TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3120-3p
miRNA Sequence: CACAGCAAGUGUAGACAGGCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000020chr1232319 571 188 11892 1880 --
NM_000021chr1421035 1023 --1294 --
NM_000038chr532077 1697 1328 1735 1342 1745
NM_000044chrX1155 1276 ----
NM_000067chr81191 1543 ----
NM_000081chr121366 55 11815 ----
NM_000084chrX85466 5020 1856 1654 1128 675 411 120 22059 58 26781 5391 --
NM_000090chr23922 727 637 --1173 --
NM_000108chr741746 1535 1431 274 --21203 576 --
NM_000109chrX22410 2370 ------
NM_000110chr12463 336 --2772 24 --
NM_000112chr535504 5112 1673 1383 13587 --
NM_000115chr1321678 531 12421 ----
NM_000138chr1512321 ------
NM_000141chr101528 --188 --
NM_000142chr42623 232 --11193 11326
NM_000163chr512096 --61516 1513 1510 1507 1504 414 --
NM_000167chrX21574 124 ------
NM_000168chr753010 2512 2276 952 798 --32279 944 373 --
NM_000176chr522750 119 --23847 91 --
NM_000194chrX1160 --1227 --
NM_000202chrX53309 3189 3088 1334 797 --11581 --
NM_000208chr1984045 3619 3442 3133 1219 1109 359 232 23925 3853 ----
NM_000210chr221650 659 179 ----
NM_000214chr2051711 1467 1385 538 91 --1503 --
NM_000216chrX23098 48 --11584 --
NM_000217chr1221849 149 --12134 --
NM_000222chr442115 2105 1710 1552 --11728 --
NM_000232chr41902 22679 121 ----
NM_000248chr332965 2311 699 --12547 --
NM_000252chrX--21524 1402 ----
NM_000259chr1586013 5583 4858 1546 854 636 381 192 46364 5788 5353 2496 16334 --
NM_000264chr963074 3062 2978 2733 2296 353 ------
NM_000266chrX2271 157 ------
NM_000267chr1733247 3155 1256 191 ----
NM_000276chrX32278 2078 292 ----1384
NM_000278chr1011556 ------
NM_000280chr111960 ------
NM_000293chr16151 1292 ----
NM_000297chr421724 1426 ----162
NM_000313chr32857 163 --1722 --
NM_000314chr1033122 1021 957 --32754 650 181 --
NM_000321chr13--11343 1276 --
NM_000322chr651654 1363 1154 467 182 ------
NM_000332chr666328 6251 4907 1282 793 769 12387 36185 4353 1855 14357
NM_000333chr31148 ------
NM_000338chr151237 176 ----
NM_000345chr43913 318 226 11043 1322 --
NM_000346chr1731656 1395 1247 1640 11387 --
NM_000362chr2253512 3439 1076 449 146 --11114 --
NM_000368chr984023 3927 3482 3355 3328 893 425 38 --14806 --
NM_000397chrX32100 1839 1655 ------
NM_000399chr101110 ------
NM_000408chr233411 2614 706 --21367 1364 23416 174
NM_000428chr1442332 2218 983 635 12494 ----
NM_000430chr1773717 3590 3221 3174 2858 2540 2481 11389 11232 --
NM_000436chr521518 166 --1411 --
NM_000442chr1711182 11284 ----
NM_000459chr9--1118 1324 --
NM_000461chr354211 3467 3301 917 500 13964 ----
NM_000462chr1521317 565 ------
NM_000489chrX53172 2642 2583 985 864 --12717 --
NM_000492chr721363 1018 11168 ----
NM_000495chrX--21162 408 ----
NM_000503chr821830 1650 --1127 --
NM_000516chr201317 ------
NM_000522chr71933 ----1486
NM_000533chrX21602 737 ----11588
NM_000555chrX47741 7560 1587 1104 --51644 537 122 119 116 --
NM_000575chr23422 177 96 ------
NM_000582chr4----1387 --
NM_000586chr4175 ------
NM_000599chr21633 --44211 4208 4205 4202 14553
NM_000600chr7184 --225 22 --
NM_000601chr73280 163 127 ------
NM_000610chr1133008 1893 707 22895 2194 ----
NM_000615chr1121106 220 ------
NM_000618chr1255555 4845 4568 4357 1411 1323 1220 11380
NM_000618chr1255555 4845 4568 4357 1411 1323 1220 11380
NM_000619chr121495 ------
NM_000627chr22297 264 ------
NM_000673chr42120 29 ------
NM_000684chr1031211 1062 190 --1204 --
NM_000719chr1276057 4266 4153 2531 2259 1933 1699 16494 26237 1959 --
NM_000722chr71288 --1278 --
NM_000724chr1011421 11657 1134 --
NM_000726chr231267 513 118 1420 ----
NM_000747chr171679 ------
NM_000780chr831110 791 124 ------
NM_000801chr2021055 843 --11022 --
NM_000806chr521230 23 11396 ----
NM_000812chr4184 --1365 --
NM_000813chr53390 262 123 14084 ----
NM_000814chr1554203 2895 2802 768 648 --14057 --
NM_000818chr101522 ------
NM_000824chr42774 588 ------
NM_000826chr422448 113 12601 ----
NM_000829chr1122345 723 ----1744
NM_000831chr131909 1322 926 12443 11424 16274
NM_000838chr6--12780 21914 1830 --
NM_000840chr7--1417 --1388
NM_000844chr321044 1005 ------
NM_000859chr531664 1122 216 11540 11566 --
NM_000868chrX22567 593 11691 2554 101 --
NM_000872chr1021484 37 1112 --1381
NM_000875chr1586436 4904 2356 2122 1918 1119 726 131 16921 ----
NM_000891chr1743189 2817 1189 423 1221 23609 647 --
NM_000899chr1223766 1697 --13270 --
NM_000901chr43844 498 46 21008 707 1701 --
NM_000908chr51291 ----1616
NM_000917chr101961 --1758 133
NM_000922chr111298 --1793 1881
NM_000926chr1178003 7952 7429 6177 5805 2212 1270 26715 6243 13734 --
NM_000933chr20--11207 --11351
NM_000935chr331111 939 255 1431 2801 798 --
NM_000944chr43820 790 72 ------
NM_000945chr222049 665 ------
NM_000950chrX23434 1157 1434 ----
NM_000958chr521235 303 11186 --1447
NM_000959chr133961 2931 2914 13430 22972 653 --
NM_001001323chr122684 192 1832 ----
NM_001001344chrX32312 2098 446 12256 ----
NM_001001389chr1133008 1893 707 22895 2194 ----
NM_001001390chr1133008 1893 707 22895 2194 ----
NM_001001391chr1133008 1893 707 22895 2194 ----
NM_001001392chr1133054 1939 753 22941 2240 ----
NM_001001395chr1222569 377 --22597 2548 --
NM_001001396chr1104477 4453 4431 4381 3904 3892 2788 2756 1055 386 ------
NM_001001419chr554624 3521 3425 3229 792 45093 3606 543 207 15075 --
NM_001001420chr554624 3521 3425 3229 792 45093 3606 543 207 15075 --
NM_001001481chr832560 1317 822 --33091 1261 1258 1712
NM_001001483chr11------1379
NM_001001484chr1022267 414 --2655 289 --
NM_001001502chr51500 ------
NM_001001549chr742168 1066 179 158 ------
NM_001001550chr742168 1066 179 158 ------
NM_001001555chr742168 1066 179 158 ------
NM_001001664chr224087 2736 --13847 --
NM_001001668chr1954175 4010 3796 2793 491 ------
NM_001001787chr13476 413 61 ------
NM_001001875chr91283 ------
NM_001001890chr2154224 3413 3259 1243 351 --13043 11649
NM_001001933chr11129 1514 ----
NM_001001974chr1022267 1978 1484 1853 --
NM_001002026chr32617 434 --22428 2425 --
NM_001002032chr173645 625 25 1703 ----
NM_001002033chr173745 725 125 1803 ----
NM_001002233chr81441 --22018 1771 --
NM_001002243chr22252 122 ------
NM_001002259chr12----1325 --
NM_001002295chr101254 1757 ----
NM_001002755chr2142 ------
NM_001002756chr2142 ------
NM_001002757chr2142 ------
NM_001002762chr1042679 811 322 235 ------
NM_001002838chrX2546 332 ------
NM_001002843chr152798 297 21272 83 ----
NM_001002860chr1474366 4072 3947 3049 1352 1224 654 13922 24294 3422 --
NM_001002909chr1721496 755 12242 1409 --
NM_001003406chr2273298 3228 2991 2928 2263 2116 1071 ------
NM_001003407chr1075024 4769 4235 1248 1007 968 315 --13456 --
NM_001003408chr1075024 4769 4235 1248 1007 968 315 --13456 --
NM_001003652chr18148475 8097 8074 7977 7651 6772 6229 5596 3350 2872 2590 2346 1834 347 11236 35543 5540 2293 12240
NM_001003674chr18157052 7007 6626 6449 6384 6059 5430 4645 4594 1311 777 643 560 504 81 35474 4993 1890 56354 6351 5522 5295 4924 --
NM_001003675chr18157052 7007 6626 6449 6384 6059 5430 4645 4594 1311 777 643 560 504 81 35474 4993 1890 56354 6351 5522 5295 4924 --
NM_001003694chr3--1445 ----
NM_001003712chr1233441 1300 753 11612 1782 --
NM_001003792chr321114 174 --4121 118 115 112 --
NM_001003793chr321114 174 --4121 118 115 112 --
NM_001003810chr41563 ------
NM_001003927chr172475 80 ------
NM_001003940chr1533203 2724 831 --1104 --
NM_001003942chr1533203 2724 831 --1104 --
NM_001003943chr1533207 2728 835 --1108 --
NM_001004051chrX------189
NM_001004065chr953437 2944 1397 1154 312 ------
NM_001004196chr3--1215 ----
NM_001004317chr644306 1808 1678 870 ------
NM_001004342chr155860 5667 4364 1806 1548 15688 15893 --
NM_001004360chr231948 1607 1300 ------
NM_001004419chr1263957 3505 1583 1555 1047 762 ------
NM_001004720chr21744 ------
NM_001004722chr21913 ------
NM_001005266chr15----1112 1665
NM_001005267chr15----1112 1665
NM_001005268chr15----1112 1665
NM_001005269chr15----1112 1665
NM_001005353chr1168 21149 939 1318 --
NM_001005353chr1168 21149 939 1318 --
NM_001005354chr125539 460 436 195 135 173 ----
NM_001005375chrY31841 1744 124 ------
NM_001005377chr192244 234 --2252 84 --
NM_001005404chr1744336 3802 3183 790 ------
NM_001005609chrX73060 2740 1188 638 315 297 80 11245 23698 658 --
