TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3116
miRNA Sequence: UGCCUGGAACAUAGUAGGGACU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000037chr852199 2047 1878 871 636 21858 496 21955 223 --
NM_000084chrX56939 5977 5686 4624 1871 36552 6407 6045 22348 751 --
NM_000088chr1731150 955 529 ------
NM_000125chr652788 1700 1351 865 350 ------
NM_000134chr451691 1212 537 431 357 ------
NM_000138chr151196 --11812 --
NM_000163chr531664 1545 372 1857 11603 --
NM_000165chr6174 --2537 523 --
NM_000168chr743212 2311 614 186 12597 ----
NM_000182chr21567 ----1479
NM_000208chr1984491 4231 3594 3524 1613 1280 1272 454 11137 1524 13107
NM_000217chr1274608 4464 4190 3792 1290 776 292 24665 3364 24921 4295 12127
NM_000232chr432379 2322 2034 31286 709 697 --1860
NM_000252chrX21072 1056 1477 ----
NM_000256chr11--129 ----
NM_000259chr1584850 4581 4369 1662 1376 1181 1108 873 --25711 2487 --
NM_000266chrX1335 ----1245
NM_000276chrX21912 334 --1363 --
NM_000278chr10102185 2179 2080 1830 1815 1779 644 594 221 215 22161 435 130 --
NM_000304chr171830 --1961 --
NM_000314chr1012225 ------
NM_000332chr667077 4650 4542 2704 1737 543 --25616 1665 1244
NM_000335chr341570 1555 1368 626 3825 231 144 ----
NM_000337chr544308 3997 1790 1330 ------
NM_000353chr1661026 930 459 289 54 38 1956 --1422
NM_000358chr5------1508
NM_000368chr9124059 4014 3813 3038 3016 1235 1196 1135 1120 1041 459 89 1417 11075 11639
NM_000376chr1252729 2706 2366 59 45 22132 580 ----
NM_000445chr86936 912 816 717 632 259 ------
NM_000449chr141381 1224 1139 947 --1402 --
NM_000461chr333268 3222 1661 --1904 13801
NM_000486chr1272781 2422 996 926 377 252 141 52233 1181 1138 1117 335 13012 --
NM_000494chr102682 33 ------
NM_000526chr17122 ------
NM_000554chr1952860 1202 959 593 481 12476 1278 --
NM_000555chrX97234 5005 4948 3152 1878 1128 978 903 248 27783 7488 33050 2144 994 15673
NM_000578chr241798 1282 1254 630 --11293 --
NM_000599chr243437 3372 1698 543 31261 777 393 23078 1763 --
NM_000609chr1033015 2734 2317 1105 --22497 1931
NM_000615chr1182813 2227 2171 2021 1066 365 359 337 ----1426
NM_000618chr1235501 5334 2247 ----11835
NM_000618chr1235501 5334 2247 ----11835
NM_000633chr1843969 3588 1050 940 --11543 21172 182
NM_000680chr8--1152 1411 --
NM_000701chr1132 ------
NM_000719chr12156620 6008 5943 5889 5649 5602 5249 4235 2218 1586 675 502 459 270 167 --46466 4331 4244 2385 --
NM_000724chr1041998 1862 711 297 ------
NM_000725chr126854 304 211 138 100 89 ----2225 64
NM_000734chr11629 ------
NM_000738chr113837 675 97 1185 2959 277 --
NM_000767chr1961463 1229 1073 428 262 34 ------
NM_000780chr83348 215 114 ------
NM_000782chr2031207 438 130 --1232 --
NM_000793chr1434451 4114 470 --14634 1662
NM_000808chrX2796 91 21065 423 --156
NM_000813chr532117 989 91 22136 1516 ----
NM_000814chr1533806 3788 944 --1879 --
NM_000826chr41976 ------
NM_000831chr1226084 5949 5752 5745 5509 5091 5063 5010 4800 4416 4037 3986 3939 3911 2024 1922 1204 717 388 269 171 26 --36192 5053 2505 --
NM_000840chr7----1173 --
NM_000870chr5153 ------
NM_000875chr1584751 4321 2773 2762 2742 1324 1012 521 21813 1552 34589 2174 2024 --
NM_000879chr5186 ----1137
NM_000883chr76606 520 458 253 245 207 ----1126
NM_000883chr76606 520 458 253 245 207 ----1126
NM_000885chr252151 1772 1700 1653 1641 ------
NM_000901chr432241 2046 1927 ----12312
NM_000912chr863260 1008 691 463 220 59 1831 13053 12694
NM_000918chr17121 ----2793 217
NM_000924chr1241138 1113 548 283 --21183 228 --
NM_000966chr123888 348 148 ----145
NM_001001132chr21129 ------
NM_001001323chr1221997 840 ----11211
NM_001001331chr312125 1993 11915 279 63
NM_001001342chr1031284 1240 251 --11395 --
NM_001001344chrX1805 2740 598 1940 --
NM_001001394chr21607 ------
NM_001001481chr812387 --1295 1186
NM_001001664chr243053 1622 563 147 --150 --
NM_001001669chr582639 2568 2433 2190 2006 901 674 109 --21928 336 --
NM_001001890chr2184229 3752 3435 2674 1483 1081 163 97 --154 --
NM_001001924chr821575 812 11837 11393 --
NM_001001925chr821575 812 11837 11393 --
NM_001001928chr22178325 8076 7601 6890 6831 5875 5187 3345 3070 2802 2757 2649 2564 2469 1938 1691 31 42854 2031 1944 595 47699 6930 1209 985 28151 5855
NM_001001931chr821575 812 11837 11393 --
NM_001001933chr1--1137 ----
NM_001002233chr872004 1759 790 720 684 160 57 --1871 --
NM_001002269chr91511 ------
NM_001002762chr1042370 1977 758 271 2712 297 ----
NM_001002814chr863300 790 720 684 160 57 --21009 871 --
NM_001002838chrX3625 312 51 11827 ----
NM_001002860chr1462945 1489 972 830 698 661 ------
NM_001003407chr1011448 --23866 3266 --
NM_001003408chr1011448 --23866 3266 --
NM_001003652chr1842943 2416 1929 981 17590 --1409
NM_001003676chr112288 281 --2271 253 --
NM_001003698chr6--11203 1629 --
NM_001003699chr6--11203 1629 --
NM_001003712chr12----11180 --
NM_001003800chr983679 3205 3169 2923 2354 1368 748 551 ------
NM_001003940chr1562891 2806 1191 697 525 186 ------
NM_001003942chr1562891 2806 1191 697 525 186 ------
NM_001003943chr1562895 2810 1195 701 529 190 ------
NM_001003962chr195476 433 402 203 164 ------
NM_001004065chr943101 1405 1174 392 12431 ----
NM_001004419chr1224281 901 124 11561 --
NM_001005207chr17----148 --
NM_001005271chr172751 30 2896 761 ----
NM_001005273chr172751 30 2896 761 ----
NM_001005404chr1774374 2925 1186 1059 699 582 119 ------
NM_001005407chr164683 610 181 141 2306 71 ----
NM_001005502chr1264855 4033 3722 1871 829 576 33584 3401 1286 160 --
NM_001005505chr33550 308 127 --1521 --
NM_001005609chrX83636 3624 3393 1387 1334 1214 335 151 13407 23573 3369 11358
NM_001005743chr141447 --2381 136 --
NM_001005744chr141447 --2381 136 --
NM_001005745chr141447 --2381 136 --
NM_001005910chr3--1530 1556 --
NM_001005911chr3--1530 1556 --
NM_001006115chr332161 921 203 1631 1239 --
NM_001006610chr161847 ------
NM_001006636chr2--1629 ----
NM_001006665chr12636 198 ----1591
NM_001006684chrX----1171 --
NM_001006945chr1--1659 1617 --
NM_001007023chr1434451 4114 470 --14634 1662
NM_001007024chr17103570 3013 1237 1187 1138 865 825 672 363 333 11123 12841 --
NM_001007025chr17103570 3013 1237 1187 1138 865 825 672 363 333 11123 12841 --
NM_001007097chr984450 4381 3783 3725 3492 3342 3228 1384 32043 1294 222 14630 --
NM_001007156chr1571845 1754 1716 1646 1635 550 96 --21655 742 176
NM_001007237chr152657 2647 1791 1140 977 --1271 --
NM_001007271chr103845 427 97 --1865 1368
NM_001007559chr1841826 1710 1660 1271 ------
NM_001008220chr5143611 3556 3351 3110 2657 2641 2589 2470 912 781 746 515 490 417 1687 ----
NM_001008225chr71280 ------
NM_001008239chr1821149 1140 1328 --12606
NM_001008408chr766294 5356 5296 4121 1747 342 14634 35801 4016 105 --
NM_001008540chr21448 ----1200
NM_001008541chr1011899 21954 690 ----
NM_001008541chr1011899 21954 690 ----
NM_001008564chr132513 374 ----11476
NM_001008660chr1111460 ------
NM_001008701chr1972658 2445 2299 1951 1013 1003 35 --22578 116 --
NM_001008738chr532936 2010 1845 ------
NM_001009185chr51658 ------
NM_001010852chr61140 ------
NM_001010853chr661263 1197 1050 716 600 550 --11131 --
NM_001010867chr1166226 6047 5884 5358 5180 4368 4106 2396 2073 2023 1902 1039 841 657 415 67 1184 1340 --
NM_001010888chrX74022 3785 3569 3312 1634 620 502 23657 537 ----
NM_001010891chr5116448 6012 5289 5173 5123 4601 2708 2540 1684 819 401 ------
NM_001010895chr931736 700 679 11654 ----
NM_001010942chr12132 --1815 --
NM_001010971chr1--1149 ----
NM_001011538chr42765 158 1972 ----
NM_001011546chr201677 ----1574
NM_001011553chr71182 ----1824
NM_001011658chrX4790 458 343 293 --21332 349 --
NM_001011666chr736168 4183 1548 14837 --11805
NM_001012329chr111895 --22164 971 --
NM_001012393chr1155154 4448 3384 1759 1597 --11973 --
NM_001012415chr94758 651 611 35 ------
NM_001012426chr6132901 2752 2700 2633 2191 2118 1098 844 766 673 663 130 107 13088 22130 56 --
NM_001012427chr6132901 2752 2700 2633 2191 2118 1098 844 766 673 663 130 107 13088 22130 56 --
NM_001012755chrX51939 1390 1224 526 362 13755 --13408
NM_001012756chr1932543 2378 222 ------
NM_001012974chr6175 ------
NM_001013399chr6--1718 1900 --
NM_001013415chr421411 287 ------
NM_001013620chr1255660 5468 3033 2866 1082 17805 --23369 599
NM_001013624chr175390 324 212 199 108 ------
NM_001013690chr1272322 2194 2176 1843 1587 920 679 2265 183 ----
NM_001013693chr172721 2078 1963 1158 458 108 93 12608 22005 168 --
NM_001013693chr172721 2078 1963 1158 458 108 93 12608 22005 168 --
NM_001014380chr1385161 4187 3979 2338 2288 1179 801 644 14137 ----
NM_001014445chr174964 728 344 294 1776 ----
NM_001014797chr10107843 7527 7356 7274 6882 6833 6157 5449 5201 2112 --12020 --
NM_001014972chr2--1194 ----
NM_001015045chr452113 838 755 649 636 ------
NM_001017368chr1741128 1067 709 121 ------
NM_001017424chr131825 547 363 ------
NM_001017425chr131825 547 363 ------
NM_001017440chr7117630 7585 6947 6563 6530 6151 2739 2562 2295 1203 464 37356 5994 2827 --27707 337
NM_001017535chr1252729 2706 2366 59 45 22132 580 ----
NM_001017916chr1761766 1683 830 820 709 67 11621 11657 --
NM_001017917chr1761766 1683 830 820 709 67 11621 11657 --
NM_001017973chr5191 ------
NM_001017974chr5191 ------
NM_001018003chr8--1644 2548 278 --
NM_001018008chr15----136 --
NM_001018050chr22113209 2791 2579 1375 1253 1035 966 955 931 802 754 1386 43310 2310 1286 166 --
NM_001018052chr22113209 2791 2579 1375 1253 1035 966 955 931 802 754 1386 43310 2310 1286 166 --
NM_001018057chr1141210 169 86 58 1212 1181 --
NM_001018067chr144258 4008 3280 1351 --13566 --
NM_001018068chr144258 4008 3280 1351 --13566 --
NM_001018069chr144258 4008 3280 1351 --13566 --
NM_001024401chr1652639 2242 1817 936 39 21783 122 ----
NM_001024593chr103369 205 66 ------
NM_001024647chr12106688 6655 6504 5782 5138 4821 2732 2487 1674 1422 17436 26835 210 --
NM_001024649chr531981 1049 769 12394 ----
NM_001024666chrX----1463 --
NM_001024680chr251694 1395 1210 400 348 11196 11328 --
NM_001024858chr14122743 2545 2496 2296 2233 2215 662 532 217 128 120 58 150 1261 --
NM_001024948chr111374 ------
NM_001025076chr1065017 4954 4551 4425 1980 427 ----1536
NM_001025077chr1066375 6312 5909 5783 1785 996 ----11894
NM_001025079chr384087 3136 3015 1453 1032 353 330 307 13430 12935 13397
NM_001025107chr121995 199 1185 12054 --
NM_001025107chr121995 199 1185 12054 --
NM_001025108chr242932 1045 427 253 1576 11147 23356 682
NM_001025242chrX61147 1059 1010 977 941 364 11017 31321 891 153 --
NM_001025243chrX61147 1059 1010 977 941 364 11017 31321 891 153 --
NM_001025252chr82741 632 ------
NM_001025253chr82741 632 ------
NM_001025266chr364601 3805 3755 3489 1622 1516 11361 13015 --
NM_001025580chrX34109 1091 521 13118 ----
NM_001025596chr11----1460 --
NM_001025603chr141381 1224 1139 947 --1402 --
NM_001025616chr4278 47 11373 ----
NM_001025780chr921121 201 ------
NM_001029858chr663028 2664 1282 1234 628 340 --1687 --
NM_001029859chr1132152 1549 56 11875 --1617
NM_001029863chr6197 ----12275
NM_001030001chr141365 ------
NM_001030007chr1623502 2450 --11493 1469
NM_001030055chr1474663 3769 1836 1549 1497 964 65 --1490 --
NM_001031680chr152040 1600 679 406 107 12288 184 --
NM_001031690chr793055 2935 2508 2201 1941 1230 1183 848 379 11075 22868 170 --
NM_001031694chr14814 726 206 56 184 2864 103 --
NM_001031694chr14814 726 206 56 184 2864 103 --
NM_001031695chr2232154 1120 898 13962 1818 --
NM_001031702chr33841 227 101 --1193 --
NM_001031711chr551179 609 472 358 271 1253 --11272
NM_001031812chr512223 ----11458
NM_001032296chr1382457 1842 1171 1148 1133 281 143 132 12400 12376 --
NM_001033044chr111156 --1742 1357
NM_001033047chr442297 263 142 88 ------
NM_001033056chr111156 --1742 1357
NM_001033117chr384596 3937 3671 3328 1448 1415 1170 151 ------
NM_001033503chr5----238 24 --
NM_001033551chr17103735 3471 3022 2634 1625 1533 1286 1244 619 144 3405 291 63 13815 12997
