TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3117-3p
miRNA Sequence: AUAGGACUCAUAUAGUGCCAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr531578 1534 177 1301 ----
NM_000052chrX32799 2526 1029 21222 684 12480 --
NM_000081chr12187 181 ------
NM_000084chrX75938 5805 4909 2203 2170 1891 1218 2897 355 25199 2605 --
NM_000092chr234266 1297 147 ------
NM_000108chr721320 1207 1699 11913 --
NM_000125chr633146 1095 158 --12954 --
NM_000129chr631070 456 49 ------
NM_000161chr1431972 1829 1784 11729 ----
NM_000163chr5--1261 ----
NM_000168chr733320 1292 88 --12029 --
NM_000192chr121342 ------
NM_000202chrX42610 2445 1221 183 1561 23114 1039 --
NM_000210chr212336 31915 664 565 ----
NM_000214chr2041691 1425 415 51 1321 21560 337 --
NM_000222chr442123 2003 427 291 --11664 --
NM_000232chr453100 2307 2099 1274 705 --23000 2184 --
NM_000240chrX32011 1733 312 ----11648
NM_000242chr10--12632 12205 --
NM_000248chr31525 ------
NM_000267chr1762965 2826 2637 2543 2468 726 --1418 --
NM_000297chr442008 1652 288 109 153 ----
NM_000314chr1012678 --12850 12497
NM_000328chrX194 ------
NM_000332chr666614 6472 6125 2697 1741 361 1122 26637 6578 --
NM_000340chr321317 1159 1256 ----
NM_000351chrX42916 1641 888 245 14127 34138 3248 1048 --
NM_000368chr994118 4111 3902 3563 1521 1072 630 608 131 24825 243 ----
NM_000379chr22335 24 ------
NM_000390chrX42701 2299 774 318 --11082 13219
NM_000393chr212127 2608 139 ----
NM_000408chr233033 2179 1124 ----1325
NM_000435chr194223 177 89 50 ------
NM_000441chr711963 ------
NM_000461chr364326 3160 986 894 201 129 33653 1074 565 23497 1623 --
NM_000462chr1531299 569 537 ------
NM_000489chrX72721 2433 1276 702 628 411 261 --1898 --
NM_000503chr821555 134 ------
NM_000527chr1912472 ------
NM_000533chrX41579 1497 409 143 ------
NM_000555chrX107484 7019 6971 6684 6586 5756 4817 1395 848 338 ------
NM_000587chr51978 ------
NM_000609chr1033150 2206 959 12633 --1943
NM_000610chr1152293 1122 933 795 602 ------
NM_000618chr1256399 4435 1492 244 201 12516 11173 --
NM_000618chr1256399 4435 1492 244 201 12516 11173 --
NM_000625chr17----1123 --
NM_000701chr1181 ------
NM_000719chr1256035 5751 5195 1990 1216 --56486 5868 4392 2638 828 --
NM_000724chr104490 223 76 43 ----1653
NM_000726chr211366 ------
NM_000793chr1454428 3362 3283 560 459 24086 1970 14980 --
NM_000806chr531878 1769 31 198 ----
NM_000809chr489157 8112 7409 6469 3294 2689 1246 1019 --13503 --
NM_000813chr555256 3405 1164 979 191 13783 --15286
NM_000817chr23792 404 160 ------
NM_000827chr522427 361 ------
NM_000845chr71124 ------
NM_000859chr5--144 1648 1488
NM_000865chr61204 ------
NM_000868chrX72571 2303 1937 1916 784 549 180 182 ----
NM_000875chr1555932 5452 2583 2177 1157 --11165 --
NM_000891chr1743683 3629 3420 3314 13403 11304 --
NM_000899chr1233785 1475 1388 14403 24243 3160 13323
NM_000912chr853326 3176 3144 2649 30 22891 2642 23228 703 --
NM_000917chr103910 873 217 --1656 170
NM_000919chr52571 78 ------
NM_000938chr41172 ------
NM_000945chr241383 1295 733 576 ------
NM_000949chr51775 ------
NM_000950chrX2914 902 2980 329 ----
NM_000983chr12463 34 1608 11162 --
NM_001001323chr1262603 2285 2145 1257 817 160 43185 1042 1019 566 1604 --
NM_001001389chr1152293 1122 933 795 602 ------
NM_001001390chr1152293 1122 933 795 602 ------
NM_001001391chr1152293 1122 933 795 602 ------
NM_001001392chr1152339 1168 979 841 648 ------
NM_001001396chr163870 3392 2763 1014 844 638 ----13412
NM_001001481chr841369 1331 298 71 --23358 38 13497
NM_001001549chr742138 1812 950 539 ------
NM_001001550chr742138 1812 950 539 ------
NM_001001555chr742138 1812 950 539 ------
NM_001001664chr253974 1418 1324 428 405 1930 1482 --
NM_001001668chr1943948 3808 3327 1028 --1724 14019
NM_001001928chr2278289 6413 3213 2315 1641 1387 37 27656 867 ----
NM_001001936chr1041090 890 478 375 ------
NM_001001974chr1021537 653 --1950 11512
NM_001002243chr23727 691 365 ----1183
NM_001002255chr61323 ------
NM_001002257chr242747 2580 1358 1215 153 ----
NM_001002258chr232022 1911 776 1497 ----
NM_001002838chrX31729 1303 511 --1482 --
NM_001002860chr1484437 4151 4003 3959 3449 1424 461 123 1645 24243 599 --
NM_001002909chr1721486 462 ------
NM_001003407chr10134799 3824 3792 3585 3574 3280 3238 1892 1848 1697 1244 946 932 ------
NM_001003408chr10134799 3824 3792 3585 3574 3280 3238 1892 1848 1697 1244 946 932 ------
NM_001003652chr18168570 8541 8382 8315 7876 7295 6762 6201 3163 3066 2620 2397 2148 1791 875 249 28152 2534 16213 --
NM_001003674chr1896949 6839 6516 4373 2506 2438 2173 1167 634 ------
NM_001003675chr1896949 6839 6516 4373 2506 2438 2173 1167 634 ------
NM_001003688chr42844 435 1328 ----
NM_001003698chr621234 581 1760 ----
NM_001003699chr621234 581 1760 ----
NM_001003712chr1253550 1316 1090 794 318 11305 ----
NM_001003760chr653517 3395 3031 2259 1197 23119 143 22653 2579 --
NM_001003790chr82303 181 --1591 --
NM_001003791chr82303 181 --1591 --
NM_001003792chr321131 957 1783 ----
NM_001003793chr321131 957 1783 ----
NM_001003805chr141106 ------
NM_001003810chr43324 278 176 ------
NM_001003940chr1553500 3224 1518 1510 1047 22347 744 ----
NM_001003942chr1553500 3224 1518 1510 1047 22347 744 ----
NM_001004317chr674474 3869 3361 1733 1653 1402 567 23923 3812 12919 13671
NM_001004342chr185885 5036 4675 1095 910 903 526 518 --15370 16082
NM_001004419chr1274312 4090 3632 1565 1274 507 401 ------
NM_001005366chr123965 835 792 ------
NM_001005375chrY31508 1201 1174 --1623 --
NM_001005386chr242401 1763 820 326 --12345 --
NM_001005404chr1761442 1309 1151 667 403 233 --12775 --
NM_001005527chr34921 887 372 284 ----1995
NM_001005746chr211366 ------
NM_001005747chr211366 ------
NM_001005781chr2------1164
NM_001005910chr33647 496 245 1226 ----
NM_001005911chr33647 496 245 1226 ----
NM_001006944chr111180 ------
NM_001007023chr1454428 3362 3283 560 459 24086 1970 14980 --
NM_001007024chr1783924 3896 3457 3265 2804 2672 1719 337 ------
NM_001007025chr1783924 3896 3457 3265 2804 2672 1719 337 ------
NM_001007214chr11277 ------
NM_001007237chr122563 180 ------
NM_001007466chr644570 3257 3221 1126 14596 11597 --
NM_001007527chr52675 55 1502 ----
NM_001007559chr1821722 1643 ------
NM_001008272chr31329 ------
NM_001008273chr31329 ------
NM_001008388chr41929 160 ----
NM_001008392chr332734 482 471 ------
NM_001008397chr51692 ------
NM_001008495chr822011 435 1727 22231 1445 187
NM_001008540chr21484 ------
NM_001008567chr92368 108 ------
NM_001008738chr522819 2220 22685 2510 12934 --
NM_001008744chr1431377 1354 565 --196 --
NM_001008895chr132907 208 ------
NM_001009185chr51525 ------
NM_001009554chr444566 1868 1712 506 --11153 14425
NM_001009554chr444566 1868 1712 506 --11153 14425
NM_001009880chr2274773 4475 3957 3585 3385 1636 841 23821 525 ----
NM_001009894chr1231556 1215 574 ----11569
NM_001009899chr386372 6348 6251 5861 4585 2404 1235 1165 ------
NM_001009993chr253657 2829 1494 816 585 33835 3148 193 2861 436 --
NM_001010861chr122021 547 --22066 1895 --
NM_001010862chrX52825 2535 2396 2144 60 --22673 1307 1495
NM_001010867chr176618 6592 6271 5098 2319 2007 709 24950 1436 14300 --
NM_001010888chrX94177 4149 4007 3012 1296 1245 1064 263 155 --14310 14442
NM_001010891chr566721 6430 5106 1470 1410 697 21234 1180 ----
NM_001010895chr941556 1523 1445 542 --1667 --
NM_001010908chr101663 --1262 --
NM_001010971chr12866 356 ------
NM_001010984chr161888 1828 1752 1676 907 86 1380 ----
NM_001011537chr322171 841 --2955 626 --
NM_001011666chr766282 6166 6010 5126 1536 107 15069 ----
NM_001011713chr1441212 536 372 210 ------
NM_001012393chr1155012 4845 1507 441 206 --23710 3158 --
NM_001012398chr161203 1145 ----
NM_001012410chr31361 ------
NM_001012512chr181206 --170 --
NM_001012513chr181217 --181 --
NM_001012751chr1011650 2552 78 ----
NM_001012754chr13----11970 --
NM_001012755chrX73376 3361 3313 3236 1132 517 57 ------
NM_001012968chrX32711 507 423 ------
NM_001013438chr34913 743 248 182 ----1140
NM_001013439chr34759 589 94 28 ------
NM_001013615chr141187 1009 848 241 ------
NM_001013659chr1931581 1388 510 11065 11981 --
NM_001013703chr151428 1385 ----
NM_001013843chr153861 173 101 ------
NM_001014797chr1077152 5474 5055 1852 1496 949 782 15639 21908 763 --
NM_001015877chrX42877 2325 899 704 12940 ----
NM_001015882chr91865 --1702 --
NM_001015885chr201346 ------
NM_001017371chr221020 71 ------
NM_001017395chr373252 2994 2504 1351 1287 994 264 --1651 --
NM_001017415chr11293 ------
NM_001017416chr11293 ------
NM_001017423chr103733 159 57 ------
NM_001017424chr13576 563 351 --11205 --
NM_001017425chr13576 563 351 --11205 --
NM_001017523chr122531 43 ------
NM_001017926chr82509 192 ------
NM_001017930chrX41425 1017 384 316 11468 ----
NM_001017962chr103910 873 217 --1656 170
NM_001017963chr142684 595 ------
NM_001018009chr32905 198 11200 ----
NM_001018038chr92452 172 ----153
NM_001018065chr985441 5408 5052 3719 2208 2149 1108 652 15279 185 12031
NM_001018066chr985441 5408 5052 3719 2208 2149 1108 652 15279 185 12031
NM_001018067chr145350 4955 4509 1448 11033 25209 4256 --
NM_001018068chr145350 4955 4509 1448 11033 25209 4256 --
NM_001018069chr145350 4955 4509 1448 11033 25209 4256 --
NM_001018072chr122531 43 ------
NM_001018091chr1542604 2165 96 51 ------
NM_001018108chr1531501 1428 884 11999 ----
NM_001024071chr143994 851 806 1751 ----
NM_001024372chr83816 783 241 31841 1740 1726 ----
NM_001024460chr611122 ------
NM_001024649chr542809 2456 319 60 ------
NM_001024660chr321215 106 11110 1391 --
NM_001025072chr332207 613 423 2930 57 ----
NM_001025073chr332207 613 423 2930 57 ----
NM_001025076chr1086182 6053 4910 4420 4304 2209 2065 1817 ----1826
NM_001025077chr1077540 7411 6268 5778 5662 994 947 15026 --12184
NM_001025079chr363459 3355 1390 657 599 311 13151 22630 1118 --
NM_001025580chrX43970 3485 2821 1385 --1643 --
NM_001029858chr621062 939 --12337 --
NM_001029863chr6--12241 195 --
NM_001029875chr531012 550 414 1818 12643 --
NM_001029884chr612596 --12240 --
NM_001029955chr432287 640 207 --12592 --
NM_001030007chr1621504 1253 13251 13922 13385
NM_001030055chr1484680 4428 4244 4125 4007 3976 3756 1725 24777 4644 11495 --
NM_001031679chr1272984 2824 2492 2310 1375 1242 552 ------
NM_001031695chr2295139 4377 4209 3590 3563 1551 1256 1123 486 14025 12152 --
NM_001031732chr453281 1176 1150 1075 550 23676 3650 ----
NM_001031804chr1653438 1718 912 645 383 12884 179 13581
NM_001031812chr532176 307 153 11786 ----
NM_001031855chrX157 1195 ----
NM_001032288chr202997 57 ----21527 535
NM_001032363chr131590 1420 1395 2466 206 1627 --
NM_001032363chr131590 1420 1395 2466 206 1627 --
NM_001033025chr141161 594 275 186 11404 ----
NM_001033081chr141728 1370 30 24 ------
NM_001033082chr141728 1370 30 24 ------
NM_001033087chr2042860 2728 2663 1010 ----12650
NM_001033112chr51131 ----1567
NM_001033117chr384829 4427 4050 3652 3128 1275 1258 1093 --11843 --
NM_001033506chr111325 ------
NM_001033507chr111213 --1215 --
NM_001033566chr172854 68 --1294 --
NM_001033568chr172854 68 --1294 --
NM_001034025chr1221034 52 ------
NM_001034915chr81352 ------
NM_001035chr121194 309 ------
NM_001035260chr1041475 1322 555 210 ------
NM_001037163chr73959 298 47 ------
NM_001037164chr72716 474 --1687 --
NM_001037317chr122021 547 --22066 1895 --
NM_001037334chr1832251 1874 783 ----1686
NM_001037339chr121359 538 ------
NM_001037340chr121359 538 ------
NM_001037341chr121359 538 ------
NM_001037341chr121359 538 ------
NM_001037535chrX31517 1083 1075 ------
NM_001037536chrX31517 1083 1075 ------
NM_001037540chrX31517 1083 1075 ------
NM_001037738chr51108 ------
