TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3117-5p
miRNA Sequence: AGACACUAUACGAGUCAUAU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000332chr686997 6249 5597 5184 4905 1492 494 189 1876 --26550 334
NM_001005473chr576537 4946 4354 4252 4164 2251 299 --34648 2608 624 1228
NM_001008539chr875391 5297 5117 4508 653 341 308 33295 1392 293 25104 514 --
NM_001008925chr412182 ----33196 422 302
NM_001009899chr346232 6199 1918 210 --1948 15974
NM_001011666chr765455 5065 2133 1816 1586 1237 26242 4138 --1459
NM_001013620chr1247327 7290 3142 1053 25944 843 37372 7175 2041 --
NM_001039618chr1125091 136 --34771 3994 1257 12032
NM_001039840chrX75648 5604 4675 1990 1431 1211 279 --14458 --
NM_001100108chr188173 7794 7676 6695 3178 1819 871 611 18275 --17345
NM_001106chr3128308 8092 7383 6358 6093 3392 2976 2906 2748 2173 2158 1900 39617 7544 3554 26112 2852 18624
NM_001204chr247423 7155 6413 6154 --1404 26046 1029
NM_001616chr262695 1106 1038 750 502 307 --12398 1817
NM_002025chrX68624 7872 7218 3047 887 731 28107 7280 26982 6722 12042
NM_002310chr544028 1803 1430 147 --45475 5349 565 56 --
NM_002737chr1764658 1687 984 861 641 223 16063 15742 15206
NM_003046chr875391 5297 5117 4508 653 341 308 33295 1392 293 25104 514 --
NM_003199chr1874911 4681 4441 4419 1644 1297 1191 25248 1166 1487 --
NM_003463chr622202 1213 --23096 2425 12898
NM_003583chr1233165 2657 255 ----33011 2807 326
NM_003590chr243282 2483 790 357 --1381 12929
NM_003799chr1873927 3219 1195 1171 470 399 322 23811 1279 11160 21757 1387
NM_003939chr1042870 2654 731 475 23800 3476 22944 355 13550
NM_004500chr1431895 1366 455 11803 --1550
NM_004501chr143286 3142 1628 871 --33247 2940 326 14036
NM_004904chr765455 5065 2133 1816 1586 1237 26242 4138 --1459
NM_005497chr1765999 4655 2452 2269 1562 185 45889 5045 3807 1883 ----
NM_005941chr843832 2779 1499 748 44111 4060 3469 3458 ----
NM_006482chr1233165 2657 255 ----33011 2807 326
NM_006544chr1465116 4052 2277 1259 884 332 41986 1738 1482 29 26035 1240 --
NM_006629chr1842088 1764 1735 29 12866 11971 22144 1994
NM_007249chr13129072 9049 8485 8002 7832 7655 7479 6654 3549 1439 1113 824 39226 6286 86 39243 9007 7367 --
NM_007331chr442484 1886 529 213 1361 11978 12125
NM_012252chr755307 4014 3822 1129 317 24349 347 15139 1175
NM_012262chr154561 4435 4169 1540 176 14569 24590 4497 1591
NM_012288chr695635 5521 5403 4496 3782 1988 1127 1075 670 24866 4118 --11722
NM_014011chr212034 22593 87 --1120
NM_014491chr7------2672 393
NM_014494chr1632401 2362 585 1453 --11991
NM_014906chr1784081 3706 3335 2560 1461 1145 359 163 1574 --23228 1362
NM_015026chr1284151 4039 3653 3212 1837 1437 382 310 13424 13834 12959
NM_015156chr1443616 2974 2939 28 22772 649 22916 901 12658
NM_015310chr868067 7245 6629 5628 3117 2991 --46473 2897 2238 1645 26909 5394
NM_015436chr4------33015 241 121
NM_015879chr1878025 6687 5737 5661 3139 2618 2007 26553 3002 23177 899 13048
NM_015886chr823681 3589 --24038 145 24822 4085
NM_016260chr247403 6754 6019 4875 2969 155 24858 2666 --
NM_016575chr1223730 80 ----24363 4328
NM_017637chr998916 6733 6080 3309 2475 2386 1562 1192 901 16477 --1979
NM_018440chr888105 7271 6089 3181 1867 1240 776 40 11462 15959 --
NM_019590chr1011068 --2567 203 1457
NM_020718chr1675904 5358 4760 4549 4511 2408 21 11102 25656 4806 16052
NM_020766chrX64517 2949 1092 647 425 287 --13526 13155
NM_020772chr1748564 5494 3433 2544 28516 6813 16799 16035
NM_020951chr195875 725 672 663 646 ----11693
NM_021813chr644542 1588 1337 672 --14325 25812 747
NM_021961chr1187173 5534 5265 4822 4643 2032 1557 637 16505 --11268
NM_021964chr331798 1227 479 15461 --24935 730
NM_022459chr1376313 5897 4406 4382 4225 1894 394 35285 2516 194 14412 --
NM_024947chr3169289 9279 9192 8909 8518 7348 7237 6836 6259 6182 6159 5851 3381 3052 2847 1424 27707 6110 26266 769 --
NM_024989chr2108194 8098 6369 5869 5705 5158 5140 4977 1952 192 16056 ----
NM_025054chr854179 3714 3250 1109 1032 --12593 1419
NM_030806chr1127394 7153 3043 2245 2224 2086 2074 1202 1103 804 492 151 16801 16107 --
NM_030817chr1263674 3650 2985 1337 1285 938 13558 11487 12321
NM_031314chr1431895 1366 455 11803 --1550
NM_031844chr143286 3142 1628 871 --33247 2940 326 14036
NM_032128chr4------2932 899
NM_032352chr1421085 983 11317 --2439 41
NM_033285chr864496 2711 1542 1345 265 255 ----13645
NM_033505chr276574 5980 4183 2594 2223 1411 1146 16506 15809 --
NM_033637chr1042870 2654 731 475 23800 3476 22944 355 13550
NM_053053chr1197 --2916 282 1862
NM_133646chr263659 3648 3404 3382 1254 834 24948 1422 --25535 3933
NM_144949chr212034 22593 87 --1120
NM_145259chr232456 1444 555 11152 16866 16272
NM_148898chr7------2672 393
NM_148899chr7------2672 393
NM_152624chr586038 5535 5251 2837 2322 2004 214 61 27106 1529 37005 5299 1216 14598
NM_172071chr156884 4826 4754 851 783 --27357 6346 15293
NM_177951chr142181 93 --187 1725
NM_181489chr396462 4907 4873 4462 2304 2101 1897 1699 713 25051 4651 24615 1018 11858
NM_182762chr765834 1615 1275 1131 450 47 25953 358 24842 850 14560
NM_182898chr765455 5065 2133 1816 1586 1237 26242 4138 --1459
NM_182899chr765455 5065 2133 1816 1586 1237 26242 4138 --1459
NM_194314chr124231 3871 24090 3668 --14529
NM_199324chr463728 3679 3625 3112 2653 764 13574 2380 314 --
NM_206909chr868067 7245 6629 5628 3117 2991 --46473 2897 2238 1645 26909 5394
NM_207325chr192145 21 21907 686 1474 1761