024024chr144375 218 209 33 ------
NM_001024070chr144371 214 205 29 ------
NM_001024071chr143343 186 177 ------
NM_001024094chr563042 844 627 504 445 416 ------
NM_001024218chr141113 ------
NM_001024660chr31658 ------
NM_001024847chr332039 360 346 ------
NM_001024956chr1121864 1062 21145 105 1276 --
NM_001025076chr1085633 5574 5394 5330 5221 4679 4505 2003 12373 ----
NM_001025077chr1086991 6932 6752 6688 6579 6037 5863 1362 ------
NM_001025079chr322681 77 11651 --23749 1008
NM_001025105chr5--11479 ----
NM_001025201chr2--1537 ----
NM_001025580chrX22960 1381 ------
NM_001025595chr41192 ------
NM_001025780chr911283 ------
NM_001029875chr532389 836 368 --1856 --
NM_001030007chr162873 348 --12903 --
NM_001030055chr1431874 1753 857 23523 1044 ----
NM_001031679chr1263143 994 417 397 281 200 13343 13221 --
NM_001031695chr2235227 5030 3394 35007 4946 89 1671 --
NM_001031710chr7144 2797 760 ----
NM_001031716chr22977 305 1155 ----
NM_001031732chr423292 2808 11373 --13551
NM_001031804chr1624035 2833 11067 --11072
NM_001032280chr611333 ------
NM_001032293chr173680 261 67 ------
NM_001032380chr1021818 104 ------
NM_001033057chr321961 593 ------
NM_001033557chr221111 85 --11376 --
NM_001033561chr17--1865 ----
NM_001033566chr171689 ------
NM_001033568chr171689 ------
NM_001033925chr1042129 1815 1770 1358 11631 ----
NM_001035chr1--1936 ----
NM_001037132chr7----1500 --
NM_001037133chr7----1500 --
NM_001037164chr71646 21730 824 1572 --
NM_001037332chr51714 3849 837 201 ----
NM_001037333chr51714 3849 837 201 ----
NM_001037954chr11--22460 884 33300 2172 322 --
NM_001039091chrX2446 346 ------
NM_001039538chr253679 3287 3196 1415 263 ------
NM_001039577chr121086 127 21652 117 23361 121 --
NM_001039585chr154072 3758 3198 2774 745 14027 1613 --
NM_001039590chrX23525 192 23672 383 1659 11576
NM_001039591chrX23525 192 23672 383 1659 11576
NM_001039649chr13------1317
NM_001039840chrX25897 1413 11130 ----
NM_001039937chr1323417 1161 13601 --11414
NM_001040147chr181616 126 ----
NM_001040284chr1645170 4855 4052 3843 11821 ----
NM_001040402chr412947 ------
NM_001040429chr1311261 ------
NM_001040441chr135150 3759 919 24884 3496 14228 --
NM_001040653chr3--2890 757 --12238
NM_001042404chr1----165 --
NM_001042413chr933664 3525 1337 11278 2486 403 --
NM_001042414chr13--1253 ----
NM_001042425chr611333 ------
NM_001042453chrX21701 644 ------
NM_001042475chr61326 ------
NM_001042481chr1432352 418 110 ------
NM_001042537chrX22392 129 --11630 1921
NM_001042555chr1211915 23824 3626 --34204 1828 1363
NM_001042599chr277237 7221 6340 6318 5705 5575 230 26878 6525 12110 --
NM_001042604chr354297 1904 1846 1487 892 23886 1234 1851 --
NM_001042683chr621432 52 ------
NM_001042762chr73824 152 59 ------
NM_001044305chr62653 299 ------
NM_001044385chr223732 1315 23858 3246 ----
NM_001049chr14--12053 11724 --
NM_001071775chr134552 348 276 143 ------
NM_001099678chr355061 4742 4611 2317 831 45448 4834 2010 1509 --11260
NM_001100108chr158116 6194 5868 1463 191 --17670 --
NM_001106chr3109556 7981 7935 7752 7058 6380 6344 3603 3050 878 17517 13785 --
NM_001117chr1821992 279 ------
NM_001121chr10--1482 ----
NM_001123chr102625 208 ------
NM_001128chr162873 348 --12903 --
NM_001130chr19--1118 ----
NM_001146chr821443 823 11923 ----
NM_001167chrX96153 5318 4970 4818 4785 4378 2299 720 679 55583 5414 5146 283 133 ----
NM_001173chr1431874 1753 857 23523 1044 ----
NM_001177chr1231790 1703 446 12124 ----
NM_001186chr2112790 23199 2702 13190 12391
NM_001195chr201114 ------
NM_001198chr622195 968 --1304 --
NM_001204chr245132 4964 4817 1033 15929 17277 --
NM_001222chr1061960 1759 1406 1246 1221 521 ------
NM_001260chr131246 ------
NM_001283chr71514 ------
NM_001284chr51133 ------
NM_001304chr1712454 23182 2401 11193 --
NM_001316chr201466 ------
NM_001346chr332659 2521 1754 22672 2375 --1730
NM_001378chr21204 ------
NM_001387chr532305 2127 286 1847 1201 --
NM_001390chr1852913 2439 2285 471 249 ------
NM_001396chr2122747 2503 12701 --12236
NM_001406chr1711456 ------
NM_001412chrX63120 3004 2502 1383 544 379 23474 917 ----
NM_001416chr171462 ------
NM_001418chr111182 ------
NM_001418chr111182 ------
NM_001431chr611157 11184 ----
NM_001438chr133452 3407 2549 ------
NM_001453chr6--1507 ----
NM_001463chr21794 ------
NM_001483chr71118 ------
NM_001494chr10----1493 --
NM_001497chr9----22628 795 --
NM_001498chr611079 1191 ----
NM_001514chr13461 391 56 ------
NM_001546chr621406 510 ------
NM_001554chr1--1225 ----
NM_001584chr111934 1487 --1838
NM_001609chr1033679 2753 1508 24020 714 ----
NM_001650chr1853696 2759 1532 500 371 --12581 --
NM_001656chr512056 157 21983 408 --
NM_001663chr1432537 1738 608 --12285 --
NM_001679chr31154 ------
NM_001689chr211764 11944 ----
NM_001693chr81272 ------
NM_001701chr941301 278 135 70 11071 11597 --
NM_001718chr611211 ------
NM_001730chr1311572 ------
NM_001730chr1311572 ------
NM_001742chr711743 ------
NM_001743chr21117 ------
NM_001745chr511155 ------
NM_001748chr121052 129 1307 ----
NM_001777chr322681 77 11651 --23749 1008
NM_001792chr181128 --1729 --
NM_001821chr154711 3254 1576 1180 483 34456 4150 44 ----
NM_001822chr2--1537 ----
NM_001830chrX53102 2494 1192 882 193 33955 2732 809 ----
NM_001873chr41237 ------
NM_001882chr51527 2476 214 --1416
NM_001892chr5--11479 ----
NM_001901chr61947 ------
NM_001903chr52764 158 ------
NM_001918chr198785 7547 5925 3671 2355 1579 1229 806 302 39234 6341 2249 18829 12668
NM_001939chrX43753 2711 2384 32 ----12695
NM_001969chr1453890 3072 2732 1206 1009 1220 ----
NM_002015chr1332080 1060 842 ----11166
NM_002017chr1121058 1027 ------
NM_002024chrX31559 812 403 1360 ----
NM_002027chr81491 ------
NM_002040chr2121089 672 --158 --
NM_002041chr15--1108 ----
NM_002063chrX1484 ------
NM_002077chr922030 751 ------
NM_002092chr444041 3462 3339 158 ------
NM_002114chr61183 ------
NM_002128chr1362228 1894 749 701 247 144 ------
NM_002129chr4----1128 --
NM_002146chr1721334 1076 ------
NM_002158chr222884 816 11267 --1713
NM_002166chr21516 ------
NM_002193chr21234 21522 1250 --11216
NM_002203chr513482 12584 ----
NM_002211chr102305 54 ------
NM_002214chr765234 4532 3940 1816 270 172 13990 ----
NM_002222chr311012 ------
NM_002252chr21120 ------
NM_002264chr3--15006 ----
NM_002270chr584488 4359 2089 1991 1234 1009 891 399 ------
NM_002279chr17------128
NM_002310chr51184 36594 6465 1724 ----
NM_002312chr131860 ------
NM_002351chrX31558 365 173 ------
NM_002356chr62730 640 --11828 --