NM_001038702chr532704 1903 157 11079 ----
NM_001038707chr122205 291 --11576 --
NM_001038707chr122205 291 --11576 --
NM_001039350chr7----1562 --
NM_001039372chr7----1624 --
NM_001039547chr386706 5847 5209 5127 2717 1828 356 289 34887 1195 601 --15621
NM_001039573chr172485 34 1389 ----
NM_001039590chrX73694 2939 2876 2849 1480 1155 139 ------
NM_001039591chrX73694 2939 2876 2849 1480 1155 139 ------
NM_001039618chr1144973 3769 3749 1131 35127 4862 2158 --15638
NM_001039693chr253656 3314 1469 1366 501 13695 13748 --
NM_001039762chr1022375 1946 ----11590
NM_001039802chr12909 474 ------
NM_001039937chr1343127 3121 1566 297 --12668 --
NM_001039960chr122379 53 --11516 --
NM_001040057chr711145 11000 ----
NM_001040142chr231921 1898 948 ------
NM_001040143chr231921 1898 948 ------
NM_001040152chr744523 4211 769 353 --11449 --
NM_001040158chr51483 ------
NM_001040159chr41533 1407 ----
NM_001040284chr1655390 5321 5173 942 727 14141 25333 671 --
NM_001040429chr1331372 943 702 --12513 2838 490
NM_001040450chr1521000 745 1342 11783 --
NM_001040453chr1521000 745 1342 11783 --
NM_001040712chr953568 3207 985 493 89 ------
NM_001040876chr421238 495 31839 1617 156 11650 --
NM_001042388chr182844 808 ------
NM_001042403chr122877 401 1256 ----
NM_001042406chr61999 --11142 --
NM_001042413chr984068 3730 2966 2708 2693 2569 1583 1207 12881 21358 834 11408
NM_001042473chr1012058 --22023 613 --
NM_001042481chr1431830 792 67 --12271 --
NM_001042492chr1762965 2826 2637 2543 2468 726 --1418 --
NM_001042494chr1553784 2488 2388 1330 234 --23290 1060 --
NM_001042495chr1553784 2488 2388 1330 234 --23290 1060 --
NM_001042496chr1553784 2488 2388 1330 234 --23290 1060 --
NM_001042497chr1553784 2488 2388 1330 234 --23290 1060 --
NM_001042510chr842178 1614 1497 841 2724 351 ----
NM_001042511chr842178 1614 1497 841 2724 351 ----
NM_001042555chr1274755 4570 4449 3575 3087 1380 876 13777 13604 --
NM_001042599chr287697 5555 5038 3094 2336 1487 962 555 --15993 --
NM_001042601chr32696 561 23288 902 12915 --
NM_001042604chr344311 4133 3450 3357 --11340 12954
NM_001042762chr73245 108 41 ------
NM_001044722chr532176 307 153 11786 ----
NM_001044723chr532176 307 153 11786 ----
NM_001046chr5--1836 --22636 1081
NM_001048183chr143769 3194 568 270 1982 1168 --
NM_001079874chr141888 1618 1397 463 2656 509 11725 22030 149
NM_001099678chr375698 2310 2126 2111 1846 641 302 --14011 --
NM_001100108chr187028 5375 5237 2536 2437 2194 597 141 11073 ----
NM_001106chr3119676 7397 3797 3672 3659 2938 2197 2060 1701 1054 392 1590 58979 8011 5928 3832 1126 16901
NM_001113490chrX52875 2755 2475 2421 1464 11067 ----
NM_001117chr1822394 92 11008 11985 12154
NM_001123chr10----1629 --
NM_001128chr1621504 1253 13251 13922 13385
NM_001146chr842317 1824 1572 865 ------
NM_001153chr2--2721 364 ----
NM_001159chr22613 59 --1705 --
NM_001160chr122600 548 22517 2387 ----
NM_001167chrX75941 5694 4723 2233 1879 1435 1108 --15339 --
NM_001173chr1484680 4428 4244 4125 4007 3976 3756 1725 24777 4644 11495 --
NM_001186chr2122750 534 --31221 1204 463 --
NM_001204chr287735 6506 5298 2669 2111 2028 1925 1115 --25379 630 11659
NM_001237chr41187 11022 ----
NM_001237chr41187 11022 ----
NM_001241chr21274 21847 1488 1963 --
NM_001241chr21274 21847 1488 1963 --
NM_001254chr1731009 178 59 --11091 --
NM_001256chr1752944 2779 1995 1896 78 ------
NM_001257chr1611306 11173 ----
NM_001259chr795387 4975 4445 2195 1628 1309 1022 732 575 24998 2001 ----
NM_001271chr1573174 2877 2270 2184 1002 816 232 ------
NM_001278chr101297 11166 1476 --
NM_001284chr5------197
NM_001349chr22517 388 ------
NM_001351chr341482 1170 1143 524 ----11763
NM_001356chrX3658 611 348 12097 ----
NM_001363chrX5810 548 181 113 94 1309 1322 --
NM_001380chr103803 284 148 ----1930
NM_001386chr832011 655 470 1613 --12307
NM_001387chr543032 2120 1172 587 --11280 --
NM_001402chr621982 557 --1803 --
NM_001412chrX33571 3413 46 ------
NM_001418chr112547 261 1175 ----
NM_001418chr112547 261 1175 ----
NM_001423chr1231970 1805 389 ------
NM_001424chr161731 ------
NM_001431chr61245 ----174
NM_001438chr122998 850 --13340 --
NM_001439chr141161 594 275 186 11404 ----
NM_001448chrX21518 1153 ------
NM_001497chr922373 588 --11840 1752
NM_001518chr74842 792 413 159 --1938 --
NM_001542chr122563 180 ------
NM_001543chr543379 1679 1128 677 13296 21085 502 --
NM_001584chr111103 1892 1307 --
NM_001609chr1033668 293 141 ----23511 1799
NM_001616chr212365 ------
NM_001635chr71873 11006 ----
NM_001650chr1831329 475 308 --22792 1007 --
NM_001659chr1242431 1969 654 357 1203 170 12251
NM_001663chr1471958 1756 723 699 331 319 129 12267 --1563
NM_001677chr1175 21076 736 ----
NM_001682chr1252317 1999 1859 971 531 42899 756 733 280 1318 --
NM_001689chr232022 1911 776 1497 ----
NM_001690chr352395 1032 299 187 161 12423 ----
NM_001699chr192328 304 61604 1544 1191 726 387 337 11512 21528 1408
NM_001701chr951414 1304 1064 1012 563 ------
NM_001709chr1142595 2197 2179 146 --12844 --
NM_001717chr1541476 982 576 385 11075 11152 --
NM_001722chr8--1259 ----
NM_001729chr41320 ------
NM_001730chr13--11257 ----
NM_001730chr13--11257 ----
NM_001731chr121771 --1256 --
NM_001742chr721746 1595 1716 ----
NM_001746chr542809 2456 319 60 ------
NM_001755chr1611606 12072 ----
NM_001759chr1265216 4829 1850 1122 840 163 ----11825
NM_001768chr23279 86 63 ------
NM_001777chr363459 3355 1390 657 599 311 13151 22630 1118 --
NM_001781chr123692 641 88 --1832 --
NM_001791chr12909 474 ------
NM_001801chr51213 --2488 255 --
NM_001829chr43903 615 338 ------
NM_001830chrX73756 3504 3492 2521 1354 989 570 ----12924
NM_001854chr121541 1029 --1399 --
NM_001882chr51406 ------
NM_001895chr2011058 ------
NM_001918chr177478 6705 3364 3101 3021 830 150 26726 2733 --17872
NM_001930chr192117 26 ------
NM_001936chr7----1562 --
NM_001938chr12464 265 11240 ----
NM_001942chr1841962 1478 746 239 ------
NM_001946chr122756 749 ------
NM_001949chr641977 804 789 677 --11042 12294
NM_001967chr3--1588 ----
NM_001969chr1473673 3309 2711 1115 620 440 421 22725 2500 12966 --
NM_001977chr42495 332 ------
NM_001981chr132041 890 881 ----1843
NM_001996chr22----176 --
NM_001999chr51127 1966 ----
NM_002006chr453595 1720 1705 617 522 14639 1502 12292
NM_002010chr13----1482 --
NM_002015chr1353374 2934 2726 1258 1175 1730 11198 --
NM_002024chrX41499 1373 439 410 ------
NM_002025chrX78867 8762 7608 6222 6074 3053 373 39014 7085 6134 12308 --
NM_002031chr61609 ------
NM_002039chr42577 349 ----1895
NM_002076chr1253292 2703 1132 293 83 --1127 --
NM_002089chr41143 1566 ----
NM_002091chr181206 --170 --
NM_002092chr424990 4553 13486 33430 1423 1201 1703
NM_002114chr61436 ------
NM_002126chr1753981 2701 1616 1445 531 ------
NM_002128chr1342576 2486 519 185 22116 813 ----
NM_002129chr4--1400 ----
NM_002135chr121205 ------
NM_002137chr752280 1991 1952 1809 1681 ----2917 829
NM_002138chr43324 278 176 ------
NM_002146chr1721042 178 ----21340 1298
NM_002147chr172302 146 1373 ----
NM_002158chr212379 33144 486 283 22478 1375 2607 208
NM_002203chr563899 2878 2850 1642 1617 849 13474 ----
NM_002214chr774630 3684 3638 1844 1747 1266 203 25499 1672 11972 --
NM_002222chr321215 70 1409 ----
NM_002245chr12598 136 ------
NM_002264chr364228 982 782 482 75 55 1972 ----
NM_002266chr17154 ------
NM_002270chr574250 4113 3481 1996 1749 48 40 ------
NM_002271chr131416 22371 1887 ----
NM_002294chrX1145 1357 ----
NM_002296chr121486 1250 11139 --1283
NM_002313chr10134799 3824 3792 3585 3574 3280 3238 1892 1848 1697 1244 946 932 ------
NM_002334chr1141796 1741 806 58 11968 11402 11680
NM_002336chr1211420 14849 14267 13870
NM_002351chrX21729 438 --2120 58 --
NM_002354chr21357 ------
NM_002356chr621752 568 --1644 --
NM_002387chr574951 4609 4042 3298 3128 1415 24 --11277 14795
NM_002398chr21266 1972 11439 --
NM_002408chr14128 ------
NM_002416chr421821 43 --1837 1392
NM_002430chr2282559 2155 1804 1761 1592 928 720 517 12093 ----
NM_002444chrX62006 1825 1783 1680 1467 328 1403 ----
NM_002473chr2211028 ------
NM_002480chr121526 ------
NM_002486chr932332 2282 57 1610 --1914
NM_002499chr1582287 2277 1534 841 506 445 394 45 --11705 --
NM_002500chr21921 ------
NM_002515chr1431839 687 425 --2434 343 11395
NM_002520chr5141 ------
NM_002543chr122307 34 ------
NM_002544chr17------1119
NM_002545chr1155012 4845 1507 441 206 --23710 3158 --
NM_002547chrX104218 3627 3575 3216 3182 962 832 414 173 60 --1844 --
NM_002577chr343771 3710 2880 404 ------
NM_002581chr944620 564 387 308 --25671 4591 --
NM_002594chr2022104 222 ------
NM_002600chr121359 538 ------
NM_002628chr32383 266 ------
NM_002641chrX----21506 45 --
NM_002655chr834039 3287 833 24895 213 11191 --
NM_002657chr2043194 1526 1438 1080 13151 22946 743 11232
NM_002687chr14--1840 ----
NM_002690chr8------144
NM_002715chr521242 1002 --11300 --
NM_002716chr1173715 3530 2576 2488 2277 893 797 13020 1968 --
NM_002719chr1472435 2255 1805 925 519 467 39 ------
NM_002731chr152571 1992 916 648 520 12791 --1817
NM_002734chr1722101 1399 12274 1212 --
NM_002740chr352828 2522 2206 2068 464 ------
NM_002745chr2294587 3997 3560 3480 3206 2846 2758 80 66 12836 ----
NM_002748chr151126 ----1965
NM_002750chr101218 ------
NM_002753chr41776 ------
NM_002788chr141106 ------
NM_002790chr11140 ----145
NM_002814chrX3286 212 54 --1122 --
NM_002822chr121539 --1298 11646
NM_002837chr1243072 3011 1563 283 34468 2860 489 --11703
NM_002839chr953568 3207 985 493 89 ------
NM_002841chr3--1155 ----
NM_002843chr1143172 2776 2197 984 --13212 --
NM_002851chr73621 577 80 ------
NM_002860chr103733 159 57 ------
NM_002868chr1242086 2070 1657 803 ------
NM_002869chr1112165 11981 1487 2843 676
NM_002892chr141604 --11125 --
NM_002897chr21583 --1170 --
NM_002902chr152502 238 ----1105
NM_002906chr112529 328 21554 1538 ----
NM_002911chr1921677 371 ------
NM_002940chr421238 495 31839 1617 156 11650 --
NM_002941chr311029 ------
NM_002955chr621234 581 1760 ----
NM_002959chr194144 3949 2983 2823 1758 1582 1226 952 254 11403 1519 --
NM_002968chr161968 ----1171
NM_002971chr31314 1810 ----
NM_002994chr431952 1360 40 11435 21366 633 --
NM_002998chr81372 ------
NM_003011chr9172 ------
NM_003020chr15--1465 ----
NM_003034chr1237329 1379 420 26822 1641 47116 4938 1723 1341 --
NM_003045chr1374768 3718 3591 1885 1164 915 781 1820 ----
NM_003051chr12624 297 ------
NM_003054chr10182 ------
NM_003068chr82915 701 ------
NM_003071chr341970 1848 1374 424 --1738 --
NM_003079chr171941 126 ----
NM_003106chr31405 --1364 --
NM_003107chr6--12503 12252 --
NM_003108chr276601 6343 4476 1975 1636 1100 941 ------
NM_003111chr221020 71 ------
NM_003112chr743016 2730 2100 1281 1800 --12435
NM_003130chr721282 1131 ------
NM_003137chr62731 720 1430 ----
NM_003144chr651394 751 396 292 257 ------
NM_003155chr822391 522 2702 415 ----
NM_003161chr1742581 2201 857 335 12895 ----
NM_003199chr182929 793 25402 555 --11447
NM_003217chr12------22005 1279
NM_003247chr631326 646 74 ----11590
NM_003253chr2121846 586 --1217 --
NM_003262chr384329 3996 3729 3568 1331 1194 1173 149 ----11805
NM_003270chrX--1245 1934 --
NM_003274chr2182382 1899 1197 910 817 388 158 103 --2953 871 12147
NM_003275chr93425 119 43 ------
NM_003286chr203292 179 23 ----1111
NM_003298chr386105 5717 4652 2445 2274 1401 749 376 13864 ----
NM_003304chr311272 ------
NM_003305chr42445 339 ------
NM_003309chr661923 1897 1879 1631 628 146 --11456 --
NM_003317chr141783 ------
NM_003319chr21929 ----1791
NM_003337chr52549 125 ------
NM_003338chr101550 11751 --11326
NM_003339chr541402 1311 482 63 --1242 --
NM_003341chr32640 216 --1130 --