NM_001033557chr2--1470 ----
NM_001033566chr172862 358 ----1267
NM_001033568chr172862 358 ----1267
NM_001033576chr1762497 1956 1868 1055 1031 89 12080 ----
NM_001033602chr1341700 1091 287 127 11002 22433 1785 --
NM_001033925chr10----11465 --
NM_001035254chr962555 2148 1999 1867 417 262 2254 208 ----
NM_001035260chr10----1465 --
NM_001035521chr23273 262 108 ------
NM_001035534chr941172 1142 989 544 158 1533 --
NM_001037132chr7--11859 --1655
NM_001037133chr7--11859 --1655
NM_001037172chr3------11078
NM_001037582chr42550 245 1439 ----
NM_001038707chr161983 1728 1617 852 676 296 ------
NM_001038707chr161983 1728 1617 852 676 296 ------
NM_001039141chr2262664 2546 2413 1731 1062 278 1475 2843 30 --
NM_001039350chr711256 ------
NM_001039547chr377736 7513 5867 5482 2821 2752 2655 27380 5428 --16653
NM_001039569chr253264 2572 2407 2100 1087 192 ----
NM_001039580chr441936 1157 409 354 11534 1614 --
NM_001039590chrX32618 1601 44 11586 ----
NM_001039591chrX32618 1601 44 11586 ----
NM_001039618chr1135264 2046 242 14343 ----
NM_001039690chr16131590 734 695 672 644 600 458 435 410 374 368 362 227 --1689 11610
NM_001039693chr243750 1513 489 478 ------
NM_001039840chrX45935 5316 1435 750 --1367 35738 4363 3986
NM_001039844chr1072751 2585 2454 2433 852 686 186 ------
NM_001040110chr771730 1292 1232 756 711 665 540 ------
NM_001040144chr16131590 734 695 672 644 600 458 435 410 374 368 362 227 --1689 11610
NM_001040146chr16131590 734 695 672 644 600 458 435 410 374 368 362 227 --1689 11610
NM_001040152chr731834 1169 21 --21251 775 199
NM_001040172chr5153 ------
NM_001040173chr5153 ------
NM_001040214chr62950 282 --12251 --
NM_001040402chr411039 12760 ----
NM_001040424chr2142553 2498 1170 935 12419 --11920
NM_001040429chr1313597 ------
NM_001040439chr1661432 1015 517 508 280 84 2476 240 21387 1163 --
NM_001040450chr1541819 1036 827 126 12785 ----
NM_001040453chr1541819 1036 827 126 12785 ----
NM_001040455chr1161202 1010 960 873 433 133 ----11051
NM_001040619chr131395 1096 193 1164 21287 374 1182
NM_001040633chr71802 --1184 --
NM_001040709chr12763 64 1250 21619 965 --
NM_001040712chr952992 2742 2650 1203 317 --1163 --
NM_001042453chrX11727 ----1560
NM_001042494chr1543411 2723 2548 746 13647 22350 1356 --
NM_001042495chr1543411 2723 2548 746 13647 22350 1356 --
NM_001042496chr1543411 2723 2548 746 13647 22350 1356 --
NM_001042497chr1543411 2723 2548 746 13647 22350 1356 --
NM_001042599chr2106333 5275 2550 2497 2473 2260 2050 1260 995 974 14919 ----
NM_001042604chr3--1145 14209 --
NM_001042669chr4278 47 11373 ----
NM_001042681chr141753 1684 1676 764 --22072 1951 --
NM_001042682chr141753 1684 1676 764 --22072 1951 --
NM_001042682chr141753 1684 1676 764 --22072 1951 --
NM_001042728chr123888 348 148 ----145
NM_001043318chr14103048 2968 2821 2647 1458 830 653 473 262 132 --11017 --
NM_001043351chr141833 1628 1603 546 ------
NM_001044305chr6----11357 --
NM_001044722chr512223 ----11458
NM_001044723chr512223 ----11458
NM_001046chr522509 2326 ------
NM_001071775chr132637 338 --11711 --
NM_001076778chr372091 2056 1807 544 341 88 21 2957 796 1633 --
NM_001083620chr41975 ------
NM_001092chr1732339 2324 941 1286 11600 --
NM_001099678chr345270 4873 4014 1610 24739 4583 ----
NM_001100108chr197023 6190 5880 2700 2678 2383 2035 1342 474 67400 6909 6448 3310 1354 325 17044 11128
NM_001106chr398362 6422 3259 3057 2787 2053 1604 1148 1029 26596 2527 36949 6500 2951 17341
NM_001111chr121995 199 1185 12054 --
NM_001113490chrX42748 2221 501 478 ------
NM_001117chr1831913 969 498 12029 --11729
NM_001121chr1011346 --1291 --
NM_001128chr1623502 2450 --11493 1469
NM_001167chrX95812 5687 4357 2622 2370 2062 1894 1645 179 16017 ----
NM_001173chr1474663 3769 1836 1549 1497 964 65 --1490 --
NM_001174chrX71693 808 771 701 688 622 518 --1590 --
NM_001189chr41409 1760 1384 1702
NM_001190chr191286 ------
NM_001191chr2031352 1175 1072 21033 956 21111 534 --
NM_001204chr236927 5981 1671 14961 15313 --
NM_001219chr752020 1689 909 605 423 11788 ----
NM_001222chr1041607 1506 1343 490 1421 ----
NM_001226chr42666 57 1198 ----
NM_001257chr162492 112 1604 --1325
NM_001259chr746292 4781 1518 379 15638 16235 22478 340
NM_001271chr1532971 2703 2148 --13045 --
NM_001304chr1742912 1511 840 501 23007 1281 ----
NM_001310chr1232610 2425 824 ----1796
NM_001315chr62798 244 3723 673 287 --11657
NM_001331chr1132633 873 110 ------
NM_001343chr531626 1072 182 ------
NM_001364chr1154538 4424 3925 3045 239 ------
NM_001382chr11394 53 38 ------
NM_001387chr532917 1951 706 1763 ----
NM_001391chr181789 1469 ----
NM_001396chr2111873 1606 12734 --
NM_001397chr162481 1986 1918 386 265 71 2657 209 ----
NM_001399chrX83636 3624 3393 1387 1334 1214 335 151 13407 23573 3369 11358
NM_001406chr1741560 680 641 425 1293 ----
NM_001408chr131276 1084 315 1536 1524 --
NM_001419chr1974212 3899 3236 1817 1282 690 531 33810 3394 661 --2732 494
NM_001420chr19112905 2859 2845 2804 2738 2687 1188 1048 404 374 237 21117 37 12391 --
NM_001423chr1232054 1714 727 ------
NM_001427chr761405 1337 665 620 564 23 ------
NM_001431chr6------1830
NM_001432chr431520 1426 313 13296 ----
NM_001438chr133649 3393 891 ----1857
NM_001465chr52818 348 ------
NM_001489chr9125 ------
NM_001494chr101663 ------
NM_001508chr21256 ------
NM_001521chr23273 262 108 ------
NM_001542chr152657 2647 1791 1140 977 --1271 --
NM_001543chr5134354 4224 4078 3625 1897 1859 1411 1287 1242 820 505 463 156 23476 827 31468 683 401 --
NM_001569chrX61147 1059 1010 977 941 364 11017 31321 891 153 --
NM_001587chrX21912 334 --1363 --
NM_001612chr11--133 ----
NM_001621chr732841 721 579 ----1686
NM_001621chr732841 721 579 ----1686
NM_001655chr1151423 1348 883 560 395 2794 586 ----
NM_001659chr1232308 1805 1723 --22273 1886 --
NM_001660chr3----150 --
NM_001668chr122066 1794 11550 --1688
NM_001678chr1711154 ------
NM_001682chr121554 ----1925
NM_001683chr312125 1993 11915 279 63
NM_001695chr853082 2911 2637 619 451 --11247 --
NM_001699chr1951462 620 454 306 246 ----11516
NM_001702chr85523 464 447 438 103 1143 ----
NM_001704chr62184 164 ------
NM_001717chr15149 1105 1298 --
NM_001730chr13--1320 127 --
NM_001730chr13--1320 127 --
NM_001743chr2------1438
NM_001746chr531981 1049 769 12394 ----
NM_001749chr195476 433 402 203 164 ------
NM_001754chr2184229 3752 3435 2674 1483 1081 163 97 --154 --
NM_001773chr141403 1135 308 181 ------
NM_001777chr384087 3136 3015 1453 1032 353 330 307 13430 12935 13397
NM_001788chr71182 ----1824
NM_001795chr1641462 364 180 51 21102 68 3573 226 164 --
NM_001800chr19------1398
NM_001845chr1331178 935 858 ------
NM_001852chr14617 468 88 51 ------
NM_001858chr614930 24402 129 ----
NM_001874chr1264855 4033 3722 1871 829 576 33584 3401 1286 160 --
NM_001915chr1761766 1683 830 820 709 67 11621 11657 --
NM_001923chr111507 ------
NM_001935chr21669 ------
NM_001936chr711256 ------
NM_001939chrX73762 3143 2993 2538 1202 982 549 22381 279 1959 --
NM_001969chr1423468 173 11212 13355 --
NM_001970chr17--1541 ----
NM_001978chr83955 753 48 3707 700 385 2667 400 --
NM_001987chr1263646 2827 1671 1638 495 370 13301 12671 --
NM_002006chr445502 3637 740 625 22170 2048 25244 1915 13657
NM_002023chr131176 214 85 11182 --11062
NM_002025chrX68801 8381 7632 6357 3058 492 22869 2109 --13258
NM_002032chr111165 ------
NM_002040chr211351 --2623 102 --
NM_002065chr111156 --1742 1357
NM_002077chr951910 1849 1827 1706 1505 ------
NM_002087chr172235 63 ------
NM_002092chr464566 4358 4191 3139 1227 243 --21898 1352 --
NM_002129chr4--149 ----
NM_002136chr121427 ------
NM_002146chr172365 111 1891 ----
NM_002198chr5------134
NM_002207chr33548 174 144 ------
NM_002223chr1243293 1186 963 585 ----13851
NM_002226chr142849 186 --1377 --
NM_002247chr1011589 ------
NM_002249chr11397 ------
NM_002253chr41970 1379 --1159
NM_002264chr374980 4557 4509 3935 3743 250 39 --1959 --
NM_002268chr351895 631 528 510 441 ------
NM_002270chr514863 --1833 1873
NM_002285chr242932 1045 427 253 1576 11147 23356 682
NM_002293chr142711 2350 2167 1845 --1647 --
NM_002298chr1351589 1078 1016 533 65 ----1276
NM_002313chr1011448 --23866 3266 --
NM_002356chr6--170 ----
NM_002359chr1764223 3001 2769 1447 589 159 144 --11720
NM_002380chr84864 227 188 79 ------
NM_002390chr1722079 189 2376 330 1107 --
NM_002397chr532150 1924 481 ------
NM_002401chr17112488 2232 2183 1951 995 971 821 601 536 513 217 2651 90 ----
NM_002430chr223856 140 31 21022 591 11589 --
NM_002442chr125650 550 528 505 150 --11753 --
NM_002499chr1541911 1753 316 272 11628 --1158
NM_002501chr19103330 3292 3264 3025 2977 1500 1026 931 694 545 11078 ----
NM_002505chr6152 ----1487
NM_002508chr11105 ------
NM_002522chr1792857 2429 2411 1553 1203 1170 1147 1140 960 1231 23064 2889 --
NM_002536chrX91490 1272 1250 1202 1115 648 512 418 136 11303 ----
NM_002537chr155926 778 368 330 95 ------
NM_002545chr1155154 4448 3384 1759 1597 --11973 --
NM_002546chr8--172 ----
NM_002561chr17----123 --
NM_002568chr81160 ------
NM_002569chr1531084 618 335 --1536 1389
NM_002577chr364058 2695 2528 1244 1044 827 22721 477 1816 --
NM_002581chr943749 793 699 608 --11242 14230
NM_002588chr561320 1286 1152 335 88 74 ------
NM_002613chr16114938 3986 3953 1922 1814 1687 1643 1572 1427 212 70 11374 24037 1937 14187
NM_002648chr651108 1052 208 198 153 ------
NM_002656chr62711 445 --1733 --
NM_002657chr2073262 3109 2972 1166 441 231 166 --1160 --
NM_002693chr15170 1285 ----
NM_002698chr1921161 264 --22570 1922 12692
NM_002710chr121882 ------
NM_002713chr13325 293 257 ------
NM_002714chr61931 ----1894
NM_002716chr1153589 3093 3072 2823 2524 1307 --13066
NM_002734chr17--11542 ----
NM_002737chr17135884 5639 5117 5082 4770 4720 2438 2368 2258 1813 825 259 162 ------
NM_002745chr2243497 3485 1729 1114 11778 14113 --
NM_002746chr162476 114 ----1173
NM_002747chr1831946 752 478 11273 122 11557
NM_002752chr5------1405
NM_002787chr71508 1283 ----
NM_002814chrX------1187
NM_002819chr1951008 909 560 195 24 --11290 --
NM_002832chr131031 312 27 11148 1184 --
NM_002833chr15--11081 ----
NM_002834chr1233191 2766 1100 12581 ----
NM_002839chr952992 2742 2650 1203 317 --1163 --
NM_002840chr141500 1477 1154 146 --11161 --
NM_002843chr1121381 986 ----12189
NM_002855chr1193613 3533 3310 3225 3016 1273 986 330 87 --1740 --
NM_002868chr1222165 1939 3660 653 179 ----
NM_002869chr11----12197 --
NM_002874chr922148 143 11708 ----
NM_002886chr384236 4012 3612 3380 1286 1016 552 495 --24806 3327 --
NM_002895chr201243 ----1804
NM_002945chr172595 209 --1264 --
NM_002953chr12636 198 ----1591
NM_002955chr6--11203 1629 --
NM_002956chr122126 86 --2543 377 --
NM_002957chr983294 2795 2785 1581 1390 1122 271 256 --1705 12702
NM_002959chr1104153 4033 3676 3646 3431 2904 2726 1105 879 77 --13302 12835
NM_002968chr16--1323 ----
NM_002971chr31209 ------
NM_003011chr91341 ------
NM_003028chr943190 3114 2734 286 33565 2378 1509 1930 --
NM_003031chr161847 ------
NM_003043chr363610 3371 3249 2926 2696 70 11139 --23216 924
NM_003045chr1384048 3246 3065 1705 1433 540 357 229 23183 317 2768 187 11206
NM_003076chr1271338 1218 1162 567 411 322 102 --11187 --
NM_003079chr171726 ------
NM_003081chr201401 ------
NM_003099chr1554170 3990 1287 301 98 24447 482 15815 --
NM_003108chr2115244 5229 2861 2758 2664 2562 2532 2521 2455 2348 522 --36823 6306 967 11029
NM_003128chr211020 ----11914
NM_003131chr63837 613 420 12001 ----
NM_003137chr6182 --1471 12090
NM_003149chr321567 1146 --3525 453 192 --
NM_003155chr842005 1736 1117 148 22105 1022 ----
NM_003170chr171237 1187 ----
NM_003173chrX31230 175 145 1912 --11357
NM_003174chr101213 1301 ----
NM_003178chr362134 1990 1959 1571 708 232 12068 ----
NM_003189chr172535 2362 1132 1104 559 494 65 12206 --23292 2561
NM_003193chr1----1166 --
NM_003214chr681255 1115 570 480 232 113 106 80 ------
