TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3119
miRNA Sequence: UGGCUUUUAACUUUGAUGGC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr571330 1172 1020 435 416 200 132 ------
NM_000024chr51517 ------
NM_000052chrX43122 2565 2272 774 --22477 333 --
NM_000081chr151388 1358 510 409 128 ------
NM_000084chrX66869 6442 4843 4462 1274 299 86434 6144 5579 4528 1393 1245 862 472 14481 34621 4602 388
NM_000088chr173983 465 210 ----197
NM_000092chr283610 1504 1346 1001 755 628 450 288 13435 --2806 307
NM_000093chr951719 1698 976 807 475 11849 11941 12020
NM_000108chr741910 1789 565 332 ----1224
NM_000109chrX32076 429 290 1862 21710 1675 11690
NM_000112chr5135488 5276 4788 4740 4437 3788 3372 1554 1296 1236 1223 1095 716 3982 626 473 ----
NM_000115chr1372438 2054 1746 801 586 227 213 --1626 --
NM_000125chr694095 3508 3479 2985 1530 1253 828 680 538 1460 ----
NM_000141chr101133 ------
NM_000146chr191134 ------
NM_000151chr1751909 1773 1757 1179 526 130 11751 21200 432
NM_000163chr572175 2116 874 707 650 342 23 --11901 12027
NM_000167chrX31707 1161 583 21741 1199 1464 --
NM_000176chr5183761 3712 3634 3498 3340 2863 2758 2665 2504 2446 1357 1213 1034 976 461 325 178 35 23075 2702 1772 --
NM_000189chr221619 763 1635 --11984
NM_000192chr1251275 1148 1126 585 340 1968 1619 --
NM_000208chr19103869 3694 3650 3409 3275 1167 1030 411 316 63 23502 1190 14457 14685
NM_000210chr262124 2100 1795 1509 119 98 1177 2263 207 --
NM_000212chr1741909 1873 1692 1517 1949 --21560 353
NM_000214chr2041661 1491 1361 575 --1657 1206
NM_000217chr1274954 4541 1726 1183 993 687 182 21969 1348 44632 3980 1216 28 14036
NM_000220chr1191046 983 696 309 114 105 57 41 32 1746 ----
NM_000224chr12149 ------
NM_000248chr362858 2808 2707 2304 2179 670 ------
NM_000252chrX4489 242 76 40 11448 --11166
NM_000253chr41456 ----1130
NM_000264chr942605 1324 1038 553 13400 --1812
NM_000280chr114984 890 806 111 ------
NM_000291chrX----2940 699 1679
NM_000314chr1073291 3027 2823 2646 691 380 306 1936 22336 2090 --
NM_000315chr11174 ------
NM_000321chr131237 11152 21237 634 --
NM_000329chr15692 369 313 187 146 --1676 --
NM_000330chrX42223 1793 483 406 1215 31403 591 258 --
NM_000332chr6156856 6351 6234 5350 5245 5081 4538 2829 2030 1288 956 785 705 631 304 16649 1345 11734
NM_000337chr5176573 5544 5330 5067 5017 4755 4343 4045 2467 2310 2303 1819 1436 1158 1063 939 93 86399 6336 5584 4984 4893 4445 2206 1135 65095 1567 1520 963 864 40 14538
NM_000340chr341445 1431 218 155 --11334 --
NM_000344chr52546 167 ------
NM_000346chr1741803 1317 793 166 --31879 752 412 --
NM_000362chr2233277 2728 481 12826 1787 1457
NM_000368chr9164710 4164 3596 3560 3550 3248 3137 1787 1519 1213 988 848 699 499 479 75 14665 34178 1332 645 --
NM_000374chr1165 ------
NM_000390chrX83371 3215 2896 2519 2310 532 427 94 1360 32699 961 488 --
NM_000408chr263347 3304 2111 1122 660 614 12866 32926 2468 359 11232
NM_000411chr2183097 3020 2945 2436 2297 2184 1171 225 ----23211 1283
NM_000430chr1773492 3318 3232 2685 2347 1199 398 ------
NM_000434chr61404 1176 1200 --
NM_000437chr162031 1870 1847 1666 739 684 41593 1481 383 25 ----
NM_000439chr5102479 2452 2426 2378 2349 2131 1927 1584 333 308 --2570 276 11977
NM_000448chr1152636 2199 507 234 207 31271 876 323 13110 1792
NM_000449chr121276 379 1935 1594 11209
NM_000461chr374089 4036 3988 3203 3152 3085 493 24316 1546 24661 350 --
NM_000493chr661136 1073 698 191 161 40 --1396 --
NM_000495chrX1192 ----11022
NM_000516chr203226 51 29 ------
NM_000517chr16197 ------
NM_000539chr331151 631 309 41562 1370 1028 238 21430 1298 11089
NM_000541chr21126 ------
NM_000555chrX127793 7523 7106 6456 6068 2240 2081 2028 1884 1562 1072 288 37070 6610 1578 24774 2886 16418
NM_000558chr16198 ------
NM_000584chr411212 1422 ----
NM_000597chr21329 ------
NM_000599chr294540 4467 3693 3271 2883 1445 938 682 530 11773 14431 31817 1656 204
NM_000609chr1041023 951 719 437 43024 843 388 241 12226 --
NM_000610chr11103042 3018 2990 2774 2661 2500 2458 1991 1008 764 21020 166 --22467 1140
NM_000612chr1132485 854 442 22663 2502 23360 381 23867 3370
NM_000615chr1152567 2491 2112 452 38 11192 13048 --
NM_000618chr12206409 5881 5023 4805 4264 4245 3993 2413 2292 2239 2106 1996 1956 1146 1047 979 961 643 560 539 16003 26201 1090 31892 1540 304
NM_000618chr12206409 5881 5023 4805 4264 4245 3993 2413 2292 2239 2106 1996 1956 1146 1047 979 961 643 560 539 16003 26201 1090 31892 1540 304
NM_000627chr21595 ------
NM_000633chr18115008 4689 3782 1930 1799 1536 1426 1126 746 407 93 13325 --15207
NM_000663chr16102630 2340 2189 2113 1954 1114 839 539 89 29 32153 891 203 1868 1331
NM_000676chr172442 385 ------
NM_000685chr33778 634 151 2623 199 1164 --
NM_000685chr33778 634 151 2623 199 1164 --
NM_000689chr94515 441 421 25 ------
NM_000702chr182116 2033 1983 1882 1843 791 384 356 --1512 --
NM_000706chr122669 581 2776 756 --1354
NM_000719chr1296302 5913 5726 5017 4556 4437 4287 1323 825 45189 2327 2215 415 35424 4389 939 16580
NM_000721chr132583 826 580 21093 69 2376 327 21940 645
NM_000726chr231431 1202 403 --11225 1487
NM_000727chr17----1517 --
NM_000791chr5102717 2427 2404 2295 2212 799 689 610 536 50 1622 22601 372 12536
NM_000793chr1494367 4307 4155 1922 1489 841 86 48 37 25163 812 1221 24556 3942
NM_000794chr531009 868 113 --1971 2957 43
NM_000806chr53543 293 221 1228 21793 582 --
NM_000808chrX2834 347 21019 218 --1906
NM_000813chr585312 4850 4512 4415 1766 797 781 99 11448 --14868
NM_000814chr1563858 3389 1607 1402 898 546 1306 13123 --
NM_000817chr22192 149 1942 ----
NM_000826chr452641 2285 1968 1652 662 1694 --1973
NM_000827chr532319 681 524 ----1789
NM_000829chr1141795 1530 808 718 11634 21724 361 11608
NM_000831chr1175347 5176 5134 4994 4907 4739 4720 4697 2133 1876 1669 1654 1253 858 843 221 49 55454 2403 1055 244 157 35102 4014 383 42455 2320 2160 1903
NM_000838chr662346 2272 759 740 232 25 --3891 556 85 --
NM_000859chr551549 1486 1418 478 316 21182 1169 178 --
NM_000861chr382704 2145 2041 1790 1659 1037 734 69 1233 11957 --
NM_000872chr1051454 1184 1113 648 629 ----11409
NM_000875chr1585926 4486 4465 2285 1542 1086 831 386 22759 740 42499 2106 1710 1271 --
NM_000877chr262618 2466 1182 942 558 220 12049 22380 2348 13014
NM_000891chr1783627 3465 3388 3212 2446 772 479 360 32504 1474 458 33395 535 388 12786
NM_000899chr12114141 3527 3308 2727 1752 1429 1168 961 802 526 305 11350 21657 1559 13263
NM_000901chr462456 2183 2000 953 389 160 32339 2110 134 21878 1863 1264
NM_000910chr451980 1660 1649 250 161 --1692 --
NM_000917chr102653 178 1925 1908 --
NM_000919chr52452 186 --1515 --
NM_000922chr1131104 745 243 --139 126
NM_000926chr11219208 8391 8248 8130 7746 7392 7158 6726 6523 6229 6132 6050 3503 3275 3259 2545 2025 1982 508 242 100 69056 8032 6994 6654 6460 371 68451 7664 7404 7350 6184 3423 37529 6454 2741
NM_000937chr17--1370 ----
NM_000944chr442227 1893 1757 1499 1274 21745 357 --
NM_000945chr261279 726 702 422 230 205 2149 120 ----
NM_000949chr54646 309 253 106 ------
NM_000950chrX83173 2650 2619 2583 2388 2309 1096 569 23657 2807 --12815
NM_000953chr14101482 1340 1239 1181 1142 678 407 145 123 104 --21728 260 11532
NM_000961chr2033751 2597 194 23897 3714 1840 2426 163
NM_000975chr1134 ------
NM_000978chr17153 ------
NM_000991chr1922728 240 32903 2698 28 1334 13016
NM_001001323chr1262403 2248 453 447 257 93 --1649 --
NM_001001331chr322597 2080 32203 2032 1949 --21965 1000
NM_001001344chrX92618 2553 2407 2236 1914 1647 921 500 321 11994 ----
NM_001001389chr11103042 3018 2990 2774 2661 2500 2458 1991 1008 764 21020 166 --22467 1140
NM_001001390chr11103042 3018 2990 2774 2661 2500 2458 1991 1008 764 21020 166 --22467 1140
NM_001001391chr11103042 3018 2990 2774 2661 2500 2458 1991 1008 764 21020 166 --22467 1140
NM_001001392chr11103088 3064 3036 2820 2707 2546 2504 2037 1054 810 21066 212 --22513 1186
NM_001001395chr12152738 2653 2535 2382 2065 1971 1924 1828 1760 971 742 716 479 209 141 ------
NM_001001396chr154445 1737 1179 441 266 11352 43645 1409 793 42 11430
NM_001001419chr595098 4413 3580 2000 1883 565 480 457 410 25185 4731 ----
NM_001001420chr595098 4413 3580 2000 1883 565 480 457 410 25185 4731 ----
NM_001001436chr162304 161 ------
NM_001001481chr821380 379 --23371 289 32473 1190 494
NM_001001484chr1022342 264 22137 1809 12439 2775 719
NM_001001556chr1531487 1194 152 21418 1368 --1213
NM_001001664chr2113280 3232 1524 1431 1425 785 707 438 207 128 119 13458 ----
NM_001001668chr19104051 3565 3260 2650 1625 1530 1281 992 911 861 23823 827 23300 553 --
NM_001001684chr1731802 946 231 11635 2931 439 --
NM_001001685chr1792775 2436 2275 2102 2016 1989 1805 1067 916 12469 12637 --
NM_001001701chr472291 2109 859 576 479 428 278 2786 603 --32331 2054 415
NM_001001740chr11309 1105 ----
NM_001001740chr11309 1105 ----
NM_001001787chr12378 102 1336 ----
NM_001001870chr172180 153 1785 --1592
NM_001001928chr22178108 7721 6820 5917 5577 5377 5173 3211 3202 2741 2387 2337 2327 1868 1085 482 184 22811 2776 47275 2448 1000 974 26142 5679
NM_001001933chr11505 ------
NM_001001938chr943776 3413 3393 2978 11457 11025 24031 2783
NM_001002009chr7------1231
NM_001002010chr7------1231
NM_001002032chr175682 555 497 456 128 ------
NM_001002033chr176782 655 597 556 228 108 ------
NM_001002258chr241959 1519 1366 532 21599 120 --21539 1252
NM_001002259chr122341 62 ------
NM_001002759chr101521 ----1467
NM_001002811chr111609 ------
NM_001002812chr111609 ------
NM_001002812chr111609 ------
NM_001002814chr8113186 3140 3074 2991 1525 1054 767 710 587 406 393 1157 31356 1300 1000 11534
NM_001002860chr14104403 3523 3339 3160 3153 3017 1127 868 816 705 14382 1684 --
NM_001003407chr10124890 4539 4109 3760 3311 1758 1636 904 683 347 191 132 13813 24921 1687 --
NM_001003408chr10124890 4539 4109 3760 3311 1758 1636 904 683 347 191 132 13813 24921 1687 --
NM_001003652chr18208538 8396 7490 6880 6659 6241 6086 6064 5932 5461 3261 3161 3151 1992 1947 1182 864 586 518 97 38711 7070 6852 --38063 1309 1029
NM_001003674chr18196837 6773 6462 6336 6069 5994 5849 5507 5175 5046 4675 4466 2196 1662 1517 1503 1276 702 579 24326 1816 --46829 6299 2784 768
NM_001003675chr18196837 6773 6462 6336 6069 5994 5849 5507 5175 5046 4675 4466 2196 1662 1517 1503 1276 702 579 24326 1816 --46829 6299 2784 768
NM_001003677chr11----1594 --
NM_001003712chr1294089 2741 1329 1262 761 615 556 430 175 --11519 23580 981
NM_001003722chr931103 416 259 1883 ----
NM_001003760chr673664 2770 2668 2415 889 584 395 22782 53 ----
NM_001003792chr361094 1069 1023 932 810 156 ------
NM_001003793chr361094 1069 1023 932 810 156 ------
NM_001003800chr9133117 3031 2941 2780 2766 986 966 812 742 591 426 289 194 33713 3543 2801 1771 --
NM_001004065chr973850 3688 2873 1448 932 133 71 23165 3022 23301 2683 11075
NM_001004127chr1351002 976 965 958 338 --2841 348 1995
NM_001004317chr693988 3853 3373 2924 2827 1819 1162 247 44 13057 ----
NM_001004328chr124956 685 656 56 --1415 130
NM_001004342chr1175942 5590 5548 5440 4961 4667 4176 4013 3996 3865 2448 1922 1711 1125 1087 334 91 22118 1773 35748 5379 4977 --
NM_001004346chr421277 449 21117 86 ----
NM_001004360chr221998 1233 11399 21517 1450 --
NM_001004419chr1293824 3776 3231 1711 1114 1036 1005 108 89 1394 23524 657 11166
NM_001005266chr152740 148 1502 1271 1523
NM_001005267chr152740 148 1502 1271 1523
NM_001005268chr152740 148 1502 1271 1523
NM_001005269chr152740 148 1502 1271 1523
NM_001005353chr191256 903 882 863 402 377 251 191 83 ------
NM_001005353chr191256 903 882 863 402 377 251 191 83 ------
NM_001005366chr121324 ------
NM_001005375chrY71718 1559 1152 557 415 393 147 1439 --11270
NM_001005386chr292517 2327 2195 1953 925 881 833 730 509 12450 ----
NM_001005404chr17114526 4469 4166 3576 2764 1663 1388 1173 938 825 553 14187 11606 13895
NM_001005473chr5116652 6619 6162 5752 5337 4472 4196 1712 1391 1219 40 --36134 4966 846 --
NM_001005474chr321300 378 ----11217
NM_001005609chrX113596 3489 3073 2586 2369 2351 1453 1122 491 354 162 31521 1331 477 23182 2562 31347 1283 1230
NM_001005612chrX3178 108 102 ----157
NM_001005746chr231431 1202 403 --11225 1487
NM_001005747chr231431 1202 403 --11225 1487
NM_001005845chr851745 1618 1449 1312 104 2581 296 1468 --
NM_001006115chr372816 2491 2146 1998 1947 533 369 1712 ----
NM_001006118chrY1221 ------
NM_001006120chrY1221 ------
NM_001006610chr164982 961 321 135 1684 --1731
NM_001006617chr941220 929 316 40 ----21481 515
NM_001006619chr941220 929 316 40 ----21481 515
NM_001006620chr941220 929 316 40 ----21481 515
NM_001006621chr941220 929 316 40 ----21481 515
NM_001006634chr161182 --195 --
NM_001006635chr21259 1312 ----
NM_001006938chrX1723 --1673 1802
NM_001007023chr1494367 4307 4155 1922 1489 841 86 48 37 25163 812 1221 24556 3942
NM_001007088chrX2161 71 --11315 1148
NM_001007097chr9104755 4746 4263 3811 3753 3410 1798 1097 333 166 34541 1381 934 2990 631 14982
NM_001007157chr7128 1116 ----
NM_001007214chr181717 1362 1270 679 647 334 270 127 ------
NM_001007246chr2151815 1560 725 375 186 21460 1419 21544 218 --
NM_001007257chr12964 42 ------
NM_001007267chr24621 339 117 46 1125 ----
NM_001007277chr112820 164 --1704 1797
NM_001007466chr6144645 4084 3887 3601 3584 3521 3403 1730 1339 1146 866 503 431 131 --33731 511 221 1201
NM_001007471chr91174 1303 --1757
NM_001007526chrY1221 ------
NM_001007531chr63232 68 58 --1119 1355
NM_001007553chr11866 ------
NM_001007794chr12508 228 ----1679
NM_001008220chr5113299 3270 3188 3180 2815 1479 1082 951 485 470 265 ----23890 973
NM_001008239chr1843499 1235 859 96 --13163 --
NM_001008392chr341434 1388 1188 808 12501 2959 282 --
NM_001008405chr791573 1494 1465 1446 1159 572 545 521 114 1684 ----
NM_001008408chr7114473 4388 4333 4210 2456 2086 1951 1487 1156 622 482 42303 1613 1117 549 24669 1326 15246
NM_001008410chr292284 2167 2031 1710 1535 887 712 307 246 51595 1391 761 695 495 11547 --
NM_001008539chr8105221 5036 4675 3321 1968 1872 1805 962 869 843 33537 3287 1492 14479 13917
NM_001008541chr1092345 2202 1435 771 602 515 410 190 179 12080 41872 1522 808 563 --
NM_001008541chr1092345 2202 1435 771 602 515 410 190 179 12080 41872 1522 808 563 --
NM_001008660chr1141364 1237 1034 146 1204 2347 309 --
NM_001008701chr1963072 3034 2653 2641 2345 2013 1982 32168 546 403 13101
NM_001008723chr102453 76 ------
NM_001008738chr562437 1138 1063 927 909 594 22261 728 --1257
NM_001008744chr1451415 1161 1083 562 93 ----11616
NM_001008801chr1931780 191 121 ----1602
NM_001008895chr1341074 905 567 507 --1322 21120 495
NM_001008925chr472996 2563 2431 2202 869 824 232 2437 384 11037 13322
NM_001009554chr473787 3523 2900 1591 1220 1076 378 1864 12881 --
NM_001009554chr473787 3523 2900 1591 1220 1076 378 1864 12881 --
NM_001009899chr386146 6082 5161 4964 4625 790 728 534 54801 4469 722 510 147 22300 1644 --
NM_001009959chr222647 419 42181 2166 2151 800 21833 193 146
NM_001009960chr752779 2671 2287 1804 102 ----1357
NM_001009993chr294520 4374 4242 3961 1557 1458 1150 709 433 1624 2858 319 13407
NM_001010846chr154173 3508 1604 1289 1103 ----22908 126
NM_001010853chr652714 2555 2378 2122 532 22789 499 1378 --
NM_001010861chr162611 2449 2320 2124 1700 225 42241 2029 1100 455 1854 12348
NM_001010862chrX163324 3151 3091 2978 2899 2416 2084 1322 1086 887 868 795 508 456 234 58 ----13060
NM_001010888chrX53240 3066 2950 854 780 2951 845 23607 1464 --
NM_001010891chr5116169 5874 5812 5801 5393 5029 2155 1799 1581 528 319 45838 2020 1753 28 26226 987 --
NM_001010922chr1124044 3951 3630 3601 3453 3370 1688 1426 1056 1048 947 93 11010 ----
NM_001010986chrX62006 1635 1611 200 169 33 21743 1000 21621 1583 --
NM_001011515chr421019 362 ------
NM_001011516chr421019 362 ------
NM_001011537chr342325 1817 952 560 11542 ----
NM_001011551chrX--1144 ----
NM_001011554chr2031647 624 200 12107 ----
NM_001011657chrX21161 365 1425 2476 178 --
NM_001011666chr7106217 5682 5371 4901 4473 2195 2182 969 734 33 15532 16132 35669 5500 4930
NM_001011708chr2122970 2740 2609 2552 2467 1961 1098 878 624 569 247 42 ------
NM_001011713chr1431569 649 270 --21522 370 1352
NM_001012270chr1771961 1826 1672 1647 1463 727 252 1565 --11606
NM_001012271chr1772064 1929 1775 1750 1566 830 355 21293 668 --11709
NM_001012393chr1174008 3743 1868 1790 1283 1118 424 34696 3147 1087 21543 1235 --
NM_001012420chr1562801 2769 2582 2019 1086 21 1910 1549 12253
NM_001012423chr1552801 2769 2582 2019 1086 1910 1549 12253
NM_001012661chr11------1152
NM_001012753chr197895 812 458 374 271 189 106 --123 --
NM_001012755chrX134549 4279 4106 3801 3553 3541 3296 3131 1607 1100 620 175 168 44510 3589 893 238 14308 24036 4016
NM_001012761chr572229 2068 1966 1884 594 577 266 ------
NM_001012968chrX62708 2555 848 795 625 246 ------
NM_001013031chr1083408 3319 3174 2755 2412 2181 1187 371 13156 ----
NM_001013251chr11------1152
NM_001013406chr731479 584 530 ----11249
NM_001013415chr431301 1022 231 --2539 492 21365 471
NM_001013620chr12198453 7857 7258 7234 6944 6834 6783 6583 6428 6342 6157 3009 2721 2310 1744 499 381 278 185 22026 1357 1206 38394 2069 1497
NM_001013699chr121143 ------
NM_001013746chr7102061 2000 1650 1459 900 578 494 466 414 77 ----1303
NM_001014380chr1355347 4480 3824 3806 1863 ----34577 4327 1266
NM_001014797chr10138019 7973 6563 6552 3303 3261 3253 3109 2318 1915 1549 1289 163 66720 6650 5385 2109 1816 747 46625 5352 2682 1325 25395 2935
NM_001015877chrX82904 2871 2623 2188 1074 540 368 315 --1897 --
NM_001015880chr1071454 1155 635 524 337 216 125 1185 --11230
NM_001015892chr51170 ------
NM_001017371chr231339 1232 1126 --1365 1891
NM_001017387chr161376 ------
NM_001017389chr161376 ------
NM_001017390chr161376 ------
NM_001017391chr161376 ------
NM_001017395chr3103039 3033 2442 2245 1441 1391 1258 992 619 613 --13105 --
NM_001017405chr41239 ------
NM_001017424chr141776 1697 705 296 31945 1844 1822 11339 --
NM_001017425chr141776 1697 705 296 31945 1844 1822 11339 --
NM_001017434chr11269 ------
NM_001017440chr7248269 7861 7697 7637 7038 7011 6737 6587 6496 6349 6331 6124 5380 3257 3225 3147 3118 2813 2477 2243 1542 776 728 692 58036 7025 6577 1888 552 25924 1833 --
NM_001017922chr151741 1531 1453 532 473 1460 21434 694 1629
NM_001017926chr861852 1662 1474 697 539 119 --11312 --
NM_001017962chr102653 178 1925 1908 --
NM_001017999chr152340 1866 1804 1677 1546 ----11910
NM_001017999chr152340 1866 1804 1677 1546 ----11910
NM_001018000chr152340 1866 1804 1677 1546 ----11910
NM_001018000chr152340 1866 1804 1677 1546 ----11910
NM_001018001chr152340 1866 1804 1677 1546 ----11910
NM_001018025chrX3795 217 203 ----2784 325
NM_001018037chr9------11336
NM_001018050chr2252162 1391 1181 1168 493 33196 590 125 23233 2467 22241 1108
NM_001018052chr2252162 1391 1181 1168 493 33196 590 125 23233 2467 22241 1108
NM_001018057chr1111430 ------
NM_001018064chr952010 1979 1387 623 139 11990 1360 11608
NM_001018065chr9104420 4157 3949 2425 2266 2213 1781 1757 1232 1125 36046 1485 1048 13748 --
NM_001018066chr9104420 4157 3949 2425 2266 2213 1781 1757 1232 1125 36046 1485 1048 13748 --
NM_001018067chr194741 4427 4247 3628 2084 2022 1343 347 53 13669 13296 --
NM_001018068chr194741 4427 4247 3628 2084 2022 1343 347 53 13669 13296 --
NM_001018069chr194741 4427 4247 3628 2084 2022 1343 347 53 13669 13296 --
NM_001018074chr5183761 3712 3634 3498 3340 2863 2758 2665 2504 2446 1357 1213 1034 976 461 325 178 35 23075 2702 1772 --
NM_001018075chr5183761 3712 3634 3498 3340 2863 2758 2665 2504 2446 1357 1213 1034 976 461 325 178 35 23075 2702 1772 --
NM_001018076chr5183761 3712 3634 3498 3340 2863 2758 2665 2504 2446 1357 1213 1034 976 461 325 178 35 23075 2702 1772 --
NM_001018077chr5183761 3712 3634 3498 3340 2863 2758 2665 2504 2446 1357 1213 1034 976 461 325 178 35 23075 2702 1772 --
NM_001018090chr1541097 981 904 179 --2798 137 --
NM_001018102chr1541097 981 904 179 --2798 137 --
NM_001018111chr773032 2758 2722 2601 1303 1032 535 53246 2857 1473 371 355 11222 21216 256
NM_001020658chr141534 1378 1302 600 --31344 365 166 --
NM_001020658chr141534 1378 1302 600 --31344 365 166 --
NM_001020825chr571236 1187 1109 973 338 233 140 2550 177 ----
NM_001023567chr1562193 2161 2069 843 158 21 1918 1552 --
NM_001024094chr5183761 3712 3634 3498 3340 2863 2758 2665 2504 2446 1357 1213 1034 976 461 325 178 35 23075 2702 1772 --
NM_001024372chr83781 439 398 22297 413 1588 11424
NM_001024455chrX62686 2667 2497 1935 1782 909 2621 474 ----
NM_001024594chr1155 --1145 --
NM_001024599chr14904 355 78 45 21253 59 --11333
NM_001024601chr1--194 ----
NM_001024647chr12156742 5595 5495 5080 3020 2722 1845 1755 1722 1601 1301 1011 930 887 426 22624 2352 ----
NM_001024649chr542846 2748 2267 594 --1577 --
NM_001024807chr191338 ------
NM_001024855chr371610 1569 1529 433 309 242 54 ----11179
NM_001024924chr41520 ------
NM_001024947chr52786 340 ------
NM_001024948chr173262 3156 2892 2826 1394 1113 403 ----12143
NM_001024956chr11125243 5104 5084 5005 4678 4658 4260 2077 1754 1737 1107 1072 34610 3933 1189 24393 1777 --
NM_001025068chr361320 576 302 88 56 44 ------
NM_001025069chr361320 576 302 88 56 44 ------
NM_001025076chr1076095 4822 2347 2058 1071 904 108 45686 5456 4779 560 11997 24706 4513
NM_001025077chr10127453 6180 2429 2262 1466 1341 941 852 525 360 321 141 67044 6814 6137 1918 822 717 --46064 5871 4657 517
NM_001025079chr394182 3881 3566 3519 3071 2738 1151 971 116 ----13638
NM_001025108chr243980 3062 1527 1215 22666 911 2449 181 --
NM_001025233chr12102748 2609 2550 2543 2506 2392 803 493 484 93 --1307 --
NM_001025252chr873149 2942 2521 1955 862 454 281 12441 1841 12711
NM_001025253chr873149 2942 2521 1955 862 454 281 12441 1841 12711
NM_001025266chr3104193 4141 3629 3620 3324 3182 1908 1889 1504 1183 14430 21047 800 24610 3312
NM_001025356chr1272715 2386 2294 2252 1147 765 21 22692 2662 1265 --
NM_001025580chrX83646 3272 3069 2726 1361 1172 919 809 11555 23471 3439 24010 1618
NM_001025595chr431582 1319 28 ----11217
NM_001025603chr121276 379 1935 1594 11209
NM_001025616chr451413 1403 691 259 241 11803 ----
NM_001025780chr931493 1345 295 ----1404
NM_001029851chr52721 319 1701 --1814
NM_001029852chr52721 319 1701 --1814
NM_001029853chr52721 319 1701 --1814
NM_001029854chr52721 319 1701 --1814
NM_001029858chr673298 2893 2416 2345 2334 2083 273 11039 21124 139 1932
NM_001029863chr662868 2731 2131 2119 449 173 1130 ----
NM_001029875chr5102989 2289 2095 1868 1031 627 587 573 238 170 23029 1074 ----
NM_001029955chr4123468 3108 2868 2832 2802 2535 2458 2338 1053 869 373 205 22553 444 1797 --
NM_001029998chr45937 504 394 272 164 11278 ----
NM_001030006chr17142470 2461 2085 1962 1780 1717 1018 994 973 747 731 460 380 345 12246 ----
NM_001030007chr1693702 3381 3277 2829 2615 1525 1216 1000 694 --23829 3750 14040
NM_001030055chr1443180 1631 238 41 13488 21907 464 24164 3057
NM_001030272chr111408 1134 --1123
NM_001030273chr111408 1134 --1123
NM_001031679chr1293254 3216 2907 2513 1261 1147 664 550 316 12841 32800 2249 150 --
NM_001031681chr1752361 2290 2155 1914 665 2855 151 --12279
NM_001031684chr2130 11290 ----
NM_001031695chr2295164 4826 3978 3704 3518 1590 1541 1226 924 23496 1202 13899 --
NM_001031710chr751072 929 820 781 231 1788 ----
NM_001031716chr251049 1019 992 207 89 ------
NM_001031735chr191226 ------
NM_001031748chr121101 ------
NM_001031803chr171304 ------
NM_001031804chr16114284 3995 3727 3695 3047 2798 1664 1349 1140 617 413 23296 85 23577 983 --
NM_001031812chr5102363 2328 2080 1593 898 817 720 605 388 322 11517 ----
NM_001032280chr641119 1088 403 303 1291 --1506
NM_001032283chr121137 --1722 --
NM_001032284chr121137 --1722 --
NM_001032288chr2041628 1478 1385 266 ------
NM_001032296chr1362960 2896 2539 2394 2257 79 12062 --170
NM_001032380chr1011839 21363 593 --12022
NM_001032393chrX----142 --
NM_001032999chr2095375 5165 5116 5016 3523 1841 1386 1049 597 15137 21242 1068 --
NM_001033044chr12457 432 11441 ----
NM_001033056chr12457 432 11441 ----
NM_001033057chr371899 1756 1548 543 469 462 174 155 22091 498 --
NM_001033081chr141846 680 304 156 11316 1652 11616
NM_001033082chr141846 680 304 156 11316 1652 11616
NM_001033085chr22211 110 ------
NM_001033087chr2043049 361 195 22 31278 1239 1228 42837 2488 890 500 1835
NM_001033112chr52240 148 1774 2175 81 --