NM_001005732chr211665 --1601 --
NM_001005733chr211622 --1558 --
NM_001005746chr231267 513 118 1420 ----
NM_001005747chr231267 513 118 1420 ----
NM_001005849chr17----1583 --
NM_001005861chr3----1902 --
NM_001006118chrY1205 ------
NM_001006120chrY1205 ------
NM_001006600chr51266 21944 1909 --12449
NM_001006617chr91935 ----11184
NM_001006619chr91935 ----11184
NM_001006620chr91935 ----11184
NM_001006621chr91935 ----11184
NM_001006623chr252007 915 690 155 105 --12387 --
NM_001006636chr22969 961 1298 ----
NM_001006656chr1941688 1646 1250 1146 11534 11070 --
NM_001006681chrX1136 ------
NM_001006682chrX1136 ------
NM_001006683chrX1136 ------
NM_001006684chrX--1231 ----
NM_001006946chr221313 722 ------
NM_001007024chr1742832 1756 1571 185 --13747 --
NM_001007025chr1742832 1756 1571 185 --13747 --
NM_001007097chr995081 5045 4444 1173 1016 950 789 85 45 ----14903
NM_001007098chr13896 781 64 1330 ----
NM_001007102chr641594 1399 1059 349 --11598 --
NM_001007224chr732328 1701 477 ------
NM_001007226chr1751237 933 208 108 57 --1570 --
NM_001007227chr1751237 933 208 108 57 --1570 --
NM_001007228chr1751237 933 208 108 57 --1570 --
NM_001007229chr1751237 933 208 108 57 --1570 --
NM_001007230chr1751237 933 208 108 57 --1570 --
NM_001007237chr152139 2002 1864 581 211 ------
NM_001007246chr2151312 686 620 240 103 11867 31857 1783 1697 --
NM_001007257chr121476 1192 --41466 1403 1235 537 1392
NM_001007278chr1374306 3602 3563 3525 1455 1313 256 15273 ----
NM_001007466chr631642 1610 357 14638 54607 1564 1561 1551 1548 --
NM_001007526chrY1205 ------
NM_001007553chr12789 338 ------
NM_001007559chr1812048 ------
NM_001007565chr32156 130 ------
NM_001007794chr12528 203 1111 ----
NM_001008220chr543809 3799 3535 1519 ------
NM_001008222chrX1157 ----1569
NM_001008225chr72505 160 --1301 --
NM_001008239chr1833583 2892 666 33352 1210 990 33464 3461 2574 --
NM_001008392chr333240 2863 996 --1864 --
NM_001008408chr776345 6279 5837 3874 2075 2048 521 --11552 --
NM_001008495chr832258 1859 1754 ------
NM_001008528chr1751833 1808 1641 231 41 11300 ----
NM_001008540chr21108 ----1385
NM_001008541chr1032173 2005 1547 ------
NM_001008541chr1032173 2005 1547 ------
NM_001008564chr1332209 1836 310 ------
NM_001008660chr1131474 1269 85 ------
NM_001008701chr1943088 2314 2004 1928 ----1899
NM_001008738chr532271 1099 325 --12250 --
NM_001008860chr151669 ----1229
NM_001008892chr151669 ----1229
NM_001008894chr151669 ----1229
NM_001008895chr133977 958 915 ------
NM_001009552chr81478 1238 ----
NM_001009960chr752054 1126 864 664 337 --12440 --
NM_001009993chr241672 1630 1390 1289 1419 24212 1027 --
NM_001010853chr612921 ----12209
NM_001010861chr132779 2375 2293 ------
NM_001010862chrX43284 2524 2222 361 --22283 980 --
NM_001010888chrX24621 4325 24615 3945 33514 3511 1754 --
NM_001010891chr5104525 4283 2533 2294 1742 1175 1094 667 310 39 --35493 4361 1115 --
NM_001010895chr922041 462 --176 --
NM_001010924chr10----2790 787 --
NM_001010932chr73280 163 127 ------
NM_001010934chr731062 899 99 ------
NM_001010971chr11982 ------
NM_001010986chrX22445 1538 --21698 1678 11685
NM_001011513chr434044 3331 2753 13058 --14154
NM_001011537chr312122 --31838 1491 411 --
NM_001011551chrX2320 49 ------
NM_001011553chr721007 67 1288 ----
NM_001011645chrX1155 1276 ----
NM_001011663chr101730 --1100 --
NM_001011666chr776446 6405 6269 5357 5122 452 151 15631 22306 1176 --
NM_001011713chr1431543 1407 151 --11410 --
NM_001011885chr15--11729 1727 --
NM_001012329chr162202 2036 1847 956 600 32 --12373 --
NM_001012420chr1532954 421 331 1717 ----
NM_001012423chr1522954 331 1717 ----
NM_001012426chr633067 1037 697 ------
NM_001012427chr633067 1037 697 ------
NM_001012478chr19----1418 1638
NM_001012751chr1031629 180 117 1617 ----
NM_001012968chrX52746 2739 2723 2246 610 1695 3923 917 914 --
NM_001012977chrX21179 1117 ------
NM_001012980chrX------1232
NM_001012989chrX----2586 222 --
NM_001013031chr1022253 1021 --11319 --
NM_001013399chr61834 ------
NM_001013415chr421199 214 ------
NM_001013437chr18--1426 ----
NM_001013438chr321022 404 1654 ----
NM_001013620chr12108238 7037 5953 5152 3391 3155 1927 1713 1475 610 28056 7330 --16619
NM_001013703chr15--168 ----
NM_001013843chr15--1179 1917 --
NM_001014283chr1322169 1472 12146 ----
NM_001014380chr1345250 4152 673 37 24591 1597 ----
NM_001014797chr1088053 6242 6075 2966 2789 2664 1231 973 --1945 --
NM_001014809chr41678 --1918 --
NM_001015045chr442194 2076 1567 506 --32468 878 444 --
NM_001015048chr1433055 984 938 ------
NM_001015049chr1433055 984 938 ------
NM_001015877chrX32886 829 322 1883 ----
NM_001015885chr20182 1329 ----
NM_001015887chr321815 140 ------
NM_001017369chr4------11082
NM_001017371chr211219 11148 ----
NM_001017395chr333594 2641 2596 --13416 22631 1000
NM_001017420chr81190 ------
NM_001017424chr13601 195 70 11528 11374 --
NM_001017425chr13601 195 70 11528 11374 --
NM_001017434chr11165 ------
NM_001017923chr14----11627 --
NM_001017930chrX31345 1233 208 ------
NM_001017962chr101961 --1758 133
NM_001017969chr91545 ----1662
NM_001017977chr11367 ------
NM_001017979chr41268 ------
NM_001017995chr543889 868 716 41 --32945 2942 2939 --
NM_001017999chr12423 278 ------
NM_001017999chr12423 278 ------
NM_001018000chr12423 278 ------
NM_001018000chr12423 278 ------
NM_001018001chr12423 278 ------
NM_001018037chr921470 1376 11227 --11329
NM_001018057chr111146 ------
NM_001018064chr922146 1577 1502 --1431
NM_001018067chr175329 4835 4681 3938 814 504 284 13736 11956 --
NM_001018068chr175329 4835 4681 3938 814 504 284 13736 11956 --
NM_001018069chr175329 4835 4681 3938 814 504 284 13736 11956 --
NM_001018074chr522750 119 --23847 91 --
NM_001018075chr522750 119 --23847 91 --
NM_001018076chr522750 119 --23847 91 --
NM_001018077chr522750 119 --23847 91 --
NM_001018090chr152641 89 --1855 --
NM_001018091chr152751 199 --1965 --
NM_001018102chr152641 89 --1855 --
NM_001018108chr151669 --12198 --
NM_001018111chr731352 1165 414 1951 21394 982 --
NM_001020658chr11233 21103 308 ----
NM_001020658chr11233 21103 308 ----
NM_001020818chr1951853 1725 1644 228 221 --1205 --
NM_001020819chr1951853 1725 1644 228 221 --1205 --
NM_001020820chr1951853 1725 1644 228 221 --1205 --
NM_001020821chr1951853 1725 1644 228 221 --1205 --
NM_001020825chr51225 --11322 --
NM_001023567chr1522357 2346 ------
NM_001024071chr141802 ------
NM_001024094chr522750 119 --23847 91 --
NM_001024380chr81209 ------
NM_001024381chr81209 ------
NM_001024455chrX72654 2640 2219 2037 1894 87 66 --12477 --
NM_001024647chr1297587 7459 7160 4983 2670 1728 1165 936 166 --14664 --
NM_001024649chr522002 958 12516 22953 2164 --
NM_001024808chr1221854 185 22783 302 ----
NM_001024934chr61264 ------
NM_001024935chr61264 ------
NM_001024936chr61264 ------
NM_001024948chr111025 12693 12605 --
NM_001024956chr11105830 5783 4545 3788 3681 1977 1747 934 226 182 11038 15749 --
NM_001025068chr341755 526 206 147 ------
NM_001025069chr341755 526 206 147 ------
NM_001025076chr10116114 5676 5466 4481 4050 3978 1361 1258 838 681 258 25892 3972 55910 5875 5869 3802 2158 --
NM_001025077chr10157472 7034 6824 5839 5408 5336 4578 2719 2616 2196 2039 1616 1351 1244 1145 27250 5330 57268 7233 7227 5160 4734 --
NM_001025079chr364014 3997 3644 3571 3220 215 21072 757 1245 --
NM_001025105chr511325 1178 ----
NM_001025203chr21--141 ----
NM_001025204chr21--141 ----
NM_001025248chr1511262 ------
NM_001025249chr1511262 ------
NM_001025266chr331615 1201 82 24462 1265 ----
NM_001025616chr441462 518 433 318 ------
NM_001025780chr9141 2500 290 ----
NM_001029858chr62704 581 --1315 --
NM_001029860chr8----1244 --
NM_001029863chr622636 314 1911 2984 62 --
NM_001029875chr51376 --11107 --
NM_001029882chr12604 494 --4616 613 610 607 --
NM_001029882chr12604 494 --4616 613 610 607 --
NM_001029989chr15172 1274 --1299
NM_001029998chr41189 --11426 --
NM_001030006chr1762549 2493 851 269 80 33 ------
NM_001030007chr1663984 2854 1425 702 405 71 23771 1134 --1599
NM_001030055chr1454672 3600 1555 678 516 11129 --1931
NM_001030288chr1623449 1977 --13718 --
NM_001031679chr122601 571 ------
NM_001031684chr21166 ------
NM_001031695chr2265377 4979 2070 1851 1377 984 --12074 12093
