TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-31-5p
miRNA Sequence: AGGCAAGAUGCUGGCAUAGCU

<
mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr52972 27 ------
NM_000016chr12613 151 ------
NM_000037chr831910 1886 241 ------
NM_000038chr541326 726 297 118 11412 11311 12033
NM_000051chr11--13115 --22513 774
NM_000074chrX1938 1322 ----
NM_000080chr172774 261 ------
NM_000081chr111699 ----1608
NM_000084chrX96082 5591 5389 5280 4954 1924 784 727 670 11638 22686 1895 15117
NM_000088chr171290 ------
NM_000089chr72650 120 2686 56 ----
NM_000090chr22170 59 ----2631 72
NM_000092chr284515 3993 3413 3085 1691 1415 1299 1016 11636 --23937 1262
NM_000093chr91771 ----11931
NM_000109chrX52125 2003 1792 570 519 1336 ----
NM_000110chr11769 11180 ----
NM_000112chr595064 4745 4196 1713 1690 756 496 222 87 --25260 2091 1888
NM_000114chr202209 156 ------
NM_000117chrX2249 114 ------
NM_000118chr92851 694 ------
NM_000125chr684220 4080 3813 3769 3035 1115 490 151 1245 34139 2700 371 --
NM_000129chr631452 543 43 11412 2979 85 --
NM_000138chr1532319 939 354 22474 227 12445 --
NM_000139chr112214 60 --12692 1530
NM_000151chr1741913 1784 1685 1366 ------
NM_000158chr32606 52 --1591 --
NM_000161chr1442008 1372 330 71 1121 1755 1198
NM_000163chr532006 1466 364 ------
NM_000165chr621554 1273 ------
NM_000167chrX1123 1592 ----
NM_000168chr772990 2858 2284 2075 2035 762 370 ----12892
NM_000176chr533530 954 557 ----1752
NM_000183chr21119 1156 ----
NM_000189chr232227 566 103 2588 288 11901 1917
NM_000192chr121204 --1345 --
NM_000194chrX1107 ------
NM_000208chr1984611 4520 3663 3140 3010 1384 804 357 --13132 --
NM_000212chr171771 --12469 1611
NM_000214chr2011383 21572 1294 ----
NM_000217chr1245321 4907 3647 1755 15165 ----
NM_000245chr722261 2100 22166 1431 --2695 96
NM_000248chr352924 2332 1083 837 285 22701 2369 1680 12484
NM_000252chrX193 ------
NM_000253chr42760 73 ------
NM_000259chr1534880 4124 1196 14399 45211 4961 4943 40 1697
NM_000264chr933099 671 603 --13073 --
NM_000266chrX2932 893 ------
NM_000267chr1763215 3130 2134 797 168 73 1134 ----
NM_000276chrX3415 397 381 ------
NM_000280chr11--1388 ----
NM_000291chrX----1266 --
NM_000314chr1083117 2341 2256 2077 1225 1217 472 143 12706 13302 --
NM_000319chr12----11095 1899
NM_000321chr1371615 1440 1316 615 381 346 214 ------
NM_000329chr11129 ------
NM_000332chr656809 5028 2746 2419 2361 1130 12764 1461
NM_000333chr3--1267 ----
NM_000337chr586328 6090 4819 4299 2327 1940 1454 1351 15948 24521 699 12268
NM_000346chr172761 577 ------
NM_000353chr1621151 205 11124 1832 11241
NM_000361chr2021740 632 1473 ----
NM_000362chr22113591 3376 3147 2751 2505 2495 1252 770 448 406 105 --1364 --
NM_000368chr974882 4531 4456 4051 4033 951 892 --1706 14675
NM_000373chr32687 217 ----1526
NM_000378chr11----1503 --
NM_000391chr1141656 1282 589 29 11151 21219 520 --
NM_000397chrX12417 12219 --1484
NM_000399chr101317 ------
NM_000408chr251337 1277 802 537 254 2192 159 12630 --
NM_000428chr1452508 2478 955 190 125 22138 268 --1547
NM_000430chr1733459 2871 2558 1571 ----
NM_000435chr193690 225 132 ------
NM_000439chr51644 --2425 61 --
NM_000441chr721965 1590 ------
NM_000448chr1132760 371 31 1489 22693 2317 1949
NM_000449chr1274 47 ----11154
NM_000450chr121167 331 --2386 100 --
NM_000451chrX32126 1562 789 ----11954
NM_000454chr21--1266 --1233
NM_000459chr91588 --1929 --
NM_000461chr374443 3811 3623 3465 3299 1461 1120 ------
NM_000462chr1541394 740 337 255 ------
NM_000476chr921400 502 1286 1442 --
NM_000480chr1131601 1428 237 ------
NM_000484chr211341 --1436 --
NM_000489chrX42741 2403 2300 630 --12241 --
NM_000492chr71260 21532 289 ----
NM_000495chrX3844 780 447 --1292 --
NM_000503chr821723 420 ------
NM_000516chr201135 ------
NM_000522chr741177 409 308 61 ------
NM_000527chr1932243 874 492 1470 ----
NM_000533chrX4533 204 145 86 193 --1416
NM_000539chr311041 11234 1297 --
NM_000555chrX97802 6989 6661 6192 5896 5503 1642 1333 312 47724 6876 6205 2681 55709 5489 2750 1951 327 17060
NM_000565chr122175 676 ------
NM_000575chr23924 403 203 ----1900
NM_000587chr521025 27 --3954 888 190 --
NM_000597chr21306 --1206 --
NM_000612chr1123515 2942 --23624 2918 --
NM_000615chr1142906 2200 966 843 22250 2219 2919 148 11926
NM_000618chr1276049 5532 4600 4399 518 475 391 --46277 5905 2646 2559 11497
NM_000618chr1276049 5532 4600 4399 518 475 391 --46277 5905 2646 2559 11497
NM_000624chr143871 792 269 --2578 212 --
NM_000633chr1835231 3860 502 ----11495
NM_000641chr1931579 1194 618 ------
NM_000663chr1672994 2510 2475 2039 968 675 65 ------
NM_000668chr431017 368 305 1275 ----
NM_000681chr1031084 966 874 --1182 --
NM_000682chr241802 592 385 194 --21834 62 --
NM_000683chr41200 1477 ----
NM_000684chr1041252 941 503 189 ------
NM_000686chrX3998 524 41 ------
NM_000702chr141870 1674 1656 537 ------
NM_000719chr12115031 2390 2257 1891 1882 1697 1688 1511 1078 888 784 15623 11957 1862
NM_000721chr132477 520 305 ------
NM_000723chr1721063 560 ----11365
NM_000724chr1051406 1235 375 113 45 --2493 449 --
NM_000726chr2--142 ----
NM_000756chr81406 ------
NM_000759chr172850 681 ------
NM_000767chr1931201 1060 228 ------
NM_000782chr201165 1202 --11265
NM_000794chr5--168 ----
NM_000800chr52268 135 ------
NM_000807chr4157 ------
NM_000809chr4129034 8923 7757 7666 5767 3534 3442 3305 2966 2624 1468 771 18186 28698 6216 --
NM_000810chr151115 --168 --
NM_000813chr595236 4312 4200 3714 1957 1658 1182 694 531 12181 ----
NM_000814chr1544118 3069 407 263 11065 13403 --
NM_000817chr21362 ------
NM_000826chr451677 1635 881 743 211 --1999 --
NM_000827chr542557 2446 982 169 --22524 2143 --
NM_000829chr1142277 1920 736 586 --1351 --
NM_000838chr632721 548 336 1388 21912 1752 --
NM_000840chr7125 ------
NM_000841chr61969 --3829 796 94 --
NM_000844chr321043 839 1409 11004 --
NM_000845chr74514 404 326 126 ------
NM_000859chr531434 1142 94 --11663 --
NM_000860chr411471 --11265 --
NM_000864chr1123 --1266 --
NM_000868chrX42230 1800 551 250 --1464 --
NM_000875chr1576760 6493 4716 2821 2354 1731 130 36652 4658 1437 35888 2197 2121 1591
NM_000876chr61321 --2248 96 --
NM_000877chr253003 2765 2409 2260 661 --22891 2227 --
NM_000883chr7----1281 --
NM_000883chr7----1281 --
NM_000891chr1783399 2440 1414 1273 1188 1075 846 738 --13011 --
NM_000899chr1213276 24110 1313 --1135
NM_000901chr451956 842 698 688 27 --11706 --
NM_000902chr323102 2433 23073 40 1689 1544
NM_000909chr421332 1190 --2135 130 --
NM_000921chr122492 184 144 ----
NM_000922chr112390 147 ------
NM_000926chr11149456 9067 8805 8410 8217 8160 8017 7012 5864 5803 3731 2237 1152 315 --27951 7428 39131 8267 2926
NM_000927chr71601 --1396 --
NM_000933chr2021690 470 --11519 --
NM_000935chr32948 807 --1962 --
NM_000944chr42819 502 --2766 98 1513
NM_000945chr241609 1579 736 33 --11866 --
NM_000949chr52215 143 ------
NM_000950chrX83348 3033 2707 1008 608 443 187 157 ------
NM_000962chr973035 2704 2338 2004 1930 830 366 23108 46 ----
NM_000965chr31394 --1478 --
NM_000966chr1211085 --1428 1137
NM_000983chr121593 1092 ------
NM_001001132chr211407 ------
NM_001001323chr1212823 22940 1119 2889 383 12295
NM_001001331chr321846 727 --1948 12485
NM_001001395chr1262184 940 807 619 236 57 22268 242 12772 --
NM_001001396chr154451 4313 3685 1135 1092 1549 13876 21643 1539
NM_001001419chr555210 1984 849 688 474 13709 14549 --
NM_001001420chr555210 1984 849 688 474 13709 14549 --
NM_001001433chr2043084 2859 876 713 ------
NM_001001436chr16--1251 ----
NM_001001438chr211384 ------
NM_001001481chr832610 1055 985 12749 11087 --
NM_001001483chr112424 357 ------
NM_001001484chr1061992 829 660 652 382 142 ----1642
NM_001001522chr11----1375 --
NM_001001523chr121104 22 --11219 --
NM_001001549chr752851 752 736 627 399 --1336 --
NM_001001550chr752851 752 736 627 399 --1336 --
NM_001001555chr752851 752 736 627 399 --1336 --
NM_001001557chr831671 545 223 ------
NM_001001664chr284104 4085 3887 1138 890 622 371 231 22843 274 ----
NM_001001669chr542602 2544 2251 849 ------
NM_001001787chr12483 474 --177 --
NM_001001872chr142575 152 ------
NM_001001890chr2133041 1376 587 --1598 --
NM_001001924chr851850 1377 665 382 284 11822 1185 --
NM_001001925chr851850 1377 665 382 284 11822 1185 --
NM_001001928chr2277574 5832 5752 5060 3293 2830 84 26419 1195 38338 6701 3010 16214
NM_001001931chr851850 1377 665 382 284 11822 1185 --
NM_001001933chr11627 ----1477
NM_001001971chr102957 511 173 ----
NM_001001974chr1042212 1819 912 562 --11651 11571
NM_001001995chrX21742 760 ------
NM_001002233chr831721 554 72 ------
NM_001002243chr21755 ------
NM_001002244chr17----1347 197
NM_001002245chr17----1382 1132
NM_001002246chr17----1382 1132
NM_001002247chr17----1382 1132
NM_001002248chr17----1382 1132
NM_001002249chr17----1382 1132
NM_001002255chr61350 ------
NM_001002257chr273364 3224 3172 2543 1158 135 81 ----11173
NM_001002259chr12172 ------
NM_001002264chr13197 ------
NM_001002295chr102898 68 1141 1969 --
NM_001002762chr1062465 2448 2176 1803 971 706 1878 12678 --
NM_001002811chr1--21619 1343 ----
NM_001002812chr1--21619 1343 ----
NM_001002812chr1--21619 1343 ----
NM_001002814chr843511 3269 554 72 13391 ----
NM_001002838chrX21867 545 11823 ----
NM_001002860chr1494355 4292 4128 3615 3360 3354 1223 388 296 --11241 --
NM_001002909chr1742114 1525 1383 407 --31646 1634 428 --
NM_001003407chr1044738 4113 3747 863 1185 22049 1136 --
NM_001003408chr1044738 4113 3747 863 1185 22049 1136 --
NM_001003652chr18138298 7994 7625 7566 7555 6635 3433 3355 2553 2378 2329 1873 1504 26346 6187 ----
NM_001003674chr1836684 5443 2175 --16087 25865 4668
NM_001003675chr1836684 5443 2175 --16087 25865 4668
NM_001003679chr132134 1847 786 11951 12181 --
NM_001003681chr2222025 407 ------
NM_001003688chr41762 ----11013
NM_001003698chr621608 379 --11630 --
NM_001003699chr621608 379 --11630 --
NM_001003712chr1233647 1398 752 22990 2862 --11273
NM_001003760chr653483 3149 2390 1011 813 11285 ----
NM_001003792chr32454 34 1999 --1214
NM_001003793chr32454 34 1999 --1214
NM_001003800chr931478 1239 269 11013 13140 --
NM_001003810chr42636 280 ------
NM_001003940chr1532723 1363 85 11096 12985 --
NM_001003942chr1532723 1363 85 11096 12985 --
NM_001003943chr1532727 1367 89 11100 12989 --
NM_001004019chr31115 ------
NM_001004051chrX1133 ------
NM_001004065chr953472 3212 2909 1152 527 --23611 2957 --
NM_001004105chr5132 ------
NM_001004106chr5168 ------
NM_001004127chr13--1280 ----
NM_001004196chr3----1500 --
NM_001004304chr1263117 3024 2891 1276 1133 381 12927 ----
NM_001004317chr674425 3846 3541 3389 3311 2935 853 13112 ----
NM_001004354chr91910 11055 ----
NM_001004360chr222005 252 --11831 --
NM_001004419chr1231046 555 360 14462 ----
NM_001004441chr521370 672 ------
NM_001004720chr2--1157 1673 --
NM_001004722chr2--1326 1842 --
NM_001005266chr151571 ------
NM_001005267chr151571 ------
NM_001005268chr151571 ------
NM_001005269chr151571 ------
NM_001005271chr173931 400 132 --11069 --
NM_001005273chr173931 400 132 --11069 --
NM_001005335chr19192 ------
NM_001005366chr123762 756 685 ------
NM_001005375chrY21176 1159 ------
NM_001005377chr193217 82 50 ------
NM_001005386chr221677 959 ------
NM_001005404chr1763430 1260 1153 1119 753 495 1113 13760 1346
NM_001005463chr1042132 944 824 771 11673 22636 656 1914
NM_001005474chr341545 1337 1013 80 ----11006
NM_001005476chr2----172 --
NM_001005502chr1234735 1689 817 --23298 1041 --
NM_001005505chr321385 1172 --1246 --
NM_001005527chr331268 1013 57 ------
NM_001005732chr212501 76 ------
NM_001005733chr212458 76 ------
NM_001005743chr14----127 --
NM_001005744chr14----127 --
NM_001005745chr14----127 --
NM_001005746chr2--142 ----
NM_001005747chr2--142 ----
NM_001005781chr21386 ----1142
NM_001005849chr172600 580 ------
NM_001005910chr33479 467 443 ------
NM_001005911chr33479 467 443 ------
NM_001005920chr161774 11106 ----
NM_001006115chr372581 1718 995 808 701 89 68 12335 1317 --
NM_001006600chr542445 2332 1659 481 ----21693 722
NM_001006610chr163920 905 331 ------
NM_001006612chrX3387 130 46 ------
NM_001006613chrX3387 130 46 ------
NM_001006614chrX3387 130 46 ------
NM_001006618chr9--199 ----
NM_001006636chr2--1128 ----
NM_001006641chr931589 1356 171 11142 1411 --
NM_001006642chr931589 1356 171 11142 1411 --
NM_001006643chr931589 1356 171 11142 1411 --
NM_001006657chr273188 3031 1063 1021 663 260 134 ------
NM_001006665chr11288 ------
NM_001006681chrX1141 1122 ----
NM_001006682chrX1141 1122 ----
NM_001006683chrX1141 1122 ----
NM_001006684chrX1422 ------
NM_001006946chr241703 1188 514 53 11959 21303 608 --
NM_001007024chr1754303 3744 3400 2850 2669 ------
NM_001007025chr1754303 3744 3400 2850 2669 ------
NM_001007026chr122433 359 ------
NM_001007097chr975080 4129 1909 1305 1102 887 873 ------
NM_001007098chr1----1322 --
NM_001007099chr11326 ------
NM_001007100chr11326 ------
NM_001007102chr641273 1196 1057 622 21511 559 ----
NM_001007156chr151661 --21592 330 --
NM_001007214chr12406 345 --2623 280 --
NM_001007226chr1751160 1138 982 567 426 --11294 --
NM_001007227chr1751160 1138 982 567 426 --11294 --
NM_001007228chr1751160 1138 982 567 426 --11294 --
NM_001007229chr1751160 1138 982 567 426 --11294 --
NM_001007230chr1751160 1138 982 567 426 --11294 --
NM_001007237chr14916 644 477 236 2987 754 12093 --
NM_001007257chr1--11441 ----
NM_001007271chr102755 412 151 ----
NM_001007277chr11--1386 ----
NM_001007466chr675217 5023 4707 4604 4174 3819 3714 13670 ----
NM_001007471chr91229 ------
NM_001007553chr161184 1121 887 788 336 303 ------
NM_001007559chr18----21652 1646 --
NM_001007565chr31281 ------
NM_001007794chr11187 ------
NM_001008220chr51761 ------
NM_001008222chrX----1156 --
NM_001008225chr74594 586 83 62 ------
NM_001008239chr1853505 2367 1382 501 355 --12391 --
NM_001008272chr32331 125 1278 ----
NM_001008273chr32331 125 1278 ----
NM_001008392chr31995 23067 1052 ----
NM_001008393chr462935 2369 2049 1020 807 329 12081 --12793
NM_001008407chr721555 139 ------
NM_001008408chr7106043 5963 5842 5511 5118 4873 4815 4676 4527 488 ----35437 609 227
NM_001008495chr861853 1844 1488 1392 722 559 ----11656
NM_001008528chr1751264 230 150 140 54 --21807 1748 1478
NM_001008529chr1731179 219 36 1372 1453 --
NM_001008539chr864998 4211 3964 2073 1265 769 --11116 --
NM_001008540chr23486 381 122 ------
NM_001008541chr1011779 11890 ----
NM_001008541chr1011779 11890 ----
NM_001008564chr1362141 2120 1954 1895 439 177 1155 1837 --
NM_001008660chr1111267 ------
NM_001008701chr1952834 2788 2049 2002 622 ----12242
NM_001008707chr142774 589 31798 1389 376 --1765
NM_001008738chr562881 2629 1836 1160 933 450 ------
NM_001008860chr152752 155 ------
NM_001008892chr152752 155 ------
NM_001008894chr152752 155 ------
NM_001009552chr81231 ------
NM_001009555chr421652 75 1693 --11522
NM_001009571chr721661 68 ----11132
NM_001009899chr3136551 6439 4841 4503 4254 4138 4020 1770 1125 910 815 768 623 --34265 4080 2475 1299
NM_001009959chr222081 458 --1783 --
NM_001009996chr3------1114
NM_001010000chr1833455 2812 986 --12433 --
NM_001010853chr653143 2297 1007 921 180 --11254 --
NM_001010854chr141185 ----1196
NM_001010861chr111792 12170 ----
NM_001010862chrX63296 525 472 360 111 102 1831 2739 169 --
NM_001010867chr146033 5802 764 464 --45662 5479 5175 2010 16234
NM_001010888chrX23387 1752 --11832 --
NM_001010895chr941965 1477 1450 1411 ----11650
NM_001010898chr142748 2288 108 54 22579 361 43073 2648 2544 741 --
NM_001010908chr103514 502 483 ------
NM_001010917chr1012039 ------
NM_001010924chr104858 498 363 141 --11084 --
NM_001010927chr61387 ------
NM_001010942chr121852 11283 1907 --
NM_001010971chr11776 1929 ----
NM_001010986chrX42492 1663 1598 337 --1356 1548
NM_001011513chr424049 3233 --32531 981 836 --
NM_001011515chr42368 92 ------
NM_001011516chr42368 92 ------
NM_001011537chr331729 419 344 --12053 --
NM_001011546chr202696 556 ----2112 54
NM_001011658chrX12098 --1610 --
NM_001011666chr786404 5405 4749 4412 2548 1674 339 321 25598 593 1809 --
NM_001011705chr131276 2327 260 ----
NM_001011708chr272532 2075 1170 1164 1081 852 342 22631 1065 ----
NM_001011724chr131270 ------
NM_001011725chr131270 ------
NM_001012337chr3192 ------
NM_001012393chr1144120 3682 1312 684 --23374 1813 --
NM_001012398chr161852 1718 ----
NM_001012420chr1572852 2316 2058 2030 1829 478 270 12811 32891 1809 330 --
NM_001012423chr1582852 2316 2058 2030 1829 478 408 270 12811 32891 1809 330 --
NM_001012514chr22973 892 ------
NM_001012516chr22973 892 ------
NM_001012614chr42487 163 --1256 --
NM_001012732chr41268 ----1164
NM_001012751chr1011947 --21524 1300 --
NM_001012754chr1331661 1565 271 ----11927
NM_001012755chrX74755 4168 3625 3363 1791 1564 1215 ------
NM_001012761chr552735 2260 1080 877 215 1429 --12198
NM_001012968chrX32019 957 553 --3562 514 164 --
NM_001012977chrX11115 ------
NM_001012979chrX173 ------
NM_001012989chrX2641 62 --1166 --
NM_001013031chr1073325 3270 3134 2981 2224 1258 1020 ------
NM_001013399chr61137 ------
NM_001013415chr431348 1083 989 ----1560
NM_001013438chr3--1222 ----
NM_001013439chr3--168 ----
NM_001013624chr173796 217 47 ------
NM_001013635chr123917 882 113 ------
NM_001013659chr1945392 5162 1404 290 --11391 --
NM_001013690chr1232429 1773 415 ----1317
NM_001013693chr152957 2140 927 906 620 ------
NM_001013693chr152957 2140 927 906 620 ------
NM_001013839chr1722539 72 ------
NM_001013843chr152220 91 ------
NM_001014283chr1321471 237 --1479 --
NM_001014380chr1364207 1914 1824 1749 1175 671 --22275 2142 1641
NM_001014442chr131110 ------
NM_001014443chr11177 ------
NM_001014797chr1047306 5597 2134 2080 --18181 17457
NM_001014831chr192821 129 ------
NM_001014832chr192821 129 ------
NM_001014834chr192821 129 ------
NM_001014835chr192821 129 ------
NM_001014839chr111032 --1726 --
NM_001014841chr111032 --1726 --
NM_001015045chr41442 ------
NM_001015053chr1721533 115 --1639 --
NM_001015877chrX43093 2749 1028 149 1778 --1632
NM_001015881chrX21160 886 ------
NM_001015885chr202350 270 ------
NM_001015887chr331835 1510 197 --21369 672 --
NM_001017369chr411079 ------
NM_001017371chr231226 1079 855 ------
NM_001017395chr332639 2394 399 --42550 1205 997 967 12703
NM_001017396chr23637 439 431 1831 1266 --
NM_001017405chr43899 746 108 ------