NM_002374chr253679 3287 3196 1415 263 ------
NM_002376chr142448 68 ------
NM_002397chr52843 423 --12081 --
NM_002408chr14--1141 ----
NM_002448chr41756 ------
NM_002467chr8--1312 ----
NM_002482chr11675 ------
NM_002486chr931804 931 403 41952 1643 331 148 ----
NM_002494chr4135 ------
NM_002500chr221007 208 ------
NM_002519chr111954 --1251 --
NM_002520chr5--1241 ----
NM_002552chr231249 985 845 --1877 --
NM_002558chr17------1152
NM_002577chr333428 702 419 33481 3110 1015 ----
NM_002578chrX1334 ------
NM_002594chr2051606 814 773 592 198 12111 ----
NM_002595chr1221939 260 11864 ----
NM_002645chr113691 382 104 ------
NM_002706chr2----1659 --
NM_002717chr81145 ------
NM_002721chr9--1177 ----
NM_002733chr121179 ------
NM_002734chr1722182 488 ------
NM_002736chr7--12054 --1422
NM_002742chr141524 ------
NM_002755chr151817 ------
NM_002758chr171183 ------
NM_002765chrX2446 346 ------
NM_002822chr1231481 1178 243 11787 ----
NM_002834chr1243345 2834 2804 2492 13335 ----
NM_002837chr1223008 179 --11431 --
NM_002844chr631303 1018 916 1435 ----
NM_002847chr731476 1307 1042 ----1101
NM_002892chr1411063 ----11539
NM_002893chrX183 ------
NM_002902chr151576 1608 ----
NM_002906chr1142072 1842 1500 461 ------
NM_002938chr411932 ------
NM_002941chr31446 2543 375 ----
NM_002942chr3----11233 --
NM_002959chr153899 3200 2702 1780 28 1765 1359 --
NM_002968chr161948 125 --1817
NM_003013chr4--2757 624 ----
NM_003017chr651281 1109 937 539 385 ----11161
NM_003028chr933554 948 693 11485 23150 1209 --
NM_003034chr1277462 6671 4922 1446 697 590 99 31322 217 210 27535 6798 --
NM_003068chr84942 863 176 114 ------
NM_003073chr221270 ------
NM_003091chr201228 ------
NM_003107chr612288 ------
NM_003108chr211405 12421 25323 2425 17014
NM_003111chr23950 476 194 1169 ----
NM_003112chr743143 2691 883 757 22534 419 ----
NM_003115chr1--1348 ----
NM_003128chr21897 ------
NM_003145chr11157 ------
NM_003150chr1742310 2071 601 430 --21739 564 --
NM_003161chr1722356 961 13373 12551 --
NM_003199chr1845528 4629 4283 1648 1997 ----
NM_003201chr102711 642 ------
NM_003217chr12----12000 --
NM_003220chr611333 ------
NM_003242chr332039 360 346 ------
NM_003247chr611884 ----1569
NM_003253chr2121277 623 21237 299 ----
NM_003262chr324742 2096 183 34169 1823 392 --
NM_003269chr62840 392 ------
NM_003292chr122012 1883 11672 12099 --
NM_003304chr3--1138 ----
NM_003337chr521143 183 --11478 --
NM_003338chr102758 436 ------
NM_003340chr4135 1525 ----
NM_003352chr21801 ------
NM_003373chr1011627 ------
NM_003374chr5----147 --
NM_003392chr31270 13696 ----
NM_003403chr14----1626 --
NM_003404chr20------11951
NM_003406chr811423 ----1269
NM_003413chrX21501 1410 ------
NM_003416chr8144 ------
NM_003457chr173680 261 67 ------
NM_003468chr273940 3756 3450 2839 1372 1270 549 ------
NM_003473chr10--1727 ----
NM_003487chr17143 ------
NM_003566chr1232530 1001 347 --11348 --
NM_003574chr1844983 4381 3681 1835 24276 499 1891 --
NM_003590chr232729 782 48 ----13076
NM_003601chr4--1143 ----
NM_003628chr21619 ------
NM_003629chr132425 710 316 --1397 --
NM_003630chr61692 ------
NM_003657chr201799 ------
NM_003664chr5----1464 --
NM_003668chr121121 ------
NM_003670chr33230 205 123 ----1577
NM_003716chr31259 ------
NM_003722chr342338 360 231 207 22278 812 ----
NM_003750chr101322 --1655 --
NM_003758chr1541249 1113 1046 228 1274 ----
NM_003758chr1541249 1113 1046 228 1274 ----
NM_003759chr443978 1313 934 289 14206 ----
NM_003783chr1157 ------
NM_003784chr181616 126 ----
NM_003799chr1864399 2909 1157 744 624 397 2671 428 --14088
NM_003919chr7--149 ----
NM_003930chr712360 42484 1960 418 322 --1327
NM_003941chr712508 ----2636 402
NM_003980chr621490 1398 11460 ----
NM_004028chr1853696 2759 1532 500 371 --12581 --
NM_004056chr821081 263 ------
NM_004075chr121248 ------
NM_004080chr71542 11271 11275 --
NM_004081chrY21594 603 ------
NM_004094chr1432122 1881 1179 12365 ----
NM_004113chr321381 573 11577 ----
NM_004124chr1423564 1065 2638 174 --12373
NM_004136chr1533217 2795 862 2640 148 ----
NM_004161chr211629 ------
NM_004170chr94652 569 411 335 --1539 --
NM_004171chr1159391 8116 3416 2934 2189 49385 9369 6326 1275 ----
NM_004186chr31151 ----1707
NM_004229chrX1196 ------
NM_004241chr101224 ----1158
NM_004242chr61153 ------
NM_004272chr53667 578 253 ------
NM_004274chr1432419 964 524 12994 --11076
NM_004331chr822110 1638 ------
NM_004338chr1846653 5102 5072 731 37067 5272 1022 1914 11365
NM_004342chr721435 430 1858 11508 --
NM_004392chr1322042 477 --11826 --
NM_004432chr921950 1873 ------
NM_004437chr123438 85 --11299 --
NM_004447chr1211096 --1416 --
NM_004454chr372072 1914 1849 1829 1704 1630 604 1339 ----
NM_004457chr221261 362 ------
NM_004458chrX22093 563 --1185 --
NM_004482chr21321 ------
NM_004496chr1411183 1543 21127 32 --
NM_004498chr15----1305 --
NM_004500chr14--11505 --22001 1433
NM_004501chr143444 2557 1175 531 ------
NM_004520chr51664 ------
NM_004538chrX--1673 ----
NM_004586chrX43842 2024 1625 1226 34746 890 315 13642 --
NM_004593chr3------1640
NM_004622chr22541 177 --22431 406 --
NM_004655chr17----1343 --
NM_004663chr1531462 1375 35 1464 ----
NM_004664chr12--180 ----
NM_004673chr121428 1297 1589 11041 --
NM_004685chr1332161 1061 362 ----11910
NM_004709chrX--11482 --11367
NM_004719chr1212489 11103 1294 --
NM_004726chrX65714 5389 4989 4805 1391 829 14157 ----
NM_004734chr1343229 2916 2477 445 1421 12362 --
NM_004736chr11616 1268 ----
NM_004742chr331131 706 176 --1155 --
NM_004772chr51479 ------
NM_004775chr1812037 ------
NM_004776chr2012808 22343 2237 23151 1064 --
NM_004788chr111919 1226 ----
NM_004794chrX1126 ------
NM_004801chr2130 ------
NM_004855chr15--1159 ----
NM_004857chr1433009 1063 389 14067 14619 --
NM_004863chr1475281 5076 4799 4755 4657 4115 2122 --14351 11922
NM_004866chr574534 4242 4086 3502 596 130 105 --13336 --
NM_004871chr1724389 2825 ------
NM_004874chr81455 ------
NM_004891chr21228 ------
NM_004898chr432853 2692 973 12887 1216 --
NM_004902chr20129 ------
NM_004904chr744243 2300 908 287 14973 --12597
NM_004906chr6----1595 --
NM_004926chr142459 245 --11577 --
NM_004938chr9------1957
NM_004947chr312289 ------
NM_004976chr1173528 1541 1093 994 516 443 405 33183 1045 614 ----
NM_004985chr1254282 3535 1482 1048 965 33458 876 750 ----
NM_004992chrX107940 7897 5363 2650 2423 2321 1936 1910 1719 738 15599 28384 656 --
NM_004992chrX107940 7897 5363 2650 2423 2321 1936 1910 1719 738 15599 28384 656 --
NM_004993chr1421227 64 --11072 --
NM_005010chr7----1500 --