NM_003342chr1763211 3176 2806 1277 1097 973 ------
NM_003348chr1231290 1207 127 1170 186 --
NM_003349chr202997 57 ----21527 535
NM_003350chr811010 127 1939 1711
NM_003368chr11293 ------
NM_003369chr1111787 1605 --12674
NM_003381chr61643 --191 1222
NM_003384chr142343 93 ------
NM_003392chr363929 3544 3286 1665 1587 1415 ------
NM_003409chr1831067 507 182 ------
NM_003411chrY168 1167 --11742
NM_003412chr32722 561 --12343 11075
NM_003413chrX52007 1711 1524 1226 312 --1434 1417
NM_003454chr1631514 510 64 ------
NM_003455chr1111442 21587 490 ----
NM_003463chr632398 2050 1187 12429 1580 --
NM_003467chr21484 ------
NM_003470chr1631532 392 93 --11847 --
NM_003472chr6--11246 ----
NM_003478chr1133069 2773 2736 12104 ----
NM_003488chr173295 110 26 --1134 --
NM_003489chr21--43135 3028 2813 1344 ----
NM_003496chr73832 790 300 ------
NM_003507chr241506 1322 642 141 ------
NM_003557chr151532 1490 1290 1134 435 ------
NM_003566chr1273212 3117 2711 2457 2303 1069 881 22998 566 ----
NM_003574chr1895329 4993 2074 1933 1862 1232 926 322 248 15112 21735 1003 1744
NM_003583chr1243946 3804 3630 441 22927 225 13833 --
NM_003589chr132907 208 ------
NM_003603chr41656 ------
NM_003607chr154228 3881 3201 2890 143 ----1375
NM_003610chr201346 ------
NM_003615chr332887 2779 870 1839 13162 --
NM_003618chr22892 328 ------
NM_003620chr17--1756 ----
NM_003622chr1242265 831 483 38 ------
NM_003630chr61128 ------
NM_003644chr17126591 5201 4857 4718 4428 3985 2295 2023 1027 818 292 28 15683 24992 1000 --
NM_003663chr323043 2825 --11199 --
NM_003705chr21251 --1206 --
NM_003713chr151585 1120 432 250 54 --1218 1562
NM_003718chr71475 1190 ----
NM_003722chr342370 2102 1989 566 ----11041
NM_003749chr1321592 547 11562 1455 --
NM_003750chr10--134 ----
NM_003758chr1531081 1006 82 1458 ----
NM_003758chr1531081 1006 82 1458 ----
NM_003759chr444056 1244 1131 40 --33930 2926 948 --
NM_003769chr122256 93 ------
NM_003783chr11277 1480 ----
NM_003787chr182101 89 1560 11059 --
NM_003795chr6------166
NM_003799chr1864408 3349 1410 1301 335 41 21529 241 --14391
NM_003819chr1180 --1286 --
NM_003822chr163130 2349 1140 913 894 617 --12009 1995
NM_003850chr132595 232 ------
NM_003872chr222364 2000 12330 42444 2269 605 286 --
NM_003887chr22747 358 ------
NM_003895chr2132008 301 275 21673 1650 ----
NM_003899chr1352552 668 595 289 37 ------
NM_003913chr663089 2842 1277 1209 900 184 ----12965
NM_003916chrX21426 1214 --1985 --
NM_003927chr181225 --2753 207 --
NM_003932chr2221798 696 11642 ----
NM_003934chr911332 --1382 --
NM_003942chr111180 ------
NM_003948chr422517 1691 --12594 --
NM_003972chr10----1485 --
NM_003980chr631014 422 109 1345 ----
NM_003983chr1633752 3195 897 --22969 695 1531
NM_003992chr151305 ------
NM_003993chr11315 ------
NM_003994chr1233785 1475 1388 14403 24243 3160 13323
NM_003996chr6125 ------
NM_004028chr1831329 475 308 --22792 1007 --
NM_004080chr711373 ------
NM_004081chrY31508 1201 1174 --1623 --
NM_004087chr361516 1345 1325 685 457 77 ------
NM_004094chr1432385 888 501 1136 --1260
NM_004100chr632257 1668 201 1100 1465 --
NM_004114chrX41189 925 905 73 ------
NM_004119chr131666 ----1486
NM_004124chr1473551 3454 3436 2365 2277 1162 758 --1649 12607
NM_004162chr3131 ------
NM_004170chr941741 1402 748 542 11313 1225 --
NM_004229chrX41650 1538 787 344 ------
NM_004232chr1831401 300 205 ----23340 1285
NM_004261chr12102 22 ------
NM_004270chr5------175
NM_004274chr1462952 2901 2607 2458 542 355 ------
NM_004277chr621171 166 11335 ----
NM_004279chr751882 889 709 698 171 --11873 --
NM_004290chr51519 ----21362 1004
NM_004330chr151400 --11100 --
NM_004338chr1896949 6839 6516 4373 2506 2438 2173 1167 634 ------
NM_004354chr4--1602 ----
NM_004384chr532176 307 153 11786 ----
NM_004392chr1352375 1908 1829 239 89 --11881 --
NM_004397chr1133560 3512 1529 ------
NM_004412chr1064631 4450 4360 2380 1537 950 --25051 4492 --
NM_004426chr1251678 719 460 232 204 21778 335 ----
NM_004429chrX21396 1093 ------
NM_004437chr122437 1404 --1444 --
NM_004438chr232413 1219 946 1732 42926 2084 705 508 --
NM_004449chr2111321 1306 1176 1277
NM_004450chr142379 276 ------
NM_004482chr21655 ------
NM_004483chr16--158 ----
NM_004500chr1431558 646 333 --1216 1559
NM_004504chr222840 114 --12326 --
NM_004521chr101302 1292 ----
NM_004525chr221444 1143 --11175 11534
NM_004537chr1221409 169 1187 ----
NM_004540chr212895 716 ------
NM_004559chr1--1395 ----
NM_004575chr431488 1481 1196 ------
NM_004576chr5------1166
NM_004583chr17------1214
NM_004586chrX44681 4015 867 54 21920 1152 23883 1008 1609
NM_004598chr542731 2578 815 431 ----13310
NM_004612chr974447 1788 1610 470 374 188 77 1293 --14294
NM_004637chr351326 1229 1101 1081 30 ------
NM_004654chrY147 1222 ----
NM_004655chr1721301 1266 ------
NM_004709chrX21436 177 1519 1637 11497
NM_004719chr121720 1149 --12212
NM_004726chrX75632 5383 4893 4468 1056 732 292 ------
NM_004730chr5--11589 ----
NM_004731chr121281 ------
NM_004734chr132723 326 11201 1132 --
NM_004741chr102285 158 21422 127 --11561
NM_004742chr33477 61 32 ------
NM_004744chr433837 3324 1217 ------
NM_004745chr886738 6219 4951 2614 2409 1414 1119 638 15565 1757 --
NM_004774chr1732460 1025 212 22577 640 ----
NM_004775chr1811490 ------
NM_004779chr52488 213 ------
NM_004788chr1131848 649 471 ------
NM_004796chr1412174 ------
NM_004798chr2033202 3129 561 ------
NM_004801chr2140 ------
NM_004834chr243221 2740 677 39 22419 740 ----
NM_004836chr22767 386 ------
NM_004841chr12739 225 ------
NM_004844chr32905 198 11200 ----
NM_004850chr211444 ------
NM_004857chr1444641 4134 3170 1273 14301 13733 1609
NM_004863chr1443938 3362 1134 615 11155 ----
NM_004865chr61359 ------
NM_004866chr543950 1343 343 159 --24671 1766 --
NM_004871chr1783924 3896 3457 3265 2804 2672 1719 337 ------
NM_004883chr51169 ------
NM_004893chr51483 ------
NM_004896chr1041390 1237 470 125 ------
NM_004897chr102858 851 ------
NM_004902chr20--1594 ----
NM_004904chr766282 6166 6010 5126 1536 107 15069 ----
NM_004939chr2----1145 150
NM_004961chrX3549 421 195 --1971 --
NM_004969chr10148 ------
NM_004982chr122647 26 ------
NM_004985chr1273960 1735 1529 1337 1160 908 494 13600 ----
NM_004992chrX107086 6252 5208 5192 2839 2606 2301 2009 1826 992 --22477 2134 --
NM_004992chrX107086 6252 5208 5192 2839 2606 2301 2009 1826 992 --22477 2134 --
NM_004999chr631684 1393 548 --1575 --
NM_005012chr11144 ------
NM_005023chr531423 1286 514 --1105 --
NM_005028chr1031751 1504 194 12303 11952 --
NM_005036chr2278289 6413 3213 2315 1641 1387 37 27656 867 ----
NM_005076chr164212 3394 2971 2750 1366 1034 --1382 --
NM_005087chr34759 589 94 28 ------
NM_005116chr2033060 1319 265 13230 --11449
NM_005121chr172795 477 1572 ----
NM_005124chr61762 ------
NM_005134chr182844 808 ------
NM_005135chr1553784 2488 2388 1330 234 --23290 1060 --
NM_005151chr1832251 1874 783 ----1686
NM_005156chr923953 1423 ----24087 890
NM_005160chr22126602 6351 5681 4646 4374 2102 1855 943 766 479 206 23 36306 5292 1986 36399 5557 4609 11233
NM_005168chr211472 1612 11465 11153
NM_005187chr1612048 --11942 --
NM_005188chr11137926 7526 7284 6993 6761 5657 5516 5470 2649 1553 999 582 108 36053 1789 1399 25956 2322 16572
NM_005197chr1475078 4567 4191 3855 1862 1332 615 ------
NM_005206chr1711029 ----2953 294
NM_005207chr2242598 1492 219 46 2886 467 ----
NM_005233chr3--1616 ----
NM_005235chr287697 5555 5038 3094 2336 1487 962 555 --15993 --
NM_005238chr1142345 1190 1175 932 21112 620 21048 1000 11126
NM_005244chr20------1461
NM_005245chr42768 591 --1268 --
NM_005249chr14--1819 ----
NM_005259chr21307 11127 ----
NM_005277chr421508 259 11730 ----
NM_005311chr742138 1812 950 539 ------
NM_005324chr173694 590 318 ----21431 437
NM_005339chr433712 3569 752 --11303 --
NM_005347chr921647 267 ------
NM_005348chr142684 595 ------
NM_005349chr4----1627 --
NM_005358chr1331841 670 159 ------
NM_005359chr1856211 2105 1679 395 311 --26062 1422 --
NM_005375chr63978 931 161 --1211 --
NM_005380chr111298 --1821 --
NM_005382chr81168 ------
NM_005385chr362520 2049 1898 1081 443 82 11950 ----
NM_005388chr941656 1610 1470 689 ----1523
NM_005399chr144240 3468 3390 915 11023 171 14083
NM_005400chr253108 2506 1960 458 324 --1898 --
NM_005402chr731801 683 276 21709 240 11691 11434
NM_005409chr41195 --125 1759
NM_005410chr51260 1640 ----
NM_005415chr22483 104 ------
NM_005433chr1822664 687 12519 ----
NM_005436chr1094102 4076 4006 3690 3553 3261 2623 1561 770 ------
NM_005437chr1031232 472 113 --1596 --
NM_005455chr11178 11527 ----
NM_005458chr922193 205 ------
NM_005465chr151905 763 715 250 129 --21711 75 --
NM_005493chr6--1759 ----
NM_005497chr17126043 5760 5463 5120 4799 1515 1272 1259 1163 769 566 401 11336 14693 --
NM_005506chr452783 2672 1084 1053 583 143 11847 --
NM_005522chr721098 943 1530 1993 --
NM_005537chr13--1896 ----
NM_005542chr741705 691 573 192 ------
NM_005544chr22912 204 ------
NM_005570chr1831126 471 425 ------
NM_005596chr965516 5426 4881 2006 1174 924 ------
NM_005599chr131443 1187 334 ------
NM_005605chr81273 ------
NM_005626chr1138 ----1413
NM_005630chr361942 1704 285 228 162 127 ------
NM_005637chr1821722 1643 ------
NM_005639chr1261905 1592 1196 375 178 81 --11311 11438
NM_005642chr53126 98 27 ------
NM_005647chrX33064 2527 1198 --12860 --
NM_005668chr544159 1379 632 204 ------
NM_005715chr672601 2040 1134 1075 702 690 49 12451 11030 --
NM_005721chr23878 701 251 ------
NM_005722chr242401 1763 820 326 --12345 --
NM_005724chr151189 1239 --1700
NM_005725chr11666 ------
NM_005738chr72716 474 --1687 --
NM_005746chr721865 423 ------
NM_005749chr171694 ------
NM_005754chr52826 192 ------
NM_005759chr233927 3724 1457 23975 3663 14015 --
NM_005768chr121150 ------
NM_005779chr553109 2777 756 423 251 --12541 --
NM_005780chr13------1100
NM_005786chr1841296 1212 884 87 ------
NM_005795chr253023 2299 1998 767 515 ------
NM_005797chr1141606 1416 212 115 ------
NM_005801chr171187 ------
NM_005808chr332734 482 471 ------
NM_005822chr63552 449 217 11911 12068 1352
NM_005826chr12409 160 ------
NM_005840chrX97355 6982 5873 5543 5102 3026 2841 2404 210 15670 15707 12621
NM_005842chr131119 ------
NM_005853chr16--1189 ----
NM_005857chr151473 1273 1056 430 48 1393 11383 --
NM_005859chr531473 1370 442 ------
NM_005895chr1274053 3828 3552 2753 2540 1029 857 --23738 1441 --
NM_005898chr1142752 2419 2071 1101 32387 537 213 11999 --
NM_005900chr42844 435 1328 ----
NM_005901chr18168570 8541 8382 8315 7876 7295 6762 6201 3163 3066 2620 2397 2148 1791 875 249 28152 2534 16213 --
NM_005909chr584146 3290 2678 1514 1462 1300 441 315 ----1601
NM_005924chr71918 ------
NM_005938chrX----1389 --
NM_005941chr841485 1310 219 151 11586 21046 245 --
NM_005966chr232068 1920 949 ------
NM_005989chr721439 352 ----1528
NM_006003chr19137 ------
NM_006007chr963969 2884 2746 1376 930 129 13182 11316 11539
NM_006016chr61229 ------
NM_006022chr132903 370 ----1946
NM_006036chr222411 333 1468 153 --
NM_006040chr1661323 938 529 506 400 59 ------
NM_006047chr2073535 1255 1145 885 748 538 462 --33409 1087 557 13088
NM_006048chr11299 ------
NM_006055chr243212 2984 2689 199 1335 12402 --
NM_006062chr21935 ------
NM_006080chr72822 716 21132 1104 --12535
NM_006089chrX51863 1230 1188 531 270 ------
NM_006095chr433841 1011 226 24103 903 13792 --
NM_006108chr1142075 2055 1771 133 11807 --11474
NM_006113chr141888 1618 1397 463 2656 509 11725 22030 149
NM_006121chr12133 1411 ----
NM_006136chr71375 1186 11053 --
NM_006139chr232891 2437 754 --22794 215 --
NM_006145chr191381 ------
NM_006176chr112684 203 ------
NM_006194chr1421112 331 1274 ----
NM_006195chr921395 120 11087 1251 --