NM_001031700chr442372 2090 433 316 --1655 --
NM_001031702chr33795 779 114 ------
NM_001031712chr61300 ------
NM_001031748chr121563 ------
NM_001031812chr552100 1666 878 679 50 1316 --11736
NM_001031835chr16151 1292 ----
NM_001032280chr611342 ------
NM_001032282chr811001 --1330 11310
NM_001032283chr122696 76 ------
NM_001032284chr122696 76 ------
NM_001032288chr2021320 347 --11338 --
NM_001032380chr1031921 694 373 1365 21997 499 --
NM_001032394chr632864 2574 2318 --12666 --
NM_001032395chr632731 2441 2185 --12533 --
NM_001033047chr4--1407 ----
NM_001033057chr321447 841 ------
NM_001033059chr631810 1659 431 --1237 --
NM_001033081chr121704 338 1218 ----
NM_001033082chr121704 338 1218 ----
NM_001033117chr354749 4472 4431 4246 3914 11015 14378 --
NM_001033506chr113407 162 96 ------
NM_001033507chr121794 119 21881 133 ----
NM_001033518chr742799 2789 2244 69 ------
NM_001033519chr742799 2789 2244 69 ------
NM_001033520chr742799 2789 2244 69 ------
NM_001033551chr1773887 3236 3091 2849 2745 1292 910 --13931 --
NM_001033557chr211216 --1133 1342
NM_001033659chr17--11344 ----
NM_001033756chr62423 214 --1727 --
NM_001033756chr62423 214 --1727 --
NM_001034837chr5------1775
NM_001034838chr5------1775
NM_001034850chr52414 246 ------
NM_001034852chr1452031 1762 1472 424 307 1340 1395 --
NM_001034954chr1032044 610 138 --42105 2102 2099 2096 13248
NM_001034955chr1032044 610 138 --42105 2102 2099 2096 13248
NM_001034956chr1032044 610 138 --42105 2102 2099 2096 13248
NM_001034957chr1032044 610 138 --42105 2102 2099 2096 13248
NM_001035chr121064 88 ------
NM_001037132chr721534 587 21615 112 21713 478 --
NM_001037133chr721534 587 21615 112 21713 478 --
NM_001037164chr741937 1858 1671 126 --1774 --
NM_001037165chr758397 2040 1700 1405 1020 --28342 7321 18900
NM_001037172chr321342 167 1912 --21035 926
NM_001037317chr132779 2375 2293 ------
NM_001037332chr522398 673 11676 ----
NM_001037333chr522398 673 11676 ----
NM_001037334chr1872278 2163 1587 865 502 319 50 11972 1383 --
NM_001037339chr12639 233 ----1717
NM_001037340chr12639 233 ----1717
NM_001037341chr12639 233 ----1717
NM_001037341chr12639 233 ----1717
NM_001037872chr21633 ------
NM_001037954chr112598 568 --11402 --
NM_001038493chr211372 --11327 --
NM_001038707chr142318 2062 703 422 ------
NM_001038707chr142318 2062 703 422 ------
NM_001039029chr121372 --11996 --
NM_001039395chr91171 --51998 467 464 188 92 --
NM_001039465chr141176 ------
NM_001039467chr202151 66 --169 --
NM_001039538chr223671 1129 ----13676
NM_001039547chr326411 1730 13216 47896 7875 1810 1406 --
NM_001039570chr2214286 ----14702
NM_001039571chr2214286 ----14702
NM_001039574chr131068 1020 354 --1704 --
NM_001039577chr173344 1217 807 598 569 140 21 23882 251 ----
NM_001039585chr154218 3188 3171 213 146 13687 23229 910 --
NM_001039590chrX63783 3474 3245 3108 2776 1437 1645 21411 157 --
NM_001039591chrX63783 3474 3245 3108 2776 1437 1645 21411 157 --
NM_001039618chr1194897 4883 4773 4132 2052 1614 1470 983 756 24956 3997 14689 25047 1004
NM_001039775chr1140 ----171
NM_001039802chr11356 --2301 247 --
NM_001039840chrX1710 --2877 89 --
NM_001039935chr52379 340 ------
NM_001039937chr1374071 3806 1228 1017 720 101 68 ------
NM_001040001chr63452 261 136 11913 ----
NM_001040057chr711139 --21188 995 --
NM_001040058chr4----1387 --
NM_001040060chr4----1387 --
NM_001040101chr441265 1193 363 156 1274 ----
NM_001040135chr71104 1526 1756 --
NM_001040142chr222155 406 --12236 --
NM_001040143chr222155 406 --12236 --
NM_001040152chr733617 3116 312 --45120 4530 3822 1515 15072
NM_001040157chr431023 718 297 12913 ----
NM_001040158chr53534 365 209 ------
NM_001040167chr721168 805 --21193 1096 --
NM_001040181chr31462 --1426 --
NM_001040182chr31462 --1426 --
NM_001040183chr31462 --1426 --
NM_001040199chr31462 --1426 --
NM_001040200chr31462 --1426 --
NM_001040202chr42419 203 --12119 --
NM_001040272chr9--11972 ----
NM_001040284chr1645234 2172 1218 888 --23625 2136 --
NM_001040402chr422615 891 12933 3264 164 70 --
NM_001040429chr1322419 1063 ------
NM_001040441chr145413 3930 194 176 13426 ----
NM_001040450chr151221 1720 ----
NM_001040453chr151221 1720 ----
NM_001040624chr832634 707 409 11758 12476 --
NM_001040625chr832634 707 409 11758 12476 --
NM_001040626chr832634 707 409 11758 12476 --
NM_001040627chr832634 707 409 11758 12476 --
NM_001040628chr832634 707 409 11758 12476 --
NM_001040629chr832634 707 409 11758 12476 --
NM_001040630chr832634 707 409 11758 12476 --
NM_001040694chr111359 --11048 --
NM_001040708chr821150 148 11138 ----
NM_001040709chr132528 717 196 12359 ----
NM_001040712chr933574 2465 882 11322 --1685
NM_001040875chr822664 2428 --22397 895 --
NM_001042353chr203399 160 113 ------
NM_001042355chr1675371 3983 3536 3355 1170 1145 602 11111 ----
NM_001042388chr183832 820 645 ----1623
NM_001042404chr141476 643 582 323 ------
NM_001042412chr1675371 3983 3536 3355 1170 1145 602 11111 ----
NM_001042413chr933455 905 434 ------
NM_001042425chr611342 ------
NM_001042453chrX11516 11417 11408 --
NM_001042473chr101198 --1115 --
NM_001042475chr63128 50 36 ------
NM_001042486chr2041579 1405 1356 254 ------
NM_001042492chr1733247 3155 1256 191 ----
NM_001042494chr1532961 2541 854 1532 23838 3835 --
NM_001042495chr1532961 2541 854 1532 23838 3835 --
NM_001042496chr1532961 2541 854 1532 23838 3835 --
NM_001042497chr1532961 2541 854 1532 23838 3835 --
NM_001042510chr821546 140 32170 2055 1353 ----
NM_001042511chr821546 140 32170 2055 1353 ----
NM_001042537chrX102283 2177 1996 962 886 629 510 453 439 248 11597 1593 --
NM_001042550chr921912 1849 11373 31915 1573 1518 11734
NM_001042555chr1294783 4633 4025 1352 1290 1193 884 792 21 --2958 605 14110
NM_001042599chr277634 7107 6651 6112 5551 5067 2205 15964 ----
NM_001042601chr353082 705 374 257 204 ------
NM_001042603chr1254605 1555 1535 1039 994 --22040 755 --
NM_001042604chr364802 4480 4262 563 537 158 --2940 583 23528 210
NM_001042616chr4--2213 24 ----
NM_001042632chr2062041 1974 1934 941 500 452 22532 1742 ----
NM_001042633chr2062041 1974 1934 941 500 452 22532 1742 ----
NM_001042646chr311544 21966 1721 11314 --
NM_001042669chr441462 518 433 318 ------
NM_001042749chrX31810 1639 746 11909 ----
NM_001042750chrX31810 1639 746 11909 ----
NM_001042751chrX31810 1639 746 11909 ----
NM_001043318chr1464088 3931 3799 1109 1102 1000 --13187 14008
NM_001043351chr141430 877 587 271 --1305 --
NM_001044305chr641540 1321 507 50 11222 --11098
NM_001044385chr263153 2820 2718 2569 1232 1211 1949 21170 165 --
NM_001044722chr552100 1666 878 679 50 1316 --11736
NM_001044723chr552100 1666 878 679 50 1316 --11736
NM_001049chr1432497 2075 121 ------
NM_001068chr3145 ------
NM_001069chr6144 ------
NM_001071775chr1341915 613 390 331 --11924 --
NM_001083620chr422446 113 12599 ----
NM_001083621chr114088 14221 13954 --
NM_001095chr1211611 1630 --11339
NM_001100108chr198249 8175 6711 2344 2016 1888 1855 1821 819 22927 525 37710 7306 2347 --
NM_001106chr3129654 9349 8023 7203 3397 2971 2382 2333 2102 1512 1287 585 27248 971 59353 8724 7788 3775 3105 --
NM_001113490chrX42932 2306 987 426 --13063 --
NM_001116chr16170 --12097 --
NM_001121chr10--11669 ----
NM_001124chr111466 --1470 --
NM_001126chr12286 220 1735 ----
NM_001128chr1663984 2854 1425 702 405 71 23771 1134 --1599
NM_001146chr811694 --22117 277 --
NM_001148chr441984 1701 818 651 1385 22060 401 --
NM_001149chr1041318 1267 940 281 ----1490
NM_001152chrX--143 ----
NM_001160chr1231967 1074 609 --1103 22675 261
NM_001167chrX45114 2613 915 30 16711 1489 11754
NM_001172chr142552 284 --1288 --
NM_001173chr1454672 3600 1555 678 516 11129 --1931
NM_001186chr2113016 ------
NM_001187chr212419 149 ------
NM_001199chr81236 ------
NM_001200chr20----1790 --
NM_001201chr423922 1324 ----23196 3074
NM_001204chr287419 7189 6418 5042 1914 1861 477 329 37524 7251 5967 --17759
NM_001206chr933147 2381 1181 --23070 468 --
NM_001222chr1021717 600 1195 --1653
NM_001235chr112708 641 ------
NM_001241chr271905 1596 1559 955 947 448 196 ------
NM_001241chr271905 1596 1559 955 947 448 196 ------
NM_001256chr1732481 1942 280 22672 1850 1697 --
NM_001257chr1621436 1189 ----11446
NM_001258chr171177 ------