NM_001017423chr10154 1241 182 --
NM_001017440chr7108201 7378 6844 5928 5251 5178 2088 1475 878 745 12823 33110 2515 1551 --
NM_001017523chr121533 --1718 --
NM_001017916chr1721601 1514 11952 22027 43 --
NM_001017917chr1721601 1514 11952 22027 43 --
NM_001017923chr1451345 1070 528 436 250 ------
NM_001017926chr82335 69 ------
NM_001017963chr143597 387 330 ------
NM_001017977chr1--1352 ----
NM_001017979chr43732 287 128 ------
NM_001017995chr554100 3063 1793 427 40 13298 2788 133 --
NM_001017999chr131704 907 680 11509 12057 --
NM_001017999chr131704 907 680 11509 12057 --
NM_001018000chr131704 907 680 11509 12057 --
NM_001018000chr131704 907 680 11509 12057 --
NM_001018001chr131704 907 680 11509 12057 --
NM_001018009chr341196 1034 345 201 ------
NM_001018037chr9----11375 1511
NM_001018053chr121282 608 1475 1351 11635
NM_001018056chr9----1182 --
NM_001018057chr111268 1239 ----
NM_001018064chr951935 1818 1698 1518 404 11796 ----
NM_001018067chr165316 4873 4833 2059 674 58 ------
NM_001018068chr165316 4873 4833 2059 674 58 ------
NM_001018069chr165316 4873 4833 2059 674 58 ------
NM_001018072chr121533 --1718 --
NM_001018074chr533530 954 557 ----1752
NM_001018075chr533530 954 557 ----1752
NM_001018076chr533530 954 557 ----1752
NM_001018077chr533530 954 557 ----1752
NM_001018090chr1542841 2020 853 225 --1687 12698
NM_001018091chr1542951 2130 963 335 --1797 12808
NM_001018102chr1542841 2020 853 225 --1687 12698
NM_001018108chr1521768 121 --130 --
NM_001018111chr783875 3179 3111 2448 1438 1392 341 192 ----12460
NM_001018676chr8189 ----1440
NM_001018677chr8189 ----1440
NM_001020658chr161644 1563 1441 1354 427 410 ------
NM_001020658chr161644 1563 1441 1354 427 410 ------
NM_001020818chr1931741 573 520 --41724 1618 203 52 --
NM_001020819chr1931741 573 520 --41724 1618 203 52 --
NM_001020820chr1931741 573 520 --41724 1618 203 52 --
NM_001020821chr1931741 573 520 --41724 1618 203 52 --
NM_001023567chr1552381 2244 1850 480 270 12203 22364 2283 11831
NM_001024094chr533530 954 557 ----1752
NM_001024218chr142726 235 ------
NM_001024226chr1--1965 132 --
NM_001024227chr1--1965 132 --
NM_001024228chr1--1965 132 --
NM_001024380chr832027 584 388 --12495 --
NM_001024381chr832027 584 388 --12495 --
NM_001024401chr1622294 1973 1972 22803 1901 --
NM_001024455chrX4654 315 156 43 2978 745 --21930 1920
NM_001024460chr651115 1050 486 329 243 ------
NM_001024593chr10172 --1192 --
NM_001024647chr1286861 6783 6353 6188 6109 2330 1026 117 ------
NM_001024649chr522474 514 1314 12871 --
NM_001024660chr31654 ------
NM_001024666chrX3456 101 79 ------
NM_001024934chr63586 527 92 ------
NM_001024935chr63586 527 92 ------
NM_001024936chr63586 527 92 ------
NM_001024937chr172655 97 ------
NM_001024947chr53859 170 149 ------
NM_001024948chr133216 227 148 --11138 --
NM_001024956chr1195707 5315 2181 1975 1951 1570 1488 437 342 ------
NM_001024959chr31708 1149 1869 --
NM_001024960chr31708 1149 1869 --
NM_001025068chr351688 649 484 385 186 --1525 11621
NM_001025069chr351688 649 484 385 186 --1525 11621
NM_001025072chr332615 2209 494 1527 22934 2622 --
NM_001025073chr332615 2209 494 1527 22934 2622 --
NM_001025076chr1095907 5675 3914 3799 2156 1256 1133 679 76 36025 4225 1242 ----
NM_001025077chr10127265 7033 5272 5157 4868 2614 2491 2037 1434 446 303 256 47383 5583 2600 178 ----
NM_001025079chr383787 3743 2725 2649 1644 748 557 220 33904 1463 432 23147 733 --
NM_001025108chr283250 3043 2558 1384 1320 1273 1256 142 11061 --11453
NM_001025252chr822763 2274 --23204 2967 166
NM_001025253chr822763 2274 --23204 2967 166
NM_001025366chr621465 1350 --21361 279 --
NM_001025366chr621465 1350 --21361 279 --
NM_001025367chr621465 1350 --21361 279 --
NM_001025367chr621465 1350 --21361 279 --
NM_001025368chr621465 1350 --21361 279 --
NM_001025368chr621465 1350 --21361 279 --
NM_001025369chr621481 1366 --21377 295 --
NM_001025369chr621481 1366 --21377 295 --
NM_001025370chr621465 1350 --21361 279 --
NM_001025370chr621465 1350 --21361 279 --
NM_001025389chr1131601 1428 237 ------
NM_001025390chr1131601 1428 237 ------
NM_001025580chrX93785 3553 3253 3095 940 340 324 281 228 21184 680 13359 --
NM_001025595chr42468 116 ------
NM_001025603chr1274 47 ----11154
NM_001025616chr461179 648 642 431 334 292 31871 1537 721 11547 --
NM_001025780chr91313 11061 140 11109
NM_001029835chr71329 ------
NM_001029839chr321125 615 ----1245
NM_001029840chr321125 615 ----1245
NM_001029858chr632980 2522 451 12108 151 --
NM_001029863chr612634 22796 73 ----
NM_001029875chr522120 953 --21009 375 --
NM_001030007chr1631540 1009 931 ----12988
NM_001030055chr1454739 4671 4435 1152 792 ------
NM_001031623chr61124 ------
NM_001031679chr1243056 290 171 137 12586 23452 3387 --
NM_001031689chr92161 123 ------
NM_001031690chr772635 2195 2020 1894 1258 988 727 11902 32782 815 429 12655
NM_001031695chr22115130 4843 4746 4625 4384 4343 3944 3567 2184 2178 1193 --11056 13575
NM_001031696chr191306 ------
NM_001031702chr33682 121 113 --132 --
NM_001031716chr21381 1435 ----
NM_001031723chr4--1320 ----
NM_001031732chr453612 1141 485 367 46 --13187 23258 3166
NM_001031804chr1663565 2850 2788 2732 1160 538 41230 902 304 73 ----
NM_001031812chr532243 234 55 ------
NM_001031855chrX162 ------
NM_001032221chr931336 588 165 ------
NM_001032279chr111386 ------
NM_001032282chr821323 327 ------
NM_001032283chr121906 --2940 926 --
NM_001032284chr121906 --2940 926 --
NM_001032288chr2041336 1089 346 95 ------
NM_001032296chr1342757 1020 715 570 --22688 804 --
NM_001032363chr151714 1708 1423 373 165 ------
NM_001032363chr151714 1708 1423 373 165 ------
NM_001032380chr102448 87 21644 625 --11862
NM_001032393chrX1204 ------
NM_001032394chr631787 1727 1064 12819 1939 12535
NM_001032395chr621654 931 12686 1806 12402
NM_001032999chr20104715 4120 3815 3796 1170 1034 901 723 678 174 14251 --14059
NM_001033025chr11302 --11508 11551
NM_001033044chr131363 720 404 --2516 145 11401
NM_001033047chr412585 ------
NM_001033049chr2121978 1618 ------
NM_001033056chr131363 720 404 --2516 145 11401
NM_001033057chr341856 1591 1403 528 1242 ----
NM_001033059chr62593 190 --21498 235 --
NM_001033081chr121762 1195 ------
NM_001033082chr121762 1195 ------
NM_001033085chr2297 87 ------
NM_001033087chr2043006 2293 1000 282 12041 ----
NM_001033088chr151322 ------
NM_001033112chr52728 133 ----190
NM_001033117chr321422 1200 --13542 --
NM_001033503chr5193 ------
NM_001033507chr121813 713 21265 591 1722 1337
NM_001033518chr732154 1075 624 21942 429 --1248
NM_001033519chr732154 1075 624 21942 429 --1248
NM_001033520chr732154 1075 624 21942 429 --1248
NM_001033554chr17------140
NM_001033557chr21338 ------
NM_001033561chr17------1790
NM_001033566chr17--1670 ----
NM_001033568chr17--1670 ----
NM_001033578chr832285 282 206 ------
NM_001033602chr1352191 1696 826 811 770 --11823 11941
NM_001033723chr831857 909 270 12114 ----
NM_001033756chr621399 1284 --21295 213 --
NM_001033756chr621399 1284 --21295 213 --
NM_001033925chr1021484 580 --1334 --
NM_001034841chr16125534 5467 5197 4405 4399 1688 1492 1392 1221 1170 984 798 1435 ----
NM_001034845chr431104 1080 231 ------
NM_001034850chr521468 673 --11558 11424
NM_001034853chrX----1957 --
NM_001034915chr811564 ----1477
NM_001034954chr1073006 2826 2661 2426 2406 1006 666 ------
NM_001034955chr1073006 2826 2661 2426 2406 1006 666 ------
NM_001034956chr1073006 2826 2661 2426 2406 1006 666 ------
NM_001034957chr1073006 2826 2661 2426 2406 1006 666 ------
NM_001035chr131260 1030 86 ----11082
NM_001035003chr41344 11393 ----
NM_001035004chr41344 11393 ----
NM_001035005chr181509 ------
NM_001035260chr102549 421 ----11326
NM_001035521chr21584 ------
NM_001037132chr731950 1782 1710 31996 1462 557 ----
NM_001037133chr731950 1782 1710 31996 1462 557 ----
NM_001037164chr751899 1857 1669 1493 86 ------
NM_001037225chr11190 ------
NM_001037277chr121470 317 ------
NM_001037278chr121470 317 ------
NM_001037317chr111792 12170 ----
NM_001037331chr181160 ------
NM_001037334chr1852201 903 429 389 251 --1318 --
NM_001037339chr15713 684 585 378 193 ------
NM_001037340chr15713 684 585 378 193 ------
NM_001037341chr15713 684 585 378 193 ------
NM_001037341chr15713 684 585 378 193 ------
NM_001037494chr12--196 ----
NM_001037495chr12--196 ----
NM_001037553chr2185189 4660 4596 4533 4475 4214 3751 1384 ------
NM_001037582chr4173 ----11738
NM_001037637chr51252 ------
NM_001037872chr21641 --1481 --
NM_001037954chr1163305 2496 1399 966 674 228 12509 22996 682 --
NM_001038493chr231427 1362 574 --1204 --
NM_001038707chr1----22227 1442 --
NM_001038707chr1----22227 1442 --
NM_001039140chr203389 127 52 ------
NM_001039199chr2064881 4726 4589 3296 1160 277 --193 --
NM_001039350chr731229 659 152 1494 ----
NM_001039459chr721014 372 --1178 11051
NM_001039465chr14--174 ----
NM_001039538chr253691 2641 2562 259 244 13710 22590 2465 --
NM_001039547chr387834 7787 7032 5159 2910 1403 1238 822 16486 36477 1808 812 --
NM_001039574chr12314 249 ------
NM_001039577chr173901 3872 3478 3446 1442 953 166 ------
NM_001039585chr144078 3440 2847 43 31354 585 135 23960 711 2858 455
NM_001039590chrX53721 1435 1408 504 339 1488 13059 --
NM_001039591chrX53721 1435 1408 504 339 1488 13059 --
NM_001039618chr1144909 4686 1593 754 --15814 --
NM_001039690chr1611885 --1824 --
NM_001039693chr253658 2904 1634 1562 758 --13947 21473 991
NM_001039709chr20104715 4120 3815 3796 1170 1034 901 723 678 174 14251 --14059
NM_001039762chr1032365 569 452 1197 --11546
NM_001039771chr14----2808 63 --
NM_001039775chr1138 ------
NM_001039802chr141334 1153 476 99 ------
NM_001039840chrX115884 5679 5328 4327 4197 3698 2347 2089 1832 1761 197 36040 4250 2217 25056 3853 --
NM_001039877chr194873 858 783 605 1119 ----
NM_001039888chr12316 99 ------
NM_001039916chr122437 314 --1449 --
NM_001039917chr122437 314 --1449 --
NM_001039918chr122437 314 --1449 --
NM_001039919chr122437 314 --1449 --
NM_001039920chr122437 314 --1449 --
NM_001039937chr1373316 3123 1093 608 532 274 76 23163 351 1258 --
NM_001040056chr16130 ------
NM_001040057chr71104 11032 21399 993 --
NM_001040059chr171567 --1599 --
NM_001040101chr421302 155 ------
NM_001040110chr721571 1307 1724 11541 --
NM_001040134chr19--21429 1009 ----
NM_001040135chr7------1602
NM_001040142chr21623 ------
NM_001040143chr21623 ------
NM_001040144chr1611885 --1824 --
NM_001040146chr1611885 --1824 --
NM_001040152chr734996 1869 1608 44939 3550 3322 1370 ----
NM_001040153chr131180 1310 ----
NM_001040158chr51113 ------
NM_001040159chr411530 ----1462
NM_001040167chr741190 1093 853 846 ------
NM_001040181chr32966 940 ------
NM_001040182chr32966 940 ------
NM_001040183chr32966 940 ------
NM_001040199chr32966 940 ------
NM_001040200chr32966 940 ------
NM_001040202chr432516 1862 794 11897 12381 --
NM_001040214chr632320 559 532 ------
NM_001040260chr42852 778 --11142 --
NM_001040261chr42852 778 --11142 --
NM_001040284chr1695866 5284 5056 4594 4430 4136 3688 3622 475 --25678 3941 23985 1293
NM_001040402chr462680 2289 889 796 162 100 2839 231 --11262
NM_001040409chr21747 ------
NM_001040429chr1333493 2971 1250 --137 12446
NM_001040441chr133691 1565 1556 ----14330
NM_001040446chr551845 882 801 624 537 ------
NM_001040624chr82890 705 11905 22735 780 184
NM_001040625chr82890 705 11905 22735 780 184
NM_001040626chr82890 705 11905 22735 780 184
NM_001040627chr82890 705 11905 22735 780 184
NM_001040628chr82890 705 11905 22735 780 184
NM_001040629chr82890 705 11905 22735 780 184
NM_001040630chr82890 705 11905 22735 780 184
NM_001040633chr71842 --163 --
NM_001040653chr352088 1668 865 729 315 21740 328 22563 840 --
NM_001040665chr754275 1916 1629 1063 241 43529 1859 884 182 34470 1960 1324 --
NM_001040668chr19------1122
NM_001040697chr111465 ------
NM_001040709chr142385 2149 716 230 12582 21836 195 --
NM_001040712chr913197 13338 1682 --
NM_001040876chr41685 1383 ----
NM_001042355chr16105213 4828 3600 3353 3294 1450 1409 1358 523 193 24240 1683 15241 11862
NM_001042357chr1021107 485 ----1203
NM_001042358chr1021107 485 ----1203
NM_001042360chr1021107 485 ----1203
NM_001042363chr1021107 485 ----1203
NM_001042389chr1021107 485 ----1203
NM_001042390chr1021107 485 ----1203
NM_001042392chr1021107 485 ----1203
NM_001042395chr1021107 485 ----1203
NM_001042399chr12--1100 ----
NM_001042406chr62254 82 2459 222 ----
NM_001042412chr16105213 4828 3600 3353 3294 1450 1409 1358 523 193 24240 1683 15241 11862
NM_001042413chr9103718 3518 3353 2645 2596 1117 776 730 617 433 150 ----
NM_001042424chr432206 2079 867 13198 ----
NM_001042453chrX31574 1264 254 ------
NM_001042459chr32296 39 ------
NM_001042473chr1032061 1630 159 ------
NM_001042481chr1442235 2214 2085 1851 12473 12692 --
NM_001042486chr2011404 --1253 --
NM_001042492chr1763215 3130 2134 797 168 73 1134 ----
NM_001042493chr62382 90 --11287 --
NM_001042510chr841764 1596 1402 369 12071 11393 --
NM_001042511chr841764 1596 1402 369 12071 11393 --
NM_001042517chr13--2980 663 ----
NM_001042537chrX21736 591 --1542 --
NM_001042555chr1254617 4363 1382 1039 557 23389 2943 13152 14308
NM_001042599chr2107771 7106 7066 6288 6274 6144 5628 5243 4837 662 --15482 15896
NM_001042603chr1284289 4161 4127 4111 1449 1401 1312 1299 13619 44024 1797 966 753 35149 5044 2147
NM_001042604chr354035 3741 3525 1780 600 --24421 3038 --
NM_001042616chr41171 ------
NM_001042631chr192639 445 ------
NM_001042635chr142164 140 ------
NM_001042669chr461179 648 642 431 334 292 31871 1537 721 11547 --
NM_001042681chr132447 2232 883 12560 ----
NM_001042682chr132447 2232 883 12560 ----
NM_001042682chr132447 2232 883 12560 ----
NM_001042683chr631495 529 444 ----1593
NM_001042728chr1211085 --1428 1137
NM_001042749chrX51922 1584 1289 721 165 11267 ----
NM_001042750chrX51922 1584 1289 721 165 11267 ----
NM_001042751chrX51922 1584 1289 721 165 11267 ----
NM_001042762chr72883 173 ------
NM_001042784chr41123 ------
NM_001043318chr1464004 3722 3177 2577 1380 1108 11121 24087 1169 --
NM_001043351chr111428 ----1820
NM_001044305chr641568 1054 624 49 ------
NM_001044385chr254003 3686 3596 2568 1167 ------
NM_001044722chr532243 234 55 ------
NM_001044723chr532243 234 55 ------
NM_001046chr542167 2026 459 401 ------
NM_001049chr1422268 1512 --11691 --
NM_001050chr173536 346 163 2549 466 ----
NM_001068chr3140 ------
NM_001071775chr1331308 566 532 --11203 --
NM_001079874chr13505 368 196 --12074 --
NM_001081472chr11401 ------
NM_001083620chr451676 1634 880 742 210 --1998 --
NM_001087chr21142 ------
NM_001094chr174873 753 327 302 ------
NM_001099678chr356292 6100 4196 1003 260 ----15486
NM_001100108chr1107321 7179 6591 5795 5744 5107 2890 817 502 76 28342 6575 42564 2495 2224 1397 --
NM_001106chr3159652 8927 7640 7600 7266 6223 6127 3376 3095 2700 2268 2101 1703 1517 1257 38841 6333 2869 33794 3078 2095 --
NM_001113490chrX32304 871 73 11272 ----
NM_001121chr1021821 1800 1588 ----
NM_001122679chr52972 27 ------
NM_001123chr10--1666 --1520
NM_001128chr1631540 1009 931 ----12988
NM_001135chr15----189 --
NM_001146chr81275 --11862 --
NM_001148chr432123 2057 308 ----11946
NM_001149chr1021062 486 ------
NM_001157chr102636 280 --1229 --
NM_001160chr1282761 2743 2672 2383 1050 899 465 192 --22793 603 --
NM_001167chrX76535 5451 4996 2104 1364 1114 913 21209 567 11882 --
NM_001173chr1454739 4671 4435 1152 792 ------
NM_001174chrX32330 1972 242 11991 --11548
NM_001177chr1242311 2064 719 232 --21523 225 --
NM_001186chr2142072 2050 1263 1132 --1191 --
NM_001198chr651702 887 720 465 263 --12221 11824
NM_001200chr2011076 --11007 --
NM_001201chr42487 87 2703 355 12839 --
NM_001204chr2147756 7488 7430 7400 7187 5831 1952 646 544 494 475 207 132 37 27517 1853 26921 2117 25647 1356
NM_001206chr963067 2367 983 758 466 320 12176 ----
NM_001207chr51252 ------
NM_001222chr1031897 1715 662 ------
NM_001241chr231865 1594 1510 11737 1832 1678
NM_001241chr231865 1594 1510 11737 1832 1678
NM_001251chr171567 --1599 --
NM_001256chr1752895 2416 2213 2181 1941 --2675 59 12382
NM_001259chr785015 4966 4843 4583 2336 2238 1357 1211 1838 11119 --
NM_001271chr1533259 2075 2043 12951 12009 1353
NM_001273chr12----159 --
NM_001278chr1031093 969 288 ----1795
NM_001280chr191677 ----1137
NM_001284chr52511 104 --1179 --
NM_001290chr41872 ------
NM_001304chr1772978 2640 2415 1450 1117 1081 316 --194 --
NM_001310chr1242447 1916 908 305 --1172 11883
NM_001315chr651751 1645 553 261 91 ----1373
NM_001316chr201120 2446 105 1369 --
NM_001319chr1931032 720 410 ------
NM_001326chr11----148 --
NM_001328chr42487 163 --1256 --
NM_001329chr1031284 489 442 ----11552
NM_001331chr1172306 2083 1787 1127 1064 971 618 --11865 1291
NM_001332chr511088 --2985 474 --
NM_001343chr531359 1103 288 --1482 1655
NM_001346chr332638 2578 2024 1169 ----
NM_001351chr311129 ------
NM_001352chr19145 ------
NM_001356chrX52362 2093 1775 1672 1610 --22548 1547 --
NM_001357chr11250 190 ----
NM_001363chrX3741 620 527 --1178 --
NM_001364chr1184533 4229 4209 3848 2899 1082 349 107 14024 11587 1665
NM_001365chr172583 254 ------
NM_001378chr21175 ------
NM_001382chr11189 --1179 --
NM_001385chr81326 ------
NM_001386chr872131 1781 1639 879 852 708 195 1956 11798 --
NM_001387chr532703 2212 160 22903 2519 1798 --
NM_001389chr211546 ------
NM_001390chr1873227 2781 2761 2733 1384 1236 994 ------
NM_001391chr18148 ------
NM_001396chr2152553 1124 904 235 29 2335 255 ----
NM_001400chr151336 1282 1117 866 262 ------
NM_001402chr632031 1239 183 1694 ----
NM_001406chr1731330 1234 301 ------
NM_001407chr321068 577 ------
NM_001408chr131270 150 74 11372 11317 --
NM_001412chrX83403 3203 3145 2890 2449 1155 796 333 ----1556
NM_001416chr17----1193 1102
NM_001417chr1261790 1722 1380 1359 702 155 ------
NM_001419chr1994602 4091 1318 1205 1173 1140 986 85 65 12975 --11028
NM_001420chr1952412 2109 2092 2082 399 --22419 2245 --
NM_001423chr1221428 1323 --21542 735 --
NM_001427chr751757 1470 1378 363 254 ------
NM_001429chr221897 ------
NM_001430chr23442 134 73 ------
NM_001431chr621213 1140 --1914 --
NM_001432chr463933 3636 3486 3404 3179 1533 ------
NM_001438chr133198 3092 1416 ------
NM_001439chr11302 --11508 11551
NM_001440chr852511 2461 823 787 619 1368 1462 --
NM_001451chr1621049 521 --11273 --
NM_001452chr61162 1693 ----
NM_001453chr631476 389 227 --2377 332 --