NM_006203chr585153 3830 1958 1651 1093 970 874 502 11007 ----
NM_006206chr422588 999 1149 --22346 992
NM_006210chr19------1182
NM_006216chr23467 124 81 ------
NM_006241chr311853 1803 12206 --
NM_006251chr523231 2121 ----1928
NM_006252chr146848 6251 4662 934 16137 45224 4628 2547 1821 14650
NM_006256chr132486 583 567 ------
NM_006265chr83409 333 115 11139 11172 --
NM_006275chr2052191 1906 1620 847 664 --12439 --
NM_006283chr894603 3546 1892 1831 1448 1422 931 794 691 21722 1428 --24267 636
NM_006306chrX24802 4707 --1499 --
NM_006310chr172914 97 ------
NM_006313chr122659 213 ------
NM_006330chr8177 ------
NM_006333chr21268 ------
NM_006352chr14773 611 269 87 11956 ----
NM_006364chr142245 230 --1995 --
NM_006380chr1724135 2764 --34019 1664 1112 --
NM_006420chr2032860 1230 1179 13178 ----
NM_006449chr222160 532 --11627 --
NM_006451chr52972 341 ------
NM_006459chr1011645 --2201 132 11853
NM_006469chr121601 616 11082 ----
NM_006482chr1243946 3804 3630 441 22927 225 13833 --
NM_006489chr1431839 687 425 --2434 343 11395
NM_006496chr141959 1323 688 669 ------
NM_006504chr1042777 921 548 496 ------
NM_006509chr191377 ------
NM_006526chr201737 1593 11496 --
NM_006544chr1476038 5860 5685 1910 1269 965 53 ------
NM_006557chr91105 21270 1170 11539 --
NM_006561chr1086182 6053 4910 4420 4304 2209 2065 1817 ----1826
NM_006572chr1742980 2933 2519 973 13295 22371 487 13165
NM_006575chr1441440 371 265 242 11202 ----
NM_006584chr171128 ------
NM_006595chr1121533 391 ------
NM_006597chr11--1215 ----
NM_006599chr1688063 6642 5290 2375 2115 1068 998 669 27174 47 37467 5706 829 12831
NM_006614chr311366 --33688 545 479 --
NM_006621chr121430 149 ----1294
NM_006626chr94983 852 773 54 ------
NM_006628chr1544217 3538 1009 632 22997 274 ----
NM_006629chr1822414 1124 --3941 674 564 --
NM_006644chr131161 ------
NM_006654chr1274755 4570 4449 3575 3087 1380 876 13777 13604 --
NM_006662chr16186 ------
NM_006694chr12256 30 ------
NM_006699chr142603 2245 1819 689 11953 11714 1300
NM_006703chr62426 331 ------
NM_006706chr51579 ------
NM_006708chr62989 916 ------
NM_006716chr721371 1165 ------
NM_006717chr923063 495 13048 ----
NM_006720chr10134799 3824 3792 3585 3574 3280 3238 1892 1848 1697 1244 946 932 ------
NM_006721chr10----1629 --
NM_006722chr31525 ------
NM_006729chrX54272 3653 2215 1847 1247 11801 11695 1304
NM_006746chrX31517 1083 1075 ------
NM_006750chr1687863 7343 6707 6581 2648 1742 1504 533 --26187 1694 15062
NM_006756chr8----11004 --
NM_006769chr11139 1569 ----
NM_006777chrX42924 2331 1015 753 --12892 --
NM_006802chr1--2269 229 ----
NM_006806chr212310 79 ------
NM_006807chr1711236 11357 166 --
NM_006811chr202957 274 ----1978
NM_006813chr61649 ------
NM_006818chr11866 --2809 141 --
NM_006826chr22310 128 ------
NM_006852chr1742544 2068 1036 930 --12346 --
NM_006854chr741619 1568 544 360 11487 ----
NM_006873chr253088 2315 924 673 195 --22984 70 11258
NM_006885chr1644047 3406 2842 1118 ------
NM_006888chr14113352 3218 2529 2296 2267 1248 855 638 546 405 187 13165 ----
NM_006902chr143062 2327 657 616 ----22107 1046
NM_006910chr16------1330
NM_006916chr221168 406 2558 300 ----
NM_006922chr22376 319 --11739 --
NM_006939chr1421174 171 ----11205
NM_006947chr431546 1420 408 1545 ----
NM_006948chr2152198 2121 708 361 156 11965 ----
NM_006981chr93884 639 630 22708 429 ----
NM_007002chr20185 ------
NM_007005chr921081 961 11420 --11511
NM_007006chr1622598 727 12280 ----
NM_007007chr1243913 3657 485 42 23758 3141 --14521
NM_007008chr21307 ------
NM_007010chr1741835 1608 1460 1234 --185 --
NM_007011chr1556226 5857 2734 2535 245 --12305 --
NM_007034chr11837 ------
NM_007038chr2135201 3979 432 --11645 --
NM_007052chrX4559 210 202 193 ------
NM_007054chr553627 689 587 414 378 1473 12667 1848
NM_007064chr321215 106 11110 1391 --
NM_007107chr332333 639 556 12403 ----
NM_007114chr323148 839 ------
NM_007124chr621943 135 1806 ----
NM_007145chr1911223 ------
NM_007146chr1722211 1004 ----12284
NM_007157chrX42984 2414 1955 510 ------
NM_007170chr1----1302 1643
NM_007175chr853549 3530 3513 3025 974 32329 981 804 12409 --
NM_007185chr131070 971 360 ------
NM_007187chr13--1914 1762 --
NM_007202chr171539 ----1218
NM_007204chr11127 ------
NM_007212chr15789 749 650 570 427 --1680 12114
NM_007222chr82509 192 ------
NM_007236chr156765 536 512 474 231 57 ------
NM_007245chr161742 ------
NM_007246chr42292 259 ------
NM_007249chr13118889 8833 8270 7957 7146 6330 2418 1442 1287 1163 728 13315 47186 3321 2391 2101 15893
NM_007271chr661803 1639 1495 1455 734 37 ------
NM_007276chr7156 ------
NM_007350chr1254392 1505 1423 1267 1261 1348 13599 --
NM_007358chr111828 1568 ----
NM_007363chrX1211 1737 1372 --
NM_007373chr1031415 1296 718 ------
NM_012062chr122370 287 ----1352
NM_012096chr342943 2355 1485 702 --1902 --
NM_012104chr1112987 --21531 670 --
NM_012104chr1112987 --21531 670 --
NM_012108chr4160 ----1355
NM_012118chr4------1295
NM_012137chr152886 2715 986 861 852 ------
NM_012141chr1343127 3121 1566 297 --12668 --
NM_012158chr13172 --21717 1435 --
NM_012160chr61389 ------
NM_012175chr113650 248 136 ------
NM_012207chr102729 27 --1309 1374
NM_012214chr256338 5804 4627 4563 544 --14229 --
NM_012215chr102287 237 11681 1407 --
NM_012219chr323227 914 ----23144 816
NM_012223chr22193 114 21191 334 ----
NM_012224chr41402 --1457 --
NM_012234chr343277 1418 996 431 13589 1634 11242
NM_012238chr1031650 1260 1180 ------
NM_012248chr162670 159 ------
NM_012249chr212831 --11345 12825
NM_012255chr201435 ------
NM_012257chr71132 ------
NM_012259chr641458 1431 1391 498 ------
NM_012281chr711509 --12081 --
NM_012288chr694965 4535 4150 1696 1291 961 575 488 260 23869 1349 1426 --
NM_012290chr221245 1176 ----1367
NM_012297chr452253 1874 923 299 23 ------
NM_012300chr532170 116 39 ------
NM_012302chr11152 --1781 11139
NM_012328chr731319 939 407 ------
NM_012334chr564473 4054 3077 1572 1368 958 11090 ----
NM_012345chr1341527 707 162 149 ------
NM_012408chr20----1774 --
NM_012416chr931078 156 119 1226 11038 --
NM_012419chr6--1405 1267 --
NM_012432chr11352 ------
NM_012463chr1221312 519 --11454 --
NM_012464chr472299 2098 798 743 700 494 419 ----12951
NM_012479chr752326 783 352 133 48 ------
NM_013229chr122600 548 22517 2387 ----
NM_013231chr1453772 3406 2707 1240 707 --14413 --
NM_013233chr231362 350 197 ------
NM_013259chr31329 ------
NM_013269chr1274239 4017 3559 1492 1201 434 328 ------
NM_013281chr2051399 1309 1005 302 76 ----11501
NM_013286chr342884 2399 740 162 --33464 342 140 --
NM_013313chr2233545 3362 2538 --42841 2729 436 240 12651
NM_013322chr731459 1292 167 ------
NM_013372chr1573374 3082 2870 2238 765 441 30 --13167 --
NM_013374chr322595 2577 --1710 --
NM_013377chr121473 ------
NM_013381chr1252284 1494 967 953 366 1841 ----
NM_013396chr213623 586 46 --11508 --
NM_013411chr142719 2476 2396 411 1751 12023 --
NM_013423chrX31286 1080 476 ------
NM_013427chrX31286 1080 476 ------
NM_013437chr811332 ------
NM_013958chr8175 ------
NM_013959chr8175 ------
NM_013960chr82773 550 ------
NM_013961chr8175 ------
NM_013962chr8175 ------
NM_013981chr51169 ------
NM_013982chr51169 ------
NM_013983chr51169 ------
NM_013989chr1454428 3362 3283 560 459 24086 1970 14980 --
NM_014011chr221852 739 22473 2294 ----
NM_014016chr3160 ----11092
NM_014021chr152977 2742 2326 2301 696 --33244 2633 415 --
NM_014023chr1042457 1982 533 220 21785 1036 22849 365 --
NM_014043chr3--31261 514 306 ----
NM_014112chr875354 4629 1741 1602 709 526 72 13572 --15321
NM_014117chr1612561 22517 2105 1151 --
NM_014141chr764246 3844 1487 1044 507 290 33694 3302 317 25078 756 --
NM_014154chr311498 ----1272
NM_014155chr1157128 5726 4772 2207 1997 ------
NM_014157chr1664025 1455 1255 1066 862 683 33029 2585 1326 11012 --
NM_014178chr141482 --1557 --
NM_014211chr51129 31426 673 165 2601 182 --
NM_014217chr13576 563 351 --11205 --
NM_014243chr431916 795 562 ------
NM_014246chr2241757 1693 1571 411 1435 --1250
NM_014264chr4191 ------
NM_014267chr112690 604 ------
NM_014268chr1811281 ------
NM_014271chrX--1680 ----
NM_014294chr8--1373 1967 --
NM_014300chr15------1438
NM_014309chr2295129 4367 4199 3580 3553 1541 1246 1113 476 14015 12142 --
NM_014319chr1241959 1929 1639 611 ----1138
NM_014333chr1142675 2653 961 453 ------
NM_014363chr131421 ------
NM_014368chr932130 286 208 1517 ----
NM_014372chr131976 1957 499 ------
NM_014393chr81368 11616 ----
NM_014394chr1051197 1166 1043 450 294 11050 ----
NM_014409chr13997 418 251 ----11093
NM_014423chr564293 2229 2220 2149 2004 1575 22247 470 14441 11105
NM_014445chr331907 481 401 ------
NM_014456chr101614 2539 473 123 --
NM_014469chr111254 ----1333
NM_014554chr1232009 690 269 ------
NM_014562chr22779 313 ------
NM_014570chr222703 168 ------
NM_014574chr1421358 597 ------
NM_014584chr1431516 1123 589 1294 --190
NM_014600chr221659 197 ------
NM_014606chr411471 ------
NM_014608chr15------1426
NM_014612chr91342 ------
NM_014620chr122528 239 ------
NM_014629chr831276 846 258 ------
NM_014636chr944280 3280 1440 1106 12841 175 13469
NM_014647chr1651838 1723 1481 180 135 ------
NM_014653chr1242142 1686 1595 248 1516 --138
NM_014671chr731441 1373 1037 11579 ----
NM_014674chr331234 993 96 1757 ----
NM_014701chr15--43424 1126 939 329 1855 --
NM_014702chr643332 3146 2723 128 --136 --
NM_014707chr742089 1887 1706 444 --1532 --
NM_014713chr21190 ------
NM_014729chr83871 771 83 --2577 321 --
NM_014733chr522094 468 ----11642
NM_014735chrX52107 2074 1706 1618 321 ------
NM_014739chr673747 3468 3064 2826 756 320 143 23865 3542 11154 --
NM_014742chr2051811 1611 1173 1109 201 --1659 --
NM_014743chr432512 1015 273 ------
NM_014746chr284344 3773 3622 3040 1535 1050 925 374 --11093 --
NM_014751chr831977 1564 294 12112 ----
NM_014755chr2165 23729 2760 14264 --
NM_014761chr162851 182 --1810 --
NM_014764chr122504 409 ------
NM_014774chr162890 2590 761 626 91 83 22408 891 ----
NM_014787chr122652 1751 --1774 --
NM_014797chr61420 --22444 890 --
NM_014802chr122188 139 ------
NM_014810chr131483 1116 763 12300 32371 1409 44 --
NM_014820chr321816 188 ------
NM_014824chr1141731 1717 1489 62 ------
NM_014826chr154228 3881 3201 2890 143 ----1375
NM_014827chr151727 1365 1135 239 150 ------
NM_014832chr1311317 --11683 --
NM_014840chr1262768 2736 2361 2247 2081 190 --12609 --
NM_014850chr384829 4427 4050 3652 3128 1275 1258 1093 --11843 --
NM_014860chr232656 1758 568 2919 275 22630 1635 --
NM_014864chr184371 3099 1588 1576 876 461 365 105 13049 13559 1270
NM_014873chr144873 3819 1228 399 ------
NM_014877chr1797725 7365 7289 7240 7022 6952 6774 5177 4928 25839 2369 17351 --
NM_014893chrY12294 --1734 --
NM_014897chr1732488 2100 87 ------
NM_014899chr572777 2444 1014 992 509 262 140 1171 ----
NM_014920chr643595 996 953 71 23774 593 ----
NM_014923chr1321467 591 1485 ----
NM_014924chr1462249 642 528 357 279 44 ------
NM_014932chr311277 ------
NM_014939chr1831296 1052 497 --1417 --
NM_014942chr611700 ----12631
NM_014946chr21749 1445 31117 1111 116 12113
NM_014947chr122640 938 ------
NM_014961chr431861 472 351 ----11840
NM_014962chr2032565 2118 1121 32475 1872 132 --12614
NM_014964chr1742147 1948 659 232 --1402 --
NM_014969chr121094 184 ------
NM_014982chr1435368 4385 257 14717 14191 --
NM_014988chr432719 977 882 ------
NM_014989chr611955 12017 1698 --
NM_014997chr762929 2611 2265 2153 1097 795 --12622 --
NM_014999chr1221697 623 11033 11411 --
NM_015008chr373252 2994 2504 1351 1287 994 264 --1651 --
NM_015017chr131126 248 217 ----124
NM_015020chr1622422 132 --1584 13805
NM_015026chr1264669 4117 3959 1698 521 64 --14182 --