NM_005028chr10----1921 --
NM_005034chr8----174 1234
NM_005056chr1274003 3740 3682 3624 3566 1299 398 24123 3406 11176 --
NM_005067chr3----139 --
NM_005095chr1--1333 --11876
NM_005105chr141522 503 330 120 21587 1574 --1209
NM_005110chr5--1744 ----
NM_005116chr2064482 3736 3712 1755 1643 800 23349 927 13748 --
NM_005124chr64418 401 314 266 ------
NM_005126chr321873 1419 22256 804 11944 --
NM_005141chr41137 ------
NM_005154chr152449 87 ------
NM_005156chr955261 5254 4395 1916 1760 15367 ----
NM_005160chr2256453 5654 5208 2482 1766 12691 12355 --
NM_005171chr1221041 951 ------
NM_005176chr12125 ------
NM_005180chr102455 327 ----11164
NM_005188chr1137570 6902 6374 11927 1573 17054
NM_005190chr6123 ------
NM_005197chr1445596 4905 3928 1254 24888 1121 11224 --
NM_005201chr31159 ------
NM_005206chr1721281 136 ------
NM_005224chr191681 ------
NM_005229chrX183 ------
NM_005235chr277237 7221 6340 6318 5705 5575 230 26878 6525 12110 --
NM_005257chr1811040 --11281 --
NM_005264chr101790 --176 --
NM_005269chr121134 ------
NM_005284chr6--1352 ----
NM_005302chr7--1337 ----
NM_005316chr111737 --11006 --
NM_005324chr1711918 1656 --11484
NM_005339chr453610 2648 1638 1176 81 ------
NM_005359chr1846413 5696 2516 1207 25458 1533 1206 --
NM_005384chr91194 ------
NM_005388chr941295 1111 447 21 ------
NM_005410chr51702 ------
NM_005436chr1023621 1498 13316 --13171
NM_005445chr102303 120 ------
NM_005458chr922434 111 11779 11783 12076
NM_005465chr111937 2261 91 ----
NM_005504chr1246537 4831 838 701 25453 2110 24167 904 15578
NM_005509chr51261 1238 ----
NM_005544chr22698 672 ------
NM_005578chr353187 1904 1833 672 356 11393 14699 --
NM_005593chr121232 ------
NM_005596chr9115804 5590 4219 3991 1714 1705 1387 1379 1324 486 350 ------
NM_005607chr8----1377 --
NM_005625chr8--3732 417 387 1736 --
NM_005639chr1221633 1193 --1664 --
NM_005648chr8--182 --1152
NM_005662chr8--1402 ----
NM_005665chr114728 34133 1391 1321 ----
NM_005668chr533814 1806 1358 ----14584
NM_005711chr5--1320 11000 --
NM_005715chr642554 680 498 303 --2970 820 --
NM_005725chr122191 1683 1608 ----
NM_005738chr71646 21730 824 1572 --
NM_005739chr1532085 715 38 ------
NM_005765chrX2231 198 ------
NM_005786chr181837 ------
NM_005795chr212274 11966 --12310
NM_005813chr232156 1725 399 --1786 1972
NM_005822chr61632 11557 12367 --
NM_005832chr311411 1448 ----
NM_005840chrX97291 6290 2859 2832 2001 1961 1446 1039 59 26489 248 11109 --
NM_005845chr13------11343
NM_005851chr111371 ------
NM_005857chr1----1218 --
NM_005859chr511540 ------
NM_005871chr1011007 --1757 --
NM_005872chr11204 ------
NM_005880chr163458 433 142 1210 --11565
NM_005885chr51652 ------
NM_005899chr172469 111 ------
NM_005901chr1878009 7657 6975 3111 1724 958 372 27959 58 ----
NM_005902chr151765 33230 1546 1331 --13356
NM_005906chr611551 11294 ----
NM_005907chr61158 11134 1303 --
NM_005909chr543395 3083 2671 1647 ------
NM_005920chr1--12644 ----
NM_005935chr465110 4447 3843 3544 3525 1295 11109 ----
NM_005941chr832745 1482 770 23845 3058 ----
NM_005955chr124204 1401 14737 11446 11179
NM_005966chr221684 117 11832 ----
NM_005986chr131713 ------
NM_006007chr9114402 4087 3687 3256 1573 1528 1226 1078 976 956 437 --23016 79 --
NM_006047chr2031039 548 115 --11112 --
NM_006051chr5179 1282 ----
NM_006088chr91150 ------
NM_006095chr433508 3230 999 --13747 --
NM_006108chr11--11465 ----
NM_006135chr11155 ------
NM_006136chr711298 ------
NM_006145chr192985 936 ------
NM_006154chr1541848 777 340 39 ----1890
NM_006180chr91351 --11686 --
NM_006186chr21884 ------
NM_006203chr545545 4806 4579 3439 44064 1898 767 436 ----
NM_006211chr81105 ------
NM_006216chr2178 ------
NM_006226chr221365 511 --1475 --
NM_006237chr1321529 223 11541 1923 --
NM_006251chr532792 1302 1121 1220 ----
NM_006252chr167483 5547 3045 2606 1806 1046 37474 4830 1286 11857 15646
NM_006275chr2032246 2109 227 ------
NM_006277chr2--1204 ----
NM_006282chr2044633 3903 3488 1507 23852 1439 ----
NM_006291chr1422053 1590 ------
NM_006306chrX33894 3795 1737 15569 24051 3609 --
NM_006310chr171478 ------
NM_006323chr4--1592 ----
NM_006333chr21458 ------
NM_006357chr2169 ------
NM_006359chrX22392 129 --11630 1921
NM_006360chr11--153 ----
NM_006377chr911301 ------
NM_006379chr7--11630 ----
NM_006380chr171471 13789 ----
NM_006393chr1024334 2822 ----24191 2853
NM_006420chr2033017 371 364 ------
NM_006449chr221794 458 1362 ----
NM_006457chr454101 3458 1279 1104 959 13696 ----
NM_006460chr171387 ------
NM_006520chrX21148 526 1163 ----
NM_006526chr2021661 1645 ------
NM_006544chr1465462 4647 4318 2291 1266 849 14608 ----
NM_006559chr1--1864 ----
NM_006561chr1085633 5574 5394 5330 5221 4679 4505 2003 12373 ----
NM_006572chr1732970 1323 231 2800 425 ----
NM_006593chr21544 ------
NM_006599chr1698107 7937 6975 6968 5852 5420 3289 2611 709 16891 ----
NM_006609chr21281 ------
NM_006618chr121496 1371 11571 ----
NM_006625chr11316 --11189 --
NM_006625chr11316 --11189 --
NM_006625chr11316 --11189 --
NM_006626chr932520 2043 848 ------
NM_006629chr1892832 2637 2603 2222 2162 1924 1752 1085 388 ------
NM_006644chr13--153 ----
NM_006646chr1312595 32934 195 91 --196
NM_006654chr1211915 23824 3626 --34204 1828 1363
NM_006667chrX178 ------
NM_006670chr61201 ------
NM_006699chr1--11840 ----
NM_006717chr923187 270 --1350 --
NM_006721chr102625 208 ------
NM_006722chr322102 1985 23000 2124 22048 1923 --
NM_006754chr7--1349 ----
NM_006756chr811418 11066 ----
NM_006772chr611114 ------
NM_006775chr633007 819 416 ------
NM_006805chr5----11315 --
NM_006807chr172176 123 ----1395
NM_006808chr9170 ------
NM_006819chr111279 ------
NM_006836chr121525 ------
NM_006874chr411175 1379 ----
NM_006897chr121554 ------
NM_006914chr9126 ------
NM_006915chrX----1626 --
NM_006918chr1121864 1062 21145 105 1276 --
NM_006924chr1734095 3590 2982 ------
NM_006939chr141876 180 ----
NM_006948chr2142055 1623 1610 145 21509 922 ----
NM_006951chr10--1169 ----
NM_006988chr21--1235 ----
NM_006996chr131879 512 80 130 ----
NM_007005chr921506 470 ------
NM_007006chr1622906 2326 13402 --11080
NM_007007chr1254809 3231 1659 987 243 2769 608 --13974
NM_007010chr1711789 11543 11759 11822
NM_007011chr1566129 2507 2036 1728 1614 226 --25390 2344 --
NM_007017chr51104 --1600 --
NM_007034chr111016 ------
NM_007050chr2058068 6809 4960 2585 585 ----26030 2851
NM_007064chr31658 ------
NM_007078chr101457 --1177 --
NM_007084chr132127 53 ------
NM_007106chr1332475 2446 2247 2963 290 ----
NM_007125chrY21093 965 ------