NM_001454chr174897 821 624 123 ------
NM_001455chr674617 4422 4413 4255 3563 992 388 33345 1135 77 23981 1621 14314
NM_001458chr72683 191 ------
NM_001460chr153270 2382 2372 1072 1006 --2391 153 31196 226 176
NM_001463chr21263 --1646 --
NM_001483chr72410 204 ------
NM_001490chr933146 769 610 174 --21395 135
NM_001493chrX3714 606 514 --1584 --
NM_001495chr81125 ------
NM_001518chr71848 ------
NM_001521chr21584 ------
NM_001527chr663683 1453 1285 720 537 381 24353 1049 ----
NM_001530chr1421103 1063 2757 439 ----
NM_001533chr19192 ------
NM_001542chr14916 644 477 236 2987 754 12093 --
NM_001546chr631488 1439 1024 11201 ----
NM_001553chr4----168 --
NM_001554chr11126 ------
NM_001555chrX----143 --
NM_001560chrX1325 1945 ----
NM_001584chr1121039 464 ------
NM_001587chrX3415 397 381 ------
NM_001604chr11--1388 ----
NM_001608chr22757 629 --1257 --
NM_001609chr10104400 4159 4033 3729 3438 3037 1572 1322 685 65 14271 24179 1195 --
NM_001614chr172526 59 ------
NM_001614chr172526 59 ------
NM_001616chr283365 2784 2733 2630 2568 2383 2367 764 23410 2670 12576 11183
NM_001619chr1121039 152 ------
NM_001620chr113268 238 125 ------
NM_001621chr733010 1911 154 ------
NM_001621chr733010 1911 154 ------
NM_001622chr3187 ----1320
NM_001624chr631871 1760 1709 --21153 222 11593
NM_001634chr62593 190 --21498 235 --
NM_001635chr71259 --1678 --
NM_001650chr1844121 3331 1336 736 11306 1311 --
NM_001655chr1111415 21861 1360 ----
NM_001658chr1--1965 132 --
NM_001659chr1252678 2201 2134 395 141 1407 22064 1878 --
NM_001660chr32703 267 ------
NM_001661chr171568 --1639 --
NM_001663chr1442657 444 426 279 --1406 --
NM_001664chr3----1278 1131
NM_001665chr11165 ------
NM_001668chr162119 1935 1824 1782 481 344 ------
NM_001670chr22133 ------
NM_001676chr131164 ------
NM_001677chr121121 1112 --1715 --
NM_001678chr1721482 118 ------
NM_001679chr31756 --1272 --
NM_001681chr12121 ------
NM_001682chr1212537 22654 833 2603 97 12009
NM_001683chr321846 727 --1948 12485
NM_001684chr154168 4030 3402 852 809 1266 13593 21360 1256
NM_001688chr13313 255 239 --1193 --
NM_001693chr83303 65 31 ------
NM_001694chr163338 162 115 ------
NM_001695chr863811 3681 1505 1360 1353 103 1606 23920 2898 --
NM_001701chr941476 1347 1105 1039 ------
NM_001706chr31699 ------
NM_001707chr72227 195 ----1707
NM_001709chr1152567 1836 1798 1130 432 --12598 --
NM_001718chr621148 547 ------
NM_001730chr1331503 1040 207 ------
NM_001730chr1331503 1040 207 ------
NM_001731chr12153 ------
NM_001740chr162512 471 1412 ----
NM_001742chr7--1324 --11386
NM_001743chr24553 504 51 32 ------
NM_001745chr54768 466 366 235 ------
NM_001746chr522474 514 1314 12871 --
NM_001753chr731561 1304 1253 --11504 --
NM_001754chr2133041 1376 587 --1598 --
NM_001755chr1642235 1731 513 208 ----12260
NM_001759chr1255004 3392 1692 1528 1481 --44963 3318 1051 609 1653
NM_001769chr12------1105
NM_001773chr111325 ------
NM_001777chr383787 3743 2725 2649 1644 748 557 220 33904 1463 432 23147 733 --
NM_001791chr141334 1153 476 99 ------
NM_001792chr1831110 798 112 ------
NM_001796chr161199 ------
NM_001797chr164608 561 549 533 ------
NM_001798chr1231085 311 107 ----11102
NM_001800chr192492 81 ------
NM_001801chr52215 51 ------
NM_001802chr163836 108 30 1818 ----
NM_001826chr12333 91 ------
NM_001829chr42679 140 ------
NM_001830chrX33010 1338 448 --33287 837 579 --
NM_001839chr11269 --184 --
NM_001842chr93562 109 86 ------
NM_001845chr133360 345 174 ------
NM_001854chr111084 ------
NM_001855chr91639 ------
NM_001858chr694705 4288 4107 4082 4025 1786 1013 310 216 25152 44 23497 2061 --
NM_001859chr9--11007 3459 302 92 --
NM_001873chr42502 475 --1580 1260
NM_001874chr1234735 1689 817 --23298 1041 --
NM_001880chr21205 ------
NM_001882chr51408 ------
NM_001893chr171385 ------
NM_001894chr22--1160 1203 --
NM_001895chr2031175 1153 1060 ------
NM_001902chr11402 ------
NM_001904chr32671 248 ----1238
NM_001915chr1721601 1514 11952 22027 43 --
NM_001921chr41268 ----1164
NM_001923chr11146 ------
NM_001935chr21807 ------
NM_001936chr731229 659 152 1494 ----
NM_001938chr131901 1574 1498 1110 ----
NM_001939chrX83684 3633 3441 2660 2405 1476 1361 868 --1728 --
NM_001940chr122433 359 ------
NM_001945chr5--1157 1912 --
NM_001946chr124829 411 360 23 ------
NM_001949chr642816 1051 893 333 12156 ----
NM_001950chr161733 ------
NM_001955chr6----11080 --
NM_001961chr19----1373 --
NM_001962chr51425 125 ----
NM_001964chr52794 329 ------
NM_001967chr31166 --199 --
NM_001968chr42871 162 ------
NM_001969chr1463614 2688 1325 970 797 684 --1889 11043
NM_001977chr421774 140 ------
NM_001978chr81406 --1950 --
NM_001980chr1242073 1805 1500 163 12234 ----
NM_001981chr162310 1784 1553 916 867 545 --1266 --
NM_001982chr1221079 1073 ------
NM_001987chr1294190 3871 3729 3688 3402 1409 1140 431 140 --23551 619 --
NM_001992chr521382 504 ------
NM_001995chr43967 378 124 11229 ----
NM_001998chr31115 ------
NM_001999chr531525 358 108 ------
NM_002009chr1521912 694 1748 ----
NM_002010chr131217 ------
NM_002014chr122644 273 ------
NM_002015chr1333182 1342 197 ----13378
NM_002017chr1141311 245 166 106 ----1344
NM_002024chrX12061 ------
NM_002025chrX78638 8324 6967 6939 3634 985 630 12896 26822 6253 18963
NM_002026chr21429 ------
NM_002027chr8189 ----1440
NM_002028chr1411282 11289 --1139
NM_002031chr61620 ------
NM_002035chr1863876 3602 1611 1443 934 52 --33795 738 334 --
NM_002037chr62167 29 ------
NM_002039chr43886 681 352 ------
NM_002040chr2143038 2986 2298 149 ----12600
NM_002041chr15----194 --
NM_002046chr12--1168 ----
NM_002051chr102898 68 1141 1969 --
NM_002056chr21868 ------
NM_002061chr151568 1523 1217 610 572 --1162 --
NM_002062chr631260 297 34 --1559 --
NM_002063chrX31197 845 347 --132 --
NM_002065chr131363 720 404 --2516 145 11401
NM_002069chr721202 78 1417 ----
NM_002076chr1253196 2505 2366 1134 309 ------
NM_002081chr2--145 ----
NM_002082chr5131 ------
NM_002086chr1722152 1561 --11566 --
NM_002088chr19--1505 1134 --
NM_002092chr484555 4391 3284 2032 1222 1153 940 526 --34861 634 390 14025
NM_002094chr161113 ------
NM_002095chr82330 98 --156 --
NM_002106chr4----1105 --
NM_002126chr1753893 3661 2665 707 456 ----1223
NM_002129chr4159 ------
NM_002130chr511550 --11412 --
NM_002133chr221411 ------
NM_002136chr121270 ------
NM_002137chr722276 1994 --21913 1607 --
NM_002138chr42636 280 ------
NM_002139chrX1154 --1563 --
NM_002140chr93772 761 347 ------
NM_002145chr171103 ------
NM_002147chr173716 254 188 --1815 --
NM_002149chr2142 ------
NM_002156chr2--1345 ----
NM_002158chr242958 2608 882 409 23088 2328 ----
NM_002166chr21512 ------
NM_002167chr11486 ------
NM_002182chr352198 1091 676 611 593 1925 --12180
NM_002193chr231875 1256 622 ------
NM_002196chr20------1339
NM_002196chr20------1339
NM_002198chr52689 195 ----1613
NM_002199chr42891 362 ------
NM_002202chr51870 2920 422 --1722
NM_002207chr31491 ------
NM_002211chr1031089 1067 938 ----1221
NM_002214chr764561 4542 4093 3688 653 615 --11992 31358 1197 1098
NM_002222chr3------11069
NM_002223chr1233970 2939 255 --1610 --
NM_002226chr141652 ------
NM_002230chr172852 172 ------
NM_002239chr221187 250 ------
NM_002240chr212468 54 --187 --
NM_002242chr232013 1565 707 ------
NM_002249chr1--2510 75 ----
NM_002254chr21315 11553 --22180 1812
NM_002264chr364299 1587 758 319 132 60 --13241 --
NM_002265chr17--1487 ----
NM_002266chr172212 168 ------
NM_002267chr1321816 1661 11712 1953 1696
NM_002268chr311799 21813 448 ----
NM_002270chr5115222 4846 4304 4141 3809 3798 1726 1200 770 568 514 34878 4336 4119 13958 --
NM_002275chr171273 131 ----
NM_002285chr283250 3043 2558 1384 1320 1273 1256 142 11061 --11453
NM_002293chr132704 2684 395 ------
NM_002298chr1321506 562 ----1294
NM_002306chr141108 ------
NM_002310chr585354 4406 1919 1899 1352 743 707 439 --21811 693 --
NM_002312chr131685 ------
NM_002313chr1044738 4113 3747 863 1185 22049 1136 --
NM_002314chr721029 132 --1261 --
NM_002332chr121735 ------
NM_002333chr192419 313 ----11254
NM_002334chr1141717 420 243 100 --31349 1295 620 --
NM_002336chr12144945 4869 4526 4486 4423 3595 3373 1978 1635 1392 900 770 738 260 11649 --11793
NM_002350chr82501 218 --1240 --
NM_002351chrX21071 425 1432 2558 388 1297
NM_002354chr21359 ------
NM_002355chr122564 256 --31060 480 116 --
NM_002356chr652749 2057 1877 310 90 22235 1957 11071 --
NM_002359chr1794158 3410 3063 3015 1301 1286 1241 1093 937 --23509 1146 --
NM_002374chr253691 2641 2562 259 244 13710 22590 2465 --
NM_002375chr321546 765 --3685 383 50 --
NM_002381chr23934 710 67 1106 ----
NM_002382chr1421293 896 ------
NM_002383chr161896 --1793 --
NM_002384chr181681 ------
NM_002395chr63432 193 182 --31419 986 980 --
NM_002397chr531379 694 37 1360 11827 11650
NM_002399chr1511263 2985 180 ----
NM_002401chr1732237 1777 1637 ------
NM_002406chr5--134 21017 709 --
NM_002408chr143730 705 118 ------
NM_002430chr223470 278 227 12139 ----
NM_002436chrX2331 65 --1159 --
NM_002440chr1--187 ----
NM_002444chrX61785 1331 616 493 300 44 11441 --11550
NM_002449chr51946 ------
NM_002451chr973248 2907 1265 1241 745 660 112 ----13038
NM_002457chr111125 ------
NM_002465chr122272 49 ------
NM_002467chr81398 ------
NM_002478chr11--1488 ----
NM_002480chr121569 ------
NM_002486chr93789 89 82 ------
NM_002487chr151563 ------
NM_002492chr3175 ------
NM_002499chr1521807 221 11782 12012 11797
NM_002501chr1944109 3325 1526 1315 ------
NM_002505chr61504 ------
NM_002507chr1731915 761 696 1535 21504 494 --
NM_002509chr202674 289 ------
NM_002514chr81846 11193 ----
NM_002515chr1411329 ------
NM_002518chr231197 287 165 --1207 --
NM_002522chr1723220 2737 33666 2595 434 53925 3899 2932 2823 1326 --
NM_002524chr11229 ------
NM_002527chr121259 ------
NM_002538chr51229 ------
NM_002545chr1144120 3682 1312 684 --23374 1813 --
NM_002546chr8------1122
NM_002552chr22124 106 --1151 --
NM_002553chr71326 1427 ----
NM_002556chr1121562 815 --12121 --
NM_002568chr8----1421 --
NM_002569chr1541483 1297 313 259 --1348 --
NM_002576chr112411 94 11161 ----
NM_002577chr353896 2885 1557 459 440 ------
NM_002579chr19--21429 1009 ----
NM_002581chr955526 4152 4111 1273 763 --1819 25643 4131
NM_002586chr621075 995 ------
NM_002588chr52630 608 21283 285 ----
NM_002590chr13--1459 1453 --
NM_002594chr2012285 ------
NM_002595chr1221961 1333 --11237 --
NM_002600chr15713 684 585 378 193 ------
NM_002601chr21322 ------
NM_002607chr7--1249 1421 --
NM_002613chr1685399 4282 3710 1357 1314 1247 540 227 23786 1197 14254 --
NM_002618chr21123 ------
NM_002623chr202202 134 ------
NM_002624chr12170 ------
NM_002628chr331119 933 129 ------
NM_002629chr102618 289 --153 --
NM_002631chr1183 ------
NM_002633chr11515 ------
NM_002635chr121186 --1130 --
NM_002636chr61158 ------
NM_002641chrX41736 1653 193 71 ------
NM_002645chr1142160 1066 324 149 --12835 12636
NM_002648chr631025 860 491 --1828 134
NM_002655chr825253 4072 1590 23360 1129 --
NM_002657chr2093358 3320 3133 2470 2444 1513 1487 1421 769 1621 ----
NM_002666chr1521177 918 1378 ----
NM_002667chr631225 914 183 135 ----
NM_002687chr143509 167 158 1258 21202 836 --
NM_002697chr11208 ------
NM_002698chr1942686 2595 2361 349 --11055 11171
NM_002709chr223102 684 --12606 --
NM_002710chr122229 90 ----1407
NM_002711chr73737 334 319 ------
NM_002714chr61137 2872 724 1966 --
NM_002715chr51272 ----1165
NM_002716chr1193566 3193 3060 3016 2926 2877 2828 1403 897 13005 23278 648 21464 41
NM_002717chr82510 245 --1256 --
NM_002721chr9159 --1119 --
NM_002729chr102605 53 --1542 --
NM_002730chr19--2523 430 1333 --
NM_002731chr122902 1951 12265 12577 1485
NM_002734chr1731968 638 547 1606 ----
NM_002736chr751953 1613 1600 744 573 ------
NM_002737chr17126385 5804 4711 4429 4349 4301 2203 1417 1373 1250 1225 900 --35931 1882 1845 --
NM_002738chr1621094 434 ------
NM_002740chr372645 2516 2032 944 570 130 61 198 ----
NM_002741chr19172 ------
NM_002742chr142540 71 --1755 --
NM_002745chr2274503 3525 3313 1769 1555 1350 593 1765 ----
NM_002748chr152314 129 ------
NM_002755chr15--148 --1153
NM_002756chr175757 696 669 358 209 ------
NM_002763chr11421 --1221 --
NM_002779chr102538 216 --1448 --
NM_002794chr1--126 ----
NM_002810chr11130 ------
NM_002819chr1941405 1273 995 166 --11059 --
NM_002823chr21673 ------
NM_002825chr71460 ------
NM_002827chr2011308 1558 21476 196 11458
NM_002833chr1541148 406 276 114 ------
NM_002834chr1253616 3387 1539 759 316 1728 13898 --
NM_002835chr72494 130 ------
NM_002837chr1274370 4297 3596 2910 1687 1363 65 1496 23544 3075 --
NM_002839chr913197 13338 1682 --
NM_002840chr111352 ------
NM_002841chr3------2142 72
NM_002843chr1143193 2487 1375 686 --22905 896 --
NM_002844chr641285 1238 991 903 ------
NM_002845chr181104 1238 ----
NM_002846chr2148 ------
NM_002849chr123829 819 414 ------
NM_002851chr71173 ------
NM_002855chr1193577 3086 2679 2660 2553 761 592 309 106 12349 13590 --
NM_002858chr141244 1222 1216 244 ------
NM_002859chr1251856 1310 617 168 117 ------
NM_002860chr10154 1241 182 --
NM_002865chr81259 ------
NM_002867chr11145 ------
NM_002868chr1222399 2380 ------
NM_002869chr1142223 1403 533 386 ------
NM_002874chr932316 2243 244 ------
NM_002886chr354883 1957 1263 1237 655 --35202 5196 80 --
NM_002890chr521032 348 ----185
NM_002892chr1431640 1343 167 1487 ----
NM_002893chrX1298 ------
NM_002894chr182186 154 ------
NM_002897chr23609 159 107 ------
NM_002899chr3122 ------
NM_002901chr11--1403 ----
NM_002902chr151566 ------
NM_002906chr1142118 1752 1736 378 196 1736 --
NM_002912chr61273 1823 1631 --
NM_002940chr41685 1383 ----
NM_002941chr331606 1267 319 --2327 277 --
NM_002942chr32878 434 ----1213
NM_002945chr173861 675 359 ------
NM_002953chr11288 ------
NM_002955chr621608 379 --11630 --
NM_002956chr122448 30 ------
NM_002968chr1651114 858 285 203 73 --1755 --
NM_002970chrX----163 --
NM_002971chr33746 414 69 ------
NM_002973chr121124 ------
NM_002977chr251357 1180 419 338 178 23401 309 11303 32806 1189 1173
NM_002979chr11326 ------
NM_002985chr173718 53 39 1730 159 --
NM_002996chr1632009 1501 529 ------
NM_002997chr241703 1188 514 53 11959 21303 608 --
NM_002998chr851403 814 590 424 60 ------
NM_003002chr11146 --1288 --
NM_003010chr1752365 2233 1799 1531 1488 21988 754 12436 --
NM_003011chr92476 103 11080 11701 --
NM_003012chr832481 369 139 11097 ----
NM_003013chr44832 717 228 139 ------
NM_003016chr1721969 1716 --1249 --
NM_003017chr61893 ------
NM_003020chr152299 175 ------
NM_003022chrX2867 466 --1892 11228
NM_003028chr963920 3841 3465 1215 1140 783 --11475 --
NM_003030chr341364 1352 372 353 ------
NM_003031chr163920 905 331 ------
NM_003035chr13832 338 332 ------
NM_003036chr121168 264 ------
NM_003042chr362013 1971 1420 757 643 483 ----11384
NM_003043chr364233 4212 4158 3815 3802 3381 --13994 1387
NM_003046chr864998 4211 3964 2073 1265 769 --11116 --
NM_003047chr141300 1250 1227 78 ------
NM_003048chr262700 2600 2021 1126 875 731 ------
NM_003060chr52888 133 ----148
NM_003068chr811076 ------
NM_003069chrX3731 271 191 ------
NM_003070chr91622 ------
NM_003071chr331760 1752 687 --11399 --
NM_003074chr351672 1651 353 343 335 ----1580
NM_003076chr1221151 208 --188 --
NM_003077chr172190 64 ------
NM_003079chr173776 409 211 --1102 --
NM_003081chr201350 --1920 --
NM_003088chr71110 --2393 262 --
NM_003095chr121284 ------
NM_003101chr12491 182 128 ----
NM_003106chr31713 ------
NM_003107chr672227 2198 2100 1948 679 484 392 ----12463
NM_003108chr257272 6605 6575 6340 459 1829 45573 4874 2586 1002 --
NM_003110chr17------11101
NM_003111chr231226 1079 855 ------
NM_003112chr733207 2732 1038 ------
NM_003113chr23740 260 207 --129 1551
NM_003115chr11120 125 1468 --
NM_003128chr262444 2433 2070 1964 839 685 21971 884 21061 498 --
NM_003130chr731206 69 60 11265 --1259
NM_003131chr661888 1673 923 661 593 410 1289 11721 1399
NM_003136chr14175 --1105 --
NM_003137chr62461 117 --1262 --
NM_003139chr113876 865 611 ------
NM_003144chr632236 1856 555 ------
NM_003146chr112290 30 ------
NM_003151chr2164 ------
NM_003155chr852533 2474 2413 2163 620 ------
NM_003156chr1131193 349 34 --1363 --
NM_003161chr1723560 3352 ------
NM_003162chr241092 423 312 146 ------
NM_003171chr10138 ------
NM_003173chrX51383 1201 1194 1084 344 ------
NM_003174chr102289 149 ------
NM_003178chr332250 1439 663 ------
NM_003185chr2021253 931 ------
NM_003186chr11----1375 --
NM_003189chr173163 2647 2578 2348 1039 689 389 1519 1648 12523
NM_003199chr1895445 4959 4615 4268 3939 3826 3669 3484 1967 ----23756 1858
NM_003204chr1711178 21572 1290 ----
NM_003206chr61418 ------
NM_003217chr1251762 773 631 593 62 ----1707
NM_003221chr662997 2890 2803 2781 1006 579 1831 --13907
NM_003222chr2011258 1813 ----
NM_003236chr232885 2398 437 ------
NM_003246chr1521934 271 11963 ----
NM_003247chr641682 1662 1414 292 --1643 21911 1330
NM_003250chr172186 180 ------
NM_003253chr2161811 1601 1494 619 446 105 11927 ----
NM_003255chr1722471 378 --2988 868 --
NM_003257chr1521233 244 --11389 --
NM_003262chr364044 3456 3393 2084 1207 1154 --23486 1298 --
NM_003269chr611261 ------
NM_003270chrX2798 753 1909 ----
NM_003272chr1--1200 1635 --
NM_003274chr2132050 1888 858 ------
NM_003281chr175121 4301 4271 4048 3862 3636 2168 1538 13465 11857
NM_003285chr1195 ----1454
NM_003286chr2031039 390 77 ------
NM_003290chr19165 ------
NM_003292chr112189 --1256 --
NM_003295chr13--159 ----
NM_003297chr12--142 ----
NM_003298chr385920 5730 2465 2415 1905 1626 1575 1363 1727 31939 501 461 25951 2008
NM_003299chr12------1234
NM_003304chr31206 --21364 1085 --
NM_003305chr41296 ------
NM_003318chr61219 ------
NM_003323chr19--144 ----
NM_003326chr142445 953 752 646 1883 12342 --
NM_003334chrX132 ----1145
NM_003338chr1031807 547 311 11474 ----
NM_003339chr521591 1313 11455 ----
NM_003340chr41433 ----1966
NM_003341chr3------1168
NM_003342chr1733075 2252 343 ------
NM_003344chr721741 1218 --11513 --
NM_003345chr16169 ------
NM_003347chr2232088 1841 612 1371 1274 --
NM_003348chr1241524 1518 1450 631 --31308 1086 166 --
NM_003349chr2041336 1089 346 95 ------
NM_003350chr82867 23 1791 ----
NM_003358chr91136 ------
NM_003359chr431292 1181 1150 ------
NM_003363chr31537 ------
NM_003367chr191432 ------
NM_003369chr1142146 735 383 190 ------
NM_003371chr941899 1615 538 448 22110 638 ----