NM_015032chr133976 651 204 11813 --1645
NM_015049chr242815 2762 2715 2596 12424 ----
NM_015051chr952847 2603 2182 874 252 ------
NM_015071chr5105674 5253 4233 4216 2266 2234 1933 1898 1276 618 16279 15645 1981
NM_015074chr164872 4618 1985 1736 932 552 ------
NM_015076chr611356 ----1507
NM_015092chr1654476 3526 3480 3072 732 --13667 --
NM_015097chr341490 625 458 76 --11579 --
NM_015099chr172478 207 ----150
NM_015101chr162501 2348 2332 913 646 331 --1533 12521
NM_015132chr71101 1201 ----
NM_015143chr41430 ----1922
NM_015144chr1643065 1365 1236 378 --33676 3377 1044 --
NM_015172chr111614 ------
NM_015176chr171398 1349 652 633 376 337 230 ------
NM_015185chrX22109 1087 22564 284 --22799 2709
NM_015187chr43706 603 274 1348 ----
NM_015192chr20------12636
NM_015197chr1473189 2973 2128 1080 456 321 306 31250 570 432 11173 1120
NM_015236chr411329 ------
NM_015252chr22619 42 --1709 --
NM_015256chr51525 ------
NM_015264chr2274773 4475 3957 3585 3385 1636 841 23821 525 ----
NM_015265chr232302 953 502 12347 ----
NM_015267chr1232101 2031 760 --1158 --
NM_015271chr434080 3008 1290 13198 11585 --
NM_015275chr121128 --1720 12081
NM_015291chr172814 2277 1113 643 630 318 152 22701 158 ----
NM_015294chr173242 211 102 ------
NM_015296chr132996 32 1353 1831 --
NM_015308chr111275 1671 --162
NM_015310chr887012 6221 5866 3186 3041 1289 1261 962 17249 47820 7809 5076 1540 27403 7094
NM_015326chr182582 2370 2334 1890 1007 812 438 23 1107 --2955 305
NM_015328chr733060 3005 2255 12944 ----
NM_015336chr1232376 2308 137 ----12340
NM_015355chr1721446 155 --11547 --
NM_015356chr8172 ------
NM_015365chrX43970 3485 2821 1385 --1643 --
NM_015375chr144838 1501 1131 443 14904 --13166
NM_015379chr71228 ------
NM_015382chr14------1616
NM_015387chr231989 1517 445 --11592 --
NM_015412chr332207 613 423 2930 57 ----
NM_015435chr821324 1236 1301 ----
NM_015446chr1--11621 --2645 371
NM_015455chr554031 3455 2725 1251 928 12565 ----
NM_015458chr865214 4538 3263 1560 897 634 --15054 --
NM_015461chr181238 ------
NM_015463chr23774 740 311 ------
NM_015464chr7--1143 ----
NM_015493chr1921979 623 ------
NM_015525chr621026 881 --177 --
NM_015550chr773334 3178 3010 2827 1189 1129 789 12757 1654 --
NM_015569chr124089 1256 14292 ----
NM_015570chr731759 1717 1261 ------
NM_015571chr61948 22196 429 ----
NM_015576chr342460 2064 1871 197 ------
NM_015578chr1921916 70 153 11734 --
NM_015640chr145350 4955 4509 1448 11033 25209 4256 --
NM_015687chr6179 1547 ----
NM_015691chrX42708 2452 2134 57 --12616 --
NM_015711chr191681 ------
NM_015713chr842365 1260 630 530 1368 12530 22250 1444
NM_015726chr131498 1146 538 ------
NM_015850chr832356 2346 1794 1852 ----
NM_015874chr4----1627 --
NM_015878chr862058 1916 1846 1623 368 230 ------
NM_015888chr143247 2666 2438 432 --11297 1655
NM_015898chr1921623 464 ------
NM_015902chr8------1746
NM_015906chr164052 1453 1128 972 880 564 1264 11499 --
NM_015907chr4--135 ----
NM_015934chr21192 ------
NM_015939chr201550 1644 ----
NM_015975chrX11644 --11650 1239
NM_016009chr194558 3873 3853 3808 1933 1915 1159 686 638 31140 1072 429 11755 --
NM_016023chr832069 1413 805 22043 78 ----
NM_016025chr1621829 21 11478 ----
NM_016037chr121087 765 --1203 --
NM_016057chr1231192 813 197 ------
NM_016072chr1222422 1996 ----11557
NM_016076chr122110 982 42835 2619 2128 1112 ----
NM_016078chr1711082 ----11001
NM_016083chr673182 3021 1214 1109 1013 865 440 1790 22908 1469 --
NM_016096chr842178 1614 1497 841 2724 351 ----
NM_016100chr201317 1111 ----
NM_016107chr521083 316 ------
NM_016131chr241671 692 508 281 ----1909
NM_016132chr1532248 752 298 --11016 23202 1065
NM_016179chr131212 ------
NM_016201chr31561 12087 ----
NM_016206chr367413 7194 7116 6650 1720 487 18145 26090 1171 12904
NM_016224chr63485 379 328 --1344 --
NM_016230chr62543 372 ------
NM_016231chr1711051 11305 ----
NM_016257chr173495 3168 2541 2533 498 196 124 ----1983
NM_016260chr257235 1453 1141 663 552 26497 1134 26698 1412 26267 6056
NM_016271chr1832022 690 496 --12327 --
NM_016275chr322093 1696 ----11079
NM_016279chr51158 ------
NM_016284chr161157 ------
NM_016287chr13745 685 396 11831 ----
NM_016297chr273532 3313 3182 1372 1068 594 532 1157 23214 722 11001
NM_016315chr211524 --1293 --
NM_016322chr932658 545 466 ------
NM_016338chr51968 ------
NM_016357chr122879 507 11140 11227 11054
NM_016374chr121402 1260 ------
NM_016374chr121402 1260 ------
NM_016376chr1783562 2902 1113 1041 740 727 514 367 ------
NM_016396chr1531180 1070 216 12895 ----
NM_016422chr112915 470 1751 12632 --
NM_016436chr2051994 1673 790 518 265 ------
NM_016441chr242102 1941 1908 1506 --12344 --
NM_016480chr51131 ----1567
NM_016513chr643595 996 953 71 23774 593 ----
NM_016525chr94919 647 294 214 ------
NM_016530chr1543305 2854 2547 1172 --1369 --
NM_016544chr243387 2405 1056 564 ----1640
NM_016584chr12----1294 --
NM_016587chr7156 ------
NM_016599chr42506 53 11437 ----
NM_016603chr5----11526 12265
NM_016605chr522253 358 ------
NM_016621chr1174495 4367 4150 3865 3408 1180 1170 ------
NM_016823chr171899 ----2823 164
NM_016836chr21583 --1170 --
NM_016839chr21583 --1170 --
NM_016929chr684584 4339 4314 3398 3302 1611 995 933 ------
NM_016936chr161123 --11663 --
NM_016946chr193419 3133 2761 2700 2418 1302 1020 493 433 13496 11058 --
NM_016950chr41533 1407 ----
NM_016952chr1133984 465 273 13149 --14062
NM_017415chr583477 2905 1727 1539 936 734 701 549 14557 --13948
NM_017420chr1453665 3531 3302 1294 523 --1651 11311
NM_017510chr5----1628 --
NM_017544chrX1619 ----1369
NM_017553chr151474 ----2267 50
NM_017569chr13142 ------
NM_017596chr184509 4283 3452 2851 1444 1040 536 138 34673 4387 3180 44372 3491 3346 1651 --
NM_017599chr1221748 613 --12014 1462
NM_017628chr443927 1261 1005 390 23956 3350 11909 15001
NM_017629chr121982 659 --1350 --
NM_017632chr41137 ----1297
NM_017634chr821973 629 ------
NM_017637chr988814 8747 8400 8352 7484 2595 2313 791 --13076 12458
NM_017643chr1742382 1972 837 619 --12128 --
NM_017644chr355046 4493 1500 1270 609 ------
NM_017646chr12516 270 --1451 --
NM_017657chr23727 691 365 ----1183
NM_017658chr1431743 1643 1012 --23928 1342 21465 1331
NM_017666chrX2412 68 --1358 --
NM_017694chr231781 1457 250 --11901 --
NM_017697chr81352 ------
NM_017709chr114152 11538 11412 12732
NM_017719chr322288 2075 3757 586 372 ----
NM_017736chr161635 1691 23016 2052 --
NM_017747chr51433 ------
NM_017758chr1721153 414 1399 ----
NM_017770chr632811 2705 560 1421 ----
NM_017772chr61223 1137 ----
NM_017786chr82485 464 ----1547
NM_017801chr332619 1697 1613 ------
NM_017811chr942703 2645 2108 359 ----12615
NM_017813chr875486 4360 4220 3975 1470 786 27 --11800 --
NM_017831chr1853335 1765 1587 1220 858 1453 ----
NM_017848chrX74259 4249 3518 336 235 202 128 13912 ----
NM_017866chr83953 778 247 1720 ----
NM_017902chr1094885 4732 4685 4350 3948 3619 2059 832 806 11302 1251 1735
NM_017919chr954919 2333 2309 1028 763 11600 14790 --
NM_017925chr911698 ----11407
NM_017938chrX41620 1341 747 487 ------
NM_017943chr142418 352 ----1778
NM_017944chr1123018 2966 11084 ----
NM_017964chr23900 373 118 ------
NM_018000chr21145 ------
NM_018011chr13--1129 --1664
NM_018015chrX21088 998 ------
NM_018018chr123749 499 449 ------
NM_018024chr81507 ------
NM_018027chr1052769 2649 2386 924 649 --1688 12964
NM_018030chr18----1181 147
NM_018036chr1453416 3399 3282 1534 226 13198 13544 159
NM_018046chr51562 ------
NM_018047chr51871 ------
NM_018078chr42237 72 1820 ----
NM_018084chr222883 150 12709 --12860
NM_018111chr19--151 ----
NM_018117chr102684 105 2715 130 ----
NM_018120chr811445 --1982 --
NM_018133chr331778 544 206 1700 ----
NM_018150chr1----1661 --
NM_018155chr332251 1120 307 ------
NM_018157chr1242219 1068 836 653 12815 32891 2182 951 --
NM_018169chr12----1480 --
NM_018181chr1851866 1216 619 504 325 --11230 --
NM_018182chr174664 514 164 59 11644 --11586
NM_018184chr341454 871 88 26 1238 ----
NM_018200chr1541932 1761 1653 559 ------
NM_018206chr161204 ------
NM_018227chr452491 2022 903 550 401 1816 ----
NM_018247chr653014 2464 1118 645 134 --150 --
NM_018254chr172285 1839 1706 1673 708 695 120 ------
NM_018264chr73944 932 863 ------
NM_018266chr341091 835 705 54 ------
NM_018286chr171834 ----2928 380
NM_018287chr10------1498
NM_018293chr321880 932 12172 1968 12297
NM_018299chr841369 1331 298 71 --23358 38 13497
NM_018300chr19--1184 ----
NM_018302chr412102 1867 --2850 714
NM_018307chr172854 68 --1294 --
NM_018312chr1122045 708 2512 239 ----
NM_018319chr1431377 1354 565 --196 --
NM_018323chr41114 11900 ----
NM_018351chr1264136 3920 3837 3641 851 373 --11436 --
NM_018362chr1163189 3123 2449 875 387 227 33072 2516 1245 12883 --
NM_018364chr132816 864 671 11148 13186 23983 506
NM_018369chr51518 --1670 --
NM_018374chr765105 3733 3717 1673 1618 153 --11298 14488
NM_018387chr92198 164 ------
NM_018416chr1252538 2242 1996 1974 218 ------
NM_018425chr1062454 2307 1999 996 877 630 --1756 --
NM_018429chr532834 2693 98 12881 --1971
NM_018440chr877648 7397 6999 6682 5487 2477 575 23345 1871 ----
NM_018444chr842299 1470 507 187 ------
NM_018456chr3--196 ----
NM_018474chr20132 ------
NM_018482chr862379 2331 2153 1614 653 267 ------
NM_018490chr1111548 --11176 11249
NM_018509chr1711513 ------
NM_018555chr1961827 1710 1560 552 428 318 ------
NM_018569chr431247 581 227 11411 ----
NM_018638chr1213918 ----15706
NM_018682chr71613 ------
NM_018703chr16------1330
NM_018710chr841171 1164 136 46 ------
NM_018718chr751882 1492 927 451 261 12182 ----
NM_018840chr201389 ------
NM_018945chr663427 2653 2483 2263 1095 110 1440 ----
NM_018948chr1----1203 1396
NM_018970chr731154 550 137 22615 1037 --1794
NM_018977chrX31008 929 249 ------
NM_018999chr1053568 1929 1193 370 338 --23574 1065 33620 3276 3071
NM_019001chr344311 4133 3450 3357 --11340 12954
NM_019006chr151727 ------
NM_019036chr61999 --11142 --
NM_019042chr7173 ------
NM_019045chrX1734 ------
NM_019063chr231935 1749 776 --1142 11412
NM_019071chr71640 ------
NM_019084chr1052376 1860 1045 478 406 --21006 242 --
NM_019116chr16103752 3580 3533 2773 2425 1362 1070 704 604 89 13385 ----
NM_019117chrX33026 1253 1240 ------
NM_019590chr101570 1305 ----
NM_019593chr2053180 2281 1076 801 147 11012 12931 --
NM_019600chr152724 581 1190 1695 --
NM_019605chr11517 --1587 --
NM_019624chr121273 ------
NM_019625chr121273 ------
NM_019849chr191170 ------
NM_019884chr191543 ------
NM_019891chr111323 ----11168
NM_020066chr12857 385 1752 ----
NM_020119chr743749 3496 1231 117 11104 ----
NM_020122chr264538 4304 3903 1645 1380 629 ------
NM_020135chr63437 317 155 ------
NM_020137chrX2399 164 ------
NM_020141chr122215 230 --11996 --
NM_020144chr731682 1558 379 ------
NM_020148chr1853083 2420 2341 2326 292 --12186 --
NM_020150chr1032193 1597 782 ------
NM_020154chr152238 61 ------
NM_020159chr451498 1441 585 442 216 ------
NM_020177chr532329 909 363 1428 ----
NM_020178chr172503 323 ------
NM_020182chr2033043 2467 279 ------
NM_020193chr11------11003
NM_020198chr1731017 105 24 --11504 --
NM_020239chr122205 291 --11576 --
NM_020240chr532704 1903 157 11079 ----
NM_020245chr644476 3163 3127 1032 14502 11503 --
NM_020336chr2053520 3156 2991 2976 2418 ------
NM_020341chr201668 1171 --11774
NM_020342chr232471 1756 932 ----12177
NM_020346chr112562 114 21449 1067 ----
NM_020347chr322338 1576 --1230 --
NM_020348chr1022176 735 1823 ----
NM_020353chr341475 1463 458 309 ------
NM_020357chr321468 661 ------
NM_020382chr1221458 541 ------
NM_020390chr344820 4034 3113 1861 164 24582 4553 --
NM_020403chr13----21772 179 --
NM_020420chrY31508 1201 1174 --1623 --