NM_007139chr711128 ------
NM_007145chr1911208 ------
NM_007146chr17--1698 ----
NM_007150chrX31966 787 450 2850 546 ----
NM_007159chr321266 1214 ------
NM_007173chr1132088 555 239 32138 917 896 --11664
NM_007187chr1311004 ------
NM_007203chr92857 307 23090 411 ----
NM_007212chr142141 1646 310 40 ------
NM_007214chr6--11108 ----
NM_007236chr1521824 955 ----12412
NM_007249chr1379437 9069 7364 3127 3052 1713 746 28209 7971 11253 --
NM_007271chr641650 570 426 351 2442 117 ----
NM_007347chr1521257 909 1319 --1517
NM_007373chr1031267 309 147 ------
NM_012073chr51145 ------
NM_012081chr543472 2803 665 548 ------
NM_012082chr84652 322 288 224 ------
NM_012096chr321378 1178 ------
NM_012124chr111232 ------
NM_012129chr722115 1725 ------
NM_012141chr1323417 1161 13601 --11414
NM_012175chr11--195 ----
NM_012183chr11475 ------
NM_012197chr92639 542 ------
NM_012238chr1021647 1397 ------
NM_012249chr233307 471 258 --13137 --
NM_012250chr11--1939 11378 --
NM_012252chr734531 3639 171 --14208 15049
NM_012281chr7--1974 ----
NM_012287chr321094 161 11010 ----
NM_012290chr21159 --11579 --
NM_012297chr442490 1914 1668 946 11723 ----
NM_012300chr51659 12144 ----
NM_012307chr181360 --11072 --
NM_012316chr164708 4517 4003 3422 1558 1110 25543 5025 ----
NM_012319chr18142 ------
NM_012328chr731102 593 122 ------
NM_012334chr513924 ----13576
NM_012347chr652085 2075 1145 735 50 ----1440
NM_012395chr7--33315 674 266 --13443
NM_012428chr15--1829 ----
NM_012482chr11255 ------
NM_012486chr1161 ------
NM_013231chr1443707 3163 3057 1557 13614 13021 --
NM_013243chr154574 481 156 53 ------
NM_013269chr1231238 273 263 21597 156 ----
NM_013283chr52244 45 ------
NM_013296chr1--184 ----
NM_013354chr831093 1015 114 1552 ----
NM_013386chr12502 191 ------
NM_013423chrX1514 --2300 195 --
NM_013427chrX1514 --2300 195 --
NM_013438chr921284 610 ------
NM_013943chr141129 417 327 146 1927 12380 --
NM_013989chr1454297 1601 1246 848 416 43306 1947 1678 1132 13225 --
NM_013995chrX22396 1876 12286 --12221
NM_014000chr1011627 ------
NM_014011chr2--281 68 1521 --
NM_014016chr311441 --11087 --
NM_014023chr104979 742 574 138 ------
NM_014034chr6180 ------
NM_014048chr1665245 4806 3965 3204 1380 141 33499 3318 206 13451 14162
NM_014089chr1311487 21864 33 1649 --
NM_014106chr1521043 408 ----1134
NM_014109chr8----11247 --
NM_014112chr865406 5096 4710 4357 3617 920 24091 970 ----
NM_014141chr734729 1573 198 24530 931 14465 1639
NM_014154chr31576 --1135 1501
NM_014155chr1177305 7125 6982 6707 1681 1314 1299 16761 ----
NM_014157chr1631214 715 386 1572 23044 262 --
NM_014178chr14------1578
NM_014212chr121690 ------
NM_014217chr1--11348 129 --
NM_014253chrX2843 785 --1660 --
NM_014279chr91777 ------
NM_014289chrX11327 ------
NM_014294chr821161 1001 ------
NM_014296chr321650 586 --11054 --
NM_014300chr15137 ------
NM_014309chr2235217 5020 3384 34997 4936 79 1661 --
NM_014319chr1221663 770 --1408 --
NM_014331chr477522 6652 5014 2110 1835 1486 1353 ------
NM_014333chr112804 545 12100 ----
NM_014345chr61319 1973 ----
NM_014376chr51714 3849 837 201 ----
NM_014421chr4--162 ----
NM_014423chr545617 5461 5426 739 ------
NM_014445chr351784 661 595 417 334 11643 ----
NM_014447chr41192 ------
NM_014470chr12----1549 --
NM_014500chrX1196 --194 --
NM_014548chr15--11672 1403 --
NM_014562chr21707 ------
NM_014577chr22299 34 ------
NM_014612chr91356 ------
NM_014613chr5--13115 ----
NM_014615chr16136 ------
NM_014636chr964028 3997 3488 941 607 418 11345 ----
NM_014676chr11248 11091 11237 --
NM_014682chr8--1707 12071 --
NM_014701chr1562889 2524 2443 2243 1019 628 11008 ----
NM_014711chr1621951 814 11761 1378 --
NM_014729chr8--1403 11651 --
NM_014730chr1221908 840 14576 11099 --
NM_014730chr1221908 840 14576 11099 --
NM_014739chr624188 4113 12898 ----
NM_014743chr423030 2110 42672 2429 2262 1191 21165 971 --
NM_014747chr175781 2267 1995 1794 1734 230 75 --14491 --
NM_014751chr82630 117 ------
NM_014752chr112710 509 --1315 11538
NM_014755chr284079 4061 3856 3487 651 518 451 234 12898 ----
NM_014756chr11161 ----1432
NM_014765chr151716 357 298 276 268 --12472 --
NM_014781chr821278 1272 ------
NM_014810chr132808 1113 357 186 --1837
NM_014812chr1----165 --
NM_014822chr4------1475
NM_014832chr1331602 1280 247 ------
NM_014836chr1021818 104 ------
NM_014839chr11767 --1735 --
NM_014877chr1745749 2809 2463 1957 15157 --24859 2617
NM_014887chr131627 ------
NM_014892chr62165 79 ------
NM_014893chrY21475 621 ------
NM_014897chr1732911 2114 589 ------
NM_014899chr553116 2897 903 713 120 ------
NM_014906chr1723223 2638 --23322 1578 --
NM_014923chr1321699 927 21884 116 ----
NM_014926chr321125 753 --11146 --
NM_014962chr2032236 2014 1815 ------
NM_014969chr1186 1854 1858 --
NM_014982chr1455228 3731 3577 1515 787 21690 462 ----
NM_014991chr421017 970 12744 ----
NM_015018chr6176 ------
NM_015025chr232588 248 224 1527 ----
NM_015027chr16--1809 --11263
NM_015032chr1321176 887 32871 1150 709 1307 --
NM_015040chr211213 23254 796 --12117
NM_015045chr101706 11551 ----
NM_015054chr12131 ------
NM_015061chr9197 --1833 --
NM_015071chr556310 5534 2387 2371 976 24738 4708 ----
NM_015074chr144446 1424 627 582 --14909 --
NM_015076chr61406 13901 11730 --
NM_015090chr166245 5471 5043 4564 4463 1920 14158 ----
NM_015091chr141783 ------
NM_015093chr61710 --1462 --
NM_015094chr2234416 1382 1098 --13552 --
NM_015097chr311799 ------
NM_015115chr412947 ------
NM_015132chr7----21852 1300 --
NM_015143chr431371 1080 520 ------
NM_015147chr222253 938 --1687 13017
NM_015156chr1422864 406 13913 1382 --
NM_015161chr161186 --1167 --
NM_015170chr832106 1855 660 --21478 693 --
NM_015185chrX11851 12482 22613 1873 --
NM_015192chr2022645 2602 --133 1399
NM_015205chr1354980 4818 3918 2107 1456 15030 --1294
NM_015234chr621194 232 11058 11128 --
NM_015238chr51249 ------
NM_015252chr21629 ----1894
NM_015271chr444202 4067 2803 1188 ------
NM_015278chr642935 2473 887 740 13033 12142 --
NM_015288chr511467 23271 374 13778 --
NM_015294chr1711120 ------
NM_015310chr898210 6603 5196 2894 2604 2472 1600 1058 950 22446 2272 12385 --
NM_015314chr732418 1010 25 12211 ----
NM_015335chr1211616 12484 12545 --
NM_015336chr121695 1995 ----
NM_015339chr201397 ------
NM_015344chr822074 543 11362 --197
NM_015349chr612884 ------
NM_015358chr2111181 ------
NM_015365chrX22960 1381 ------
NM_015387chr231489 111 94 11728 ----
NM_015423chr11----1509 11665
NM_015446chr111682 ------
NM_015455chr533741 2932 1451 --13796 --
NM_015475chr2------1706