NM_003373chr1021636 1480 ------
NM_003374chr52585 39 ------
NM_003376chr621465 1350 --21361 279 --
NM_003376chr621465 1350 --21361 279 --
NM_003380chr101213 ------
NM_003383chr9----1182 --
NM_003385chr24332 321 147 141 ------
NM_003387chr242875 2100 820 212 21815 1107 ----
NM_003390chr1111095 --1876 --
NM_003392chr344345 4123 3279 537 ----13624
NM_003399chrX31059 833 52 ------
NM_003400chr21646 ------
NM_003403chr141756 --1207 --
NM_003404chr20----11857 --
NM_003405chr22--167 1543 --
NM_003406chr81639 ----11505
NM_003409chr1821107 26 --1207 --
NM_003410chrX62696 828 699 501 309 161 22084 2021 1506 --
NM_003411chrY31617 693 70 ------
NM_003412chr362929 2798 2735 2295 1110 360 --1306 12311
NM_003413chrX3797 309 121 --1260 --
NM_003418chr31122 ------
NM_003420chr32829 321 1712 ----
NM_003423chr191705 --12006 --
NM_003432chr5----1518 --
NM_003436chr192818 716 --1601 --
NM_003442chr112834 684 ------
NM_003452chr92925 898 ------
NM_003453chr131308 ------
NM_003455chr11--2630 501 --176
NM_003458chr363806 3800 3368 2624 970 385 23482 3410 1360 --
NM_003463chr673299 2499 2311 997 907 810 489 22857 237 23128 212 --
NM_003467chr23486 381 122 ------
NM_003468chr233508 1112 206 ----169
NM_003469chr21176 ------
NM_003470chr1671813 1555 1365 1347 1181 577 394 ------
NM_003471chr32234 102 --21692 532 --
NM_003472chr63328 233 211 11518 1964 --
NM_003478chr1133355 2915 326 11128 12801 1153
NM_003482chr1232751 1013 702 ------
NM_003483chr1252859 1909 1821 970 557 1836 ----
NM_003487chr17----163 --
NM_003488chr173878 391 33 ------
NM_003489chr2161087 871 525 362 335 168 13341 ----
NM_003498chr163373 231 107 12182 1795 --
NM_003506chr82995 97 ------
NM_003507chr261797 1662 1586 740 620 41 1479 ----
NM_003557chr131580 282 69 --11102 21429 1239
NM_003558chr91221 ------
NM_003559chr1723891 3254 --33654 3120 554 --
NM_003563chr1751160 1138 982 567 426 --11294 --
NM_003566chr1232218 1033 867 --12460 --
NM_003574chr1895804 5606 4692 4181 4161 4040 697 324 136 14581 43816 3611 1574 610 --
NM_003575chr751564 1350 1275 1005 69 --11479 --
NM_003576chr1342757 1020 715 570 --22688 804 --
NM_003579chr12128 61 ------
NM_003581chr2--1157 1673 --
NM_003583chr1222696 737 --12665 --
NM_003590chr253473 3082 2947 1076 749 --1457 11206
NM_003592chr7--1329 ----
NM_003597chr262172 1569 914 840 775 434 11874 1603 --
NM_003602chr71440 ------
NM_003603chr442093 624 540 483 ------
NM_003607chr184281 4103 4028 3729 3621 813 589 345 13674 33204 1558 657 23212 3187
NM_003610chr202350 270 ------
NM_003613chr15------1671
NM_003615chr353630 3129 1284 825 252 12881 ----
NM_003618chr21503 ------
NM_003620chr173693 392 158 1809 ----
NM_003621chr111513 ------
NM_003628chr2----172 --
NM_003629chr183499 3322 2958 2397 1333 1267 419 99 ----13376
NM_003632chr171601 ------
NM_003633chr53755 334 261 ------
NM_003642chr2297 87 ------
NM_003644chr17176281 6253 5545 5366 5222 5205 4474 4353 4124 2057 1702 1140 1058 372 296 255 214 24003 1032 25561 4228 --
NM_003648chr232554 563 345 1800 11011 --
NM_003651chr121527 ------
NM_003659chr21829 ------
NM_003663chr343373 991 685 119 --12947 13159
NM_003670chr3----21004 482 --
NM_003672chr131937 1351 721 --189 --
NM_003673chr171103 ------
NM_003676chr12647 61 ------
NM_003692chr91269 ------
NM_003701chr13--1740 ----
NM_003705chr22788 166 ------
NM_003713chr11174 --31076 105 58 --
NM_003716chr31735 --2984 978 --
NM_003722chr332660 2373 469 12728 1108 --
NM_003728chr41507 ------
NM_003735chr52630 608 21283 285 ----
NM_003736chr52630 608 21283 285 ----
NM_003743chr242127 1953 905 425 --1558 --
NM_003744chr14----127 --
NM_003745chr16164 ------
NM_003746chr12--196 ----
NM_003749chr1312181 --22304 2150 12270
NM_003750chr101953 ------
NM_003758chr15--21075 395 1182 --
NM_003758chr15--21075 395 1182 --
NM_003760chr11560 ------
NM_003763chr2043084 2859 876 713 ------
NM_003766chr17126 ------
NM_003768chr111819 --11530 --
NM_003772chr112385 348 ------
NM_003782chr61261 ------
NM_003782chr61261 ------
NM_003782chr61261 ------
NM_003787chr1851457 1319 673 613 431 1527 ----
NM_003794chr31967 11094 1435 --
NM_003795chr6----1223 --
NM_003796chr194473 464 422 240 ------
NM_003797chr11------170
NM_003799chr1863728 2756 1825 995 255 177 --11307 --
NM_003800chr632306 1877 1661 ----21901 460
NM_003818chr202894 821 ------
NM_003822chr152913 968 896 330 125 1665 11084 13135
NM_003825chr153575 371 290 ------
NM_003846chr1----1709 --
NM_003850chr131238 1270 ----
NM_003861chr1452904 2830 2511 2419 320 ----1413
NM_003862chr51247 ------
NM_003872chr21693 --22716 862 --
NM_003884chr311783 ------
NM_003885chr1742317 1046 654 284 12094 1926 --
NM_003887chr252306 2046 1660 876 788 ----167
NM_003895chr2131618 790 32 ------
NM_003899chr1362401 2251 649 343 291 118 --21875 727 --
NM_003901chr1072663 2575 2083 1702 1047 512 151 12259 3521 224 95 --
NM_003908chr2031106 1068 21 159 ----
NM_003909chr83686 530 189 1973 ----
NM_003913chr633258 3127 649 1795 --13599
NM_003916chrX2117 28 ----1102
NM_003924chr421410 609 ------
NM_003927chr181727 --185 --
NM_003930chr732490 233 33 12037 ----
NM_003931chr63586 527 92 ------
NM_003934chr941320 1098 1041 479 ------
NM_003939chr1053150 3069 2824 1516 28 21235 381 23335 375 1361
NM_003940chr3152 ------
NM_003941chr741678 1629 923 129 12080 ----
NM_003949chr1721657 266 12015 ----
NM_003953chr122268 332 12067 1249 --
NM_003957chr113960 839 436 ------
NM_003958chr673821 3184 3077 2682 1491 155 115 --13414 --
NM_003966chr5107219 5848 5231 5184 4753 2190 1997 1159 626 26 1779 36230 5654 553 --
NM_003968chr32676 503 ------
NM_003969chr192235 124 ------
NM_003970chr81143 --1449 --
NM_003971chr171546 ------
NM_003972chr101140 ------
NM_003980chr651070 1018 937 593 581 ------
NM_003983chr1634194 4015 3186 ------
NM_003994chr1213276 24110 1313 --1135
NM_003998chr41597 2535 269 ----
NM_004006chrX52125 2003 1792 570 519 1336 ----
NM_004007chrX52125 2003 1792 570 519 1336 ----
NM_004009chrX52125 2003 1792 570 519 1336 ----
NM_004010chrX52125 2003 1792 570 519 1336 ----
NM_004011chrX52125 2003 1792 570 519 1336 ----
NM_004012chrX52125 2003 1792 570 519 1336 ----
NM_004013chrX52125 2003 1792 570 519 1336 ----
NM_004014chrX52125 2003 1792 570 519 1336 ----
NM_004015chrX52125 2003 1792 570 519 1336 ----
NM_004016chrX52039 1917 1706 484 433 1250 ----
NM_004017chrX52125 2003 1792 570 519 1336 ----
NM_004018chrX52039 1917 1706 484 433 1250 ----
NM_004020chrX52125 2003 1792 570 519 1336 ----
NM_004021chrX52039 1917 1706 484 433 1250 ----
NM_004022chrX52039 1917 1706 484 433 1250 ----
NM_004023chrX52039 1917 1706 484 433 1250 ----
NM_004028chr1844121 3331 1336 736 11306 1311 --
NM_004036chr22660 268 ----1676
NM_004040chr231258 1016 427 ------
NM_004050chr1461855 1731 780 623 558 307 --12465 --
NM_004055chr1142001 1663 211 121 1573 21440 370 --
NM_004061chr51241 ------
NM_004063chr8----2163 118 --
NM_004067chr741007 520 509 222 --11293 --
NM_004073chr12308 52 ------
NM_004080chr711375 1530 11023 --
NM_004081chrY21176 1159 ------
NM_004087chr331741 1329 60 ----11305
NM_004089chrX21160 886 ------
NM_004090chr1742617 1314 205 119 21280 188 ----
NM_004093chr1352940 2691 2406 839 171 1439 ----
NM_004094chr1442567 2545 1070 745 1338 --1444
NM_004098chr101501 ------
NM_004100chr632456 1790 827 ------
NM_004103chr82736 66 1122 ----
NM_004112chr1731421 1372 634 ------
NM_004113chr341961 659 442 186 11685 --12022
NM_004114chrX1841 11011 ----
NM_004116chr2----1189 --
NM_004124chr1473438 2781 2647 1435 1164 254 246 1411 ----
NM_004128chr132335 153 ------
NM_004136chr1542565 2164 787 351 1728 ----
NM_004137chr5--130 ----
NM_004156chr81231 ------
NM_004161chr211231 ------
NM_004170chr911410 21354 704 11288 --
NM_004171chr11189295 8650 8193 8012 7387 7070 6761 6017 3837 3474 3098 2836 2395 1832 1316 888 839 149 36253 2812 187 36337 3189 1965 27566 284
NM_004180chr2----1535 --
NM_004183chr111687 1644 ----
NM_004185chr12686 677 ------
NM_004186chr3143 ----1936
NM_004200chr1153124 2890 1044 955 233 12533 12873 --
NM_004225chr821284 64 ------
NM_004227chr713122 --12666 --
NM_004229chrX11522 1248 12118 --
NM_004231chr7--159 1261 --
NM_004232chr1863841 2447 1295 983 92 24 22746 2413 13038 --
NM_004235chr93847 752 140 ------
NM_004236chr152462 157 ------
NM_004237chr51823 ----1213
NM_004238chr22231 106 ------
NM_004241chr101732 ------
NM_004242chr61436 ------
NM_004267chr32353 144 ------
NM_004272chr521457 484 --21364 657 1524
NM_004274chr1432113 749 324 ------
NM_004282chr61694 --1221 --
NM_004293chr922551 620 --23519 2398 --
NM_004295chr1711278 ------
NM_004301chr32248 108 ------
NM_004302chr121712 ------
NM_004311chr1032765 642 577 --22360 2249 --
NM_004319chr131072 537 146 31047 570 264 --12231
NM_004320chr162332 75 ------
NM_004323chr962712 2551 2411 652 387 321 1116 12035 12126
NM_004326chr11772 132 ----
NM_004329chr101400 ------
NM_004331chr841786 958 806 371 ------
NM_004337chr852031 1572 395 264 63 137 11588 --
NM_004338chr1836684 5443 2175 --16087 25865 4668
NM_004342chr7--1844 ----
NM_004346chr411397 ------
NM_004349chr821130 923 ------
NM_004354chr41730 ------
NM_004359chr19121 ------
NM_004364chr1951235 1187 1058 934 85 21072 351 ----
NM_004369chr2162 ------
NM_004370chr641727 1561 657 487 --21555 530 --
NM_004379chr221246 158 ------
NM_004380chr161614 ------
NM_004384chr532243 234 55 ------
NM_004385chr53557 494 258 ------
NM_004386chr1942229 2057 1818 298 1304 ----
NM_004389chr21754 --1715 --
NM_004392chr1351958 1751 634 388 263 ------
NM_004393chr311725 --31464 374 221 --
NM_004397chr1163387 2635 1705 1673 1609 1346 33230 1664 350 13033 --
NM_004407chr4----1370 --
NM_004411chr72670 74 ------
NM_004415chr61622 1628 ----
NM_004419chr1041077 948 877 682 1804 ----
NM_004422chr17172 ------
NM_004427chr121025 401 ------
NM_004429chrX31452 351 201 31172 331 85 ----
NM_004430chr852782 2087 932 457 132 12026 11103 --
NM_004434chr142774 589 31798 1389 376 --1765
NM_004437chr123194 1333 --23188 1410 23413 387
NM_004438chr252827 2242 1117 741 728 ------
NM_004439chr41126 ------
NM_004440chr621602 1502 ------
NM_004441chr3--11295 11129 --
NM_004447chr121783 --1383 --
NM_004450chr141153 ------
NM_004454chr341476 537 307 104 --1742 --
NM_004455chr131095 368 300 ------
NM_004456chr72263 208 ------
NM_004457chr251596 1284 1246 581 523 1239 ----
NM_004458chrX62644 2253 1698 1627 1060 180 --22425 375 --
NM_004459chr1741742 1440 1325 766 ----1212
NM_004469chrX1379 155 ----
NM_004480chr141268 ------
NM_004481chr142519 2113 1703 668 1563 ----
NM_004491chr1954378 4309 2999 2686 367 13297 ----
NM_004496chr141293 --1860 --
NM_004499chr5------1485
NM_004501chr164091 3320 3176 2803 1069 763 ------
NM_004504chr23588 78 65 1828 1651 --
NM_004505chr171287 --1560 1574
NM_004506chr63478 163 137 ------
NM_004514chr1732712 2664 599 --22435 2241 --
NM_004516chr1951070 1032 867 187 132 ------
NM_004520chr51612 2540 264 ----
NM_004523chr101573 ------
NM_004525chr22120 42 ----11147
NM_004529chr931304 1259 85 21236 509 ----
NM_004543chr22328 24 ------
NM_004566chr1032554 2187 809 --2884 697 --
NM_004569chr14----1209 1675
NM_004571chr2152934 2248 1289 581 139 1684 ----
NM_004575chr431509 1445 1159 11146 ----
NM_004583chr171291 --1314 1777
NM_004586chrX25036 4045 33592 1933 1386 11995 24466 930
NM_004588chr1134027 3858 3688 --23662 3650 --
NM_004591chr23333 131 59 ------
NM_004593chr34862 767 226 74 ------
NM_004595chrX1364 ------
NM_004598chr5103026 2855 2221 1165 841 822 767 425 170 30 12838 ----
NM_004603chr72781 307 1835 ----
NM_004614chr1672345 2224 1704 1515 870 502 83 1207 21815 1760 11911
NM_004615chrX5803 725 672 627 111 ------
NM_004620chr11156 ----1258
NM_004622chr221567 27 22300 1763 1292 1528
NM_004626chr112468 141 ------
NM_004630chr113998 770 277 1758 ----
NM_004637chr331268 420 228 ------
NM_004642chr123482 286 171 ------
NM_004643chr141731 ------
NM_004645chr17138 ----1695
NM_004654chrY31396 1138 464 ------
NM_004655chr1721268 47 11056 ----
NM_004657chr231530 363 69 1541 ----
NM_004660chrY62018 1707 1554 1483 615 530 ------
NM_004663chr1561393 1354 1238 976 168 79 ----1381
NM_004685chr1352688 2539 2230 2047 1112 12265 1434 22653 1198
NM_004686chr8--21642 314 ----
NM_004687chr1711822 11598 ----
NM_004689chr141447 ------
NM_004694chr172598 196 ------
NM_004698chr1134 --1145 --
NM_004703chr1721034 285 --1551 --
NM_004705chr112225 93 ------
NM_004709chrX11800 ----11381
NM_004711chr2263357 2944 2774 996 582 112 ------
NM_004713chr141150 2773 123 ----
NM_004714chr191328 ------
NM_004715chr181150 ------
NM_004718chr23519 451 108 1172 ----
NM_004719chr1222485 2199 ------
NM_004721chr31355 ------
NM_004723chr12988 350 2121 78 1406 11036
NM_004726chrX104910 4485 3972 3794 1936 1858 1341 779 147 37 23993 82 14971 --
NM_004730chr521735 299 ----11817
NM_004734chr133897 587 466 ------
NM_004736chr1--1235 ----
NM_004738chr20----1119 --
NM_004739chr112194 175 ------
NM_004742chr331868 130 91 ------
NM_004744chr443750 3611 3326 1471 ------
NM_004745chr824400 1155 15525 14644 --
NM_004748chr1594257 3811 3799 3784 2714 2684 758 418 46 --23722 1666 12876
NM_004757chr42535 99 ------
NM_004760chr722384 361 1793 1580 --
NM_004762chr1731524 626 141 --21988 254 --
NM_004764chr121207 ------
NM_004768chr11472 --1834 1201
NM_004772chr541389 1162 359 127 --11365 --
NM_004774chr1722259 251 ------
NM_004775chr1862301 2227 1711 705 684 399 --12333 --
NM_004781chr151425 1280 547 541 198 2598 323 --1680
NM_004781chr151425 1280 547 541 198 2598 323 --1680
NM_004783chr16----1515 --
NM_004785chr161362 ------
NM_004786chr18------1198
NM_004788chr1132719 1097 608 --1150 12711
NM_004792chr2--159 ----
NM_004796chr1422184 1601 --11891 --
NM_004798chr2071432 685 501 380 299 284 40 --1564 --
NM_004801chr23492 255 170 --11395 --
NM_004808chr1033390 3336 248 --1266 12277
NM_004817chr91264 ------
NM_004822chr1724026 2618 13660 ----
NM_004824chr611361 ------
NM_004826chr2----1294 --
NM_004831chr193939 430 36 ------
NM_004834chr263370 3356 2579 2521 348 328 12757 1961 13250
NM_004836chr22275 189 1837 ----
NM_004837chr121470 317 ------
NM_004841chr12326 148 ------
NM_004842chr611240 21530 323 ----
NM_004844chr341196 1034 345 201 ------
NM_004845chrX103646 3505 2996 2990 1640 1543 1121 804 724 587 21332 258 24149 2665 --
NM_004846chr2157 ------
NM_004849chr651607 1355 1171 558 68 ------
NM_004859chr1762339 1955 746 643 561 100 ------
NM_004860chr172529 41 --1194 --
NM_004863chr1434528 3852 265 13971 ----
NM_004865chr61168 ------
NM_004866chr541812 854 466 156 ------
NM_004867chrX------1168
NM_004871chr1754303 3744 3400 2850 2669 ------
NM_004874chr8------1402
NM_004879chr11--1264 ----
NM_004884chr1541249 553 433 246 ------
NM_004893chr51113 ------
NM_004896chr102464 336 ----11241
NM_004897chr101903 ------
NM_004902chr201215 ------
NM_004904chr786404 5405 4749 4412 2548 1674 339 321 25598 593 1809 --
NM_004905chr14878 651 325 263 ------
NM_004906chr63454 181 90 ------
NM_004915chr212577 518 ------
NM_004921chr11272 ------
NM_004924chr193988 890 405 ------
NM_004926chr1411131 11137 21752 710 --
NM_004929chr811488 21441 25 1262 --
NM_004943chr1931112 859 204 1414 ----
NM_004947chr321608 523 2341 47 ----
NM_004949chr1832082 691 583 11703 --2836 676
NM_004956chr784444 2791 1508 739 584 528 427 31 11309 --13858
NM_004961chrX31172 980 458 163 ----
NM_004965chr21146 ------
NM_004972chr931047 409 337 --1264 --
NM_004973chr631588 1260 72 11450 ----
NM_004976chr1155108 4450 3887 2037 1459 15102 ----
NM_004978chr11513 ------
NM_004985chr1234194 4169 2774 ------
NM_004992chrX198544 7450 7146 7002 6991 6918 5769 5761 5519 5414 5401 5170 2397 2207 1943 1853 1847 1339 279 26791 2296 11486 --
NM_004992chrX198544 7450 7146 7002 6991 6918 5769 5761 5519 5414 5401 5170 2397 2207 1943 1853 1847 1339 279 26791 2296 11486 --
NM_004993chr143541 375 310 11078 11274 --
NM_004995chr1461497 1080 1058 506 122 43 ------
NM_004998chr151337 ------
NM_004999chr6--2279 38 1875 --
NM_005005chr8162 ------
NM_005010chr731950 1782 1710 31996 1462 557 ----
NM_005011chr721571 1307 1724 11541 --
NM_005020chr72456 42 ------
NM_005023chr511202 11501 ----
NM_005028chr1022154 99 1710 21507 835 --
NM_005032chrX2393 353 --31002 322 307 --
NM_005036chr2277574 5832 5752 5060 3293 2830 84 26419 1195 38338 6701 3010 16214
NM_005045chr71732 ------
NM_005054chr231682 1161 551 ------
NM_005056chr1284533 4405 4371 4355 1693 1645 1556 1543 13863 44268 2041 1210 997 25393 5288
NM_005057chr151878 608 426 377 316 137 ----
NM_005060chr121104 22 --11219 --
NM_005063chr1043384 2904 2508 483 ------
NM_005066chr12774 71 ------
NM_005070chr21238 ------
NM_005072chr162192 108 ------
NM_005076chr144173 2955 2614 830 --24004 1603 --
NM_005078chr1541774 1336 1319 417 --1340 --
NM_005079chr822763 2274 --23204 2967 166
NM_005087chr3--168 ----
NM_005088chrX1739 ------
NM_005093chr20104715 4120 3815 3796 1170 1034 901 723 678 174 14251 --14059
NM_005096chrX31027 377 250 ------
NM_005099chr1--11319 ----
NM_005103chr111225 ------
NM_005105chr132135 1536 85 --2459 296 11646
NM_005109chr352385 2284 2060 591 562 11682 1312 1775
NM_005110chr52737 160 ------
NM_005114chr4--1531 ----
NM_005116chr2063274 1299 986 307 212 57 1410 12807 24013 1833
NM_005119chr131188 1182 1089 ------
NM_005121chr1731531 1342 394 --1534 --
NM_005124chr6----1765 --
NM_005126chr342182 2028 1698 519 --12022 --
NM_005133chr111386 ------
NM_005151chr1852201 903 429 389 251 --1318 --
NM_005156chr945108 4722 4647 1439 1512 34241 1752 89 --
NM_005164chr1222585 1006 11892 1800 --
NM_005168chr21633 --21490 580 --
NM_005180chr1031339 503 377 --11497 --
NM_005184chr1931216 456 353 --21026 220 --
NM_005188chr11137621 7463 6811 6184 6002 5500 5355 3086 2733 2081 1328 1231 313 35813 5224 671 56445 5580 2235 1276 111 28220 2708
NM_005189chr1742389 595 440 398 --1259 --
NM_005190chr61137 ------
NM_005191chr321264 108 ------
NM_005197chr14106088 5387 5201 4700 4050 4021 2163 1335 160 107 1316 --14498
NM_005204chr10----1994 --
NM_005207chr2233550 3219 2827 12653 1415 33282 1180 1046
NM_005219chr531754 1679 725 --21370 383 --
NM_005221chr72131 47 ------
NM_005222chr71299 --1242 --
NM_005227chr13453 428 156 ------
NM_005230chr121101 ------
NM_005231chr1141290 1259 328 166 ----2979 283