NM_020432chr721873 190 ----11439
NM_020440chr173137 1187 1039 373 157 105 36 ------
NM_020444chr511138 ------
NM_020449chrX1492 ------
NM_020463chr2135 ----1154
NM_020466chr674401 4120 3819 1629 1452 655 209 13991 188 --
NM_020473chrX----21506 45 --
NM_020474chr1821890 251 ------
NM_020532chr21307 ------
NM_020630chr101683 ------
NM_020640chr31726 --1289 --
NM_020644chr114741 725 280 220 ------
NM_020645chr112444 110 ------
NM_020647chr85697 340 314 220 55 --1566 126
NM_020666chr51748 ----1760
NM_020673chr20127240 7177 6341 5904 5140 3055 2062 1183 990 144 106 99 35863 752 46 --17514
NM_020676chr32747 261 ------
NM_020682chr101885 1929 ----
NM_020702chr931779 1155 39 ------
NM_020715chr142855 645 ------
NM_020717chrX53882 3464 1781 1629 694 2682 161 --14520
NM_020718chr16106097 5585 5335 4780 4612 2438 1896 1511 765 535 14558 --14303
NM_020724chr482609 2447 1976 853 806 799 616 159 ------
NM_020727chr2123656 261 12492 1391 --
NM_020734chr1222381 759 ----11019
NM_020747chr52796 772 --1789 --
NM_020750chr621268 548 ------
NM_020752chr1042690 2374 905 209 1816 ----
NM_020760chr23763 237 171 --11474 --
NM_020766chrX13353 23728 1583 33521 2908 2898 --
NM_020772chr1797303 6685 5867 5671 2864 2340 2230 1502 1270 27558 344 28239 694 --
NM_020774chr1875371 4684 4612 1104 921 265 80 --25224 1576 --
NM_020782chr1294730 4003 3655 3491 3232 1946 1493 905 595 --11377 23000 818
NM_020792chr342108 347 312 145 ------
NM_020800chr311138 ------
NM_020801chr51247 11819 ----
NM_020819chr621116 1017 ----193
NM_020825chr1642693 1181 896 190 13100 1661 --
NM_020830chr262658 2647 2393 2225 1063 874 ------
NM_020834chr1441772 1345 682 656 ------
NM_020841chr1253550 1316 1090 794 318 11305 ----
NM_020844chr897073 6955 6045 5436 4963 2722 2507 2392 1624 ------
NM_020854chr1821501 1480 ----11105
NM_020858chr151863 ------
NM_020861chr651349 501 363 106 81 ------
NM_020871chrX21881 465 ----1616
NM_020888chr131981 700 239 ------
NM_020899chr1722344 213 ------
NM_020914chr1732533 885 807 11788 ----
NM_020922chrX31729 1303 511 --1482 --
NM_020927chr1631792 1689 1453 --1274 --
NM_020935chr233841 1488 246 --11749 --
NM_020940chr1052442 2383 1040 987 210 ------
NM_020948chr1------1123
NM_020975chr1021610 1271 --21672 230 --
NM_020988chr161202 ------
NM_021005chr1561128 867 464 395 367 276 ------
NM_021007chr231921 1898 948 ------
NM_021025chr51506 ------
NM_021069chr41656 ------
NM_021076chr22--1401 ----
NM_021100chr201370 1218 ----
NM_021116chr788978 8932 7573 7230 6692 2157 2080 707 ----12704
NM_021120chrX72911 2756 2619 2610 2234 1266 1154 33072 1105 1087 32660 870 152 --
NM_021132chr101538 1436 ----
NM_021133chr131257 656 50 ------
NM_021137chr1782304 1929 1811 1665 1604 800 361 208 12003 ----
NM_021140chrX3743 424 59 ------
NM_021141chr22420 258 ----159
NM_021145chr72399 120 11185 ----
NM_021151chr7----1305 --
NM_021159chr41485 1115 1276 --
NM_021161chr141522 ------
NM_021174chr81293 ------
NM_021183chrX3981 271 251 ----1802
NM_021190chr121185 212 ----11062
NM_021202chr2032755 1120 313 --22404 2021 11180
NM_021238chr1261954 1791 1686 1542 597 498 1293 12115 --
NM_021252chr1011751 --12060 12002
NM_021622chr1021537 653 --1950 11512
NM_021629chr353183 1397 1379 1223 611 ------
NM_021644chr102729 27 --1309 1374
NM_021647chr444566 1868 1712 506 --11153 14425
NM_021648chr662611 2426 2193 924 655 82 2429 131 ----
NM_021784chr202220 160 ------
NM_021800chr102150 65 179 ----
NM_021813chr675593 5046 4230 4146 1456 266 128 11311 1491 25096 1904
NM_021814chr611483 ------
NM_021911chr555256 3405 1164 979 191 13783 --15286
NM_021913chr192328 304 61604 1544 1191 726 387 337 11512 21528 1408
NM_021935chr3----155 --
NM_021942chr41179 ------
NM_021950chr1111541 11556 11749 --
NM_021961chr1186274 5668 4852 2969 2200 888 405 208 37168 2581 641 24800 1720 --
NM_021963chrX1248 ------
NM_021964chr354246 2486 1955 1659 485 11362 26469 4713 --
NM_021984chrX3549 421 195 --1971 --
NM_021987chrX3549 421 195 --1971 --
NM_021988chr202997 57 ----21527 535
NM_021990chrX3549 421 195 --1971 --
NM_021999chr13190 ------
NM_022037chr221033 831 --1346 --
NM_022041chr1652077 1728 1054 1023 988 22715 561 ----
NM_022048chr1576185 4735 4524 1918 1710 1218 21 1720 14492 14756
NM_022049chr131175 613 386 11448 ----
NM_022063chr103633 172 152 --11689 --
NM_022075chr12957 117 ------
NM_022080chr2052531 1941 1727 999 51 ----12782
NM_022116chr73245 108 41 ------
NM_022166chr1655721 4892 4575 3866 1542 11490 1259 11431
NM_022173chr221033 831 --1346 --
NM_022351chr843244 3159 1347 1170 --11389 --
NM_022373chr71298 ------
NM_022442chr202997 57 ----21527 535
NM_022458chr753171 3128 2428 2275 933 --12249 --
NM_022459chr1355723 4047 511 80 74 14976 25135 4063 --
NM_022462chr19102741 2496 2376 2349 1390 1364 1241 909 790 688 12460 --13184
NM_022465chr1232425 724 442 --1681 --
NM_022469chr11942 ------
NM_022473chr1553022 2946 1085 664 182 ------
NM_022476chr161203 1145 ----
NM_022482chr202753 374 3724 322 283 11958 --
NM_022485chr32408 331 ------
NM_022491chr1241393 735 498 187 ----11090
NM_022497chr353175 2960 2684 337 254 12761 --11442
NM_022552chr211178 --1227 --
NM_022567chrX1776 ------
NM_022652chr122756 749 ------
NM_022716chr142906 2171 501 460 ----21951 890
NM_022726chr62638 127 ------
NM_022756chr121366 192 1149 ----
NM_022763chr342648 2138 2053 934 ------
NM_022780chr221190 662 ------
NM_022781chr921238 170 1756 ----
NM_022821chr1--1493 ----
NM_022828chr51314 11630 11458 --
NM_022841chr1562735 2581 2122 814 434 167 161 ----
NM_022845chr1611560 12026 ----
NM_022893chr22889 548 --13107 --
NM_022894chr231745 385 309 --11708 1340
NM_022897chr54744 721 228 194 --1841 --
NM_022900chr72250 127 ------
NM_022912chr233043 2837 302 12328 1439 13089
NM_023000chr141604 --11125 --
NM_023001chr141604 --11125 --
NM_023010chrX2687 143 3570 336 28 ----
NM_023015chr11290 1770 ----
NM_023071chr1211130 ------
NM_023074chr1921062 427 --11212 1974
NM_023079chr1731494 574 470 ------
NM_023105chr832356 2346 1794 1852 ----
NM_023106chr832356 2346 1794 1852 ----
NM_023110chr832356 2346 1794 1852 ----
NM_023111chr832356 2346 1794 1852 ----
NM_023923chr143769 3194 568 270 1982 1168 --
NM_023929chr841808 514 305 291 --2916 575 --
NM_024007chr511200 2978 649 ----
NM_024016chr17--1632 ----
NM_024036chr111244 ------
NM_024077chr92736 632 ------
NM_024090chr411483 1578 ----
NM_024312chr1221223 375 1599 ----
NM_024345chr9106040 5807 5140 4212 4068 2051 1195 1057 586 258 15565 ----
NM_024496chr141540 --1144 --
NM_024501chr21227 ------
NM_024524chr332215 2188 992 1178 22729 211 --
NM_024546chr132881 210 21141 36 186 --
NM_024581chr61230 ------
NM_024586chr11552 ----1214
NM_024590chr42175 40 ----21966 268
NM_024594chr531658 1478 1306 --21830 750 --
NM_024613chr821389 95 ------
NM_024624chr21535 21593 27 --11185
NM_024626chr121643 1337 --11360 --
NM_024635chr92217 38 ------
NM_024646chr133938 3543 3446 13135 --12719
NM_024665chr354549 4038 4025 3039 1826 11729 ----
NM_024700chr131003 129 50 ------
NM_024713chr1531513 1429 1325 11185 ----
NM_024740chr1173737 2952 2804 2591 1413 955 589 13146 13592 --
NM_024744chr22425 50 ------
NM_024755chr153861 173 101 ------
NM_024757chr931110 907 98 ------
NM_024761chr944310 4023 3804 305 1693 --1843
NM_024778chrX157 1195 ----
NM_024812chr83710 677 135 31735 1634 1620 ----
NM_024817chr1544950 1581 1077 203 24161 1590 15146 --
NM_024828chr92200 85 ------
NM_024831chr82216 106 ------
NM_024913chr741783 1312 690 371 11402 ----
NM_024920chr411289 ------
NM_024921chrX21451 153 1661 ----
NM_024930chr552468 2267 1921 1101 173 ------
NM_024944chr2121319 1214 1440 ----
NM_024947chr3109133 8681 6666 6236 6005 5831 3106 1427 1057 542 38978 3573 2397 33646 3510 1486 --
NM_024949chr484947 4730 4296 3863 3682 3634 1712 1068 24502 1423 23115 1937 14476
NM_024989chr2127857 7119 6967 6838 5711 2820 2721 1589 1558 1546 1278 442 ----12558
NM_025054chr832931 858 265 14025 13680 1294
NM_025073chr184188 3887 3479 3108 1751 694 280 166 23927 1366 1832 12996
NM_025083chr1531926 360 179 ----11509
NM_025134chr1632550 1724 1709 12507 12417 --
NM_025146chr362582 2542 2300 2180 494 315 21674 277 11984 --
NM_025154chr711228 ----1465
NM_025160chr143916 2977 1550 1287 --23901 2635 --
NM_025191chr131002 661 534 11427 --11324
NM_025222chr341979 1005 957 797 --21197 399 13050
NM_030621chr1463559 1504 1368 930 691 641 --1442 12836
NM_030623chr211202 168 ----
NM_030629chr164602 483 126 80 ----11614
NM_030647chr756116 4267 4245 4233 2496 24798 4785 --1550
NM_030648chr455211 4977 2160 1922 209 33727 2190 685 ----
NM_030650chr273495 2865 2745 2642 1551 874 364 --22891 42 --
NM_030670chr1241802 1722 1634 562 11714 154 --
NM_030671chr1241802 1722 1634 562 11714 154 --
NM_030674chr12135854 5848 5287 5243 5127 4793 4249 3887 2021 1204 1166 1056 163 --15540 --
NM_030756chr101256 ------
NM_030759chr10------1672
NM_030762chr1221900 487 11615 ----
NM_030806chr187056 6529 5790 3781 3619 3247 1539 84 --27501 3585 28990 6689
NM_030816chr123519 782 23559 402 ----
NM_030820chr61947 ------
NM_030885chr32618 142 ------
NM_030914chr91941 ------
NM_030918chr145388 1851 1585 263 --21607 255 --
NM_030938chr171439 ------
NM_030939chr6------11000
NM_030963chr6----1588 --
NM_030964chr573686 3119 3072 2422 1498 793 485 22881 221 ----
NM_031243chr752280 1991 1952 1809 1681 ----2917 829
NM_031267chr71475 1190 ----
NM_031309chr8161 ------
NM_031314chr1431558 646 333 --1216 1559
NM_031369chr43324 278 176 ------
NM_031370chr43324 278 176 ------
NM_031371chr121402 1260 ------
NM_031371chr121402 1260 ------
NM_031412chr1231217 1201 863 ------
NM_031427chr1425551 2248 15423 35127 1664 1408 1979
NM_031438chr54551 462 318 219 1151 ----
NM_031442chrX43164 2179 1975 1295 12969 12231 --
NM_031483chr2083596 3129 2609 2314 1396 1206 363 255 --12268 --
NM_031942chr2--11240 --1500
NM_031966chr5--1178 ----
NM_032124chr1821231 858 --11106 1431
NM_032139chr192799 117 1953 ----
NM_032144chr21594 11837 --2695 528
NM_032145chr621442 1407 11233 --11890
NM_032147chr122877 401 1256 ----
NM_032160chr1844231 2708 1285 673 ------
NM_032199chr1042818 1023 720 207 12716 --11258
NM_032228chr1122798 2235 22850 2450 ----
NM_032256chr122207 66 ------
NM_032288chr322171 841 --2955 626 --
NM_032291chr111372 --1178 1795
NM_032321chr232805 466 233 --1198 13088
NM_032352chr141307 ------
NM_032354chr1741049 889 859 820 --1288 --
NM_032373chr1054370 1270 1229 1205 547 22312 322 15264 --
NM_032410chr81194 --1898 --
NM_032424chr113493 303 241 ----1473
NM_032434chr241248 1038 1015 218 ------
NM_032436chr133870 678 25 ------
NM_032440chr1022254 908 ----22690 1160
NM_032445chr151951 --1769 1506
NM_032452chr1411535 1394 ----
NM_032457chr441180 734 543 27 ----22843 648
NM_032458chrX43207 2655 1229 1034 13270 ----
NM_032491chr121371 ------
NM_032511chr6--1349 ----
NM_032550chr1041090 890 478 375 ------
NM_032560chr142811 799 ------
NM_032562chr10167 --1160 --
NM_032581chr741627 1413 1284 226 1115 ----
NM_032590chr1241137 1007 964 128 ------
NM_032632chr1431769 1539 466 ------
NM_032717chr411079 ------
NM_032802chr15195 ------
NM_032833chr142406 2205 1036 787 --1627 --
NM_032837chr1752033 767 732 517 470 ------
NM_032842chr741457 1246 387 315 ------
NM_032859chr1341380 905 839 408 --11139 --
NM_032870chr6------1128
NM_032873chr1124108 139 ------
NM_032876chr1451968 1407 473 352 113 ------
NM_032968chrX34227 3366 2830 --12812 --
NM_032969chrX34227 3366 2830 --12812 --
NM_032973chrY34219 3361 2825 ------
NM_032999chr74842 792 413 159 --1938 --
NM_033000chr74842 792 413 159 --1938 --