NM_015483chr71885 ------
NM_015496chr8--1283 ----
NM_015520chr332659 1979 1787 ----1129
NM_015560chr342748 2693 2540 618 22477 409 ----
NM_015569chr133674 3006 1089 33722 1861 283 1858 1247
NM_015570chr72389 137 --183 --
NM_015576chr332416 1154 566 --12098 --
NM_015578chr1921541 257 11665 21478 656 11827
NM_015640chr125079 3860 34204 3382 1975 1685 --
NM_015641chr771231 1184 1093 1017 951 235 32 ------
NM_015676chr141308 ------
NM_015832chr181172 ------
NM_015878chr83880 867 667 21880 508 ----
NM_015888chr142869 2084 1140 650 ------
NM_015891chr621694 648 21609 1414 ----
NM_015902chr82361 156 ------
NM_015906chr124554 1259 ----14011
NM_015912chr852178 2144 1793 377 220 ------
NM_015933chr3----194 --
NM_015975chrX21382 1190 11585 ----
NM_015995chr1525472 3488 --14355 1754
NM_016009chr174628 4346 3497 3219 3207 1409 155 14024 --11353
NM_016019chr71188 ------
NM_016021chr61415 12438 ----
NM_016023chr81532 --12165 --
NM_016025chr16----1416 --
NM_016072chr1242253 1538 805 661 --1130 --
NM_016073chr15196 ------
NM_016079chr242167 2057 1564 206 --11470 --
NM_016083chr62782 163 13824 ----
NM_016090chr11----1731 --
NM_016120chrX--1809 ----
NM_016131chr21202 1304 ----
NM_016132chr1553142 2194 1117 865 281 ------
NM_016195chr10142 1132 ----
NM_016206chr348613 1389 275 104 38513 6413 1005 1723 --
NM_016213chr15----130 --
NM_016220chr721871 1851 ------
NM_016248chr1343768 1597 1533 129 13744 ----
NM_016260chr264873 2111 1506 1485 1098 705 26348 610 --1907
NM_016275chr311887 2947 531 1228 --
NM_016281chr121803 ------
NM_016290chr5168 ------
NM_016303chrX141 ------
NM_016410chr91616 ------
NM_016505chr12528 92 ------
NM_016531chr431483 1097 1033 23437 701 12924 --
NM_016542chrX21701 644 ------
NM_016588chr63946 828 787 ------
NM_016603chr522089 1374 11489 --12053
NM_016655chr15--1108 ----
NM_016823chr1711151 ------
NM_016824chr10--1482 ----
NM_016830chr121495 ------
NM_016953chr256096 2072 375 246 152 2623 612 --13981
NM_017420chr1443292 3164 3144 784 ----13504
NM_017423chr411850 --1104 --
NM_017455chr15--1829 ----
NM_017481chr111178 ------
NM_017544chrX2751 120 ----1311
NM_017563chr356020 4804 4183 2113 431 --180 11395
NM_017596chr154608 3591 3171 1840 1677 --24167 3487 --
NM_017629chr111492 ------
NM_017632chr4164 ------
NM_017633chr643081 2920 659 340 13517 --13562
NM_017634chr811435 --11497 1291
NM_017635chr1111520 1395 ----
NM_017637chr966731 3356 2886 2719 948 65 --12967 1513
NM_017644chr325052 5005 --15145 --
NM_017645chr933064 2159 1969 12423 ----
NM_017650chr755838 4906 4406 1189 642 14842 --1420
NM_017657chr2--1152 ----
NM_017672chr15--1840 --1265
NM_017714chr201920 --1704 --
NM_017719chr332016 505 157 12124 22005 1886 --
NM_017742chr1811330 11547 ----
NM_017754chr624360 4231 54398 4036 598 442 335 ----
NM_017769chr1431287 301 151 11030 ----
NM_017770chr612323 22921 2645 --12079
NM_017778chr8----11054 --
NM_017780chr81112 ------
NM_017810chr161640 ------
NM_017813chr845542 2337 751 92 --14827 --
NM_017824chr1052142 2102 1768 958 248 12707 ----
NM_017831chr1833124 1148 964 11499 13269 --
NM_017845chr41292 ------
NM_017864chr81189 ------
NM_017902chr10105539 5410 5287 4678 4566 3558 1377 628 542 128 ------
NM_017915chr121829 ------
NM_017919chr934970 4018 1129 --21964 1271 --
NM_017944chr112368 331 12905 --1851
NM_017955chr1431208 839 493 ------
NM_017964chr21845 ------
NM_018027chr1013269 12972 12060 12400
NM_018078chr4--1989 ----
NM_018080chr15--1140 ----
NM_018084chr2--1495 ----
NM_018092chr161507 ------
NM_018098chr34887 452 358 36 ------
NM_018121chr1012111 ------
NM_018202chr11299 ------
NM_018214chr61471 ------
NM_018254chr12537 351 ------
NM_018257chr2041618 1597 221 198 ------
NM_018293chr3--1925 ----
NM_018307chr171689 ------
NM_018323chr4--162 ----
NM_018328chr2178 ------
NM_018351chr1253995 3933 1426 525 321 54587 1853 809 639 395 ----
NM_018364chr153521 2553 1530 692 449 13725 14093 --
NM_018374chr72515 308 --1748 --
NM_018383chr2--11963 11818 --
NM_018403chr3--24026 3274 ----
NM_018409chr433116 2649 2314 --12821 --
NM_018440chr887574 7327 6282 6059 3118 2754 1923 546 38008 6637 2959 ----
NM_018442chr11316 ------
NM_018445chr151165 ------
NM_018471chr2--1187 ----
NM_018477chr142820 232 ------
NM_018482chr842444 350 296 84 ------
NM_018489chr12940 77 1300 ----
NM_018509chr1741471 1459 1350 279 --11608 --
NM_018534chr2--1418 ----
NM_018566chr134580 3701 3345 --24359 1742 --
NM_018602chr1541442 1110 539 177 11298 ----
NM_018638chr1225048 2259 25200 1195 12071 --
NM_018650chr14468 442 297 142 ------
NM_018682chr71503 1593 ----
NM_018689chr1512611 ------
NM_018695chr552379 1785 726 385 276 1236 ----
NM_018708chr1931647 1376 1037 --1591 174
NM_018834chr5--1162 ----
NM_018843chr7134 ------
NM_018846chr7144 2797 760 ----
NM_018847chr91186 ----1519
NM_018945chr631288 1144 926 11317 --12917
NM_018948chr131155 1057 316 ------
NM_018976chr12----1687 --
NM_018993chr20--1500 11343 --
NM_018999chr1024506 733 11768 --14946
NM_019001chr354297 1904 1846 1487 892 23886 1234 1851 --
NM_019004chr732312 905 540 ------
NM_019022chr1822736 132 1524 1528 --
NM_019027chr432327 597 280 12287 11020 --
NM_019049chr11621 ------
NM_019072chr534259 1190 655 23595 254 2739 691 --
NM_019087chr531617 1190 316 1577 ----
NM_019098chr8130 ------
NM_019590chr10--1545 ----
NM_019593chr2022352 2136 ----1295
NM_019595chr2--1204 ----
NM_019600chr152666 62 1576 ----
NM_019605chr11247 ----1168
NM_019842chr6------128
NM_019903chr10--1482 ----
NM_020116chr4--11576 ----
NM_020135chr6--1283 1403 --
NM_020140chr12122 ------
NM_020144chr71154 ------
NM_020150chr1022136 1723 21382 823 ----
NM_020159chr42484 474 1134 ----
NM_020180chr18----1209 --
NM_020205chr122814 1158 ------
NM_020245chr654739 4555 3560 2046 1973 13630 ----
NM_020309chr1911116 ------
NM_020311chr21580 ------
NM_020341chr2011387 ------
NM_020342chr222164 1686 --1610 --
NM_020348chr1021864 199 --2433 260 --
NM_020357chr3----11239 --
NM_020390chr354455 4046 3830 3562 84 ------
NM_020420chrY21594 603 ------
NM_020463chr211399 ------
NM_020474chr181575 --11881 1208
NM_020478chr832504 1017 717 --12293 --
NM_020640chr32719 31 ------
NM_020644chr112722 317 ------
NM_020649chr17----162 --
NM_020682chr102898 251 177 --11022
NM_020686chr1632954 1108 506 12129 --12895
NM_020708chr202596 519 ------
NM_020731chr553176 3039 681 328 283 ----12098
NM_020734chr1232203 244 222 ------
NM_020748chr171141 ----11670
NM_020761chr17147 ------
NM_020772chr1768482 7984 7300 5372 1745 727 --18142 11313