NM_001033117chr3104516 4345 4202 3505 3423 3193 3003 1853 1440 849 --31933 1648 597 1832
NM_001033503chr5----1336 --
NM_001033521chr202517 183 ------
NM_001033522chr202517 183 ------
NM_001033578chr8112248 2063 1989 1728 1671 1616 1558 971 893 521 179 ----1240
NM_001033602chr1332710 563 197 1230 1303 --
NM_001033723chr882329 2192 2064 1842 774 759 324 76 32726 1065 108 1117 1259
NM_001033925chr1051938 821 667 483 370 2566 243 ----
NM_001034845chr41500 --1884 --
NM_001035chr121105 150 ----11231
NM_001035003chr441453 1330 1045 250 11203 --1898
NM_001035004chr441453 1330 1045 250 11203 --1898
NM_001035260chr103629 284 111 ----1188
NM_001035511chr141826 813 358 155 --2866 576 --
NM_001035512chr151933 920 465 262 90 --1683 --
NM_001035513chr151933 920 465 262 90 --1683 --
NM_001037126chr7----148 --
NM_001037132chr752236 2133 1980 1662 1511 ------
NM_001037133chr752236 2133 1980 1662 1511 ------
NM_001037164chr741853 781 360 115 1242 31957 1285 1267 --
NM_001037165chr7138511 8124 7572 7468 3379 3248 3072 2950 2925 2919 2858 1233 762 48827 8318 6269 464 28282 6800 --
NM_001037174chr272284 2258 1733 686 439 311 61 1766 --12297
NM_001037277chr171697 1561 1266 1256 1115 493 200 --21401 155 --
NM_001037278chr171697 1561 1266 1256 1115 493 200 --21401 155 --
NM_001037290chr111755 ----1129
NM_001037317chr162611 2449 2320 2124 1700 225 42241 2029 1100 455 1854 12348
NM_001037332chr582338 2323 786 615 594 564 226 43 159 1952 --
NM_001037333chr582338 2323 786 615 594 564 226 43 159 1952 --
NM_001037334chr1862437 2108 1872 941 266 135 --32249 2081 238 --
NM_001037954chr1183202 2797 1248 1141 783 518 278 120 2986 743 22194 800 12965
NM_001039091chrX3389 159 111 ------
NM_001039111chr31154 ------
NM_001039199chr20114340 4015 3965 3463 3382 3259 1831 695 617 554 526 21931 346 24805 3112 13928
NM_001039372chr72621 72 ------
NM_001039538chr283606 3589 3505 2254 997 639 457 335 13400 13422 22888 2786
NM_001039547chr397375 6004 5908 5796 5000 4878 1695 1677 131 48082 7238 5864 509 15329 47249 6604 5479 1609
NM_001039570chr2273394 3277 3262 731 722 230 181 44327 3184 3024 3003 13709 --
NM_001039571chr2273394 3277 3262 731 722 230 181 44327 3184 3024 3003 13709 --
NM_001039577chr1104555 3664 3324 2793 1741 1635 1623 1543 704 305 33566 3419 969 1369 22936 2847
NM_001039580chr463157 1886 1588 1403 918 163 34884 3585 809 --14356
NM_001039585chr173998 3634 2594 1313 1017 504 106 --13574 --
NM_001039590chrX73862 2785 2546 1142 695 443 327 --12575 --
NM_001039591chrX73862 2785 2546 1142 695 443 327 --12575 --
NM_001039615chr84684 655 85 56 --1415 130
NM_001039618chr11135865 5724 4939 4422 3808 3735 2289 2173 1860 1503 1121 147 115 24574 4339 11941 --
NM_001039675chr151364 ------
NM_001039693chr264002 3467 1391 1156 765 513 23368 3182 33976 1467 213 --
NM_001039709chr2095375 5165 5116 5016 3523 1841 1386 1049 597 15137 21242 1068 --
NM_001039762chr1042288 504 407 171 1714 1143 1811
NM_001039840chrX94977 4891 4187 3678 2243 1428 1348 1222 1108 21046 725 35780 5074 1805 --
NM_001039846chr191226 ------
NM_001039916chr121254 --179 --
NM_001039917chr121254 --179 --
NM_001039918chr121254 --179 --
NM_001039919chr121254 --179 --
NM_001039920chr121254 --179 --
NM_001040001chr641867 1626 1459 589 ------
NM_001040020chr781276 981 613 579 279 232 90 28 ------
NM_001040108chr1443038 1249 788 638 22927 2893 23123 2667 33093 2197 1078
NM_001040110chr751807 1742 748 568 142 ----1236
NM_001040142chr241695 1612 1560 245 --1960 12421
NM_001040143chr241695 1612 1560 245 --1960 12421
NM_001040152chr784976 4458 4087 3669 3638 3316 1691 1534 11665 13568 --
NM_001040167chr741146 1128 954 833 ----1925
NM_001040181chr31758 ------
NM_001040182chr31758 ------
NM_001040183chr31758 ------
NM_001040199chr31758 ------
NM_001040200chr31758 ------
NM_001040202chr41143 2971 911 22374 598 --
NM_001040214chr6102127 1508 908 763 729 540 263 134 87 80 ------
NM_001040272chr982142 1797 1719 789 679 608 412 279 2916 883 ----
NM_001040284chr16145957 5441 5404 5330 5015 4263 4117 3796 3725 2366 1522 279 226 200 25551 5029 15319 14062
NM_001040402chr463233 3112 2852 2843 2015 2001 ------
NM_001040429chr13113630 3280 3248 2931 2302 1381 1244 1076 833 669 486 11395 23605 3083 13561
NM_001040440chr51226 ------
NM_001040441chr1115470 4424 3940 3783 1985 1896 1216 1042 773 650 447 14522 --1717
NM_001040450chr1552203 960 854 811 659 ------
NM_001040453chr1552203 960 854 811 659 ------
NM_001040610chr15146 ------
NM_001040633chr7145 --1763 --
NM_001040665chr784976 4733 4345 4199 3223 1044 817 422 24527 1213 ----
NM_001040708chr8290 78 ------
NM_001040712chr963504 2898 2256 1354 605 491 11427 13148 11020
NM_001040875chr822477 1709 --22065 576 --
NM_001040876chr431641 1216 779 --21851 1747 31587 424 144
NM_001041chr31128 ------
NM_001042355chr16155080 4869 4732 4388 4281 3831 3548 3476 1600 1437 1324 1282 1221 328 186 11740 --11231
NM_001042403chr121972 --1745 --
NM_001042404chr131726 1240 216 11599 ----
NM_001042412chr16155080 4869 4732 4388 4281 3831 3548 3476 1600 1437 1324 1282 1221 328 186 11740 --11231
NM_001042413chr984132 3937 3747 3482 3379 1475 1260 257 1451 11216 --
NM_001042414chr131114 ----140
NM_001042425chr641119 1088 403 303 1291 --1506
NM_001042453chrX61619 1613 522 499 133 43 1356 1400 11274
NM_001042473chr1092071 2041 2020 1896 1797 1772 1638 706 604 ------
NM_001042481chr1472604 2433 1817 942 678 578 273 159 1149 --
NM_001042493chr661854 1845 682 462 293 239 ------
NM_001042494chr1573154 2420 1010 337 261 197 164 21200 1066 43372 2832 99 43 --
NM_001042495chr1573154 2420 1010 337 261 197 164 21200 1066 43372 2832 99 43 --
NM_001042496chr1573154 2420 1010 337 261 197 164 21200 1066 43372 2832 99 43 --
NM_001042497chr1573154 2420 1010 337 261 197 164 21200 1066 43372 2832 99 43 --
NM_001042517chr13--2137 46 ----
NM_001042533chr3113324 3296 2779 1283 920 787 765 608 340 261 55 --22737 570 12428
NM_001042537chrX52386 1943 1540 599 289 --175 --
NM_001042543chr431552 560 386 1168 21375 140 11499
NM_001042550chr941959 1394 723 313 3506 463 400 --1299
NM_001042555chr1294742 4337 3812 3404 3183 1639 621 576 354 --14724 --
NM_001042599chr2146987 6356 6012 5061 3092 3025 2711 2408 2323 1981 1499 1473 1198 738 195 25866 5156 16890
NM_001042601chr363303 2654 2403 987 951 82 ----12282
NM_001042603chr12135247 5200 4993 4829 4792 4439 4245 4101 3830 3771 3744 781 125 1264 1748 --
NM_001042604chr374524 3772 3611 2950 1853 1685 1249 24248 2997 14131 --
NM_001042632chr2062482 2232 1646 965 461 282 32105 981 678 1486 --
NM_001042633chr2062482 2232 1646 965 461 282 32105 981 678 1486 --
NM_001042669chr451413 1403 691 259 241 11803 ----
NM_001042681chr1102368 2213 1920 1668 957 668 440 394 263 88 ------
NM_001042682chr1102368 2213 1920 1668 957 668 440 394 263 88 ------
NM_001042682chr1102368 2213 1920 1668 957 668 440 394 263 88 ------
NM_001042749chrX71748 1625 1459 796 620 591 549 ------
NM_001042750chrX71748 1625 1459 796 620 591 549 ------
NM_001042751chrX71748 1625 1459 796 620 591 549 ------
NM_001044385chr293463 2598 2578 1620 1419 1011 966 601 301 21371 1356 23912 396 23550 320
NM_001044387chr1984198 3780 3458 1086 1041 595 429 22 1401 21309 1247 --
NM_001044388chr1984198 3780 3458 1086 1041 595 429 22 1401 21309 1247 --
NM_001044722chr5102363 2328 2080 1593 898 817 720 605 388 322 11517 ----
NM_001044723chr5102363 2328 2080 1593 898 817 720 605 388 322 11517 ----
NM_001045556chr831541 1278 74 2615 303 2428 256 2127 117
NM_001045557chr831541 1278 74 2615 303 2428 256 2127 117
NM_001046chr542459 593 278 133 --2650 317 --
NM_001048183chr173688 2552 1288 1054 1020 530 498 12300 21464 1159 --
NM_001071775chr132691 548 ----11615
NM_001079874chr161722 1359 835 694 416 260 --3279 98 59 --
NM_001083620chr452639 2283 1966 1651 661 1693 --1972
NM_001083621chr1144745 4455 4060 4020 3794 3287 3139 3031 1048 819 766 669 314 23 14167 24695 3994 11668
NM_001100108chr1137067 6859 6480 5864 5740 3077 2870 2842 1802 1790 1547 442 174 22297 514 37107 2884 1060 16905
NM_001104548chr11183 ------
NM_001106chr3229723 9376 9290 9114 9025 8743 8305 7957 7886 7238 6542 3456 3168 2492 2470 1590 1410 1099 994 804 787 59 --38327 7865 296 18631
NM_001117chr1831604 915 360 1126 22338 51 --
NM_001121chr1051545 769 649 595 516 ------
NM_001122679chr571330 1172 1020 435 416 200 132 ------
NM_001128chr1693702 3381 3277 2829 2615 1525 1216 1000 694 --23829 3750 14040
NM_001144chr1651449 1274 1168 578 91 --11341 --
NM_001146chr852095 916 86 51 30 21777 1661 1555 --
NM_001148chr441973 1609 717 84 1344 1637 --
NM_001153chr23935 207 188 ------
NM_001160chr1232177 128 91 --12367 12321
NM_001167chrX136740 5274 5182 4802 4590 4283 2706 2341 1299 1293 925 578 246 15229 --15096
NM_001173chr1443180 1631 238 41 13488 21907 464 24164 3057
NM_001174chrX122349 2069 1775 782 697 602 410 396 345 199 96 25 1255 12038 11621
NM_001178chr111408 1134 --1123
NM_001186chr2173185 3075 1116 881 668 474 64 23038 1317 12634 --
NM_001187chr211467 --1632 1599
NM_001198chr64817 409 394 99 --12026 1192
NM_001200chr2011174 --1447 --
NM_001204chr2227751 7610 7511 7361 6985 6751 6741 6495 6363 6230 5760 5266 3095 3052 2758 2740 2661 2473 657 373 311 280 --26012 1458 15618
NM_001206chr982806 2709 2356 2223 850 611 171 50 32235 363 196 --12191
NM_001219chr782049 2015 1989 1486 610 175 117 31 --1501 11784
NM_001233chr771673 823 810 667 490 251 66 --12418 --
NM_001255chr1--147 ----
NM_001256chr1782942 2740 2146 1909 1881 906 821 167 22129 1921 --1811
NM_001257chr1641216 1151 1119 1047 --1420 --
NM_001259chr7176226 6127 5935 5681 5615 5381 5292 4479 4272 4149 2348 2188 2174 1945 889 629 267 24036 1567 36142 5702 4973 14869
NM_001270chr511004 1460 ----
NM_001278chr102461 268 --2857 436 1221
NM_001282chr17142470 2461 2085 1962 1780 1717 1018 994 973 747 731 460 380 345 12246 ----
NM_001284chr51573 ------
NM_001289chrX81514 1323 1291 1031 633 518 248 24 ------
NM_001298chr24998 981 945 121 --21281 866 --
NM_001304chr1773855 2512 1505 1180 1168 421 106 1294 13030 23770 757
NM_001310chr1252852 2817 2646 2135 783 134 ----
NM_001315chr682297 2136 2106 1409 871 452 296 49 11719 11927 --
NM_001324chr202517 183 ------
NM_001329chr1071668 1616 1349 1172 637 548 150 ------
NM_001332chr541064 533 150 104 2204 165 ----
NM_001343chr531476 1422 69 41716 1647 626 191 11153 --
NM_001349chr23632 524 164 2549 81 ----
NM_001351chr371759 1691 1654 1533 1294 459 291 ------
NM_001356chrX22476 1839 ------
NM_001361chr16122 1294 --1277
NM_001364chr1193797 3667 3473 2993 1519 882 760 290 35 54249 3721 1765 1269 155 12978 --
NM_001379chr191212 ------
NM_001387chr563171 3109 2508 2265 85 31 51167 1161 1140 759 54 12865 1829
NM_001389chr21--158 ----
NM_001391chr184949 877 866 380 11220 --2799 92
NM_001392chr182241 172 ------
NM_001396chr2182047 2012 1898 766 356 302 130 78 --21886 865 1188
NM_001399chrX113596 3489 3073 2586 2369 2351 1453 1122 491 354 162 31521 1331 477 23182 2562 31347 1283 1230
NM_001401chr91546 1644 --21401 105
NM_001417chr123676 381 245 ----11713
NM_001419chr1994725 4670 4517 4470 4265 3323 1416 1330 1013 13379 34379 4024 1834 24287 1895
NM_001420chr1953188 1994 1959 930 466 1146 ----
NM_001422chr1151151 511 416 375 77 1494 ----
NM_001432chr453440 1163 834 505 260 23202 3010 1821 23671 2691
NM_001438chr11688 21405 577 --12802
NM_001448chrX5482 434 44 36 22 --1474 11384
NM_001449chrX61242 1189 1050 328 290 193 ------
NM_001453chr62456 440 1214 --148
NM_001460chr1103294 3212 2458 2326 1350 1258 763 698 526 257 178 --23524 1435
NM_001483chr72961 883 ----11084
NM_001493chrX1622 ------
NM_001498chr631352 1223 1013 1237 --1933
NM_001526chr6------1155
NM_001543chr5123881 3866 3846 3644 3341 3305 3167 2960 1449 927 418 38 24075 3073 34146 4102 1378 --
NM_001546chr631286 1128 68 --21320 354 190
NM_001560chrX42645 1953 883 260 1961 --2227 133
NM_001564chr41132 ------
NM_001570chr321515 1295 --1172 11400
NM_001584chr1131167 897 294 --1304 1237
NM_001604chr114984 890 806 111 ------
NM_001609chr10114005 3771 3189 1795 1541 1535 1494 1263 625 256 126 ----13367
NM_001614chr172705 456 ------
NM_001614chr172705 456 ------
NM_001616chr263438 3110 979 846 792 245 1528 ----
NM_001620chr111827 1226 ----
NM_001627chr342223 2153 2022 1991 11488 11601 --
NM_001650chr18113794 3751 3599 3456 3272 3150 2770 1215 647 519 21 --22882 1056 23396 1449
NM_001655chr1151761 1682 721 262 220 ----12054
NM_001656chr531627 250 41 --11405 12026
NM_001660chr31213 ------
NM_001663chr1452708 2045 1982 536 329 ------
NM_001668chr151645 840 792 87 60 ------
NM_001677chr131016 948 740 1974 ----
NM_001682chr1252117 1962 1110 167 161 --1363 --
NM_001683chr322597 2080 32203 2032 1949 --21965 1000
NM_001684chr154162 1672 1454 896 158 11069 33362 1126 510 11147
NM_001689chr241959 1519 1366 532 21599 120 --21539 1252
NM_001695chr831052 982 805 34048 4039 790 24169 336 --
NM_001699chr1971148 1125 730 391 357 237 185 ------
NM_001701chr93303 131 32 --1619 11524
NM_001706chr32305 264 ----11075
NM_001709chr1142593 2069 1147 278 11852 22824 213 --
NM_001717chr1521045 110 --11202 11348
NM_001718chr611272 ------
NM_001729chr41300 1344 ----
NM_001730chr1341642 1482 1386 94 ------
NM_001730chr1341642 1482 1386 94 ------
NM_001731chr12----1769 --
NM_001743chr21404 ------
NM_001746chr542846 2748 2267 594 --1577 --
NM_001755chr1651640 1550 824 364 337 ----11719
NM_001759chr12114441 4360 3255 2107 2023 1705 1283 969 539 263 186 33915 3688 1713 23673 1866 14653
NM_001777chr394182 3881 3566 3519 3071 2738 1151 971 116 ----13638
NM_001792chr184944 225 73 63 --11075 --
NM_001796chr161173 ------
NM_001802chr163701 282 85 31015 402 352 ----
NM_001806chr1982876 2657 2256 2183 2074 558 477 401 1972 12823 --
NM_001838chr173804 281 113 1688 2957 99 --
NM_001854chr111443 --1174 --
NM_001858chr6104724 3933 3814 1879 1495 1101 1064 884 822 137 34616 2000 856 64395 4057 1520 1381 1072 772 1967
NM_001859chr923866 3828 22708 285 22868 1256 1245
NM_001884chr51508 2171 33 ----
NM_001896chr161432 ------
NM_001901chr621036 750 ------
NM_001903chr51927 ------
NM_001904chr3------133
NM_001918chr1168913 8872 8853 8812 8564 7952 7856 7838 7832 7332 7223 7162 3641 3306 2008 865 27439 5854 --79265 7772 7743 3415 3349 2166 1927
NM_001920chr121304 1138 --175
NM_001931chr1141131 1083 1064 953 ------
NM_001938chr141873 1661 1224 336 ----11328
NM_001939chrX103551 3385 3047 1340 1295 1126 911 753 316 56 33560 3343 812 2515 387 12900
NM_001941chr18103928 3854 3485 3375 2853 2618 1608 1510 1148 174 23870 1284 13670 12502
NM_001942chr181827 32024 1947 1754 --11861
NM_001945chr561207 947 414 226 220 170 1885 --1433
NM_001949chr692870 2528 2506 2298 2185 2169 504 217 140 --13149 --
NM_001957chr432322 1667 809 22143 652 --22280 1767
NM_001963chr4170 124 ----
NM_001968chr44901 692 83 71 ------
NM_001969chr14113939 3841 3706 3571 3552 3298 2663 2645 1265 1155 636 22955 1131 --189
NM_001981chr11636 1294 2839 195 11606
NM_001987chr1263938 3325 3090 1448 952 873 13956 24312 1109 11134
NM_001992chr582076 2050 2010 1687 1531 419 44 34 --1654 --
NM_001995chr41298 11014 --11402
NM_001996chr22173 ------
NM_001999chr541534 1230 200 55 1596 --168
NM_002006chr4144985 4955 4830 4344 4011 3989 3662 2223 1896 1523 1155 1028 924 178 15298 31495 1483 735 --
NM_002009chr1552732 1715 594 197 111 1569 ----
NM_002015chr1382748 2616 2448 2428 2232 1316 65 29 13260 ----
NM_002023chr171670 1615 1171 1143 319 199 33 31367 1131 665 --11540
NM_002024chrX42035 1508 1356 533 12182 11497 --
NM_002025chrX138508 7757 7110 6449 5777 3643 3523 3264 3170 2140 1783 1210 789 21830 1656 29055 1339 11009
NM_002033chr1183964 3218 1602 1502 1461 1220 1102 887 21588 948 2699 313 --
NM_002036chr1133 ------
NM_002037chr62404 388 ------
NM_002040chr2132610 599 29 12048 ----
NM_002044chr1531487 1194 152 21418 1368 --1213
NM_002048chr931036 462 35 1280 1528 --
NM_002049chrX2141 116 ------
NM_002063chrX21276 399 11300 ----
NM_002065chr12457 432 11441 ----
NM_002069chr721819 227 ----11810
NM_002074chr141453 1261 1068 169 21688 1427 11335 1662
NM_002099chr471772 1396 1323 1311 549 464 370 11801 21896 1824 --
NM_002126chr1763979 3851 3472 3110 1178 828 33882 3793 3544 ----
NM_002128chr1352191 917 804 778 405 --1593 --
NM_002137chr792380 2329 2015 1621 890 589 475 310 54 22344 173 --1397
NM_002139chrX5667 537 267 166 49 ------
NM_002140chr921144 392 ----1122
NM_002158chr233125 1205 212 33027 2531 60 12674 --
NM_002166chr22588 548 ------
NM_002184chr5--151 ----
NM_002193chr251817 1509 593 468 419 1454 ----
NM_002214chr795607 5432 4216 3795 3672 3579 3516 1112 291 --24331 790 21030 76
NM_002223chr12163833 3408 3396 2778 2701 2449 1569 1520 1440 1256 859 486 263 250 212 104 33761 3453 923 13282 1773
NM_002233chr111370 ------
NM_002242chr251751 1426 1409 602 452 ----11258
NM_002247chr1072211 2100 1612 640 363 252 217 1656 1558 1862
NM_002267chr1361953 1881 889 847 541 88 --32461 2012 913 31975 651 167
NM_002270chr5144904 4575 4426 4201 4131 3938 2211 2008 1304 1174 624 584 447 273 11843 25386 5016 33476 1546 561
NM_002271chr13112358 2099 1954 1946 1903 1891 1598 1550 468 212 145 1131 1437 --
NM_002285chr243980 3062 1527 1215 22666 911 2449 181 --
NM_002293chr12412 161 --1640 1143
NM_002310chr5135749 5650 5317 4784 4166 2303 2234 2007 1895 1410 1343 1323 274 11788 14863 45076 2052 1585 176
NM_002312chr135664 415 348 118 25 3877 339 183 --1382
NM_002313chr10124890 4539 4109 3760 3311 1758 1636 904 683 347 191 132 13813 24921 1687 --
NM_002336chr12155097 4726 4663 4493 4433 4235 3876 3382 3062 1798 1537 915 333 249 221 24854 3274 ----
NM_002351chrX71756 1502 1446 1284 546 205 151 1109 31708 1690 336 --
NM_002356chr662436 1099 842 522 492 335 ------
NM_002359chr1783885 3855 3368 2737 1072 791 776 513 12998 --23479 1049
NM_002372chr53713 504 73 ----1184
NM_002374chr283606 3589 3505 2254 997 639 457 335 13400 13422 22888 2786
NM_002381chr25983 843 639 273 213 ------
NM_002382chr1441261 996 152 76 1968 --1532
NM_002387chr5124969 4258 4123 4020 3347 3296 3215 3177 1535 849 586 264 13721 24724 3237 --
NM_002389chr171888 1654 1559 1368 1329 676 47 1730 1555 11316
NM_002395chr61956 11167 1250 1401
NM_002397chr542108 848 365 140 11891 --32130 1458 119
NM_002399chr1551443 1140 1090 979 259 ------
NM_002401chr1792169 2055 1812 1625 1002 953 836 331 162 12485 --1479
NM_002402chr73856 465 119 11096 --1160
NM_002408chr141211 ------
NM_002409chr2263241 2682 2055 1964 334 149 31971 1039 806 1386 1521
NM_002429chr1261456 1344 1189 1066 1008 86 --179 31277 1114 595
NM_002430chr2272289 2074 2022 1006 740 539 205 ------
NM_002431chr14150 1318 ----
NM_002465chr121267 ------
NM_002473chr2241297 1219 971 297 --11201 --
NM_002480chr1241466 1308 1013 979 1318 ----
NM_002481chr1187796 7502 7060 7043 6823 6213 5843 5769 5271 5227 4827 3048 2829 2752 2722 2456 2022 1472 24878 1130 17090 1746
NM_002486chr962413 2214 2041 572 421 172 ------
NM_002487chr152789 586 ------
NM_002495chr5--142 ----
NM_002501chr1993621 2539 1181 774 395 327 238 218 147 13592 43777 1454 820 687 --
NM_002508chr161675 1372 1307 719 448 79 --21414 191 --
NM_002515chr144684 596 528 509 11341 11913 --
NM_002518chr221189 1181 ------
NM_002522chr17103784 3688 3304 3089 2975 2880 2796 1349 956 196 --33631 1026 570 --
NM_002524chr141027 870 310 118 1772 --135
NM_002539chr2----1294 --
NM_002543chr1251558 1089 1036 424 93 --21136 32 --
NM_002545chr1174008 3743 1868 1790 1283 1118 424 34696 3147 1087 21543 1235 --
NM_002547chrX93311 3205 2993 1667 1638 1548 956 255 105 1431 3790 715 576 11102
NM_002556chr1141909 1384 409 63 22077 1719 1416 12179
NM_002577chr383924 3733 3675 3492 1191 615 548 121 --149 1654
NM_002581chr994495 4404 3532 1532 1499 1093 936 257 219 24634 1362 45201 4608 4102 4001 --
NM_002585chr11382 ------
NM_002588chr551264 1215 547 452 201 21310 123 11805 123
NM_002594chr2042175 577 463 429 ----22017 356
NM_002608chr2231553 1249 1047 ------
NM_002613chr16105409 4734 4603 4505 4264 3869 1885 1272 1110 766 --24819 3974 23613 886
NM_002645chr1152821 2513 2412 1114 573 2230 213 12487 --
NM_002655chr895176 4865 4547 3479 2095 2082 1168 1105 413 2922 267 ----
NM_002657chr2043722 2850 1009 504 --33384 2687 392 12395
NM_002668chrX1121 ------
NM_002669chr4----158 --
NM_002709chr2123359 3134 2789 2725 2675 2580 1337 1010 476 460 324 282 --11426 13505
NM_002711chr71343 1630 ----
NM_002716chr1193332 3182 2989 2274 1212 1124 1111 1081 335 33668 496 421 2739 23 --
NM_002718chr382222 2208 1794 1675 1030 828 476 434 1245 32470 926 734 11733
NM_002719chr14122453 2209 2055 1971 1938 1649 1608 732 289 199 186 101 2636 274 ----
NM_002734chr1722044 1797 11664 --12127
NM_002737chr1776364 4338 2235 2157 2136 929 278 65158 4991 4417 4085 442 87 55343 4362 4035 2486 543 --
NM_002745chr2274361 3509 3396 3043 2999 1108 771 12854 --11196
NM_002752chr5----1468 --
NM_002760chrY125613 5342 5330 4797 4791 3658 1377 1255 597 264 61 37 34466 4449 991 --22275 2075
NM_002765chrX3389 159 111 ------
NM_002776chr1961765 1723 1589 1348 553 259 ----21930 252
NM_002786chr11191 ------
NM_002809chr171367 ------
NM_002810chr11106 ------
NM_002816chr173328 228 25 ------
NM_002819chr1921174 1041 ----162
NM_002822chr121305 1195 2443 42 --
NM_002823chr23441 243 223 --140 1552
NM_002834chr12154064 4045 3431 2944 2730 2632 2606 1472 1402 1375 1224 1086 1078 774 461 33282 2479 1439 --33661 3085 2900
NM_002835chr72572 171 160 ----
NM_002837chr1274088 3444 3363 1494 1174 1001 567 23683 474 --1928
NM_002839chr963504 2898 2256 1354 605 491 11427 13148 11020
NM_002841chr31121 ------
NM_002843chr1153201 2798 1123 1059 859 1360 13122 --
NM_002844chr631206 384 137 --2986 419 --
NM_002852chr31579 126 1190 --
NM_002855chr11113539 3256 3028 2782 2634 1233 1163 1149 1118 932 871 22984 122 21335 428 11222
NM_002857chr152588 2293 1772 1034 446 --21824 1666 --
NM_002865chr81301 ------
NM_002868chr1242392 2068 505 43 --1735 22001 1721
NM_002869chr1131939 647 33 --11629 2214 181
NM_002886chr394630 4569 3737 3717 3150 1681 1362 1355 326 13686 25137 3258 142
NM_002892chr1441632 1378 308 79 ----21731 1512
NM_002897chr22747 646 ------
NM_002906chr1131600 820 56 --12417 --
NM_002938chr421802 616 ----1629
NM_002940chr431641 1216 779 --21851 1747 31587 424 144
NM_002941chr351634 1521 1507 1459 1053 11431 21582 203 --
NM_002943chr151174 ------
NM_002956chr12------11197
NM_002959chr133671 3354 1330 34313 1504 135 12961 --
NM_002965chr11174 ------
NM_002970chrX1113 ------
NM_002971chr33858 814 140 11046 160 --
NM_002976chr2279 55 ----1466
NM_002977chr283473 3337 2560 2409 1151 820 412 243 13229 ----
NM_002994chr461561 1549 1353 623 564 29 11729 ----
NM_002998chr852221 2206 1788 321 55 12023 --1105
NM_003001chr151933 920 465 262 90 --1683 --
NM_003003chr171271 ------
NM_003010chr1732010 1775 437 11746 --12269
NM_003011chr931611 1455 1379 --11559 --
NM_003013chr43773 645 603 2296 177 1214 --
NM_003016chr1741440 1383 509 287 ------
NM_003022chrX31161 1031 460 ------
NM_003030chr33668 468 335 1165 11769 --
NM_003031chr164982 961 321 135 1684 --1731
NM_003034chr12177835 7640 7548 5697 5389 4966 2529 2250 2185 2162 1827 1719 1609 1189 1166 1109 366 17816 47476 5203 4935 902 --
NM_003037chr13614 411 402 ----1624
NM_003043chr393975 3727 3479 1683 1443 1372 744 722 411 13698 --13129
NM_003046chr8105221 5036 4675 3321 1968 1872 1805 962 869 843 33537 3287 1492 14479 13917
NM_003048chr282542 2526 2319 2301 2150 1887 530 414 --12439 22740 1867
NM_003068chr84297 172 76 69 153 ----
NM_003069chrX2151 92 ----1710
NM_003070chr92653 641 --2569 248 --
NM_003071chr341874 1712 522 394 ----11931
NM_003079chr177954 939 912 755 398 235 122 1353 ----
NM_003099chr15126405 5680 5425 4721 4431 4162 2340 1793 1651 998 970 21 56596 6272 4861 4024 936 35291 1039 749 11455
NM_003106chr33769 730 360 1341 1403 --
NM_003107chr642314 324 122 56 12515 ----
NM_003108chr2146271 6096 5949 5886 5878 4532 2715 2686 2549 1732 1414 1398 1169 395 26949 6792 26840 1147 --
NM_003111chr231339 1232 1126 --1365 1891
NM_003112chr773227 2977 2956 2076 1214 208 181 22809 1001 12013 --
NM_003115chr11395 ------
NM_003128chr232085 1887 195 32588 2199 217 ----
NM_003144chr641588 854 511 505 --11392 183
NM_003151chr22199 45 ------
NM_003155chr882791 2465 2385 1875 1838 1816 1130 682 ----22134 643
NM_003166chr161376 ------