NM_003215chr441406 1108 1051 301 31552 269 243 ----
NM_003216chr2231108 905 827 12092 23033 783 --
NM_003217chr1251933 1706 500 332 312 2711 261 ----
NM_003223chr16----1612 --
NM_003234chr332053 764 422 --11690 --
NM_003236chr263179 2921 1238 781 65 28 --21082 347 --
NM_003246chr1541978 1434 543 433 ----1370
NM_003255chr1762046 1678 1656 1002 809 426 2885 222 1921 --
NM_003285chr13509 407 217 ----1373
NM_003298chr3115970 4611 4363 2484 2359 2322 1709 1390 1315 1196 43 --24926 4030 14321
NM_003317chr141565 ------
NM_003324chr1221377 45 11208 1231 --
NM_003326chr1--41702 326 262 30 ----
NM_003339chr521525 1116 11481 ----
NM_003342chr1742631 2033 240 37 12453 ----
NM_003344chr71656 --11417 --
NM_003345chr161469 ------
NM_003373chr1011566 21362 416 ----
NM_003388chr752086 1997 1321 607 307 11787 1504 2834 77
NM_003439chr743546 2245 1071 555 12382 --12573
NM_003458chr373257 3190 2888 2759 1572 402 147 ----13398
NM_003463chr632973 2494 133 22861 2719 ----
NM_003467chr21448 ----1200
NM_003468chr273903 2864 2794 1728 556 361 167 ------
NM_003469chr21134 ------
NM_003473chr10----1113 --
NM_003482chr1282502 2182 1783 914 359 243 218 163 2653 22 12146 --
NM_003502chr162570 30 166 ----
NM_003508chr7--1113 ----
NM_003559chr1783420 3297 1394 1225 1102 810 666 263 11014 1374 --
NM_003574chr1821434 416 ----13845
NM_003576chr1382457 1842 1171 1148 1133 281 143 132 12400 12376 --
NM_003583chr1222643 1024 --1416 23639 2981
NM_003590chr233115 2475 347 --1185 --
NM_003603chr441850 751 378 333 ----12025
NM_003607chr143976 3390 808 137 ----12894
NM_003613chr151621 ------
NM_003618chr211161 ------
NM_003644chr17166614 5783 5321 4873 4699 4594 4495 4040 2288 2067 961 859 693 423 378 182 12414 15451 26073 1169
NM_003671chr942237 749 628 38 12816 ----
NM_003677chr1221953 641 12190 12124 --
NM_003701chr131802 ------
NM_003705chr21633 1723 ----
NM_003709chr21277 --180 --
NM_003711chr5121 ------
NM_003716chr31272 ------
NM_003735chr561320 1286 1152 335 88 74 ------
NM_003736chr561320 1286 1152 335 88 74 ------
NM_003743chr241897 1605 618 109 1493 ----
NM_003744chr141447 --2381 136 --
NM_003759chr463490 1638 1208 1044 971 601 23859 1490 ----
NM_003790chr1125 ------
NM_003800chr61759 ----1438
NM_003850chr13------1120
NM_003861chr1432745 2357 929 ------
NM_003873chr1021951 120 11747 --1897
NM_003941chr721913 794 ----12195
NM_003972chr101259 ------
NM_003980chr61521 1327 --11314
NM_003983chr1664124 4059 1401 1164 1135 962 1411 13963 --
NM_003987chr10102185 2179 2080 1830 1815 1779 644 594 221 215 22161 435 130 --
NM_003988chr10102262 2256 2157 1907 1892 1856 721 671 298 292 22238 512 1107 --
NM_003992chr15287 80 --1265 --
NM_004004chr132359 265 ------
NM_004050chr1462573 2112 1905 1746 1101 243 32010 882 159 ----
NM_004055chr1162203 2026 1856 605 483 385 22081 846 ----
NM_004086chr14--1623 ----
NM_004090chr1711371 32362 1138 1061 22272 2182 12767
NM_004097chr24682 649 98 53 1689 --1325
NM_004099chr942043 660 481 307 --22075 408 --
NM_004111chr111218 1237 ----
NM_004113chr311969 11773 11665 --
NM_004114chrX----148 --
NM_004172chr531545 813 35 11611 1595 11530
NM_004186chr35907 826 719 254 231 1726 ----
NM_004199chr5191 ------
NM_004200chr1182471 2328 1187 475 326 199 163 39 22313 640 12160 --
NM_004227chr772233 2119 2032 844 812 731 140 125 12321 12287
NM_004230chr1992388 1784 1617 1469 881 756 704 387 26 1825 ----
NM_004253chr9----1654 1886
NM_004263chr2----11513 --
NM_004293chr952995 1223 907 547 66 ------
NM_004309chr1781095 958 761 439 396 329 293 264 11102 1356 --
NM_004311chr1033010 828 498 11033 ----
NM_004321chr2113530 3304 2985 2794 2495 2360 1000 987 841 600 141 12269 22992 2561 --
NM_004323chr952459 2260 714 337 88 11029 ----
NM_004331chr81770 ------
NM_004350chr152040 1600 679 406 107 12288 184 --
NM_004368chr193884 721 389 1145 2770 267 --
NM_004380chr1642367 2149 1873 70 --11719 164
NM_004381chr65412 338 87 55 47 ------
NM_004384chr512223 ----11458
NM_004416chr126815 329 177 130 85 66 1953 1705 --
NM_004423chr331906 965 655 1443 2753 124 --
NM_004429chrX51303 1017 463 222 21 --11338 --
NM_004438chr222577 1234 12051 ----
NM_004442chr141660 1468 1279 1173 11392 1473 --
NM_004454chr31312 ----154
NM_004459chr172732 90 ------
NM_004482chr2--161 ----
NM_004504chr252720 2703 2679 2131 790 1148 ----
NM_004505chr171397 ----1210
NM_004516chr19------11083
NM_004532chr3121 ------
NM_004535chr2011669 --1179 11504
NM_004538chrX----1198 --
NM_004567chr341843 1334 586 466 129 2770 63 --
NM_004588chr1163718 3328 2898 2696 554 489 11133 13557 1720
NM_004595chrX--184 ----
NM_004598chr512191 --12977 12875
NM_004603chr72454 331 1271 2810 31 --
NM_004612chr943577 3178 1177 482 --13938 --
NM_004642chr121216 ------
NM_004656chr341078 813 423 142 --1119 --
NM_004660chrY1910 1786 ----
NM_004667chr152569 117 142 ----
NM_004690chr61508 ------
NM_004703chr1712510 --1227 22086 2010
NM_004726chrX85157 4856 2187 2037 1871 708 400 375 ------
NM_004734chr1332389 2368 244 --1483 --
NM_004742chr31638 ------
NM_004745chr896280 6159 5853 5500 4910 4566 4390 948 652 --35437 5065 4796 --
NM_004748chr1544061 1679 1155 823 13536 --13137
NM_004756chr1951198 1171 939 194 173 11232 135 --
NM_004762chr1741758 1696 484 103 --11661 11344
NM_004774chr1752747 2652 2556 2383 1944 --12692 --
NM_004776chr2062827 2779 2561 2387 2093 135 --11035 11330
NM_004798chr2023625 542 11026 1535 11154
NM_004801chr2--11403 ----
NM_004805chr241227 1070 348 179 144 1506 --
NM_004808chr1043079 851 718 646 12909 12115 --
NM_004815chr144630 3686 3392 1443 ------
NM_004818chr12----185 1561
NM_004822chr17103483 3421 2747 1519 1219 966 650 395 239 108 ------
NM_004834chr223011 712 ----12595
NM_004863chr1465140 4964 3940 3779 3474 74 34796 4112 1294 1457 --
NM_004870chr17--1504 1551 --
NM_004871chr17103570 3013 1237 1187 1138 865 825 672 363 333 11123 12841 --
NM_004896chr10----1380 --
NM_004904chr736168 4183 1548 14837 --11805
NM_004922chr103954 938 31 --1796 --
NM_004926chr14----11675 --
NM_004937chr1752379 2344 2208 2007 938 32177 289 205 1179 22388 257
NM_004947chr371733 1682 1024 559 465 384 372 1605 21032 59 11745
NM_004955chr61568 --1149 --
NM_004966chr101907 ------
NM_004976chr11164583 4426 4411 3385 3164 2055 2049 1767 1662 1638 1609 1298 1263 1202 323 244 24650 3525 1416 11831
NM_004978chr151640 1523 1251 1094 641 1130 ----
NM_004985chr1233187 1324 1004 --13508 1484
NM_004992chrX167755 7673 7634 7425 6484 6427 6136 5756 5729 2897 2867 2713 2002 828 260 155 48047 6083 834 316 --25746 1314
NM_004992chrX167755 7673 7634 7425 6484 6427 6136 5756 5729 2897 2867 2713 2002 828 260 155 48047 6083 834 316 --25746 1314
NM_004998chr152921 345 1868 --143
NM_005010chr7--11859 --1655
NM_005011chr771730 1292 1232 756 711 665 540 ------
NM_005016chr12----191 --
NM_005028chr1052200 1697 1683 808 689 1428 1132 --
NM_005032chrX137 1215 167 --
NM_005036chr22178325 8076 7601 6890 6831 5875 5187 3345 3070 2802 2757 2649 2564 2469 1938 1691 31 42854 2031 1944 595 47699 6930 1209 985 28151 5855
NM_005056chr1243413 1164 529 175 --11043 11172
NM_005073chr131258 163 1208 --
NM_005079chr82741 632 ------
NM_005096chrX31108 911 147 1386 ----
NM_005105chr141482 890 516 243 --22127 21 --
NM_005110chr5----1536 --
NM_005116chr2093848 3616 3391 2903 1697 1303 709 365 358 --13818 14174
NM_005121chr1721096 791 --1939 11134
NM_005135chr1543411 2723 2548 746 13647 22350 1356 --
NM_005144chr841061 252 210 47 161 ----
NM_005155chr62659 74 --1203 --
NM_005188chr1187295 7217 6719 6606 6204 5664 5057 1036 67500 5793 5779 3004 2516 972 12142 1442
NM_005190chr6--1718 1900 --
NM_005197chr1476047 4485 4215 4161 1864 1588 937 24134 548 24391 416 --
NM_005207chr2273285 2553 1376 1361 804 780 615 ----13652
NM_005229chrX21161 517 --1791 11102
NM_005233chr311813 ------
NM_005235chr2106333 5275 2550 2497 2473 2260 2050 1260 995 974 14919 ----
NM_005249chr141132 ----180
NM_005250chr1681808 1753 1728 1575 1393 563 466 122 21258 353 31832 1782 1650 --
NM_005259chr21602 ------
NM_005266chr1130 ------
NM_005296chrX2895 366 --1254 --
NM_005312chr992461 2419 2197 2029 724 397 328 143 21 22241 2186 ----
NM_005329chr1632336 603 557 --21750 1489 11872
NM_005334chrX61550 1380 1274 492 350 50 ------
NM_005336chr212070 21606 599 1175 --
NM_005339chr433386 854 324 13248 --1126
NM_005347chr941556 1496 1449 490 1646 --11065
NM_005349chr42525 114 --1571 --
NM_005359chr1875412 4938 4573 4193 3966 2286 1327 34401 2122 202 --1784
NM_005374chr1741722 915 744 210 32163 774 511 --1922
NM_005392chr941899 1638 733 420 --1289 --
NM_005399chr153746 3078 838 727 31 12831 21641 1048 12955
NM_005402chr7------21472 1463
NM_005414chr3--1109 ----
NM_005415chr21283 ------
NM_005433chr1831955 549 210 ------
NM_005436chr1033574 3417 2572 --1121 --
NM_005440chr1782612 2498 1075 1006 936 839 777 71 --12746 22183 437
NM_005442chr33614 588 488 ------
NM_005455chr11449 ------
NM_005458chr962164 1712 1589 513 498 452 --11504 --
NM_005475chr1273033 2622 2467 1238 978 815 604 12314 --1827
NM_005477chr1582377 2147 1763 1634 733 677 294 58 1154 ----
NM_005477chr1582377 2147 1763 1634 733 677 294 58 1154 ----
NM_005497chr1796141 5790 4737 4361 3782 1827 1703 1653 104 55879 5265 4228 2396 193 ----
NM_005512chr1172019 2007 1838 219 172 87 22 11865 ----
NM_005523chr7--11472 1578 --
NM_005563chr11656 ------
NM_005575chr51619 ------
NM_005587chr15--1187 ----
NM_005596chr914429 15801 16186 --
NM_005602chr331076 432 98 ------
NM_005604chr621015 829 1242 --1937
NM_005632chr1651085 912 298 236 201 2677 339 ----
NM_005637chr1841826 1710 1660 1271 ------
NM_005657chr15160 ------
NM_005665chr184493 3797 3616 1912 1826 1809 587 537 13024 ----
NM_005668chr534101 699 320 13281 14342 --
NM_005678chr153844 93 47 1867 --1750
NM_005730chr1283673 3210 3171 2726 2699 2587 2525 972 ----1483
NM_005737chr241815 535 343 282 --1410 --
NM_005775chr8--1644 2548 278 --
NM_005779chr583091 2367 1292 1246 1136 856 743 274 --1588 --
NM_005786chr18160 ------
NM_005819chr183464 2523 2503 2445 2412 2238 568 289 --1601 --
NM_005826chr1----1254 --
NM_005828chr17114229 4219 4079 3987 3314 3282 959 499 347 294 142 ------
NM_005840chrX86827 6474 6043 5540 1404 1115 445 256 25482 2629 36811 2558 892 --
NM_005842chr13--1267 ----
NM_005852chr172751 30 2896 761 ----
NM_005859chr5--1625 ----
NM_005868chr731963 1876 213 21638 803 11594 --
NM_005871chr101290 ------
NM_005876chr26316 225 193 86 68 21 ------
NM_005901chr1842943 2416 1929 981 17590 --1409
NM_005911chr221419 981 11228 ----
NM_005920chr163168 3151 2725 2569 1329 77 21563 808 32759 1251 993 --
NM_005924chr7------1122
NM_005927chr51917 ------
NM_005928chr15122 ------
NM_005933chr1122682 457 1407 1866 --
NM_005941chr853211 1123 887 506 286 --1248 --
NM_005943chr651091 605 252 116 82 --1548 2594 486
NM_005955chr1124993 4382 3899 3441 2141 2050 1938 1823 1724 1021 995 534 31553 1442 683 11010 --
NM_005962chr1011899 21954 690 ----
NM_005962chr1011899 21954 690 ----
NM_006011chr1514287 21303 516 13486 --
NM_006030chr33550 308 127 --1521 --
NM_006055chr253120 2795 2360 512 466 ----12294
NM_006080chr7--12885 ----
NM_006091chr1531138 586 246 1692 11612 --
NM_006095chr441207 818 427 54 --13736 --
NM_006106chr11--1793 191 --
NM_006135chr121207 566 11100 11345 1955
NM_006153chr3------1498
NM_006161chr51514 --191 1548
NM_006166chr12--22413 2036 11646 --
NM_006177chr142881 359 2862 275 1939 11073
NM_006196chr2----182 --
NM_006203chr514261 32163 1478 307 13550 --
NM_006212chr194467 4228 4200 1988 1638 1039 854 670 550 15269 ----
NM_006224chr1732340 2261 2201 ----21866 121
NM_006251chr552878 2111 702 535 251 ------
NM_006268chr114775 412 222 186 ------
NM_006283chr834341 4062 77 ----14631
NM_006298chr642991 2619 2265 495 11266 ----
NM_006301chr123572 169 123 ------
NM_006306chrX55833 5187 1134 594 420 24616 790 25089 733 --