NM_033001chr74842 792 413 159 --1938 --
NM_033020chr164052 1453 1128 972 880 564 1264 11499 --
NM_033055chr1261 43 31108 892 109 ----
NM_033056chr103692 231 50 ------
NM_033081chr202474 383 --1453 --
NM_033083chr373283 2735 1231 1037 556 401 151 11311 1589 --
NM_033105chr8147 ------
NM_033132chr1321533 45 ------
NM_033181chr673182 3021 1214 1109 1013 865 440 1790 22908 1469 --
NM_033196chr1921460 137 --11312 --
NM_033211chr5--1678 ----
NM_033221chr94763 642 624 359 1921 12431 1227
NM_033224chr757285 7205 5443 2170 536 ----57095 6320 5563 2883 1150
NM_033225chr812420 1221 --13207
NM_033226chr16161 ------
NM_033228chr51427 ------
NM_033254chr31581 --1176 --
NM_033326chr1132272 308 286 1119 2628 295 2922 607
NM_033337chr32558 273 ------
NM_033360chr1274081 1856 1650 1458 1281 1029 615 13721 ----
NM_033375chr171976 11183 ----
NM_033389chr1784393 3878 3817 3739 3731 3551 3505 1205 14590 13705 --
NM_033394chr21486 --21578 498 --
NM_033503chr1553500 3224 1518 1510 1047 22347 744 ----
NM_033505chr276244 5784 4917 1990 1546 1156 999 1261 1796 --
NM_033512chr842991 2423 2226 1894 --12287 --
NM_033642chrX41189 925 905 73 ------
NM_033644chr532170 116 39 ------
NM_033645chr532170 116 39 ------
NM_033656chr2155695 4793 4650 390 85 14757 ----
NM_052864chr441961 1693 592 469 ------
NM_052865chr202895 342 --1909 --
NM_052879chr1223043 2783 1989 11476 --
NM_052886chr842077 1426 518 142 1581 1845 --
NM_052896chr152539 903 748 656 357 1209 --1717
NM_052898chr81416 11863 ----
NM_052904chr631469 965 107 1306 --11080
NM_052927chr552255 1749 1514 806 326 1165 --11679
NM_052937chr822591 45 ------
NM_052966chr13892 188 24 --32888 2818 995 --
NM_052978chr1431746 1346 622 ------
NM_052998chr1----1167 --
NM_053002chr311043 ------
NM_053023chr1121049 890 12734 22651 2389 --
NM_053024chr31588 ----172
NM_053025chr31367 --11422 --
NM_053026chr31367 --11422 --
NM_053027chr31367 --11422 --
NM_053028chr31367 --11422 --
NM_053031chr31367 --11422 --
NM_053032chr31367 --11422 --
NM_053042chr4--11235 ----
NM_054012chr91244 ------
NM_054111chr61801 --1107 1941
NM_057175chr432537 2084 1913 --11940 --
NM_058179chr93934 764 717 ----1998
NM_058237chr144876 855 406 353 ------
NM_058240chr1421340 686 ----1176
NM_058241chr21174 11747 1863 --
NM_058241chr21174 11747 1863 --
NM_078469chr101548 ------
NM_078470chr1062522 2312 1890 1779 353 316 --12701 --
NM_078487chr921263 492 --13234 --
NM_080546chr932317 2134 1762 1280 1455 12115
NM_080597chr18----1181 147
NM_080629chr121541 1029 --1399 --
NM_080630chr121541 1029 --1399 --
NM_080632chrX2687 143 3570 336 28 ----
NM_080655chr91197 ------
NM_080669chr1751532 1217 1156 1011 265 1318 14953 23869 3151
NM_080676chr2042860 2728 2663 1010 ----12650
NM_080717chr121342 ------
NM_080743chr642371 2328 2145 854 12155 1882 --
NM_080748chr20168 ------
NM_080759chr1352375 1908 1829 239 89 --11881 --
NM_080760chr1352375 1908 1829 239 89 --11881 --
NM_080872chr883705 3433 3281 2979 2880 1393 1105 627 --12788 --
NM_130387chr331184 1112 927 --1103 --
NM_130391chr953568 3207 985 493 89 ------
NM_130392chr953568 3207 985 493 89 ------
NM_130393chr953568 3207 985 493 89 ------
NM_130395chr63437 317 155 ------
NM_130435chr1042777 921 548 496 ------
NM_130797chr7----1562 --
NM_130838chr1531299 569 537 ------
NM_130839chr1531299 569 537 ------
NM_130847chr1165554 4971 4855 3748 3662 698 11522 ----
NM_133265chrX52875 2755 2475 2421 1464 11067 ----
NM_133334chr485840 5232 4927 4715 4631 1093 751 431 32293 2223 726 ----
NM_133370chr453281 1176 1150 1075 550 23676 3650 ----
NM_133372chr522819 2220 22685 2510 12934 --
NM_133378chr21929 ----1791
NM_133432chr21929 ----1791
NM_133433chr51683 ------
NM_133437chr21929 ----1791
NM_133468chr732590 693 685 --12509 --
NM_133478chr232200 667 248 1265 ----
NM_133486chrX1108 ------
NM_133496chr123765 395 --23643 3480 14292
NM_133507chr122811 85 ------
NM_133625chr31315 ------
NM_133631chr311029 ------
NM_133646chr233769 1657 1189 25582 990 25391 4423 --
NM_133647chr1553784 2488 2388 1330 234 --23290 1060 --
NM_134428chr91339 ------
NM_138270chrX72721 2433 1276 702 628 411 261 --1898 --
NM_138286chr1933242 3227 2700 ------
NM_138288chr1422035 1772 ------
NM_138317chr141522 ------
NM_138318chr141522 ------
NM_138333chr942052 2002 793 331 --22634 1932 --
NM_138348chr576308 4815 4794 4237 2392 2372 182 22031 146 11555 --
NM_138357chr1021762 737 1220 ----
NM_138381chr332353 1829 104 --1501 --
NM_138423chr1532005 770 440 12331 ----
NM_138444chr1334797 511 38 ----11216
NM_138459chr6103636 3374 3176 3132 2393 944 508 413 315 144 ------
NM_138468chr254881 4626 2022 1937 1108 --11706 --
NM_138473chr1244323 4216 1456 973 --14384 --
NM_138609chr51483 ------
NM_138610chr51483 ------
NM_138713chr1688063 6642 5290 2375 2115 1068 998 669 27174 47 37467 5706 829 12831
NM_138714chr1688063 6642 5290 2375 2115 1068 998 669 27174 47 37467 5706 829 12831
NM_138735chr2140 ------
NM_138766chr52571 78 ------
NM_138782chr512065 ------
NM_138821chr52571 78 ------
NM_138822chr52571 78 ------
NM_138959chr186746 6263 5867 5281 2271 2182 999 914 ------
NM_138970chr1412174 ------
NM_138971chr1112987 --21531 670 --
NM_138971chr1112987 --21531 670 --
NM_138972chr1112987 --21531 670 --
NM_138972chr1112987 --21531 670 --
NM_138973chr1112987 --21531 670 --
NM_138973chr1112987 --21531 670 --
NM_138980chr41645 ------
NM_138981chr41776 ------
NM_138982chr41645 ------
NM_138992chr216968 824 171 107 58 27 199 11089 --
NM_139046chr101218 ------
NM_139047chr10184 ------
NM_139049chr10184 ------
NM_139068chr5295 27 ------
NM_139069chr5295 27 ------
NM_139136chr122690 320 ------
NM_139166chr8--143 ----
NM_139168chr511929 ------
NM_139169chr101302 12286 --11897
NM_139207chr1232083 843 157 1861 ----
NM_139283chr122473 122 --1627 --
NM_139316chr71873 11006 ----
NM_139321chr2043559 2899 2872 1190 12879 23262 3208 1683
NM_144571chr466615 5370 4964 4836 4745 4561 16419 16828 24577 1646
NM_144578chr1441982 1193 491 273 --15262 --
NM_144583chr23403 181 88 1283 ----
NM_144590chr1042730 2391 981 421 12419 --12647
NM_144599chr1544874 3927 3486 85 11581 13553 --
NM_144600chr16--129 ----
NM_144604chr16179 ------
NM_144628chr2032463 1129 823 ------
NM_144633chr311483 --21404 291 --
NM_144642chr341354 1149 429 130 --2452 150 --
NM_144657chrX2493 32 ------
NM_144664chr1122449 1970 --12268 12181
NM_144703chr2021090 862 ------
NM_144778chr136882 741 567 322 308 129 ------
NM_144949chr221852 739 22473 2294 ----
NM_144963chr821998 731 1611 ----
NM_144973chr1264683 4542 1334 1316 583 518 14965 13922 --
NM_144974chr13--1117 ----
NM_144982chr12------123
NM_145008chr112805 717 ------
NM_145049chr521006 677 ------
NM_145056chr191145 ------
NM_145117chr1153019 2722 1120 1012 856 --11052 13302
NM_145176chr663574 3194 2322 1140 517 312 1204 ----
NM_145206chr1042751 2394 2259 840 --22074 980 --
NM_145207chr465266 5061 5055 4828 3524 1912 --14287 --
NM_145251chr1421015 443 11146 --11345
NM_145259chr266251 5025 2070 1961 1671 92 36351 5532 693 12580 --
NM_145274chr172677 344 ------
NM_145280chr23328 88 52 ------
NM_145320chr773334 3178 3010 2827 1189 1129 789 12757 1654 --
NM_145321chr773334 3178 3010 2827 1189 1129 789 12757 1654 --
NM_145322chr773334 3178 3010 2827 1189 1129 789 12757 1654 --
NM_145341chr101614 2539 473 123 --
NM_145686chr243221 2740 677 39 22419 740 ----
NM_145687chr243221 2740 677 39 22419 740 ----
NM_145698chr1012058 --22023 613 --
NM_145756chr1821315 439 ------
NM_145799chrX5970 784 481 378 40 ------
NM_145810chr2--11240 --1500
NM_145858chr211413 ----1456
NM_147175chrX21748 290 ------
NM_148174chr862058 1916 1846 1623 368 230 ------
NM_148571chr1741902 511 318 274 --11341 --
NM_148904chr11552 ----1214
NM_148905chr11552 ----1214
NM_148906chr11552 ----1214
NM_148907chr11552 ----1214
NM_148908chr11552 ----1214
NM_148909chr11552 ----1214
NM_148921chr1742147 1948 659 232 --1402 --
NM_152132chr141106 ------
NM_152261chr1252290 928 578 434 280 1999 ----
NM_152263chr155585 4375 3812 2239 1470 15983 ----
NM_152275chr241737 703 513 94 ------
NM_152280chr132470 1355 171 ------
NM_152300chr1741835 1608 1460 1234 --185 --
NM_152309chr1051996 1647 1491 363 50 --11693 --
NM_152330chr1431830 792 67 --12271 --
NM_152371chr121729 625 ------
NM_152391chr231042 827 308 ------
NM_152408chr5262 44 ------
NM_152409chr512333 1300 --12868
NM_152418chr841822 629 207 161 --1392 --
NM_152422chr931577 1291 732 1460 11407 --
NM_152437chr1252083 1651 1634 991 956 --22324 2316 --
NM_152450chr1522085 160 123 ----
NM_152455chr15157 ------
NM_152470chr1864097 3294 3195 1503 1450 808 ----11239
NM_152478chr191490 --1461 --
NM_152542chr442137 508 363 214 ------
NM_152594chr152570 144 --11890 --
NM_152608chr112344 --22511 506 11033
NM_152622chr5174 21363 1223 ----
NM_152624chr5146935 6411 6062 5956 5565 5553 5546 5516 5302 5281 5098 4499 1917 777 37285 5653 4630 --36578 6056 4698
NM_152629chr984068 3730 2966 2708 2693 2569 1583 1207 12881 21358 834 11408
NM_152638chr1231225 816 803 ------
NM_152641chr1242649 2563 1971 685 1708 12364 182
NM_152653chr32488 161 ------
NM_152660chr13660 388 276 --1697 1756
NM_152665chr121238 1022 ----11149
NM_152678chr33507 479 434 1254 ----
NM_152707chr102982 735 ------
NM_152716chr1191393 631 605 511 262 247 237 116 21 11599 ----
NM_152723chr113967 955 54 ------
NM_152726chr132519 91 ------
NM_152745chr74885 843 781 426 ------
NM_152749chr72790 437 ------
NM_152754chr743875 3799 3099 2891 ------
NM_152756chr533885 2977 718 --13333 --
NM_152787chrX33221 1527 813 ------
NM_152789chr711145 11000 ----
NM_152835chr142693 2444 2152 2025 12482 ----
NM_152838chr2073535 1255 1145 885 748 538 462 --33409 1087 557 13088
NM_152857chr6------1341
NM_152858chr6------1341
NM_152860chr1221534 402 --1963 --
NM_152866chr1111541 11556 11749 --
NM_152890chr131127 1097 420 ------
NM_152924chr1556226 5857 2734 2535 245 --12305 --
NM_152990chr641149 1017 841 31 --1856 --
NM_153029chr1693929 3268 3132 1287 1177 1144 1110 851 529 1408 --11316
NM_153035chr112693 ----12313
NM_153184chr321558 522 --11517 --
NM_153188chr574250 4113 3481 1996 1749 48 40 ------
NM_153201chr11--1215 ----
NM_153207chr1253822 3028 2903 2639 1345 --151 --
NM_153208chr161196 1749 ----
NM_153260chr1521410 211 ------
NM_153261chr16------11535
NM_153262chr162376 1172 1071 726 461 245 --32901 2115 138 --
NM_153353chr3138 ------
NM_153354chr52651 313 ------
NM_153371chr1332303 360 202 ------
NM_153374chr152442 192 --1133 --
NM_153464chr19------1334
NM_153607chr533062 2288 2089 1418 ----
NM_153616chr151863 ------
NM_153617chr151863 ------
NM_153618chr151863 ------
NM_153620chr731489 1334 1135 --11384 --
NM_153633chr122528 239 ------
NM_153634chr12--1584 ----
NM_153675chr202220 160 ------
NM_153748chr122690 320 ------
NM_153759chr211178 --1227 --
NM_153810chr1044900 4013 1508 525 11110 24730 4300 --
NM_153828chr21307 ------
NM_170606chr741755 1606 150 135 ------
NM_170665chr122926 488 11773 --11277
NM_170672chr231463 1386 1342 --1682 --
NM_170692chr12739 225 ------
NM_170721chr1731210 450 113 ------
NM_170731chr1142595 2197 2179 146 --12844 --
NM_170732chr1142595 2197 2179 146 --12844 --
NM_170733chr1142595 2197 2179 146 --12844 --
NM_170734chr1142595 2197 2179 146 --12844 --
NM_170735chr1142595 2197 2179 146 --12844 --
NM_170750chrX2358 200 --1268 --
NM_171827chr23279 86 63 ------
NM_172058chr821555 134 ------
NM_172059chr821555 134 ------
NM_172060chr821555 134 ------
NM_172071chr157026 5760 5700 2816 722 15732 26998 1557 11050
NM_172103chr632257 1668 201 1100 1465 --
NM_172105chr632257 1668 201 1100 1465 --
NM_172110chr20------1461