NM_005233chr312505 ------
NM_005235chr2107771 7106 7066 6288 6274 6144 5628 5243 4837 662 --15482 15896
NM_005238chr1163512 2404 1312 1201 951 673 ------
NM_005241chr31200 --11236 --
NM_005242chr51534 11270 --11251
NM_005243chr221119 ------
NM_005244chr201625 ------
NM_005245chr41732 ------
NM_005249chr14--1260 ----
NM_005254chr1531353 1118 152 --11231 --
NM_005256chr111830 ------
NM_005263chr1185 164 ----
NM_005264chr103620 162 71 ------
NM_005271chr103490 354 284 --1242 --
NM_005277chr431596 1511 346 ------
NM_005284chr61456 ------
NM_005311chr752851 752 736 627 399 --1336 --
NM_005312chr961868 1711 1700 976 666 232 ------
NM_005316chr1121121 1052 ------
NM_005318chr2221256 236 1303 199 --
NM_005328chr81546 --1278 --
NM_005329chr1632197 1556 785 1675 ----
NM_005336chr251957 1841 820 800 397 ------
NM_005339chr4134055 3851 3843 3730 3640 3603 3006 2852 1241 1169 816 710 34 2631 576 31021 744 107 --
NM_005342chrX32095 567 449 12147 --12787
NM_005348chr143597 387 330 ------
NM_005349chr41508 ------
NM_005359chr1885185 5128 4017 1721 1358 604 562 141 36133 1171 198 56484 4563 2274 2108 1635 1626
NM_005376chr121119 226 ------
NM_005380chr1--11263 --1418
NM_005381chr22399 346 ------
NM_005382chr81462 ------
NM_005386chr201712 --1728 --
NM_005387chr112252 142 --1187 --
NM_005388chr91491 ------
NM_005392chr931836 1567 108 --1761 --
NM_005393chrX1251 ------
NM_005397chr783875 3179 3111 2448 1438 1392 341 192 ----12460
NM_005398chr1011133 134 11148 --
NM_005399chr193888 3271 3114 2778 1674 1454 875 475 149 --13472 --
NM_005400chr252318 1023 642 148 25 1439 42832 589 410 205 12998
NM_005406chr183479 186 144 --11243 --
NM_005407chr1441477 1400 1125 1067 --11310 --
NM_005415chr21596 ------
NM_005417chr203653 559 70 1474 --11487
NM_005418chr111474 ------
NM_005433chr184968 744 532 461 ------
NM_005436chr1063981 3258 3133 2674 1563 301 --23937 1515 --
NM_005437chr1031458 493 346 173 1424 --
NM_005439chr122378 27 ------
NM_005442chr35578 454 100 76 38 1611 ----
NM_005455chr151663 1318 705 678 454 ------
NM_005460chr5177 ------
NM_005461chr2041995 1431 698 31 ------
NM_005465chr121732 199 ------
NM_005467chr111159 ------
NM_005474chr1721533 115 --1639 --
NM_005475chr1243271 3181 729 231 ------
NM_005476chr91349 --161 --
NM_005479chr102511 407 21556 1306 ----
NM_005487chr2222025 407 ------
NM_005497chr1746135 2322 916 281 11016 ----
NM_005499chr192668 143 ------
NM_005502chr943114 2805 2560 208 ------
NM_005503chr15----11006 2242 167
NM_005504chr1296553 6183 4650 4485 2404 2206 1464 757 672 24782 2155 11689 11104
NM_005509chr53717 134 106 ----11630
NM_005520chr5--1756 ----
NM_005522chr72947 389 1319 ----
NM_005542chr741930 1445 1384 1274 1632 --11786
NM_005561chr133208 187 134 --1927 --
NM_005563chr12802 237 --1593 --
NM_005566chr112420 207 ------
NM_005569chr2231488 1230 229 11450 1336 --
NM_005573chr51707 ------
NM_005575chr5169 ------
NM_005578chr344372 3198 238 122 11323 44770 1025 491 430 23747 3379
NM_005581chr19----1366 --
NM_005587chr1521002 311 ------
NM_005593chr121511 1139 ----
NM_005595chr12942 274 ------
NM_005596chr975428 4924 1990 1569 1492 1362 473 16002 35022 1862 1403 --
NM_005598chr141589 677 621 276 11414 21369 1337 --
NM_005604chr651951 1912 693 627 75 ------
NM_005605chr81275 ------
NM_005607chr8------126
NM_005614chr751101 1024 973 823 768 ------
NM_005619chr19----171 --
NM_005627chr62794 625 ------
NM_005632chr1611008 ------
NM_005634chrX2143 96 --1221 --
NM_005637chr18----21652 1646 --
NM_005638chrX41482 604 570 138 ------
NM_005639chr12129 ------
NM_005647chrX23245 3133 ----13205
NM_005648chr81146 ------
NM_005650chr2221242 1095 ------
NM_005655chr821323 327 ------
NM_005656chr2161415 1193 475 206 129 58 11002 ----
NM_005660chrX1230 --2256 47 --
NM_005662chr81393 ------
NM_005667chr2148 ------
NM_005668chr541539 1297 1211 978 1402 23304 1329 --
NM_005684chr1--177 ----
NM_005688chr33960 447 94 ----11093
NM_005715chr62982 156 ----22258 251
NM_005717chr11113 --1121 --
NM_005718chr31708 1149 1869 --
NM_005722chr221677 959 ------
NM_005730chr1293534 3428 2915 2423 2379 2220 614 593 339 11217 22955 1175 21210 262
NM_005731chr2--154 ----
NM_005734chr113254 184 165 ------
NM_005736chr1021212 354 --1993 11151
NM_005738chr751899 1857 1669 1493 86 ------
NM_005746chr7--22616 228 ----
NM_005748chr1243355 3338 3282 1155 2825 551 1891 --
NM_005749chr172591 546 1158 ----
NM_005751chr7--1140 1378 --
NM_005754chr52339 272 ------
NM_005756chrX41494 1455 1381 535 --11285 --
NM_005759chr294487 4405 3677 3349 3258 1834 1784 1387 23 11495 --13083
NM_005766chr1311358 ------
NM_005768chr122479 73 --1197 --
NM_005776chr142616 158 ------
NM_005777chr3140 --179 --
NM_005779chr563661 2633 526 426 379 42 --22955 2552 1706
NM_005782chr17----151 --
NM_005801chr17--2541 73 ----
NM_005802chr9--2841 817 ----
NM_005808chr31995 23067 1052 ----
NM_005819chr152986 1365 781 335 282 12780 23502 2844 --
NM_005826chr14626 483 452 108 ------
NM_005828chr1764983 4731 4542 4127 3761 632 11865 14660 14576
NM_005832chr31498 1294 ----
NM_005833chr9--1167 ----
NM_005839chr12835 797 1601 --1989
NM_005840chrX97217 5611 4724 4694 3074 2613 1883 1614 1240 --37211 6840 5345 --
NM_005841chr41931 ------
NM_005842chr13----2688 497 --
NM_005843chr21619 1561 --11551
NM_005845chr1321353 476 ------
NM_005851chr111397 ------
NM_005852chr173931 400 132 --11069 --
NM_005859chr511148 1196 11531 --
NM_005862chr31143 --1425 --
NM_005869chr52144 29 ------
NM_005871chr102858 849 ------
NM_005877chr2242037 436 412 92 12337 2539 38 --
NM_005880chr162601 46 ------
NM_005882chr43899 746 108 ------
NM_005884chr192821 129 ------
NM_005885chr51660 ------
NM_005888chr121186 --1130 --
NM_005896chr21547 ------
NM_005898chr1132416 871 261 --13086 --
NM_005899chr1721118 84 ------
NM_005900chr41762 ----11013
NM_005901chr18138298 7994 7625 7566 7555 6635 3433 3355 2553 2378 2329 1873 1504 26346 6187 ----
NM_005902chr1584601 3917 2852 1532 1443 906 838 539 14290 ----
NM_005903chr555210 1984 849 688 474 13709 14549 --
NM_005904chr18186 1331 ----
NM_005906chr621501 622 1247 ----
NM_005907chr61128 11069 --1395
NM_005909chr574096 3292 2951 2746 2636 940 170 --13588 --
NM_005911chr221396 562 1182 ----
NM_005920chr162598 1236 1200 1044 633 109 13107 33323 2836 1459 --
NM_005924chr74747 432 279 216 ------
NM_005930chr143866 680 88 ------
NM_005933chr1132786 1914 284 22357 450 12429 --
NM_005935chr4104805 4691 4509 3803 3694 3677 3550 3282 3206 42 23778 3753 1229 --
NM_005937chr1734180 4101 1213 11476 11617 --
NM_005941chr852850 1376 1062 450 31 11221 ----
NM_005943chr621219 423 --1601 --
NM_005944chr3----1500 --
NM_005955chr1135145 4920 4895 4567 3674 1873 1493 1102 1063 930 754 474 263 --24970 1574 --
NM_005957chr143755 3546 1335 840 24462 764 21552 705 --
NM_005962chr1011779 11890 ----
NM_005962chr1011779 11890 ----
NM_005964chr1721452 481 ------
NM_005966chr222400 1691 12156 ----
NM_005968chr192216 56 ------
NM_005977chr13162 ------
NM_005982chr142220 94 ------
NM_005986chr1341947 1801 1086 643 ----1118
NM_005996chr1241042 627 593 108 ------
NM_005999chr131408 445 237 ----1298
NM_006007chr931351 1144 122 24230 1597 23950 3619 --
NM_006011chr1554208 3329 3173 1340 1137 24239 3693 --24015 1203
NM_006015chr131049 500 209 ----1995
NM_006016chr652172 2035 2013 1410 318 ------
NM_006020chr14----1552 --
NM_006030chr321385 1172 --1246 --
NM_006036chr272441 2271 1645 1028 854 164 143 ----12111
NM_006037chr274923 4895 4735 3716 3472 893 473 --44779 4443 1661 29 --
NM_006040chr1631075 91 51 ------
NM_006043chr161741 ------
NM_006047chr2042442 2370 1290 542 23559 1276 --2726 370
NM_006048chr11400 ------
NM_006058chr52566 37 ------
NM_006064chrX2320 295 ------
NM_006070chr31281 ------
NM_006076chr743030 1024 523 75 ------
NM_006080chr732672 294 42 23007 319 --12881
NM_006089chrX11290 ------
NM_006090chr11187 ------
NM_006091chr1531364 658 629 --1580 --
NM_006094chr842363 1832 625 323 ----159
NM_006095chr494240 4050 3920 3133 1658 1484 1461 1328 1046 23167 531 13082 1263
NM_006106chr1172671 2528 2416 1359 241 158 147 23321 2265 1315 --
NM_006108chr11112057 1985 1794 1616 953 937 861 735 449 135 110 12342 ----
NM_006113chr13505 368 196 --12074 --
NM_006134chr2131547 1491 1337 --1317 1294
NM_006135chr1197 ------
NM_006141chr1642759 2034 268 152 ------
NM_006145chr192835 347 --1464 --
NM_006147chr11461 ------
NM_006148chr1732757 1888 813 --32243 712 642 1143
NM_006154chr152896 336 --1750 12329
NM_006156chr141178 ------
NM_006158chr841351 695 443 218 11586 ----
NM_006159chr121622 ------
NM_006160chr1731580 543 40 --134 --
NM_006161chr51242 --1534 --
NM_006162chr1841789 1563 1290 682 ------
NM_006166chr122973 385 12529 12308 --
NM_006178chr1721540 531 --21489 260 11336
NM_006180chr951935 1818 1698 1518 404 11796 ----
NM_006191chr12126 ------
NM_006194chr1451216 1054 829 404 186 ----1171
NM_006195chr961441 971 964 477 405 117 ------
NM_006202chr1921642 630 --31983 99 91 --
NM_006203chr554755 4209 3499 1686 1136 13694 --23659 1338
NM_006206chr42545 201 12464 ----
NM_006210chr192933 297 ------
NM_006211chr8197 --1244 --
NM_006212chr165129 3658 3401 1621 1437 915 34031 971 73 23444 752 --
NM_006216chr21430 ----1601
NM_006224chr1741601 539 426 28 ------
NM_006226chr221343 60 ------
NM_006228chr81164 1364 1308 --
NM_006237chr1331971 833 75 ------
NM_006238chr632014 401 299 1781 ----
NM_006241chr362280 1842 1588 471 192 70 ------
NM_006243chr12935 712 --11090 --
NM_006246chr142509 385 ------
NM_006251chr52380 27 --12097 32834 2771 1019
NM_006252chr1106845 6068 5608 3009 2731 1923 1768 1241 821 349 11485 1806 12155
NM_006256chr142736 2469 2301 2171 2665 338 ----
NM_006257chr10134 1710 --1676
NM_006258chr1041390 352 284 30 --11168 --
NM_006259chr4----2834 368 --
NM_006265chr821452 119 ------
NM_006267chr21266 ------
NM_006275chr2052182 2035 1911 820 733 22279 657 11857 --
NM_006277chr22678 216 ------
NM_006281chr82422 227 --195 --
NM_006281chr82422 227 --195 --
NM_006282chr20104484 4406 3323 2879 1605 1328 1134 590 451 64 23932 1315 21788 1334 --
NM_006283chr873652 1956 1924 1917 1500 1202 50 24698 723 168 --
NM_006287chr231631 995 172 ------
NM_006306chrX24038 1814 --25910 308 --
NM_006310chr17--1283 ----
NM_006313chr122359 215 ------
NM_006315chr464077 3183 2876 2737 871 320 11705 --13967
NM_006317chr51570 ------
NM_006319chr161753 --148 --
NM_006325chr123844 660 290 --1820 --
NM_006328chr11------1208
NM_006330chr831102 114 96 ------
NM_006334chr9186 1212 ----
NM_006345chr4----1948 --
NM_006352chr141504 1480 129 89 ------
NM_006359chrX21736 591 --1542 --
NM_006364chr143843 428 204 --1350 --
NM_006366chr631239 972 198 1887 ----
NM_006367chr13927 93 25 ------
NM_006372chr61369 ------
NM_006373chr1711049 ------
NM_006375chrX31763 1638 567 ------
NM_006378chr92491 225 --21037 144 --
NM_006379chr721743 163 ------
NM_006380chr1783472 3306 3299 1346 1223 532 291 151 12924 --13994
NM_006383chr151657 --1542 --
NM_006386chr2252456 2292 1975 425 298 --12325 --
NM_006389chr111293 --1523 11236
NM_006393chr1074488 3472 2973 2914 1402 1248 426 ------
NM_006400chr122278 135 --1305 --
NM_006403chr671814 1807 1434 1131 593 525 249 ------
NM_006411chr621000 98 --2249 204 --
NM_006420chr2053345 3127 2129 657 411 ----12266
NM_006421chr81484 ------
NM_006431chr121164 ------
NM_006434chr1073006 2826 2661 2426 2406 1006 666 ------
NM_006439chr43548 385 194 ------
NM_006449chr242059 1922 1620 526 11470 ----
NM_006451chr51285 ------
NM_006454chr432706 2070 156 ------
NM_006457chr424049 3233 --32531 981 836 --
NM_006460chr1731596 620 215 1528 11279 --
NM_006466chr202125 31 ------
NM_006469chr131559 1090 122 ----1308
NM_006471chr18291 66 ------
NM_006480chr52450 193 ------
NM_006482chr1222696 737 --12665 --
NM_006483chr191328 ------
NM_006484chr191328 ------
NM_006486chr221224 ------
NM_006489chr1411329 ------
NM_006494chr19151 --197 --
NM_006496chr131417 1402 61 --11252 --
NM_006497chr171529 ------
NM_006504chr1032385 2025 1029 --12849 --
NM_006517chrX2932 714 11596 --21555 77
NM_006520chrX21409 1300 11688 --11442
NM_006526chr2052215 1741 1711 1650 317 ------
NM_006527chr42732 188 --1140 --
NM_006529chr441656 1323 1249 386 ------
NM_006532chr1921731 1608 ----11953
NM_006534chr2063353 2727 2379 2119 858 548 2583 331 1794 --
NM_006538chr284096 3519 3208 3073 847 720 112 41 --11602 --
NM_006539chr16----1536 --
NM_006540chr82357 46 --1394 --
NM_006544chr14115862 5807 5505 5303 4654 3709 2362 1565 1206 344 201 14092 22308 505 25714 377
NM_006546chr17106658 5619 5425 5155 5124 4449 1734 1726 1189 128 14426 14311 12432
NM_006548chr331636 1336 1155 1206 ----
NM_006549chr1232711 2657 1989 ------
NM_006552chr111106 --189 --
NM_006557chr92439 302 --1108 --
NM_006558chr8----1499 1394
NM_006559chr12362 56 ------
NM_006561chr1095907 5675 3914 3799 2156 1256 1133 679 76 36025 4225 1242 ----
NM_006565chr1661028 847 516 431 425 179 ------
NM_006572chr1743469 966 738 568 ------
NM_006574chr3288 70 ------
NM_006575chr1411152 --1489 1187
NM_006587chr421055 458 --11333 2253 28
NM_006589chr12164 80 --1157 --
NM_006593chr23687 322 178 ------
NM_006595chr1142021 1998 1950 288 ------
NM_006599chr1698224 7590 7532 6940 3105 2512 1995 1522 55 26067 1185 46795 5634 5495 1838 22074 1371
NM_006601chr1221002 113 ------
NM_006602chr201560 ------
NM_006603chrX51922 1584 1289 721 165 11267 ----
NM_006606chr2032335 508 24 --13179 --
NM_006609chr222369 560 ------
NM_006614chr353080 1094 585 306 200 ------
NM_006618chr131445 1384 261 ------
NM_006621chr13620 171 124 11644 --11584
NM_006624chr103644 138 102 ------
NM_006625chr1----1418 1400
NM_006625chr1----1418 1400
NM_006625chr1----1418 1400
NM_006628chr1564587 2971 1728 1333 737 567 --24008 3471 --
NM_006633chr52622 162 ------
NM_006636chr21747 ------
NM_006640chr1711843 21629 1621 11391 11640
NM_006644chr131485 ----148
NM_006646chr1363093 2947 1973 1965 687 333 1781 12245 --
NM_006650chr51761 ------
NM_006651chr41577 --1254 --
NM_006654chr1254617 4363 1382 1039 557 23389 2943 13152 14308
NM_006656chr1131021 846 232 --1153 --
NM_006660chr15121 ------
NM_006667chrX21129 37 1113 ----
NM_006670chr6174 ------
NM_006675chr1273265 2911 2654 2147 1242 1176 1145 42609 2313 783 246 ----
NM_006690chr2041903 1872 1509 714 1584 11607 1440
NM_006691chr1121029 289 ------
NM_006695chr17----1282 --
NM_006698chr2031207 499 213 1378 11322 --
NM_006699chr111002 12402 ----
NM_006706chr52756 581 ------
NM_006713chr51780 ------
NM_006717chr942641 1212 861 844 ------
NM_006720chr1044738 4113 3747 863 1185 22049 1136 --
NM_006721chr10--1666 --1520
NM_006722chr352924 2332 1083 837 285 22701 2369 1680 12484
NM_006726chr431229 1085 770 ------
NM_006729chrX85273 4833 4732 4115 3602 2032 1591 1294 11965 --34416 4143 1137
NM_006732chr1952073 1997 1831 1491 198 ------
NM_006734chr6------11122
NM_006735chr7----161 --
NM_006736chr21573 11339 --11450
NM_006738chr1543742 1288 977 618 13066 21450 1442 14569
NM_006741chr1241014 747 302 97 --1184 --
NM_006744chr102167 84 ------
NM_006745chr411079 ------
NM_006750chr16107865 7218 7040 5550 2716 1507 742 664 567 409 1626 12651 15451
NM_006751chr2----11078 --
NM_006754chr741271 1123 1000 275 --11203 --
NM_006755chr11----1141 --
NM_006766chr831042 951 894 ------
NM_006772chr631250 1234 247 ------
NM_006775chr652905 2795 855 125 93 --22933 2080 --
NM_006777chrX42937 2590 2444 429 11169 --12227
NM_006788chr181858 --21461 454 11618
NM_006790chr52383 159 ------
NM_006791chr15167 ------
NM_006795chr1121506 513 ------
NM_006803chr851583 1548 312 54 30 ------
NM_006805chr541145 347 304 168 --2184 113 11179
NM_006807chr17172 ------
NM_006811chr201733 1639 ----
NM_006813chr6187 --1249 --
NM_006815chr1241022 992 546 206 ------
NM_006818chr1289 31 --1921 --
NM_006820chr154277 3624 3483 2826 93 1469 23224 109 13949
NM_006822chr172536 198 ------
NM_006825chr122888 613 --2994 100 --
NM_006826chr211166 1518 ----
NM_006827chr1443137 2913 355 221 --22513 1159 1119
NM_006828chr63516 458 87 1397 ----
NM_006831chr11121 ----1422
NM_006832chr141124 1896 ----
NM_006838chr1231779 1378 673 176 ----
NM_006839chr2192 --1297 --
NM_006846chr5199 ------
NM_006848chr111203 --1158 --
NM_006851chr1242608 2445 1139 348 --12810 --
NM_006852chr1742570 2541 2377 1068 11049 1130 1779
NM_006854chr711565 --31716 1622 186 11289
NM_006861chr1211520 --4685 662 537 341 --
NM_006868chr1853078 2239 1986 1951 263 22632 2008 ----
NM_006870chr202696 556 ----2112 54
NM_006874chr421073 824 ------
NM_006875chrX4789 779 744 268 --1257 --
NM_006884chr341364 1352 372 353 ------
NM_006885chr1684049 3391 2859 2588 1602 1048 987 339 1467 21075 193 22628 437
NM_006887chr2179 1526 1202 --
NM_006888chr1452828 2338 1039 551 68 12665 12574 --
NM_006892chr2031382 577 164 --1135 --
NM_006892chr2031382 577 164 --1135 --
NM_006893chr1183 ------
NM_006899chr202299 111 1266 ----
NM_006908chr751491 1466 1293 432 295 ----11211
NM_006915chrX42503 2475 1743 810 ------
NM_006918chr1195707 5315 2181 1975 1951 1570 1488 437 342 ------
NM_006920chr21687 1162 ----
NM_006922chr242053 1862 1020 527 1859 --1509
NM_006924chr1794233 3887 2887 1672 1393 1129 689 142 128 --32791 1374 344 --
NM_006925chr14--174 ----
NM_006937chr172600 580 ------
NM_006939chr1431080 893 210 11043 ----
NM_006940chr1211603 21587 641 --11700
NM_006948chr2142487 2284 583 35 ------
NM_006951chr102809 722 --1767 --
NM_006959chr193357 333 94 ------
NM_006965chr1811156 --1907 --
NM_006981chr962976 2877 2396 2254 914 641 151 ----
NM_006988chr211945 ----197
NM_006990chr142160 1768 912 540 --11847 --
NM_006996chr121560 680 ------
NM_006997chr10----1371 1183
NM_007005chr911051 1160 ----
NM_007006chr1642273 383 109 38 ----11138
NM_007007chr1294821 4621 948 586 487 347 249 84 66 --21559 625 --
NM_007010chr17--11436 --1216
NM_007011chr1576413 2670 2604 2550 1251 1142 334 1341 46039 5936 4235 249 12723
NM_007014chr1621778 1757 21509 437 ----
NM_007015chr131276 2327 260 ----
NM_007018chr92382 139 ------
NM_007023chr21889 2704 319 ----
NM_007026chr171389 ------
NM_007030chr545113 4221 3374 1147 ------
NM_007034chr11718 ------
NM_007035chr123688 612 556 ----1160
NM_007038chr2175936 5867 5721 5444 4654 3748 555 24219 307 11756 15490