NM_003174chr103871 729 236 ------
NM_003182chr72468 129 ------
NM_003182chr72468 129 ------
NM_003187chr51170 ------
NM_003194chr63590 426 407 ------
NM_003199chr18115365 4892 4744 4119 3916 3872 3645 3519 1942 430 207 14502 15049 35695 3602 954
NM_003201chr101847 --2885 838 1389
NM_003203chr241620 229 123 68 --22426 177 --
NM_003211chr1241740 1111 594 180 ----11363
NM_003212chr361149 991 971 897 885 66 2936 226 ----
NM_003217chr1271647 1408 1232 724 604 522 100 21738 371 1112 --
NM_003220chr641119 1088 403 303 1291 --1506
NM_003221chr673951 3807 1384 1296 1143 1103 1001 13532 13747 1150
NM_003234chr342239 2035 1507 605 ----1655
NM_003244chr18--1183 ----
NM_003246chr1541446 626 359 260 21597 1386 --11617
NM_003262chr343757 3495 2018 949 1195 14248 25295 5172
NM_003269chr641031 855 493 481 --1331 --
NM_003274chr2142279 815 634 247 32254 1152 347 12143 22922 2651
NM_003286chr2031011 885 353 ------
NM_003291chr132838 535 ------
NM_003298chr3106251 5988 5856 5420 5355 5217 1179 937 700 66 24988 3888 25766 374 24899 4378
NM_003304chr331101 1053 212 ----1117
NM_003305chr41131 --1443 --
NM_003309chr641877 1777 1610 459 ------
NM_003314chr53129 115 95 --3467 323 70 --
NM_003319chr24871 847 675 101 ------
NM_003337chr541380 401 362 65 11109 2148 123 11627
NM_003338chr1031728 1368 293 ------
NM_003339chr571599 1303 1274 1083 423 357 61 11539 1273 --
NM_003340chr41882 ----11428
NM_003342chr1743335 1304 468 452 12449 1175 --
NM_003348chr122441 237 --31677 607 110 --
NM_003349chr2041628 1478 1385 266 ------
NM_003366chr16--1158 ----
NM_003385chr25978 916 741 281 200 --133 --
NM_003387chr272966 2067 1820 1055 838 353 35 21036 1021 12129 12590
NM_003388chr742071 1907 1730 43 2719 495 11503 21343 470
NM_003392chr384238 3004 2984 2850 2752 1575 1413 699 ----13469
NM_003403chr141547 ------
NM_003404chr2062060 2044 1418 1336 662 561 --1797 --
NM_003407chr192457 443 --1663 --
NM_003409chr1851371 1086 504 438 417 ------
NM_003410chrX53126 2378 1203 961 581 32792 2237 64 11248 --
NM_003411chrY21664 1303 163 1270 --
NM_003412chr342469 2340 683 222 33069 2126 530 11093 23155 2559
NM_003413chrX62005 1816 1601 1437 431 164 11360 ----
NM_003418chr33861 809 183 --1546 1797
NM_003423chr1932636 1035 47 --1315 1214
NM_003427chr61725 ------
NM_003430chr193645 480 396 --1491 --
NM_003432chr51453 ------
NM_003439chr7133393 3359 3243 3235 2993 2553 2231 1425 1255 1109 542 255 209 --1984 1115
NM_003442chr115857 654 355 302 69 ------
NM_003462chr111590 1311 11126 21416 103
NM_003468chr293518 3363 3334 3064 2683 1409 1286 941 787 13997 --13653
NM_003471chr331838 507 23 --22033 527 --
NM_003473chr10--1292 ----
NM_003474chr1031537 378 366 52193 2069 1879 1804 485 ----
NM_003478chr1162908 2188 2033 1089 714 265 1804 1245 --
NM_003483chr1222744 996 22167 804 22571 2360 22225 1854
NM_003488chr172909 108 1196 ----
NM_003489chr21112983 2895 877 832 800 767 697 400 126 91 74 12565 12828 --
NM_003505chr741658 1352 725 342 21612 59 1158 --
NM_003507chr231602 1303 193 21468 714 --11312
NM_003558chr91569 1576 1589 --
NM_003559chr1743911 2839 851 749 43668 2945 2701 26 13993 12598
NM_003566chr1252520 2394 2362 1156 796 22749 1045 12709 12290
NM_003574chr1884651 4448 4033 1783 1717 1587 1037 740 --14571 --
NM_003576chr1362960 2896 2539 2394 2257 79 12062 --170
NM_003583chr1263533 2434 1578 1168 391 229 11137 2714 620 --
NM_003589chr1341074 905 567 507 --1322 21120 495
NM_003603chr421844 324 --1711 11719
NM_003607chr162849 2833 2729 1532 1254 883 41680 860 805 100 23199 686 13570
NM_003615chr383065 2992 2840 2609 1305 1095 715 123 32766 2548 796 34031 2854 1588 11451
NM_003617chr1124741 4628 4239 3949 3881 3771 3721 3460 1177 1103 479 188 23364 3215 --13574
NM_003618chr2----186 --
NM_003620chr171443 ------
NM_003629chr143430 2919 339 246 23308 2930 11059 21311 655
NM_003630chr6----2623 126 --
NM_003636chr151781 1598 1459 738 369 61617 1423 359 353 321 78 --11626
NM_003637chr171383 1253 986 516 194 62 25 1474 2601 95 1562
NM_003642chr22211 110 ------
NM_003644chr17135894 5609 5477 4763 4753 4016 2425 2268 1418 1216 853 708 340 35313 2214 1942 36315 1741 1286 --
NM_003653chr171201 ------
NM_003659chr261143 1034 953 864 447 263 ------
NM_003663chr343473 2822 2709 600 ----33013 1402 672
NM_003668chr121112 ------
NM_003670chr351217 359 217 66 55 --2952 351 --
NM_003671chr9133630 3491 3350 3049 3033 2954 2564 1439 1428 1388 1355 899 438 23436 970 32432 1413 96 12543
NM_003672chr171984 1617 1533 1377 130 78 23 ------
NM_003676chr12123 95 --2797 278 3662 617 290
NM_003677chr1221442 824 1338 ----
NM_003679chr1123390 2578 2518 2248 2230 2223 2133 1167 1100 952 284 245 22393 1069 ----
NM_003692chr931009 946 669 1304 ----
NM_003713chr151541 1440 566 511 349 --11776 --
NM_003718chr7--1447 ----
NM_003719chr52721 319 1701 --1814
NM_003722chr372588 2449 2412 2088 1741 78 55 --1805 12703
NM_003735chr551264 1215 547 452 201 21310 123 11805 123
NM_003736chr551264 1215 547 452 201 21310 123 11805 123
NM_003743chr272308 2262 1976 1434 1409 774 445 21814 1402 1208 21594 1545
NM_003758chr1551451 1388 1170 536 403 ------
NM_003758chr1551451 1388 1170 536 403 ------
NM_003759chr4103838 3736 3615 3504 3031 2996 2923 1648 613 60 33907 3885 1374 --23681 3065
NM_003760chr15685 668 317 182 57 192 ----
NM_003774chr1253380 2828 2715 876 131 149 3538 65 56 1100
NM_003798chr91158 ------
NM_003800chr672300 1969 1889 1870 1864 608 602 ----12143
NM_003816chr831359 1232 1063 1195 182 --
NM_003821chr82176 96 1633 ----
NM_003822chr182922 2794 1224 504 435 223 150 85 ------
NM_003825chr1551515 1449 1313 1174 447 11250 ----
NM_003860chr11--1364 ----
NM_003861chr1452863 967 564 99 34 2845 771 12232 22294 27
NM_003872chr293034 2506 2372 2257 2197 2134 748 456 145 12315 32441 1093 506 --
NM_003873chr1062443 2192 2069 2036 1771 816 21590 990 ----
NM_003884chr351760 1700 1297 1157 581 11221 21874 460 --
NM_003895chr21102017 1522 1474 856 588 576 456 435 401 251 12161 1321 --
NM_003908chr20127 11026 2918 103 --
NM_003909chr873059 2783 2305 613 592 267 237 --11902 --
NM_003913chr6113391 3283 2736 1361 1312 1275 1083 982 913 898 278 23901 2988 ----
NM_003916chrX31470 1288 495 11070 ----
NM_003924chr461718 1265 1099 580 477 457 ----1511
NM_003932chr2251924 1526 386 39 22 ----11700
NM_003934chr911330 1261 ----
NM_003939chr1074163 3639 3585 2751 2611 1423 1083 43499 3119 2907 1149 23036 3001 13848
NM_003947chr341129 911 870 248 --21017 880 --
NM_003958chr643671 2773 1404 141 13870 12557 12411
NM_003966chr5217641 6793 6658 6595 6566 6203 6056 5609 5550 5519 5435 2556 1899 1529 1497 1097 969 562 513 166 48 16957 --1834
NM_003972chr10----2427 234 --
NM_003983chr1674078 3904 3668 3581 3035 1333 1271 33676 3303 3152 22865 432 --
NM_003994chr12114141 3527 3308 2727 1752 1429 1168 961 802 526 305 11350 21657 1559 13263
NM_003996chr6123 ------
NM_004004chr1351327 1179 1105 1069 192 --1206 1356
NM_004006chrX32076 429 290 1862 21710 1675 11690
NM_004007chrX32076 429 290 1862 21710 1675 11690
NM_004009chrX32076 429 290 1862 21710 1675 11690
NM_004010chrX32076 429 290 1862 21710 1675 11690
NM_004011chrX32076 429 290 1862 21710 1675 11690
NM_004012chrX32076 429 290 1862 21710 1675 11690
NM_004013chrX32076 429 290 1862 21710 1675 11690
NM_004014chrX32076 429 290 1862 21710 1675 11690
NM_004015chrX32076 429 290 1862 21710 1675 11690
NM_004016chrX31990 343 204 1776 21624 1589 11604
NM_004017chrX32076 429 290 1862 21710 1675 11690
NM_004018chrX31990 343 204 1776 21624 1589 11604
NM_004020chrX32076 429 290 1862 21710 1675 11690
NM_004021chrX31990 343 204 1776 21624 1589 11604
NM_004022chrX31990 343 204 1776 21624 1589 11604
NM_004023chrX31990 343 204 1776 21624 1589 11604
NM_004028chr18113794 3751 3599 3456 3272 3150 2770 1215 647 519 21 --22882 1056 23396 1449
NM_004035chr1764431 3326 1657 458 168 37 11171 31378 816 226 --
NM_004050chr1482769 2650 2475 2206 2137 1949 1775 720 22321 1690 ----
NM_004060chr551223 951 451 98 37 1216 1222 --
NM_004081chrY71718 1559 1152 557 415 393 147 1439 --11270
NM_004087chr341927 692 589 367 --31803 1376 326 --
NM_004090chr1793115 2611 2446 2322 2218 703 331 274 182 ----22627 2475
NM_004093chr1362905 2586 1205 1165 810 76 21189 278 2944 141 21215 312
NM_004094chr1473075 2721 2045 795 626 456 100 12669 ----
NM_004100chr621780 857 11875 12341 21032 777
NM_004113chr341658 600 239 182 ------
NM_004114chrX71211 1201 1156 1021 296 174 85 ------
NM_004124chr1422611 2551 ------
NM_004130chr31166 --184 --
NM_004136chr1562635 2445 2023 1075 294 46 33168 2773 2096 --1415
NM_004162chr31961 11202 ----
NM_004225chr821425 1101 --1287 11179
NM_004226chr21228 ------
NM_004227chr742834 2165 292 155 1455 --2488 337
NM_004232chr18133788 3574 3440 3144 3063 2812 2731 2551 2419 1085 1005 642 337 --11545 --
NM_004241chr101211 1654 ----
NM_004242chr6------159
NM_004253chr91833 ------
NM_004261chr12741 707 --1696 --
NM_004273chr1094444 4407 3846 1752 1661 1082 1056 891 673 44114 4101 1998 1594 53526 3104 1199 987 39 13476
NM_004274chr1492289 2050 2013 1151 1070 739 726 571 248 13016 1778 1500
NM_004279chr782267 2203 1913 1846 1713 1586 1564 775 --1788 --
NM_004293chr993698 3202 3052 2568 2518 1082 723 437 308 181 13687 --
NM_004296chr14113871 3392 2906 2759 2696 2488 1543 1479 1109 591 195 13840 ----
NM_004301chr32332 141 ------
NM_004311chr1092423 2241 2209 2196 2023 930 715 549 378 12638 32186 808 634 32044 2013 1029
NM_004326chr11899 ----11097
NM_004330chr15--1788 ----
NM_004331chr882703 2439 2375 1972 988 530 470 431 --22342 1873 --
NM_004337chr831796 141 111 --11716 --
NM_004338chr18196837 6773 6462 6336 6069 5994 5849 5507 5175 5046 4675 4466 2196 1662 1517 1503 1276 702 579 24326 1816 --46829 6299 2784 768
NM_004342chr772097 1953 1910 1719 1692 1644 193 11768 ----
NM_004361chr18138 ------
NM_004370chr652082 1520 476 258 191 --11598 --
NM_004380chr1652536 2273 1864 762 398 1606 22584 720 --
NM_004384chr5102363 2328 2080 1593 898 817 720 605 388 322 11517 ----
NM_004392chr135650 292 163 135 87 --21992 671 12164
NM_004396chr171228 ------
NM_004397chr11103287 2718 1655 1367 1335 807 434 164 124 29 14007 14327 --
NM_004412chr10125858 5622 4888 4557 4233 4207 4100 1783 1308 1237 982 704 ----15357
NM_004414chr2161373 1028 986 599 421 150 1592 11089 --
NM_004419chr1041045 1007 366 35 2379 198 --1754
NM_004430chr872799 2350 2124 1958 1008 851 62 21827 75 ----
NM_004432chr93654 472 50 --21750 629 --
NM_004438chr272931 2127 1111 872 802 702 517 11261 1505 --
NM_004440chr661907 1270 750 681 461 135 ------
NM_004450chr141377 ------
NM_004454chr372206 2190 1458 1403 503 437 100 11426 --1215
NM_004458chrX61048 824 808 444 210 140 --22630 796 22369 1909
NM_004459chr1771651 1274 522 355 284 244 185 1192 ----
NM_004464chr4113783 3662 3628 3487 1437 1425 837 765 674 436 234 11735 ----
NM_004472chr51206 ----1519
NM_004481chr172264 1787 717 685 459 329 183 2609 133 22489 2419 --
NM_004482chr2193 1851 1924 --
NM_004485chr1104405 4260 4015 3874 3304 3124 982 455 259 44 13620 ----
NM_004486chr94263 221 203 24 --1174 1278
NM_004491chr1944048 3378 1440 337 12771 24340 1365 13349
NM_004496chr141513 ------
NM_004498chr151117 --137 --
NM_004501chr1104138 3958 3741 3720 3473 3330 2902 753 188 129 13579 --11426
NM_004503chr121727 1152 ----
NM_004504chr242859 2315 575 509 --2958 123 1748
NM_004505chr1772051 1935 1660 1236 657 465 73 11577 ----
NM_004514chr1713060 ------
NM_004524chr171276 ------
NM_004525chr231529 598 74 ------
NM_004535chr2051391 1245 520 281 270 --11790 --
NM_004566chr1062395 2247 1774 1023 997 287 22506 191 11927 --
NM_004569chr141263 1137 --2697 666
NM_004571chr2153289 2875 1317 1051 412 22273 2197 --1604
NM_004575chr431479 1095 392 1642 1325 --
NM_004580chr1521779 1587 2466 226 21500 1309 --
NM_004586chrX94866 4425 3568 3494 3356 3300 1861 1442 945 34131 1891 717 55175 4891 3906 2137 1078 11072
NM_004588chr1183838 3774 2830 1426 1114 999 709 588 2773 571 23432 2773 --
NM_004593chr35679 364 334 217 83 ------
NM_004598chr583156 2728 1306 1010 895 813 716 258 13112 43062 2588 2392 1211 1949
NM_004606chrX1138 ------
NM_004612chr964862 3084 1502 1059 1037 696 21229 135 34164 3340 734 --
NM_004639chr6----177 --
NM_004655chr171120 --1213 --
NM_004660chrY52347 2266 819 718 36 1145 12356 --
NM_004670chr1071454 1155 635 524 337 216 125 1185 --11230
NM_004681chrY3781 716 112 --1160 --
NM_004685chr13102930 2897 2636 2327 2098 1849 1165 897 890 485 --12175 --
NM_004686chr851493 1366 1142 711 142 --1337 --
NM_004687chr1751721 1617 796 406 345 ------
NM_004690chr61764 ----2797 694
NM_004703chr1741561 772 697 271 11006 22576 2097 --
NM_004709chrX41434 1354 415 308 --1131 11170
NM_004717chr771397 1227 1053 1047 1011 475 82 ------
NM_004719chr1252784 2667 2229 1069 718 ------
NM_004726chrX135485 5362 5149 5116 5052 4710 4687 4665 1549 1234 1050 884 511 --35699 4905 107 35373 1191 501
NM_004730chr541773 1333 378 344 ----11374
NM_004731chr1251699 1623 1183 1177 279 --11321 --
NM_004736chr131792 500 476 11589 12227 --
NM_004739chr11----1651 --
NM_004741chr1031556 1385 283 ------
NM_004744chr483854 3397 3304 2996 1431 915 685 174 11295 23835 1029 --
NM_004745chr8146820 5783 5494 5341 4949 4613 2269 2136 1761 1436 1137 1021 985 600 36457 5985 2143 55418 2407 2186 1377 479 --
NM_004748chr15154247 4221 4204 3779 3666 3584 3431 3157 3151 3106 2697 2660 2637 846 376 23532 2761 23742 3445 --
NM_004757chr42722 43 1495 --1508
NM_004760chr742197 1005 331 171 1159 12131 --
NM_004768chr121117 130 2777 379 2272 166 --
NM_004769chr7191 ------
NM_004774chr1783188 2929 1100 760 683 676 417 155 --22739 1051 1919
NM_004775chr1831546 953 769 22048 227 --2944 117
NM_004779chr511104 11090 11228 1982
NM_004786chr18------1186
NM_004788chr1142175 2104 1036 525 12014 12471 --
NM_004789chr91430 ------
NM_004796chr1471956 1766 1487 972 670 488 193 --1829 1704
NM_004798chr2083636 2793 2644 1336 1159 465 260 116 22952 2787 168 13309
NM_004801chr231327 615 377 11128 1584 --
NM_004804chr292729 2464 2450 2389 2138 1934 1748 738 196 1146 12759 --
NM_004807chr292608 2553 2520 2158 1615 973 665 608 217 22434 556 ----
NM_004808chr1093010 2866 2728 2467 2427 666 238 228 89 11120 31015 707 141 --
NM_004822chr1773891 3535 3351 3238 2869 1041 745 --1842 13667
NM_004824chr641231 284 252 200 --1362 --
NM_004835chr33778 634 151 2623 199 1164 --
NM_004835chr33778 634 151 2623 199 1164 --
NM_004836chr22359 90 --1684 --
NM_004837chr171697 1561 1266 1256 1115 493 200 --21401 155 --
NM_004850chr231270 317 262 1594 --196
NM_004857chr14104684 3801 3330 1897 1427 1356 1349 1080 985 355 11254 24611 3646 24446 1208
NM_004865chr62440 406 ------
NM_004866chr5104991 3761 3196 1756 1503 1341 1148 957 721 384 11678 1497 14572
NM_004879chr112698 42 ----1675
NM_004884chr1561613 652 615 522 300 59 --11766 --
NM_004888chr921028 418 ------
NM_004896chr103544 199 26 ----1103
NM_004904chr7106217 5682 5371 4901 4473 2195 2182 969 734 33 15532 16132 35669 5500 4930
NM_004905chr14705 624 321 154 --1586 --
NM_004906chr61483 ------
NM_004912chr731479 584 530 ----11249
NM_004915chr212795 291 --1530 1752
NM_004921chr182513 2104 2091 2074 1700 1636 350 24 11833 --1852
NM_004926chr1431536 362 343 --11160 --
NM_004932chr551382 1278 1237 630 605 ----1113
NM_004937chr1792726 2655 2520 2279 1030 320 79 71 55 1516 --12644
NM_004938chr961222 1115 1015 390 213 44 ----1249
NM_004939chr2139 ------
NM_004947chr352448 2414 942 933 68 11956 --11585
NM_004956chr774090 3843 2807 1749 1696 1535 781 11728 24624 2974 --
NM_004962chr101476 1753 --126
NM_004965chr21--1669 ----
NM_004976chr11115057 4359 4244 4063 3282 1694 1447 1087 807 504 473 24567 2030 23214 154 13847
NM_004985chr1264068 3841 3781 1309 1244 1177 21001 658 --13412
NM_004990chr12--124 ----
NM_004992chrX188424 8399 8041 7566 7506 7254 6774 6757 5310 3228 3104 2469 1621 1530 1523 1464 88 45 13403 28254 6349 37921 7334 5243
NM_004992chrX188424 8399 8041 7566 7506 7254 6774 6757 5310 3228 3104 2469 1621 1530 1523 1464 88 45 13403 28254 6349 37921 7334 5243
NM_004993chr1411221 ------
NM_005010chr752236 2133 1980 1662 1511 ------
NM_005011chr751807 1742 748 568 142 ----1236
NM_005025chr31229 ------
NM_005028chr1051482 914 902 896 732 21760 1545 --1277
NM_005036chr22178108 7721 6820 5917 5577 5377 5173 3211 3202 2741 2387 2337 2327 1868 1085 482 184 22811 2776 47275 2448 1000 974 26142 5679
NM_005044chrX84205 4169 3864 3852 3310 3124 473 81 22985 2968 11762 --
NM_005054chr261713 1501 684 206 187 125 1427 1670 --
NM_005056chr12145491 5444 5237 5073 5036 4683 4489 4345 4074 4015 3988 1025 369 155 1508 1992 --
NM_005058chrY1221 ------
NM_005063chr10143880 3660 3509 3318 2835 2499 2446 1260 788 697 522 501 326 147 23351 158 ----
NM_005065chr14135057 4743 4717 4589 4142 3568 1933 1705 1483 1307 797 447 139 31692 1160 1085 34611 3656 656 2812 490
NM_005078chr1521878 672 11628 21494 654 21846 1488
NM_005079chr873149 2942 2521 1955 862 454 281 12441 1841 12711
NM_005093chr2095375 5165 5116 5016 3523 1841 1386 1049 597 15137 21242 1068 --
NM_005095chr131543 1515 574 --11423 1413
NM_005116chr2073836 3682 2929 1413 1258 1036 389 34559 1081 657 44602 3877 3652 1524 --
NM_005121chr1753859 3147 581 328 285 12821 12443 --
NM_005128chr211666 ------
NM_005135chr1573154 2420 1010 337 261 197 164 21200 1066 43372 2832 99 43 --
NM_005141chr41133 --1347 --
NM_005151chr1862437 2108 1872 941 266 135 --32249 2081 238 --
NM_005156chr974224 3686 3302 2065 1937 937 878 25036 1112 ----
NM_005160chr22136208 5902 5572 2203 2120 2100 1710 1103 924 750 519 490 203 36545 5990 435 1764 46187 4340 2369 1720
NM_005161chr1152153 1624 1492 535 298 1274 31875 321 21 --
NM_005164chr1271867 1834 560 227 102 42 24 --11959 12622
NM_005166chr191338 ------
NM_005168chr231773 619 412 196 ----
NM_005171chr1211018 ------
NM_005188chr11168305 7924 7827 7397 6515 6088 6045 5315 3293 2131 2104 1942 1654 1065 764 580 45819 5337 1851 296 47787 7018 5966 2647 27177 6524
NM_005197chr14115780 5361 4785 4077 1872 1725 1404 1321 1110 924 638 53867 2365 1040 570 216 1254 55900 1991 785 440 287
NM_005222chr72649 321 1877 1125 1982
NM_005235chr2146987 6356 6012 5061 3092 3025 2711 2408 2323 1981 1499 1473 1198 738 195 25866 5156 16890
NM_005238chr1183364 3343 2902 1272 922 731 329 257 1183 23329 1081 12673
NM_005261chr82400 296 149 1203 1181
NM_005277chr441677 1232 1202 606 ------
NM_005316chr1121144 731 --11018 --
NM_005324chr1742091 1593 478 146 11515 11407 --
NM_005333chrX91253 826 502 483 439 408 381 322 311 --1289 --
NM_005339chr463299 3081 1539 1221 1049 561 21406 173 --13887
NM_005359chr18126495 6447 6290 6247 6124 4821 1904 1226 872 518 384 316 36569 5118 4790 25489 806 36405 6394 2506
NM_005369chrX3570 464 171 --1558 --
NM_005376chr13955 284 69 1299 21071 277 --
NM_005382chr8--1334 ----
NM_005388chr931570 1525 1184 1210 --11237
NM_005389chr64833 518 112 54 1225 ----
NM_005397chr773032 2758 2722 2601 1303 1032 535 53246 2857 1473 371 355 11222 21216 256
NM_005398chr1051351 371 339 308 82 ----1543
NM_005399chr1154444 4338 4061 3461 3150 1764 1595 1385 1273 1237 787 653 237 124 37 11746 --13656
NM_005400chr272550 2471 1166 939 913 866 357 22723 624 ----
NM_005402chr75561 474 352 194 126 21774 152 ----
NM_005409chr43720 281 34 11066 --1268
NM_005414chr3----1313 --
NM_005429chr4----1115 --
NM_005433chr1842661 2332 1755 480 1328 1859 1386
NM_005436chr1093865 3519 3165 3128 2867 2599 1610 1371 68 13916 11559 23391 3351
NM_005437chr1041492 1254 950 328 2909 378 ----
NM_005440chr1731280 533 458 22167 679 33197 1264 469 --
NM_005442chr31155 --1507 --
NM_005455chr151829 1604 1458 572 271 1522 ----
NM_005475chr1243307 2122 949 408 42976 2650 2138 2038 1527 --
NM_005494chr72586 580 ------
NM_005497chr17155420 4522 4133 3900 2417 2334 2297 2266 2001 1438 1361 1061 859 573 496 21036 866 33827 779 399 1965
NM_005502chr973287 3151 2715 2284 1197 892 559 42783 2263 2029 848 --22843 87
NM_005504chr1286454 6383 4911 4162 2265 2075 1942 1742 56494 4504 4206 1600 387 ----
NM_005513chr321117 71 ------
NM_005517chr141023 583 494 199 1564 1312 1121
NM_005523chr7--31468 491 76 31167 1034 397 --
NM_005542chr741655 678 495 328 11349 1689 --
NM_005544chr21910 --1967 --
NM_005575chr51569 2668 88 --2658 77
NM_005578chr3104721 4280 4272 3887 3858 1914 1785 1100 746 159 ----175
NM_005584chr134617 260 177 45 1209 121 --
NM_005585chr15----1368 1417
NM_005587chr15--1915 ----
NM_005589chr141471 ----1320
NM_005593chr12----172 1172
NM_005596chr9185892 5817 5602 5395 5293 4905 4375 4302 4257 4241 4215 3934 2307 1232 1021 771 596 203 35421 4040 557 14864 --
NM_005600chr11302 ------
NM_005603chr1842040 1357 1343 383 1171 2756 193 --
NM_005629chrX51250 964 524 374 132 1535 1888 11337
NM_005638chrX71646 585 515 374 308 232 53 ------
NM_005639chr121168 1707 --11626
NM_005647chrX72884 2715 2130 1313 360 201 185 --53191 1380 1324 990 344 22381 1111
NM_005650chr2211227 ------
NM_005662chr8197 ------
NM_005665chr1104842 3834 3807 3060 1773 1683 1190 1161 888 873 21970 1460 11668 --
NM_005668chr594404 4291 4285 3934 3600 3418 3175 1734 968 ----2650 412
NM_005688chr311069 ------
NM_005690chr121141 ------
NM_005711chr53355 116 45 2794 343 1334 --
NM_005715chr672861 2749 2343 2084 1768 751 728 ----12457
NM_005717chr111110 ------
NM_005721chr241108 786 768 369 ----1413
NM_005722chr292517 2327 2195 1953 925 881 833 730 509 12450 ----
NM_005725chr171961 1904 1495 713 370 332 34 --1664 --
NM_005730chr12123651 3053 3036 2389 2298 2253 1015 604 438 305 136 84 22435 1336 12768 1364
NM_005736chr1081616 1487 1340 1193 1124 541 530 242 11101 21446 1317 --
NM_005737chr252511 2120 2025 373 117 --22143 312 --
NM_005738chr741853 781 360 115 1242 31957 1285 1267 --
NM_005739chr1542163 443 408 254 --2827 123 1575
NM_005746chr722345 871 --1734 22139 1691
NM_005748chr1243238 2824 2767 1094 --1855 --
NM_005749chr172675 577 ------
NM_005759chr2114511 4258 4248 4088 4004 3364 3101 1595 1530 656 63 --14456 --
NM_005765chrX1329 ------
NM_005776chr14--1690 --147
NM_005779chr583382 2574 2538 2253 1441 1141 1075 1026 1105 ----
NM_005795chr243021 1934 591 279 12547 1121 12390
NM_005808chr341434 1388 1188 808 12501 2959 282 --
NM_005813chr252523 2241 2034 1937 563 11041 12653 --
NM_005815chr192116 33 ----1306
NM_005822chr662376 2000 1835 1536 791 228 12237 ----
NM_005828chr1763700 1759 1289 1207 775 133 34190 4059 1986 23949 1713 --
NM_005832chr331145 336 35 21009 401 1144 --
NM_005840chrX227399 7246 7051 6957 6924 6088 6037 5825 5704 5674 5306 5129 4847 4660 2130 1733 1723 1523 1249 1086 1023 696 27417 1381 56167 2392 1766 1555 1545 37462 5283 1139
NM_005843chr291883 1673 1455 1241 674 668 476 389 27 1151 1528 --
NM_005857chr131481 1271 213 21120 501 1115 --
NM_005859chr571362 1243 1183 392 275 110 102 11251 1440 --
NM_005862chr31984 ------
NM_005868chr782488 2364 1990 1835 1764 952 874 375 11773 ----
NM_005880chr1641177 1081 632 180 ----11039
NM_005882chr41239 ------
NM_005885chr551523 1399 1277 1110 593 ------
NM_005895chr1254115 3317 2614 865 420 21005 152 1218 --
NM_005898chr1173243 2675 2432 1139 1037 966 332 1656 ----
NM_005901chr18208538 8396 7490 6880 6659 6241 6086 6064 5932 5461 3261 3161 3151 1992 1947 1182 864 586 518 97 38711 7070 6852 --38063 1309 1029
NM_005902chr1594529 4477 4301 3783 3387 3098 1158 901 724 --34636 4336 421 --
NM_005903chr595098 4413 3580 2000 1883 565 480 457 410 25185 4731 ----
NM_005909chr594328 4319 4074 3861 3784 3755 2861 1617 1079 ----182
NM_005910chr17124132 3926 3149 2727 2643 2575 1519 1501 1321 1182 354 194 43804 3235 649 604 12845 --
NM_005911chr231332 913 478 1324 151 21362 1139
NM_005920chr163823 3361 2853 2620 903 343 1772 --12584
NM_005925chr181100 1157 ----
NM_005933chr1193005 2979 2392 1161 929 840 576 412 66 --12145 12628
NM_005935chr474521 3862 3366 1922 193 109 54 54831 3379 3248 1830 712 --11449
NM_005937chr1774049 3816 3565 2657 1399 115 102 13983 21187 554 --
NM_005941chr863168 2645 935 393 334 67 11542 23529 3349 11658
NM_005955chr1125519 5489 5286 5181 4628 3713 3688 3581 3381 1373 635 32 1464 55198 5188 4279 1482 1211 2502 220
NM_005962chr1092345 2202 1435 771 602 515 410 190 179 12080 41872 1522 808 563 --
NM_005962chr1092345 2202 1435 771 602 515 410 190 179 12080 41872 1522 808 563 --
NM_005966chr271704 1646 947 910 525 472 263 --1814 --
NM_005977chr131741 --1893 --