NM_006315chr454244 3169 3084 1419 1357 14122 44271 3576 1441 328 1275
NM_006321chr331948 1395 221 32106 1529 99 ----
NM_006336chr941259 1083 595 376 1488 --21286 608
NM_006347chr1123 ------
NM_006367chr13969 791 158 ------
NM_006371chr394929 4407 4239 3203 784 418 253 76 38 23263 1078 34657 3797 1660 11352
NM_006375chrX1527 ------
NM_006380chr1754066 3481 1424 1174 43 13016 ----
NM_006389chr111468 --1439 --
NM_006413chr1031186 344 296 ------
NM_006415chr911011 ------
NM_006421chr81494 ------
NM_006454chr462937 2589 2437 2013 1963 761 1600 ----
NM_006459chr1021452 448 --1500 --
NM_006460chr17------1577
NM_006465chr153635 274 157 22242 2009 1147 --
NM_006482chr1222643 1024 --1416 23639 2981
NM_006517chrX31621 758 206 22058 1559 1154 --
NM_006521chrX61403 1344 995 375 316 137 3538 157 108 11203 --
NM_006532chr1981660 1580 1549 714 633 294 259 123 11327 1733 --
NM_006534chr2042243 612 554 451 1917 12407 186
NM_006538chr294042 3635 3599 3525 3430 3364 3009 1318 1298 13378 13219 --
NM_006544chr1424379 1274 ------
NM_006546chr1786228 1958 1342 887 337 111 96 30 21612 1455 45466 4159 815 281 24339 4088
NM_006548chr31200 ------
NM_006549chr1252736 2058 1111 924 803 12077 --1946
NM_006557chr921078 26 11198 ----
NM_006560chr11----1460 --
NM_006561chr1065017 4954 4551 4425 1980 427 ----1536
NM_006572chr17--1279 21373 289 --
NM_006591chr1131490 1273 245 1686 ----
NM_006599chr1666881 5356 4983 2617 954 283 12231 16329 --
NM_006609chr2--11156 ----
NM_006628chr1554369 3642 3476 3129 1394 13372 --11852
NM_006629chr18--12870 --12048
NM_006633chr51152 ------
NM_006650chr5143611 3556 3351 3110 2657 2641 2589 2470 912 781 746 515 490 417 1687 ----
NM_006675chr1263190 2876 2284 786 538 482 13285 22956 2082 --
NM_006677chr32220 50 --1281 --
NM_006690chr20112157 2129 2066 1928 1877 792 409 264 151 110 44 11444 --12047
NM_006717chr932589 2449 855 ----11237
NM_006718chr62711 445 --1733 --
NM_006720chr1011448 --23866 3266 --
NM_006731chr945744 4239 2230 1409 24839 375 ----
NM_006732chr19------1842
NM_006735chr7152 ------
NM_006738chr1594147 3932 3765 3456 3435 1660 1021 486 136 33541 1027 599 24301 1076 1731
NM_006742chr1662013 1625 1474 702 605 182 ------
NM_006756chr8168 11253 ----
NM_006763chr121598 207 ------
NM_006769chr11641 ------
NM_006788chr183386 159 74 12007 ----
NM_006795chr11101378 1287 1279 1224 1181 1040 536 530 383 360 21352 412 21318 1234 --
NM_006802chr131120 263 39 1991 ----
NM_006814chr2022181 27 32458 1647 517 ----
NM_006815chr1271382 1213 1082 911 518 332 241 ------
NM_006827chr1432692 2526 2189 ------
NM_006852chr1782605 2583 2006 1959 1010 827 201 113 ----12622
NM_006870chr201677 ----1574
NM_006874chr4----2909 28 --
NM_006885chr1643869 3563 1681 1211 13675 ----
NM_006888chr1452478 2390 2173 658 346 ----11158
NM_006912chr142339 1948 1929 726 12046 ----
NM_006927chr1651910 1608 640 597 150 21759 1363 ----
NM_006941chr227924 900 881 817 745 456 77 --1181 --
NM_006951chr101611 --1836 --
NM_006981chr912195 ------
NM_006990chr142110 1940 692 578 --1198 21019 726
NM_007011chr15114574 2231 1624 1581 1418 1090 1035 638 495 486 70 65386 5057 4982 4942 4863 1012 65764 2661 2495 1736 441 177 --
NM_007024chr33558 198 69 1518 1230 --
NM_007030chr5134678 4245 3209 3160 1722 1409 1375 1133 1103 381 199 142 136 24048 825 --13502
NM_007032chr2262664 2546 2413 1731 1062 278 1475 2843 30 --
NM_007038chr2145969 5151 3873 741 15460 ----
NM_007050chr20177700 7554 7524 7018 6856 5921 5227 3073 3038 2738 2611 2217 1256 1243 545 485 211 26782 2091 37211 2532 1742 --
NM_007084chr131155 1137 ----
NM_007114chr343203 2980 1201 1104 ------
NM_007129chr13------1186
NM_007137chrX33771 1955 126 24843 4457 11943 --
NM_007146chr1732741 2585 2181 ----1550
NM_007166chr1111460 ------
NM_007170chr13351 123 113 --1305 --
NM_007175chr872978 1242 1156 1091 1065 197 155 ------
NM_007177chr372091 2056 1807 544 341 88 21 2957 796 1633 --
NM_007200chr1594147 3932 3765 3456 3435 1660 1021 486 136 33541 1027 599 24301 1076 1731
NM_007203chr943101 1405 1174 392 12431 ----
NM_007213chrX1432 --2528 273 --
NM_007220chrX74525 3253 1436 1270 518 311 261 1988 14905 14623
NM_007236chr1572214 2037 1682 1516 770 632 570 ------
NM_007249chr1368917 6798 2053 2007 1436 206 46458 938 838 552 38710 6151 3569 --
NM_007275chr34940 406 90 54 ------
NM_007286chr571892 1513 1417 770 667 531 454 1592 --1551
NM_007331chr432633 966 439 21709 1066 ----
NM_007345chr183927 737 731 --12281 --
NM_007347chr1552436 2318 2268 1219 1156 12647 ----
NM_007350chr1221078 267 --24399 945 --
NM_007358chr141751 733 693 249 11583 ----
NM_007363chrX2387 131 ----1664
NM_007372chr175648 585 305 286 233 --1660 --
NM_012081chr5----12883 --
NM_012096chr363713 3009 2959 2824 2710 2697 --1355 --
NM_012102chr141753 1684 1676 764 --22072 1951 --
NM_012120chr632306 2090 33 --11909 --
NM_012154chr8----1653 --
NM_012160chr61535 ------
NM_012164chr976304 6073 4584 2414 1419 930 762 32755 1178 824 --12830
NM_012175chr112612 227 --2125 40 --
NM_012193chr11145223 4424 4133 3968 3813 3620 3582 2051 2045 2039 1766 1431 316 307 25278 4734 ----
NM_012199chr153932 3923 3518 3091 1106 --11427 --
NM_012200chr11164 --1132 137
NM_012214chr286166 5540 2577 2401 2217 1396 1262 990 24120 2458 ----
NM_012215chr1021858 1744 ----1590
NM_012218chr1952904 2690 2183 1965 747 --42227 754 669 98 1486
NM_012236chr14814 726 206 56 184 2864 103 --
NM_012247chr10----1890 --
NM_012264chr2211847 816 620 548 378 311 226 190 171 78 48 1501 11751 11957
NM_012264chr2211847 816 620 548 378 311 226 190 171 78 48 1501 11751 11957
NM_012281chr71859 ------
NM_012287chr353693 3442 1441 1276 272 ------
NM_012288chr685210 4934 3988 1080 857 285 234 64 --33775 2266 2162 --
NM_012294chr752720 1023 542 484 153 --13348 --
NM_012297chr432569 2148 295 ----11620
NM_012302chr1--1246 ----
NM_012306chr1283460 3451 3152 2455 1072 941 577 119 52995 2570 1292 852 458 42280 1399 1275 452 12679
NM_012308chr1171688 1042 1006 964 427 292 174 11585 21847 974 --
NM_012309chr1174122 1484 1353 1189 887 851 424 23529 1756 1844 1406
NM_012334chr564211 3015 1684 1518 108 58 14079 12907 --
NM_012335chr194412 162 147 69 1333 ----
NM_012384chr206781 730 431 357 301 204 --12190 1675
NM_012398chr19132915 2502 2006 1987 983 957 914 874 740 724 662 404 157 1830 ----
NM_012402chr1121193 1132 11002 1302 --
NM_012410chr161388 ------
NM_012417chr17--1412 ----
NM_012419chr61108 ------
NM_012428chr15--1168 ----
NM_012429chr2271309 1248 1043 1022 525 363 266 11061 ----
NM_012448chr1742297 1975 1927 854 11663 21811 950 --
NM_012453chr73571 231 81 ------
NM_012464chr41317 ----12871
NM_012478chr171400 --1108 --
NM_012479chr761083 870 749 723 446 188 --1694 --
NM_013230chrY----1468 --
NM_013233chr211057 ------
NM_013238chr131617 ----21774 1254
NM_013253chr1141210 169 86 58 1212 1181 --
NM_013281chr2021452 178 ----21525 607
NM_013283chr52344 121 ----1619
NM_013309chr1552443 2220 992 814 479 11852 1968 --
NM_013312chr19187 ------
NM_013316chr71411 ------
NM_013364chrX41320 1269 543 415 --21381 222 --
NM_013368chr193510 397 131 --1450 --
NM_013374chr312175 --12977 --
NM_013381chr1212332 ------
NM_013411chr132739 1773 630 12055 ----
NM_013433chr1941753 1485 625 22 ------
NM_013444chrX--1800 ----
NM_013446chr721108 337 192 1110 --
NM_013451chr101168 ------
NM_013989chr1434451 4114 470 --14634 1662
NM_014000chr1011566 21362 416 ----
NM_014001chr1731316 1231 292 139 ----
NM_014021chr133226 2785 2234 --13193 --
NM_014028chr632037 1208 715 ----1206
NM_014042chr111251 --137 --
NM_014048chr1674213 3482 3410 1921 1914 934 478 ----23444 706
NM_014079chr33778 280 217 ------
NM_014089chr132513 374 ----11476
NM_014110chr13325 293 257 ------
NM_014112chr825081 488 45039 1047 805 463 --15470
NM_014117chr162412 153 ------
NM_014155chr11126626 6362 5907 5763 5212 4845 2288 2031 1458 1378 1345 1289 15421 15790 --
NM_014166chr13--1102 ----
NM_014181chr232479 2361 2267 ----11887
NM_014190chr441576 1422 1205 507 ----1275
NM_014217chr131825 547 363 ------
NM_014231chr1261858 1419 1389 595 486 112 ------
NM_014235chrX61680 1504 1380 1229 124 36 1132 ----
NM_014240chr363677 3300 1679 1560 1204 420 13650 ----
NM_014246chr2241607 1540 362 317 3844 406 328 ----
NM_014299chr1971968 1839 1788 1764 772 462 222 1797 ----
NM_014309chr2232144 1110 888 13952 1808 --
NM_014323chr2221026 772 ------
NM_014331chr457131 4850 2244 640 613 11350 11202 --
NM_014333chr11--12000 ----
NM_014338chr221836 1128 --190
NM_014352chr1131487 1266 1095 --1612 --
NM_014368chr921734 138 ------
NM_014388chr1115311 5186 4938 4292 4230 3929 2123 1956 1305 1135 152 --35866 4005 1213 --
NM_014405chr1752163 2124 1838 1548 375 22040 673 11803 --
NM_014452chr621109 244 ------
NM_014458chr11924 ------
NM_014488chr11--1238 ----
NM_014494chr1612148 ------
NM_014496chrX1238 ------
NM_014497chr2--1194 ----
NM_014503chr122396 305 ------
NM_014515chr12--198 ----
NM_014516chr19158 ------
NM_014517chr311374 ----11418
NM_014563chrX4790 458 343 293 --21332 349 --
NM_014570chr22169 ------
NM_014572chr132209 40 ----11548
NM_014575chr3--1194 ----
NM_014591chr1021159 84 --159 --
NM_014614chr2----126 --
NM_014629chr831278 973 939 1517 ----
NM_014630chr1543837 2716 1480 316 23328 831 11163 11204
NM_014634chr22113560 3243 3067 2650 2627 2420 1127 701 590 468 408 21357 1254 3920 731 630 --
NM_014646chr1862964 2927 2582 2074 165 152 ------
NM_014665chr853137 3042 2956 422 240 33019 2448 443 23210 1064 --
NM_014679chr1131409 130 76 ------
NM_014683chr1721740 1609 21971 1650 --1427
NM_014686chr1941856 1845 369 242 --12391 11985
NM_014689chr21207 ------
NM_014690chr793055 2935 2508 2201 1941 1230 1183 848 379 11075 22868 170 --
NM_014701chr1531216 890 361 1777 1704 --
NM_014709chr2--1153 ----
NM_014711chr16------12104
NM_014719chr7--1843 ----
NM_014720chr1031812 197 116 ------
NM_014726chr1751286 1157 916 376 279 --11228 1165
NM_014730chr1234787 3689 1623 24873 1858 11778 14550
NM_014730chr1234787 3689 1623 24873 1858 11778 14550
NM_014731chr2061639 1552 600 439 410 138 ------
NM_014733chr522036 674 ------
NM_014741chr1151732 1462 1368 712 104 --12074 --
NM_014742chr205700 619 590 344 289 ------
NM_014746chr273651 3320 598 183 149 130 37 3831 303 277 ----
NM_014747chr1115039 4746 4613 3889 2055 1933 1612 1477 768 754 342 --11221 21600 1277
NM_014755chr253206 3198 2904 2753 836 12912 ----
NM_014759chr831489 1097 64 11241 2511 306 --
NM_014761chr161277 131 --11133
NM_014762chr152507 826 752 617 156 145 11655 11763
NM_014764chr1211079 ----1145
NM_014767chr1042856 1470 815 806 --11140 --
NM_014770chr123403 309 58 21245 44 11086 --
NM_014771chr1641091 682 352 73 ------
NM_014772chr1863333 3212 3174 645 631 506 ------
NM_014774chr143209 794 650 605 ----22293 684
NM_014788chr942199 2164 627 174 11195 12178 131
NM_014806chr92447 335 ------
NM_014810chr153532 2822 2772 2339 579 1824 --1832
NM_014813chr12535 515 ----1462
NM_014820chr331474 1317 150 --11323 --
NM_014826chr143976 3390 808 137 ----12894
NM_014838chr2241948 632 64 23 1110 32146 647 174 --
NM_014840chr1292976 2948 2913 2864 2843 2523 1194 643 265 --12961 --
NM_014849chr14850 820 365 316 11027 ----
NM_014850chr384596 3937 3671 3328 1448 1415 1170 151 ------
NM_014869chr32507 41 --21022 439 --
NM_014876chr2262176 2039 777 679 613 535 ------
NM_014883chr452113 838 755 649 636 ------
NM_014891chr741674 1563 1374 1235 21241 638 ----
NM_014897chr1773125 2875 2670 989 845 816 28 12228 ----
NM_014901chr54612 438 425 93 21869 522 11512 --
NM_014903chr1211772 1399 ----
NM_014906chr1764089 3888 2847 1506 1111 144 ------
NM_014912chr101327 --1736 --
NM_014920chr643272 1506 1456 1373 12905 1506 --
NM_014921chr1972658 2445 2299 1951 1013 1003 35 --22578 116 --
NM_014924chr1462095 2071 1107 960 328 320 ------
NM_014926chr3----1827 --
NM_014945chr541748 659 591 363 1136 ----
NM_014949chr1----1325 --