NM_007040chr1911050 ------
NM_007043chr122572 564 12122 ----
NM_007045chr61592 ------
NM_007050chr2088037 7049 6073 6051 6024 5815 2709 758 37256 5363 4988 25102 1264 --
NM_007054chr553393 3113 946 787 384 ----22413 656
NM_007064chr31654 ------
NM_007067chr17186 1368 1521 11365
NM_007069chr11152 ------
NM_007078chr1043021 2845 795 320 12258 23040 2489 --
NM_007107chr31243 21961 906 12323 --
NM_007111chr133757 630 302 --1286 --
NM_007118chr52563 304 ------
NM_007123chr1----2472 123 --
NM_007125chrY11464 ------
NM_007129chr1321030 766 1915 ----
NM_007139chr711121 ------
NM_007144chr1741277 1240 1223 282 1932 ----
NM_007145chr1911395 --11220 --
NM_007146chr1732417 2030 758 ------
NM_007150chrX62120 2086 2021 726 468 214 1477 2134 70 --
NM_007158chr161184 1121 887 788 336 303 ------
NM_007159chr321593 1382 ------
NM_007166chr1111267 ------
NM_007170chr11883 --1363 --
NM_007172chr2262558 2480 2247 2060 1253 991 ------
NM_007173chr1162197 1909 1798 1565 308 235 ------
NM_007174chr1231745 928 866 1526 ----
NM_007175chr863412 3249 2371 2235 620 591 1462 1518 13534
NM_007185chr11336 ------
NM_007190chr1021045 760 --131 --
NM_007191chr122615 206 ------
NM_007192chr141928 ----2995 108
NM_007195chr1843420 2766 2639 1062 --32798 2773 925 13086
NM_007197chr122663 244 ------
NM_007200chr1543742 1288 977 618 13066 21450 1442 14569
NM_007202chr171735 ------
NM_007203chr953472 3212 2909 1152 527 --23611 2957 --
NM_007207chr11671 1749 ----
NM_007212chr13864 429 241 ------
NM_007214chr631352 477 50 ------
NM_007221chr11373 ------
NM_007222chr82335 69 ------
NM_007225chr1721050 985 1269 --1372
NM_007232chr201377 ------
NM_007236chr1562135 2119 1901 1643 838 779 ------
NM_007238chr2054813 4149 3155 1822 369 33885 3867 3823 --1936
NM_007245chr161107 --1745 --
NM_007246chr41354 ------
NM_007249chr1379057 7069 3311 2772 2397 1541 1208 26872 602 29133 7943 --
NM_007250chrX1374 ------
NM_007256chr1171670 1616 1602 1480 1387 1142 66 2442 169 ----
NM_007260chr11764 ------
NM_007275chr32338 313 ------
NM_007276chr71161 ------
NM_007285chr162405 46 ------
NM_007286chr522081 173 1446 12075 --
NM_007287chr323102 2433 23073 40 1689 1544
NM_007288chr323102 2433 23073 40 1689 1544
NM_007289chr323102 2433 23073 40 1689 1544
NM_007294chr1711197 ------
NM_007295chr1711197 ------
NM_007296chr1711197 ------
NM_007297chr1711197 ------
NM_007298chr1711197 ------
NM_007299chr1711197 ------
NM_007300chr1711197 ------
NM_007302chr1711197 ------
NM_007303chr1711197 ------
NM_007304chr1711197 ------
NM_007305chr1711197 ------
NM_007308chr41501 ------
NM_007327chr93764 244 226 ------
NM_007345chr1812157 --11876 --
NM_007347chr1543104 3043 2196 485 ------
NM_007349chr7194 1334 1428 --
NM_007353chr742312 1941 458 278 12122 ----
NM_007357chr12406 178 ------
NM_007358chr11579 21370 758 --11521
NM_007363chrX4806 795 350 336 ------
NM_007365chr131987 148 25 --2805 679 --
NM_007372chr173893 776 753 ------
NM_007373chr101676 1265 ----
NM_007374chr141468 ------
NM_007375chr162448 2285 1950 976 488 244 22570 317 ----
NM_012062chr123943 307 241 145 ----
NM_012064chr1221079 156 ------
NM_012069chrX32526 896 135 --1259 --
NM_012074chr142965 120 ------
NM_012081chr533418 2299 457 11427 ----
NM_012082chr81648 ------
NM_012084chrX2479 350 --1229 --
NM_012090chr12832 192 1386 ----
NM_012095chr1073464 3276 1419 1331 1048 668 493 23423 872 22543 1344 --
NM_012096chr332812 400 311 12595 12946 12654
NM_012102chr132447 2232 883 12560 ----
NM_012110chr4158 ------
NM_012115chr61531 ------
NM_012120chr632743 2638 1996 ----2928 179
NM_012123chr62326 307 1121 ----
NM_012124chr11169 1611 1827 --
NM_012129chr731643 199 36 ------
NM_012137chr152144 886 732 368 116 --1485 --
NM_012141chr1373316 3123 1093 608 532 274 76 23163 351 1258 --
NM_012153chr1152387 1766 1728 848 778 ----1329
NM_012156chr2033415 2647 344 12252 22866 697 --
NM_012158chr1311503 ------
NM_012161chr431076 179 81 ------
NM_012164chr9117274 6437 6110 5666 5202 4698 2972 2146 1896 1152 810 17321 66210 5701 5390 4725 2763 1798 25775 146
NM_012180chr42221 187 ----1144
NM_012192chr112196 126 --12219 --
NM_012193chr1154800 4466 4253 1565 181 15423 13955 14555
NM_012197chr931477 1392 86 ------
NM_012199chr194563 4073 2981 2942 2894 1726 1599 1506 917 --12917 21467 236
NM_012207chr10------11102
NM_012214chr285763 4995 4860 4046 2359 2313 532 99 16163 15829 --
NM_012215chr1021345 239 --21844 1330 --
NM_012218chr1942842 2825 1113 259 --11095 --
NM_012224chr421113 899 1475 ----
NM_012229chr1011312 ----11456
NM_012233chr231143 1039 939 --1766 --
NM_012234chr363445 3401 3285 2956 1450 1115 1141 12460 --
NM_012242chr101291 ------
NM_012243chr12339 63 ------
NM_012245chr14----2448 400 --
NM_012247chr101707 --1284 --
NM_012248chr162674 527 ----2719 261
NM_012249chr242893 2726 2511 408 1801 ----
NM_012250chr1131047 856 75 1318 1422 --
NM_012255chr201432 ------
NM_012256chr731056 416 122 11170 ----
NM_012257chr731055 1040 919 ------
NM_012259chr621397 500 --11139 1978
NM_012262chr1104684 3792 3687 3427 1275 1067 1023 544 382 329 ------
NM_012264chr2232042 1928 800 ------
NM_012264chr2232042 1928 800 ------
NM_012268chr191306 ------
NM_012281chr71962 --11758 --
NM_012286chrX170 ------
NM_012287chr353897 3515 3018 1537 926 14191 21263 356 24348 315
NM_012288chr6115642 5303 5085 4907 4739 4715 3820 2175 374 313 128 --1325 --
NM_012290chr221280 581 ------
NM_012296chr1113883 --13727 --
NM_012297chr442101 1876 598 60 --2926 409 --
NM_012300chr552224 2052 1574 1002 740 12318 ----
NM_012301chr732189 1662 774 21801 758 ----
NM_012308chr1122289 433 42442 1681 1641 669 1817 --
NM_012309chr1173389 1206 1128 346 327 298 35 ------
NM_012311chr102639 495 ------
NM_012316chr194037 2047 1753 1506 1000 717 587 574 536 11512 35200 1943 515 --
NM_012322chr7------1287
NM_012325chr2041389 1273 1193 464 11130 ----
NM_012327chr181189 --21569 1053 --
NM_012328chr71371 --1238 --
NM_012329chr1731289 1259 563 ------
NM_012330chr1031782 1256 1144 --1539 --
NM_012333chr151172 672 602 517 474 1507 ----
NM_012347chr662655 2390 2000 972 452 31 ------
NM_012382chr544363 4213 3545 1436 --2884 434 13509
NM_012383chr9--2172 68 --146
NM_012388chr1532032 378 210 ------
NM_012395chr743417 1245 590 479 12230 11131 1801
NM_012399chr2241968 715 654 113 11959 ----
NM_012410chr162506 449 ------
NM_012414chr11768 1646 --1717
NM_012420chr101172 11785 ----
NM_012421chr1--160 ----
NM_012426chr162348 316 127 ----
NM_012428chr152759 733 ------
NM_012429chr2221277 391 1911 ----
NM_012430chr31538 ------
NM_012433chr2154 ------
NM_012448chr1742065 1620 970 56 --11554 --
NM_012454chr61387 ------
NM_012475chr11177 ------
NM_012479chr732171 1832 703 1537 --1163
NM_013227chr15----189 --
NM_013229chr1282761 2743 2672 2383 1050 899 465 192 --22793 603 --
NM_013231chr1433804 3781 3680 23917 1636 22816 1139 13795
NM_013233chr211044 11343 ----
NM_013235chr52251 34 ------
NM_013236chr2231096 215 183 ------
NM_013253chr111268 1239 ----
NM_013257chr832285 282 206 ------
NM_013259chr32331 125 1278 ----
NM_013261chr453661 3266 2536 2414 2302 1941 32781 2736 1460 21396 793
NM_013269chr123973 482 287 14389 ----
NM_013277chr122778 419 ------
NM_013279chr1152296 1523 1472 554 366 ----11452
NM_013281chr2031444 1311 599 1131 1346 --
NM_013283chr52804 137 ------
NM_013286chr363678 3223 3019 3010 955 742 13418 ----
NM_013293chr71275 ------
NM_013309chr1522624 1719 1187 ----
NM_013330chr11171 ------
NM_013336chr361620 1525 1474 1329 462 170 ------
NM_013341chr272532 2075 1170 1164 1081 852 342 22631 1065 ----
NM_013348chr1931013 971 956 ------
NM_013372chr1543270 2240 2144 532 1538 ----
NM_013373chr222729 157 ------
NM_013374chr32838 429 ----22774 2041
NM_013377chr12----1470 --
NM_013381chr1242237 2005 273 230 --1970 --
NM_013382chr1421674 905 ------
NM_013386chr131707 1604 388 ------
NM_013392chr21442 ------
NM_013396chr2121426 57 ----1264
NM_013403chr194873 858 783 605 1119 ----
NM_013423chrX21292 934 1953 1291 1510
NM_013427chrX21292 934 1953 1291 1510
NM_013437chr821334 403 1524 --1392
NM_013438chr921319 426 11546 ----
NM_013443chr93777 223 97 ------
NM_013444chrX11142 --1221 --
NM_013446chr731414 1084 545 ------
NM_013449chr1232369 1850 131 12654 22251 191 12613
NM_013450chr211058 ------
NM_013943chr133018 588 97 2869 284 31195 793 622 --
NM_013958chr8130 ------
NM_013959chr8130 ------
NM_013961chr8130 ------
NM_013962chr8130 ------
NM_013986chr221119 ------
NM_013995chrX42592 893 415 407 1792 11612 --
NM_014000chr1021636 1480 ------
NM_014007chr91388 190 --1396
NM_014011chr231948 1854 741 --1230 --
NM_014023chr1072876 2253 2152 1796 1117 783 198 134 11176 --
NM_014028chr633162 2404 2349 --21234 664 --
NM_014034chr611186 ----11370
NM_014043chr361596 415 335 257 92 24 ----1164
NM_014044chr2162 ------
NM_014048chr1665294 5168 4632 4203 4103 1973 24667 234 24889 1555 14542
NM_014055chr121398 ------
NM_014079chr3179 11070 ----
NM_014089chr1362141 2120 1954 1895 439 177 1155 1837 --
NM_014112chr844153 2200 1990 817 11311 14036 21746 1385
NM_014117chr1641673 454 393 176 --11963 --
NM_014141chr742149 1539 986 437 1550 13847 --
NM_014153chr161626 ------
NM_014154chr32390 211 ------
NM_014155chr1157367 6701 4731 1099 327 --14697 --
NM_014176chr11122 142 ----
NM_014178chr143587 565 87 --1238 1196
NM_014181chr242773 525 486 139 11923 12652 --
NM_014184chr11134 ------
NM_014191chr121981 ------
NM_014212chr121392 --1313 --
NM_014223chr11521 ----146
NM_014231chr1211717 12051 ----
NM_014232chr1731338 1318 1074 --1269 --
NM_014232chr1731338 1318 1074 --1269 --
NM_014233chr1721664 94 ------
NM_014239chr141343 ------
NM_014243chr421779 1499 ------
NM_014245chr32359 53 --1733 --
NM_014246chr2232256 1655 431 --1570 12230
NM_014250chr2222025 407 ------
NM_014251chr72839 105 ------
NM_014253chrX72268 2239 1701 559 422 285 207 ------
NM_014263chr10126 ------
NM_014264chr42647 491 ------
NM_014268chr1821285 999 21167 172 ----
NM_014271chrX3594 300 137 ------
NM_014279chr91821 ------
NM_014280chr11738 1855 ----
NM_014283chr131566 1257 347 1542 ----
NM_014284chr111032 --1726 --
NM_014289chrX11117 1246 ----
NM_014292chr2241950 311 109 78 --161 --
NM_014293chr2263990 3478 2553 1321 392 32 13527 13417 --
NM_014294chr821225 114 --1334 11421
NM_014305chr131698 ------
NM_014309chr22125120 4833 4736 4615 4374 4333 3934 3557 2180 2174 2168 1183 --11046 13565
NM_014319chr1271956 1695 766 613 366 348 242 --21777 297 --
NM_014325chr1252259 1611 1486 790 456 ------
NM_014331chr476572 6287 5611 5555 5486 2488 2005 15467 --22289 1323
NM_014333chr1121771 410 --11881 --
NM_014335chr1521057 334 --11219 --
NM_014351chr2241463 1354 968 84 ------
NM_014360chr14------1590
NM_014368chr911805 --11555 --
NM_014372chr121832 250 --11725 --
NM_014382chr331702 548 495 ------
NM_014386chr51102 ------
NM_014392chr421302 155 ------
NM_014393chr852313 1600 1567 438 204 --181 --
NM_014395chr441970 1951 1576 1281 ------
NM_014399chr7141 2890 78 ----
NM_014405chr1721596 1490 1831 22028 818 2454 357
NM_014410chr181360 ------
NM_014415chr351714 437 363 230 38 ------
NM_014423chr585143 4342 3644 2238 2223 1338 1167 1085 24561 4533 12100 --
NM_014431chr1051626 1435 1380 1208 1166 ------
NM_014445chr331544 647 403 22213 2164 --1528
NM_014447chr42468 116 ------
NM_014452chr641048 934 908 434 1241 1306 --
NM_014454chr62784 234 ------
NM_014456chr101295 --11706 --
NM_014458chr131218 106 21 ------
NM_014470chr121643 --1749 --
NM_014482chr21102 ------
NM_014488chr11----1513 --
NM_014491chr71289 ------
NM_014494chr1652376 1878 1842 748 351 22145 1485 ----
NM_014498chr31358 ------
NM_014504chr732074 1772 536 --22009 1498 --
NM_014506chr93622 542 59 11693 197 --
NM_014515chr1231020 781 381 ----1262
NM_014521chr221779 633 ------
NM_014552chr231496 1195 429 ------
NM_014554chr1242164 365 279 189 ------
NM_014562chr23524 173 90 --1776 --
NM_014563chrX12098 --1610 --
NM_014564chr92314 283 ------
NM_014570chr224644 250 106 94 --1854 --
NM_014572chr1321444 576 ----1697
NM_014573chr1731754 1356 1178 --11830 1378
NM_014574chr142499 402 ------
NM_014575chr3143 ------
NM_014577chr22----128 --
NM_014580chr92599 506 1395 ----
NM_014585chr241117 415 388 95 ------
NM_014588chr202505 142 1757 ----
NM_014602chr31347 ------
NM_014606chr421413 378 --1625 --
NM_014607chr261875 787 720 540 476 201 ------
NM_014612chr91413 --21437 962 --
NM_014613chr552752 2701 2449 2270 430 --2748 363 --
NM_014614chr241298 1226 1111 191 ------
NM_014615chr1642833 962 464 377 --32379 2323 418 --
NM_014616chr352522 2512 2248 831 425 ------
NM_014620chr121137 1145 ----
NM_014630chr1563602 3271 2995 920 524 362 32835 2745 2644 1258 --
NM_014635chr231660 1124 513 ------
NM_014636chr984282 4188 3453 2836 1299 1022 831 712 ----12952
NM_014637chr81169 11029 1530 --
NM_014646chr1842651 964 869 143 12579 22224 901 --
NM_014647chr1622163 348 ------
NM_014655chr162286 1997 1973 442 353 192 --1163 --
NM_014660chr74278 269 232 165 2171 144 1373 1337
NM_014663chr141119 987 967 375 ------
NM_014665chr852780 2295 699 194 129 ------
NM_014666chr5--1401 ----
NM_014667chr341683 1623 168 44 ------
NM_014670chr21582 --11221 --
NM_014674chr383760 3004 2715 2588 2499 1238 839 704 --23982 99 --
NM_014676chr161644 1563 1441 1354 427 410 ------
NM_014677chr821291 1223 ------
NM_014679chr112533 387 ------
NM_014682chr832113 1885 489 --1445 --
NM_014683chr1722022 2016 --12155 --
NM_014686chr1912369 22484 251 22018 1919 --
NM_014689chr2--1220 --1144
NM_014690chr772635 2195 2020 1894 1258 988 727 11902 32782 815 429 12655
NM_014699chr161318 ------
NM_014701chr1593295 2928 2825 2153 979 935 874 748 80 13125 ----
NM_014702chr632856 2115 648 149 13506 --
NM_014703chr311215 ------
NM_014705chr771766 1737 1728 758 582 130 36 ------
NM_014707chr742226 1811 1569 388 --12268 11516
NM_014709chr2169 ------
NM_014711chr1622095 2019 ------
NM_014713chr2--1352 ----
NM_014717chr19241 35 ------
NM_014720chr1031485 1321 729 ------
NM_014721chr662500 2271 1830 1756 1187 565 37380 6287 4979 25524 214 --
NM_014723chr2052091 2064 1089 984 440 --13199 12343
NM_014726chr172562 555 1127 ----
NM_014729chr821853 259 --11523 --
NM_014730chr1264557 4541 4305 1193 999 623 25087 4941 33789 3236 2114 --
NM_014730chr1264557 4541 4305 1193 999 623 25087 4941 33789 3236 2114 --
NM_014733chr51683 12014 1575 --
NM_014735chrX61500 1469 613 139 39 33 --11533 --
NM_014743chr452370 1145 1078 293 270 --1148 1654
NM_014746chr294100 3749 2853 1461 1409 1115 1109 765 646 --197 --
NM_014747chr145156 1297 284 101 --1461 15750
NM_014748chr22161 55 ------
NM_014751chr821991 1784 ------
NM_014752chr113554 430 260 1791 139 --
NM_014754chr81154 1207 ----
NM_014755chr273744 3158 2770 1670 997 142 89 11476 1443 --
NM_014757chr532395 1915 1524 11592 ----
NM_014758chr1142489 892 637 297 22424 333 21537 578 1311
NM_014759chr83574 296 281 --11114 --
NM_014765chr141039 885 876 400 --12504 --
NM_014766chr753795 3403 2842 2602 458 --12874 --
NM_014772chr1832892 2373 1079 33314 2859 857 ----
NM_014774chr162997 2884 2618 2158 2005 371 1119 12604 --
NM_014776chr1292965 2537 2137 1936 1222 945 513 186 146 12774 --1653
NM_014779chr31409 ------
NM_014781chr81511 ------
NM_014782chrX292 46 ------
NM_014784chr11722 ------
NM_014786chr112135 55 ----11235
NM_014787chr121748 822 11067 ----
NM_014795chr241284 1238 942 922 ------
NM_014798chr1711933 2114 70 ----
NM_014800chr721014 372 --1178 11051
NM_014802chr122181 130 ------
NM_014803chr1022638 1951 --12380 12766
NM_014806chr91187 ------
NM_014810chr193569 3059 1273 1072 985 760 605 252 177 --13030 --
NM_014813chr12556 49 ------
NM_014819chr531923 859 463 ------
NM_014820chr331428 654 190 ------
NM_014822chr4----1100 --
NM_014824chr1141733 705 420 64 ----11722
NM_014826chr184281 4103 4028 3729 3621 813 589 345 13674 33204 1558 657 23212 3187
NM_014827chr141669 1585 1203 108 ------
NM_014828chr1422450 328 ------
NM_014829chr51605 --1109 --
NM_014830chr1263382 2754 2687 1322 1286 906 --2221 99 12410
NM_014835chr2031999 875 625 ------
NM_014836chr102448 87 21644 625 --11862
NM_014838chr2242662 2400 1131 223 --11759 --
NM_014839chr13865 422 260 --11868 --
NM_014840chr124853 820 408 384 21302 1000 12971 12206
NM_014841chr611209 ------
NM_014847chr11530 ------
NM_014848chr1542380 2179 656 472 11018 139 --
NM_014850chr321422 1200 --13542 --
NM_014853chr1721183 1131 --11482 --
NM_014859chr173418 363 236 3549 526 84 ----
NM_014868chr121849 --1611 --
NM_014871chr122583 91 ------
NM_014872chr911822 ------
NM_014873chr154194 4005 3716 840 718 --23445 822 --
NM_014874chr12728 178 ------
NM_014876chr2221856 604 185 12193 --
NM_014877chr17107222 6794 6635 5259 2644 1689 1044 1032 454 183 12178 --32986 1951 1296
NM_014883chr41442 ------
NM_014890chr32296 39 ------
NM_014893chrY22296 1830 ------
NM_014897chr1732490 838 318 --12093 --
NM_014898chr19192 ----1689
NM_014899chr533085 476 236 12555 21018 819 --
NM_014901chr51765 31831 1787 181 ----
NM_014902chr2011404 --1253 --
NM_014903chr1212428 12468 ----
NM_014904chr1073948 3387 3148 2932 2613 1552 498 ----12964
NM_014906chr1753923 3643 2768 2488 1241 ----14114
NM_014912chr1053469 3183 2188 1360 691 --1634 --
NM_014917chr11967 ------
NM_014918chr151172 11487 1192 --
NM_014920chr622658 1254 --13076 --
NM_014921chr1952834 2788 2049 2002 622 ----12242
NM_014923chr13--11940 --1130
NM_014925chr12----2772 179 1294
NM_014926chr3289 74 ----1250
NM_014931chr192652 535 ------
NM_014932chr3--1511 ----
NM_014934chr1343749 3677 998 69 ------
NM_014935chr143890 3394 1096 321 22762 478 22419 1156 --
NM_014937chr1011330 ------
NM_014938chr1262254 2237 1947 1018 397 211 1927 32426 2268 934 --
NM_014939chr18144 2311 133 1450 1964
NM_014945chr54724 649 118 84 ------
NM_014946chr233030 1091 210 1644 ----
NM_014947chr143004 2785 325 259 195 23028 941 --
NM_014949chr12968 263 ----1874
NM_014951chr1022443 1010 --12479 --
NM_014952chr1531749 592 391 11491 1836 --
NM_014961chr4----1600 --
NM_014962chr2032875 2416 57 --1458 11793
NM_014969chr13941 449 332 ------
NM_014970chr1175 ------
NM_014974chr1031787 1492 662 11255 ----
NM_014978chr102733 722 11276 11338 --
NM_014982chr1465447 1986 1121 835 240 156 34161 1891 366 ----
NM_014989chr632013 1611 821 --1115 --
NM_014991chr472830 2791 2080 1195 966 767 313 --12432 --