NM_001259chr766382 4466 2110 1820 1100 120 --62339 956 953 946 937 934 35602 1982 757
NM_001260chr131226 ------
NM_001271chr1553200 2602 2236 980 117 13245 ----
NM_001273chr12--1122 ----
NM_001278chr102971 42 ------
NM_001280chr192547 207 1652 ----
NM_001282chr1762549 2493 851 269 80 33 ------
NM_001304chr1742814 2642 1412 770 23021 310 12981 --
NM_001310chr1242725 1015 692 254 12567 1696 --
NM_001313chr41678 --1918 --
NM_001315chr631646 302 93 ------
NM_001332chr5----11079 1495
NM_001343chr521330 1253 ------
NM_001351chr341820 1717 352 36 ------
NM_001356chrX42446 2363 1777 1659 --32504 2501 2159 22249 221
NM_001358chr41344 ------
NM_001363chrX3743 664 70 1680 ----
NM_001364chr1163849 3563 3211 863 649 92 ------
NM_001379chr19161 1288 ----
NM_001389chr21----1485 --
NM_001390chr1853251 2476 2363 2268 376 --23520 3094 --
NM_001396chr2112267 --22555 2118 --
NM_001399chrX73060 2740 1188 638 315 297 80 11245 23698 658 --
NM_001400chr12954 933 --1994 --
NM_001402chr631769 1241 520 ------
NM_001406chr1731548 1213 136 11632 ----
NM_001408chr121625 421 --31657 1654 1651 11630
NM_001412chrX63270 2614 2371 943 713 280 ------
NM_001415chrX21613 1604 21985 724 --1630
NM_001419chr1923255 818 14132 ----
NM_001427chr72388 364 --11955 --
NM_001429chr22--11010 ----
NM_001430chr2----1414 --
NM_001431chr62397 378 --2261 258 --
NM_001438chr132310 2289 1160 12253 --13180
NM_001448chrX21400 1287 11759 ----
NM_001449chrX11061 ------
NM_001451chr1621037 296 ------
NM_001452chr6------1708
NM_001453chr621759 669 --21729 1719 --
NM_001455chr643314 3142 1622 382 21321 504 21881 1296 13984
NM_001457chr321274 48 11402 1125 --
NM_001460chr121067 1038 --2161 155 --
NM_001463chr24782 307 288 59 ------
NM_001483chr71230 1112 ----
NM_001490chr953486 3073 2419 1341 465 23563 1488 13076 --
NM_001491chr622590 1755 --1229 --
NM_001495chr831133 899 784 ------
NM_001497chr952664 2568 2492 2278 51 1936 22176 695 --
NM_001498chr6--1871 21099 461 --
NM_001527chr634736 3631 735 --23999 471 --
NM_001542chr152139 2002 1864 581 211 ------
NM_001546chr621076 249 ------
NM_001564chr4------1139
NM_001584chr1121118 118 1833 3439 436 433 --
NM_001587chrX32278 2078 292 ----1384
NM_001604chr111960 ------
NM_001609chr1034402 4180 67 23650 41 ----
NM_001614chr172172 30 ------
NM_001614chr172172 30 ------
NM_001616chr24909 797 510 139 --1444 --
NM_001620chr111549 1811 ----
NM_001634chr631810 1659 431 --1237 --
NM_001635chr721070 212 11031 ----
NM_001650chr1832857 1098 1018 --1111 --
NM_001656chr521483 1330 11580 --11280
NM_001660chr31134 ------
NM_001662chr71159 --1393 --
NM_001663chr142281 215 --1859 1429
NM_001668chr161940 1844 1826 1512 739 483 ------
NM_001677chr141114 1051 859 313 --1422 --
NM_001679chr3134 ------
NM_001682chr121398 1546 ----
NM_001684chr184194 4170 4148 4098 3621 3609 772 103 ------
NM_001690chr352411 2016 1993 655 194 --42195 2192 2189 2186 --
NM_001693chr831168 483 466 ----1257
NM_001701chr911348 ----11005
NM_001703chr11281 ------
NM_001704chr61437 2590 211 ----
NM_001706chr31417 ------
NM_001709chr1182555 2267 2084 942 673 502 248 239 12329 12600 --
NM_001718chr62934 199 ----11152
NM_001730chr1311210 --11498 1210
NM_001730chr1311210 --11498 1210
NM_001735chr92292 50 ------
NM_001742chr72739 636 1701 ----
NM_001746chr522002 958 12516 22953 2164 --
NM_001748chr11927 ------
NM_001753chr751796 1306 1195 1145 290 ------
NM_001754chr2154224 3413 3259 1243 351 --13043 11649
NM_001755chr162567 298 11777 ----
NM_001759chr1211291 25166 4680 73480 3409 3406 3403 1368 1365 611 --
NM_001761chr1611805 ------
NM_001777chr364014 3997 3644 3571 3220 215 21072 757 1245 --
NM_001788chr721007 67 1288 ----
NM_001791chr11356 --2301 247 --
NM_001792chr182861 113 ------
NM_001798chr1221001 255 ------
NM_001821chr151456 1024 409 127 24 --13800 --
NM_001826chr1--1362 1335 --
NM_001829chr42951 50 ------
NM_001830chrX3495 450 247 23309 1420 ----
NM_001842chr9------1565
NM_001845chr1321324 175 ------
NM_001855chr92767 640 1840 1348 185
NM_001858chr644027 3612 1934 1808 11693 ----
NM_001859chr963154 3064 1601 1388 1238 48 ----13954
NM_001860chr91240 11125 ----
NM_001892chr511325 1178 ----
NM_001895chr201801 --11177 --
NM_001896chr161281 ------
NM_001901chr611019 ------
NM_001904chr321035 362 --1280 11026
NM_001920chr121605 ------
NM_001933chr142414 109 ----1949
NM_001935chr21352 ------
NM_001938chr131576 768 418 11917 ----
NM_001939chrX43685 2815 2648 869 12642 33635 2825 2663 --
NM_001944chr1842402 2150 1959 179 ------
NM_001945chr511342 --2577 574 --
NM_001946chr122838 24 1208 ----
NM_001948chr1511262 ------
NM_001949chr662495 2228 1052 695 651 77 13093 32807 2217 335 12832
NM_001951chr81534 ------
NM_001964chr51795 11028 ----
NM_001968chr41380 1838 ----
NM_001981chr122337 2067 1580 ----
NM_001987chr1253184 840 722 389 64 ------
NM_001995chr42379 72 ------
NM_001999chr521054 961 --31063 1060 1057 --
NM_002006chr475603 4429 1688 1517 1117 753 218 --13770 --
NM_002009chr151401 ------
NM_002015chr131763 1225 ----
NM_002017chr1121323 108 11380 ----
NM_002024chrX1757 ------
NM_002025chrX69139 6724 3308 3083 2567 1836 38010 7118 533 59197 8326 6931 5708 2571 26717 1793
NM_002026chr21806 ------
NM_002028chr1431264 1113 906 ------
NM_002031chr6--1349 1831 --
NM_002035chr1842476 1301 595 53 1947 ----
NM_002040chr2122987 2820 --11278 --
NM_002051chr101254 1757 ----
NM_002054chr21145 ------
NM_002063chrX142 11255 ----
NM_002071chr181179 --1689 --
NM_002072chr9----3923 920 917 --
NM_002074chr161556 1282 1162 622 561 158 1204 ----
NM_002077chr91722 22105 2074 ----
NM_002080chr162843 812 1711 ----
NM_002086chr1712153 --21987 487 --
NM_002107chr12487 471 ------
NM_002114chr6--1180 1144 --
NM_002126chr1744122 3165 1342 594 11582 33080 1125 982 --
NM_002128chr1372511 2468 2283 2263 959 421 270 --32445 472 358 12525
NM_002130chr52202 186 --11302 --
NM_002131chr621023 982 ------
NM_002133chr223489 432 404 --1479 --
NM_002136chr122585 516 ------
NM_002137chr772418 2104 1996 1914 842 638 594 1482 1276 11496
NM_002138chr41563 ------
NM_002139chrX--1250 ----
NM_002140chr91301 11085 1178 --
NM_002141chr71578 ------
NM_002148chr2----1122 1131
NM_002158chr232634 786 411 --2512 166 --
NM_002160chr9----1230 --
NM_002181chr21229 135 1537 --
NM_002196chr201717 ------
NM_002196chr201717 ------
NM_002199chr4127 --2139 52 --
NM_002202chr52953 397 ------
NM_002207chr31116 --1493 --
NM_002214chr734604 350 115 --12057 --
NM_002221chr122577 388 ------
NM_002222chr31189 ------
NM_002223chr1243735 3506 988 98 --1943 --
NM_002241chr132974 2101 1971 11131 ----
NM_002242chr21255 --11568 --
NM_002247chr101599 --51778 424 421 418 415 --
NM_002253chr4169 ------
NM_002264chr374861 3710 3229 1511 1502 812 452 ------
NM_002265chr17------1410
NM_002267chr1332307 785 764 ------
NM_002268chr321782 1209 1598 ----
NM_002270chr555114 4765 4450 4346 1210 --15117 --
NM_002271chr1332010 1776 105 12343 --1984
NM_002293chr142201 1949 1879 111 ------
NM_002294chrX169 ------
NM_002296chr121134 89 ------
NM_002298chr1311508 --11011 --
NM_002309chr2242336 1039 420 23 ------
NM_002310chr555153 4935 4213 1573 346 16188 56381 5577 2348 1901 695 --
NM_002313chr1075024 4769 4235 1248 1007 968 315 --13456 --
NM_002336chr1294528 4370 4358 3893 1945 1564 894 739 205 --24325 611 11031
NM_002355chr123991 481 432 ------
NM_002356chr62749 55 --32807 2060 160 --
NM_002359chr1753307 3187 2884 1302 293 ----14266
NM_002360chr742624 2267 2165 692 1413 ----
NM_002373chr1521297 845 11344 1123 --
NM_002374chr223671 1129 ----13676
NM_002375chr331861 751 686 12293 ----
NM_002376chr14----1492 --
NM_002380chr82379 102 ------
NM_002381chr21777 ------
NM_002382chr1411198 11269 ----
NM_002384chr182887 682 ------
NM_002387chr544199 1059 1026 83 15075 1899 --
NM_002395chr641433 563 458 361 1256 ----
NM_002397chr51268 ------
NM_002398chr211372 --11352 --
NM_002399chr1521351 1281 ------
NM_002401chr1742128 1817 77 38 1748 12239 --
NM_002411chr111122 ------
NM_002430chr2222415 111 1375 ----
NM_002444chrX1324 --11797 --
NM_002445chr82376 178 1136 11617 --
NM_002449chr5--11036 --1407
NM_002473chr222162 102 --21243 462 --
NM_002480chr1231142 1129 606 --2185 182 --
NM_002481chr155280 2009 1629 1076 45 --17890 --