NM_014978chr101665 --21469 1205 --
NM_014982chr1455160 4412 4378 1273 970 13445 ----
NM_014990chr14----21105 242 --
NM_014991chr431274 673 191 ----13271
NM_014999chr123433 325 275 11642 ----
NM_015015chr1962051 1592 1462 738 194 59 1564 ----
NM_015020chr1653241 2801 2517 315 148 --12751 --
NM_015023chr161861 1281 1263 575 472 347 ------
NM_015026chr12--33748 3355 996 --14260
NM_015027chr1631722 159 43 --1383 --
NM_015032chr13------12735
NM_015035chr20116382 5404 5118 4477 4059 2391 2175 2159 1714 1511 620 34799 2142 493 16555 15026
NM_015039chr163084 3008 2770 1737 1239 207 13398 ----
NM_015042chr1543358 3264 2679 992 22760 943 --13543
NM_015045chr102391 21 --2467 228 11491
NM_015049chr243213 2327 2099 377 11057 1622 --
NM_015051chr953134 2881 2837 1020 984 12380 ----
NM_015052chr7----2394 190 --
NM_015064chr1263538 2792 2345 586 234 187 ------
NM_015068chr72686 21 --1103 --
NM_015071chr562477 2361 2121 1314 1200 663 24111 2064 36392 5234 421 11994
NM_015074chr1113979 3249 1952 1825 1758 1652 1645 1635 918 799 605 53326 1946 1078 1069 415 --11433
NM_015075chrX31632 313 168 1506 1282 12230
NM_015076chr632944 568 21 --12828 --
NM_015080chr113704 669 112 1245 ----
NM_015091chr141773 ------
NM_015092chr1643226 3178 1652 382 170 13532 --
NM_015094chr22144573 4354 4280 3875 3846 3703 3657 3480 3428 2855 971 680 233 114 43614 3281 1417 1362 23727 784 --
NM_015101chr141932 1816 1137 393 --22781 950 --
NM_015115chr411039 12760 ----
NM_015130chr4----1383 --
NM_015132chr741795 513 485 38 ------
NM_015133chr1661432 1015 517 508 280 84 2476 240 21387 1163 --
NM_015143chr4----1330 --
NM_015162chr152154 70 1490 1121 --
NM_015172chr1--11230 ----
NM_015173chr421143 164 1383 145 --
NM_015176chr1----21476 105 --
NM_015185chrX82353 2308 2220 2127 949 886 800 504 11915 1819 --
NM_015191chr1162725 2292 1831 875 592 312 ------
NM_015199chr332947 788 55 --12740 --
NM_015208chr1843801 1403 1392 355 ------
NM_015233chr1341700 1091 287 127 11002 22433 1785 --
NM_015245chr672462 1919 1767 759 592 331 103 1505 1208 --
NM_015250chr961981 1507 1471 656 265 162 ------
NM_015256chr51658 ------
NM_015263chr15--163 11149 --
NM_015265chr2--1347 ----
NM_015267chr1231738 1669 1370 --11951 --
NM_015278chr652713 2488 1348 1298 426 12981 ----
NM_015288chr583063 3019 2532 2486 569 390 236 24 11176 12695 12514
NM_015291chr163009 2246 1321 952 395 69 ----11261
NM_015299chr14143894 3534 3486 3153 3147 3108 3090 3038 2781 1454 1346 931 756 451 --22462 1575 --
NM_015305chr1441709 1631 1322 397 1426 2351 160 --
NM_015315chr532314 2189 1210 --13394 --
NM_015317chr222686 2301 12032 12531 --
NM_015318chr1941348 1338 266 89 31695 369 299 1680 --
NM_015321chr19134751 4333 4217 4089 3455 3359 3304 3224 3142 1588 1221 1149 191 24114 4103 ----
NM_015335chr121993 1667 ----
NM_015344chr811460 11406 12094 --
NM_015347chr1232382 682 78 1863 ----
NM_015365chrX34109 1091 521 13118 ----
NM_015375chr123577 829 84255 3654 3518 1873 1840 696 514 144 --11628
NM_015397chr9----1312 --
NM_015401chr122441 391 --1929 --
NM_015435chr831349 973 83 ------
NM_015446chr1----1667 1176
NM_015455chr523132 157 13255 ----
NM_015457chr113969 368 56 ------
NM_015458chr864392 4042 3817 3423 758 372 --13756 --
NM_015461chr18------1271
NM_015509chr121413 --1564 11421
NM_015523chr111204 ------
NM_015530chr22257 166 ------
NM_015535chr243696 2734 920 645 1239 23489 1084 --
NM_015549chr142545 139 ----1431
NM_015550chr762742 2643 2534 2294 382 97 ------
NM_015553chr654226 4076 3175 1825 276 --1843 15120
NM_015557chr1103544 3449 3403 3370 1382 1348 1337 1036 687 61 13438 ----
NM_015575chr243349 2810 2541 130 13009 ----
NM_015576chr341994 1923 1843 690 ------
NM_015609chr132477 1037 905 --22558 1957 --
NM_015630chr21911 1851 ----
NM_015635chr921546 711 1120 --11372
NM_015640chr144258 4008 3280 1351 --13566 --
NM_015646chr12132 --1815 --
NM_015651chr971840 1632 1602 316 204 192 152 21760 657 21946 80 --
NM_015668chr8----1161 --
NM_015686chrX3545 212 58 22272 616 ----
NM_015691chrX52812 2693 2656 2214 2048 ----1324
NM_015695chr65862 845 667 658 642 11736 11648 --
NM_015719chr194800 619 600 157 --1217 --
NM_015723chr71197 ------
NM_015726chr121636 74 ------
NM_015840chr121995 199 1185 12054 --
NM_015841chr121995 199 1185 12054 --
NM_015872chr151632 1436 1179 529 343 21497 1192 ----
NM_015874chr42525 114 --1571 --
NM_015881chr1141210 169 86 58 1212 1181 --
NM_015885chr111188 ----1590
NM_015898chr1942427 1895 1821 171 11857 1686 --
NM_015962chr1441199 1068 685 115 11205 ----
NM_015982chr171268 ------
NM_016018chr812761 12609 1862 --
NM_016037chr14814 422 403 256 ------
NM_016072chr121584 ------
NM_016076chr132828 672 626 --1922 --
NM_016083chr623543 190 --1973 --
NM_016103chr5----238 24 --
NM_016133chr2----11445 --
NM_016138chr1641474 1446 592 507 --1358 --
NM_016144chr5173 --1609 --
NM_016147chr115739 363 332 216 183 1992 ----
NM_016173chr3114064 3775 3326 1763 1161 1093 967 903 144 133 80 33661 1241 318 ----
NM_016203chr71802 --1184 --
NM_016206chr3118959 8016 7428 6544 5949 5842 2879 2476 1958 582 365 22571 1713 ----
NM_016218chr521094 490 1950 ----
NM_016240chr821666 502 --162 11441
NM_016247chr3--1488 ----
NM_016257chr142731 2685 1095 833 21354 1303 12643 13366
NM_016260chr226976 4885 11949 26130 6111 --
NM_016272chr2252378 2072 1989 1718 796 1144 2720 578 12134
NM_016320chr111155 2996 958 ----
NM_016337chr141329 --1317 1406
NM_016341chr10126 ------
NM_016358chr5142 ------
NM_016418chr22103699 3690 3447 3036 2871 2618 1378 1230 1096 550 33251 1259 629 ----
NM_016436chr202701 117 ----11053
NM_016441chr23837 550 448 1829 ----
NM_016472chr1421477 1449 ------
NM_016484chrX2177 61 ----1218
NM_016504chr17140 ------
NM_016507chr1711995 ------
NM_016513chr643272 1506 1456 1373 12905 1506 --
NM_016526chr1192491 2472 2012 929 898 869 467 416 156 32180 975 432 ----
NM_016542chrX11727 ----1560
NM_016544chr242400 783 672 143 13406 ----
NM_016559chr31209 ------
NM_016563chr1551527 1156 528 395 25 --21453 193 --
NM_016577chr354305 3360 1734 1431 1236 13630 21501 523 1658
NM_016578chr11----1220 --
NM_016596chr122441 391 --1929 --
NM_016603chr5--198 ----
NM_016605chr572524 2418 1818 1787 1780 1772 609 --21887 816 --
NM_016617chr1321727 801 179 ----
NM_016621chr11104393 3965 3953 3646 3491 3281 942 837 791 148 14051 23336 1092 --
NM_016626chr181109 ------
NM_016824chr1011346 --1291 --
NM_016848chr9136 ------
NM_016940chr211472 ------
NM_016952chr1133888 529 399 22564 895 33955 635 479 --
NM_016953chr274366 2216 2079 1954 1756 1590 1027 ----14785
NM_017413chrX72508 2309 2244 2148 935 560 454 --2721 290 --
NM_017415chr533370 1238 738 1242 23700 775 13181
NM_017420chr1423353 2568 12590 1712 --
NM_017449chr141660 1468 1279 1173 11392 1473 --
NM_017455chr15--1168 ----
NM_017456chr1741758 1696 484 103 --11661 11344
NM_017551chr1042542 1085 989 921 42028 1979 1045 947 ----
NM_017553chr151491 1316 11032 1480
NM_017559chr174266 207 192 51 ------
NM_017572chr192170 28 ------
NM_017592chr19122560 2540 2419 2077 1034 976 903 883 720 682 587 165 32569 2406 2224 1999 --
NM_017594chr942399 2347 1251 202 12694 ----
NM_017628chr464911 4640 4262 4121 3944 3323 24238 248 11194 --
NM_017634chr831673 564 471 1286 --1773
NM_017635chr1131508 1349 518 --11643 --
NM_017637chr988844 8363 6793 6175 2918 2248 1239 250 17183 11414 --
NM_017641chr12--186 ----
NM_017643chr1762194 2160 1983 1115 734 135 ------
NM_017644chr354116 3707 3177 1502 445 34256 3493 868 14845 1560
NM_017650chr745398 1016 922 466 1615 1118 --
NM_017658chr1423801 382 21731 1236 --13031
NM_017670chr115817 693 292 224 46 1591 --1656
NM_017681chrX------145
NM_017719chr321608 398 ------
NM_017730chr3----1124 --
NM_017737chr1183 ----1486
NM_017741chr432205 1098 309 22070 175 ----
NM_017742chr1811577 ----11230
NM_017745chrX--1469 ----
NM_017749chr112759 207 1279 1801 --
NM_017758chr1781323 1251 1239 1095 1061 1004 565 320 ------
NM_017772chr62599 132 11585 ----
NM_017787chr1022569 426 --1602 1163
NM_017811chr932524 2229 42 ------
NM_017813chr865090 4779 2150 1982 1763 818 25744 4419 ----
NM_017848chrX54559 3228 1883 1489 109 --11507 --
NM_017849chr283175 3064 2682 2485 2315 1189 505 492 2772 639 12756 --
NM_017851chr153949 421 88 ------
NM_017857chr114603 481 439 205 1445 1546 --
NM_017893chr1051399 1172 207 153 52 1361 11199 --
NM_017902chr10115520 5167 5009 3952 3776 1179 1112 834 827 387 30 11241 21156 555 --
NM_017933chr2--1319 1247 11509
NM_017938chrX2183 125 ------
NM_018003chr15--11700 ----
NM_018017chr1022881 1000 1581 --11140
NM_018027chr1062879 2166 2078 2032 1062 387 --12986 --
NM_018028chr1931149 922 182 ------
NM_018045chr132693 975 84 22266 1225 12485 --
NM_018085chr146662 2084 882 158 57662 6275 6104 5390 1731 15761 --
NM_018092chr163301 295 55 1160 ----
NM_018096chr174964 728 344 294 1776 ----
NM_018121chr1012308 --32967 2754 2105 --
NM_018126chr4----181 --
NM_018157chr1222591 61 1659 ----
NM_018178chr131890 807 145 ------
NM_018181chr18----2591 102 --
NM_018182chr174455 431 381 223 ------
NM_018189chr32512 347 ------
NM_018192chr361003 790 737 731 312 244 ----1991
NM_018205chr1072219 2206 2004 1943 1582 1443 941 2391 252 11847 --
NM_018239chr1072219 2206 2004 1943 1582 1443 941 2391 252 11847 --
NM_018241chr41339 1127 ----
NM_018247chr652505 2220 918 780 430 --12586 --
NM_018298chr12937 675 ------
NM_018299chr812387 --1295 1186
NM_018307chr172862 358 ----1267
NM_018313chr3----11981 1817
NM_018315chr421411 287 ------
NM_018340chr1664233 3968 3800 3093 1912 1895 41669 1534 449 106 ----
NM_018362chr1133205 2711 1411 --12508 13852
NM_018364chr111071 13193 ----
NM_018372chr1--1659 1617 --
NM_018373chr14116331 5624 5458 4493 4095 2396 2365 1177 1064 794 591 11920 46393 6141 5852 3988 14272
NM_018403chr363616 2886 2596 1630 1042 676 ------
NM_018406chr3121 ------
NM_018433chr2------153
NM_018440chr836739 6678 185 26279 3227 ----
NM_018445chr15------1181
NM_018469chr17------1378
NM_018486chrX----1424 --
NM_018489chr142121 743 550 200 1384 ----
NM_018584chr12399 145 ------
NM_018590chr1031382 680 326 --11503 --
NM_018667chr1692477 2353 2335 2255 1799 1104 791 345 193 32100 2057 748 ----
NM_018689chr1552290 2159 2031 823 574 ----12440
NM_018691chr52773 172 1284 --1114
NM_018712chr112491 428 1248 ----
NM_018717chr43483 388 171 11829 3809 762 148 --
NM_018834chr511008 ------
NM_018912chr561320 1286 1152 335 88 74 ------
NM_018913chr561320 1286 1152 335 88 74 ------
NM_018914chr561320 1286 1152 335 88 74 ------
NM_018915chr561320 1286 1152 335 88 74 ------
NM_018916chr561320 1286 1152 335 88 74 ------
NM_018917chr561320 1286 1152 335 88 74 ------
NM_018918chr561320 1286 1152 335 88 74 ------
NM_018919chr561320 1286 1152 335 88 74 ------
NM_018920chr561320 1286 1152 335 88 74 ------
NM_018921chr561320 1286 1152 335 88 74 ------
NM_018922chr561320 1286 1152 335 88 74 ------
NM_018923chr561320 1286 1152 335 88 74 ------
NM_018924chr561320 1286 1152 335 88 74 ------
NM_018925chr561320 1286 1152 335 88 74 ------
NM_018926chr561320 1286 1152 335 88 74 ------
NM_018927chr561320 1286 1152 335 88 74 ------
NM_018928chr561320 1286 1152 335 88 74 ------
NM_018929chr561320 1286 1152 335 88 74 ------
NM_018952chr171259 ------
NM_018970chr712450 12920 ----
NM_018977chrX3859 800 52 --131 --
NM_018992chr1651286 569 478 440 70 ----1647
NM_018999chr1064336 3342 1945 538 279 112 --21572 594 13889
NM_019001chr3--1145 14209 --
NM_019009chr1162413 2301 1740 1620 675 188 12512 11732 --
NM_019016chr17------184
NM_019045chrX2688 152 --175 --
NM_019071chr7------1103
NM_019116chr1643521 2862 1110 940 1952 11437 --
NM_019593chr2042317 2283 2256 2209 1181 12015 --
NM_019600chr15----1559 --
NM_019842chr6------2354 23
NM_019859chr10----1360 --
NM_019885chr232086 711 630 134 22134 1139 1945
NM_019903chr1011346 --1291 --