NM_005986chr1392591 1984 1829 1734 1028 902 796 342 289 --22438 726 1320
NM_005996chr1221178 608 ----11446
NM_006004chr11177 ------
NM_006007chr9134444 4382 4364 3520 3486 3480 2992 2931 1639 1121 910 576 68 23300 2737 --11481
NM_006011chr1584086 4057 3916 3853 1614 1324 1068 433 21401 981 --33564 704 309
NM_006015chr121135 262 --21043 141 --
NM_006037chr284568 4416 3942 3457 1234 1089 935 146 1264 34393 3137 1859 1652
NM_006043chr165667 589 526 520 146 1158 ----
NM_006047chr2093187 2609 2288 1419 763 460 448 417 280 23081 203 21143 647 --
NM_006048chr141182 486 474 59 142 1222 --
NM_006063chr21549 --2533 80 --
NM_006076chr7112781 2655 1189 1144 958 879 859 799 430 214 172 --12313 --
NM_006080chr732793 2267 377 21930 359 22249 1844 --
NM_006089chrX41649 624 229 65 ------
NM_006090chr12508 228 ----1679
NM_006095chr423945 957 44113 3990 3268 3115 11476 11538
NM_006106chr1163378 3266 3118 2699 2440 1136 12238 ----
NM_006107chr174504 180 145 137 1119 ----
NM_006113chr161722 1359 835 694 416 260 --3279 98 59 --
NM_006136chr761366 1321 509 279 147 61 --1962 --
NM_006141chr1672675 2142 2104 1889 1043 564 423 1805 12402 12241
NM_006143chr12----143 --
NM_006148chr1792974 2811 2401 2393 2179 1184 956 677 152 32500 1014 834 12549 --
NM_006154chr1592574 2384 2109 2004 1997 739 730 419 134 1242 ----
NM_006158chr831744 672 533 ----21163 109
NM_006180chr952010 1979 1387 623 139 11990 1360 11608
NM_006187chr1282989 2956 2740 2656 2038 1181 1130 1043 43095 2793 2780 1969 1698 12752
NM_006191chr121655 ------
NM_006196chr2----1371 --
NM_006197chr852137 1522 719 435 389 1901 ----
NM_006201chrX1208 --11218 --
NM_006203chr5125279 5185 5005 4575 4070 3640 2100 1988 1956 1460 377 317 25313 4739 --12040
NM_006204chr101183 ------
NM_006206chr472504 2445 2028 1130 996 866 725 12169 1622 --
NM_006212chr165235 4985 4740 3966 3381 1853 1999 33613 1200 418 14044
NM_006226chr241095 1045 400 176 1494 11273 --
NM_006246chr1411188 ------
NM_006247chr19--1493 ----
NM_006252chr1107552 6653 6486 2776 2510 2483 1512 1490 1330 452 37622 2709 971 27602 689 1524
NM_006256chr172782 2552 2336 2088 791 171 146 ------
NM_006264chr41431 ------
NM_006265chr821550 113 ----1314
NM_006267chr241751 1726 273 189 21376 486 11644 --
NM_006275chr2082005 1716 1686 955 774 662 478 451 --21935 1639 --
NM_006281chr83763 157 121 1305 ----
NM_006281chr83763 157 121 1305 ----
NM_006282chr2074166 3803 3687 1634 1205 872 657 34205 1512 776 24471 698 13723
NM_006283chr8134923 4589 3946 3552 3471 3386 3136 3075 1799 1446 1114 1008 121 31650 1277 309 --11170
NM_006290chr681863 1837 1694 1593 778 487 208 202 31904 453 410 --21458 404
NM_006306chrX65518 5301 5290 4065 1421 1341 11914 11085 55679 5613 5411 5378 4213
NM_006310chr174457 376 295 277 1416 --1930
NM_006313chr1261741 1558 1482 1426 1361 585 21732 683 21586 90 --
NM_006315chr4154523 4363 3995 3710 3538 3124 2795 1610 1595 1519 1125 1105 990 520 212 --14007 21455 1282
NM_006317chr5----1755 --
NM_006322chr132970 650 --1247 1157
NM_006335chr1--1973 1371 1287
NM_006352chr141473 780 107 81 --21747 1348 --
NM_006353chr641299 960 307 82 --1568 1487
NM_006357chr21341 ------
NM_006359chrX52386 1943 1540 599 289 --175 --
NM_006366chr631248 72 59 ----1918
NM_006369chr11432 ------
NM_006371chr3104894 4266 4060 4016 3446 3240 2022 1412 126 94 24186 1014 13698 11721
NM_006375chrX51811 683 658 589 419 11319 1261 --
NM_006379chr721861 734 11814 --1433
NM_006380chr1784132 3202 3076 2914 2669 1583 477 298 ------
NM_006393chr1083913 3846 2926 2816 2769 1721 1581 1565 11698 33947 1324 859 34016 1692 1074
NM_006401chr91468 --1357 1132
NM_006403chr631682 1579 1327 --1586 11608
NM_006420chr2093493 3261 3088 2955 2481 1278 1250 928 730 --21015 717 --
NM_006431chr121202 ------
NM_006459chr1031511 737 256 1161 11786 11417
NM_006464chr2104584 3941 3722 3601 1881 1253 971 567 499 142 13925 13265 --
NM_006482chr1263533 2434 1578 1168 391 229 11137 2714 620 --
NM_006489chr144684 596 528 509 11341 11913 --
NM_006496chr132024 1662 1316 2771 187 ----
NM_006500chr1161342 1034 501 382 179 75 11089 198 --
NM_006504chr1072406 2280 1997 1941 1810 1095 351 --11037 42183 1880 1148 133
NM_006520chrX21157 101 2122 27 1390 --
NM_006521chrX31140 1119 1098 ----11400
NM_006524chr75825 405 173 69 41 --2321 237 --
NM_006529chr431543 551 377 1159 21366 131 11490
NM_006538chr243919 3856 3678 2905 11395 1465 11616
NM_006544chr1475858 1982 1644 1019 840 686 83 75044 4629 4569 2057 1685 1614 1585 35240 4889 4232 11176
NM_006546chr17236369 6270 6141 6030 5292 4725 4324 4283 2540 2166 2023 1991 1984 1969 1953 1905 1775 1759 1512 1004 969 910 272 35285 2338 1145 35547 2073 1532 24551 1391
NM_006547chr761719 1429 1347 736 592 263 21840 1472 --11323
NM_006549chr1282910 2591 2498 2164 963 490 375 109 11883 --12267
NM_006554chr21259 1312 ----
NM_006561chr1076095 4822 2347 2058 1071 904 108 45686 5456 4779 560 11997 24706 4513
NM_006572chr1783541 3499 2897 2500 2316 1159 681 170 ------
NM_006575chr14------21098 226
NM_006591chr1141702 1589 534 224 1302 3679 638 197 --
NM_006595chr1151565 1540 1483 557 515 11733 ----
NM_006599chr16186932 6701 6483 5526 5432 5373 5033 2733 2552 2265 1452 1306 1122 595 573 476 429 148 21961 1473 --15838
NM_006603chrX71748 1625 1459 796 620 591 549 ------
NM_006609chr252810 2738 2582 2540 1131 1754 12772 --
NM_006614chr373684 3458 3137 3062 1057 476 280 22893 1320 1542 12838
NM_006620chr694540 4190 4043 3895 3693 3249 501 395 202 44321 619 594 131 ----
NM_006624chr1051938 1536 1381 479 194 22006 787 11370 172
NM_006625chr12854 387 ------
NM_006625chr12854 387 ------
NM_006625chr12854 387 ------
NM_006626chr942584 1912 786 183 ------
NM_006629chr1862800 2776 2536 2426 1939 823 --1665 1780
NM_006644chr13----1146 1522
NM_006646chr1362826 2466 2080 1956 1169 1125 --22239 1020 --
NM_006650chr5113299 3270 3188 3180 2815 1479 1082 951 485 470 265 ----23890 973
NM_006654chr1294742 4337 3812 3404 3183 1639 621 576 354 --14724 --
NM_006677chr31256 ------
NM_006682chr762750 2658 1763 929 918 152 --22192 1868 --
NM_006693chr71863 ------
NM_006696chr5143 ------
NM_006699chr172626 2373 2338 2014 1979 842 327 22384 2240 12590 --
NM_006717chr982624 2473 956 850 776 595 253 91 ----11315
NM_006720chr10124890 4539 4109 3760 3311 1758 1636 904 683 347 191 132 13813 24921 1687 --
NM_006722chr362858 2808 2707 2304 2179 670 ------
NM_006729chrX85476 4594 4526 1845 1790 1279 869 578 --24752 1634 25196 509
NM_006738chr15114636 4084 4000 3947 3905 2851 1751 1156 1032 471 322 11090 ----
NM_006748chr831541 1278 74 2615 303 2428 256 2127 117
NM_006750chr16128117 7794 7669 6705 6579 5864 2555 1900 737 706 207 67 46128 2423 1066 719 47956 3148 159 24 22459 1031
NM_006761chr173568 184 174 1339 1667 --
NM_006763chr171897 1833 1801 1403 665 151 100 11412 1557 --
NM_006766chr842321 2151 2006 338 12473 32454 817 295 --
NM_006775chr672490 923 650 509 428 323 260 --11097 1847
NM_006777chrX2750 153 1881 22329 255 --
NM_006803chr82516 61 1334 --1424
NM_006806chr21276 69 ------
NM_006807chr173334 254 160 --11089 1117
NM_006808chr9166 ------
NM_006811chr205955 828 750 383 284 --1974 --
NM_006823chr841244 1109 1103 439 ----1943
NM_006826chr231004 510 213 --1953 --
NM_006827chr1493404 3162 3124 3089 2668 2392 2279 1170 565 33305 2892 289 ----
NM_006832chr1411089 1327 157 --
NM_006838chr1231791 247 152 --21337 186 --
NM_006839chr2--126 ----
NM_006842chr111133 ------
NM_006846chr51279 ------
NM_006851chr1282739 2386 1830 1814 990 974 899 481 11997 1736 12349
NM_006854chr751978 1865 1326 290 68 ----1159
NM_006873chr272945 2377 2347 1151 821 657 260 13047 12336 11092
NM_006874chr4------21169 83
NM_006875chrX2936 118 ----2907 43
NM_006884chr33668 468 335 1165 11769 --
NM_006885chr16103903 3835 3782 3153 1464 1268 716 403 141 93 1699 1232 --
NM_006901chr154552 408 177 170 --2494 415 --
NM_006902chr172770 1197 1051 833 628 310 251 21299 112 --1650
NM_006908chr731060 278 263 ------
NM_006910chr161399 --1316 --
NM_006914chr941485 1191 324 56 11309 ----
NM_006915chrX42204 1972 1571 291 12097 2897 762 1212
NM_006918chr11125243 5104 5084 5005 4678 4658 4260 2077 1754 1737 1107 1072 34610 3933 1189 24393 1777 --
NM_006920chr221940 552 ----21440 605
NM_006922chr272194 2183 2122 1875 880 772 656 11768 ----
NM_006924chr1753846 3484 3217 921 545 --33740 3625 2772 --
NM_006939chr1421032 996 --1169 21121 238
NM_006940chr1241659 1520 434 167 --2621 43 11539
NM_006948chr2131803 1640 84 1805 11516 --
NM_006962chrX2161 71 --11315 1148
NM_006981chr962664 2574 2476 952 127 111 32850 2313 174 ----
NM_006988chr215406 395 322 245 64 ------
NM_006990chr172487 1714 1703 1635 817 123 103 12183 11984 --
NM_006991chr35916 830 685 406 83 ------
NM_006996chr1101615 1518 1408 1371 1254 767 741 706 276 247 ------
NM_007002chr20183 ------
NM_007005chr91335 ------
NM_007006chr1652507 2265 878 441 86 1739 131 --
NM_007007chr1284517 4413 3689 1250 1034 483 446 237 14508 24665 3465 1312
NM_007008chr22954 937 --1363 --
NM_007011chr15166651 5381 5218 5212 5125 4768 4521 4305 2476 2136 1796 1275 961 852 427 350 24266 2686 ----
NM_007030chr583966 1828 1701 1350 1095 874 663 587 25007 3335 31623 1547 1169 --
NM_007034chr12354 260 ------
NM_007038chr21105809 5623 4131 3899 1962 1292 1187 657 522 466 45671 5400 1549 95 14780 --
NM_007039chr1442042 1937 932 59 11441 --12289
NM_007042chr352565 2371 2073 1022 611 --4728 677 515 91 --
NM_007050chr20198096 7929 7754 7585 7463 7457 7435 7133 6997 6435 6224 5800 5685 2680 2568 2144 2132 2003 275 45338 4994 1692 1566 56708 6450 1922 1031 206 27877 1194
NM_007054chr553625 3210 2551 762 398 ----13895
NM_007073chr6164206 4105 3971 3843 3732 3681 3501 3127 3011 2820 2800 2611 2597 1662 1322 449 --12772 12713
NM_007078chr1073074 2391 2161 2138 826 287 280 ------
NM_007099chr25815 805 319 142 98 ------
NM_007106chr1332497 2277 268 32594 1025 546 11031 --
NM_007107chr362330 1795 553 450 111 61 ----11826
NM_007111chr132682 296 ------
NM_007124chr652024 1702 1665 366 88 11588 --21856 1788
NM_007125chrY1976 11290 --1100
NM_007144chr1731016 412 348 ------
NM_007145chr194946 575 249 32 ------
NM_007146chr1762621 2412 2013 948 79 33 12433 21763 769 --
NM_007158chr11866 ------
NM_007166chr1141364 1237 1034 146 1204 2347 309 --
NM_007172chr2253348 2880 2866 757 324 2961 817 12206 --
NM_007179chr9----134 --
NM_007187chr135919 856 801 322 184 --11067 --
NM_007195chr1843032 795 718 28 1218 1573 12396
NM_007200chr15114636 4084 4000 3947 3905 2851 1751 1156 1032 471 322 11090 ----
NM_007203chr973850 3688 2873 1448 932 133 71 23165 3022 23301 2683 11075
NM_007212chr142073 2023 904 885 ------
NM_007222chr861852 1662 1474 697 539 119 --11312 --
NM_007231chrX32244 628 463 --12221 --
NM_007236chr155992 865 704 336 55 11820 ----
NM_007249chr13279474 8853 8718 8122 7934 7848 7829 7440 7241 7060 6295 6127 5958 5919 3784 3490 3424 3163 2996 2952 2925 2813 1332 1239 1005 508 32 33077 1367 944 55831 3582 3295 2883 785 12413
NM_007269chr11396 ------
NM_007276chr71774 --1201 11038
NM_007282chr3------1902
NM_007292chr1764431 3326 1657 458 168 37 11171 31378 816 226 --
NM_007315chr231208 966 220 31376 508 347 --1113
NM_007345chr18102023 2002 844 756 456 404 366 183 85 56 21963 864 22147 1621 --
NM_007347chr1573201 2952 2606 2013 1269 741 222 2712 356 12714 --
NM_007350chr12144501 4289 3668 3596 3376 3056 2952 2835 1705 1503 1421 1022 501 88 --13654 44175 3754 1274 619
NM_007353chr782564 2231 2184 2032 1991 1069 994 452 21005 553 1609 --
NM_007358chr162051 1826 1603 1540 1331 60 ----1109
NM_007361chr142481 73 --1162 1430
NM_007365chr162241 1697 1647 1638 1437 69 1183 12207 11452
NM_007375chr182725 2133 1900 821 570 520 507 171 ------
NM_009585chr33778 634 151 2623 199 1164 --
NM_009585chr33778 634 151 2623 199 1164 --
NM_012063chr121141 ------
NM_012069chrX62582 2409 2294 919 768 249 12473 ----
NM_012081chr563239 2523 2411 1103 933 357 13533 22476 810 --
NM_012084chrX----1503 --
NM_012089chr141432 1282 1145 347 --1365 --
NM_012090chr1199 11004 1291 --
NM_012095chr1082821 2417 2279 897 641 353 300 293 21257 1092 --22909 543
NM_012096chr3133753 3721 3301 2922 2876 2795 2320 2289 1333 1052 671 639 439 32639 2612 878 11445 --
NM_012097chr272284 2258 1733 686 439 311 61 1766 --12297
NM_012102chr1102368 2213 1920 1668 957 668 440 394 263 88 ------
NM_012104chr11123720 3203 3105 2946 2766 1401 1101 795 764 644 214 156 2636 447 12985 13634
NM_012104chr11123720 3203 3105 2946 2766 1401 1101 795 764 644 214 156 2636 447 12985 13634
NM_012120chr682867 2697 2401 2255 2026 993 140 44 --12629 --
NM_012124chr11--1149 --1143
NM_012129chr772500 2219 1771 574 401 324 64 1116 22335 2318 --
NM_012137chr162469 1919 859 822 416 47 22643 1020 ----
NM_012156chr2063293 2527 1227 830 478 145 22802 850 12962 12473
NM_012157chr35938 707 669 202 112 ----1758
NM_012158chr1361875 1729 1557 1514 1223 517 1609 11624 --
NM_012164chr9187181 6643 6579 6339 5921 5860 5572 5345 5213 5038 2982 2645 2632 1383 884 735 541 377 11920 45657 4901 4691 2153 35448 1082 476
NM_012175chr113949 712 648 ------
NM_012183chr12524 517 --1544 --
NM_012189chr181510 --1460 1202
NM_012193chr11125357 4784 1957 1931 1463 1281 1045 965 631 477 235 75 15236 11365 24867 216
NM_012199chr154141 3868 3567 3187 37 23705 907 23607 378 --
NM_012214chr286141 5669 5606 4844 4561 4282 4061 1231 2782 708 --36416 1929 1888
NM_012215chr1051587 1493 1447 789 551 --2637 32 --
NM_012234chr353064 2862 2842 1346 830 --12395 23695 3224
NM_012238chr1031760 1587 628 --21251 1205 1363
NM_012244chr1421151 731 --21284 749 1742
NM_012249chr292619 2601 2474 1219 1190 628 598 177 47 32761 461 198 13291 1269
NM_012252chr7135013 4893 4457 2062 1921 1700 1586 1528 667 546 301 138 34 --13667 --
NM_012259chr621311 1060 1123 --11046
NM_012262chr1145058 4895 4604 3868 3660 3502 1695 1598 1495 1368 1015 794 754 293 --23525 1471 14462
NM_012281chr762022 1896 1652 1629 1571 135 11746 11507 1827
NM_012286chrX1602 ------
NM_012287chr3124232 4185 3935 3919 3841 3493 3144 2953 2882 799 691 302 1398 1214 --
NM_012288chr695780 5329 5260 4163 4136 3902 1943 1620 1281 3975 731 206 64707 4608 3722 1647 1341 461 --
NM_012294chr783572 3538 3105 2606 2574 829 365 234 1136 1893 1530
NM_012296chr11133958 3709 3489 3315 2907 2779 2773 1347 888 615 524 275 21 33464 1163 531 12441 11546
NM_012297chr482224 2191 2053 2027 1872 1654 124 21 1973 --12238
NM_012301chr771714 1675 1643 1483 382 204 119 ------
NM_012309chr1175006 1845 1739 1328 1306 859 565 23852 776 34873 3493 3349 --
NM_012316chr194259 4147 3658 3615 1789 1498 1155 994 55 12080 15215 1613
NM_012319chr183401 384 33 1148 1808 --
NM_012322chr71357 1100 ----
NM_012323chr2261507 1189 1113 1088 996 284 21605 387 ----
NM_012327chr1841421 504 489 223 ----11235
NM_012328chr741367 1348 1077 331 ------
NM_012329chr1721643 148 ----1339
NM_012330chr1061769 1720 722 611 256 163 --21206 147 1622
NM_012334chr5114629 4541 4289 4118 3820 3141 1889 1264 831 651 221 44580 4031 3677 3305 ----
NM_012343chr551130 246 166 131 103 ------
NM_012347chr682770 2546 2302 2254 1992 1898 461 60 --12505 --
NM_012382chr594549 4206 4195 1135 1107 1008 852 659 460 33259 3195 2897 22827 2743 --
NM_012383chr9175 ------
NM_012388chr1542085 850 695 512 12581 --12316
NM_012414chr14802 153 133 96 ------
NM_012416chr941111 937 358 40 --1849 --
NM_012420chr1042210 2064 539 524 11669 12337 --
NM_012425chr1052535 1785 1097 243 230 --32098 1932 416 11811
NM_012428chr1521008 345 ------
NM_012432chr11350 ------
NM_012448chr17102547 2439 2259 1790 1610 536 422 338 320 290 ------
NM_012463chr1231590 1321 1128 11805 --1291
NM_012465chr1072493 2432 2343 2301 2100 541 160 33055 1390 618 11264 12687
NM_012471chrX71737 1719 1667 1554 1471 1294 324 11211 11754 --
NM_013229chr1232177 128 91 --12367 12321
NM_013230chrY21604 1445 1402 1425 --
NM_013231chr14144410 4020 3713 3576 3322 2917 2673 1360 1330 797 573 559 247 171 24034 3824 --12895
NM_013233chr231460 1323 1296 11368 1387 1278
NM_013253chr1111430 ------
NM_013255chr7188543 8061 7310 6958 6778 6283 6109 5762 5539 5392 3238 3106 2983 1440 1274 887 808 86 46663 3483 3378 2878 25754 1890 88257 7859 7425 7266 6239 2963 2261 798
NM_013257chr8112248 2063 1989 1728 1671 1616 1558 971 893 521 179 ----1240
NM_013262chr64577 470 320 284 11221 ----
NM_013263chr161164 ------
NM_013269chr1283751 3703 3158 1638 1041 963 932 35 1321 23451 584 11093
NM_013281chr2041538 1424 165 111 ------
NM_013286chr393540 2872 2507 1520 754 594 560 137 43 11278 --13767
NM_013293chr71748 --1505 1766
NM_013296chr11438 ------
NM_013302chr16103705 3441 3431 3029 3022 1753 1712 1152 1115 239 13461 --11739
NM_013313chr2273573 3405 3076 2212 1167 624 112 --1656 11352
NM_013322chr741552 1238 92 63 1194 11290 21332 1272
NM_013326chr18163 ------
NM_013341chr2122970 2740 2609 2552 2467 1961 1098 878 624 569 247 42 ------
NM_013372chr1593394 3110 3080 2843 2733 2327 2075 763 717 11100 1439 2728 698
NM_013374chr363165 2933 2654 2559 707 147 11913 ----
NM_013381chr125800 697 655 635 449 11605 ----
NM_013382chr1471944 1717 1556 890 523 187 176 22157 50 22372 1998 12388
NM_013391chr51118 ------
NM_013396chr2121516 172 --11063 --
NM_013410chr191256 903 882 863 402 377 251 191 83 ------
NM_013438chr95650 589 563 360 347 --21246 690 --
NM_013444chrX1323 ------
NM_013448chr141669 ------
NM_013449chr1232646 2328 309 --12587 1238
NM_013943chr183230 2603 2375 2001 1304 681 674 629 --1841 22314 575
NM_013989chr1494367 4307 4155 1922 1489 841 86 48 37 25163 812 1221 24556 3942
NM_013995chrX22252 40 --1641 --
NM_013996chr72468 129 ------
NM_013996chr72468 129 ------
NM_013997chr72468 129 ------
NM_013997chr72468 129 ------
NM_013998chr72468 129 ------
NM_013998chr72468 129 ------
NM_014007chr921269 103 11296 11286 1468
NM_014011chr252253 2174 2009 1835 793 1643 2667 416 12414
NM_014016chr361287 689 586 463 409 116 ------
NM_014021chr193383 3357 2770 2540 1155 830 538 263 211 23101 80 31265 1226 183 --
NM_014023chr1061971 1874 831 619 570 241 1901 12829 22548 2084
NM_014028chr653204 3020 2839 569 349 12340 ----
NM_014033chr1262303 2207 1548 773 46 21 --22061 2013 --
NM_014034chr671541 1444 1345 1265 1059 543 278 ------
NM_014035chr541375 1107 30 24 2312 214 ----
NM_014043chr32385 242 ------
NM_014048chr16155000 4649 4594 4470 4299 4263 3268 1684 1562 1376 968 514 503 390 280 13313 34279 3618 1623 --
NM_014106chr1541992 973 447 52 1877 186 --
NM_014109chr831052 854 128 ----1492
NM_014112chr8114918 4643 4451 4148 3998 3685 3659 1218 916 179 105 14086 --24986 3391
NM_014117chr1672680 2503 2308 2096 1064 977 283 141 ----
NM_014141chr7115240 4567 3442 3273 3247 2040 1983 1977 1424 1340 67 55189 4412 3369 1070 883 35162 1485 360 24018 397
NM_014154chr361623 1356 998 520 268 63 --1621 --
NM_014155chr11186579 6388 6028 5847 5754 5712 5414 4796 4770 2658 2573 2142 895 722 562 203 134 74 26403 5352 35499 2944 366 26228 2703
NM_014157chr1663362 2840 2784 2681 1515 47 32823 2701 310 13340 13878
NM_014181chr272669 2635 2497 2432 2383 1021 153 --32008 1933 1818 1332
NM_014186chr1152059 1654 1624 478 164 22271 469 32211 244 227 32319 2034 1450
NM_014191chr123393 379 372 --1830 --
NM_014217chr141776 1697 705 296 31945 1844 1822 11339 --
NM_014240chr363968 1533 1519 926 837 690 12580 --13646
NM_014241chr101302 ------
NM_014243chr431613 1309 336 ----21463 730
NM_014248chr221160 ------
NM_014253chrX72520 1791 946 917 752 349 268 11737 --11016
NM_014255chr121119 ------
NM_014268chr1811226 1515 11460 --
NM_014283chr16310 280 268 192 143 108 --11420 --
NM_014286chr963641 3565 2912 1297 421 251 33290 2570 189 13260 1818
NM_014309chr2295154 4816 3968 3694 3508 1580 1531 1216 914 23486 1192 13889 --
NM_014325chr1242031 431 277 228 --2721 209 --
NM_014331chr4227342 6987 6789 6553 6017 5645 5503 5493 5420 5002 4774 4724 3073 2877 2562 2479 2432 1919 1111 435 413 78 45516 5345 2971 1610 --12540
NM_014332chrX1310 ------
NM_014333chr1132273 1839 1041 ----12021
NM_014342chr1161398 1183 1155 1128 557 260 ------
NM_014350chr53833 745 175 1360 2800 203 --
NM_014372chr161428 473 209 185 153 109 1817 --2442 78
NM_014376chr582338 2323 786 615 594 564 226 43 159 1952 --
NM_014379chr82825 301 21083 1068 --129
NM_014381chr1443038 1249 788 638 22927 2893 23123 2667 33093 2197 1078
NM_014388chr165935 5909 4912 4628 1607 171 45545 4406 3805 2424 11744 --
NM_014423chr5125372 4907 4300 4256 3704 2252 2163 1763 1301 1233 1179 789 --25131 4581 25332 1588
NM_014445chr352115 1898 951 550 449 --1560 1736
NM_014447chr431581 1318 28 ----11216
NM_014455chr12427 411 ------
NM_014456chr1031561 370 215 --21845 1380 --
NM_014469chr114666 582 524 231 1732 ----
NM_014480chr194265 181 81 23 --3351 322 154 --
NM_014517chr351815 1708 1544 300 52 --11490 --
NM_014572chr1351429 1289 1255 264 83 --21795 557 --
NM_014574chr141306 ------
NM_014584chr1451631 1477 283 202 68 11424 ----
NM_014585chr231047 1005 875 --1134 11081
NM_014603chr1751721 1593 598 217 38 31198 337 238 --11304
NM_014607chr251976 1706 1493 776 166 --11800 --
NM_014612chr961399 1241 1014 548 233 72 --1294 --
NM_014613chr583075 2512 1901 820 665 480 465 381 12828 --22424 604
NM_014615chr1683126 2708 2468 1372 1100 1045 1037 582 11115 2854 599 21384 763
NM_014616chr393223 2780 2764 2172 1379 943 480 465 156 12968 11029 12993
NM_014620chr121606 2589 519 1312 1276
NM_014629chr81428 11062 --1513
NM_014636chr993514 3504 3130 2649 1193 994 748 639 68 13085 --13606
NM_014647chr1652134 625 469 315 60 31466 784 110 1840 --
NM_014667chr362452 2320 2273 1980 1943 1655 --11671 --
NM_014670chr281645 1418 1403 1297 609 429 410 292 ----1648
NM_014676chr141534 1378 1302 600 --31344 365 166 --
NM_014677chr851188 456 369 196 181 1262 1306 --
NM_014701chr1553091 2769 583 453 339 ----1773
NM_014702chr653345 3036 1122 1083 429 33223 3137 2749 13330 11394
NM_014705chr761899 1503 808 525 383 162 ------
NM_014707chr762133 1885 1704 1685 697 260 --11637 --
NM_014711chr1632110 1796 563 --21917 1652 --
NM_014720chr1021775 1168 --11161 1458
NM_014721chr6197301 7110 6981 6366 5499 5459 5274 5179 4772 4632 4521 2693 2366 1732 1579 1131 678 268 51 64904 1947 981 905 821 325 12459 11707
NM_014727chr191307 ------
NM_014729chr842191 1620 1497 606 11482 1318 11677
NM_014730chr12165251 5010 4708 4587 4418 4379 4095 3395 3252 2052 1688 1391 1107 1084 563 516 --34118 3455 1057 --
NM_014730chr12165251 5010 4708 4587 4418 4379 4095 3395 3252 2052 1688 1391 1107 1084 563 516 --34118 3455 1057 --
NM_014732chr16115125 4624 4581 4156 2166 1212 973 941 901 847 235 33563 115 99 1800 15485
NM_014733chr54901 422 88 65 ------
NM_014735chrX61841 1355 760 699 691 664 ------
NM_014739chr6124217 4100 3365 3192 1669 1480 1283 1052 653 624 595 505 13625 1576 --
NM_014743chr473152 2700 2487 2434 2210 2197 487 ----2905 667
NM_014746chr2114300 4245 3793 3761 3574 2729 2673 1268 948 611 429 24388 1654 21695 1019 11311
NM_014747chr1105621 4815 4580 4261 4190 4180 3746 1548 1486 403 45825 4511 1815 1264 34950 3949 3538 11857
NM_014749chr142880 142 149 ----
NM_014751chr882004 1826 1790 1743 1631 1370 523 438 ------
NM_014752chr1131404 1324 252 --2268 111 1576
NM_014755chr283972 3590 3435 3321 3019 2694 1314 1171 43963 1020 916 910 1322 13559
NM_014757chr542283 731 120 69 11690 32294 555 90 --
NM_014766chr783257 2929 2365 1165 1093 618 370 338 21214 125 --23315 2803
NM_014767chr10113343 3180 2788 2497 2434 1434 1418 1248 1235 881 696 11302 1286 --
NM_014772chr1873544 2879 2654 2397 1444 517 420 --21185 716 13265
NM_014774chr1102738 2298 1102 895 813 463 316 262 153 142 11095 32639 1063 600 --
NM_014776chr1272892 2650 1237 1151 818 272 46 22287 715 11213 1938
NM_014779chr36907 901 251 148 85 37 --1865 1380
NM_014781chr8------1105
NM_014787chr172781 2680 2635 2365 2126 507 370 --1771 --
NM_014790chr51491 1124 1523 179
NM_014803chr1052077 195 152 123 30 --12531 --
NM_014810chr143408 3203 3043 2854 ------
NM_014812chr131726 1240 216 11599 ----
NM_014819chr552142 1994 800 585 511 1251 12416 --
NM_014820chr342031 1848 633 37 11669 ----
NM_014826chr162849 2833 2729 1532 1254 883 41680 860 805 100 23199 686 13570
NM_014828chr1421875 635 21602 1562 157 1737
NM_014830chr1263711 3286 2424 1479 642 182 12640 ----
NM_014835chr2082151 1702 1604 708 633 536 397 206 ------
NM_014836chr1011839 21363 593 --12022