NM_014994chr1512259 12398 ----
NM_014999chr1231693 1195 1143 11429 11104 --
NM_015000chr1263131 3022 1933 1216 784 60 ------
NM_015001chr1----1382 --
NM_015002chr121255 ------
NM_015005chr1451709 1662 1640 533 150 ------
NM_015008chr332639 2394 399 --42550 1205 997 967 12703
NM_015009chr32767 641 ------
NM_015015chr1921841 70 --12032 --
NM_015017chr11818 --1251 --
NM_015020chr1633640 2581 633 159 33573 2371 135 --
NM_015023chr121649 166 --1434 --
NM_015024chr821407 1233 --11292 --
NM_015025chr252611 1725 645 55 48 12227 3465 151 29 --
NM_015026chr1273802 3122 3115 3071 1182 635 388 --11026 24728 3159
NM_015027chr1641347 789 301 176 11588 ----
NM_015032chr131206 --22655 2605 --
NM_015039chr143593 1618 1363 113 --23418 433 11548
NM_015042chr1543304 3113 843 117 --23527 906 --
NM_015044chr1642757 551 523 52 2881 405 12115 13084
NM_015045chr1031590 1380 481 --1301 --
NM_015046chr922623 2467 22366 2249 22015 631 --
NM_015049chr232437 1099 333 --22202 266 --
NM_015051chr932152 876 866 ------
NM_015053chr122151 1756 --169 --
NM_015055chr1132895 2250 994 12715 ----
NM_015057chr131652 ----1170
NM_015059chr1543030 1495 1486 619 13997 1579 12807
NM_015063chr191370 --1965 --
NM_015064chr1231428 1282 484 33007 1353 285 ----
NM_015068chr733848 721 460 33791 1495 222 ----
NM_015069chr16140 1535 ----
NM_015071chr595257 5106 4751 4437 4130 1885 1392 1143 1109 185 --15003
NM_015072chr142389 105 ------
NM_015074chr174901 4875 4600 1915 193 129 91 21872 1487 --34669 4497 578
NM_015075chrX31998 1640 387 --22055 1491 --
NM_015076chr653538 1648 1178 1009 190 --24285 1242 --
NM_015080chr111899 ------
NM_015087chr1372615 2436 2408 2376 440 254 183 22607 2279 ----
NM_015090chr1106054 6042 5096 5028 4049 1213 1184 707 481 264 35735 1815 629 25398 746 --
NM_015092chr1674473 4129 3774 3287 2938 1314 949 11334 ----
NM_015093chr61513 ------
NM_015094chr2241222 1158 1018 37 24533 4169 21786 803 --
NM_015097chr321713 394 1307 --1663
NM_015099chr172583 155 ------
NM_015100chr121779 779 --11731 --
NM_015101chr152883 2845 1856 1143 333 2968 670 ----
NM_015103chr31293 --1728 --
NM_015107chrX5931 787 498 454 297 1666 --1535
NM_015115chr462680 2289 889 796 162 100 2839 231 --11262
NM_015116chr1341653 1464 1272 78 11264 ----
NM_015124chr223689 560 109 ------
NM_015125chr192514 140 1426 ----
NM_015129chrX31733 397 162 ------
NM_015130chr421164 202 11054 21137 307 --
NM_015132chr731519 698 222 ------
NM_015137chr852307 2108 1642 787 643 1518 ----
NM_015138chr1552801 2568 2459 1027 271 22824 2316 32742 933 347 --
NM_015141chr332157 2018 823 12510 ----
NM_015143chr43272 245 158 ------
NM_015144chr1673286 3229 3148 2638 2497 1411 1397 23200 2433 --13248
NM_015149chr112150 130 ----
NM_015153chr63670 663 57 ------
NM_015156chr1433869 974 263 --13366 --
NM_015157chr112793 470 1343 ----
NM_015158chr91728 ----1838
NM_015161chr1621510 307 --1270 --
NM_015163chr1431879 1269 281 ------
NM_015170chr822174 1991 21453 319 ----
NM_015172chr121107 420 1531 ----
NM_015176chr121245 708 ------
NM_015184chr31451 ------
NM_015185chrX42898 879 811 359 22913 405 ----
NM_015187chr41125 ----1107
NM_015192chr2052482 2364 2329 2002 653 --22843 899 --
NM_015198chr71260 --2224 109 --
NM_015199chr322495 262 ------
NM_015200chr452479 2469 2395 2104 1005 ------
NM_015202chr1631711 1483 509 ------
NM_015206chr1562839 2723 1369 1024 902 67 11113 33065 810 545 12582
NM_015208chr1833483 3043 551 ------
NM_015209chr131704 907 680 11509 12057 --
NM_015215chr12916 642 1929 3812 777 733 --
NM_015216chr511451 ------
NM_015219chr1722539 72 ------
NM_015221chr102149 29 ------
NM_015225chr942595 2282 2224 538 --12613 1199
NM_015226chr1612128 12803 13203 --
NM_015227chr2133292 354 136 --159 --
NM_015229chr1721148 181 ------
NM_015233chr1352191 1696 826 811 770 --11823 11941
NM_015236chr411032 11504 1222 --
NM_015247chr16105213 4828 3600 3353 3294 1450 1409 1358 523 193 24240 1683 15241 11862
NM_015250chr9----11442 --
NM_015251chr1631823 233 137 ------
NM_015252chr21377 --145 1849
NM_015254chr82711 126 --42772 2243 2068 302 --
NM_015260chr1921546 453 21381 1176 1343 --
NM_015265chr212469 21727 838 12305 22383 2204
NM_015267chr121690 --1852 1460
NM_015270chr1252147 1863 1763 1653 469 1336 2897 310 12161
NM_015271chr4114082 4001 3922 3877 3167 2951 542 479 359 288 36 13024 --11326
NM_015272chr16----11641 --
NM_015275chr1221532 308 --1219 159
NM_015277chr1841357 77 63 56 ------
NM_015278chr673431 3313 2941 2137 594 392 373 13075 --11291
NM_015282chr263060 2325 1953 578 428 259 1584 ----
NM_015285chr1822208 296 --1697 1139
NM_015286chr1532464 391 289 1555 --1521
NM_015288chr543598 926 647 407 23204 1423 11065 --
NM_015291chr173384 2610 2561 1127 1088 869 291 --1285 12234
NM_015292chr123761 250 152 --1702 1573
NM_015294chr17151 1928 11101 --
NM_015296chr132959 155 ----11044
NM_015299chr1433667 418 230 12789 ----
NM_015305chr1441903 1896 1462 191 --11468 1422
NM_015308chr111180 ------
NM_015310chr8167427 6743 6662 6565 6538 5873 5794 3278 3100 2578 2134 1024 646 291 199 184 12210 31185 704 452 11802
NM_015313chr1154805 4141 1155 554 390 --23999 3453 11507
NM_015315chr541389 1314 1193 654 13240 --13058
NM_015316chr141178 ----3279 225 32
NM_015317chr292859 2558 2382 1754 1065 997 883 837 162 22116 1093 ----
NM_015320chr221003 748 ------
NM_015326chr152495 2063 1991 397 118 --21924 777 --
NM_015328chr752832 2715 2165 2073 2023 2783 551 32611 2457 322 --
NM_015332chr7113092 2752 2335 1257 718 707 572 507 343 99 91 --1547 --
NM_015335chr1222460 332 ------
NM_015336chr1232589 2215 1636 ------
NM_015338chr2041949 1587 1564 1288 1541 41621 1248 179 119 --
NM_015339chr203716 697 654 --1179 --
NM_015344chr821900 170 ------
NM_015346chr1441689 1647 1625 145 1374 11219 --
NM_015347chr1232152 1906 779 --12745 --
NM_015349chr632332 922 184 --11117 --
NM_015353chr1721915 674 --12306 --
NM_015354chr91409 ------
NM_015355chr172769 329 --11566 --
NM_015358chr2111225 ------
NM_015361chr22375 296 ------
NM_015365chrX93785 3553 3253 3095 940 340 324 281 228 21184 680 13359 --
NM_015374chr2251439 1247 1016 1007 77 ------
NM_015379chr71222 ------
NM_015381chr2212018 ------
NM_015382chr142106 58 ------
NM_015385chr1073006 2826 2661 2426 2406 1006 666 ------
NM_015387chr21133 21683 1512 11992 --
NM_015393chr443602 3557 3497 3157 --23509 1278 12628
NM_015396chr33479 203 121 --1288 --
NM_015397chr95591 469 181 123 96 --1446 11934
NM_015412chr332615 2209 494 1527 22934 2622 --
NM_015415chr11247 ------
NM_015423chr11----2661 636 21753 1252
NM_015429chr311026 ------
NM_015435chr821105 594 1256 ----
NM_015436chr422153 862 1269 ----
NM_015443chr172972 155 ----1196
NM_015446chr1--11377 --1529
NM_015447chr94777 622 244 142 ------
NM_015449chr1167 --121 --
NM_015455chr554036 3501 2790 2697 92 23996 1193 11445 --
NM_015458chr843512 1014 888 568 11784 15217 --
NM_015461chr181168 ------
NM_015470chr231246 839 118 1109 1103 --
NM_015475chr23912 435 23 --11018 --
NM_015485chr12331 53 ------
NM_015488chr221638 1525 --1400 --
NM_015493chr1941732 1480 246 50 21410 600 ----
NM_015496chr8----1276 --
NM_015508chr31591 --11389 --
NM_015509chr1231434 1286 617 --11087 --
NM_015511chr2021119 438 ------
NM_015514chr144622 598 412 143 166 ----
NM_015520chr332554 2289 2101 1940 ----
NM_015527chr162633 105 191 ----
NM_015530chr23799 395 250 ------
NM_015532chr1542841 2020 853 225 --1687 12698
NM_015535chr264209 4132 3653 2891 1362 165 --22649 907 --
NM_015541chr3------2890 25
NM_015542chr1031249 1121 926 ------
NM_015548chr63727 670 83 ------
NM_015549chr14--1612 ----
NM_015554chr1552859 2692 2018 1969 249 --12269 --
NM_015555chr61124 ------
NM_015559chr183732 693 210 ------
NM_015564chr51451 --22572 419 1492
NM_015565chr2131393 657 532 1710 --12254
NM_015567chr133373 226 29 ------
NM_015569chr174624 4574 4467 1904 948 638 273 11571 14663 --
NM_015570chr751833 1732 1491 1263 736 --21396 1341 --
NM_015571chr682517 2308 2231 1780 1754 939 882 663 12282 ----
NM_015575chr242469 1058 948 346 --11006 1357
NM_015577chr541846 1721 1339 709 134 1418 --
NM_015584chr171535 1338 1948 --
NM_015595chr31124 1137 ----
NM_015601chr10161 ------
NM_015607chr1132 ------
NM_015609chr132123 769 139 13005 12009 1999
NM_015610chr732154 1075 624 21942 429 --1248
NM_015626chr172286 125 --11153 --
NM_015630chr241068 443 379 255 ----1358
NM_015635chr922009 607 --1221 --
NM_015640chr165316 4873 4833 2059 674 58 ------
NM_015646chr121852 11283 1907 --
NM_015649chr19--142 ----
NM_015652chr102496 57 ------
NM_015657chr21716 1679 ----
NM_015677chr22633 253 ------
NM_015686chrX42512 2323 2141 512 --1952 --
NM_015687chr63529 448 206 ------
NM_015694chr71112 ------
NM_015695chr63806 561 29 --1526 --
NM_015711chr191829 1323 1116 --
NM_015714chr12363 296 ------
NM_015716chr172655 97 ------
NM_015726chr161555 1495 1415 1148 615 110 --21570 1540 --
NM_015833chr2121978 1618 ------
NM_015844chr181681 ------
NM_015846chr181681 ------
NM_015847chr181681 ------
NM_015850chr872413 1988 1704 1677 824 815 416 --1373 11632
NM_015866chr1--11441 ----
NM_015872chr141358 1269 372 108 11172 ----
NM_015874chr41508 ------
NM_015878chr82370 48 22006 1894 ----
NM_015879chr1888645 7817 6455 6246 2766 2754 396 139 --18301 --
NM_015881chr111268 1239 ----
NM_015885chr112551 306 ------
NM_015886chr855424 1721 836 110 79 13935 ----
NM_015888chr142727 2167 918 624 1542 --1156
NM_015891chr621942 1625 --11564 --
NM_015902chr85916 600 357 282 145 ------
NM_015904chr21278 ------
NM_015906chr164751 4678 4547 4483 4041 1602 ----23421 186
NM_015912chr832475 1636 355 1307 ----
NM_015920chr151628 ------
NM_015933chr3------186
NM_015955chr21368 ------
NM_015957chr112377 264 1112 ----
NM_015967chr121043 172 ----1290
NM_015975chrX184 ------
NM_015984chr1----1131 --
NM_015995chr1555437 4309 4161 1281 936 15256 --23845 1632
NM_016003chr732154 1075 624 21942 429 --1248
NM_016009chr113229 --34824 3631 1163 --
NM_016018chr832301 2224 902 22602 1825 11143 12137
NM_016019chr73986 840 297 ------
NM_016022chr11136 ------
NM_016023chr832170 1347 560 12192 ----
NM_016025chr1632032 1594 1579 ------
NM_016026chr142462 126 ----160
NM_016027chr83424 201 33 ------
NM_016032chrX----1156 --
NM_016037chr1--123 --1410
NM_016038chr72254 89 ------
NM_016045chr2031264 740 620 --11286 --
NM_016048chr53726 321 127 ------
NM_016057chr123381 288 191 ------
NM_016059chr61277 --1341 1600
NM_016061chr251689 1380 1338 1022 518 21459 559 ----
NM_016070chr171118 ------
NM_016072chr1222419 810 --11508 --
NM_016073chr152984 268 ------
NM_016075chr1322590 321 --12675 --
NM_016076chr143167 3099 308 287 --12319 --
NM_016078chr171437 ----1857
NM_016083chr673586 3331 3097 2813 1228 1184 1174 ------
NM_016087chr721411 102 ----11140
NM_016090chr111963 ----1340
NM_016096chr841764 1596 1402 369 12071 11393 --
NM_016097chr182989 976 1108 ----
NM_016103chr5193 ------
NM_016107chr521368 874 ------
NM_016121chr131148 782 380 ------
NM_016122chr12--1100 ----
NM_016124chr111430 11280 --11437
NM_016131chr262251 2096 1523 694 242 163 1885 153 --
NM_016132chr1553354 2841 2715 261 39 12979 ----
NM_016133chr211410 ------
NM_016141chr32745 227 ------
NM_016144chr53485 103 52 --1296 --
NM_016147chr112940 851 2879 304 ----
NM_016152chr31394 --1478 --
NM_016162chr122663 321 --2264 249 --
NM_016169chr1042651 2580 1244 1093 --13253 --
NM_016201chr32660 593 --1272 --
NM_016203chr71842 --163 --
NM_016205chr431374 466 399 --126 --
NM_016206chr3108587 8135 8104 7819 3588 2140 2069 2020 854 503 2324 227 37416 7173 259 28598 8536
NM_016216chr32340 199 --1658 165
NM_016217chr643384 2932 2621 155 1570 22513 2491 23540 3523
NM_016226chr122336 107 ------
NM_016227chr131566 1257 347 1542 ----
NM_016231chr172467 179 ------
NM_016248chr1363835 3809 3722 3026 1460 385 2745 651 11229 13532
NM_016252chr21988 ------
NM_016255chr653199 3160 2125 1228 170 12707 ----
NM_016257chr153292 2910 2676 1007 568 12144 22756 275 --
NM_016258chr12743 610 ------
NM_016260chr256479 5472 2914 1652 1277 21458 338 24998 2925 --
NM_016270chr192488 454 ------
NM_016275chr321997 31 --21834 1754 --
NM_016277chr621016 280 11642 --1469
NM_016281chr1211094 ------
NM_016283chr5134 ------
NM_016284chr163963 897 363 ------
NM_016287chr131482 308 257 --1748 --
NM_016289chr21874 11497 --11911
NM_016297chr243738 3344 1036 251 ----1100
NM_016303chrX3387 130 46 ------
NM_016308chr132003 453 378 11464 ----
NM_016312chr12----1386 --
NM_016315chr211455 ------
NM_016316chr21641 --1481 --
NM_016320chr112760 335 185 1739 --
NM_016322chr953072 2276 1029 979 248 --22841 1050 --
NM_016338chr5--11047 ----
NM_016339chr1741465 593 347 312 --11523 --
NM_016352chr791406 1344 1213 1088 581 575 508 419 389 ------
NM_016374chr131404 620 214 ------
NM_016374chr131404 620 214 ------
NM_016376chr1753593 3257 1498 1452 1125 --42959 1068 719 504 --
NM_016377chr611240 21530 323 ----
NM_016395chr1531813 1761 219 ----128
NM_016396chr1563044 2208 1873 1006 835 92 --22020 113 --
NM_016404chr11126 ------
NM_016410chr92475 26 179 ----
NM_016422chr1132308 324 124 ----1628
NM_016424chr1741821 1531 520 398 ------
NM_016427chr18143 --1164 --
NM_016436chr2042738 1845 571 270 ----11886
NM_016441chr252277 2129 675 250 84 ------
NM_016453chr3178 ------
NM_016467chr231095 544 497 --11018 --
NM_016470chr201492 146 ----
NM_016476chr17----1382 1132
NM_016480chr52728 133 ----190
NM_016488chr1231871 1431 549 11696 21761 766 21912 1289
NM_016492chr171141 ------
NM_016505chr11703 ------
NM_016506chr111258 ------
NM_016507chr175839 762 574 503 142 2151 85 13132 --
NM_016513chr622658 1254 --13076 --
NM_016519chr42184 72 --1171 --
NM_016522chr1111398 ------
NM_016530chr1574029 3967 3730 3145 2573 1521 604 --11175 1559
NM_016531chr454073 3852 3076 965 581 2619 397 --1542
NM_016532chr1731080 1011 478 1842 2363 310 --
NM_016536chr191260 --176 --
NM_016542chrX31574 1264 254 ------
NM_016544chr263914 3740 2669 1547 1180 1053 33429 1072 724 1920 13321
NM_016545chr12274 255 ------
NM_016548chr91477 1636 11590 --
NM_016559chr361369 998 971 594 579 430 ------
NM_016569chr1241042 627 593 108 ------
NM_016570chr12----2313 33 --
NM_016577chr363850 3172 2774 1775 1261 39 13307 1591 23331 304
NM_016578chr111658 ------
NM_016582chr11126 ------
NM_016587chr71161 ------
NM_016588chr62741 173 1186 ----
NM_016592chr2021253 1226 ------
NM_016598chr331352 1198 561 ------
NM_016603chr521428 597 ------
NM_016604chr51343 ------
NM_016605chr512223 --22167 840 --
NM_016607chrX21651 243 ------
NM_016618chr21151 ------
NM_016620chr11330 ------
NM_016621chr1143123 2815 805 404 34164 246 165 54471 3439 3395 1580 1465 --
NM_016623chr8----1103 --
NM_016626chr1811423 --1189 --
NM_016628chr101202 ------
NM_016630chr15145 ------
NM_016631chr212843 100 ------
NM_016645chr151322 ------
NM_016654chr1531353 1118 152 --11231 --
NM_016655chr15----194 --
NM_016656chrX2320 295 ------
NM_016733chr2231488 1230 229 11450 1336 --
NM_016818chr212577 518 ------
NM_016824chr1021821 1800 1588 ----
NM_016830chr12179 1413 ----
NM_016831chr162251 1935 1875 1653 957 691 ----11736
NM_016836chr23609 159 107 ------
NM_016839chr23609 159 107 ------
NM_016929chr654487 4112 3568 3279 805 11488 1125 --
NM_016931chr111319 ------
NM_016932chr23883 169 26 --2312 307 --
NM_016936chr1632190 1627 183 124 11891 --
NM_016937chrX1347 1814 1648 --
NM_016946chr173449 2763 2618 1371 1264 618 36 --23216 3136 --
NM_016950chr411530 ----1462
NM_016952chr1153988 3960 3093 608 238 --1468 --
NM_017409chr121772 ------
NM_017410chr1211101 1306 21284 386 --
NM_017412chr851075 1006 65 59 28 --11039 1947
NM_017420chr1433214 3116 106 ----12738
NM_017423chr422049 1667 1614 ----
NM_017437chr1472022 2016 1942 884 622 348 161 ------
NM_017447chr2164399 4170 1398 1330 643 580 2447 114 1796 --
NM_017455chr152759 733 ------
NM_017456chr1731524 626 141 --21988 254 --
NM_017488chr241489 1449 1325 526 ------
NM_017514chrX1175 ------
NM_017519chr621365 73 ------
NM_017540chr52856 423 12082 ----
NM_017548chr322039 829 21563 1539 ----
NM_017551chr104615 428 416 133 ------
NM_017553chr153939 94 78 ------
NM_017563chr396220 5490 5451 4954 4810 4036 1546 367 151 44397 1951 1735 248 15400 --
NM_017578chr3194 ------
NM_017580chr1041564 1547 937 549 1815 ----
NM_017590chr2222676 704 ------
NM_017594chr922067 1124 22222 576 ----
NM_017599chr1241831 1383 676 392 --11313 21322 308
NM_017602chrX2774 761 --190 --
NM_017610chr1531662 762 242 11904 123 --
NM_017613chr211366 ------
NM_017626chr1031303 1286 641 --11516 --
NM_017629chr121254 316 1499 21670 1385 --
NM_017632chr41115 ------
NM_017633chr653674 2823 957 569 548 21526 347 12682 --
NM_017634chr811881 ------
NM_017635chr1111376 ------
NM_017637chr9179452 9431 9364 9264 9102 8751 8726 8157 3416 3313 3021 2943 2810 2708 2434 1936 712 25945 2081 11149 --
NM_017641chr1221015 971 1447 ----
NM_017643chr1773119 2637 2538 1925 543 466 100 --12238 --
NM_017644chr345140 3226 1567 829 --13694 --
NM_017649chr104900 450 380 91 ------
NM_017650chr7115875 5169 4924 4524 4307 2217 2211 2060 1601 280 254 32037 805 611 --26048 2053
NM_017655chr121294 598 --11269 --
NM_017657chr21755 ------
NM_017660chr1963112 1290 986 436 275 264 13347 ----
NM_017662chr972027 1804 1720 1700 1490 267 33 21783 1689 ----
NM_017666chrX42148 1868 879 274 --12110 --
NM_017672chr151918 --130 --
NM_017679chr171190 --1678 --
NM_017693chr1341561 1345 1324 111 --1530 --
NM_017694chr221769 1576 ------
NM_017700chr41110 1626 ----
NM_017709chr163943 3850 3625 1632 506 459 24335 4256 13912 --
NM_017714chr20193 ------
NM_017715chr7--3747 498 231 ----
NM_017719chr322290 2197 ------
NM_017730chr32647 158 ------
NM_017737chr121925 438 1401 --1513
NM_017740chr1651356 1280 1269 1145 28 --21404 1300 --
NM_017742chr183396 297 140 11795 ----
NM_017747chr5------1355
NM_017752chrX42149 2035 1557 93 ------
NM_017753chr92239 163 ------
NM_017754chr664182 4095 3330 858 820 222 14978 33196 1111 252 13827
NM_017757chr182872 831 ------
NM_017758chr171370 21402 1257 11026 11232
NM_017762chr1572466 2352 1941 1822 903 785 229 --12225 11579
NM_017763chr171200 --1116 --
NM_017768chr12274 114 127 ----
NM_017770chr61751 --1563 --
NM_017778chr811099 1342 ----
NM_017779chr112774 --22732 568 --
NM_017780chr81667 ----1632