NM_020774chr1876215 4555 4066 1381 1214 586 106 46232 5319 4098 946 ----
NM_020800chr321191 1183 1482 ----
NM_020801chr51518 11976 --12183
NM_020806chr141113 ------
NM_020810chr1443521 3224 3143 1068 1975 ----
NM_020830chr233126 2166 207 22793 2595 ----
NM_020841chr1243537 2903 1544 1333 ------
NM_020854chr1811335 ------
NM_020856chr191599 ------
NM_020870chr412032 1810 ----
NM_020871chrX32114 611 29 22056 345 ----
NM_020873chr3----1157 --
NM_020927chr16------12404
NM_020940chr1042535 1843 890 669 12299 ----
NM_020948chr111439 --11375 12683
NM_020951chr1932357 178 161 ------
NM_020962chr1521987 221 ------
NM_021032chr321381 573 11577 ----
NM_021033chr1321371 1298 --1240 --
NM_021101chr33926 686 173 2818 610 ----
NM_021136chr141205 ------
NM_021148chr711600 11732 ----
NM_021159chr4--11074 ----
NM_021619chr911139 ------
NM_021620chr61744 ------
NM_021647chr433253 1672 382 --11048 --
NM_021648chr632560 822 737 --2308 237 --
NM_021813chr624779 414 25160 2052 ----
NM_021911chr535240 4520 675 ----11804
NM_021912chr1532716 902 310 11073 ----
NM_021940chr62653 299 ------
NM_021961chr1124903 611 15207 ----
NM_021964chr376495 6141 6056 5144 2432 1648 1377 11566 35725 2214 385 --
NM_021970chr42607 538 ------
NM_021998chrX1167 1374 ----
NM_022048chr1554671 4023 2545 2363 2333 34114 1458 790 14081 --
NM_022068chr18--1582 ----
NM_022116chr73824 152 59 ------
NM_022118chr13--2469 424 ----
NM_022130chr511319 ------
NM_022340chr313023 --23538 2752 13312
NM_022373chr74741 650 337 220 ------
NM_022459chr1323942 1097 25924 1526 ----
NM_022461chr31164 ------
NM_022469chr121299 1106 12931 ----
NM_022473chr152731 654 23288 1376 --1248
NM_022474chr1452641 2292 2100 1014 203 ----2799 181
NM_022476chr1641025 412 393 138 ------
NM_022658chr1211183 ------
NM_022659chr82530 169 123 ----
NM_022739chr171859 ------
NM_022745chr172976 2854 2234 2138 636 593 338 31976 1135 836 ----
NM_022771chr122725 230 1383 ----
NM_022831chr131828 187 61 ------
NM_022832chr411000 --1496 --
NM_022841chr153489 406 362 --12348 --
NM_022842chr353215 2987 2107 1257 293 22230 1126 ----
NM_022894chr231383 404 49 11766 1643 --
NM_022900chr73854 339 232 ------
NM_022902chr5----1397 --
NM_022915chr21564 ------
NM_022918chr1131981 860 203 ------
NM_022977chrX22093 563 --1185 --
NM_023000chr1411063 ----11539
NM_023001chr1411063 ----11539
NM_023074chr193433 93 28 1913 ----
NM_023079chr17------21777 746
NM_023929chr822073 1914 1149 ----
NM_024015chr171996 ------
NM_024040chr101123 ------
NM_024090chr431652 1636 27 --1641 --
NM_024336chr16180 ------
NM_024496chr142243 151 ------
NM_024539chrX--11126 ----
NM_024545chr21184 ------
NM_024551chr1252032 1634 932 561 229 12123 21919 715 --
NM_024551chr1252032 1634 932 561 229 12123 21919 715 --
NM_024561chr1321143 1062 ------
NM_024581chr6129 ------
NM_024612chr171206 11123 11108 --
NM_024617chr9--1879 ----
NM_024632chr51176 ------
NM_024639chr642469 2241 2234 832 22719 1170 ----
NM_024640chr11785 ------
NM_024652chr1521074 768 ------
NM_024665chr3299 46 24379 1190 --13753
NM_024674chr11947 ------
NM_024686chr1--1548 ----
NM_024713chr1511457 ------
NM_024743chr42481 122 2994 530 ----
NM_024761chr934033 3619 3520 44046 3435 614 298 14814 --
NM_024948chr101585 ------
NM_024953chr121712 1362 --12785
NM_024989chr257941 5054 758 466 176 25990 1844 ----
NM_025073chr174696 3376 3204 1655 1478 1255 545 1347 14291 --
NM_025126chr121704 1620 1609 --
NM_025130chr101752 ------
NM_025133chr22990 892 ------
NM_025134chr1622386 2363 ------
NM_025138chr131322 ----1353
NM_025160chr131439 1160 634 24252 173 ----
NM_025187chr1621177 1115 1444 ----
NM_025191chr152573 1381 1240 1232 139 ------
NM_025212chr41124 ------
NM_025222chr392975 2953 2631 1975 954 384 287 123 30 ------
NM_030621chr142790 638 13985 ----
NM_030627chr531327 1319 223 13933 13063 --
NM_030648chr455025 1357 1170 949 364 ------
NM_030660chr1421227 64 --11072 --
NM_030674chr1265875 5783 5124 1940 1852 1524 22149 506 ----
NM_030806chr158789 8460 6663 3549 2187 39276 1095 106 --16504
NM_030816chr122331 510 ----13672
NM_030821chr4----1719 --
NM_030885chr312075 ------
NM_030918chr143406 1891 1512 1466 ----13818
NM_030939chr611049 --1756 --
NM_030964chr543620 3112 1196 1183 11403 ----
NM_031314chr14--11505 --22001 1433
NM_031372chr42307 149 ------
NM_031422chr18--1552 ----
NM_031442chrX--12656 ----
NM_031452chr15180 ------
NM_031844chr143444 2557 1175 531 ------
NM_031845chr253679 3287 3196 1415 263 ------
NM_031847chr253679 3287 3196 1415 263 ------
NM_031858chr172469 111 ------
NM_031862chr172469 111 ------
NM_031953chr41467 ------
NM_032116chr1355871 5659 5006 1135 963 12022 23942 3739 --
NM_032121chrX22507 2063 ------
NM_032128chr43938 911 895 --1985 --
NM_032154chr102720 142 ------
NM_032181chr2--1367 ----
NM_032189chr1354782 4620 3720 1909 1258 14832 --196
NM_032199chr1033668 2488 458 23848 3661 2912 35 --
NM_032217chr41445 ------
NM_032221chr2031735 526 257 ------
NM_032228chr1113514 ------
NM_032233chr141284 ------
NM_032256chr121304 --1260 --
NM_032288chr311909 --1838 --
NM_032321chr233017 1037 449 ------
NM_032352chr1411276 ------
NM_032434chr21331 ------
NM_032436chr132660 213 --280 63 --
NM_032439chr1011151 ------
NM_032440chr1032926 1878 792 12197 ----
NM_032458chrX52242 2204 914 587 534 ----1159
NM_032485chr201659 ------
NM_032505chr332350 2243 809 1816 ----
NM_032509chr81828 21626 211 ----
NM_032523chr2176 ------
NM_032560chr141845 ------
NM_032581chr721585 1459 11204 11906 --
NM_032598chr17--136 ----
NM_032663chr12--12064 ----
NM_032682chr313339 ------
NM_032784chr6----1158 --
NM_032786chr121519 --130 --
NM_032813chr13--1153 ----
NM_032859chr1333493 1270 867 33909 3888 723 ----
NM_032867chr11--1549 --1157
NM_032869chr811518 1746 1534 --
NM_032870chr61123 ------
NM_032932chr1755655 5384 5133 1831 899 1641 14141 15043
NM_032961chr431300 1119 142 ------
NM_032975chr1852913 2439 2285 471 249 ------
NM_032980chr1852913 2439 2285 471 249 ------
NM_033020chr124554 1259 ----14011
NM_033055chr111024 ------
NM_033081chr201267 11164 ----
NM_033087chr931200 491 340 1386 ----
NM_033138chr721435 430 1858 11508 --
NM_033139chr721435 430 1858 11508 --
NM_033140chr721435 430 1858 11508 --
NM_033157chr721435 430 1858 11508 --
NM_033181chr62782 163 13824 ----
NM_033211chr52658 616 12012 1247 --
NM_033224chr767728 5216 2927 2863 2380 668 17232 ----
NM_033227chr51586 --1513 --
NM_033228chr51626 --1553 --
NM_033253chr21924 ------