NM_002499chr152762 332 12430 1636 --
NM_002500chr211194 --1444 --
NM_002501chr1912908 --11318 --
NM_002509chr201576 ------
NM_002516chr191315 ------
NM_002518chr21166 11086 ----
NM_002519chr1141397 1287 292 144 ----1585
NM_002520chr51126 ------
NM_002527chr121289 ------
NM_002536chrX41351 1120 205 110 ----1289
NM_002537chr1521097 385 ------
NM_002539chr21303 ------
NM_002567chr122744 722 --1597 --
NM_002577chr353945 3643 1575 564 301 14024 2849 846 1312
NM_002578chrX1339 ------
NM_002581chr935344 1845 837 14202 45529 3789 3786 1275 --
NM_002588chr531624 1612 609 1238 ----
NM_002589chr4------1124
NM_002590chr131117 177 ----
NM_002594chr2022422 1698 12469 ----
NM_002595chr1241921 1684 1576 319 --21346 172 --
NM_002600chr12639 233 ----1717
NM_002607chr731295 1081 1034 ------
NM_002608chr2211223 ----154
NM_002609chr521852 146 ------
NM_002613chr16115107 5097 4380 4341 3311 1726 1479 1248 979 629 399 14887 11205 15189
NM_002628chr311121 ------
NM_002635chr122296 37 ------
NM_002645chr1142975 2605 1910 150 1607 1220 --
NM_002651chr12203 165 ------
NM_002655chr875222 4267 4124 3369 1130 893 571 25058 4749 --15278
NM_002670chr341646 1280 346 260 ------
NM_002687chr14--1109 11001 --
NM_002703chr421962 1835 ------
NM_002706chr21499 ------
NM_002707chr2--1357 ----
NM_002709chr213604 11136 23075 956 --
NM_002710chr122793 154 ------
NM_002715chr541282 1171 891 225 ------
NM_002716chr1163582 3161 2928 2615 898 649 ------
NM_002721chr92502 99 --1164 --
NM_002730chr191334 11378 ----
NM_002731chr133060 327 83 --22880 414 22983 2028
NM_002734chr17--1413 31970 600 227 --
NM_002736chr731874 1772 598 ------
NM_002737chr17106198 4713 4625 4303 1883 1876 1805 902 863 735 --11847 --
NM_002738chr1621089 812 --1815 --
NM_002742chr14--2685 200 ----
NM_002745chr2223530 3514 13814 ----
NM_002748chr151778 ------
NM_002753chr41124 ------
NM_002755chr151322 1803 ----
NM_002756chr171885 --1976 --
NM_002813chr1231451 485 342 --31470 1330 1283 --
NM_002814chrX3279 219 33 --141 --
NM_002819chr1911218 ------
NM_002821chr61128 --1754 --
NM_002823chr22675 645 --1601 --
NM_002834chr1263849 3400 3309 2772 815 406 13541 --23554 3232
NM_002835chr72495 132 ------
NM_002839chr933574 2465 882 11322 --1685
NM_002840chr121353 105 21572 1557 ----
NM_002843chr1123184 2325 11331 13387 --
NM_002844chr62992 905 168 ----
NM_002845chr18--1513 ----
NM_002847chr7148 ------
NM_002848chr1221184 309 --1834 --
NM_002855chr1143468 2662 2597 220 ------
NM_002865chr81254 ------
NM_002868chr1222359 846 ------
NM_002869chr1122225 132 11647 11555 1536
NM_002873chr5--1437 ----
NM_002874chr92497 119 --12246 --
NM_002886chr364434 4354 3460 3283 1378 1183 23471 1337 14230 13193
NM_002890chr51655 --1351 2925 748
NM_002892chr143440 169 34 11453 1259 --
NM_002897chr21752 1629 --1512
NM_002902chr15--184 ----
NM_002906chr1121754 888 22348 1868 12121 --
NM_002912chr63625 162 61 ------
NM_002923chr11488 ------
NM_002924chr13491 190 65 --1618 --
NM_002941chr31522 --31209 178 175 --
NM_002942chr3--1361 ----
NM_002958chr3----1902 --
NM_002968chr16--1277 --1288
NM_002970chrX2134 74 ------
NM_002971chr3----192 1910
NM_002994chr421822 1430 11454 3245 106 103 --
NM_002997chr221313 722 ------
NM_002998chr82777 393 12171 ----
NM_003010chr1731950 1737 281 --11677 --
NM_003016chr17----1251 1455
NM_003017chr61437 11398 ----
NM_003026chr931372 1147 256 ------
NM_003028chr952930 784 150 107 88 --11217 --
NM_003030chr321908 1366 ------
NM_003038chr272615 2596 2497 2183 2022 929 482 ------
NM_003042chr31758 11921 ----
NM_003043chr32427 39 ----23785 2723
NM_003045chr1374953 3110 3099 1861 1720 786 547 24999 1828 11215 --
NM_003048chr252138 973 892 876 238 ------
NM_003051chr131246 362 339 --21581 1232 11717
NM_003060chr511208 --2861 104 1865
NM_003068chr83935 344 237 ------
NM_003069chrX2572 21 --2733 493 --
NM_003070chr91648 ------
NM_003071chr331963 1860 1321 --1689 --
NM_003076chr123598 516 111 ------
NM_003077chr173161 106 65 ------
NM_003079chr171183 ------
NM_003081chr2071041 1009 883 319 285 127 33 --1922 --
NM_003085chr51500 ------
NM_003107chr632594 2294 300 --2303 288 --
NM_003108chr256586 6237 2175 1670 1641 --26926 1004 17086
NM_003110chr1711066 ------
NM_003111chr211219 11148 ----
NM_003112chr712895 --32385 2382 2201 --
NM_003113chr2----1350 --
NM_003123chr1623449 1977 --13718 --
NM_003128chr252458 2446 687 499 317 --11126 --
NM_003131chr652023 517 411 234 56 --11715 --
NM_003136chr14148 1386 ----
NM_003137chr61501 --22167 463 --
NM_003144chr671506 741 727 557 315 272 154 --2476 473 --
NM_003150chr1742270 2141 466 300 --3352 349 346 12379
NM_003151chr21174 ------
NM_003155chr832482 2152 1921 ------
NM_003156chr114937 923 323 235 --1273 --
NM_003161chr1753329 2713 2402 1133 205 --11056 --
NM_003176chr1----1220 --
NM_003176chr1----1220 --
NM_003178chr341648 1603 863 102 11695 1867 --
NM_003182chr71513 ------
NM_003182chr71513 ------
NM_003193chr11146 ------
NM_003194chr62431 92 ------
NM_003198chr1----1260 --
NM_003199chr1832221 1320 466 ------
NM_003200chr193682 449 112 ------
NM_003206chr6--1329 ----
NM_003211chr1221397 1191 ------
NM_003220chr611342 ------
NM_003221chr6----24214 1366 --
NM_003222chr201803 --11224 --
NM_003223chr162534 527 --1665 --
NM_003246chr1521889 563 11625 11532 --
NM_003247chr651778 1664 1654 1396 416 11277 21657 1627 --
NM_003255chr1742594 2472 1928 804 11714 1990 --
NM_003257chr1521269 474 ------
NM_003262chr323198 668 13967 24969 1053 --
NM_003269chr6--11172 1826 --
NM_003274chr2132224 795 163 11174 1166 12431
NM_003275chr931225 970 603 --1325 --
NM_003298chr366186 5061 4226 2466 2178 601 --26208 6127 --
NM_003309chr631784 210 108 --1344 --
NM_003317chr14--1794 --1681
NM_003319chr23970 876 167 ------
NM_003330chr1221670 478 ------
NM_003336chrX3909 379 112 1251 ----
NM_003337chr51203 --138 --
NM_003338chr103728 353 313 ------
NM_003339chr5--1153 ----
NM_003341chr31646 ----1150
NM_003342chr1743216 3187 1137 93 1106 ----
NM_003344chr731422 638 464 11637 ----
NM_003348chr1221190 520 --31331 576 222 --
NM_003349chr2021320 347 --11338 --
NM_003356chr1131011 125 115 ------
NM_003373chr103543 480 86 --21697 444 --
NM_003374chr52784 590 3813 719 82 ----
NM_003388chr712036 ------
NM_003392chr344300 4221 1611 1056 --22821 1539 --
NM_003406chr82620 68 ------
NM_003410chrX2571 108 1708 ----
NM_003411chrY1103 --11620 --
NM_003412chr362800 2528 2366 2350 2288 711 --12909 --
NM_003413chrX31801 507 344 ----11453
NM_003418chr3------1779
NM_003423chr1911051 ------
NM_003432chr53135 122 36 ------
NM_003439chr752822 2778 1358 1083 397 ------
NM_003440chr123869 791 234 ------
NM_003454chr1631504 1484 953 11006 ----
NM_003458chr333957 3435 314 23879 3471 149 --
NM_003463chr6--1625 1214 --
NM_003467chr21108 ----1385
NM_003468chr264200 3740 3078 471 279 100 24393 3958 1455 --
NM_003471chr331788 149 103 11764 --1243
NM_003472chr631307 1282 298 --1169 --
NM_003473chr101311 ------
NM_003474chr101149 --22026 286 --
NM_003478chr1183143 3065 1245 1099 748 410 328 214 13250 1670 --
NM_003482chr1232571 1958 1905 --1705 --
NM_003483chr1232864 2262 316 22504 240 22832 2664 --
NM_003488chr17------1882
NM_003489chr2122390 337 --12333 --
NM_003498chr164375 232 108 82 ------
NM_003506chr82997 361 11261 ----
NM_003507chr232004 445 316 11876 ----
NM_003508chr71294 ------
NM_003557chr131394 1277 338 --11121 --
NM_003558chr91222 --1213 --
NM_003563chr1751237 933 208 108 57 --1570 --
NM_003566chr1273450 3040 2461 2332 1250 420 408 --21062 412 --
NM_003569chr61524 ----1618
NM_003574chr1875667 4694 4595 4322 4194 532 22 --1367 11661
NM_003581chr21744 ------
NM_003583chr1233778 2659 46 23516 2841 13908 13058
NM_003589chr133977 958 915 ------
NM_003590chr243547 3503 3284 329 2641 545 1752 --
NM_003597chr231685 776 397 --1917 --
NM_003603chr451884 1558 626 427 164 2776 557 ----
NM_003610chr20182 1329 ----
NM_003615chr363664 3653 2663 1364 445 94 --13131 --
NM_003618chr22983 264 ------
NM_003620chr172949 934 ----1206
NM_003621chr111480 ------
NM_003629chr173410 3245 2756 2188 1113 932 671 --13400 --
NM_003632chr172821 312 ------
NM_003633chr52787 583 ----32326 1663 337
NM_003644chr1785585 4944 4632 4475 2366 1325 1082 248 ------