NM_017786chr82619 104 ------
NM_017787chr10--21904 487 ----
NM_017789chr22690 55 ------
NM_017798chr2021119 117 --2139 126 --
NM_017799chr1421421 655 11429 21696 1529 --
NM_017801chr3175 --1798 --
NM_017811chr963026 2808 2555 2334 2020 218 1491 --12381
NM_017813chr875554 5061 4790 4043 3821 1584 1236 15818 25719 5165 33959 1045 722
NM_017822chr121775 --1514 --
NM_017824chr1032694 1751 882 12664 ----
NM_017831chr1843143 1480 483 448 ----34154 3328 2950
NM_017842chr122675 626 ------
NM_017845chr4----1251 --
NM_017848chrX11773 ------
NM_017849chr232281 1282 617 11245 ----
NM_017866chr8170 --1980 --
NM_017873chr922168 360 --12266 1635
NM_017880chr23314 170 26 ------
NM_017890chr841708 537 385 84 ----1180
NM_017902chr10114833 4781 4754 4690 4588 4379 2063 610 538 210 204 13516 34715 4672 780 21635 124
NM_017905chr131530 --1166 --
NM_017915chr122958 752 1372 ----
NM_017918chr41115 ------
NM_017919chr965626 4916 4809 3776 1840 724 11071 21398 830 --
NM_017921chr1732059 1568 439 ------
NM_017922chr143504 262 237 ------
NM_017925chr951848 1823 1527 1327 370 ------
NM_017926chr143583 309 77 ------
NM_017933chr221067 1011 ------
NM_017934chr6184 ------
NM_017938chrX31980 1385 645 ----11719
NM_017943chr142793 183 --11020 --
NM_017944chr1133062 1186 585 21949 1107 12197 --
NM_017946chr721299 405 1424 195 --
NM_017954chr721661 68 ----11132
NM_017958chr252761 2201 1159 644 238 ------
NM_017964chr21120 --1376 --
NM_017972chr143583 309 77 ------
NM_017987chr1081986 1935 582 506 500 474 270 261 ------
NM_017990chr16104150 4037 3779 3072 2999 2768 963 182 164 106 13897 34400 3183 40 21635 706
NM_017994chr7102608 2323 1902 1004 749 530 381 206 100 52 11116 52924 2797 1199 795 782 --
NM_018004chr32383 305 1338 ----
NM_018009chr12----1116 --
NM_018010chr331533 454 363 ------
NM_018011chr131644 ------
NM_018023chr321926 127 ------
NM_018026chr1111279 --21252 260 --
NM_018027chr1033285 1146 171 --1318 --
NM_018028chr191171 ------
NM_018030chr181201 --1945 --
NM_018043chr1121362 183 ------
NM_018061chr12545 224 --1516 --
NM_018064chr61235 ------
NM_018078chr42836 650 ------
NM_018079chr21483 1505 ----
NM_018085chr198110 7590 7486 7175 948 601 595 548 54 38104 6458 5386 37039 5368 344 --
NM_018086chr231359 1193 381 11483 1613 21347 489
NM_018090chr121144 127 ------
NM_018092chr1611548 ------
NM_018094chrX1107 ------
NM_018095chr111258 ------
NM_018098chr31230 ------
NM_018103chr11317 ------
NM_018110chr1631139 877 133 ------
NM_018114chr3------1114
NM_018119chr162261 79 ------
NM_018120chr84619 556 487 387 ----1517
NM_018121chr1073163 2692 2508 2487 2431 2389 305 ------
NM_018133chr352009 1930 1651 852 83 --11717 --
NM_018144chr103308 264 107 ------
NM_018150chr11897 ------
NM_018155chr343377 1032 878 549 --12930 1975
NM_018157chr1222231 95 ----1313
NM_018159chrX--21234 689 1172 --
NM_018172chr1111110 11496 ----
NM_018179chr123234 65 53 ------
NM_018181chr1861924 1871 1649 1275 1261 621 --11401 --
NM_018182chr1731784 1409 591 1598 11810 --
NM_018184chr331736 1547 751 11676 ----
NM_018193chr152204 75 ------
NM_018195chr118844 705 603 457 238 180 112 79 --21827 143 21848 68
NM_018202chr14888 881 278 186 ------
NM_018203chr1126 --170 1718
NM_018206chr162764 593 ------
NM_018211chr111940 ----11463
NM_018221chr2133 ------
NM_018222chr112580 97 21638 491 21175 40 --
NM_018227chr442898 2501 2244 190 ------
NM_018230chr11480 ------
NM_018237chr101222 ------
NM_018243chr493812 3449 3416 3169 1226 1102 474 147 43 33806 3579 1022 ----
NM_018246chr832379 592 166 11891 --21786 242
NM_018247chr642495 1020 871 599 1420 13168 --
NM_018254chr132218 2157 769 --11881 11889
NM_018257chr2042157 1850 1666 832 ------
NM_018266chr321088 66 21066 692 ----
NM_018270chr202759 740 --1596 --
NM_018286chr172819 353 ------
NM_018287chr101109 11029 ----
NM_018293chr342496 2329 2263 1833 ----1443
NM_018299chr832610 1055 985 12749 11087 --
NM_018307chr17--1670 ----
NM_018312chr1131710 710 214 --11937 21798 272
NM_018313chr32777 219 ------
NM_018315chr431348 1083 989 ----1560
NM_018317chr4--1287 ----
NM_018318chr121331 ------
NM_018327chr2021155 57 --1649 --
NM_018334chr72522 387 ------
NM_018339chr931708 1645 1486 ------
NM_018340chr1664910 4456 3072 1424 625 131 --33955 3787 83 24698 54
NM_018348chr16146 ----11016
NM_018351chr1224563 4213 ----23522 1795
NM_018361chr883288 3278 2678 1472 1172 447 422 302 23482 1074 1940 --
NM_018362chr1143527 2975 405 30 1127 23192 2698 --
NM_018364chr173898 3600 3228 3176 3118 816 308 13371 32825 345 101 2919 358
NM_018371chr841443 1222 186 45 ------
NM_018373chr1486192 5885 5709 5284 2482 2448 1638 133 --25874 5445 --
NM_018374chr745218 4929 975 156 14191 ----
NM_018375chr141249 31466 746 38 191 11492
NM_018383chr22429 55 --11265 --
NM_018387chr91440 ------
NM_018388chrX2517 467 ------
NM_018398chr3--1228 ----
NM_018399chr62598 533 1262 ----
NM_018403chr333161 3120 324 --13501 --
NM_018409chr431267 166 85 --1708 --
NM_018413chr122244 202 ------
NM_018416chr1262624 2330 1914 1004 571 311 ----12246
NM_018424chr921544 1168 1173 21501 1200 --
NM_018425chr1041764 866 721 650 1128 --1573
NM_018426chr61564 ------
NM_018429chr532876 258 207 --12822 --
NM_018433chr21577 ------
NM_018434chr5----134 --
NM_018439chr1881942 1673 987 803 699 475 385 31 --11980 1372
NM_018440chr8107875 7627 7335 7300 6987 3309 3007 2430 2009 508 11531 28001 1820 15811
NM_018442chr1--1352 ----
NM_018444chr811963 --1337 1647
NM_018448chr1231176 427 398 1821 ----
NM_018462chr31117 1257 ----
NM_018464chr102152 33 ------
NM_018469chr1721198 346 ------
NM_018471chr2----1147 1587
NM_018477chr1431080 169 26 ------
NM_018482chr822215 2072 22518 221 ----
NM_018489chr13787 679 306 --1541 --
NM_018490chr1111533 1536 --1414
NM_018534chr2166 ------
NM_018553chr1731556 1334 46 ----1133
NM_018557chr241622 1579 1062 158 11528 11684 --
NM_018566chr174962 4076 3751 3275 2048 1254 1055 24988 255 14979 35067 4417 4343
NM_018569chr421181 1104 --21251 261 --
NM_018571chr2149 ------
NM_018584chr131090 1064 464 1107 ----
NM_018593chr62553 33 ------
NM_018602chr15--1312 --11644
NM_018638chr1295377 5305 4807 1963 1927 1756 1221 1140 587 --1114 --
NM_018640chr1262184 940 807 619 236 57 22268 242 12772 --
NM_018650chr142169 1759 1753 116 --11604 11903
NM_018652chr151337 ------
NM_018653chr17----1352 --
NM_018657chr31286 ----1723
NM_018667chr1632800 2609 449 ------
NM_018682chr73617 552 147 ------
NM_018683chr2041652 1161 422 312 ----1190
NM_018685chr731126 717 222 1841 ----
NM_018689chr1552637 2560 1908 1878 923 --22212 894 --
NM_018695chr542445 2332 1659 481 ----21693 722
NM_018698chrX21648 1431 --21991 1560 --
NM_018704chr131581 845 673 ------
NM_018708chr191306 --21532 90 --
NM_018710chr84443 417 323 183 ----1542
NM_018712chr1141508 1299 1115 52 --1234 --
NM_018717chr432405 940 918 ------
NM_018719chr721235 1112 11359 11213 --
NM_018834chr5--1716 ----
NM_018841chr143954 3663 2931 982 --21013 691 --
NM_018890chr751491 1466 1293 432 295 ----11211
NM_018897chr2135 ------
NM_018898chr51800 --22165 2038 --
NM_018899chr51800 --22165 2038 --
NM_018900chr51800 --22165 2038 --
NM_018901chr51800 --22165 2038 --
NM_018902chr51800 --22165 2038 --
NM_018903chr51800 --22165 2038 --
NM_018904chr51800 --22165 2038 --
NM_018905chr51800 --22165 2038 --
NM_018906chr51800 --22165 2038 --
NM_018907chr51800 --22165 2038 --
NM_018908chr51800 --22165 2038 --
NM_018909chr51800 --22165 2038 --
NM_018910chr51800 --22165 2038 --
NM_018911chr51800 --22165 2038 --
NM_018912chr52630 608 21283 285 ----
NM_018913chr52630 608 21283 285 ----
NM_018914chr52630 608 21283 285 ----
NM_018915chr52630 608 21283 285 ----
NM_018916chr52630 608 21283 285 ----
NM_018917chr52630 608 21283 285 ----
NM_018918chr52630 608 21283 285 ----
NM_018919chr52630 608 21283 285 ----
NM_018920chr52630 608 21283 285 ----
NM_018921chr52630 608 21283 285 ----
NM_018922chr52630 608 21283 285 ----
NM_018923chr52630 608 21283 285 ----
NM_018924chr52630 608 21283 285 ----
NM_018925chr52630 608 21283 285 ----
NM_018926chr52630 608 21283 285 ----
NM_018927chr52630 608 21283 285 ----
NM_018928chr52630 608 21283 285 ----
NM_018929chr52630 608 21283 285 ----
NM_018934chr53245 119 61 ------
NM_018945chr673658 3471 3124 3114 2732 1275 617 13151 ----
NM_018947chr753817 3118 2004 1448 436 ----21950 778
NM_018948chr12937 529 ------
NM_018951chr731143 948 892 ------
NM_018957chr222279 108 --1309 --
NM_018959chr191579 ------
NM_018970chr773188 3092 2986 2877 1960 1156 450 ------
NM_018976chr1222268 590 --12186 12257
NM_018977chrX----1876 --
NM_018979chr1262652 2575 2548 2121 892 298 1659 1369 1123
NM_018992chr1611369 11305 1141 --
NM_018993chr2031462 1284 54 ------
NM_018999chr10104888 4713 4615 3409 3369 1559 1402 1117 492 65 21299 805 11932 --
NM_019000chr521468 673 --11558 11424
NM_019001chr354035 3741 3525 1780 600 --24421 3038 --
NM_019003chrX1141 1122 ----
NM_019004chr722016 221 ----11509
NM_019008chr2283593 3578 2652 1301 411 353 345 303 --32817 418 111 --
NM_019022chr1862878 2531 2177 2087 646 115 --12466 --
NM_019028chr112424 357 ------
NM_019030chr5--1210 ----
NM_019036chr62254 82 2459 222 ----
NM_019042chr71315 ------
NM_019045chrX--1626 ----
NM_019046chr10195 ------
NM_019049chr11109 ------
NM_019053chr1011014 ------
NM_019072chr543791 3560 3529 140 21697 452 23682 708 11366
NM_019074chr15--1158 ----
NM_019080chr1351572 1279 1069 206 154 --11089 --
NM_019084chr1022099 902 3819 397 309 --12063
NM_019091chr221162 1031 ------
NM_019094chr1211168 2559 108 13688 --
NM_019096chr62341 131 ------
NM_019106chr2243225 3189 583 317 --1127 --
NM_019114chr932158 983 778 ----22211 994
NM_019116chr1693338 3294 3215 3208 3015 2960 2329 728 209 13231 1785 --
NM_019555chr32564 351 ------
NM_019556chrX41414 1228 585 438 1976 ----
NM_019558chr21284 ------
NM_019590chr10--11181 --1524
NM_019592chr92756 607 ------
NM_019593chr2062831 2813 2756 2169 483 150 12348 ----
NM_019594chr92627 460 --11491 --
NM_019595chr22678 216 ------
NM_019596chr2132995 1087 997 22777 818 11157 --
NM_019597chrX1204 ------
NM_019605chr12624 519 ----1703
NM_019606chr71485 --1384 --
NM_019610chr141521 736 715 158 --1572 11378
NM_019885chr262858 2741 2703 2260 126 116 11948 ----
NM_019895chr32966 940 ------
NM_019903chr1021821 1800 1588 ----
NM_020066chr12710 116 ------
NM_020116chr431173 564 544 ------
NM_020122chr264635 2301 997 929 384 111 145 35744 4260 651 --
NM_020123chr1011424 --11064 --
NM_020125chr142186 845 823 688 12000 ----
NM_020132chr2185189 4660 4596 4533 4475 4214 3751 1384 ------
NM_020142chr123592 481 175 ------
NM_020144chr721797 1605 --125 --
NM_020148chr1812350 12048 2575 129 --
NM_020150chr101251 11936 12051 --
NM_020151chr241431 1236 523 512 11364 11483 --
NM_020152chr211713 2625 148 ----
NM_020159chr43673 423 417 11337 --1151
NM_020177chr522295 2233 22083 1071 23232 374 --
NM_020178chr1731200 1113 1058 --182 --
NM_020182chr2063104 1120 668 649 615 285 12969 23322 958 12373
NM_020184chr252272 2187 1787 1771 1613 --1383 --
NM_020189chr8--153 ----
NM_020190chr13462 71 21 ------
NM_020193chr1151338 1071 436 300 93 ------
NM_020194chr22607 434 ------
NM_020198chr1721030 483 --11161 --
NM_020199chr5--175 1118 --
NM_020228chr1152535 2365 775 461 258 --2957 577 2205 159
NM_020229chr11--1160 ----
NM_020235chr3152 ------
NM_020239chr1----22227 1442 --
NM_020244chr12--122 131 --
NM_020245chr675123 4929 4613 4510 4080 3725 3620 13576 12037 --
NM_020307chr31435 --141 --
NM_020309chr191317 ------
NM_020310chr1732784 1039 518 --12124 --
NM_020336chr2043749 3051 701 554 32406 1541 1096 --1507
NM_020337chr473164 3043 2826 2362 961 499 463 ------
NM_020338chr1033732 3555 3095 ------
NM_020340chr651653 1494 801 291 219 ------
NM_020341chr2052068 1674 1360 432 164 ------
NM_020342chr2------12489
NM_020346chr1141367 1265 579 215 11271 1117 --
NM_020354chr102755 113 1321 ----
NM_020357chr321339 391 --1645 --
NM_020362chr12274 135 1849 ----
NM_020366chr14--176 ----
NM_020374chr122806 683 1415 11370 --
NM_020379chr13905 341 47 1256 ----
NM_020382chr123527 465 250 ------
NM_020390chr344517 800 787 145 24444 4243 --13475
NM_020401chr12184 ------
NM_020403chr1321799 155 11766 ----
NM_020420chrY21176 1159 ------
NM_020425chr62382 90 --11287 --
NM_020429chr762907 2517 2197 1988 1164 728 12206 ----
NM_020431chr1432725 1787 774 ------
NM_020432chr741824 1601 361 135 22290 73 ----
NM_020438chr91922 --11341 --
NM_020440chr163269 2958 1340 1253 1041 625 13064 22965 1001 1732
NM_020443chr196641 6482 5603 4338 4247 1265 864 401 293 --25929 1834 --
NM_020444chr541414 994 476 40 ------
NM_020445chr7------1602
NM_020449chrX2596 577 1585 ----
NM_020455chr631787 1727 1064 12819 1939 12535
NM_020456chr1322061 909 11665 21740 411 --
NM_020457chr16--1570 1133 --
NM_020463chr21209 1191 ----
NM_020465chr1611555 ------
NM_020466chr633282 3150 1703 13260 ----
NM_020473chrX41736 1653 193 71 ------
NM_020475chr831847 1823 178 ------
NM_020476chr831847 1823 178 ------
NM_020477chr831847 1823 178 ------
NM_020478chr831910 1886 241 ------
NM_020480chr831847 1823 178 ------
NM_020546chr542439 1209 1014 202 11263 ----
NM_020630chr10------1711
NM_020640chr31193 --11761 --
NM_020642chr112553 507 ------
NM_020644chr113161 144 69 ------
NM_020647chr821781 652 --12232 --
NM_020651chr211212 ------
NM_020654chr311514 1396 ----
NM_020655chr1621378 161 11218 ----
NM_020672chr1165 ------
NM_020673chr2087506 5576 5436 5281 3079 1812 992 247 47671 7472 5241 643 ----
NM_020686chr1672994 2510 2475 2039 968 675 65 ------
NM_020689chr2021696 553 11108 11443 11321
NM_020690chr5--1212 ----
NM_020697chr831140 458 49 ----1266
NM_020699chr175178 4698 3817 2145 1458 1151 926 14398 21641 1357 --
NM_020702chr911771 --21793 1158 --
NM_020708chr2022398 460 ------
NM_020711chr222081 458 --1783 --
NM_020715chr1432266 1554 111 ------
NM_020717chrX43266 1693 706 273 33087 1714 1681 24563 4312 --
NM_020718chr16125565 4913 4467 4404 4165 2630 2234 1691 1323 1026 856 422 21443 950 1505 --
NM_020732chr621365 73 ------
NM_020734chr1253193 2081 1130 356 325 ------
NM_020739chr1594257 3811 3799 3784 2714 2684 758 418 46 --23722 1666 12876
NM_020742chrX22662 1896 12534 22683 477 1586
NM_020744chr2189 ------
NM_020748chr171170 11375 ----
NM_020749chr851850 1377 665 382 284 11822 1185 --
NM_020750chr631270 462 81 ----139
NM_020752chr1052695 1155 862 853 571 12297 ----
NM_020753chr172169 49 ------
NM_020755chr6189 2609 143 ----
NM_020760chr212024 11625 1488 --
NM_020766chrX73863 3760 3530 1515 1387 569 63 --11763 --
NM_020769chrX2882 670 --1720 1346
NM_020771chr641522 1177 406 339 11141 11230 1491
NM_020772chr17138457 7123 6939 6784 6757 6598 5474 3426 2318 2265 1615 924 422 12004 38396 7139 6185 27006 600
NM_020773chr4--12597 ----
NM_020774chr1845373 2393 1560 619 14455 15412 --
NM_020775chr11180 ------
NM_020778chr1563045 1746 1676 1298 428 353 1298 --13864
NM_020779chr273188 3031 1063 1021 663 260 134 ------
NM_020791chr1711272 ------
NM_020794chr1------182
NM_020795chr1741725 1359 770 563 ----1343
NM_020796chr512331 12834 12607 --
NM_020801chr52659 647 22198 857 1112 1403
NM_020805chr1821945 630 ------
NM_020806chr142726 235 ------
NM_020808chr141124 887 107 45 ------
NM_020810chr141113 ------
NM_020815chr41360 ------
NM_020818chr14------1171
NM_020819chr61245 ------
NM_020824chr102127 76 ------
NM_020826chr1183641 3359 2935 1496 1241 1113 213 146 ------
NM_020830chr263318 3180 2171 903 604 400 --12228 --
NM_020832chr11617 ------
NM_020839chr321065 609 ------
NM_020841chr1233647 1398 752 22990 2862 --11273
NM_020845chr1242204 974 467 427 1195 21746 288 --
NM_020850chr1642508 2008 878 610 --23188 2561 12055
NM_020854chr1851576 1261 235 106 76 11401 1247 --
NM_020856chr1931597 1005 410 ------
NM_020858chr1541486 416 410 194 1157 --1867
NM_020859chr463105 2971 2805 2574 1064 362 12650 1165 --
NM_020860chr421043 373 ------
NM_020866chr132709 36 --1764 --
NM_020868chr222005 252 --11831 --
NM_020870chr442116 1653 1382 517 ------
NM_020871chrX32072 626 101 ------
NM_020872chr321320 662 1595 ----
NM_020873chr32562 50 ----1863
NM_020886chr112462 50 --11120 2474 303
NM_020895chr19----1218 --
NM_020896chr1111016 1314 1283 --
NM_020899chr1732314 1854 107 ----12348
NM_020918chr1043508 3392 2270 753 ------
NM_020919chr241200 1010 825 401 ------
NM_020921chr1483639 3401 3097 2953 2636 2469 671 608 ------
NM_020922chrX21867 545 11823 ----
NM_020924chr92169 76 --1180 --
NM_020935chr274432 3922 3747 3722 1857 1833 1135 13069 14314 --
NM_020940chr1012326 11169 12931 --
NM_020948chr1103715 3105 2772 2724 2690 1416 1011 821 374 159 12984 --23606 3574
NM_020951chr1922376 1663 ------
NM_020952chr91229 ------
NM_020960chr954767 4746 3668 3079 578 14249 15005 --
NM_020962chr1562369 2005 1894 950 798 650 ------
NM_020963chr11221 ------
NM_020971chr191587 ------
NM_020972chr41217 ------
NM_020977chr432123 2057 308 ----11946
NM_020980chr15178 21198 1184 31723 1424 684 21409 282
NM_020981chr23719 611 118 1765 ----
NM_020983chr1252147 1863 1763 1653 469 1336 2897 310 12161
NM_020987chr1021062 486 ------
NM_021003chr141785 ------
NM_021005chr15--1242 ----
NM_021007chr21623 ------
NM_021019chr122197 171 --1151 --
NM_021032chr341961 659 442 186 11685 --12022
NM_021033chr1333173 2692 34 22195 700 11212 --
NM_021035chr20----127 --
NM_021047chr19------1270
NM_021069chr442093 624 540 483 ------
NM_021072chr521818 559 ----1981
NM_021088chr23637 439 431 1831 1266 --
NM_021103chr21189 ------
NM_021106chr92779 482 ------
NM_021111chr911165 ------
NM_021120chrX42794 1256 444 26 11078 32762 803 108 --
NM_021127chr181427 --21231 319 --
NM_021131chr921474 1015 ------
NM_021132chr101847 11318 ----
NM_021145chr71793 ------
NM_021148chr742319 1995 866 513 ----11631
NM_021149chr1611145 130 --1414
NM_021159chr42312 226 11130 ----
NM_021174chr82295 233 1556 2686 255 1592
NM_021183chrX32058 1773 898 --12324 12528
NM_021188chr141478 ----1127
NM_021189chr12835 109 ------
NM_021190chr11256 1472 --11190
NM_021191chr1232166 1792 1764 --11705 --
NM_021192chr21358 ------
NM_021194chr12104 32 180 ----
NM_021202chr2062737 1129 784 565 303 32 42636 2516 2300 901 11983 --
NM_021205chr142686 2593 1140 169 --11968 --
NM_021213chr1741280 430 303 195 ----