NM_014838chr2231150 1050 914 --12767 --
NM_014839chr132083 936 184 ----12516
NM_014850chr3104516 4345 4202 3505 3423 3193 3003 1853 1440 849 --31933 1648 597 1832
NM_014859chr1721441 903 21282 1101 ----
NM_014864chr174219 3819 2727 2666 870 793 728 24079 3592 11530 --
NM_014869chr321132 1065 11210 21415 1139 1504
NM_014870chr1144745 4455 4060 4020 3794 3287 3139 3031 1048 819 766 669 314 23 14167 24695 3994 11668
NM_014873chr1124841 4714 4360 3681 3547 3188 3027 1615 1034 622 574 102 24053 1525 23522 1879 --
NM_014874chr181776 1463 1330 1256 538 348 311 196 ------
NM_014877chr17117545 7539 6789 6717 6346 5416 2120 1944 780 627 325 17576 --26675 5774
NM_014888chr781276 981 613 579 279 232 90 28 ------
NM_014892chr62488 423 ------
NM_014893chrY42369 1980 347 217 --1667 --
NM_014898chr1962485 2309 2128 1663 1597 630 1354 2246 162 1724
NM_014900chr261171 1080 1026 447 337 155 --1745 --
NM_014903chr1282325 2305 2007 1525 751 334 236 91 21923 1625 ----
NM_014904chr1093966 3876 3668 3531 3322 1361 1226 760 666 --11522 --
NM_014906chr1764078 2598 1271 941 900 570 ----1522
NM_014909chr14113958 3173 3136 3079 3068 2604 2575 1503 705 612 588 43325 3026 1170 294 ----
NM_014912chr10113452 3366 3009 2848 2435 2417 2160 1376 1243 989 834 12506 22482 1067 --
NM_014920chr673327 2796 1277 817 531 100 39 43494 2428 1193 1065 ----
NM_014921chr1963072 3034 2653 2641 2345 2013 1982 32168 546 403 13101
NM_014923chr1372352 2181 2153 760 686 447 432 --1569 --
NM_014924chr1453070 2983 2349 1076 640 --1453 22847 880
NM_014926chr321162 978 ----1817
NM_014934chr1384030 3917 1435 1105 935 646 478 264 --32917 2719 1383 132
NM_014935chr193673 3227 3154 2853 2684 2617 2411 1335 65 153 ----
NM_014936chr652473 2183 1890 1865 609 12292 2630 456 --
NM_014946chr252872 1107 681 556 205 1868 12788 12330
NM_014951chr1052247 1618 492 253 207 22648 341 --1113
NM_014953chr1384124 4013 3648 3017 1402 584 577 401 13235 32825 1047 517 --
NM_014961chr482193 2132 1956 1930 1732 1590 635 115 --2298 230 --
NM_014962chr2062209 1955 1876 796 752 204 --11828 1863
NM_014964chr1711577 12285 --11484
NM_014965chr3102210 2188 1854 1431 778 574 483 372 170 142 1915 1669 --
NM_014970chr11331 ----1266
NM_014977chr141142 ------
NM_014978chr1051363 1259 1244 464 217 11301 --11530
NM_014982chr1495071 3908 1920 1648 1075 585 472 282 200 1813 25361 5053 14311
NM_014988chr442155 1014 748 118 1783 --12514
NM_014989chr65725 695 579 349 80 1652 1773 --
NM_014999chr121621 ------
NM_015000chr1262840 2560 2327 2297 2272 2144 12195 --2963 454
NM_015002chr1232044 1394 223 41944 1723 1587 112 12175 --
NM_015008chr3103039 3033 2442 2245 1441 1391 1258 992 619 613 --13105 --
NM_015017chr151179 1124 1080 215 81 ------
NM_015018chr61240 ------
NM_015020chr1693612 3054 2894 2733 2442 1054 675 563 458 23336 468 13321 23176 2642
NM_015024chr81392 ----1560
NM_015025chr232399 2366 1082 --11953 --
NM_015026chr12114036 3730 3441 3312 3034 1240 1136 582 556 181 23 --23957 3045 --
NM_015027chr164784 704 667 516 31627 1613 624 1526 11970
NM_015032chr1372102 1982 1794 1100 1041 86 33 22427 1055 12965 --
NM_015035chr20166180 5909 5796 5583 4938 4836 4599 4391 2589 2477 2400 2234 1597 992 967 155 22167 516 26104 4182 164
NM_015039chr1113776 3647 3459 3410 3187 3147 2699 1750 1394 1347 1256 43489 1598 933 660 13840 --
NM_015044chr1673254 2888 2503 2267 1118 711 418 11038 --12437
NM_015045chr1032049 516 399 21606 137 --22191 63
NM_015046chr962731 1044 941 626 556 298 12255 22439 185 --
NM_015051chr962600 2331 1217 1081 643 259 23131 419 --23183 2076
NM_015052chr721261 547 21019 426 1148 --
NM_015054chr12--1152 1523 --
NM_015055chr1162777 2097 1136 1098 472 171 --12448 1525
NM_015057chr132719 178 ------
NM_015059chr15113735 3503 3479 3192 3072 2568 1343 1300 1153 861 690 13157 13323 2463 293
NM_015068chr793828 3310 2939 2521 2490 1368 1027 543 386 1517 22420 1359 --
NM_015069chr161185 ------
NM_015071chr5146110 5714 5525 5464 5424 5306 5198 4675 4571 4486 1983 1817 1227 259 66052 5248 4949 4404 4023 2567 14543 25222 4611
NM_015074chr154473 3971 3064 1846 47 --24440 4387 14343
NM_015076chr694382 4142 3828 3043 1067 949 923 807 356 13992 11036 11635
NM_015082chr552235 2131 794 450 94 52590 2443 2377 2277 543 21959 1746 --
NM_015087chr1372712 2204 2018 752 558 269 31 ------
NM_015090chr176270 4551 4524 4213 2281 1401 939 24795 88 24383 1089 26190 3967
NM_015091chr14268 34 --1266 --
NM_015092chr16114561 4444 4186 3642 3524 3214 1203 905 535 528 232 180 24163 4081 13408
NM_015093chr671679 1602 627 582 388 207 72 1551 11294 --
NM_015094chr2284615 3052 3022 2953 1208 810 179 63 22848 195 44710 3210 794 566 13863
NM_015097chr382179 2083 1637 1504 707 371 363 215 12111 --12275
NM_015100chr1----21639 589 --
NM_015107chrX112463 2243 2009 1972 1842 1610 886 571 564 382 139 --31737 1618 427 --
NM_015110chr992199 1882 923 818 610 395 376 187 97 1787 ----
NM_015115chr463233 3112 2852 2843 2015 2001 ------
NM_015124chr2272482 2342 2245 2103 843 810 400 1419 ----
NM_015130chr41122 11111 --1424
NM_015132chr781972 1804 1582 1569 1435 753 594 346 1338 ----
NM_015134chr172621 211 ----1428
NM_015138chr1552764 2680 1821 895 547 ----22690 2384
NM_015141chr332063 1959 1935 2871 485 12771 --
NM_015143chr411476 11186 1175 1316
NM_015144chr16104032 3509 3333 2871 2490 1551 1363 1276 802 292 23456 3081 23489 1234 12466
NM_015147chr2112821 2514 2373 1065 1041 993 764 417 314 304 237 ----189
NM_015149chr161744 1611 1562 1413 864 35 1853 1492 21384 596
NM_015163chr141687 21612 54 2746 125 --
NM_015176chr141536 1236 1097 484 --21191 703 --
NM_015178chr852212 529 478 306 287 22255 1923 42003 974 587 258 1573
NM_015185chrX73017 2667 1158 753 288 201 77 12818 ----
NM_015198chr711099 ------
NM_015199chr3152189 1933 1206 1144 1108 1097 1040 885 645 612 397 388 162 63 35 --12784 --
NM_015200chr462445 2337 1963 605 221 42 2423 33 --1266
NM_015206chr1593530 3365 3305 3036 2900 2428 1264 1058 1019 ------
NM_015208chr1883755 3690 3595 3028 2909 1559 933 276 --13453 --
NM_015209chr152340 1866 1804 1677 1546 ----11910
NM_015215chr162635 1992 1236 1041 703 470 12390 --1325
NM_015225chr962712 2696 2328 2012 864 574 12829 13130 12480
NM_015230chr451727 1540 1164 537 361 --1640 --
NM_015233chr1332710 563 197 1230 1303 --
NM_015235chr1092116 1847 1760 1708 1524 1445 442 430 363 --171 --
NM_015236chr421489 443 --11327 1374
NM_015239chr91115 ------
NM_015247chr16155080 4869 4732 4388 4281 3831 3548 3476 1600 1437 1324 1282 1221 328 186 11740 --11231
NM_015251chr1621973 314 22352 1765 --12259
NM_015252chr21967 --1839 165
NM_015265chr242102 1077 741 67 ------
NM_015268chr33662 513 184 ----2152 35
NM_015271chr4164340 3849 3513 1647 1445 1284 1235 1050 1018 985 884 878 747 734 529 376 33771 3478 945 ----
NM_015272chr16102044 1840 1399 1333 806 666 554 475 353 280 ------
NM_015275chr1241425 590 172 135 1710 --11340
NM_015277chr1851637 1373 1208 439 281 ----11732
NM_015278chr693465 3335 2861 2807 2786 2385 2286 708 485 --42635 527 178 113 2823 35
NM_015282chr242382 1150 190 34 --11053 21044 241
NM_015285chr1851788 1638 889 826 315 52127 2116 2033 1008 273 --1815
NM_015288chr593552 3276 2872 2768 1502 581 535 311 49 11308 11340 13011
NM_015291chr142389 1134 1063 332 1903 33222 2482 502 --
NM_015296chr1321109 779 1191 ----
NM_015308chr115889 832 746 331 58 ----1794
NM_015310chr8128214 7691 7660 7105 6623 6278 5958 5096 3355 3255 1857 600 46035 6018 5107 1635 27546 96 26383 5487
NM_015313chr11104018 3536 3518 3064 2987 1871 1865 1253 840 369 11115 ----
NM_015314chr782452 2187 2103 2087 2060 2042 1698 532 1943 --1468
NM_015315chr5103505 2988 2801 2358 2286 2267 1102 984 913 433 11259 13065 --
NM_015317chr262546 2310 2213 942 769 351 1325 21087 289 --
NM_015322chr15142 ------
NM_015326chr142114 2108 1184 161 --12522 12439
NM_015328chr762758 2018 918 810 517 103 41098 1032 893 214 ----
NM_015335chr1241741 1730 836 777 2990 914 52598 2401 2143 2054 734 --
NM_015336chr124862 541 164 99 --21016 728 --
NM_015339chr204859 414 261 70 ------
NM_015347chr1242836 2480 758 363 12375 1924 1275
NM_015349chr692656 2348 2156 1037 885 420 231 174 85 21237 848 --1616
NM_015355chr1741858 1752 1617 236 --11823 --
NM_015365chrX83646 3272 3069 2726 1361 1172 919 809 11555 23471 3439 24010 1618
NM_015375chr1114796 4767 4137 4042 3977 3648 3162 1464 1170 771 232 --1252 --
NM_015378chr182414 1187 1145 962 924 472 460 152 42610 2354 1968 991 21104 883 --
NM_015394chr1242423 2386 765 27 11756 1859 --
NM_015409chr1272763 2403 1961 679 539 491 225 3503 313 291 1361 --
NM_015415chr1--187 ----
NM_015420chr8170 ------
NM_015429chr31196 2184 80 1104 --
NM_015435chr851201 946 528 232 200 --198 --
NM_015436chr482815 2382 2250 1345 1285 688 643 51 2256 203 1856 13141
NM_015447chr93681 663 635 1130 ----
NM_015448chr10--1172 ----
NM_015455chr543445 3117 2733 589 23246 154 --21540 574
NM_015458chr855069 1968 1532 687 306 14578 11454 12086
NM_015460chr351820 1723 495 165 108 21375 1352 21416 594 12141
NM_015462chr17137 --1282 --
NM_015464chr711003 ------
NM_015472chr3163 --1366 --
NM_015472chr3163 --1366 --
NM_015477chr1521031 201 ------
NM_015497chr1521140 336 ------
NM_015509chr1261680 1488 1194 1126 1018 395 11441 --1281
NM_015520chr382597 2454 2246 872 336 285 113 87 2753 582 12789 --
NM_015523chr11--1286 ----
NM_015532chr1541097 981 904 179 --2798 137 --
NM_015534chr11735 ------
NM_015548chr63387 217 22 2740 194 ----
NM_015550chr793152 3037 2266 1360 1332 1113 1045 935 288 12624 23579 2699 --
NM_015553chr675139 4854 1963 1783 1484 1393 229 24641 1877 44566 4378 1709 66 --
NM_015554chr1582921 2789 2656 2579 2548 2497 729 405 1918 ----
NM_015557chr173096 2650 2382 821 763 369 191 33541 2670 2546 21085 93 12931
NM_015564chr5123599 3306 3142 2654 2607 2475 2199 1343 940 589 343 227 12971 23559 2181 33431 2490 1075
NM_015567chr13------1901
NM_015568chr20124298 3864 3845 3814 3808 3198 3173 1064 805 562 304 222 43268 3100 1410 683 23972 3745 24017 3560
NM_015569chr1144789 3891 3777 3464 2970 1763 1607 1135 1098 736 652 613 565 48 --34077 675 591 23658 1318
NM_015570chr771786 1757 1513 561 452 378 106 --21259 635 --
NM_015571chr65979 877 632 618 147 --1167 --
NM_015575chr263701 3559 3195 3014 1381 1176 12336 1962 --
NM_015576chr352474 1814 952 511 280 --21137 841 --
NM_015577chr551769 1521 656 639 212 ------
NM_015578chr1921984 668 32077 1303 703 12083 --
NM_015602chr121726 1649 ----11794
NM_015622chr71279 ------
NM_015635chr92662 648 1497 ----
NM_015640chr194741 4427 4247 3628 2084 2022 1343 347 53 13669 13296 --
NM_015651chr962098 1930 1432 591 580 159 ----21861 56
NM_015652chr101266 1525 ----
NM_015678chr133473 61 34 21087 694 --124
NM_015726chr161859 1523 545 469 280 256 ------
NM_015852chr7123609 2549 2485 1413 1083 999 915 747 579 495 411 159 11168 1327 --
NM_015866chr12964 42 ------
NM_015878chr842108 2055 366 291 ------
NM_015879chr18178088 8051 7926 7546 7538 6466 6364 6001 5583 5337 3157 2873 2632 2600 1744 796 40 57390 5201 3372 878 192 28315 7563 38421 5819 1274
NM_015881chr1111430 ------
NM_015885chr11----140 --
NM_015897chr191187 ------
NM_015906chr1104860 4695 4585 4413 3872 1173 801 237 231 130 14817 ----
NM_015932chr137796 667 531 244 202 177 85 ------
NM_015967chr14660 397 216 146 ------
NM_015975chrX31635 1442 1282 31260 1136 621 ----
NM_015976chr11359 ------
NM_015984chr12563 524 ------
NM_015995chr1565056 4737 3850 2166 600 97 35365 5226 4207 25262 3457 --
NM_016009chr173344 1569 1509 1405 646 466 436 --24136 1685 --
NM_016018chr852554 2492 2414 1925 1116 --31867 1021 91 --
NM_016021chr642374 2310 999 441 --32979 2848 2282 12022
NM_016023chr842054 1972 1938 555 21684 127 ----
NM_016025chr1662024 1852 1803 1334 536 379 1234 --1137
NM_016027chr8190 ------
NM_016040chr172469 2418 2219 1895 1702 603 110 1240 3730 639 477 --
NM_016057chr122825 209 ------
NM_016072chr1262153 1957 1699 769 693 164 2581 52 12368 --
NM_016073chr1531027 740 196 ------
NM_016076chr173052 2985 2484 976 197 73 61 12133 ----
NM_016083chr63821 244 209 --11576 23516 3436
NM_016089chr332170 1509 850 1864 7821 653 485 401 317 233 65 --
NM_016090chr1131023 794 763 1137 1975 --
NM_016103chr5----1336 --
NM_016107chr51540 11193 ----
NM_016112chr10126 ------
NM_016120chrX2866 837 1426 --1191
NM_016127chr85709 303 169 113 73 --1693 --
NM_016129chr42369 268 ------
NM_016131chr242288 1929 1860 1450 ----1456
NM_016132chr1521061 894 --21013 95 33290 2883 60
NM_016133chr241673 437 261 33 1417 ----
NM_016162chr12------1595
NM_016169chr1032200 693 434 ----32847 1256 559
NM_016185chr176782 655 597 556 228 108 ------
NM_016201chr362320 1830 1583 1519 802 279 22352 2222 ----
NM_016203chr7145 --1763 --
NM_016206chr3218644 8296 8224 6894 6450 6176 5738 3581 3558 2376 2095 1540 1490 1098 732 621 514 417 189 160 100 28504 6828 27708 3295 11018
NM_016220chr7102061 2000 1650 1459 900 578 494 466 414 77 ----1303
NM_016221chr542399 1713 945 708 11964 --11938
NM_016224chr662200 2018 1889 1624 1396 252 ----11636
NM_016227chr16310 280 268 192 143 108 --11420 --
NM_016235chr1611255 1265 --1179
NM_016248chr1353749 3707 2684 2428 1505 --1984 --
NM_016255chr652625 873 676 304 222 22674 55 --12379
NM_016257chr1103351 3242 3224 3213 3143 1236 1223 1108 721 699 --12422 13555
NM_016258chr11652 ------
NM_016260chr2157664 7453 6996 6858 6619 5818 5683 5206 4841 4652 2888 1409 928 819 257 12622 35326 5214 1139 26343 2978
NM_016269chr431180 1094 274 142 1973 1225
NM_016271chr1852362 2190 600 594 105 22287 881 --11611
NM_016275chr382704 2404 2168 1085 761 334 77 53 ------
NM_016279chr51196 ------
NM_016287chr141699 1689 443 368 --12118 1499
NM_016289chr242303 2279 2243 561 --1572 --
NM_016297chr273484 2784 1452 772 652 355 121 13028 21500 1007 --
NM_016300chr33389 376 337 ------
NM_016301chr123463 109 31 188 1376 --
NM_016315chr2------21584 363
NM_016338chr551095 439 249 237 76 --11027 --
NM_016353chr831973 232 36 ------
NM_016356chr64906 887 723 398 --22974 138 1215
NM_016374chr151595 1390 372 245 169 --11510 11526
NM_016374chr151595 1390 372 245 169 --11510 11526
NM_016376chr17104290 4237 4087 4051 3302 3184 2915 1328 632 397 --11628 --
NM_016410chr91235 ------
NM_016424chr1762009 1685 1650 1642 1319 296 21624 568 1147 1667
NM_016441chr23443 377 61 2609 559 32374 2100 475 --
NM_016448chr141895 1393 666 116 41799 1634 1461 599 ----
NM_016453chr32529 224 1596 --1641
NM_016480chr52240 148 1774 2175 81 --
NM_016488chr12111976 1959 1921 1771 1681 1552 777 446 178 160 115 ----11228
NM_016489chr7------1231
NM_016507chr1773043 2856 2644 2474 2187 284 123 ------
NM_016513chr673327 2796 1277 817 531 100 39 43494 2428 1193 1065 ----
NM_016522chr1161658 1554 1234 502 178 31 ------
NM_016530chr1583089 1532 1138 990 598 403 269 60 21302 526 33991 1312 1170 1569
NM_016531chr421463 1344 23296 865 12970 --
NM_016542chrX61619 1613 522 499 133 43 1356 1400 11274
NM_016545chr11753 --3781 717 644 --
NM_016559chr341147 570 380 177 1206 --1111
NM_016569chr1221178 608 ----11446
NM_016577chr374317 3118 3072 2871 1331 1088 966 34336 1428 1273 33059 1126 718 --
NM_016578chr112687 481 --172 --
NM_016587chr71774 --1201 11038
NM_016592chr2051317 1276 1142 1120 65 1558 --11310
NM_016598chr321439 91 1399 1164 --
NM_016603chr542044 1699 1626 460 134 1451 --
NM_016604chr52470 183 1107 --11229
NM_016613chr442173 2055 1873 512 12280 12465 --
NM_016621chr11124644 4285 4203 3920 3786 1663 1595 1350 786 701 78 72 14635 11081 24445 23
NM_016623chr8----1582 --
NM_016626chr1891768 1333 1287 1182 359 320 263 153 49 ------
NM_016653chr21758 --1941 21209 1018
NM_016818chr212795 291 --1530 1752
NM_016823chr17193 ----1995
NM_016824chr1051545 769 649 595 516 ------
NM_016834chr17124132 3926 3149 2727 2643 2575 1519 1501 1321 1182 354 194 43804 3235 649 604 12845 --
NM_016835chr17124132 3926 3149 2727 2643 2575 1519 1501 1321 1182 354 194 43804 3235 649 604 12845 --
NM_016836chr22747 646 ------
NM_016839chr22747 646 ------
NM_016841chr17124132 3926 3149 2727 2643 2575 1519 1501 1321 1182 354 194 43804 3235 649 604 12845 --
NM_016929chr6144179 3832 3624 3513 3385 3024 2911 1803 1792 1740 1691 1563 1210 286 33091 586 405 21387 974 23323 1165
NM_016936chr1622083 1968 31715 853 496 --11682
NM_016952chr1174102 3982 3662 3367 2837 2735 309 33974 1418 974 13177 --
NM_017411chr52546 167 ------
NM_017412chr831325 547 42 1953 ----
NM_017413chrX72019 1913 1769 1730 919 473 272 --32112 1582 880 1779
NM_017415chr543896 3877 603 480 23999 1614 44586 3444 3431 827 --
NM_017420chr14113425 3225 3128 3029 1536 1527 1411 1385 1040 521 56 ------
NM_017426chr41497 --1218 --
NM_017444chr871721 1234 596 578 476 344 200 1307 ----
NM_017447chr21104308 3635 3424 2733 1247 1106 1038 940 785 717 --11352 --
NM_017455chr1521008 345 ------
NM_017519chr61361 11032 ----
NM_017540chr5113259 3062 2923 2526 2286 1984 1217 347 273 264 198 ----33104 819 587
NM_017541chr31252 1180 ----
NM_017544chrX----1878 1897
NM_017563chr3176164 6016 5989 5957 5679 5513 4205 2408 2254 1910 1486 1046 906 698 414 275 218 14256 36044 4338 2486 1552
NM_017577chr311031 21506 1285 ----
NM_017580chr1031861 378 318 ----32131 1837 590
NM_017583chr1131300 717 88 1305 2490 224 --
NM_017594chr962849 2459 2385 1353 1153 967 23380 2933 11320 2951 405
NM_017599chr1252011 1531 722 530 49 1106 ----
NM_017610chr1542141 2111 1849 1759 --1193 --
NM_017612chr12--1137 ----
NM_017628chr474597 4006 3804 1906 1139 645 30 23793 1483 ----
NM_017632chr42425 416 ------
NM_017633chr693949 3682 3501 3424 3287 1261 363 268 151 22911 32 12627 13493
NM_017637chr9199128 8968 8031 7901 7610 7369 7334 6616 6348 5900 3752 3190 2777 2454 2334 1976 1602 1440 1314 18809 32982 2400 1250 25881 1519
NM_017641chr121998 ----1935
NM_017643chr1743068 2804 2305 1937 32780 2555 938 12032 --
NM_017644chr385161 4980 4871 4796 1999 1369 788 169 14113 11643 127
NM_017645chr953025 2952 2072 486 477 22512 253 1537 --
NM_017650chr7145914 4479 4446 4319 4266 3941 3854 2079 1695 1544 1169 666 589 335 23922 1824 1673 11951
NM_017658chr1474283 3883 3080 3003 1579 226 132 12944 --23046 1662
NM_017664chr131130 --1398 --
NM_017671chr2072152 1682 1641 1502 270 244 46 11942 ----
NM_017672chr1531306 1202 178 --11097 --
NM_017694chr25658 571 545 509 495 --21898 1802 --
NM_017709chr184286 4141 3361 1704 1665 1608 1488 1391 1595 ----
NM_017712chr19106344 6027 5970 5452 5209 4967 4063 2523 1222 663 35564 4212 797 2418 165 --
NM_017719chr312237 31689 1663 905 1203 --
NM_017737chr161971 1865 1601 1535 518 103 ----2852 237
NM_017742chr1821624 1507 --21462 731 11924
NM_017744chr172427 2307 2104 2025 1547 774 671 1716 1138 --
NM_017745chrX----1570 --
NM_017747chr51337 ------
NM_017752chrX61945 1822 1412 661 212 132 21859 114 ----
NM_017754chr664792 4292 3419 1294 379 263 24693 408 1455 --
NM_017769chr1463250 1238 843 615 312 25 --22683 38 1436
NM_017770chr672979 2703 1898 1195 1185 1173 273 12157 --12957
NM_017776chrX71304 431 195 180 110 96 52 11060 31546 321 265 21594 129
NM_017799chr1451989 764 599 546 232 --31464 1382 244 --
NM_017813chr8115713 4693 4497 4458 4245 3876 1521 1196 681 549 466 45274 4988 432 101 --1477
NM_017822chr122820 221 1144 ----
NM_017824chr1062554 2389 2366 2098 1888 1089 --12017 --
NM_017826chr134317 156 90 66 --1189 --
NM_017831chr18124336 4075 4050 4022 3942 3935 3448 3371 1244 1120 897 523 14423 13676 24666 3161
NM_017847chr121941 1911 11409 21551 271 --
NM_017848chrX84356 4169 3959 3298 1331 1261 686 585 23925 3047 24506 347 23597 2888
NM_017873chr982970 1996 1038 674 427 395 315 142 22996 2344 22183 756 1129
NM_017890chr841629 1559 741 646 2485 249 2562 210 --
NM_017902chr1075729 5535 3766 3498 1149 620 248 23689 1307 15324 --
NM_017919chr985779 4574 4565 4332 4293 2343 1310 760 --35745 4167 429 --
NM_017922chr142573 39 ------
NM_017944chr1183052 2964 2639 2458 2322 1202 489 146 --32578 2190 383 32257 395 262
NM_017958chr272087 1204 742 547 505 283 87 12752 --21054 390
NM_017964chr23912 827 199 --1834 1306
NM_017994chr742503 1138 674 224 22332 451 --22171 2017
NM_017998chr961358 571 517 353 244 79 ----1502
NM_018000chr241922 1573 275 143 ------
NM_018003chr1552428 2183 1637 1528 980 ------
NM_018010chr371654 1482 1257 1018 243 214 157 ------
NM_018017chr1042254 1871 533 187 21041 553 --135
NM_018018chr1281700 1669 1652 1369 755 491 460 366 21543 421 ----
NM_018027chr1082786 1264 1191 1129 1097 1048 913 882 2811 330 --22342 85
NM_018043chr1161460 1096 1025 511 331 276 1192 1420 11210
NM_018045chr192807 2763 2597 2286 2075 956 882 693 655 --22706 1981 --
NM_018046chr551923 1890 1870 1746 1485 ----11209
NM_018054chr161182 --195 --
NM_018056chr1----1172 --
NM_018064chr61287 ------
NM_018084chr262302 1079 798 530 71 45 32363 2320 581 23119 2634 --
NM_018085chr1267812 7533 7424 7247 6613 6546 6179 6068 5887 5817 5777 5651 5531 5425 4993 3146 3060 2912 2875 2422 2254 2026 978 830 509 280 47973 5847 2263 1642 37343 5436 2047 --
NM_018086chr27674 499 419 213 196 166 75 --11935 --
NM_018105chr831245 313 214 1487 ----
NM_018121chr1073170 630 506 416 383 259 224 11026 2838 50 --
NM_018131chr101784 ------
NM_018133chr34611 461 396 236 11595 ----
NM_018137chr13937 255 198 1458 11206 --
NM_018155chr363338 2653 2384 2232 230 207 1320 --172
NM_018156chr182414 1187 1145 962 924 472 460 152 42610 2354 1968 991 21104 883 --
NM_018157chr12103299 3054 2422 2007 581 474 430 416 407 225 ------
NM_018158chr21198 ------
NM_018167chr145934 698 392 84 43 --1624 --
NM_018172chr1151573 1159 1138 959 87 5559 507 455 403 351 --1611
NM_018178chr151453 1437 1390 610 358 2619 231 1697 11818
NM_018182chr1731757 503 441 1468 21546 662 --
NM_018200chr1562444 2122 1885 1842 1004 886 1164 --32020 148 63
NM_018211chr122234 659 ----11960
NM_018214chr651252 1193 1018 1009 300 ------
NM_018227chr472613 2462 974 368 344 252 66 12038 ----
NM_018234chr292284 2167 2031 1710 1535 887 712 307 246 51595 1391 761 695 495 11547 --
NM_018243chr433675 3225 1220 12952 23724 3622 12487
NM_018246chr872606 2336 2111 1133 965 321 269 --12884 --
NM_018247chr63981 284 128 144 11907 12280
NM_018254chr132341 1493 610 --1198 11777
NM_018261chr41520 ------
NM_018293chr341824 868 362 50 --11844 --
NM_018294chr105814 562 371 90 47 1641 ----
NM_018297chr3----124 --
NM_018298chr11156 2895 222 ----
NM_018299chr821380 379 --23371 289 32473 1190 494
NM_018312chr1142197 1965 523 334 1689 ----
NM_018313chr352661 1037 941 715 31 1132 32420 2104 542 11965
NM_018314chr111760 ----1202
NM_018315chr431301 1022 231 --2539 492 21365 471
NM_018319chr1451415 1161 1083 562 93 ----11616
NM_018323chr431736 1159 146 --2478 372 --
NM_018327chr2071873 1477 1271 1145 730 590 453 --11185 --
NM_018328chr21204 ----1195
NM_018342chr451621 1556 1525 627 425 ----1517
NM_018348chr161126 11296 --1105
NM_018351chr1264502 3196 3099 2994 951 371 23604 109 --11209
NM_018361chr894046 3776 3631 2582 1309 898 519 148 107 33253 2796 1092 1537 1224
NM_018362chr1183016 2500 1386 1211 939 379 350 199 ----11507
NM_018364chr163624 3060 2805 1558 625 573 13274 24134 2814 13202
NM_018367chr1142457 2124 1940 1860 32138 1921 969 12403 1409
NM_018371chr85373 341 231 195 130 --11479 11010
NM_018373chr14106271 5798 4527 4319 2253 2138 1600 1574 496 474 1575 --1348
NM_018374chr754348 2036 637 398 135 --1262 1304
NM_018375chr1441821 1702 1427 576 --2236 167 --
NM_018383chr221555 84 1810 1247 11626
NM_018403chr393946 2779 2731 2630 1087 721 576 30 24 33599 941 896 --13055
NM_018425chr1072490 2467 1868 800 748 162 50 --2110 84 42667 2100 549 76
NM_018429chr562923 2888 2847 2801 2650 1908 ------
NM_018434chr51141 --1177 --
NM_018440chr8248677 8637 8136 8062 7852 7465 7454 7442 6966 5876 3410 3083 3041 2844 2654 2591 2406 2343 1605 1458 1108 873 497 383 46938 6485 1651 311 37181 2824 328 18722
NM_018444chr852377 2057 1711 848 325 --1744 --
NM_018448chr1221171 263 11023 196 --
NM_018452chr6_random133781 3706 3587 3397 3234 2749 2736 1424 865 652 592 326 313 1811 2771 407 1624
NM_018469chr1771402 1109 966 366 334 328 209 11170 1290 --
NM_018474chr20130 ------
NM_018475chr42710 80 ------
NM_018482chr851921 810 726 532 346 21836 227 12022 --
NM_018489chr1102363 2341 2254 1926 1811 1646 1573 646 457 365 1740 --1886
NM_018490chr1161904 1829 1168 739 732 304 21660 1471 ----
NM_018555chr1951817 1797 1558 1439 763 ----1391