NM_003648chr272424 2210 629 565 507 492 299 12589 ----
NM_003659chr22831 309 ------
NM_003663chr332611 2591 2151 12895 --1611
NM_003668chr121247 1118 ----
NM_003671chr922378 340 3619 517 238 ----
NM_003672chr13696 427 90 ------
NM_003685chr193849 782 639 ------
NM_003692chr91876 ------
NM_003701chr132905 673 ------
NM_003702chr82670 266 1223 ----
NM_003714chr532205 417 305 12427 ----
NM_003728chr41270 --1462 --
NM_003735chr531624 1612 609 1238 ----
NM_003736chr531624 1612 609 1238 ----
NM_003741chr31285 ------
NM_003749chr132587 223 ------
NM_003750chr103954 246 106 ----1613
NM_003758chr1551089 625 256 248 183 ------
NM_003758chr1551089 625 256 248 183 ------
NM_003759chr413267 --2829 176 --
NM_003774chr1221335 184 ------
NM_003778chr31111 ------
NM_003787chr1821272 433 ------
NM_003794chr321088 1074 ------
NM_003797chr11----139 --
NM_003799chr1884497 3952 3187 2992 2972 1749 988 485 --1156 --
NM_003800chr62910 773 ------
NM_003818chr202916 822 2813 194 ----
NM_003822chr153083 2687 1085 862 840 11231 ----
NM_003829chr92879 87 ------
NM_003831chr1841817 1794 1579 578 ------
NM_003846chr11528 ----1712
NM_003870chr1532079 759 286 ----11589
NM_003872chr242336 2052 1989 625 ------
NM_003873chr1021873 808 1613 32422 2059 598 --
NM_003885chr1732168 927 285 --1586 --
NM_003895chr2132204 1924 1723 --22081 1602 --
NM_003899chr133765 650 514 22589 2170 21941 1841 --
NM_003908chr2061322 1212 1171 1108 1069 1045 --133 --
NM_003909chr852431 2408 1977 314 279 1403 31866 379 282 --
NM_003913chr663129 2627 1656 1157 1026 378 ------
NM_003916chrX1481 --11175 --
NM_003931chr61264 ------
NM_003932chr2231406 1285 29 --2704 591 11654
NM_003934chr93891 182 105 ------
NM_003936chr22980 188 ------
NM_003938chr1931134 159 128 ------
NM_003941chr721567 119 1709 12135 1108
NM_003949chr1721659 61 ------
NM_003953chr132304 815 612 --1251 --
NM_003958chr673923 3883 3822 3732 2750 2443 1273 13050 3311 308 305 --
NM_003983chr1654488 3122 2783 1070 670 14066 24351 848 14355
NM_003987chr1011556 ------
NM_003988chr1021633 1456 ------
NM_003989chr1011492 ------
NM_003990chr1011492 ------
NM_003994chr1223766 1697 --13270 --
NM_004006chrX22410 2370 ------
NM_004007chrX22410 2370 ------
NM_004009chrX22410 2370 ------
NM_004010chrX22410 2370 ------
NM_004011chrX22410 2370 ------
NM_004012chrX22410 2370 ------
NM_004013chrX22410 2370 ------
NM_004014chrX22410 2370 ------
NM_004015chrX22410 2370 ------
NM_004016chrX22324 2284 ------
NM_004017chrX22410 2370 ------
NM_004018chrX22324 2284 ------
NM_004020chrX22410 2370 ------
NM_004021chrX22324 2284 ------
NM_004022chrX22324 2284 ------
NM_004023chrX22324 2284 ------
NM_004028chr1832857 1098 1018 --1111 --
NM_004035chr1745042 4201 4134 560 1738 14991 --
NM_004037chr13811 713 73 --2835 186 --
NM_004040chr2----11253 --
NM_004055chr1131394 298 212 1903 1123 --
NM_004056chr81182 --11046 --
NM_004061chr51438 --1253 --
NM_004067chr72451 251 --2523 225 11458
NM_004075chr122413 120 ------
NM_004081chrY31841 1744 124 ------
NM_004087chr331851 1297 1288 21997 1914 21279 1276 --
NM_004093chr1353032 1049 980 841 248 12757 ----
NM_004100chr652142 651 566 249 154 ------
NM_004112chr1711664 ------
NM_004114chrX4886 874 450 53 --21228 831 11232
NM_004115chr13121 --1125 --
NM_004133chr832618 114 48 11982 --1472
NM_004136chr1543043 1105 381 231 23276 2459 ----
NM_004143chrX--149 ----
NM_004152chr191231 1106 ----
NM_004156chr81478 1238 ----
NM_004161chr22554 254 --11436 --
NM_004170chr921850 1217 ------
NM_004171chr1179479 9001 8693 7550 6763 1486 177 --23477 2388 --
NM_004200chr112733 557 12916 ----
NM_004227chr732888 2667 2080 --12208 --
NM_004232chr1841331 751 306 94 --23563 3040 --
NM_004236chr152454 159 1230 ----
NM_004238chr2----1280 1110
NM_004241chr102561 32 ------
NM_004261chr13893 368 224 ------
NM_004262chr411304 1549 ----
NM_004272chr511314 21711 664 --21367 455
NM_004274chr1422712 1051 1640 --1752
NM_004279chr731983 1888 804 12295 12078 --
NM_004280chr61108 ------
NM_004290chr511135 ------
NM_004293chr943294 3179 612 525 1972 23731 3154 --
NM_004294chr13------1702
NM_004299chrX----130 --
NM_004302chr122713 701 12943 ----
NM_004304chr21386 ----1278
NM_004311chr1051110 465 458 388 68 ------
NM_004319chr133142 2217 1189 ------
NM_004330chr1521120 54 1168 ----
NM_004331chr82722 240 1715 ----
NM_004338chr18157052 7007 6626 6449 6384 6059 5430 4645 4594 1311 777 643 560 504 81 35474 4993 1890 56354 6351 5522 5295 4924 --
NM_004342chr72405 237 ----11938
NM_004346chr421399 290 ----1552
NM_004369chr22651 235 ------
NM_004370chr622123 1698 12031 --1661
NM_004379chr23669 590 474 21292 1196 ----
NM_004380chr1642167 976 635 303 12560 ----
NM_004384chr552100 1666 878 679 50 1316 --11736
NM_004392chr131264 12204 11850 12519
NM_004393chr32508 60 ------
NM_004397chr1154217 3304 1719 1241 1072 34234 3960 1173 ----
NM_004408chr92489 446 1124 ----
NM_004411chr72591 259 --1106 --
NM_004417chr52561 178 ------
NM_004420chr1132286 1830 1534 12443 ----
NM_004423chr332298 2037 282 --12762 --
NM_004426chr122637 163 --1507 --
NM_004429chrX21454 1084 ------
NM_004430chr842741 2293 2089 458 12690 ----
NM_004431chr12778 67 ------
NM_004432chr9--1362 1452 --
NM_004438chr232346 316 160 1309 ----
NM_004440chr61626 11426 ----
NM_004441chr31532 ----11212
NM_004447chr121348 11042 11148 --
NM_004449chr2121449 535 ------
NM_004454chr342060 1986 1477 412 22040 1911 --11902
NM_004457chr261716 1395 1290 1218 503 487 --1507 --
NM_004458chrX41764 591 558 77 --21006 155 --
NM_004459chr1731954 428 403 ------
NM_004461chr191184 ------
NM_004464chr444271 4147 3506 509 --11263 --
NM_004481chr142679 1853 904 797 12580 ----
NM_004483chr162479 418 ------
NM_004487chr32269 253 --1929 --
NM_004492chr151222 ------
NM_004494chr131264 1116 45 ------
NM_004504chr243033 652 397 73 ------
NM_004505chr1742021 1842 1727 392 ------
NM_004508chr101815 11121 ----
NM_004514chr1762959 2654 2520 2511 1051 321 --1826 --
NM_004525chr211458 1543 ----
NM_004529chr9--1985 188 11308
NM_004537chr122358 261 --1109 --
NM_004561chr1131824 1365 600 11711 ----
NM_004571chr2152936 2166 1298 849 582 --23411 2999 --
NM_004575chr431567 1218 621 1229 11456 11449
NM_004586chrX65253 5219 4047 3404 598 128 24243 3318 ----
NM_004588chr1133689 3663 819 --13652 --
NM_004598chr53441 199 107 --33184 218 215 --
NM_004602chr2011183 --1199 --
NM_004603chr71776 ------
NM_004612chr964845 942 690 352 312 286 13105 --14412
NM_004622chr242023 1882 893 28 11943 1206 11895
NM_004634chr3--1445 ----
NM_004635chr32448 288 --1116 --
NM_004654chrY11398 --21141 341 11109
NM_004657chr231560 364 30 ------
NM_004660chrY42231 1709 1603 1520 --12107 --
NM_004663chr1511179 ----11434
NM_004685chr1332764 2629 2104 --1977 --
NM_004687chr1722014 1394 12088 ----
NM_004689chr14----1308 --
NM_004703chr171402 21732 457 ----
NM_004705chr113804 573 313 --2838 594 --
NM_004719chr1232842 760 725 --21837 1159 --
NM_004723chr1----21046 678 --
NM_004725chr102401 205 --11013 11449
NM_004726chrX55692 4917 1687 1590 1334 --1919 14974
NM_004727chr1542123 1924 1449 666 --1870 --
NM_004729chrX12179 12164 --160
NM_004730chr542166 1463 828 440 1365 11894 --
NM_004733chr32502 445 ------
NM_004734chr132538 313 ------
NM_004741chr101515 --2341 260 --
NM_004742chr3----11657 --
NM_004744chr413203 --13716 13844
NM_004745chr846942 6118 4675 2114 12091 65560 216 213 210 207 204 --
NM_004748chr1544259 3785 3766 2674 11393 --12688
NM_004759chr132147 425 38 --1396 12138
NM_004760chr742470 2018 2000 571 --12394 11952
NM_004772chr511215 --11218 --
NM_004774chr1723116 932 ------
NM_004775chr1812080 ------
NM_004776chr2063000 2838 2556 1309 963 836 --22965 769 --
NM_004779chr52374 349 1840 ----
NM_004781chr131229 281 27 --1576 --
NM_004781chr131229 281 27 --1576 --
NM_004788chr1142236 874 269 151 ------
NM_004792chr2179 ------
NM_004795chr1361847 1829 1747 1235 698 83 ------
NM_004796chr1452365 1892 1603 780 755 1257 12162 --
NM_004798chr2052650 2633 1465 382 164 ------
NM_004799chr1138 ------
NM_004834chr243398 2648 2522 237 ------
NM_004840chrX72294 2096 1895 1775 1765 1697 637 --1198 --
NM_004841chr131054 371 328 ------
NM_004842chr671600 1437 1260 1134 491 159 85 ------