NM_033254chr31103 ------
NM_033260chr6----1802 --
NM_033326chr111753 12557 --12454
NM_033360chr1254403 3656 1603 1169 1086 33579 997 871 ----
NM_033396chr11--1311 ----
NM_033425chr11--22460 884 33300 2172 322 --
NM_033480chr652085 2075 1145 735 50 ----1440
NM_033481chr652085 2075 1145 735 50 ----1440
NM_033495chrX------11011
NM_033515chr61291 ------
NM_033644chr51659 12144 ----
NM_033645chr51659 12144 ----
NM_033656chr2111665 31632 326 258 22259 729 --
NM_052851chr131878 12173 --1342
NM_052855chr17------1120
NM_052879chr1242780 2763 783 366 ----11118
NM_052904chr621184 36 --1224 --
NM_052911chr183933 813 281 ------
NM_052918chr1033593 1390 150 ------
NM_052937chr822669 2367 22633 2041 ----
NM_052940chr1--1196 ----
NM_053016chr976732 5688 4840 2210 1418 1236 582 36175 2739 1497 ----
NM_053023chr1152918 2877 2450 1018 24 ----12550
NM_053053chr13974 939 94 ------
NM_057089chr71312 ------
NM_057749chr821247 524 2534 279 ----
NM_080617chr2011058 ------
NM_080650chr1541060 1041 993 806 ----160
NM_080664chr142262 24 ------
NM_080678chr23651 512 274 ------
NM_080743chr62599 402 21884 1590 --1312
NM_080759chr1322042 477 --11826 --
NM_080760chr1322042 477 --11826 --
NM_080867chr1413078 ------
NM_080872chr834030 3951 3678 ------
NM_080874chr4--2610 198 ----
NM_130395chr6--1283 1403 --
NM_130436chr2122747 2503 12701 --12236
NM_130438chr2123324 3080 23278 2061 1429 12813
NM_130446chr334219 3922 3041 13344 13935 --
NM_130469chr14--1939 ----
NM_130831chr342748 2693 2540 618 22477 409 ----
NM_130832chr342748 2693 2540 618 22477 409 ----
NM_130833chr342748 2693 2540 618 22477 409 ----
NM_130834chr342748 2693 2540 618 22477 409 ----
NM_130835chr342748 2693 2540 618 22477 409 ----
NM_130836chr342748 2693 2540 618 22477 409 ----
NM_130837chr342748 2693 2540 618 22477 409 ----
NM_130838chr1511407 --11172 --
NM_130839chr1511407 --11172 --
NM_133170chr2058068 6809 4960 2585 585 ----26030 2851
NM_133172chr5179 1282 ----
NM_133173chr5179 1282 ----
NM_133174chr5179 1282 ----
NM_133370chr423292 2808 11373 --13551
NM_133372chr522871 2415 ----22136 139
NM_133433chr51753 ------
NM_133445chr932980 1070 989 ------
NM_133493chr61166 --1159 13799
NM_133496chr132866 1088 633 ------
NM_133631chr31446 2543 375 ----
NM_138270chrX22342 834 11374 22708 668 --
NM_138333chr9------1367
NM_138335chr42261 242 2867 632 ----
NM_138360chr141305 ------
NM_138423chr151197 ----1348
NM_138426chr712497 1248 ----
NM_138443chr181181 ------
NM_138459chr643186 2636 1458 1067 --13245 12358
NM_138468chr274243 3861 2233 2192 1877 1812 1212 24399 4167 ----
NM_138494chr762725 2467 2269 2206 696 114 1575 ----
NM_138713chr1698107 7937 6975 6968 5852 5420 3289 2611 709 16891 ----
NM_138714chr1698107 7937 6975 6968 5852 5420 3289 2611 709 16891 ----
NM_138730chr61178 ------
NM_138735chr2130 ------
NM_138771chr7--21255 1147 ----
NM_138779chr131247 ------
NM_138811chr721146 891 1455 ----
NM_138933chr10----1136 --
NM_138959chr166130 5667 5484 5114 2340 2189 14856 ----
NM_139015chr12137 11069 ----
NM_139068chr51728 ------
NM_139069chr51728 ------
NM_139072chr21800 ------
NM_139078chr121121 ------
NM_139211chr41519 --192 --
NM_139212chr41519 --192 --
NM_139215chr17143 ------
NM_139276chr1742310 2071 601 430 --21739 564 --
NM_139283chr12--12515 1470 --
NM_139323chr20------11951
NM_144571chr466947 5207 5196 2610 1556 540 11692 --12057
NM_144578chr1444253 3998 198 164 --11147 --
NM_144596chr14--1176 ----
NM_144599chr1533838 1723 1320 15449 1149 11678
NM_144618chr1--1117 11347 --
NM_144664chr1142514 1921 1643 596 ------
NM_144665chr11--180 ----
NM_144710chr2------11507
NM_144721chr432677 1703 549 12180 ----
NM_144722chr51415 ----1219
NM_144778chr1342279 1770 338 298 11983 ----
NM_144949chr2--281 68 1521 --
NM_144963chr81774 --1576 --
NM_144973chr1235041 4107 825 11434 --23692 3294
NM_145176chr633123 890 713 --171 --
NM_145259chr266838 6118 6047 4677 167 36 ------
NM_145263chr41241 11632 ----
NM_145690chr811423 ----1269
NM_145739chr2176 ------
NM_145793chr101790 --176 --
NM_145805chr151599 ------
NM_145808chr732850 2668 830 1771 22640 500 --
NM_147150chr92857 307 23090 411 ----
NM_147175chrX21640 867 --159 --
NM_148174chr83880 867 667 21880 508 ----
NM_148894chr42958 355 ------
NM_152261chr1222011 452 ------
NM_152298chr11675 ------
NM_152300chr1711789 11543 11759 11822
NM_152330chr1432352 418 110 ------
NM_152352chr1842719 2513 2199 22 ------
NM_152388chr223732 1315 23858 3246 ----
NM_152424chrX34089 3372 772 1441 1627 --
NM_152433chr111525 ------
NM_152437chr1232338 949 273 ------
NM_152455chr1532739 2509 2398 --11800 --
NM_152556chr722488 1964 1214 ----
NM_152581chrX2410 210 ------
NM_152594chr1512207 ----1188
NM_152608chr122056 1724 ------
NM_152621chr4162 ------
NM_152622chr51129 12822 23050 71 --
NM_152625chr5156 ------
NM_152626chr711128 ------
NM_152629chr933664 3525 1337 11278 2486 403 --
NM_152667chr201540 21420 982 1237 --
NM_152688chr6144 --1233 --
NM_152692chrX137 ------
NM_152740chr71733 ------
NM_152745chr71917 ------
NM_152774chr722275 2210 21731 773 --11059
NM_152788chr12122 ------
NM_152829chr771231 1184 1093 1017 951 235 32 ------
NM_152838chr2031039 548 115 --11112 --
NM_152924chr1566129 2507 2036 1728 1614 226 --25390 2344 --
NM_152996chr111369 ------
NM_153188chr584488 4359 2089 1991 1234 1009 891 399 ------
NM_153223chr52245 139 11338 ----
NM_153235chr63823 499 182 22020 405 ----
NM_153252chrX------1400
NM_153332chr832987 2331 457 2957 226 ----
NM_153354chr51383 ------
NM_153362chr63776 401 165 ------
NM_153607chr511981 21961 1146 ----
NM_153619chr152407 232 12707 --12588
NM_153634chr121355 ------
NM_153705chr114893 604 573 80 1140 ----
NM_153816chr62421 183 --1313 --
NM_153831chr8----1377 --
NM_153836chr2--42126 1577 650 106 1624 --
NM_170665chr1244180 1165 1076 723 11422 ----
NM_170719chr131322 ----1353
NM_170753chr10135 ------
NM_172020chr721472 282 ------
NM_172069chr222263 1550 ------
NM_172071chr131789 173 54 ------
NM_172164chr11675 ------
NM_172169chr1061960 1759 1406 1246 1221 521 ------
NM_172170chr1061960 1759 1406 1246 1221 521 ------
NM_172171chr1061960 1759 1406 1246 1221 521 ------
NM_172173chr1061960 1759 1406 1246 1221 521 ------
NM_173082chr611169 ------
NM_173083chr121189 1079 ------
NM_173171chr21884 ------
NM_173173chr21884 ------
NM_173177chr21458 ------
NM_173214chr1698107 7937 6975 6968 5852 5420 3289 2611 709 16891 ----
NM_173354chr2112104 ------
NM_173468chr475577 5297 2279 2019 1584 914 512 ----12234