NM_018566chr1134898 4449 3965 3525 2043 1787 1380 986 466 439 359 332 26 --14375 --
NM_018590chr1031756 594 250 ------
NM_018638chr1275167 4780 4420 4037 3481 3458 2143 --13539 173
NM_018640chr12152738 2653 2535 2382 2065 1971 1924 1828 1760 971 742 716 479 209 141 ------
NM_018650chr161801 1436 709 515 436 201 1165 ----
NM_018657chr33590 262 129 ------
NM_018660chr862957 2774 2050 1051 722 670 21067 230 1929 --
NM_018671chr151364 ------
NM_018682chr7185 ------
NM_018685chr75796 470 407 298 63 --1242 --
NM_018697chr742364 876 280 98 21790 149 2747 617 32398 2030 45
NM_018698chrX4665 659 176 78 1785 11802 --
NM_018703chr161399 --1316 --
NM_018704chr172145 2072 840 623 386 268 214 1207 21818 54 --
NM_018712chr1121054 373 --11085 11343
NM_018717chr492203 1944 1046 659 428 284 274 50 42 22814 1799 22090 1823 --
NM_018837chr202290 119 1359 --2946 268
NM_018841chr183897 3844 3464 2894 1488 1235 619 386 22464 494 13601 --
NM_018844chr7101815 1736 1707 1688 1401 814 787 763 356 185 ------
NM_018846chr75929 820 781 662 231 1788 ----
NM_018890chr731060 278 263 ------
NM_018898chr5102176 2010 1733 1568 922 851 743 648 369 240 --1179 21691 823
NM_018899chr5102176 2010 1733 1568 922 851 743 648 369 240 --1179 21691 823
NM_018900chr5102176 2010 1733 1568 922 851 743 648 369 240 --1179 21691 823
NM_018901chr5102176 2010 1733 1568 922 851 743 648 369 240 --1179 21691 823
NM_018902chr5102176 2010 1733 1568 922 851 743 648 369 240 --1179 21691 823
NM_018903chr5102176 2010 1733 1568 922 851 743 648 369 240 --1179 21691 823
NM_018904chr5102176 2010 1733 1568 922 851 743 648 369 240 --1179 21691 823
NM_018905chr5102176 2010 1733 1568 922 851 743 648 369 240 --1179 21691 823
NM_018906chr5102176 2010 1733 1568 922 851 743 648 369 240 --1179 21691 823
NM_018907chr5102176 2010 1733 1568 922 851 743 648 369 240 --1179 21691 823
NM_018908chr5102176 2010 1733 1568 922 851 743 648 369 240 --1179 21691 823
NM_018909chr5102176 2010 1733 1568 922 851 743 648 369 240 --1179 21691 823
NM_018910chr5102176 2010 1733 1568 922 851 743 648 369 240 --1179 21691 823
NM_018911chr5102176 2010 1733 1568 922 851 743 648 369 240 --1179 21691 823
NM_018912chr551264 1215 547 452 201 21310 123 11805 123
NM_018913chr551264 1215 547 452 201 21310 123 11805 123
NM_018914chr551264 1215 547 452 201 21310 123 11805 123
NM_018915chr551264 1215 547 452 201 21310 123 11805 123
NM_018916chr551264 1215 547 452 201 21310 123 11805 123
NM_018917chr551264 1215 547 452 201 21310 123 11805 123
NM_018918chr551264 1215 547 452 201 21310 123 11805 123
NM_018919chr551264 1215 547 452 201 21310 123 11805 123
NM_018920chr551264 1215 547 452 201 21310 123 11805 123
NM_018921chr551264 1215 547 452 201 21310 123 11805 123
NM_018922chr551264 1215 547 452 201 21310 123 11805 123
NM_018923chr551264 1215 547 452 201 21310 123 11805 123
NM_018924chr551264 1215 547 452 201 21310 123 11805 123
NM_018925chr551264 1215 547 452 201 21310 123 11805 123
NM_018926chr551264 1215 547 452 201 21310 123 11805 123
NM_018927chr551264 1215 547 452 201 21310 123 11805 123
NM_018928chr551264 1215 547 452 201 21310 123 11805 123
NM_018929chr551264 1215 547 452 201 21310 123 11805 123
NM_018945chr662524 2359 1093 994 450 57 --1962 1180
NM_018948chr111318 --1200 --
NM_018951chr72927 383 --21284 969 1227
NM_018958chr15143861 3611 3539 3199 3051 2893 2720 1586 1495 1442 1225 1067 1035 358 13234 ----
NM_018972chr822477 1709 --22065 576 --
NM_018979chr1241808 1043 746 294 ----22295 760
NM_018999chr10144976 4922 4910 4810 3066 1828 1273 830 587 579 513 95 76 49 2616 355 31233 976 189 1430
NM_019001chr374524 3772 3611 2950 1853 1685 1249 24248 2997 14131 --
NM_019004chr762275 2232 1587 401 353 237 ------
NM_019006chr15----1608 --
NM_019016chr17123 ------
NM_019027chr462611 2483 2055 1594 691 406 --12551 --
NM_019035chr421769 338 21330 661 11381 --
NM_019044chr264356 4247 3717 1502 911 85 --34509 3393 1339 --
NM_019049chr11638 1793 1577 --
NM_019050chr462118 1672 817 528 472 187 --21519 663 --
NM_019053chr101241 ------
NM_019071chr71621 ------
NM_019072chr573618 3113 3025 2817 2661 1003 588 12611 ----
NM_019084chr1042564 2472 1003 954 --12128 12167
NM_019091chr2----147 --
NM_019106chr22103232 3109 2613 2493 2155 670 590 354 310 189 32217 652 545 ----
NM_019114chr942300 1975 475 165 32330 2321 136 ----
NM_019116chr1683124 3042 2843 2729 2638 1301 693 373 33403 237 147 1347 12367
NM_019555chr381622 1361 1322 1231 674 525 396 84 11634 --11706
NM_019591chr12--1329 1150 --
NM_019593chr2062874 1130 875 699 626 289 ------
NM_019596chr2152901 2360 2187 734 242 12440 1208 --
NM_019597chrX----142 --
NM_019610chr161867 842 824 676 546 170 11598 ----
NM_019885chr262807 2302 2278 1953 927 737 1157 22219 386 --
NM_019895chr31758 ------
NM_019903chr1051545 769 649 595 516 ------
NM_020122chr285481 3880 1406 1091 1085 470 463 251 55711 5471 4156 709 566 35796 5292 2040 --
NM_020123chr1021539 1363 ------
NM_020141chr132234 2097 683 21646 199 11578 --
NM_020143chr251121 914 835 135 104 ----11039
NM_020148chr1893081 2902 2627 2265 2183 794 604 501 457 1267 23024 339 --
NM_020150chr10112263 2206 2089 1765 1633 1506 854 543 350 261 92 12233 --1122
NM_020178chr171146 --1304 --
NM_020182chr20103157 3091 3035 2943 2691 2627 2595 1210 484 43 12452 13620 --
NM_020193chr1141188 987 411 85 --21362 226 --
NM_020198chr1731539 1124 510 --11528 --
NM_020210chr151999 ------
NM_020214chr15160 ------
NM_020225chr41275 ------
NM_020228chr1172444 2423 770 730 671 528 61 ------
NM_020245chr6144551 3990 3793 3507 3490 3427 3309 1636 1245 1052 772 409 337 37 --33637 417 127 1107
NM_020321chr7157 ------
NM_020336chr2093712 3176 1302 741 649 613 297 257 107 --23832 568 13359
NM_020337chr472951 2424 2252 2169 2037 729 364 1838 1285 --
NM_020338chr1093561 2919 1378 1149 873 649 550 456 424 2942 109 23123 1126 --
NM_020341chr2051992 1593 1379 548 395 129 188 11427
NM_020342chr241962 976 522 200 194 22544 563 --
NM_020346chr1121727 333 1349 --21422 343
NM_020366chr14----255 30 --
NM_020374chr1231379 432 206 ----11801
NM_020390chr354136 3547 3141 1890 767 34055 3323 80 23300 1722 --
NM_020416chr432266 1739 1007 21991 94 ----
NM_020420chrY71718 1559 1152 557 415 393 147 1439 --11270
NM_020424chr164693 596 288 272 --1635 --
NM_020425chr661854 1845 682 462 293 239 ------
NM_020429chr7113008 2591 2410 1046 985 927 872 838 795 80 50 32092 1193 819 22751 2376 11248
NM_020432chr741948 1859 1584 67 11487 --1321
NM_020440chr142620 1327 1156 1020 1412 22688 2665 1980
NM_020443chr1116834 6790 6771 5564 5395 5312 5027 4670 1876 1752 520 36901 5125 4407 36066 4290 2128 14449
NM_020449chrX1698 ------
NM_020453chr43403 267 127 31968 1579 791 1488 --
NM_020457chr161686 ------
NM_020463chr251042 1018 950 537 80 1969 --2934 277
NM_020466chr6134991 3835 3638 3134 1953 1816 1808 1657 1585 1334 1131 80 32 --1884 --
NM_020482chr65832 739 248 169 123 2557 54 1785 --
NM_020529chr142389 52 ------
NM_020532chr22954 937 --1363 --
NM_020546chr5122870 2738 2600 2574 2555 2178 1276 1190 860 775 647 245 12141 --1788
NM_020548chr21208 ------
NM_020630chr102635 79 ------
NM_020640chr342177 2150 1623 294 ----12007
NM_020648chr18102870 2749 2618 2246 1782 814 635 360 252 52 --1525 12402
NM_020651chr261733 1394 1269 1231 1222 555 ----11521
NM_020654chr351494 1274 1250 368 49 11267 ----
NM_020665chrX3443 146 78 --1605 --
NM_020686chr16102630 2340 2189 2113 1954 1114 839 539 89 29 32153 891 203 1868 1331
NM_020699chr1115293 5067 5037 4940 4767 3869 2162 1782 1576 1510 114 44295 4233 1652 1262 23586 716 --
NM_020703chr14593 569 536 231 --1456 --
NM_020711chr222647 419 42181 2166 2151 800 21833 193 146
NM_020715chr1482281 2224 2179 2136 1923 1659 617 145 11881 1724 --
NM_020717chrX114013 3429 1589 1466 1431 1117 1079 961 944 510 374 21355 187 14099 24350 3829
NM_020718chr16156591 6507 6398 6261 6068 5479 5265 5182 4386 4314 4241 4015 1662 698 73 1797 25049 4700 35972 1065 363
NM_020724chr46778 473 270 227 157 144 1592 --32573 1008 295
NM_020727chr2143399 3246 2573 1319 33085 1180 902 --11494
NM_020728chr793133 2909 2596 2149 1966 1226 999 831 482 12329 1527 --
NM_020731chr583274 3185 2959 2817 2153 1269 1054 1017 23195 1209 12395 --
NM_020732chr61361 11032 ----
NM_020734chr1273120 3109 2582 2509 1029 924 606 --11007 --
NM_020738chr251565 1161 422 214 172 ----1352
NM_020739chr15154247 4221 4204 3779 3666 3584 3431 3157 3151 3106 2697 2660 2637 846 376 23532 2761 23742 3445 --
NM_020742chrX92625 2575 2442 1983 974 710 320 151 97 --1682 --
NM_020747chr54967 600 368 352 ------
NM_020748chr1771915 1908 1759 1750 722 575 25 1667 ----
NM_020752chr1072803 2099 1960 1050 876 207 164 3963 714 128 ----
NM_020755chr62235 23 ------
NM_020760chr261922 1854 1601 749 423 46 1111 ----
NM_020762chr122990 916 1695 --167
NM_020766chrX124632 4617 3931 3801 3237 1670 641 631 370 363 270 50 1863 1384 24144 2807
NM_020772chr17218378 8152 7562 7401 7227 7089 6931 6773 5504 5412 2471 2200 2158 2042 1735 1663 1513 1255 796 392 179 57183 6383 6345 2501 45 22118 1049 46241 3266 2555 2011
NM_020773chr43768 740 39 ----22708 301
NM_020774chr18156132 5750 5461 5446 5369 4992 4601 4274 3996 3968 2470 2406 1584 836 263 25021 4852 15874 --
NM_020778chr1594709 4027 3759 3617 3481 3106 1709 1276 594 23544 1570 ----
NM_020781chr7102832 2617 2458 2406 1989 988 434 399 292 256 22472 2053 22439 383 22149 801
NM_020783chr1872035 1830 1714 1635 514 369 339 21674 906 ----
NM_020796chr5133033 3015 3004 2303 2238 1887 1060 1020 927 776 301 118 106 --12319 --
NM_020800chr351445 1136 401 139 90 --11525 --
NM_020801chr562452 1915 1823 1044 969 462 --1162 12062
NM_020805chr1841881 1838 1813 1638 --11316 11738
NM_020810chr1493642 3432 3343 2586 2531 2484 1387 988 384 43413 2753 2688 1264 33161 2822 2774 --
NM_020813chr1992484 2421 1175 892 831 811 746 601 464 2785 349 22169 2123 --
NM_020819chr61912 ------
NM_020825chr16103784 3416 3385 3241 2510 2450 767 548 231 27 11458 22597 1525 --
NM_020830chr262323 2149 1141 957 694 323 ----11115
NM_020841chr1294089 2741 1329 1262 761 615 556 430 175 --11519 23580 981
NM_020844chr8237502 7482 7309 7237 7067 6245 5976 5770 5568 5349 4844 4795 2886 2832 2448 1679 1551 1054 967 658 504 239 186 --12922 22877 2541
NM_020854chr1821423 971 31413 1364 1065 --1479
NM_020856chr1911153 ----11192
NM_020858chr1532286 957 288 22414 1927 ----
NM_020859chr443586 755 427 150 33936 1550 825 ----
NM_020868chr221998 1233 11399 21517 1450 --
NM_020870chr44815 412 73 21 --31851 1649 1417 --
NM_020872chr331744 502 53 11457 ----
NM_020873chr3166 ------
NM_020914chr1741913 1682 648 172 --1634 1628
NM_020921chr1453274 2543 1424 776 703 33511 744 446 32730 1067 663 --
NM_020925chr121271 1058 --11105 1341
NM_020927chr1651973 1451 771 566 372 --21871 140 1939
NM_020935chr274666 4127 4072 3679 3401 3191 3102 21029 546 11057 --
NM_020940chr1032271 2132 1120 12124 31954 293 94 --
NM_020948chr162373 1386 1055 734 180 81 ------
NM_020952chr91174 1303 --1757
NM_020956chr1964595 4468 4372 3465 1569 721 34184 857 223 14190 12981
NM_020977chr441973 1609 717 84 1344 1637 --
NM_020980chr1551608 1379 1108 156 142 --11592 1639
NM_020981chr21249 ------
NM_021005chr1541098 830 317 44 ------
NM_021007chr241695 1612 1560 245 --1960 12421
NM_021025chr52524 344 ------
NM_021032chr341658 600 239 182 ------
NM_021033chr1362857 2728 1239 1116 844 305 2890 275 11155 --
NM_021038chr363103 2581 1311 1155 800 114 1725 --11059
NM_021061chr874549 3736 3397 3016 1459 430 143 23587 3353 22928 595 24004 3259
NM_021069chr421844 324 --1711 11719
NM_021072chr582468 2439 2025 1793 1667 1061 642 382 12617 --1771
NM_021079chr1753365 2520 2033 719 321 22750 31 42931 2856 2206 407 1977
NM_021097chr2112783 2627 2482 2224 2008 988 900 619 611 534 126 22617 2235 ----
NM_021111chr951374 1287 1064 448 102 ----1470
NM_021115chr221172 ------
NM_021116chr7168997 8671 8637 7871 7479 7454 6158 6026 3211 3141 3040 2962 2846 2595 621 545 67641 7592 6958 3486 3107 1418 11511 3685 506 375
NM_021129chr10286 69 ------
NM_021136chr145633 498 271 254 213 ------
NM_021140chrX31073 456 192 ------
NM_021145chr731124 310 294 ----11007
NM_021148chr792449 2219 1910 758 662 299 206 115 24 12339 --1156
NM_021149chr162990 398 136 11015 2265 112
NM_021159chr441362 1054 459 198 11183 --11069
NM_021183chrX32497 2247 1917 ------
NM_021191chr1272567 2242 983 846 710 571 405 11923 22442 636 --
NM_021204chr43955 798 78 1340 1364 --
NM_021213chr1751239 1085 861 828 113 11176 ----
NM_021215chr2072371 2315 2001 1497 851 648 379 1631 --11535
NM_021238chr1241525 1331 612 466 2400 66 21811 1464 --
NM_021239chr1421366 938 1181 1552 --
NM_021249chr1461554 1058 565 431 117 105 ------
NM_021255chr1464051 3272 2526 1323 932 370 43445 3092 3035 966 12682 --
NM_021269chr1971811 803 592 564 465 245 97 ----21739 514
NM_021629chr3144981 4804 4766 4456 4191 3471 1621 1395 703 520 460 182 176 156 21198 638 1743 14609
NM_021638chr4114312 3911 3748 3710 3573 3223 1665 1641 560 395 242 24733 1725 23560 645 14727
NM_021643chr2----1546 --
NM_021647chr473787 3523 2900 1591 1220 1076 378 1864 12881 --
NM_021738chr103871 729 236 ------
NM_021813chr6175785 5718 5664 5274 4901 4639 4300 4079 4066 2316 2182 2040 1998 1553 1191 979 954 --34572 3767 488 --
NM_021814chr631267 444 431 ------
NM_021815chr282634 2533 1992 1174 1143 982 666 181 --1333 11208
NM_021826chr20--133 --178
NM_021831chr22343 266 --1231 --
NM_021911chr585312 4850 4512 4415 1766 797 781 99 11448 --14868
NM_021912chr1563858 3389 1607 1402 898 546 1306 13123 --
NM_021913chr1971148 1125 730 391 357 237 185 ------
NM_021914chr1432466 2427 507 22206 1905 1772 --
NM_021945chr683353 2931 1225 1208 594 571 260 94 13197 3822 682 153 --
NM_021947chr1771261 1220 1005 979 971 539 478 --21047 199 --
NM_021949chrX82913 2848 2702 2531 2209 1942 795 616 12289 ----
NM_021951chr92797 587 1300 --1866
NM_021954chr13113711 3127 2475 1149 1083 1020 734 613 571 399 97 ------
NM_021956chr61374 ----11365
NM_021960chr182227 2017 715 525 429 399 209 123 12130 22282 1839 11967
NM_021961chr11187077 6691 6157 5707 5666 5602 5506 5470 5144 5033 4917 4547 2756 2550 2522 2132 1073 321 15749 22745 2722 12190
NM_021964chr382267 2016 1224 878 592 442 213 98 --1633 --
NM_021973chr43720 227 209 --182 --
NM_021977chr663279 1237 902 843 235 59 23301 777 2961 321 12876
NM_021988chr2041628 1478 1385 266 ------
NM_021998chrX61519 500 281 199 92 24 --11148 --
NM_021999chr13188 ------
NM_022041chr1672427 1966 1697 986 976 906 40 12153 --1922
NM_022048chr1545891 4935 4733 402 1443 15255 1938
NM_022049chr161324 1204 611 536 348 115 31281 751 260 ----
NM_022058chr281468 1423 1413 1357 553 541 53 36 21889 643 ----
NM_022063chr1031686 1626 379 ----11613
NM_022073chr141419 11043 1296 21312 1227
NM_022091chr6101886 1756 1689 996 909 794 698 563 370 190 --12274 12368
NM_022103chr191130 2924 124 --1138
NM_022114chr164686 3968 3571 1799 545 324 13404 24698 171 24012 3794
NM_022133chr861629 1345 1156 592 253 106 --1639 --
NM_022143chr731570 1232 501 --21263 1043 1162
NM_022166chr16115435 5352 4985 4530 3980 2271 1813 1023 741 442 46 32382 1424 630 25099 1687 14177
NM_022336chr272245 1577 1482 709 537 192 155 12062 ----
NM_022346chr431400 353 189 11154 11305 --
NM_022351chr893888 3837 3539 3316 3101 2443 615 531 287 --12657 --
NM_022442chr2041628 1478 1385 266 ------
NM_022455chr5----1289 --
NM_022456chr12156742 5595 5495 5080 3020 2722 1845 1755 1722 1601 1301 1011 930 887 426 22624 2352 ----
NM_022457chr11309 1105 ----
NM_022458chr7113195 3183 2967 2798 970 555 548 414 401 337 77 1650 ----
NM_022459chr13126338 6094 5982 5447 5313 4485 3981 2094 1045 549 446 119 26196 1351 --12314
NM_022469chr173337 2504 2285 1150 847 836 354 23175 2163 12073 12403
NM_022474chr1442835 1973 867 625 11795 22862 2349 --
NM_022482chr2052336 2106 1811 228 174 11686 1747 --
NM_022491chr1263473 2282 2249 1043 482 379 12720 22329 606 13531
NM_022495chr14161 ------
NM_022497chr3113852 3441 3430 3157 2837 1083 926 500 286 270 82 23274 310 11447 13835
NM_022648chr273470 3363 2811 1783 1378 1014 263 1478 33318 894 381 12990
NM_022716chr172614 1041 895 677 472 154 95 11143 --1494
NM_022719chr2253271 3084 1563 106 40 73434 3037 2978 2647 1367 1297 1241 --11057
NM_022725chr1162146 1982 1964 1681 303 257 21570 221 22013 435 --
NM_022726chr691736 1593 1490 1451 1267 713 636 446 77 ------
NM_022728chr7------1523
NM_022735chr131665 369 286 ----1449
NM_022739chr171949 ------
NM_022748chr772503 2397 2253 1782 732 243 43 12229 --12726
NM_022753chr172824 2486 2314 1919 1047 913 351 22407 291 ----
NM_022756chr151146 959 940 38 21 11012 11485 11247
NM_022758chr662843 739 484 305 145 43 13161 --1328
NM_022763chr352478 2281 773 229 80 ----1249
NM_022768chr12295 83 1154 ----
NM_022771chr123989 922 143 ------
NM_022776chr32629 375 ------
NM_022781chr983076 3012 2867 2794 2021 780 380 339 --32125 705 157 --
NM_022784chr1541020 912 721 399 --1428 1221
NM_022802chr1071668 1616 1349 1172 637 548 150 ------
NM_022824chr551934 635 359 252 158 1223 21761 518 --
NM_022826chr221154 381 ------
NM_022829chr2031647 624 200 12107 ----
NM_022832chr462477 1926 795 713 582 529 2681 270 ----
NM_022841chr156854 613 607 432 276 112 11098 --12658
NM_022843chr1321346 964 11188 1244 --
NM_022845chr1651594 1504 778 318 291 ----11673
NM_022875chr52528 149 ------
NM_022877chr52528 149 ------
NM_022893chr232909 2830 2468 --21054 659 22491 955
NM_022898chr14104457 4342 3914 3831 3227 1697 1683 1388 1245 554 33737 3657 1723 --1485
NM_022902chr51422 ------
NM_022912chr293085 2603 2492 2410 2243 1884 644 118 31 --12079 --
NM_022970chr101133 ------
NM_022977chrX61048 824 808 444 210 140 --22630 796 22369 1909
NM_023000chr1441632 1378 308 79 ----21731 1512
NM_023001chr1441632 1378 308 79 ----21731 1512
NM_023016chr282571 2249 2231 2132 2057 848 624 166 ------
NM_023039chr51404 ------
NM_023072chr193731 280 197 11152 1223 1205
NM_023923chr173688 2552 1288 1054 1020 530 498 12300 21464 1159 --
NM_023925chr122341 62 ------
NM_023929chr862831 2441 2413 1873 313 141 ------
NM_024007chr5122827 2720 2429 2230 1273 1018 1008 813 432 392 333 257 12584 22729 472 --
NM_024045chr101139 ------
NM_024090chr471704 1530 528 324 314 294 283 123 11453 11431
NM_024117chr941220 929 316 40 ----21481 515
NM_024294chr662843 739 484 305 145 43 13161 --1328
NM_024329chr1------11552
NM_024334chr341861 1815 1774 680 --1607 --
NM_024341chr1984198 3780 3458 1086 1041 595 429 22 1401 21309 1247 --
NM_024345chr9135805 5339 5223 5112 4801 4082 3938 3854 2226 2180 1922 1378 1266 --35684 4455 4251 --
NM_024408chr183432 3367 3214 3069 2425 561 304 156 13733 11289 1997
NM_024423chr18104142 4068 3699 3589 3067 2832 1362 388 198 134 24084 1498 13884 22716 2622
NM_024429chr7145 --1763 --
NM_024496chr141136 ------
NM_024509chr191153 ------
NM_024511chr463286 2929 1004 959 862 244 ------
NM_024524chr3123149 3013 2818 2744 2726 2646 2093 1980 1965 701 478 208 12175 1394 --
NM_024528chrX149 --1151 --
NM_024546chr1341129 866 82 51 ------
NM_024548chr331337 536 506 2682 232 --11527
NM_024551chr1262523 2099 1914 831 677 609 12476 11951 11991
NM_024551chr1262523 2099 1914 831 677 609 12476 11951 11991
NM_024563chr541654 1648 1278 514 --11661 --
NM_024567chr8----1604 1741
NM_024570chr131224 ------
NM_024580chr15146 ------
NM_024590chr431976 1336 777 --2589 477 11605
NM_024607chr8104509 4373 4230 4208 3891 3835 3216 1542 889 632 32784 1625 80 12758 1372
NM_024612chr174404 155 141 130 11151 ----
NM_024624chr251299 1100 1019 559 362 --1636 --
NM_024626chr161470 1252 425 414 144 22 21198 33 --1163
NM_024632chr51107 ------
NM_024639chr6102483 2353 1880 1825 920 904 728 563 548 119 --2469 448 1505
NM_024640chr15346 312 243 74 22 --1231 1618
NM_024646chr183857 3733 3217 3024 2723 1392 988 675 1900 ----
NM_024665chr354443 3263 2970 1089 302 ----13331
NM_024692chr251577 1348 630 266 226 1159 ----
NM_024712chr161111 ------
NM_024713chr1521411 22 --175 1134
NM_024721chr852031 510 452 293 84 --22433 463 --
NM_024740chr1173843 3660 2817 446 315 160 148 1172 21057 237 --
NM_024744chr242450 2438 552 120 21824 236 1250 --
NM_024749chr191620 1582 1548 804 752 622 415 193 180 --22092 1494 --
NM_024761chr9125366 5292 5015 4809 4789 4363 1958 1493 959 727 277 33 13916 31815 839 503 --
NM_024779chr1241474 1409 1374 428 11191 --11455
NM_024806chr111262 ------
NM_024812chr83675 333 292 22191 307 1482 --
NM_024814chr71316 ------
NM_024824chr1481451 1435 1301 1245 1169 1149 539 239 ------
NM_024828chr941602 1468 1155 344 145 11353 1281
NM_024834chr1051828 1635 1268 264 248 1372 ----
NM_024835chr171284 ------
NM_024837chr1541515 580 398 326 --1682 --
NM_024857chr17185 ------
NM_024884chr1464470 4395 3889 3761 1778 1585 24301 375 14402 --
NM_024896chr952309 1792 507 364 122 22240 287 ----
NM_024908chr152595 500 ------
NM_024939chr1681676 1638 1606 1595 1420 1348 279 112 21567 493 --126
NM_024940chr841345 1110 675 606 --31579 400 160 --
NM_024941chr541188 462 438 418 11379 21216 267 11237
NM_024947chr3199311 9276 9254 8478 7957 7776 7249 6511 6299 6153 6082 5900 3163 2876 2608 2374 1474 1466 337 12009 59634 8695 7232 3220 67 38728 8620 785
NM_024948chr102542 171 ------
NM_024949chr4125014 4752 4294 4027 3972 3740 3384 3199 1518 1457 818 503 34488 4278 3158 11165 --
NM_024953chr1252241 1834 729 193 67 --11866 --
NM_024963chr7105494 5312 5144 4986 4722 4436 4055 3837 1930 43 35978 3758 2102 15472 --
NM_024969chr2------1230
NM_024971chr91174 1303 --1757
NM_024989chr2138033 6899 6886 6377 6088 5757 5455 5209 3114 1343 841 503 395 16289 15337 13291
NM_025027chr194911 885 369 310 --1175 --
NM_025054chr8124124 3927 3392 3099 2725 2582 1693 1276 1069 767 290 23 --1347 --
NM_025073chr1103827 3425 3364 3284 3278 1834 1370 955 739 679 --11813 --
NM_025106chr141863 1271 498 286 ----21189 633
NM_025133chr24850 785 735 195 --2287 23 --
NM_025134chr1642211 874 437 237 ----12514
NM_025146chr351765 1021 375 338 96 --32634 2580 2249 --
NM_025160chr194161 3942 2946 2684 1339 998 615 587 136 12648 33898 1548 1383 11700
NM_025179chr1154533 4431 4315 3862 3802 3607 3586 3342 3066 1568 1511 1206 1191 736 519 1728 31916 1532 407 23023 1544
NM_025191chr183147 3050 2769 2419 2213 2188 1212 809 33098 1010 639 23471 3318 --
NM_025208chr1182091 1779 1621 1554 936 846 604 479 11960 12263 1576
NM_025221chr441453 1330 1045 250 11203 --1898
NM_025235chr1051437 760 726 412 161 11726 ----
NM_025237chr1781505 1380 1363 1350 976 420 358 172 11015 ----
NM_030576chr1782600 2225 1945 1748 613 607 601 36 --12152 --
NM_030579chr1643427 1101 934 181 32809 2438 2273 --13380
NM_030594chr153385 293 40 1910 ----
NM_030621chr1493725 3433 2731 2603 1577 1166 1076 928 670 23501 362 11491 --
NM_030625chr1041607 641 622 216 172 12560 --
NM_030627chr573843 1453 1398 1193 827 667 569 33969 3628 848 ----
NM_030647chr796012 5953 5469 4216 2091 1820 1187 947 546 24579 388 24551 1676 15428
NM_030648chr485310 5193 1878 1786 1616 1481 1474 1179 1551 14237 45275 4482 3482 990
NM_030650chr273908 3517 3391 3162 675 273 181 ------
NM_030660chr1411221 ------
NM_030664chr1022342 264 22137 1809 12439 2775 719
NM_030674chr12115906 5537 5450 5383 4723 4132 3793 3552 1214 684 96 12173 11735 --
NM_030755chr1492799 2749 2164 2013 1242 1011 988 975 155 --1942 11200
NM_030756chr101254 ------
NM_030758chr2241306 1240 1053 477 1519 1492 --
NM_030761chr172613 2304 2209 2049 1028 195 50 11970 --1495
NM_030762chr1252016 1669 1565 593 494 1750 ----
NM_030773chr2041868 1696 1555 722 1530 --2625 495
NM_030780chr831671 1501 1433 11449 --1131
NM_030786chr141743 1339 1210 500 11678 ----
NM_030799chr541697 1421 786 340 12064 ----
NM_030806chr1188986 8778 8230 7527 7412 7013 6927 6769 6685 6071 3757 3078 2878 2234 1100 965 575 558 39148 7287 1163 47859 3137 2989 1169 29129 7200
NM_030809chr1282432 2309 1546 733 362 351 226 86 22290 463 22210 294 --
NM_030816chr153702 2971 1479 1275 1058 --13064 --
NM_030820chr63691 239 173 2859 844 ----
NM_030918chr194836 4307 1709 1597 1420 1375 924 917 619 --2940 85 --
NM_030933chr1194 ------
NM_030936chr72380 42 --1158 --
NM_030964chr573668 2993 2827 1298 1288 1266 193 22705 846 23524 1481 --
NM_031216chr1832159 1476 65 --21830 153 1827
NM_031217chr11--1112 ----
NM_031243chr792380 2329 2015 1621 890 589 475 310 54 22344 173 --1397