NM_020069chr11--133 ----
NM_020122chr275955 4774 4080 3749 1683 834 97 14623 ----
NM_020159chr41582 1625 ----
NM_020168chr1571201 1188 1164 1057 995 355 162 --1554 --
NM_020178chr17----11153 --
NM_020205chr173316 3266 3231 2777 1381 295 160 --1812 --
NM_020211chr1551173 1148 1097 461 287 2516 147 ----
NM_020239chr161983 1728 1617 852 676 296 ------
NM_020248chr111895 --22164 971 --
NM_020310chr1781994 1785 1046 437 397 122 98 92 ------
NM_020342chr21528 ------
NM_020348chr1052712 2606 918 817 505 ------
NM_020374chr1221993 50 --11583 21414 1250
NM_020381chr62738 573 11888 ----
NM_020382chr1261648 1306 1156 578 403 344 21362 597 ----
NM_020384chrX21655 599 11905 --11488
NM_020390chr324204 960 13590 11128 --
NM_020403chr13------11220
NM_020405chr1763813 3526 2877 2789 964 342 13555 1931 --
NM_020416chr491077 944 748 644 637 458 362 287 178 ------
NM_020429chr742795 2495 2453 250 --12512 --
NM_020440chr1102429 2413 2275 2105 1192 958 886 785 543 38 ------
NM_020443chr1106838 5942 5826 5776 5506 5090 2755 1927 953 748 --46435 2400 2111 1898 --
NM_020475chr852136 1984 1815 808 573 21795 433 21892 160 --
NM_020476chr852136 1984 1815 808 573 21795 433 21892 160 --
NM_020477chr852136 1984 1815 808 573 21795 433 21892 160 --
NM_020478chr852199 2047 1878 871 636 21858 496 21955 223 --
NM_020480chr852136 1984 1815 808 573 21795 433 21892 160 --
NM_020526chr15628 530 171 99 45 124 11530 --
NM_020640chr311499 --11714 11483
NM_020689chr202149 122 1318 ----
NM_020697chr821147 140 170 1888 --
NM_020699chr1114968 4800 4734 4673 4312 3844 3727 3425 2023 1793 1488 --1898 --
NM_020715chr1452022 1428 525 177 158 12301 ----
NM_020717chrX114820 4436 4387 4075 1934 1907 1051 631 588 566 482 24687 4553 ----
NM_020718chr1685606 5577 5541 5400 5026 2447 2306 593 ------
NM_020728chr742743 2357 1147 201 ----23008 152
NM_020739chr1544061 1679 1155 823 13536 --13137
NM_020742chrX42602 2362 2182 1686 ------
NM_020749chr821575 812 11837 11393 --
NM_020750chr6----2129 72 --
NM_020766chrX21651 837 --2989 949 --
NM_020769chrX2888 286 ----2300 128
NM_020772chr1737886 7837 2535 --22024 1835 --
NM_020776chr1842756 987 164 55 1185 ----
NM_020786chr1631938 486 359 11514 ----
NM_020801chr51564 ------
NM_020803chr432318 1616 508 22184 381 ----
NM_020804chr682525 2286 2230 2196 2152 726 701 603 11968 1359 --
NM_020824chr10----1501 --
NM_020841chr12----11180 --
NM_020845chr1282222 2166 704 681 378 333 321 40 --12018 11564
NM_020850chr1672636 2252 2209 1196 1167 1003 732 23105 3030 12573 1536
NM_020853chr1252499 1012 971 424 230 ----22078 408
NM_020854chr18------11505
NM_020856chr19--1328 165 --
NM_020858chr15--11742 ----
NM_020860chr4----1122 1878
NM_020861chr61202 --21109 495 --
NM_020886chr1121020 854 ----1326
NM_020888chr161680 1652 1464 1445 707 430 --1596 --
NM_020918chr1032405 716 100 1572 11018 --
NM_020922chrX3625 312 51 11827 ----
NM_020924chr9--2311 144 ----
NM_020935chr234452 4321 4194 --14201 13979
NM_020947chr1642250 2047 1921 595 11550 --12016
NM_020948chr132575 573 58 --1885 --
NM_020956chr19144578 4331 4202 4083 4060 3801 3774 3764 3580 3266 1089 957 517 202 33603 3221 817 34552 1080 179 --
NM_020971chr191233 ------
NM_020972chr45968 902 889 183 34 1691 ----
NM_020981chr2----174 --
NM_021032chr311969 11773 11665 --
NM_021061chr893896 3802 3718 2985 1644 1528 1478 846 730 13369 13557 --
NM_021069chr441850 751 378 333 ----12025
NM_021076chr223214 203 189 --1484 --
NM_021079chr1783295 2961 2797 2779 2284 2233 2141 2068 21337 1007 ----
NM_021097chr242846 2822 1953 823 12123 1255 --
NM_021098chr164683 610 181 141 2306 71 ----
NM_021145chr71874 ------
NM_021183chrX1906 ------
NM_021198chr251146 1019 929 153 72 --3595 454 197 --
NM_021202chr2062347 2012 1247 1193 811 692 1508 11233 11025
NM_021216chr1911086 ------
NM_021238chr1251519 1401 546 284 119 ------
NM_021239chr14--1216 ----
NM_021252chr105842 754 532 438 298 11950 ----
NM_021570chr92404 185 ----1359
NM_021629chr364128 4115 3957 3325 1971 1853 23193 405 ----
NM_021638chr463970 3814 3457 1021 275 155 23319 419 --24029 1865
NM_021705chr6152 ----1487
NM_021738chr101213 1301 ----
NM_021813chr655421 5209 4932 1850 1400 23604 215 2295 45 --
NM_021907chr21131 132 ----
NM_021911chr532117 989 91 22136 1516 ----
NM_021912chr1533806 3788 944 --1879 --
NM_021913chr1951462 620 454 306 246 ----11516
NM_021914chr141913 --21850 1788 --
NM_021940chr6----11357 --
NM_021949chrX21827 1100 21035 893 1150 --
NM_021961chr1156500 2811 2559 2168 2029 11508 22778 2004 --
NM_021962chr1732339 2324 941 1286 11600 --
NM_021977chr633015 2435 37 ----23029 637
NM_021999chr13--1534 ----
NM_022048chr1595968 5235 4483 2406 1636 1532 575 503 26 ----1696
NM_022075chr11701 1187 ----
NM_022091chr6--12415 11820 --
NM_022103chr1911207 ------
NM_022121chr6--11249 172 --
NM_022140chr541706 1540 258 185 ------
NM_022166chr16106207 4898 4477 4444 4421 2244 2215 1121 797 379 ----12203
NM_022169chr1161330 1125 603 443 350 342 --11376 --
NM_022171chr321577 103 31234 381 179 ----
NM_022336chr241947 1495 924 601 1230 --1591
NM_022374chr21458 ------
NM_022456chr12106688 6655 6504 5782 5138 4821 2732 2487 1674 1422 17436 26835 210 --
NM_022459chr1355225 4396 4201 2372 1306 1389 ----
NM_022465chr1252358 1164 1027 754 741 1661 ----
NM_022473chr1571722 1412 1280 1042 796 638 405 1124 11668 --
NM_022477chr2041302 1136 534 467 ----11469
NM_022497chr33961 933 789 23127 621 11455 --
NM_022552chr211034 --11183 --
NM_022719chr22123407 3040 2949 1419 1370 1300 1159 927 806 557 367 93 --12411 --
NM_022744chr1631317 861 122 1167 ----
NM_022745chr152790 2617 1190 588 172 1436 ----
NM_022748chr782568 2527 2287 2248 2095 1074 542 353 --21140 113 12555
NM_022749chr86402 351 256 177 160 111 31147 1035 929 1893 1209
NM_022756chr121250 1028 --129 --
NM_022758chr61476 11967 --12291
NM_022780chr211595 ----11829
NM_022781chr922541 1280 ----22802 725
NM_022817chr231524 829 44 ------
NM_022823chr21125 ------
NM_022824chr511300 --1529 --
NM_022833chr941172 1142 989 544 158 1533 --
NM_022841chr151459 12340 --1760
NM_022898chr1474219 4009 3959 3776 3751 3358 1290 --13316 --
NM_023002chr1962008 1979 1794 1755 829 517 11583 ----
NM_023033chr121534 ----2145 53
NM_023037chr13--1859 ----
NM_023071chr121269 --1304 --
NM_024007chr532353 1999 96 ----1891
NM_024017chr1761303 1254 1150 1095 657 193 1524 ----
NM_024107chr173799 713 684 ------
NM_024293chr21586 ------
NM_024294chr61476 11967 --12291
NM_024306chr162770 212 1101 1281 --
NM_024312chr1231325 1161 1076 ------
NM_024315chr7--1367 ----
NM_024345chr965228 4728 1796 1678 1545 1009 ------
NM_024429chr71802 --1184 --
NM_024524chr332178 856 43 ------
NM_024539chrX----21011 417 --
NM_024551chr1232382 2300 1755 ------
NM_024551chr1232382 2300 1755 ------
NM_024595chr141113 901 890 28 ------
NM_024598chr1641283 1074 43 25 ------
NM_024607chr883404 1652 1088 953 823 616 447 172 ------
NM_024617chr9297 38 ------
NM_024645chr831404 1072 550 ------
NM_024659chr2--1629 ----
NM_024665chr324175 3176 ----24633 1577
NM_024671chr162467 192 ------
NM_024674chr162603 2434 2131 653 151 116 --22292 829 12228
NM_024700chr12455 410 ------
NM_024740chr1154036 3594 3137 2968 1269 23754 227 ----
NM_024742chr1651912 1866 1352 438 241 11221 21207 682 1153
NM_024770chr2116698 5766 5631 4261 2394 2052 1917 1457 1044 646 442 1782 1614 15877
NM_024785chr241313 1307 1142 332 1433 2274 111 --
NM_024798chr1592709 2603 2504 2343 2267 1860 667 502 255 1390 ----
NM_024817chr1585378 4216 1957 1894 1806 1011 851 103 21818 704 ----
NM_024830chr581850 1678 1414 690 545 357 267 130 ------
NM_024835chr17----1171 --
NM_024837chr154614 353 184 43 ------
NM_024881chr1993839 3523 3143 3031 2976 1223 928 432 368 21188 1055 12689 --
NM_024887chr182036 1362 753 714 633 343 136 45 ------
NM_024920chr4----11513 --
NM_024947chr388259 8142 8092 7859 7508 7342 2406 749 --26570 3597 --
NM_024949chr423839 3448 11246 24380 4188 --
NM_024989chr287047 5619 2951 2385 2269 2219 1251 899 ------
NM_025054chr81186 --14086 12588
NM_025058chr12701 227 2762 653 ----
NM_025074chr452856 2031 1950 1108 1014 22104 1147 ----
NM_025083chr15101933 1773 1646 1335 1300 525 508 357 310 263 --31419 1309 197 1232
NM_025151chr872004 1759 790 720 684 160 57 --1871 --
NM_025160chr113918 13039 1266 --
NM_025179chr174132 3955 3506 1785 1523 1050 91 11014 23885 1622 --
NM_025191chr132694 2500 263 1692 ----
NM_025195chr8--11484 ----
NM_025208chr11--21875 318 12059 --
NM_025224chr20102287 2059 2038 1872 1738 1450 792 718 670 469 --3708 630 537 11559
NM_025235chr10----21794 229 --
NM_025250chr772834 2340 2002 1133 819 700 106 11186 21893 1063 --
NM_025263chr621453 477 11563 21351 22 --
NM_030576chr17102588 2157 1976 1951 1056 624 306 152 121 95 32488 2170 638 ----
NM_030583chr84864 227 188 79 ------
NM_030629chr1611633 ----11937
NM_030631chr14186 ------
NM_030640chr121793 ----1660
NM_030647chr744467 3862 538 46 14153 1685 --
NM_030648chr4113909 3575 3395 2062 2013 1833 1757 1705 1652 1630 959 ------
NM_030674chr1265035 4729 3938 1810 1088 1013 25117 2063 --11695
NM_030761chr172676 2374 2359 2231 1730 553 539 2723 156 22248 1084 21866 611
NM_030767chr992725 2574 2525 2419 2061 749 718 712 57 22683 275 12346 1263
NM_030775chr123923 886 770 --1623 --
NM_030791chr142719 78 11436 --169
NM_030802chr172621 65 --1656 --
NM_030806chr1168141 7318 6997 6957 6872 6487 6111 3365 3020 2923 2764 2002 1869 1861 1415 1377 16499 16818 36584 5937 270
NM_030809chr1252293 1973 941 524 479 2804 385 12334 --
NM_030820chr6--130 ----
NM_030914chr93676 296 154 --178 1137
NM_030918chr195243 5090 5041 4586 4498 4452 3457 2036 1498 --24992 270 1683
NM_030927chr1021463 1241 ----11266
NM_030949chr651347 1296 1187 1063 297 21376 553 ----
NM_031157chr121427 ------
NM_031268chr16114938 3986 3953 1922 1814 1687 1643 1572 1427 212 70 11374 24037 1937 14187
NM_031305chr4278 47 11373 ----
NM_031309chr8112303 2062 1841 1724 1610 772 682 438 228 75 26 1800 --11564
NM_031412chr1221244 917 1789 1949 --
NM_031417chr1952136 2126 749 182 52 12261 --11006
NM_031426chr972734 2583 2563 2314 2002 1970 402 --1370 --
NM_031427chr1445769 4271 1526 1179 11055 ----
NM_031444chr2282055 1986 1936 1573 1554 80 55 25 --2663 458 --
NM_031459chr131108 394 300 ----31286 1259 410
NM_031468chr7117630 7585 6947 6563 6530 6151 2739 2562 2295 1203 464 37356 5994 2827 --27707 337
NM_031989chr12----191 --
NM_031990chr1951008 909 560 195 24 --11290 --
NM_031991chr1951008 909 560 195 24 --11290 --
NM_032012chr941634 1418 1366 30 22094 1511 23439 776 --
NM_032013chr2041302 1136 534 467 ----11469
NM_032017chr15592 453 334 139 101 1684 21839 496 11295
NM_032050chr2221026 772 ------
NM_032088chr561320 1286 1152 335 88 74 ------
NM_032092chr561320 1286 1152 335 88 74 ------
NM_032102chr1132702 763 581 22020 1899 1476 --
NM_032105chr1117187 6317 6167 6026 3087 2318 2219 2184 570 412 140 --21869 48 --
NM_032116chr1385161 4187 3979 2338 2288 1179 801 644 14137 ----
NM_032121chrX42412 800 732 395 --1849 --
NM_032144chr2----11162 --
NM_032160chr1853818 3652 3299 2729 2705 ------
NM_032181chr2----1214 --
NM_032199chr1021351 293 21554 236 11008 --
NM_032229chr13------1190
NM_032242chr3103229 2991 2554 2300 2180 1251 695 446 355 254 2733 515 23211 2445 --
NM_032281chr19112905 2859 2845 2804 2738 2687 1188 1048 404 374 237 21117 37 12391 --
NM_032287chr2273896 3604 2853 1002 813 622 461 22887 41 ----
NM_032311chr2251668 1405 545 476 387 11422 21250 574 --
NM_032353chr172388 44 ----1448
NM_032373chr1025642 4028 13895 13889 --
NM_032389chr113390 62 21 1349 ----
NM_032403chr561320 1286 1152 335 88 74 ------
NM_032421chr752086 1997 1321 607 307 11787 1504 2834 77
NM_032445chr1521915 1835 12235 1149 --
NM_032446chr533148 549 179 1702 13685 13465
NM_032449chr162182 1830 1007 503 326 223 --22320 2199 --
NM_032457chr431094 673 146 --11218 --