NM_172111chr20------1461
NM_172112chr20------1461
NM_172113chr20------1461
NM_172238chr6134 ------
NM_172373chr131405 ------
NM_173075chr411414 --1406 --
NM_173083chr12465 51 --1499 --
NM_173157chr121205 ------
NM_173177chr21268 ------
NM_173198chr93884 639 630 22708 429 ----
NM_173200chr93884 639 630 22708 429 ----
NM_173214chr1688063 6642 5290 2375 2115 1068 998 669 27174 47 37467 5706 829 12831
NM_173359chr31714 157 ----
NM_173469chr1531338 1100 1038 ------
NM_173470chrX21039 198 --12265 --
NM_173495chrX52058 545 184 84 36 12301 --22148 2008
NM_173500chr151924 11232 ----
NM_173508chr111157 --1116 --
NM_173511chr263756 3606 3417 3367 2789 1505 --23696 2587 --
NM_173517chr71182 ------
NM_173531chr1943120 2943 2538 29 13247 ----
NM_173557chr181488 ------
NM_173576chr1052317 2177 1684 1479 747 ------
NM_173582chr1196056 5048 4373 3969 2338 1812 1803 1552 333 13849 ----
NM_173602chr1253764 3139 3093 2360 735 ----13615
NM_173631chr1941280 1222 334 250 ------
NM_173642chr157223 6535 3179 1625 626 19192 ----
NM_173647chr231083 718 186 ------
NM_173670chr51196 1142 ----
NM_173683chr821760 1447 ------
NM_173797chr53533 424 103 ------
NM_173808chr11818 14484 23037 1030 --
NM_173830chr61235 ------
NM_173848chr8------1261
NM_173854chr11549 12348 ----
NM_173872chr42835 270 ------
NM_174916chr1551960 1749 919 691 428 ------
NM_174934chr1172776 2378 2280 1096 820 552 122 21295 391 1148 11252
NM_175061chr711555 11683 11487 11595
NM_175573chr20185 ------
NM_175607chr3--11196 ----
NM_175612chr3--11196 ----
NM_175629chr211178 --1227 --
NM_175748chr1432077 1821 856 ------
NM_175767chr531774 1257 538 ------
NM_175854chr1342442 2372 1807 952 12721 ----
NM_175856chr52632 123 1130 ----
NM_175907chr1832604 486 403 ------
NM_175931chr1612048 --11942 --
NM_176081chr1064631 4450 4360 2380 1537 950 --25051 4492 --
NM_176083chr1064631 4450 4360 2380 1537 950 --25051 4492 --
NM_176814chr711384 11277 ----
NM_177398chr111213 --1215 --
NM_177399chr111213 --1215 --
NM_177414chr151585 1120 432 250 54 --1218 1562
NM_177424chr151917 1841 144 107 59 12097 ----
NM_177438chr1463559 1504 1368 930 691 641 --1442 12836
NM_177559chr2011058 ------
NM_177560chr2011058 ------
NM_177974chr1532005 770 440 12331 ----
NM_177990chr201668 1171 --11774
NM_177995chr931577 1291 732 1460 11407 --
NM_178011chr1033263 3089 700 11283 12365 --
NM_178140chr552410 2134 1827 1727 29 ------
NM_178151chrX107484 7019 6971 6684 6586 5756 4817 1395 848 338 ------
NM_178152chrX107484 7019 6971 6684 6586 5756 4817 1395 848 338 ------
NM_178153chrX107484 7019 6971 6684 6586 5756 4817 1395 848 338 ------
NM_178423chr7--1888 --1447
NM_178425chr7--1888 --1447
NM_178498chr1152976 1045 816 570 299 23386 602 --13755
NM_178566chr951590 1537 1385 82 30 11627 1113 --
NM_178586chr1472435 2255 1805 925 519 467 39 ------
NM_178812chr82585 226 --1648 --
NM_180989chr1311519 --1347 --
NM_181077chr1522234 1882 ----11656
NM_181354chr841485 1419 1108 186 --1527 --
NM_181358chr143512 3314 820 194 --13104 --
NM_181443chr2032565 2118 1121 32475 1872 132 --12614
NM_181457chr211251 1284 ----
NM_181458chr211384 1417 ----
NM_181459chr211150 1183 ----
NM_181460chr211197 1230 ----
NM_181481chr1896949 6839 6516 4373 2506 2438 2173 1167 634 ------
NM_181482chr1896949 6839 6516 4373 2506 2438 2173 1167 634 ------
NM_181483chr1896949 6839 6516 4373 2506 2438 2173 1167 634 ------
NM_181486chr121342 ------
NM_181504chr533193 1492 1398 --23627 3423 12762
NM_181521chr1686394 4803 4610 2406 2118 542 249 72 ----1966
NM_181523chr533193 1492 1398 --23627 3423 12762
NM_181524chr533193 1492 1398 --23627 3423 12762
NM_181527chr201317 1111 ----
NM_181528chr201372 1166 ----
NM_181670chr121161 21354 1288 ----
NM_181672chrX41435 1267 528 347 ------
NM_181673chrX41435 1267 528 347 ------
NM_181674chr5------1166
NM_181675chr5------1166
NM_181676chr5------1166
NM_181677chr5------1166
NM_181678chr5------1166
NM_181705chr553557 2264 851 816 24 --21915 68 1415
NM_181714chr621369 368 ----1509
NM_181746chr12957 117 ------
NM_181838chr541402 1311 482 63 --1242 --
NM_181861chr122600 548 22517 2387 ----
NM_181868chr122600 548 22517 2387 ----
NM_181869chr122685 633 22602 2472 ----
NM_182485chr41916 11054 ----
NM_182493chr1623803 658 1645 ----
NM_182503chr6105082 4929 4698 4547 4349 4151 3514 2251 644 525 12015 --24919 665
NM_182522chr34921 887 372 284 ----1995
NM_182540chrX1678 ------
NM_182551chr242747 2580 1358 1215 153 ----
NM_182607chrX21742 356 11429 ----
NM_182646chr41916 11054 ----
NM_182666chr32640 216 --1130 --
NM_182691chr72552 188 11431 ----
NM_182692chr72552 188 11431 ----
NM_182700chr761691 1483 1299 734 589 49 ------
NM_182703chr1511474 11293 ----
NM_182706chr8172 ------
NM_182744chr111298 --1821 --
NM_182762chr745495 2423 1611 938 11035 --14248
NM_182763chr122624 2594 --1837 --
NM_182767chr1231678 1554 416 ------
NM_182789chr52972 341 ------
NM_182830chr1422150 59 ------
NM_182898chr766282 6166 6010 5126 1536 107 15069 ----
NM_182899chr766282 6166 6010 5126 1536 107 15069 ----
NM_182918chr2111321 1306 1176 1277
NM_182920chr311161 ------
NM_182931chr71613 ------
NM_182936chr1421340 686 ----1176
NM_182948chr152571 1992 916 648 520 12791 --1817
NM_182964chr1153019 2722 1120 1012 856 --11052 13302
NM_182976chr11808 145 ----
NM_183002chr1421340 686 ----1176
NM_183004chr1473673 3309 2711 1115 620 440 421 22725 2500 12966 --
NM_183047chr20----1774 --
NM_183048chr20----1774 --
NM_183065chr1741049 889 859 820 --1288 --
NM_183238chr1273371 3301 3069 2948 923 565 475 ------
NM_183323chr52972 341 ------
NM_183398chr51519 ----21362 1004
NM_183399chr51519 ----21362 1004
NM_183400chr51519 ----21362 1004
NM_183401chr51519 ----21362 1004
NM_183419chr821324 1236 1301 ----
NM_183422chr132903 370 ----1946
NM_184234chr20--1594 ----
NM_194247chr242885 1557 1316 26 14128 1811 --
NM_194282chr432994 2775 104 --12688 --
NM_194285chr1132163 1361 422 1480 ----
NM_194286chr1275820 5283 5256 4699 1591 564 353 16225 ----
NM_194314chr1105675 5667 5629 5588 4613 3888 3510 3469 1858 113 22172 1730 ----
NM_194328chr921238 170 1756 ----
NM_194329chr921238 170 1756 ----
NM_194330chr921238 170 1756 ----
NM_194332chr921238 170 1756 ----
NM_194434chr1895329 4993 2074 1933 1862 1232 926 322 248 15112 21735 1003 1744
NM_194435chr61643 --191 1222
NM_194442chr121486 1250 11139 --1283
NM_194449chr181630 ------
NM_197941chr542966 1992 1892 893 --12699 --
NM_198074chr121407 1220 ----11202
NM_198086chr1451968 1407 473 352 113 ------
NM_198087chr1631514 510 64 ------
NM_198088chr1631514 510 64 ------
NM_198128chr1832022 690 496 --12327 --
NM_198151chr7----1624 --
NM_198158chr31525 ------
NM_198159chr31525 ------
NM_198177chr31525 ------
NM_198178chr31525 ------
NM_198217chr13--1896 ----
NM_198218chr13--1896 ----
NM_198219chr13--1896 ----
NM_198243chr151979 1218 134 --
NM_198268chr143512 3314 820 194 --13104 --
NM_198269chr143512 3314 820 194 --13104 --
NM_198270chrX23404 212 12853 ----
NM_198336chr741617 603 485 104 ------
NM_198390chr164602 483 126 80 ----11614
NM_198391chr2051399 1309 1005 302 76 ----11501
NM_198395chr52826 192 ------
NM_198401chr821486 314 ------
NM_198465chrX22452 1864 ------
NM_198467chr71219 ------
NM_198468chr631537 1375 1362 13091 1999 --
NM_198472chr101263 ------
NM_198503chr132340 2227 459 ------
NM_198513chr821393 1287 ------
NM_198549chr132369 2069 167 ------
NM_198581chr2136451 6012 5767 5492 5440 5385 4863 4703 2109 1492 1345 675 50 11560 --25795 2466
NM_198793chr363455 3351 1386 653 595 307 13147 22626 1114 --
NM_198794chr1441440 371 265 242 11202 ----
NM_198859chr384837 4635 4622 4371 3906 436 266 175 --13229 --
NM_198896chr1112165 11981 1487 2843 676
NM_198901chr721282 1131 ------
NM_198902chr151189 1239 --1700
NM_198935chr2032881 2355 2061 ------
NM_198956chr761691 1483 1299 734 589 49 ------
NM_198995chr182526 478 ------
NM_199000chr711420 --11964 1433
NM_199051chr11111 ------
NM_199053chr41201 ------
NM_199144chr202997 57 ----21527 535
NM_199160chr932071 227 149 1458 ----
NM_199169chr2033043 2467 279 ------
NM_199170chr2033043 2467 279 ------
NM_199171chr2033043 2467 279 ------
NM_199185chr5141 ------
NM_199188chr1223043 2783 1989 11476 --
NM_199190chr1223043 2783 1989 11476 --
NM_199192chr21107 ----1448
NM_199193chr21107 ----1448
NM_199203chr202997 57 ----21527 535
NM_199205chr81293 ------
NM_199229chr221168 406 2558 300 ----
NM_199324chr472809 2739 1166 1068 1012 650 630 13370 ----
NM_199420chr32108 21 ------
NM_199423chr162426 166 ------
NM_199436chr21749 1445 31117 1111 116 12113
NM_199461chr1093302 3220 3121 2949 1169 900 694 636 126 12871 --13088
NM_199462chr144838 1501 1131 443 14904 --13166
NM_199478chrX41579 1497 409 143 ------
NM_199482chr231989 1517 445 --11592 --
NM_199483chr201217 ------
NM_201266chr222364 2000 12330 42444 2269 605 286 --
NM_201279chr222364 2000 12330 42444 2269 605 286 --
NM_201432chr17126591 5201 4857 4718 4428 3985 2295 2023 1027 818 292 28 15683 24992 1000 --
NM_201433chr17126591 5201 4857 4718 4428 3985 2295 2023 1027 818 292 28 15683 24992 1000 --
NM_201434chr17------1214
NM_201437chr8----11004 --
NM_201570chr104490 223 76 43 ----1653
NM_201571chr104490 223 76 43 ----1653
NM_201572chr104490 223 76 43 ----1653
NM_201590chr104490 223 76 43 ----1653
NM_201591chr421508 259 11730 ----
NM_201592chr421508 259 11730 ----
NM_201593chr104490 223 76 43 ----1653
NM_201596chr104490 223 76 43 ----1653
NM_201597chr104490 223 76 43 ----1653
NM_201624chr131126 248 217 ----124
NM_202002chr122658 581 ------
NM_203283chr4----1627 --
NM_203284chr4----1627 --
NM_203327chr2033060 1319 265 13230 --11449
NM_203342chr122437 1404 --1444 --
NM_203343chr122437 1404 --1444 --
NM_203350chr1173 11422 --1674
NM_203394chr1252323 1695 531 262 96 21726 85 ----
NM_203437chr23727 691 365 ----1183
NM_203444chr121273 ------
NM_203446chr2162818 1111 1085 408 264 195 22483 2460 ----
NM_203459chr142387 929 918 881 ------
NM_203463chr274147 3275 3028 1723 845 246 154 --2921 511 --
NM_203487chr13----21772 179 --
NM_203504chr452253 1874 923 299 23 ------
NM_203505chr452253 1874 923 299 23 ------
NM_205768chr14773 611 269 87 11956 ----
NM_205848chr142082 614 432 306 12286 21869 250 --
NM_205860chr163130 2349 1140 913 894 617 --12009 1995
NM_206594chr122998 850 --13340 --
NM_206595chr122998 850 --13340 --
NM_206832chr171218 ------
NM_206853chr6103979 2964 2801 2608 1629 1591 1524 1167 846 838 23304 367 1418 13545
NM_206854chr685240 4225 4062 3869 2107 2099 1194 540 44565 3518 1628 1281 23744 1679 14806
NM_206855chr686205 5190 5027 4834 3855 2159 1505 716 35530 4483 2246 24709 733 15771
NM_206866chr2122750 534 --31221 1204 463 --
NM_206907chr523231 2121 ----1928
NM_206909chr887012 6221 5866 3186 3041 1289 1261 962 17249 47820 7809 5076 1540 27403 7094
NM_207015chr31309 1756 11509 --
NM_207123chr42577 349 ----1895
NM_207303chr1053897 3579 1396 1075 65 11105 ----
NM_207304chr1361042 769 628 454 209 195 ------
NM_207325chr1951937 1403 708 477 182 --1125 11821
NM_207337chr123886 782 153 31105 361 122 ----
NM_207406chr4106219 5983 5715 5389 5365 4610 4377 1855 62 34 16487 11489 22448 2068
NM_207422chrX4983 556 366 209 ------
NM_207520chr21307 ------
NM_207521chr21307 ------
NM_207647chr931950 717 650 ----1417
NM_212460chr72716 474 --1687 --
NM_212467chr1562566 1705 895 885 294 195 --11765 --
NM_212471chr1722101 1399 12274 1212 --
NM_212472chr1722101 1399 12274 1212 --
NM_212535chr161124 ------
NM_213589chr255083 4725 4257 2029 717 ------
NM_213594chr121371 ------
NM_213609chr31885 2865 705 2960 848 --
NM_213654chr311498 ----1272