NM_004845chrX33943 2998 1642 14007 13478 --
NM_004850chr221302 564 ------
NM_004859chr1742414 2327 676 293 1682 1849 --
NM_004863chr1435089 3847 1884 --13883 --
NM_004865chr6------1171
NM_004867chrX1449 1650 ----
NM_004871chr1742832 1756 1571 185 --13747 --
NM_004873chr1433055 984 938 ------
NM_004879chr11--1386 ----
NM_004884chr1531275 584 554 1375 1436 --
NM_004893chr53534 365 209 ------
NM_004898chr442731 2246 1119 519 --11967 --
NM_004904chr776446 6405 6269 5357 5122 452 151 15631 22306 1176 --
NM_004906chr6--1620 1126 --
NM_004926chr1421753 626 ------
NM_004947chr332607 2254 2136 ----1435
NM_004956chr761547 1116 1062 951 91 68 12901 3741 574 567 11393
NM_004965chr213561 523 192 ------
NM_004966chr10--1881 ----
NM_004973chr611489 11077 21590 1497 175
NM_004976chr1133612 3547 249 --13467 --
NM_004978chr131731 1683 515 --11367 --
NM_004985chr1244465 3576 3391 1077 ------
NM_004992chrX77619 6961 6363 2202 1183 280 54 12464 11945 --
NM_004992chrX77619 6961 6363 2202 1183 280 54 12464 11945 --
NM_004993chr1421275 546 ------
NM_004999chr623058 1073 --1682 11193
NM_005006chr22689 286 ------
NM_005010chr721534 587 21615 112 21713 478 --
NM_005032chrX1839 ----1293
NM_005034chr8------170
NM_005045chr7--1241 ----
NM_005054chr241388 1209 676 634 ------
NM_005058chrY1205 ------
NM_005063chr1033610 1433 396 --13386 --
NM_005065chr1445407 5091 3717 3665 14056 12117 --
NM_005066chr11756 ------
NM_005077chr91447 ------
NM_005078chr151388 1537 ----
NM_005095chr11621 1315 ----
NM_005096chrX11235 11220 11099 --
NM_005099chr1177 --11349 --
NM_005104chr61558 --2751 86 --
NM_005105chr1----3461 298 87 --
NM_005109chr332376 2142 593 ------
NM_005116chr2054536 508 233 148 58 33904 3285 2821 24159 1095 11064
NM_005119chr11263 --11196 --
NM_005121chr1713734 --13653 --
NM_005123chr12--1123 ----
NM_005124chr6----1750 --
NM_005126chr311709 ------
NM_005134chr183832 820 645 ----1623
NM_005135chr1532961 2541 854 1532 23838 3835 --
NM_005137chr2252535 2342 2100 438 373 147 1748 --
NM_005139chr41320 ------
NM_005151chr1872278 2163 1587 865 502 319 50 11972 1383 --
NM_005153chr162739 514 ------
NM_005156chr9105322 5187 4691 4630 4570 4176 3928 3307 1753 1632 15002 14452 24456 1970
NM_005168chr241675 1357 1347 1244 ------
NM_005171chr121368 --11315 --
NM_005180chr1021641 683 --21535 197 --
NM_005188chr11127623 7373 6918 6892 2880 2869 2478 2372 1300 1277 424 315 26196 2809 11899 18363
NM_005190chr61834 ------
NM_005194chr201441 --1445 --
NM_005197chr1465622 5282 4051 2464 2353 2153 --15203 --
NM_005201chr31123 --1857 --
NM_005219chr551792 1531 630 384 269 1242 1474 --
NM_005222chr71920 ------
NM_005224chr191555 --1613 --
NM_005225chr2011109 ----11246
NM_005233chr332437 2092 878 22535 1728 ----
NM_005235chr277634 7107 6651 6112 5551 5067 2205 15964 ----
NM_005238chr1173514 3092 3052 2828 2247 2196 1313 --22406 561 --
NM_005240chr1----2638 635 --
NM_005249chr142814 660 ------
NM_005252chr141583 ------
NM_005254chr1541136 379 362 255 ------
NM_005261chr8142 ------
NM_005276chr1241621 1168 666 498 ------
NM_005276chr1241621 1168 666 498 ------
NM_005277chr41687 11318 1152 --
NM_005284chr62458 170 ------
NM_005295chr7--1114 ----
NM_005311chr742168 1066 179 158 ------
NM_005313chr151242 ------
NM_005318chr221291 --11259 --
NM_005324chr172844 273 21797 1331 ----
NM_005336chr262159 2096 2041 887 754 103 ------
NM_005339chr443829 2933 381 333 13347 54013 3853 3470 3194 1671 11731
NM_005342chrX11770 --1287 --
NM_005358chr132724 53 182 1182 --
NM_005359chr1876115 5785 5364 4564 442 373 134 --12110 --
NM_005369chrX1106 1664 ----
NM_005374chr1731957 1878 814 ------
NM_005375chr62921 873 --1111 --
NM_005385chr342560 2055 2034 78 --11844 --
NM_005387chr111253 --1189 --
NM_005392chr911686 11438 ----
NM_005397chr731352 1165 414 1951 21394 982 --
NM_005398chr101427 1967 11150 --
NM_005399chr154414 4070 1676 520 371 --23474 1669 --
NM_005400chr232386 1057 819 ------
NM_005402chr71491 ----1113
NM_005406chr1811067 --1129 --
NM_005410chr5--1606 ----
NM_005415chr21310 ------
NM_005418chr112476 86 1178 ----
NM_005430chr121262 1729 ----
NM_005436chr1073966 3628 1565 1290 766 406 172 1142 11230 --
NM_005440chr1723184 571 ------
NM_005442chr32623 167 --2457 66 --
NM_005455chr121539 537 1586 ----
NM_005461chr2031677 716 392 ------
NM_005493chr61554 2674 651 ----
NM_005494chr71176 ----1223
NM_005497chr1745782 4050 283 112 21445 368 25347 4675 --
NM_005502chr932962 474 73 23262 1305 ----
NM_005506chr421164 91 1422 2273 270 --
NM_005507chr111406 ------
NM_005509chr511485 21210 220 ----
NM_005517chr121466 127 --1153 --
NM_005537chr134741 432 70 61 1789 ----
NM_005539chr1041326 1276 1094 261 ------
NM_005562chr161704 1670 1390 632 507 343 ------
NM_005563chr12239 154 1896 ----
NM_005573chr51193 ------
NM_005575chr5127 ----1647
NM_005576chr151208 --2219 216 --
NM_005578chr314685 --1348 14856
NM_005586chr61263 ----1646
NM_005587chr15--1924 ----
NM_005595chr11846 2292 170 ----
NM_005596chr955169 4689 4074 2395 1571 --1476 14285
NM_005599chr131367 976 536 --11104 --
NM_005610chr11609 --1649 --
NM_005637chr1812048 ------
NM_005639chr12--2326 275 ----
NM_005647chrX43135 2372 2303 370 13420 1631 --
NM_005650chr2211165 ------
NM_005655chr811001 --1330 11310
NM_005660chrX1246 ------
NM_005664chr152749 251 ------
NM_005668chr534464 3407 3334 13389 --13017
NM_005669chr511995 1140 ----
NM_005676chrX1160 ------
NM_005688chr341306 1237 1201 1155 --11163 1429
NM_005717chr121063 44 --11251 --
NM_005724chr152708 71 ------
NM_005725chr11263 1825 1115 --
NM_005734chr112751 507 ------
NM_005735chr21252 --1789 --
NM_005736chr1031024 502 355 ------
NM_005737chr232937 752 323 12872 ----
NM_005738chr741937 1858 1671 126 --1774 --
NM_005739chr1512292 ----12258
NM_005742chr22803 690 ----1204
NM_005746chr732305 104 24 ----1702
NM_005754chr51797 ------
NM_005756chrX21232 1104 ----1396
NM_005759chr284773 4406 3312 3136 2921 1151 888 732 23989 1076 ----
NM_005765chrX1587 ------
NM_005778chr3199 1342 1382 --
NM_005779chr532486 1100 572 1968 12877 --
NM_005786chr18197 ------
NM_005789chr1731768 1552 1414 ------
NM_005795chr222093 627 22695 2292 22470 2233 --
NM_005796chr161149 ------
NM_005798chr1374306 3602 3563 3525 1455 1313 256 15273 ----
NM_005808chr333240 2863 996 --1864 --
NM_005819chr12858 302 --1338 2798 477
NM_005822chr62324 61 --21702 1463 --
NM_005828chr1754897 4498 1029 361 191 --11807 --
NM_005829chr1551918 1613 1222 655 455 --11226 1772
NM_005832chr31903 --11075 --
NM_005839chr1------1102
NM_005840chrX117218 5393 5270 2768 2231 2083 2043 1741 1597 701 378 16596 15347 --
NM_005841chr4----1767 --
NM_005859chr53631 425 214 11537 ----
NM_005862chr3--2737 396 1882 --
NM_005866chr92900 68 1124 ----
NM_005869chr52118 30 ------
NM_005871chr103948 245 219 ------
NM_005873chr202151 66 --169 --
NM_005875chr3----1298 1302
NM_005876chr21773 ------
NM_005880chr1611220 ----11135
NM_005885chr53331 192 162 1599 ----
NM_005888chr122296 37 ------
NM_005898chr1112164 ----1875
NM_005901chr18148475 8097 8074 7977 7651 6772 6229 5596 3350 2872 2590 2346 1834 347 11236 35543 5540 2293 12240
NM_005902chr1544360 3148 1495 1113 13158 191 --
NM_005903chr554624 3521 3425 3229 792 45093 3606 543 207 15075 --
NM_005904chr183206 126 59 ------
NM_005905chr132467 335 ------
NM_005906chr61453 --1395 1358
NM_005910chr1752663 1487 1165 717 409 --13365 14127
NM_005911chr2131 ------
NM_005920chr123324 1449 13777 21352 1349 23875 1356
NM_005922chr61381 --2421 418 --
NM_005924chr7143 ------
NM_005933chr1122283 2220 12691 ----
NM_005935chr411012 --15238 1602
NM_005941chr841569 208 146 78 --13700 --
NM_005944chr3--1215 ----
NM_005955chr1125147 4983 4464 3917 3806 3615 1881 1758 868 699 691 548 --1270 --
NM_005962chr1032173 2005 1547 ------
NM_005962chr1032173 2005 1547 ------
NM_005966chr211730 --1403 --
NM_005968chr192218 75 ------
NM_006007chr924033 1236 11774 ----
NM_006011chr1544329 1182 1006 391 ------
NM_006015chr12309 116 11024 11051 1485
NM_006016chr632220 313 249 22240 1799 ----
NM_006035chr142223 84 ------
NM_006036chr222434 826 1648 11603 --
NM_006040chr1641415 429 148 92 ------
NM_006047chr2053455 3306 819 622 572 --143 2545 187
NM_006060chr743554 757 450 112 23586 2730 13703 --