NM_032511chr6--167 ----
NM_032512chrX21070 28 ------
NM_032514chr202438 49 ------
NM_032538chr6132631 2574 2392 2312 2203 2098 1971 1939 585 378 372 272 176 11131 12400 --
NM_032575chr16101893 1835 1731 1696 1426 1410 788 649 468 412 2570 106 11393 --
NM_032582chr1721276 408 ----1222
NM_032632chr141585 11756 1166 --
NM_032642chr123923 886 770 --1623 --
NM_032682chr343589 2907 952 651 ----12526
NM_032711chr1764223 3001 2769 1447 589 159 144 --11720
NM_032765chr5--1362 ----
NM_032864chr1--185 1993 --
NM_032867chr114588 568 237 49 ------
NM_032873chr1134531 4370 2956 13521 ----
NM_032884chr11114 ------
NM_032892chr15133 ------
NM_032947chr5----1367 --
NM_032978chr181789 1469 ----
NM_032979chr181789 1469 ----
NM_032981chr181789 1469 ----
NM_032983chr743260 2961 2836 890 12300 2987 411 --
NM_032992chr42666 57 1198 ----
NM_032995chr251079 595 360 312 306 31540 1138 327 1288 --
NM_033012chr131802 ------
NM_033025chr196846 734 306 173 99 41 ------
NM_033036chr1121458 350 --31301 1124 440 --
NM_033083chr333203 2474 330 ----12684
NM_033088chr11101 ------
NM_033103chr1931043 876 174 --2365 25 --
NM_033121chr1221184 515 --2223 172 11426
NM_033129chr2092049 1581 1520 1416 1410 817 629 286 51 1280 31813 1345 1298 --
NM_033133chr1742986 2405 821 228 23098 1375 22455 306 --
NM_033135chr11--21875 318 12059 --
NM_033136chr541589 1227 643 395 ----21747 1391
NM_033137chr541589 1227 643 395 ----21747 1391
NM_033147chr21131 132 ----
NM_033148chr21131 132 ----
NM_033181chr623543 190 --1973 --
NM_033224chr7106802 6685 6341 5153 5091 1627 716 547 488 340 25213 853 26631 430 --
NM_033274chr5133462 2714 2692 2667 2615 2312 1067 883 687 439 343 212 120 22556 243 ----
NM_033285chr823924 605 --13978 21132 865
NM_033290chrX53053 2559 1279 1020 954 --2795 48 --
NM_033309chr165908 847 389 353 96 ------
NM_033315chr1792066 2053 1976 863 735 655 601 528 337 ------
NM_033331chr942237 749 628 38 12816 ----
NM_033334chr9125 ------
NM_033360chr1233308 1445 1125 --13629 1605
NM_033375chr1721232 196 --11261 --
NM_033387chr972508 2180 2165 894 775 454 181 --21871 988 --
NM_033389chr1734283 3377 3226 ----13520
NM_033396chr112373 100 2394 39 ----
NM_033503chr1562891 2806 1191 697 525 186 ------
NM_033515chr6--1449 ----
NM_033518chrX2274 21 ------
NM_033549chr55916 771 755 157 138 ------
NM_033551chr532314 2189 1210 --13394 --
NM_033631chr183738 2761 2553 885 848 490 204 134 23697 94 ----
NM_033632chr421411 287 ------
NM_033642chrX----148 --
NM_052840chr1521000 247 1526 1624 --
NM_052847chr19133521 3452 3335 3190 3137 3065 3043 2804 2443 1020 854 415 226 22427 75 33708 3343 1169 12485
NM_052864chr411872 --1472 1414
NM_052874chr163735 619 163 3631 575 117 193 --
NM_052896chr11151 ------
NM_052897chr124774 584 299 271 ------
NM_052906chr2264862 3800 3748 3101 1728 421 24620 715 44602 3657 1195 68 --
NM_052911chr181775 ------
NM_052934chr141779 1710 451 251 --1573 --
NM_052978chr141630 --1276 --
NM_053016chr976667 6181 5776 3128 2983 2344 524 27537 6673 12692 --
NM_053043chr766294 5356 5296 4121 1747 342 14634 35801 4016 105 --
NM_053056chr1122366 59 --1953 21984 549
NM_054016chr121279 448 1130 31610 792 481 1625
NM_054016chr121279 448 1130 31610 792 481 1625
NM_054016chr121279 448 1130 31610 792 481 1625
NM_054035chr172785 560 1669 2707 119 --
NM_057175chr412217 ----11075
NM_057178chr1741128 1067 709 121 ------
NM_058172chr41475 --11694 --
NM_078476chr65691 522 375 355 182 ----1294
NM_079421chr19------1398
NM_080546chr932063 1633 395 1473 ----
NM_080588chr131031 312 27 11148 1184 --
NM_080616chr202632 577 2690 678 ----
NM_080617chr201348 --131 --
NM_080669chr1794063 3795 3686 3301 3272 1177 401 336 190 23813 3669 24253 1550 --
NM_080738chr131600 1274 666 21324 488 11582 11460
NM_080764chr2273244 3092 2777 2088 966 335 145 --1385 --
NM_080792chr2072213 1908 1815 1692 1573 596 370 --1550 --
NM_080867chr1454968 3769 3604 1071 210 --13654 1310
NM_101395chr2132541 412 264 21274 87 23402 2207 --
NM_130385chr1132555 2407 75 1810 12513 12694
NM_130391chr952992 2742 2650 1203 317 --1163 --
NM_130392chr952992 2742 2650 1203 317 --1163 --
NM_130393chr952992 2742 2650 1203 317 --1163 --
NM_130436chr2111873 1606 12734 --
NM_130437chr2132500 371 223 21233 46 23361 2166 --
NM_130438chr2132450 321 173 11183 23311 2116 --
NM_130439chr1011899 21954 690 ----
NM_130439chr1011899 21954 690 ----
NM_130440chr141500 1477 1154 146 --11161 --
NM_130459chr951576 1296 1221 554 77 1190 11085 --
NM_130797chr711256 ------
NM_130811chr201401 ------
NM_133170chr20177700 7554 7524 7018 6856 5921 5227 3073 3038 2738 2611 2217 1256 1243 545 485 211 26782 2091 37211 2532 1742 --
NM_133264chr1773569 3433 1380 1340 1014 778 769 --23196 3120 --
NM_133265chrX42748 2221 501 478 ------
NM_133266chr112335 174 1746 ----
NM_133372chr532936 2010 1845 ------
NM_133445chr993667 3533 1039 952 423 297 193 185 112 1574 13037 13459
NM_133478chr222127 200 42061 984 818 731 ----
NM_133496chr164137 2943 1598 1571 1480 717 ------
NM_133634chr2151663 1298 666 483 368 --21826 1230 1593
NM_133635chr2151310 945 415 313 130 --11473 1240
NM_133646chr252042 1891 1683 1090 1005 14903 ----
NM_133647chr1543411 2723 2548 746 13647 22350 1356 --
NM_138288chr14----11902 --
NM_138297chr3121 ------
NM_138338chr22113209 2791 2579 1375 1253 1035 966 955 931 802 754 1386 43310 2310 1286 166 --
NM_138350chr161368 1334 1164 919 203 91 --2554 507 --
NM_138357chr10--1177 11449 --
NM_138370chr25712 552 489 278 223 ------
NM_138385chr471312 1232 1125 1031 1004 898 567 ------
NM_138395chr251136 356 228 153 67 ------
NM_138426chr751959 1552 835 507 385 --1409 --
NM_138444chr1313346 ----14591
NM_138457chr6132901 2752 2700 2633 2191 2118 1098 844 766 673 663 130 107 13088 22130 56 --
NM_138473chr1284670 4510 3559 3145 1290 1119 848 803 --11930 --
NM_138479chr132040 1506 1462 --3819 786 371 --
NM_138558chr13325 293 257 ------
NM_138576chr1474219 4009 3959 3776 3751 3358 1290 --13316 --
NM_138578chr2031352 1175 1072 21033 956 21111 534 --
NM_138619chr1731316 1231 292 139 ----
NM_138621chr294042 3635 3599 3525 3430 3364 3009 1318 1298 13378 13219 --
NM_138635chr752646 2356 997 819 763 ----1346
NM_138638chr141913 --21850 1788 --
NM_138693chr72392 46 ----1141
NM_138694chr623155 2463 1229 21443 924 --
NM_138713chr1666881 5356 4983 2617 954 283 12231 16329 --
NM_138714chr1666881 5356 4983 2617 954 283 12231 16329 --
NM_138717chr62659 74 --1203 --
NM_138732chr113704 669 112 1245 ----
NM_138734chr113704 669 112 1245 ----
NM_138735chr2--11385 ----
NM_138771chr721564 1128 11494 --1194
NM_138775chr111293 ------
NM_138967chr1542347 2054 1821 1587 --32216 1978 561 12240
NM_139012chr62798 244 3723 673 287 --11657
NM_139014chr62878 324 3803 753 367 --11737
NM_139057chr1562180 1022 883 489 254 246 11948 22236 1798 --
NM_139068chr5------1536
NM_139069chr5------1536
NM_139070chr5------1405
NM_139071chr1271338 1218 1162 567 411 322 102 --11187 --
NM_139132chr111155 2996 958 ----
NM_139136chr121154 ------
NM_139242chr1541487 294 178 128 ------
NM_139283chr1241581 879 734 528 --12528 --
NM_139321chr2063745 2609 1224 1082 515 238 22737 1273 12598 --
NM_144571chr465750 4833 4752 1704 433 107 ------
NM_144579chr272628 2379 2282 1007 868 753 462 1582 22033 861 1781
NM_144599chr1565094 4479 3909 3581 3542 920 ------
NM_144767chr1594147 3932 3765 3456 3435 1660 1021 486 136 33541 1027 599 24301 1076 1731
NM_144973chr1275310 4924 4330 2016 1769 1102 954 ----1412
NM_144982chr12----1220 --
NM_145008chr111549 2312 154 ----
NM_145013chr1172620 2528 1934 1848 817 512 390 1597 --1448
NM_145055chr1821149 1140 1328 --12606
NM_145159chr142849 186 --1377 --
NM_145206chr1052699 2396 2196 1223 101 ------
NM_145245chr1951238 999 969 854 259 2863 57 1243 --
NM_145259chr246335 5677 4581 2091 ------
NM_145284chrX21963 785 --12382 --
NM_145296chr194592 324 311 25 --1699 --
NM_145320chr762742 2643 2534 2294 382 97 ------
NM_145321chr762742 2643 2534 2294 382 97 ------
NM_145322chr762742 2643 2534 2294 382 97 ------
NM_145349chr1741792 1539 296 146 1557 21525 1380 --
NM_145686chr223011 712 ----12595
NM_145687chr223011 712 ----12595
NM_145753chr3127 ----11141
NM_145804chr113442 332 92 31189 1113 144 ----
NM_145808chr721075 202 ------
NM_145861chr131600 1274 666 21324 488 11582 11460
NM_145909chr61209 ------
NM_146388chr1941132 1101 880 270 149 ----
NM_147150chr943101 1405 1174 392 12431 ----
NM_147175chrX2767 418 --1758 11457
NM_147189chr831905 684 485 --1220 --
NM_147192chr121309 413 --1396 --
NM_147202chr952654 2625 2482 1747 894 --12537 --
NM_147223chr262080 1788 801 292 143 31 1676 ----
NM_147233chr241897 1605 618 109 1493 ----
NM_147686chr6132 --1380 --
NM_148570chr17140 ------
NM_148894chr43921 331 23 ------
NM_148955chr1554170 3990 1287 301 98 24447 482 15815 --
NM_152253chr22134118 4056 3430 3381 3247 3223 2833 1660 1597 1518 935 803 536 13148 --21371 435
NM_152261chr12--1355 1204 --
NM_152263chr1105601 4526 4390 3889 2343 2177 1877 1585 962 505 36104 4837 4013 1462 --
NM_152264chr116991 831 725 443 379 217 3964 813 709 ----
NM_152280chr152960 2141 1185 433 267 --1317 --
NM_152282chr3------11078
NM_152341chr1691304 1211 1110 1020 585 507 390 344 52 --21354 1239 --
NM_152344chr17--11353 --11312
NM_152352chr1842965 2694 2415 1179 1331 ----
NM_152371chr161642 1423 727 709 470 262 21611 1405 --11369
NM_152380chr1----11186 --
NM_152409chr551306 1101 1034 822 25 ------
NM_152424chrX64533 4261 3746 3349 3168 1270 13718 ----
NM_152470chr18103665 3172 3143 2893 2591 898 772 295 279 42 13048 1884 --
NM_152493chr181518 620 510 178 167 89 78 62 153 11405 --
NM_152496chr151206 488 415 178 102 1144 ----
NM_152557chr731156 560 342 --11105 185
NM_152586chr102196 63 2934 835 ----
NM_152695chrX11705 --21843 1664 11519
NM_152722chr1151739 1558 1512 1403 80 ------
NM_152733chr6196299 6266 6145 5894 5834 5812 5457 5041 5000 4870 4096 4006 2588 2457 2105 1346 357 288 110 34113 1692 208 25959 5923 --
NM_152739chr71140 --1172 --
NM_152744chr772965 2704 2612 1055 672 592 279 1609 1937 22939 2547
NM_152787chrX43177 1314 555 23 1631 ----
NM_152826chr1554170 3990 1287 301 98 24447 482 15815 --
NM_152860chr1231196 617 227 --1393 --
NM_152890chr12448 280 141 128 --
NM_152924chr15114574 2231 1624 1581 1418 1090 1035 638 495 486 70 65386 5057 4982 4942 4863 1012 65764 2661 2495 1736 441 177 --
NM_152991chr111649 --132 --
NM_153042chr61556 11323 --11593
NM_153188chr514863 --1833 1873
NM_153235chr631958 1650 423 11792 1955 --
NM_153255chr61910 1920 ----
NM_153257chr1931161 1035 985 --1473 --
NM_153273chr332161 921 203 1631 1239 --
NM_153321chr171830 --1961 --
NM_153322chr171830 --1961 --
NM_153333chrX----1171 --
NM_153367chr1042795 1092 405 287 11100 33537 1022 939 --
NM_153371chr1342394 2355 508 373 ------
NM_153464chr19------1676
NM_153487chr6164601 4454 4050 3799 3705 3632 3403 3196 3188 3168 3120 3028 1830 1789 1348 568 1172 11920 --
NM_153499chr1252834 2156 1209 1022 901 12175 --11044
NM_153500chr1252834 2156 1209 1022 901 12175 --11044
NM_153605chr321571 1302 1578 ----
NM_153616chr15--11742 ----
NM_153617chr15--11742 ----
NM_153618chr15--11742 ----
NM_153619chr1521240 1056 12980 ----
NM_153649chr141833 1628 1603 546 ------
NM_153748chr121154 ------
NM_153759chr211034 --11183 --
NM_153810chr1024760 960 11306 23998 1799 --
NM_153812chr132238 1499 821 11508 12374 --
NM_170662chr31498 ------
NM_170665chr1244599 3382 3223 2796 33390 3076 2854 ----
NM_170679chr5----11246 --
NM_170706chr163084 3008 2770 1737 1239 207 13398 ----
NM_170739chr111275 ------
NM_170750chrX1585 ----1333
NM_170782chr11397 ------
NM_171998chrX1211 31589 241 217 --1819
NM_172070chr2--1628 ----
NM_172169chr1041607 1506 1343 490 1421 ----
NM_172170chr1041607 1506 1343 490 1421 ----
NM_172171chr1041607 1506 1343 490 1421 ----
NM_172173chr1041607 1506 1343 490 1421 ----