NM_031262chr921087 335 ----165
NM_031263chr921144 392 ----1122
NM_031267chr7--1447 ----
NM_031268chr16105409 4734 4603 4505 4264 3869 1885 1272 1110 766 --24819 3974 23613 886
NM_031292chr12101722 1656 1596 1402 1320 1276 1201 1132 329 212 ------
NM_031296chr432412 251 183 1610 12603 --
NM_031305chr451413 1403 691 259 241 11803 ----
NM_031371chr151595 1390 372 245 169 --11510 11526
NM_031371chr151595 1390 372 245 169 --11510 11526
NM_031372chr421686 576 21095 658 11214 --
NM_031411chr5102176 2010 1733 1568 922 851 743 648 369 240 --1179 21691 823
NM_031419chr321300 378 ----11217
NM_031427chr14135739 5569 4880 4662 4620 2089 1928 1389 1294 908 554 433 102 12061 --13824
NM_031435chr1263274 2608 2481 1311 639 531 ------
NM_031442chrX73227 2973 2943 2322 1001 985 407 --12363 --
NM_031452chr153590 55 29 ------
NM_031453chr1052179 2046 2033 857 368 --41782 864 617 78 1387
NM_031461chr861733 1621 1441 803 188 150 1644 ----
NM_031468chr7248269 7861 7697 7637 7038 7011 6737 6587 6496 6349 6331 6124 5380 3257 3225 3147 3118 2813 2477 2243 1542 776 728 692 58036 7025 6577 1888 552 25924 1833 --
NM_031469chr683412 3115 2790 2781 2635 1453 545 449 13318 13787 195
NM_031483chr2032204 612 427 --21204 305 --
NM_031844chr1104138 3958 3741 3720 3473 3330 2902 753 188 129 13579 --11426
NM_031845chr283606 3589 3505 2254 997 639 457 335 13400 13422 22888 2786
NM_031847chr283606 3589 3505 2254 997 639 457 335 13400 13422 22888 2786
NM_031849chr5102176 2010 1733 1568 922 851 743 648 369 240 --1179 21691 823
NM_031850chr33778 634 151 2623 199 1164 --
NM_031850chr33778 634 151 2623 199 1164 --
NM_031857chr5102176 2010 1733 1568 922 851 743 648 369 240 --1179 21691 823
NM_031860chr5102176 2010 1733 1568 922 851 743 648 369 240 --1179 21691 823
NM_031889chr431345 359 229 1239 11452 --
NM_031892chrX3994 769 244 --1138 --
NM_031938chr111755 ----1129
NM_031942chr231211 309 54 --2496 414 11313
NM_031954chr1221817 284 22810 853 --22931 1851
NM_031966chr52170 95 --1406 --
NM_031990chr1921174 1041 ----162
NM_031991chr1921174 1041 ----162
NM_032012chr9135160 4893 4746 4481 4154 1888 1722 1140 1125 1109 1020 255 116 --1123 --
NM_032017chr152053 1901 1707 692 57 --21394 221 12044
NM_032021chr1111036 --1955 --
NM_032042chr542854 1066 541 113 12562 --12675
NM_032049chr33778 634 151 2623 199 1164 --
NM_032049chr33778 634 151 2623 199 1164 --
NM_032088chr551264 1215 547 452 201 21310 123 11805 123
NM_032092chr551264 1215 547 452 201 21310 123 11805 123
NM_032105chr1187929 7635 7193 7176 6956 6346 5976 5902 5404 5360 4960 3181 2962 2885 2855 2589 2155 1605 25011 1263 17223 1879
NM_032109chr531318 1070 479 ----11078
NM_032116chr1355347 4480 3824 3806 1863 ----34577 4327 1266
NM_032128chr451060 873 391 110 30 11009 ----
NM_032136chr4149 1139 --124
NM_032138chr132191 84 ------
NM_032144chr231795 1546 631 --21485 499 264 31
NM_032145chr63718 371 172 ------
NM_032147chr121972 --1745 --
NM_032153chr342738 2623 635 469 22670 1942 32515 1106 382 1178
NM_032156chr122341 62 ------
NM_032160chr18103544 3107 2964 1418 1362 1072 1065 539 428 240 --2632 373 24376 3043
NM_032174chr181514 1461 1249 1231 1087 1072 380 84 1936 11387 11371
NM_032181chr22733 118 1874 ----
NM_032188chr16--191 ----
NM_032199chr1043470 3118 2613 921 13339 --11405
NM_032208chr263193 2845 2649 2459 832 92 22747 1023 13365 --
NM_032217chr431255 1116 411 11289 --1929
NM_032228chr1162697 2663 2542 2535 2468 926 ------
NM_032239chr421233 114 123 11223 --
NM_032242chr393242 3190 3140 3039 2999 2158 1336 1202 285 --22863 503 --
NM_032250chr94794 321 129 58 ------
NM_032268chr1642229 944 426 276 12898 2957 331 --
NM_032281chr1953188 1994 1959 930 466 1146 ----
NM_032288chr342325 1817 952 560 11542 ----
NM_032291chr131207 729 619 1127 1644 --
NM_032312chr24866 366 302 250 ------
NM_032321chr243186 741 81 61 1630 33323 2614 389 1658
NM_032333chr101652 ------
NM_032348chr11898 ------
NM_032373chr10155832 5696 5553 4656 3879 3762 3746 3607 2265 1789 1620 1268 752 524 472 24469 125 32250 1671 999 --
NM_032379chr113767 312 166 --1275 1136
NM_032403chr551264 1215 547 452 201 21310 123 11805 123
NM_032408chr74909 828 403 345 ------
NM_032421chr742071 1907 1730 43 2719 495 11503 21343 470
NM_032435chr172361 2333 1682 868 562 483 224 --3680 537 101 1474
NM_032440chr1062790 2337 2115 1035 384 295 1443 22686 2313 --
NM_032441chrX21161 365 1425 2476 178 --
NM_032446chr563519 3331 586 275 142 135 ----13282
NM_032449chr152519 2395 2340 1082 1069 --22377 375 11109
NM_032457chr4123543 3404 2914 1492 1017 919 681 589 569 501 340 116 ----1844
NM_032458chrX83234 3201 2953 2518 870 698 645 118 --11227 --
NM_032466chr841529 1459 1390 1373 21476 1163 --1448
NM_032468chr851529 1459 1390 1373 690 21476 1163 --1448
NM_032491chr122968 437 ----1205
NM_032499chr1541629 519 504 24 2527 512 ----
NM_032505chr392374 2294 2167 1926 696 571 443 318 90 ------
NM_032521chr2063251 2919 2719 1227 348 68 1759 ----
NM_032538chr672424 2092 1845 1814 1778 481 460 32813 2695 2325 12871 --
NM_032547chr43474 344 75 ----11440
NM_032560chr1431133 895 862 ----1271
NM_032564chr11--1370 --1162
NM_032569chr1661833 1625 1336 424 325 220 31999 1413 752 11822 --
NM_032582chr1771668 1255 694 672 476 86 73 11600 ----
NM_032622chr421333 124 21246 145 1262 11448
NM_032646chr1761516 1402 675 598 152 90 11106 1419 11093
NM_032663chr12111871 1699 1449 675 611 453 433 224 128 100 59 1296 ----
NM_032682chr352364 879 738 534 68 1815 11128 --
NM_032711chr1783885 3855 3368 2737 1072 791 776 513 12998 --23479 1049
NM_032737chr1992464 2361 2251 2136 2052 1888 1826 810 257 31000 682 42 ----
NM_032772chr103475 361 228 ------
NM_032778chr3113324 3296 2779 1283 920 787 765 608 340 261 55 --22737 570 12428
NM_032784chr61357 2999 885 --1174
NM_032801chr1192339 1842 1738 1597 853 550 512 450 117 1346 32558 1826 1702 --
NM_032804chr1042520 2019 1668 988 22086 285 ----
NM_032810chr1021507 1442 1290 ----
NM_032812chr101353 ------
NM_032826chr775347 4982 4736 4510 2124 1074 314 11985 --42135 2047 1132 653
NM_032827chr231113 725 268 21076 25 11159 1355
NM_032833chr182467 2446 2404 2297 2190 1977 692 356 1179 22003 876 --
NM_032842chr741711 1644 1505 1486 ------
NM_032857chr151222 ------
NM_032859chr13103665 3132 2787 2420 1276 1157 1033 997 434 273 13084 11302 --
NM_032870chr61555 ------
NM_032871chr1191737 1507 1433 1423 1337 710 472 137 101 ------
NM_032873chr1183876 3801 3752 3501 3477 3126 2791 2783 21199 455 129 --
NM_032884chr12355 98 --177 --
NM_032895chr172180 153 1785 --1592
NM_032900chr1083581 3348 3271 2911 2794 1092 372 80 33080 908 123 --23675 485
NM_032906chr4--1672 ----
NM_032943chr113767 312 166 --1275 1136
NM_032961chr451359 1224 970 59 46 ----1329
NM_032968chrX74277 4206 3876 3729 3426 808 369 --13281 --
NM_032969chrX74277 4206 3876 3729 3426 808 369 --13281 --
NM_032978chr184949 877 866 380 11220 --2799 92
NM_032979chr184949 877 866 380 11220 --2799 92
NM_032981chr184949 877 866 380 11220 --2799 92
NM_033016chr2231553 1249 1047 ------
NM_033018chrX1208 --11218 --
NM_033020chr1104860 4695 4585 4413 3872 1173 801 237 231 130 14817 ----
NM_033044chr1199 11004 1291 --
NM_033055chr13987 782 462 ------
NM_033083chr363442 3330 2543 2391 781 234 ----1316
NM_033100chr1092649 2268 1890 935 924 779 767 741 520 12399 --21906 314
NM_033128chr72677 578 --2876 78 --
NM_033132chr1382024 1990 1879 1443 784 526 432 400 --1800 --
NM_033133chr17113805 3496 3352 3346 3269 1433 1166 769 411 380 244 --33085 2924 1503 11008
NM_033135chr1182091 1779 1621 1554 936 846 604 479 11960 12263 1576
NM_033136chr581722 631 474 348 295 144 62 23 --11650 --
NM_033137chr581722 631 474 348 295 144 62 23 --11650 --
NM_033138chr772097 1953 1910 1719 1692 1644 193 11768 ----
NM_033139chr772097 1953 1910 1719 1692 1644 193 11768 ----
NM_033140chr772097 1953 1910 1719 1692 1644 193 11768 ----
NM_033143chr4114114 3993 3959 3818 1768 1756 1168 1096 1005 767 565 ----2241 119
NM_033157chr772097 1953 1910 1719 1692 1644 193 11768 ----
NM_033181chr63821 244 209 --11576 23516 3436
NM_033222chr91511 ------
NM_033224chr7238108 7910 7889 7798 7637 7518 7270 6156 6047 6005 5939 5732 5539 5441 2808 2256 2031 1941 1460 1123 1069 805 187 26298 967 26932 6578 46913 1951 849 612
NM_033225chr831274 804 212 12410 2933 476 12783
NM_033272chr21120 ------
NM_033274chr583015 3009 2810 2710 2550 2509 182 80 43404 3316 3263 328 12925 1366
NM_033281chr54897 804 619 297 2908 613 ----
NM_033290chrX73595 3158 2585 2369 1153 543 72 ----12307
NM_033305chr9------11336
NM_033326chr1142437 2070 625 603 --2516 73 --
NM_033331chr9133630 3491 3350 3049 3033 2954 2564 1439 1428 1388 1355 899 438 23436 970 32432 1413 96 12543
NM_033343chr11459 ------
NM_033360chr1274189 3962 3902 2805 1430 1365 1298 21122 779 --13533
NM_033375chr1731241 970 114 21151 220 --1345
NM_033380chrX1192 ----11022
NM_033381chrX1192 ----11022
NM_033389chr17124171 3992 3565 3446 3433 1456 1427 871 707 388 335 276 33617 1570 886 24097 3021 23581 249
NM_033394chr211575 ------
NM_033421chr2041826 1576 501 309 41449 642 325 22 --1402
NM_033425chr1183202 2797 1248 1141 783 518 278 120 2986 743 22194 800 12965
NM_033426chr1472813 2686 2305 1031 747 88 77 42270 2075 1152 134 --32954 2611 2463
NM_033427chr72696 676 ------
NM_033429chr1572587 1207 708 525 508 338 66 22291 492 12982 23296 2706
NM_033430chr4113783 3716 2630 1664 965 871 558 530 447 404 253 24099 669 13748 --
NM_033437chr4113783 3716 2630 1664 965 871 558 530 447 404 253 24099 669 13748 --
NM_033480chr682770 2546 2302 2254 1992 1898 461 60 --12505 --
NM_033481chr682770 2546 2302 2254 1992 1898 461 60 --12505 --
NM_033495chrX4778 398 247 220 ------
NM_033505chr2106755 6635 6315 6192 5587 5510 4481 2280 2155 829 25054 4583 36255 2621 1796 14427
NM_033515chr611241 --1976 1146
NM_033540chr32214 123 --2946 781 --
NM_033551chr5103505 2988 2801 2358 2286 2267 1102 984 913 433 11259 13065 --
NM_033624chr1232044 1394 223 41944 1723 1587 112 12175 --
NM_033631chr1153916 3577 3479 3420 3090 3071 2789 2732 2650 2408 1294 908 716 300 130 21169 82 ----
NM_033632chr431301 1022 231 --2539 492 21365 471
NM_033637chr1074163 3639 3585 2751 2611 1423 1083 43499 3119 2907 1149 23036 3001 13848
NM_033642chrX71211 1201 1156 1021 296 174 85 ------
NM_033646chr18138 ------
NM_033656chr21135709 5205 5180 4591 4507 4426 4106 4056 3998 2254 2224 123 57 --16031 --
NM_052834chr1851788 1638 889 826 315 52127 2116 2033 1008 273 --1815
NM_052840chr1551546 1319 1091 299 62 1149 1466 --
NM_052845chr12113138 2502 2392 2362 2352 2195 948 389 327 318 92 --32716 2274 2262 --
NM_052851chr1351494 819 308 297 81 21736 732 11592 --
NM_052869chr1761516 1402 675 598 152 90 11106 1419 11093
NM_052879chr12134139 3788 3415 3259 3176 3010 2732 1593 1171 911 545 404 248 23942 556 13746 --
NM_052885chr1284982 4941 4835 4600 3452 3243 1935 1170 24810 3926 ----
NM_052886chr83860 537 104 11776 --1726
NM_052888chr171149 ------
NM_052896chr182569 2390 2258 1581 776 376 215 37 --1654 1738
NM_052898chr831430 1318 456 --1430 --
NM_052904chr631444 1087 408 11002 ----
NM_052906chr2264295 3509 1976 413 390 103 65112 4385 3745 1848 740 330 ----
NM_052907chr12124274 4136 4007 3926 3239 3021 1292 1235 1082 847 695 164 13485 21562 934 12674
NM_052918chr1083607 3518 3373 2954 2611 2380 1386 570 13355 ----
NM_052927chr562253 1504 828 479 357 87 1502 --11648
NM_052932chr1132537 2440 1895 ----12333
NM_052937chr892699 2688 2654 2326 2302 828 767 689 661 12183 ----
NM_052944chr16179 ------
NM_052953chr31293 --1304 --
NM_052954chr2141599 1493 553 173 1784 --21984 417
NM_052959chr114312 159 37 25 ------
NM_052966chr163807 3633 3019 2443 739 568 33281 2559 2415 23531 1098 21058 40
NM_052978chr1461369 1333 237 222 114 86 1642 11845 --
NM_053002chr331088 944 434 --1789 1170
NM_053016chr9146519 6417 6400 5915 5566 5275 2553 2265 2200 1637 1289 1055 729 496 17417 --11366
NM_053023chr1193323 2973 2295 2148 1096 1042 994 240 51 --23130 781 --
NM_053025chr341587 1197 481 93 2354 314 ----
NM_053026chr341587 1197 481 93 2354 314 ----
NM_053027chr341587 1197 481 93 2354 314 ----
NM_053028chr341587 1197 481 93 2354 314 ----
NM_053031chr341587 1197 481 93 2354 314 ----
NM_053032chr341587 1197 481 93 2354 314 ----
NM_053043chr7114473 4388 4333 4210 2456 2086 1951 1487 1156 622 482 42303 1613 1117 549 24669 1326 15246
NM_053064chr1482956 2645 2594 2496 2141 907 827 711 --22375 25 12478
NM_053281chrX2170 103 ------
NM_054016chr121461 396 --11828 21500 167
NM_054016chr121461 396 --11828 21500 167
NM_054016chr121461 396 --11828 21500 167
NM_057159chr91546 1644 --21401 105
NM_057169chr1272892 2650 1237 1151 818 272 46 22287 715 11213 1938
NM_057170chr1272892 2650 1237 1151 818 272 46 22287 715 11213 1938
NM_057175chr451032 970 880 216 158 ------
NM_057749chr821380 968 ----1258
NM_058170chr161440 1282 1187 422 231 207 1266 ----
NM_058172chr461606 1502 603 319 107 95 11821 11351 --
NM_058179chr93994 169 78 --1932 --
NM_080425chr203226 51 29 ------
NM_080426chr203226 51 29 ------
NM_080491chr11133958 3709 3489 3315 2907 2779 2773 1347 888 615 524 275 21 33464 1163 531 12441 11546
NM_080546chr931752 1669 1444 --12028 1531
NM_080617chr201713 --1249 --
NM_080629chr111443 --1174 --
NM_080630chr111443 --1174 --
NM_080645chr652082 1520 476 258 191 --11598 --
NM_080663chr16----1138 2361 76
NM_080669chr1744534 3414 704 76 44727 3698 3251 1359 34246 3267 1840 31479 1174 1144
NM_080671chr242163 724 582 536 1815 21966 224 12032
NM_080676chr2043049 361 195 22 31278 1239 1228 42837 2488 890 500 1835
NM_080683chr41431 ------
NM_080684chr41431 ------
NM_080685chr41431 ------
NM_080702chr6----177 --
NM_080703chr6----177 --
NM_080717chr1251275 1148 1126 585 340 1968 1619 --
NM_080725chr2042077 1757 1352 156 1744 21913 36 1270
NM_080748chr20166 ------
NM_080759chr135650 292 163 135 87 --21992 671 12164
NM_080760chr135650 292 163 135 87 --21992 671 12164
NM_080867chr14114752 4354 4160 4027 1886 1165 759 568 498 378 93 34949 4831 3455 11837 14124
NM_080872chr884081 3430 2986 2906 2739 1546 1189 271 11479 13986 --
NM_080874chr471654 1506 1268 632 447 308 99 1268 ----
NM_080927chr383149 2895 2877 2241 998 953 893 821 23056 2470 1262 --
NM_130385chr1183226 2828 2800 2087 724 588 565 212 33068 2458 708 12674 12622
NM_130391chr963504 2898 2256 1354 605 491 11427 13148 11020
NM_130392chr963504 2898 2256 1354 605 491 11427 13148 11020
NM_130393chr963504 2898 2256 1354 605 491 11427 13148 11020
NM_130434chr1521144 827 ------
NM_130435chr1072406 2280 1997 1941 1810 1095 351 --11037 42183 1880 1148 133
NM_130436chr2182047 2012 1898 766 356 302 130 78 --21886 865 1188
NM_130438chr21102624 2589 2475 2207 2149 1343 933 879 707 655 --12463 1765
NM_130439chr1092345 2202 1435 771 602 515 410 190 179 12080 41872 1522 808 563 --
NM_130439chr1092345 2202 1435 771 602 515 410 190 179 12080 41872 1522 808 563 --
NM_130798chr1551515 1449 1313 1174 447 11250 ----
NM_133170chr20198096 7929 7754 7585 7463 7457 7435 7133 6997 6435 6224 5800 5685 2680 2568 2144 2132 2003 275 45338 4994 1692 1566 56708 6450 1922 1031 206 27877 1194
NM_133264chr1753474 3237 2843 1351 1040 12487 33022 2807 2619 1830
NM_133329chr231846 1187 358 --11587 --
NM_133334chr491607 1571 1430 1087 1061 815 789 632 263 22323 186 56172 5631 4973 2204 1303 15769
NM_133367chr653242 1232 1005 69 33 1144 41350 937 491 337 1766
NM_133372chr562437 1138 1063 927 909 594 22261 728 --1257
NM_133378chr24871 847 675 101 ------
NM_133432chr24871 847 675 101 ------
NM_133437chr24871 847 675 101 ------
NM_133445chr9113382 3315 3230 3203 3014 2296 1490 849 755 635 493 --22864 740 1581
NM_133468chr732191 933 544 --21014 364 22364 62
NM_133476chr121254 --179 --
NM_133478chr282231 1841 1771 1020 715 366 347 236 1400 ----
NM_133493chr654548 1671 1563 1343 918 --14666 --
NM_133496chr144347 3675 3631 1360 34224 3727 3703 24514 4197 12785
NM_133503chr121304 1138 --175
NM_133504chr121304 1138 --175
NM_133505chr121304 1138 --175
NM_133506chr121304 1138 --175
NM_133507chr123617 191 63 1316 --1253
NM_133631chr351634 1521 1507 1459 1053 11431 21582 203 --
NM_133638chr541451 1287 1002 947 --11412 11032
NM_133646chr2135503 4515 4466 4440 4141 3767 2028 1337 1180 923 823 802 50 21980 99 11540 --
NM_133647chr1573154 2420 1010 337 261 197 164 21200 1066 43372 2832 99 43 --
NM_134260chr151174 ------
NM_134261chr151174 ------
NM_134262chr151174 ------
NM_134428chr91289 ------
NM_138286chr1984131 3458 3176 860 800 243 142 33 --14208 1189
NM_138316chr1031404 288 74 192 1921 --
NM_138328chr1793236 3191 2876 2401 2364 1270 1063 178 38 --13027 --
NM_138338chr2252162 1391 1181 1168 493 33196 590 125 23233 2467 22241 1108
NM_138348chr5116630 5456 2494 2166 2160 2102 1552 1489 1190 1149 602 15019 15564 21772 961
NM_138394chr2--154 ----
NM_138426chr752289 1653 830 323 184 ----1588
NM_138444chr1394795 4702 3847 1844 1586 1045 936 623 67 23722 3575 21784 772 --
NM_138459chr6103274 2240 1454 1173 1143 1027 678 607 313 138 12701 ----
NM_138468chr265876 5488 5077 4865 1034 97 24548 4211 25366 4460 12492
NM_138473chr1275192 3411 1813 1619 1606 928 843 33814 349 94 24419 3300 --
NM_138479chr181865 1812 1608 745 568 249 127 104 1807 11908 --
NM_138494chr752779 2671 2287 1804 102 ----1357
NM_138576chr14104457 4342 3914 3831 3227 1697 1683 1388 1245 554 33737 3657 1723 --1485
NM_138612chr16----176 --
NM_138621chr243919 3856 3678 2905 11395 1465 11616
NM_138638chr1432466 2427 507 22206 1905 1772 --
NM_138713chr16186932 6701 6483 5526 5432 5373 5033 2733 2552 2265 1452 1306 1122 595 573 476 429 148 21961 1473 --15838
NM_138714chr16186932 6701 6483 5526 5432 5373 5033 2733 2552 2265 1452 1306 1122 595 573 476 429 148 21961 1473 --15838
NM_138727chr172427 2307 2104 2025 1547 774 671 1716 1138 --
NM_138728chr172427 2307 2104 2025 1547 774 671 1716 1138 --
NM_138730chr6------184
NM_138731chr1444000 3838 942 82 11658 --14175
NM_138735chr231309 615 377 11128 1584 --
NM_138736chr1674236 3694 3623 3590 3241 1496 338 22939 224 24064 902 1480
NM_138766chr52452 186 --1515 --
NM_138771chr7----31137 108 62 --
NM_138799chr271731 1635 1424 1337 794 681 92 ------
NM_138811chr751069 791 298 198 43 --1351 --
NM_138821chr52452 186 --1515 --
NM_138822chr52452 186 --1515 --
NM_138923chrX1138 ------
NM_138927chr2141032 935 256 48 2707 60 11025 --
NM_138931chr32305 264 ----11075
NM_138959chr1136520 5734 5552 5404 5369 4602 4249 2404 2315 1668 1464 773 476 15384 15718 1239
NM_138966chr183573 488 79 ------
NM_138970chr1471956 1766 1487 972 670 488 193 --1829 1704
NM_138971chr11123720 3203 3105 2946 2766 1401 1101 795 764 644 214 156 2636 447 12985 13634
NM_138971chr11123720 3203 3105 2946 2766 1401 1101 795 764 644 214 156 2636 447 12985 13634
NM_138972chr11123720 3203 3105 2946 2766 1401 1101 795 764 644 214 156 2636 447 12985 13634
NM_138972chr11123720 3203 3105 2946 2766 1401 1101 795 764 644 214 156 2636 447 12985 13634
NM_138973chr11123720 3203 3105 2946 2766 1401 1101 795 764 644 214 156 2636 447 12985 13634
NM_138973chr11123720 3203 3105 2946 2766 1401 1101 795 764 644 214 156 2636 447 12985 13634
NM_139012chr682297 2136 2106 1409 871 452 296 49 11719 11927 --
NM_139014chr682377 2216 2186 1489 951 532 376 129 11799 12007 --
NM_139035chrX2151 92 ----1710
NM_139045chr92653 641 --2569 248 --
NM_139048chr351037 875 393 299 83 ----11094
NM_139057chr15102216 2099 1965 1943 1842 1044 915 418 404 28 --12724 --
NM_139070chr5----1468 --
NM_139072chr2----2639 73 1691
NM_139076chr42414 274 151 11513 --
NM_139078chr121112 ------
NM_139135chr121135 262 --21043 141 --
NM_139168chr551679 1470 1442 668 49 12003 11562 --
NM_139169chr1031629 342 312 21492 659 ----
NM_139177chr1751254 1231 641 515 348 ----31414 1159 32
NM_139182chr451727 1540 1164 537 361 --1640 --
NM_139244chr63705 665 45 ------
NM_139246chr9102018 1962 1594 1546 867 375 265 249 67 39 ------
NM_139283chr1262143 1968 1901 889 807 723 12212 1587 --
NM_139321chr20154257 4220 3908 3844 3300 3201 1680 1576 1406 1289 1278 1142 1010 987 449 2278 55 13139 --
NM_139323chr2062060 2044 1418 1336 662 561 --1797 --
NM_144498chr2082151 1702 1604 708 633 536 397 206 ------
NM_144567chr142535 2466 644 462 ----12437
NM_144571chr4126821 5856 5033 4770 4739 4676 4604 1826 1807 1177 753 376 24421 482 34658 948 931 26429 2803
NM_144583chr261721 1439 1143 496 318 128 21363 1296 21551 1237 1638
NM_144590chr102149 36 32835 2640 2053 1399 1825
NM_144599chr15115480 5345 5144 4912 4784 4469 4458 4398 3721 2086 1882 ----21595 1500
NM_144600chr1631130 1037 201 --1537 1157
NM_144604chr163491 123 106 ----1145
NM_144609chr173978 929 919 2455 324 21018 288 --
NM_144628chr2072994 2914 2774 2269 2200 1197 173 22079 1159 12888 --
NM_144641chr32873 298 ------
NM_144642chr321279 307 11023 ----
NM_144658chrX1236 ------
NM_144767chr15114636 4084 4000 3947 3905 2851 1751 1156 1032 471 322 11090 ----
NM_144775chr1784578 4053 4025 3899 3837 3607 561 190 54877 1583 769 340 301 13274 14624
NM_144777chr132220 30 --189 1187
NM_144778chr1392773 2403 1808 1686 1108 1058 739 352 156 11745 ----
NM_144949chr252253 2174 2009 1835 793 1643 2667 416 12414
NM_144963chr861817 872 645 430 127 82 --12049 --
NM_145011chr1042015 1497 694 390 --32136 485 376 --
NM_145055chr1843499 1235 859 96 --13163 --
NM_145063chr61215 ------
NM_145112chr1441261 996 152 76 1968 --1532
NM_145165chr1442550 2444 2329 914 21798 960 --1479
NM_145176chr643572 2748 1248 249 13152 1857 23553 1318
NM_145206chr10103042 2815 2616 2601 2516 1336 1231 920 834 436 --22919 398 13183
NM_145244chr42535 267 21512 69 41168 641 455 274 --
NM_145247chr101521 ----1467
NM_145251chr1431340 1181 1012 11296 11600 --
NM_145259chr2126956 6941 5778 4709 4375 2653 2187 1982 1441 335 273 221 --12217 15851
NM_145263chr482358 2081 1664 909 812 350 274 112 42213 2174 1767 670 11703 1728
NM_145268chr74897 871 340 101 132 11106 1182
NM_145284chrX42324 2309 886 320 --11797 --
NM_145292chr7----141 --
NM_145307chr1064460 3805 3542 1627 1127 850 21302 1046 ----
NM_145320chr793152 3037 2266 1360 1332 1113 1045 935 288 12624 23579 2699 --
NM_145321chr793152 3037 2266 1360 1332 1113 1045 935 288 12624 23579 2699 --
NM_145322chr793152 3037 2266 1360 1332 1113 1045 935 288 12624 23579 2699 --
NM_145332chr63943 901 772 --268 48 --
NM_145333chr63943 901 772 --268 48 --
NM_145341chr1031561 370 215 --21845 1380 --
NM_145350chr1791626 1598 1451 623 513 363 346 149 99 2420 282 2533 182 1409
NM_145351chr17102766 2738 2591 2066 2004 1980 1830 1812 1763 263 ------
NM_145698chr1092071 2041 2020 1896 1797 1772 1638 706 604 ------
NM_145735chr1362183 1893 1774 821 814 676 1892 --22689 961
NM_145799chrX83142 2810 2729 2322 2202 2184 1998 1183 --11069 22377 222
NM_145808chr752857 2555 1961 567 507 11005 --1365
NM_145810chr231211 309 54 --2496 414 11313
NM_145888chr1961765 1723 1589 1348 553 259 ----21930 252
NM_145912chr22134714 4392 3936 3560 3159 1706 1522 1475 1110 929 316 133 93 11890 --13435
NM_147147chr6164206 4105 3971 3843 3732 3681 3501 3127 3011 2820 2800 2611 2597 1662 1322 449 --12772 12713
NM_147150chr973850 3688 2873 1448 932 133 71 23165 3022 23301 2683 11075
NM_147156chr1041411 940 579 564 11099 ----
NM_147175chrX41947 1936 1659 122 21595 244 11965 --
NM_147181chr441453 1330 1045 250 11203 --1898
NM_147182chr441453 1330 1045 250 11203 --1898
NM_147183chr441453 1330 1045 250 11203 --1898
NM_147189chr882209 2129 1509 1483 811 344 213 184 ----1397
NM_147223chr272491 2445 2159 1617 1592 957 628 21997 1585 3391 157 116 21777 1728
NM_147233chr272308 2262 1976 1434 1409 774 445 21814 1402 1208 21594 1545
NM_148174chr842108 2055 366 291 ------
NM_148921chr1711577 12285 --11484
NM_148955chr15126405 5680 5425 4721 4431 4162 2340 1793 1651 998 970 21 56596 6272 4861 4024 936 35291 1039 749 11455
NM_148976chr11191 ------
NM_148977chr1031404 288 74 192 1921 --
NM_148978chr1031404 288 74 192 1921 --
NM_152222chr1191737 1507 1433 1423 1337 710 472 137 101 ------
NM_152233chr1461554 1058 565 431 117 105 ------
NM_152238chr11359 ------
NM_152253chr22133945 3906 3553 3515 2966 2781 1555 1187 674 562 427 413 285 21050 685 13312 1983
NM_152261chr12----21662 967 22115 1742
NM_152262chr197879 771 687 354 271 188 106 --1604 --
NM_152271chr811133 ----21179 396
NM_152277chr561881 1436 1365 1328 504 235 1811 1761 1193
NM_152283chr52938 168 11126 --1948