NM_173500chr15--1373 ----
NM_173503chr17148 ------
NM_173510chr2232520 551 267 ----174
NM_173511chr263482 3280 3215 1234 1032 1001 1462 ----
NM_173560chr62225 154 1559 ----
NM_173602chr1253310 611 409 288 224 ------
NM_173797chr52100 85 ------
NM_173829chr5--35544 4625 1337 35141 2225 227 --
NM_174902chr1121535 1322 1407 ----
NM_174921chr4--1825 ----
NM_174934chr1143431 3393 2592 2428 ----23039 880
NM_174937chr101499 ------
NM_175061chr712020 ------
NM_175709chr2212059 ----13036
NM_175854chr1342409 2109 498 30 --1702 --
NM_175856chr5--1273 --1820
NM_175861chr1245720 5130 4408 1904 25593 1556 11716 --
NM_175898chr1511513 1440 ----
NM_175907chr1842457 1978 1100 212 ------
NM_176812chr201684 ----1164
NM_176814chr721294 445 ------
NM_177424chr11761 1783 --11721
NM_177438chr142790 638 13985 ----
NM_177969chr2----1659 --
NM_177974chr151197 ----1348
NM_177990chr2011387 ------
NM_178006chr131878 12173 --1342
NM_178007chr131878 12173 --1342
NM_178126chr1742238 1995 1985 1734 ------
NM_178151chrX87433 6905 6802 5873 5318 2979 2172 1443 1933 12484 --
NM_178152chrX87433 6905 6802 5873 5318 2979 2172 1443 1933 12484 --
NM_178153chrX87433 6905 6802 5873 5318 2979 2172 1443 1933 12484 --
NM_178313chr21105 22130 1388 ----
NM_178335chr3--140 ----
NM_178422chr1134 ------
NM_178498chr1143857 2479 1015 97 ------
NM_178539chr125651 483 443 143 53 --11323 --
NM_178566chr931266 527 444 ------
NM_178584chr2------11507
NM_178585chr421017 970 12744 ----
NM_178857chr8--1105 ----
NM_181354chr811716 11334 --11402
NM_181356chr6--1924 ----
NM_181358chr124164 31 --11081 --
NM_181361chr311411 1448 ----
NM_181427chr15--1108 ----
NM_181442chr201397 ------
NM_181443chr2032236 2014 1815 ------
NM_181481chr1846653 5102 5072 731 37067 5272 1022 1914 11365
NM_181482chr1846653 5102 5072 731 37067 5272 1022 1914 11365
NM_181483chr1846653 5102 5072 731 37067 5272 1022 1914 11365
NM_181492chr221202 ------
NM_181552chr71880 --1933 --
NM_181705chr522298 313 25453 2225 ----
NM_181713chr21884 ------
NM_181741chr231249 985 845 --1877 --
NM_181742chr231249 985 845 --1877 --
NM_181886chr4135 1525 ----
NM_181887chr4135 1525 ----
NM_181888chr4135 1525 ----
NM_181889chr4135 1525 ----
NM_181890chr4135 1525 ----
NM_181891chr4135 1525 ----
NM_181892chr4182 1572 ----
NM_181893chr4135 1525 ----
NM_182527chr22--12193 1520 11582
NM_182663chr132133 2013 166 --21900 1702 --
NM_182664chr132263 2143 296 --22030 1832 --
NM_182665chr132133 2013 166 --21900 1702 --
NM_182678chr2169 ------
NM_182691chr7--11207 ----
NM_182692chr7--11207 ----
NM_182715chr7--1349 ----
NM_182717chr104946 567 469 441 ------
NM_182720chr104946 567 469 441 ------
NM_182721chr104946 567 469 441 ------
NM_182722chr104946 567 469 441 ------
NM_182723chr104946 567 469 441 ------
NM_182756chr2--1158 ----
NM_182767chr121553 21413 790 ----
NM_182796chr52244 45 ------
NM_182798chr51308 1335 ----
NM_182799chr51308 1335 ----
NM_182801chr51308 1335 ----
NM_182802chr201659 ------
NM_182853chr104946 567 469 441 ------
NM_182898chr744243 2300 908 287 14973 --12597
NM_182899chr744243 2300 908 287 14973 --12597
NM_182907chr622195 968 --1304 --
NM_182931chr71503 1593 ----
NM_182976chr11201 ------
NM_183004chr1453890 3072 2732 1206 1009 1220 ----
NM_183011chr104946 567 469 441 ------
NM_183012chr104946 567 469 441 ------
NM_183013chr104946 567 469 441 ------
NM_183353chrX--1809 ----
NM_183393chr31259 ------
NM_183394chr31259 ------
NM_183416chr121560 576 21597 1447 ----
NM_184234chr20129 ------
NM_194247chr243234 1691 199 143 ------
NM_194271chr121704 1620 1609 --
NM_194434chr1844983 4381 3681 1835 24276 499 1891 --
NM_194463chrX--11126 ----
NM_197941chr532533 2141 452 22598 2493 1680 --
NM_198066chr1442907 2858 2482 635 1502 ----
NM_198158chr322102 1985 23000 2124 22048 1923 --
NM_198159chr322102 1985 23000 2124 22048 1923 --
NM_198177chr322102 1985 23000 2124 22048 1923 --
NM_198178chr322102 1985 23000 2124 22048 1923 --
NM_198215chr102310 255 ------
NM_198225chr1021818 104 ------
NM_198268chr124164 31 --11081 --
NM_198269chr124164 31 --11081 --
NM_198270chrX43500 2810 2232 787 22824 2668 1234 --
NM_198400chr1541848 777 340 39 ----1890
NM_198439chr111525 ------
NM_198459chr12894 864 2798 238 ----
NM_198465chrX144 1188 ----
NM_198467chr71111 ------
NM_198485chr321688 754 ------
NM_198503chr13766 517 140 1611 ----
NM_198507chr51183 ------
NM_198581chr267001 6097 2265 1075 967 146 36108 2572 1429 14809 --
NM_198715chr156087 5281 2478 237 145 25746 1147 15061 11752
NM_198793chr322677 73 11647 --23745 1004
NM_198859chr334554 2001 1702 ------
NM_198881chrX----1462 --
NM_198889chr41445 ------
NM_198904chr511676 ----12020
NM_198969chr19--1118 ----
NM_198970chr19--1118 ----
NM_198990chr7--22498 201 12838 13184
NM_199166chr31118 ------
NM_199168chr10--1188 ----
NM_199185chr5--1241 ----
NM_199188chr1242780 2763 783 366 ----11118
NM_199189chr5--1162 ----
NM_199190chr1242780 2763 783 366 ----11118
NM_199324chr452819 2497 1116 1039 704 22780 1385 ----
NM_199421chr1413078 ------
NM_199464chr131131 ------
NM_199482chr231489 111 94 11728 ----
NM_201267chr2--1418 ----
NM_201437chr811418 11066 ----
NM_201999chr411175 1379 ----
NM_203301chr143570 387 198 ------
NM_203327chr2064482 3736 3712 1755 1643 800 23349 927 13748 --
NM_203342chr123438 85 --11299 --
NM_203343chr123438 85 --11299 --
NM_203349chr1552051 1870 1412 839 607 ------
NM_203364chr111429 11247 ----
NM_203372chr221261 362 ------
NM_203406chr512148 1556 ----
NM_203437chr2--1152 ----
NM_203504chr442490 1914 1668 946 11723 ----
NM_203505chr442490 1914 1668 946 11723 ----
NM_206594chr133452 3407 2549 ------
NM_206595chr133452 3407 2549 ------
NM_206852chr141205 ------
NM_206855chr645134 4676 3975 2434 1641 1613 --
NM_206857chr141205 ------
NM_206866chr2112790 23199 2702 13190 12391
NM_206907chr532792 1302 1121 1220 ----
NM_206909chr898210 6603 5196 2894 2604 2472 1600 1058 950 22446 2272 12385 --
NM_206937chr131860 ------
NM_206966chr51229 ------
NM_207303chr1041580 1375 715 237 13985 23181 1494 --
NM_207304chr1352166 1657 1028 225 185 11870 ----
NM_207337chr12----1421 --
NM_207343chr111140 ------
NM_207359chr332042 1297 28 ------
NM_207406chr475340 4960 4517 2162 1908 757 105 --16309 --
NM_212460chr71646 21730 824 1572 --
NM_212461chr121179 ------
NM_212471chr1722182 488 ------
NM_212472chr1722182 488 ------
NM_213589chr252026 1239 696 680 300 ------
NM_213606chr1022358 1779 --22295 250 --
NM_213609chr31941 1968 1878 --
NM_213654chr31576 --1135 1501