NM_172216chr1252736 2058 1111 924 803 12077 --1946
NM_172225chr121309 413 --1396 --
NM_172226chr1252834 2156 1209 1022 901 12175 --11044
NM_172375chr141816 ----1175
NM_173065chr1103119 2951 2508 1418 822 695 373 207 201 44 ------
NM_173156chr121966 1589 ----11904
NM_173167chr1762497 1956 1868 1055 1031 89 12080 ----
NM_173191chr1021159 84 --159 --
NM_173192chr1021159 84 --159 --
NM_173193chr1021159 84 --159 --
NM_173194chr1021159 84 --159 --
NM_173195chr1021159 84 --159 --
NM_173198chr912195 ------
NM_173200chr912195 ------
NM_173201chr16------151
NM_173214chr1666881 5356 4983 2617 954 283 12231 16329 --
NM_173468chr456036 3675 2244 1556 773 ------
NM_173470chrX42378 2302 2290 2278 ----12107
NM_173471chr31281 --1825 --
NM_173475chr1641614 1236 577 451 ------
NM_173476chr16132231 2058 1837 1792 1643 1555 912 876 803 516 398 297 102 41887 1815 617 136 21925 832 1481
NM_173478chr17--2777 296 ----
NM_173491chr511001 ----1920
NM_173507chr1183 ----2192 22
NM_173536chr434124 3610 1386 --23175 174 --
NM_173562chr653085 2585 2184 847 761 22129 386 ----
NM_173564chr71164 1702 ----
NM_173582chr1135098 4441 590 26100 4098 16059 --
NM_173595chr1284713 4141 3831 3489 3449 1153 514 207 1385 25198 4496 1954
NM_173602chr1263356 3167 3120 2505 1284 1217 13307 --11012
NM_173653chr331408 1181 309 11312 21167 340 --
NM_173681chr73678 412 378 11698 1237 11868
NM_173808chr133269 544 537 24110 3262 ----
NM_173809chr1031284 1240 251 --11395 --
NM_173851chr833689 2679 1299 23561 1345 --11329
NM_173854chr142173 879 701 103 12109 31825 531 269 --
NM_174900chr43908 792 75 1434 ----
NM_174934chr1153331 3275 2676 1418 230 12248 22819 347 1130
NM_175056chr362164 2011 1461 716 452 251 1753 ----
NM_175077chr205946 477 230 105 44 11155 ----
NM_175623chr12106688 6655 6504 5782 5138 4821 2732 2487 1674 1422 17436 26835 210 --
NM_175624chr12106783 6750 6599 5877 5233 4916 2827 2582 1769 1517 17531 26930 305 --
NM_175625chr12106783 6750 6599 5877 5233 4916 2827 2582 1769 1517 17531 26930 305 --
NM_175629chr211034 --11183 --
NM_175630chr24777 657 638 570 ------
NM_175709chr2292837 2418 2349 2297 1972 1125 946 772 190 ----1916
NM_175733chr11--31867 1809 836 1431 --
NM_175736chr1265633 3017 1438 1303 885 531 16968 35389 568 412 --
NM_175847chr1951008 909 560 195 24 --11290 --
NM_175852chr1102562 2502 2362 2194 1995 1950 663 461 413 50 42892 2681 2215 522 12262 --
NM_175920chr51619 ------
NM_176792chr1041289 1246 147 104 1418 145 --
NM_176801chr441576 1422 1205 507 ----1275
NM_176871chr8103196 2991 2290 1237 1187 1145 710 321 155 59 31267 583 169 12658 12348
NM_176895chr5121 ------
NM_177441chr173799 713 684 ------
NM_177968chr2--1226 ----
NM_177999chr983440 3127 2563 2543 2367 1143 575 233 22424 700 21017 376 12536
NM_178011chr10----22629 965 --
NM_178026chr202495 70 ------
NM_178037chr1263538 2792 2345 586 234 187 ------
NM_178038chr1263538 2792 2345 586 234 187 ------
NM_178120chr22501 40 --2424 57 --
NM_178126chr173803 645 474 1409 22144 524 --
NM_178136chr2251668 1405 545 476 387 11422 21250 574 --
NM_178151chrX97234 5005 4948 3152 1878 1128 978 903 248 27783 7488 33050 2144 994 15673
NM_178152chrX97234 5005 4948 3152 1878 1128 978 903 248 27783 7488 33050 2144 994 15673
NM_178153chrX97234 5005 4948 3152 1878 1128 978 903 248 27783 7488 33050 2144 994 15673
NM_178167chr162441 117 278 70 161 --
NM_178426chr122166 1894 11650 --1788
NM_178427chr122066 1794 11550 --1688
NM_178505chr1023433 556 23233 1070 ----
NM_178548chr12104 37 1210 1577 --
NM_178554chr382953 2619 2563 2519 1273 931 888 359 22336 1223 2864 118 --
NM_178566chr92409 135 11783 ----
NM_178568chr1771688 1366 1194 1151 597 185 100 41513 1263 674 579 11354 --
NM_178578chr2022181 27 32458 1647 517 ----
NM_178582chr2031195 996 33 ------
NM_178585chr431274 673 191 ----13271
NM_178812chr811556 ----11144
NM_178818chr1661735 1679 936 740 278 96 --21761 1754 --
NM_180989chr1332332 608 505 12290 ----
NM_181050chr162570 30 166 ----
NM_181332chrX42602 2362 2182 1686 ------
NM_181336chr651313 458 434 305 76 ------
NM_181349chr742795 2495 2453 250 --12512 --
NM_181351chr1182813 2227 2171 2021 1066 365 359 337 ----1426
NM_181354chr811323 ------
NM_181509chr202438 49 ------
NM_181521chr16126516 6460 5717 5521 5059 4877 1998 1751 1656 992 666 234 31569 494 404 26542 6535 --
NM_181656chr171112 --188 1828
NM_181659chr2042243 612 554 451 1917 12407 186
NM_181659chr2042243 612 554 451 1917 12407 186
NM_181671chr17--1723 ----
NM_181672chrX1407 ----11930
NM_181673chrX1407 ----11930
NM_181703chr1130 ------
NM_181715chr1----1162 --
NM_181746chr11701 1187 ----
NM_181787chr862672 2550 2434 2368 1152 785 12807 ----
NM_181828chr22103699 3690 3447 3036 2871 2618 1378 1230 1096 550 33251 1259 629 ----
NM_181829chr22103699 3690 3447 3036 2871 2618 1378 1230 1096 550 33251 1259 629 ----
NM_181830chr22103699 3690 3447 3036 2871 2618 1378 1230 1096 550 33251 1259 629 ----
NM_181832chr22103714 3705 3462 3051 2886 2633 1393 1245 1111 565 33266 1274 644 ----
NM_181838chr521525 1116 11481 ----
NM_181876chr491077 944 748 644 637 458 362 287 178 ------
NM_182314chrX1527 ------
NM_182485chr42834 192 --13633 --
NM_182509chr1411290 ----11156
NM_182526chr1483153 2322 2180 1952 1902 1050 434 249 22675 1127 12052 --
NM_182557chr1162205 1885 1771 1613 854 554 11403 ----
NM_182565chr172628 188 --1675 1201
NM_182580chr161974 1816 1658 341 120 24 31894 959 712 1889 --
NM_182616chr153842 800 311 ------
NM_182641chr172732 90 ------
NM_182644chr31734 --1310 --
NM_182646chr42834 192 --13633 --
NM_182697chr71656 --11417 --
NM_182700chr751360 596 565 330 210 1502 --11672
NM_182760chr34894 329 282 276 ------
NM_182796chr52344 121 ----1619
NM_182830chr142683 241 138 --11834
NM_182898chr736168 4183 1548 14837 --11805
NM_182899chr736168 4183 1548 14837 --11805
NM_182925chr531478 1384 74 1451 2164 40 --
NM_182970chr2094218 4040 3866 3321 2615 1694 1437 628 68 13822 33066 1327 967 23408 438
NM_182972chr12639 438 --1940 11961
NM_183004chr1423468 173 11212 13355 --
NM_183243chr76606 520 458 253 245 207 ----1126
NM_183243chr76606 520 458 253 245 207 ----1126
NM_183360chr21131 132 ----
NM_183361chr21131 132 ----
NM_183393chr31272 ------
NM_183394chr31272 ------
NM_183397chr2094900 3928 3626 3453 3173 1707 1174 420 42 23966 1848 1496 --
NM_183419chr831349 973 83 ------
NM_183425chr2091673 1555 1180 624 555 489 361 268 220 --21337 614 --
NM_194247chr253467 3206 2994 1208 188 23328 3142 ----
NM_194259chr161469 ------
NM_194260chr161469 ------
NM_194261chr161469 ------
NM_194278chr14103048 2968 2821 2647 1458 830 653 473 262 132 --11017 --
NM_194282chr452701 2681 1235 1034 982 22615 575 --12156
NM_194285chr1121210 179 22707 1086 12956 --
NM_194286chr12135815 5648 5004 4293 2423 2413 2040 1756 1007 939 512 491 217 24903 1724 14867 --
NM_194301chr14----2933 70 --
NM_194313chr941656 235 80 60 --11676 --
NM_194328chr922541 1280 ----22802 725
NM_194329chr922541 1280 ----22802 725
NM_194330chr922541 1280 ----22802 725
NM_194332chr922541 1280 ----22802 725
NM_194434chr1821434 416 ----13845
NM_194463chrX----21011 417 --
NM_197939chr173220 124 109 11017 ----
NM_197941chr51859 33041 2278 1031 ----
NM_198053chr11629 ------
NM_198056chr341570 1555 1368 626 3825 231 144 ----
NM_198081chr632453 1940 626 --22854 2640 --
NM_198213chr122664 632 --2297 186 --
NM_198240chr122126 86 --2543 377 --
NM_198270chrX----11074 --
NM_198320chr1264855 4033 3722 1871 829 576 33584 3401 1286 160 --
NM_198390chr1611633 ----11937
NM_198391chr2021452 178 ----21525 607
NM_198392chr672304 2191 2138 2116 1697 143 111 11556 --1553
NM_198446chr1----1146 --
NM_198468chr61114 14319 ----
NM_198516chr111102 ------
NM_198546chr1------125
NM_198549chr132237 929 109 13191 ----
NM_198560chr393103 3018 2918 2442 994 817 738 438 347 --43370 672 521 138 --
NM_198581chr2167044 7024 7016 7008 6618 6503 6467 6142 5508 5228 5180 5071 5046 4931 4881 918 --27193 7134 17069
NM_198595chr463970 3814 3457 1021 275 155 23319 419 --24029 1865
NM_198597chr103954 938 31 --1796 --
NM_198679chr992461 2419 2197 2029 724 397 328 143 21 22241 2186 ----
NM_198700chr11----1460 --
NM_198793chr384083 3132 3011 1449 1028 349 326 303 13426 12931 13393
NM_198834chr1741750 1559 234 140 ----11906
NM_198836chr1741750 1559 234 140 ----11906
NM_198837chr1741750 1559 234 140 ----11906
NM_198838chr1741750 1559 234 140 ----11906
NM_198839chr1741750 1559 234 140 ----11906
NM_198850chr19171 ------
NM_198880chr3----1124 --
NM_198896chr11----12197 --
NM_198900chr1265633 3017 1438 1303 885 531 16968 35389 568 412 --
NM_198956chr751360 596 565 330 210 1502 --11672
NM_198993chr1721171 74 1277 11234 --
NM_199054chr1952044 1902 682 465 326 2559 119 ----
NM_199129chr2011182 2402 128 ----
NM_199160chr921675 79 ------
NM_199189chr511008 ------
NM_199245chr1262264 1825 1795 1001 892 518 ------
NM_199262chr1731993 114 60 1185 12239 12265
NM_199421chr1454968 3769 3604 1071 210 --13654 1310
NM_199461chr1022631 982 22203 705 22243 530 --
NM_199462chr123577 829 84255 3654 3518 1873 1840 696 514 144 --11628
NM_201378chr86936 912 816 717 632 259 ------
NM_201379chr86936 912 816 717 632 259 ------
NM_201380chr86936 912 816 717 632 259 ------
NM_201381chr86936 912 816 717 632 259 ------
NM_201382chr86936 912 816 717 632 259 ------
NM_201383chr86936 912 816 717 632 259 ------
NM_201384chr86936 912 816 717 632 259 ------
NM_201432chr17166614 5783 5321 4873 4699 4594 4495 4040 2288 2067 961 859 693 423 378 182 12414 15451 26073 1169
NM_201433chr17166614 5783 5321 4873 4699 4594 4495 4040 2288 2067 961 859 693 423 378 182 12414 15451 26073 1169
NM_201437chr8168 11253 ----
NM_201520chr17101694 1555 1377 1252 1204 645 601 278 249 176 11781 11683 --
NM_201568chr121966 1589 ----11904
NM_201569chr121966 1589 ----11904
NM_201570chr1041998 1862 711 297 ------
NM_201571chr1041998 1862 711 297 ------
NM_201572chr1041998 1862 711 297 ------
NM_201575chr161388 ------
NM_201590chr1041998 1862 711 297 ------
NM_201593chr1041998 1862 711 297 ------
NM_201596chr1041998 1862 711 297 ------
NM_201597chr1041998 1862 711 297 ------
NM_201599chrX31108 911 147 1386 ----
NM_201999chr4----2909 28 --
NM_203283chr42525 114 --1571 --
NM_203284chr42525 114 --1571 --
NM_203305chr962555 2148 1999 1867 417 262 2254 208 ----
NM_203316chr11394 53 38 ------
NM_203327chr2093848 3616 3391 2903 1697 1303 709 365 358 --13818 14174
NM_203344chr193510 397 131 --1450 --
NM_203346chr212070 21606 599 1175 --
NM_203350chr11344 ------
NM_203351chr17112488 2232 2183 1951 995 971 821 601 536 513 217 2651 90 ----
NM_203399chr11656 ------
NM_203401chr11656 ------
NM_203458chr132954 2352 1465 ----1865
NM_203467chr14----149 --
NM_203487chr13------11220
NM_203499chr175648 585 305 286 233 --1660 --
NM_203504chr432569 2148 295 ----11620
NM_203505chr432569 2148 295 ----11620
NM_205833chrX--1275 142 --
NM_205861chr182036 1362 753 714 633 343 136 45 ------
NM_206594chr133649 3393 891 ----1857
NM_206595chr133649 3393 891 ----1857
NM_206808chr13126 ------
NM_206884chr7145 --132 --
NM_206885chr7145 --132 --
NM_206907chr552878 2111 702 535 251 ------
NM_206914chr124651 72 66 29 1348 2829 42 --
NM_206921chr6141 ------
NM_207119chr1072219 2206 2004 1943 1582 1443 941 2391 252 11847 --
NM_207303chr1053210 3037 1661 1317 148 13493 --13732
NM_207371chr1031299 1163 1076 11324 1239 --
NM_207380chr15103566 3374 3237 2541 1457 1343 833 717 703 300 23111 2425 --12396
NM_207396chr171581 603 486 435 299 132 28 ------
NM_207429chr1131805 428 145 31635 856 171 ----
NM_207481chr211284 ------
NM_207577chr1132062 983 134 12051 ----
NM_212464chr1521571 833 --21878 361 11683
NM_212471chr17--11542 ----
NM_212472chr17--11542 ----
NM_212558chr924179 784 --23466 3157 --
NM_213589chr264101 3868 3553 1293 109 76 15214 ----
NM_213606chr1031909 361 30 --1764 --