NM_152330chr1472604 2433 1817 942 678 578 273 159 1149 --
NM_152332chr1432613 2149 273 12079 --11922
NM_152354chr192810 655 ----139
NM_152375chr182624 2016 685 649 587 478 323 32 21717 1662 ----
NM_152388chr293463 2598 2578 1620 1419 1011 966 601 301 21371 1356 23912 396 23550 320
NM_152406chr521751 324 11418 --1558
NM_152407chr563173 2927 2789 2471 902 418 --1687 --
NM_152409chr573177 2714 1404 812 679 412 57 ------
NM_152424chrX74017 1887 1485 1332 1299 1264 1038 13043 --13459
NM_152437chr1242418 2037 1574 787 --22127 1553 3634 350 295
NM_152446chr142384 140 ------
NM_152455chr1542754 2713 2112 55 22103 1831 ----
NM_152462chr172246 50 1619 --1549
NM_152467chr17----127 --
NM_152470chr1833563 2968 2531 --1109 1623
NM_152519chr242056 1574 93 57 --12013 11428
NM_152527chr261822 1638 1612 507 412 92 --2726 352 --
NM_152549chr51226 ------
NM_152556chr751956 1892 1796 374 179 21619 498 1591 --
NM_152563chr1151573 1159 1138 959 87 5559 507 455 403 351 --1611
NM_152564chr841629 1559 741 646 2485 249 2562 210 --
NM_152581chrX4344 304 233 54 ----11015
NM_152588chr1251787 1734 1567 193 87 1327 141 --
NM_152589chr121283 ------
NM_152594chr1551690 884 479 411 375 ----1257
NM_152606chr193321 201 176 ----2682 674
NM_152622chr543224 3075 919 521 1644 12481 11214
NM_152629chr984132 3937 3747 3482 3379 1475 1260 257 1451 11216 --
NM_152636chr1132688 1200 361 ----13089
NM_152638chr1251298 1091 410 327 85 1462 --1227
NM_152641chr1262203 2118 690 455 369 70 2823 38 11873 --
NM_152653chr3----1534 --
NM_152678chr342160 1908 585 227 12047 12745 11794
NM_152682chr471784 1336 1227 690 345 242 28 ------
NM_152688chr63901 707 333 ------
NM_152692chrX--1144 ----
NM_152699chr333649 741 661 --1302 32415 1432 1187
NM_152705chr1341447 1112 482 70 11405 21076 447 --
NM_152716chr1121616 114 ----1424
NM_152722chr1161597 1428 1375 583 75 60 --11249 1524
NM_152723chr112964 112 1165 --1129
NM_152724chr1052535 1785 1097 243 230 --32098 1932 416 11811
NM_152729chr641072 417 402 54 21656 1188 ----
NM_152733chr6126364 6332 6180 6165 6096 5294 4814 2357 2164 2090 1056 135 25359 371 26215 4755 35038 1563 1385
NM_152734chr6165508 5077 4441 4351 4004 2045 1575 1411 1296 1103 947 780 742 530 168 36 43977 1691 465 398 14113 --
NM_152749chr771096 1008 806 435 408 235 99 --1279 --
NM_152753chr671980 1958 1881 1721 1397 695 59 --1499 1235
NM_152754chr753279 3039 2971 2905 2630 ----13005
NM_152756chr5124170 3997 3958 3883 3834 3555 1700 991 882 431 352 315 --44322 1021 583 66 2961 267
NM_152758chr842672 2351 447 87 12478 ----
NM_152765chr852206 1851 748 605 322 22416 214 12022 --
NM_152787chrX93977 3902 3890 3698 2858 2799 653 489 280 43946 3690 1338 789 ----
NM_152793chr7134909 4903 4661 4583 4311 4124 3871 3529 1988 911 894 752 391 2872 687 55204 4221 3958 3367 574 21617 974
NM_152826chr15126405 5680 5425 4721 4431 4162 2340 1793 1651 998 970 21 56596 6272 4861 4024 936 35291 1039 749 11455
NM_152835chr152838 2377 1890 700 263 --12300 191
NM_152836chr861629 1345 1156 592 253 106 --1639 --
NM_152837chr861629 1345 1156 592 253 106 --1639 --
NM_152838chr2093187 2609 2288 1419 763 460 448 417 280 23081 203 21143 647 --
NM_152878chr2261507 1189 1113 1088 996 284 21605 387 ----
NM_152903chr1372877 2782 2725 750 392 142 111 11005 ----
NM_152910chr13190 ------
NM_152924chr15166651 5381 5218 5212 5125 4768 4521 4305 2476 2136 1796 1275 961 852 427 350 24266 2686 ----
NM_152989chr1241659 1520 434 167 --2621 43 11539
NM_152996chr141797 1566 1442 565 1267 11869 21738 359
NM_152999chr784976 4733 4345 4199 3223 1044 817 422 24527 1213 ----
NM_153015chr841064 224 104 56 ----1173
NM_153018chr1751233 885 808 708 655 1574 33229 2918 377 135
NM_153020chr63490 457 428 1604 1229 1247
NM_153029chr16153959 3916 3455 3279 3011 2963 2540 1652 1449 1046 994 396 376 321 230 13127 1897 --
NM_153035chr1142810 2747 2638 2185 2135 1979 1068 1014 877 817 733 624 585 154 1501 ----
NM_153040chr153280 235 64 1547 1553 1679
NM_153042chr641412 1263 237 164 1405 --11703
NM_153047chr62404 388 ------
NM_153048chr62404 388 ------
NM_153181chr183573 488 79 ------
NM_153182chr3113324 3296 2779 1283 920 787 765 608 340 261 55 --22737 570 12428
NM_153184chr351821 1514 1427 592 162 ------
NM_153188chr5144904 4575 4426 4201 4131 3938 2211 2008 1304 1174 624 584 447 273 11843 25386 5016 33476 1546 561
NM_153207chr12103884 3163 3071 3040 1343 1243 575 413 295 24 ----1991
NM_153211chr183438 73 60 ------
NM_153223chr581582 1412 1220 1072 1018 595 417 69 11031 --1523
NM_153235chr662209 2075 2025 1851 792 75 --11816 --
NM_153260chr1551234 1215 575 394 74 --1209 11327
NM_153261chr1621396 1011 --11424 168
NM_153262chr1103109 2790 2674 2478 771 653 582 455 87 34 ----1304
NM_153273chr372816 2491 2146 1998 1947 533 369 1712 ----
NM_153331chr31487 ------
NM_153332chr853114 3105 2847 2747 1241 1857 ----
NM_153340chr1----1118 --
NM_153343chr4122453 2142 1971 1860 1769 1718 903 852 772 668 497 159 159 1713 1505
NM_153346chrX61719 1709 1357 1257 821 676 ------
NM_153347chr1132674 2539 694 --1851 21102 207
NM_153367chr1074016 3487 3380 820 324 266 209 2453 27 21430 277 --
NM_153377chr121151 --125 --
NM_153437chr9----193 --
NM_153456chr13115934 5196 5165 4584 4264 2485 2003 1960 1840 1379 77 32069 266 256 35696 1503 1008 21984 359
NM_153487chr6154838 4647 4500 3854 3465 3458 3431 3390 3280 1894 1767 1275 1039 894 409 34029 3534 3519 14082 14582
NM_153607chr542651 2317 2226 588 --12575 --
NM_153608chr196724 634 605 251 169 159 ------
NM_153616chr1532286 957 288 22414 1927 ----
NM_153617chr1532286 957 288 22414 1927 ----
NM_153618chr1532286 957 288 22414 1927 ----
NM_153619chr1563524 1183 782 573 563 258 43652 3165 702 605 1401 1388
NM_153620chr741689 1658 1210 304 --11834 --
NM_153633chr121606 2589 519 1312 1276
NM_153645chr2253348 2880 2866 757 324 2961 817 12206 --
NM_153687chr1251394 1161 610 561 152 ------
NM_153689chr242310 1966 1931 428 11495 ----
NM_153693chr121727 1152 ----
NM_153695chr9255 32 ------
NM_153702chr41276 ------
NM_153706chr5------1176
NM_153715chr72927 383 --21284 969 1227
NM_153756chr1111763 1693 1454 1352 1308 793 787 397 341 204 178 21936 1717 1766 21724 1255
NM_153764chr1191046 983 696 309 114 105 57 41 32 1746 ----
NM_153765chr1191046 983 696 309 114 105 57 41 32 1746 ----
NM_153766chr1191046 983 696 309 114 105 57 41 32 1746 ----
NM_153767chr1191046 983 696 309 114 105 57 41 32 1746 ----
NM_153810chr10124364 4297 3889 3776 3115 1974 1218 1186 523 337 264 112 35028 3288 1137 23874 1053 14931
NM_153812chr142211 1631 759 457 11681 ----
NM_153828chr22954 937 --1363 --
NM_170606chr731308 1190 188 1713 2370 123 --
NM_170665chr1284434 4140 4066 3949 3579 2911 1727 259 13264 23413 1584 11712
NM_170674chr1551443 1140 1090 979 259 ------
NM_170675chr1531119 816 766 ------
NM_170676chr1531119 816 766 ------
NM_170677chr1551443 1140 1090 979 259 ------
NM_170679chr561322 846 810 433 372 339 ------
NM_170686chr7102832 2617 2458 2406 1989 988 434 399 292 256 22472 2053 22439 383 22149 801
NM_170695chr18--1183 ----
NM_170706chr1113776 3647 3459 3410 3187 3147 2699 1750 1394 1347 1256 43489 1598 933 660 13840 --
NM_170709chr8112248 2063 1989 1728 1671 1616 1558 971 893 521 179 ----1240
NM_170710chr472673 2485 1261 1118 525 285 275 --22980 1279 --
NM_170725chr11269 ------
NM_170731chr1142593 2069 1147 278 11852 22824 213 --
NM_170732chr1142593 2069 1147 278 11852 22824 213 --
NM_170733chr1142593 2069 1147 278 11852 22824 213 --
NM_170734chr1142593 2069 1147 278 11852 22824 213 --
NM_170735chr1142593 2069 1147 278 11852 22824 213 --
NM_170740chr693152 3045 2804 2768 1130 1124 911 742 329 --11282 1953
NM_170743chr172943 2802 2781 2707 2636 2130 1789 --182 32628 2138 956
NM_170751chr641231 284 252 200 --1362 --
NM_170752chr641231 284 252 200 --1362 --
NM_170768chr1131768 1548 438 11399 11243 11666
NM_171998chrX72351 2343 2028 1901 1670 402 48 --2859 284 21596 1002
NM_172070chr292179 1966 1708 1439 575 567 511 259 130 11474 ----
NM_172071chr1136267 6024 5464 5154 4664 2850 2526 2439 2158 1881 1367 771 97 11000 15402 12703
NM_172103chr621780 857 11875 12341 21032 777
NM_172105chr621780 857 11875 12341 21032 777
NM_172130chr151781 1598 1459 738 369 61617 1423 359 353 321 78 --11626
NM_172159chr331838 507 23 --22033 527 --
NM_172160chr331838 507 23 --22033 527 --
NM_172193chr1411267 --11079 --
NM_172216chr1282910 2591 2498 2164 963 490 375 109 11883 --12267
NM_172315chr1551443 1140 1090 979 259 ------
NM_172316chr1551443 1140 1090 979 259 ------
NM_172344chr231846 1187 358 --11587 --
NM_172349chr5----1289 --
NM_172354chr171888 1654 1559 1368 1329 676 47 1730 1555 11316
NM_172375chr146894 805 767 469 182 92 1359 ----
NM_173064chr172943 2802 2781 2707 2636 2130 1789 --182 32628 2138 956
NM_173065chr1133640 3499 3478 3404 3333 2827 2486 2422 2369 568 452 301 194 --1779 23325 2835
NM_173156chr182009 1769 1556 1368 895 643 548 326 ----1355
NM_173198chr962664 2574 2476 952 127 111 32850 2313 174 ----
NM_173200chr962664 2574 2476 952 127 111 32850 2313 174 ----
NM_173201chr16----1259 --
NM_173207chr18--1183 ----
NM_173208chr18--1183 ----
NM_173209chr18--1183 ----
NM_173210chr18--1183 ----
NM_173211chr18--1183 ----
NM_173214chr16186932 6701 6483 5526 5432 5373 5033 2733 2552 2265 1452 1306 1122 595 573 476 429 148 21961 1473 --15838
NM_173354chr2171976 1699 1650 1452 757 750 98 182 11865 11470
NM_173463chr464203 1633 1570 1130 1042 991 44422 4261 3754 870 --11158
NM_173468chr475680 4727 4157 1800 1760 1030 652 24705 182 --1508
NM_173469chr1551164 1126 1087 440 274 --171 --
NM_173473chr1062569 2323 2054 707 426 210 145 ----
NM_173475chr1631697 615 264 31233 606 600 11099 11601
NM_173478chr174949 852 782 734 ----1212
NM_173491chr521330 213 --1351 1382
NM_173495chrX51624 903 569 558 313 ----11933
NM_173500chr1521269 378 ------
NM_173510chr2262683 1810 851 774 271 206 ------
NM_173511chr253981 3415 793 712 669 13666 --23471 856
NM_173515chr661000 893 759 719 234 131 ------
NM_173536chr464886 4500 4358 4156 2022 142 2685 490 14017 --
NM_173545chr281954 1737 1521 1505 1482 708 665 295 ----31674 1660 303
NM_173546chr31671 ------
NM_173552chr352252 2190 1745 866 786 1614 ----
NM_173560chr6--1129 --1435
NM_173570chr372150 1865 1778 1770 1764 822 361 22061 1465 1161 --
NM_173576chr1062338 1855 1450 712 701 399 --169 --
NM_173582chr1195644 2499 2166 1701 882 472 297 245 230 12409 --36009 1529 1226
NM_173595chr1285107 4166 3952 2093 1286 1178 802 128 21968 1098 44506 1798 460 64 11301
NM_173602chr12113480 3458 2706 2656 1428 1418 904 794 772 699 69 32562 1170 889 1848 12825
NM_173609chr152740 148 1502 1271 1523
NM_173626chr172523 265 1145 --1551
NM_173642chr1149038 8363 8102 7959 7213 6515 6268 6255 6082 5845 3177 2339 1695 355 42486 1384 1262 881 27724 6048 32982 2701 857
NM_173645chr2----1595 --
NM_173647chr22992 965 ------
NM_173667chr541823 437 412 323 11626 11816 --
NM_173670chr551030 341 209 176 66 1780 ----
NM_173683chr871445 1128 1101 679 673 584 361 ----11243
NM_173694chrX72072 1701 1677 266 235 99 76 11809 21687 1649 --
NM_173797chr531152 417 292 --1996 11073
NM_173808chr1114452 3426 3083 2838 1460 1027 462 298 232 82 21 33349 3160 1565 13611 24106 1550
NM_173822chr251920 1668 1643 1517 528 11933 12134 --
NM_173825chr352805 2371 2058 996 370 --1235 1841
NM_173829chr5115431 5362 4912 4770 4292 2105 1952 1826 1311 1152 1079 44544 4098 2435 1730 14925 22113 1132
NM_173832chr873598 3574 2644 1038 959 459 140 11481 22529 2483 1234
NM_173848chr82742 273 1370 --1326
NM_173851chr8103780 3519 3276 3253 3173 1389 1204 1059 448 355 23344 432 ----
NM_174886chr18--1183 ----
NM_174890chr103195 186 114 ----1727
NM_175061chr722110 1756 --42169 1484 635 244 --
NM_175573chr20183 ------
NM_175607chr311311 11460 21109 677 --
NM_175612chr311311 11460 21109 677 --
NM_175623chr12156742 5595 5495 5080 3020 2722 1845 1755 1722 1601 1301 1011 930 887 426 22624 2352 ----
NM_175624chr12166837 5690 5590 5175 3115 2817 1940 1850 1817 1696 1396 1106 1025 982 521 70 22719 2447 ----
NM_175625chr12166837 5690 5590 5175 3115 2817 1940 1850 1817 1696 1396 1106 1025 982 521 70 22719 2447 ----
NM_175733chr1192104 1960 1909 1841 1747 1515 1399 774 326 21978 1805 ----
NM_175736chr12227483 7306 5860 5774 5694 5664 5316 4916 4735 2990 2592 2511 1972 1834 1731 1522 1466 871 601 468 318 21 25208 2120 12647 --
NM_175748chr1451787 1634 1363 471 296 ----11477
NM_175767chr541639 516 462 446 11735 11772 --
NM_175847chr1921174 1041 ----162
NM_175854chr1372701 2530 1838 1025 728 183 121 12062 32440 1805 820 --
NM_175861chr12135562 4953 3901 2342 2320 2156 1973 1566 1174 1003 764 359 64 --14778 25716 5366
NM_175863chr61361 11032 ----
NM_175876chr172822 2794 2587 1916 968 377 118 ----12723
NM_175907chr1872573 1993 1140 993 869 789 117 ----22781 445
NM_175910chr19122064 2002 975 893 814 730 562 478 394 310 226 58 --1618 --
NM_175920chr51569 2668 88 --2658 77
NM_175921chr553952 3042 2702 1585 799 1411 23574 1357 1792
NM_176081chr10125858 5622 4888 4557 4233 4207 4100 1783 1308 1237 982 704 ----15357
NM_176083chr10125858 5622 4888 4557 4233 4207 4100 1783 1308 1237 982 704 ----15357
NM_176787chr1841421 504 489 223 ----11235
NM_176816chr571938 1923 1659 1540 1520 1320 808 ------
NM_177414chr151541 1440 566 511 349 --11776 --
NM_177424chr141814 1439 797 767 --21915 482 --
NM_177438chr1493725 3433 2731 2603 1577 1166 1076 928 670 23501 362 11491 --
NM_177452chr1452261 1882 412 305 58 12227 11801 11698
NM_177524chr73856 465 119 11096 --1160
NM_177525chr73856 465 119 11096 --1160
NM_177538chr278847 8082 6640 3404 3203 1892 1164 28823 1246 25452 1507 --
NM_177552chr161376 ------
NM_177925chr1273130 3117 2636 2030 1121 544 434 1348 22400 43 12363
NM_177966chr321700 74 11459 21676 1656 --
NM_177985chr272284 2258 1733 686 439 311 61 1766 --12297
NM_177989chr32332 141 ------
NM_177990chr2051992 1593 1379 548 395 129 188 11427
NM_177996chr2063293 2527 1227 830 478 145 22802 850 12962 12473
NM_177999chr9103533 2559 1237 990 958 878 705 491 275 104 33559 2907 253 22746 1319 1692
NM_178006chr1351494 819 308 297 81 21736 732 11592 --
NM_178007chr1351494 819 308 297 81 21736 732 11592 --
NM_178010chr1241659 1520 434 167 --2621 43 11539
NM_178011chr1063299 2491 2454 1044 873 844 22125 302 ----
NM_178013chr1463106 2701 1981 1091 434 65 1326 12341 1470
NM_178042chr32332 141 ------
NM_178120chr22419 354 1239 1361 1470
NM_178123chr231025 354 255 ------
NM_178140chr562272 888 821 717 600 144 22314 2200 2391 190 12280
NM_178151chrX127793 7523 7106 6456 6068 2240 2081 2028 1884 1562 1072 288 37070 6610 1578 24774 2886 16418
NM_178152chrX127793 7523 7106 6456 6068 2240 2081 2028 1884 1562 1072 288 37070 6610 1578 24774 2886 16418
NM_178153chrX127793 7523 7106 6456 6068 2240 2081 2028 1884 1562 1072 288 37070 6610 1578 24774 2886 16418
NM_178426chr151745 940 892 187 160 ------
NM_178427chr151645 840 792 87 60 ------
NM_178438chr11274 ------
NM_178483chr20186 ------
NM_178496chr331162 996 969 ------
NM_178509chr1763857 3210 1103 1096 984 366 23153 1351 23955 1477 --
NM_178539chr1251826 1672 1630 1316 533 ----21598 175
NM_178554chr3113295 3159 2832 1335 1302 913 876 847 716 450 342 31067 614 41 1586 --
NM_178565chr841501 1436 1120 571 158 ----
NM_178566chr931747 421 270 --11412 --
NM_178586chr14122453 2209 2055 1971 1938 1649 1608 732 289 199 186 101 2636 274 ----
NM_178587chr141111 ------
NM_178812chr82582 224 11451 --21299 528
NM_178815chr1072651 2276 2084 1946 1787 943 718 ------
NM_178864chr111700 ------
NM_180989chr1372199 1911 1567 872 355 112 27 ------
NM_181265chr472673 2485 1261 1118 525 285 275 --22980 1279 --
NM_181332chrX92625 2575 2442 1983 974 710 320 151 97 --1682 --
NM_181349chr7113008 2591 2410 1046 985 927 872 838 795 80 50 32092 1193 819 22751 2376 11248
NM_181351chr1152567 2491 2112 452 38 11192 13048 --
NM_181358chr163366 3242 3036 703 517 377 11040 1818 1862
NM_181361chr331145 336 35 21009 401 1144 --
NM_181442chr204859 414 261 70 ------
NM_181443chr2062209 1955 1876 796 752 204 --11828 1863
NM_181481chr18196837 6773 6462 6336 6069 5994 5849 5507 5175 5046 4675 4466 2196 1662 1517 1503 1276 702 579 24326 1816 --46829 6299 2784 768
NM_181482chr18196837 6773 6462 6336 6069 5994 5849 5507 5175 5046 4675 4466 2196 1662 1517 1503 1276 702 579 24326 1816 --46829 6299 2784 768
NM_181483chr18196837 6773 6462 6336 6069 5994 5849 5507 5175 5046 4675 4466 2196 1662 1517 1503 1276 702 579 24326 1816 --46829 6299 2784 768
NM_181486chr1251275 1148 1126 585 340 1968 1619 --
NM_181504chr593264 2980 2973 1637 1121 1063 951 536 58 43966 2877 257 110 --13621
NM_181521chr16117116 7078 7001 6260 4787 1860 1496 1359 1261 532 120 25226 1807 --44941 1960 783 516
NM_181523chr593264 2980 2973 1637 1121 1063 951 536 58 43966 2877 257 110 --13621
NM_181524chr593264 2980 2973 1637 1121 1063 951 536 58 43966 2877 257 110 --13621
NM_181532chrX1244 ------
NM_181571chr1041146 1021 417 375 --11125 --
NM_181645chr112171 77 --155 1513
NM_181670chr1231110 394 365 ----1138
NM_181672chrX11878 ------
NM_181673chrX11878 ------
NM_181702chr82400 296 149 1203 1181
NM_181705chr554955 4079 3698 2316 1083 45541 4181 3579 3525 165 --
NM_181712chr141885 1351 611 362 21708 96 2837 36 --
NM_181714chr671862 1718 1690 1529 1509 712 405 ------
NM_181723chr842193 753 592 56 1660 --1735
NM_181782chr651798 1706 1430 846 62 11660 179 --
NM_181832chr2273396 3213 2618 2408 724 453 70 1154 33570 3272 220 1464
NM_181838chr571599 1303 1274 1083 423 357 61 11539 1273 --
NM_181839chr841244 1109 1103 439 ----1943
NM_181844chr1751749 1677 1668 422 46 11827 32014 1530 1353 --
NM_181861chr1232177 128 91 --12367 12321
NM_181868chr1232177 128 91 --12367 12321
NM_181869chr1232262 213 176 --12452 12406
NM_181876chr432266 1739 1007 21991 94 ----
NM_181886chr41882 ----11428
NM_181887chr41882 ----11428
NM_181888chr41882 ----11428
NM_181889chr41882 ----11428
NM_181890chr41882 ----11428
NM_181891chr41882 ----11428
NM_181892chr41929 163 --11475
NM_181893chr41882 ----11428
NM_181897chr382222 2208 1794 1675 1030 828 476 434 1245 32470 926 734 11733
NM_182314chrX51811 683 658 589 419 11319 1261 --
NM_182485chr453515 2861 2729 2482 870 11289 32685 2290 820 --
NM_182503chr6125471 5355 4509 4132 4091 3823 1732 1385 1090 809 209 64 --35288 4721 3463 24053 1763
NM_182511chr181591 31230 1127 283 --21458 1219
NM_182515chr19124848 4806 2063 1662 1592 1357 1068 740 643 525 357 274 26676 6632 --24545 690
NM_182527chr2292168 1921 1805 1623 1447 815 707 701 462 2788 489 ----
NM_182580chr1122565 2523 1941 1919 798 787 767 390 367 227 214 139 1777 ----
NM_182641chr1771651 1274 522 355 284 244 185 1192 ----
NM_182646chr453515 2861 2729 2482 870 11289 32685 2290 820 --
NM_182648chr141669 ------
NM_182663chr1112273 2129 2099 2006 1720 874 688 627 598 482 438 3868 807 561 32283 829 140 11985
NM_182664chr1102403 2259 2229 2136 1850 818 757 728 612 568 2937 691 32413 959 270 12115
NM_182665chr1112273 2129 2099 2006 1720 874 688 627 598 482 438 3868 807 561 32283 829 140 11985
NM_182678chr21341 ------
NM_182680chrX1115 ------
NM_182691chr71941 ----21380 543
NM_182692chr71941 ----21380 543
NM_182703chr1531471 1323 1304 ------
NM_182718chr1041146 1021 417 375 --11125 --
NM_182719chr1041146 1021 417 375 --11125 --
NM_182724chr1041146 1021 417 375 --11125 --
NM_182725chr1041146 1021 417 375 --11125 --
NM_182728chr1421151 731 --21284 749 1742
NM_182757chr632430 384 62 13246 --21040 162
NM_182758chr15143753 3633 3492 3432 3355 3008 2937 2876 2820 2804 2793 870 789 81 13517 ----
NM_182763chr182216 2006 704 514 418 388 198 112 12119 22271 1828 11956
NM_182765chr1061623 1606 543 306 163 103 11482 1211 12115
NM_182769chr1041146 1021 417 375 --11125 --
NM_182770chr1041146 1021 417 375 --11125 --
NM_182771chr1041146 1021 417 375 --11125 --
NM_182772chr1041146 1021 417 375 --11125 --
NM_182830chr1482022 1822 1734 1703 915 860 454 327 1357 ----
NM_182848chr134648 265 74 43 21320 655 ----
NM_182850chr1041146 1021 417 375 --11125 --
NM_182898chr7106217 5682 5371 4901 4473 2195 2182 969 734 33 15532 16132 35669 5500 4930
NM_182899chr7106217 5682 5371 4901 4473 2195 2182 969 734 33 15532 16132 35669 5500 4930
NM_182907chr64817 409 394 99 --12026 1192
NM_182915chr292284 2167 2031 1710 1535 887 712 307 246 51595 1391 761 695 495 11547 --
NM_182931chr7185 ------
NM_182970chr2073964 3126 2918 1244 1102 994 509 1362 23521 1282 12780
NM_182972chr152643 2320 2187 835 589 12407 --1368
NM_182977chr551130 246 166 131 103 ------
NM_183004chr14113939 3841 3706 3571 3552 3298 2663 2645 1265 1155 636 22955 1131 --189
NM_183043chr131741 --1893 --
NM_183044chr131741 --1893 --
NM_183050chr662299 2153 2106 1844 1526 129 133 12177 11947
NM_183060chr1041146 1021 417 375 --11125 --
NM_183075chr432007 1063 861 11838 --12532
NM_183234chr1521779 1587 2466 226 21500 1309 --
NM_183235chr1521779 1587 2466 226 21500 1309 --
NM_183236chr1521779 1587 2466 226 21500 1309 --
NM_183238chr12103107 2590 2508 1281 1189 974 964 518 274 173 --1115 31134 290 193
NM_183353chrX2866 837 1426 --1191
NM_183376chr1542533 2064 1616 531 1241 2876 668 --
NM_183380chr63387 217 22 2740 194 ----
NM_183381chr3------1902
NM_183383chr3------1902
NM_183384chr3------1902
NM_183419chr851201 946 528 232 200 --198 --
NM_184231chr32529 224 1596 --1641
NM_194071chr764322 4308 3476 1783 1319 1066 23768 3699 15394 --
NM_194247chr2104019 3749 3399 3241 3127 1789 1396 216 152 61 --14107 --
NM_194250chr21374 ------
NM_194279chr141440 --1353 --
NM_194282chr453041 2791 2598 674 498 ----1359
NM_194285chr1133084 2692 2122 21239 1156 22240 74 --
NM_194286chr12136078 5533 5420 4675 4316 4307 4177 4085 4034 1948 712 545 297 66165 5954 5581 5144 1960 1824 13986 15077
NM_194291chr852936 2557 858 632 348 --22791 183 --
NM_194298chr1051909 1855 418 384 277 ------
NM_194314chr1125456 5192 5076 3664 2017 1999 1468 1397 1155 871 699 602 24167 596 11106 11223
NM_194317chr292346 1930 1796 988 807 630 618 398 205 ----12639
NM_194328chr983076 3012 2867 2794 2021 780 380 339 --32125 705 157 --
NM_194329chr983076 3012 2867 2794 2021 780 380 339 --32125 705 157 --
NM_194330chr983076 3012 2867 2794 2021 780 380 339 --32125 705 157 --
NM_194332chr983076 3012 2867 2794 2021 780 380 339 --32125 705 157 --
NM_194434chr1884651 4448 4033 1783 1717 1587 1037 740 --14571 --
NM_194454chr731479 584 530 ----11249
NM_194455chr731479 584 530 ----11249
NM_194456chr731479 584 530 ----11249
NM_197941chr542696 2612 771 555 166 --12229
NM_198066chr1493015 2982 2028 812 709 653 594 360 278 11997 ----
NM_198128chr1852362 2190 600 594 105 22287 881 --11611
NM_198151chr72621 72 ------
NM_198158chr362858 2808 2707 2304 2179 670 ------
NM_198159chr362858 2808 2707 2304 2179 670 ------
NM_198177chr362858 2808 2707 2304 2179 670 ------
NM_198178chr362858 2808 2707 2304 2179 670 ------
NM_198181chr15112973 2959 2946 2917 2885 2570 2538 2350 1105 853 257 2927 91 --11998
NM_198212chr771635 785 772 629 452 213 28 --12380 --
NM_198225chr1011839 21363 593 --12022
NM_198240chr12------11197
NM_198268chr163366 3242 3036 703 517 377 11040 1818 1862
NM_198269chr163366 3242 3036 703 517 377 11040 1818 1862
NM_198270chrX83475 2773 2456 2381 2282 883 826 343 --186 132
NM_198273chr572885 2440 2258 756 511 322 85 --12503 11208
NM_198321chr5113259 3062 2923 2526 2286 1984 1217 347 273 264 198 ----33104 819 587
NM_198336chr741567 590 407 240 11261 1601 --
NM_198353chr41437 ------
NM_198381chr1151151 511 416 375 77 1494 ----
NM_198391chr2041538 1424 165 111 ------
NM_198392chr672264 2036 1819 669 629 413 130 --2914 761 --
NM_198399chr361320 576 302 88 56 44 ------
NM_198400chr1592574 2384 2109 2004 1997 739 730 419 134 1242 ----
NM_198401chr841269 1128 303 238 11221 --1431
NM_198404chr138738 719 676 666 329 257 111 23 --1572 --
NM_198465chrX62962 2543 2524 2371 2025 662 21162 431 1937 1549
NM_198468chr654631 4199 1576 989 775 148 14104 13781
NM_198485chr362419 2353 2191 2072 976 952 12032 31832 1719 152 --
NM_198490chr393453 2997 2822 2531 2368 1397 1047 828 492 43480 2806 448 79 32851 2438 2139 11122
NM_198503chr13716 291 57 12329 --1225
NM_198504chr35968 610 310 285 137 ------
NM_198513chr861596 1242 540 354 228 205 --11583 --
NM_198521chr12----1153 --
NM_198535chr19131 ------
NM_198549chr152794 2602 2163 2150 2094 1276 1328 --