NM_006070chr32156 130 ------
NM_006080chr722072 1822 12975 ----
NM_006089chrX11292 21846 598 --11666
NM_006090chr12528 203 1111 ----
NM_006094chr832001 474 173 11620 ----
NM_006095chr434139 3568 782 14300 1732 13757
NM_006099chr1154 1860 ----
NM_006106chr1153210 2203 716 183 166 12549 12990 12913
NM_006116chr2221582 385 1557 ----
NM_006122chr1542534 817 156 149 ------
NM_006133chr111810 1516 --12411
NM_006134chr21--11391 11570 --
NM_006136chr721328 1147 ------
NM_006139chr222774 552 ------
NM_006141chr161769 12618 1841 --
NM_006153chr3126 1623 2238 100 --
NM_006157chr112431 393 ------
NM_006158chr83711 219 156 --1446 --
NM_006166chr1252452 1825 1051 1013 248 11694 --1505
NM_006180chr922146 1577 1502 --1431
NM_006183chr121200 ------
NM_006186chr21367 2926 484 2978 309 --
NM_006190chr231035 253 74 ------
NM_006191chr123929 881 27 ------
NM_006194chr1421121 395 11165 11218 11236
NM_006195chr91242 11116 ----
NM_006197chr822055 476 ----11534
NM_006198chr21--1256 ----
NM_006203chr533501 1041 116 --11139 --
NM_006206chr442259 1947 874 474 --12284 --
NM_006212chr155431 4050 2021 1967 1670 14863 53680 3677 3555 3283 1624 --
NM_006216chr2----7615 546 543 540 537 534 531 --
NM_006226chr211334 --1422 --
NM_006237chr13--11827 1175 --
NM_006239chr41167 ------
NM_006241chr31924 --11590 --
NM_006246chr141973 ------
NM_006251chr543274 3157 2342 2098 13047 22612 196 --
NM_006252chr197280 6791 6285 5421 2873 2722 2351 1825 409 36855 2415 1396 1356 16983
NM_006256chr11959 21000 905 3112 109 106 --
NM_006257chr1041008 984 921 365 ------
NM_006258chr103353 271 31 ------
NM_006265chr811481 ------
NM_006267chr231863 1324 141 11509 ----
NM_006281chr83907 311 181 ------
NM_006281chr83907 311 181 ------
NM_006282chr2021818 1789 --14709 --
NM_006283chr8104846 4281 3685 3621 1958 1827 1717 1229 736 153 --14678 --
NM_006300chr1932304 1914 171 ------
NM_006313chr1221214 271 ------
NM_006321chr331655 677 249 11799 1680 --
NM_006323chr42623 208 ------
NM_006330chr82540 392 21625 1369 ----
NM_006333chr21503 1682 ----
NM_006343chr21137 150 ----
NM_006352chr122031 1665 --11550 --
NM_006353chr621372 113 --1139 --
NM_006359chrX102283 2177 1996 962 886 629 510 453 439 248 11597 1593 --
NM_006364chr14----1812 --
NM_006373chr1731038 321 282 ------
NM_006375chrX21596 405 2312 212 ----
NM_006377chr921112 445 --11233 --
NM_006380chr1743813 3474 3300 75 --33617 1349 271 --
NM_006386chr2262326 2122 1817 844 691 568 ------
NM_006393chr1044295 3518 1403 1348 --14217 12877
NM_006400chr12--1373 ----
NM_006403chr611653 --2383 380 --
NM_006420chr2022130 453 --22921 2825 --
NM_006421chr8122 --1915 --
NM_006434chr1032044 610 138 --42105 2102 2099 2096 13248
NM_006439chr42550 406 ------
NM_006454chr473069 2820 2320 1219 1202 314 103 ------
NM_006457chr434044 3331 2753 13058 --14154
NM_006459chr1021699 1477 --11716 --
NM_006464chr244672 3886 1335 987 --24590 3053 --
NM_006465chr1512291 21462 167 ----
NM_006466chr2021078 126 ------
NM_006469chr121159 1091 1149 ----
NM_006471chr18135 1104 ----
NM_006472chr13977 224 205 ------
NM_006476chr11150 ------
NM_006482chr1233778 2659 46 23516 2841 13908 13058
NM_006496chr131990 1690 1343 --164 --
NM_006504chr1032877 2480 618 1305 1757 --
NM_006520chrX11738 --11642 --
NM_006526chr2012107 --21743 588 --
NM_006532chr1921527 835 11890 71759 1750 1747 1744 1741 1610 1530 --
NM_006534chr2053413 2729 2595 1079 212 ------
NM_006537chr153609 578 211 --2174 171 --
NM_006538chr223483 3210 24149 2845 1208 --
NM_006546chr1765182 4786 4100 2199 1735 1619 --16661 --
NM_006548chr311249 ------
NM_006549chr1232517 2292 419 --21076 149 --
NM_006557chr921134 537 --1369 --
NM_006558chr81143 ------
NM_006559chr1----1261 --
NM_006561chr10116114 5676 5466 4481 4050 3978 1361 1258 838 681 258 25892 3972 55910 5875 5869 3802 2158 --
NM_006565chr16--11273 2868 181 --
NM_006572chr1732812 694 438 --42816 1151 1148 969 2942 202
NM_006574chr33269 249 226 ------
NM_006575chr1421197 490 ------
NM_006577chr221057 58 ------
NM_006593chr2------1223
NM_006595chr111779 --1346 --
NM_006599chr1657284 2285 1570 1057 167 15849 23127 2410 --
NM_006601chr1221121 1088 1107 --11005
NM_006603chrX31810 1639 746 11909 ----
NM_006609chr223002 2574 ------
NM_006614chr321184 571 ------
NM_006621chr11692 ------
NM_006624chr1041608 1467 442 245 --11612 --
NM_006625chr11467 ------
NM_006625chr11467 ------
NM_006625chr11467 ------
NM_006626chr932349 2081 937 ----12316
NM_006646chr1342252 1975 1218 1146 12968 31900 1897 335 --
NM_006650chr543809 3799 3535 1519 ------
NM_006654chr1294783 4633 4025 1352 1290 1193 884 792 21 --2958 605 14110
NM_006675chr1233320 968 920 --22150 1179 --
NM_006677chr3123 --168 --
NM_006681chr42163 119 1147 ----
NM_006691chr1131031 896 870 ------
NM_006699chr12859 825 ------
NM_006706chr51791 --1584 --
NM_006711chr163518 185 170 --1797 --
NM_006713chr51256 ------
NM_006717chr921243 1050 ------
NM_006720chr1075024 4769 4235 1248 1007 968 315 --13456 --
NM_006722chr332965 2311 699 --12547 --
NM_006724chr61381 --2421 418 --
NM_006726chr441213 1060 810 803 2862 408 ----
NM_006729chrX35573 5228 4149 14679 14735 --
NM_006734chr621071 527 11390 ----
NM_006738chr1531224 978 62 14488 13395 --
NM_006745chr4------11082
NM_006751chr21344 1385 ----
NM_006754chr72786 132 --11205 11143
NM_006756chr821039 1011 --11540 11335
NM_006758chr21--141 ----
NM_006763chr121552 1388 --11335 --
NM_006766chr831726 1067 397 --1701 22365 107
NM_006772chr611216 11468 ----
NM_006775chr622219 530 --23037 171 1866
NM_006777chrX52377 2122 2112 1118 138 ------
NM_006788chr1841942 1313 794 404 --11463 --
NM_006791chr153511 478 205 1245 ----
NM_006800chrX1129 --1601 --
NM_006802chr11388 ------
NM_006803chr821585 353 11284 1733 --
NM_006805chr51348 --11470 1404
NM_006807chr1721021 246 ------
NM_006810chr3----156 --
NM_006813chr6193 ------
NM_006815chr1221092 429 ------
NM_006823chr831287 1119 477 11004 ----
NM_006827chr1462514 2318 2176 1175 1073 945 1860 ----
NM_006838chr1251477 1269 1251 84 47 ------
NM_006852chr1712783 ------
NM_006854chr721717 113 1245 ----
NM_006873chr243226 937 669 378 ------
NM_006874chr41892 ----21066 828
NM_006884chr321908 1366 ------
NM_006885chr1643802 2861 982 867 12641 14171 --
NM_006888chr1422975 2159 --23242 806 --
NM_006892chr2011167 1546 ----
NM_006892chr2011167 1546 ----
NM_006896chr721088 1021 ------
NM_006908chr7----1344 --
NM_006910chr162353 127 ------
NM_006915chrX42578 2492 1745 138 ------
NM_006918chr11105830 5783 4545 3788 3681 1977 1747 934 226 182 11038 15749 --
NM_006920chr21680 ----1806
NM_006922chr2----22056 208 --
NM_006924chr1744456 4006 1395 788 24342 37 24150 3889 --
NM_006925chr141176 ------
NM_006931chr1241516 1318 732 161 ------
NM_006936chr2171260 1250 1199 1122 906 888 809 --31292 477 43 11226
NM_006937chr17----1583 --
NM_006940chr12----31605 403 21 --
NM_006946chr112560 188 ------
NM_006947chr411220 1256 ----
NM_006951chr101774 ------
NM_006965chr18--11225 11127 --
NM_006981chr932491 1864 626 ------
NM_006997chr102403 62 ------
NM_007005chr921262 1151 --41163 1157 1154 514 --
NM_007006chr1663336 2995 2786 1105 1047 708 12245 ----
NM_007007chr1231720 1540 724 23890 413 34624 1791 950 --
NM_007008chr23815 296 149 ------
NM_007010chr1761731 771 657 640 497 222 ------
NM_007017chr52678 357 ----1898
NM_007035chr121621 ------
NM_007038chr2144551 3914 3682 556 --44657 1758 1532 1353 --
NM_007039chr1411700 12200 ----
NM_007050chr2067889 7181 6921 2431 1512 42 12866 --15105
NM_007067chr1741305 1183 338 188 ------
NM_007078chr1022501 1943 --11226 --
NM_007084chr131368 ------
NM_007106chr1341907 1763 305 214 12847 11766 --
NM_007107chr332142 1947 175 22388 254 ----
NM_007111chr135588 363 313 304 179 ------
NM_007118chr51857 1901 --1229
NM_007124chr62684 415 ------
NM_007125chrY21203 1115 --11041 --
NM_007126chr91422 1524 ----
NM_007137chrX135305 4723 4596 4236 3962 3715 3668 3494 1848 1587 985 900 246 24281 3359 --23514 1175
NM_007158chr12789 338 ------
NM_007166chr1131474 1269 85 ------
NM_007174chr1241883 1799 944 817 1488 22404 2265 --
NM_007187chr131377 ------
NM_007197chr1221049 153 ------
NM_007200chr1531224 978 62 14488 13395 --
NM_007203chr953437 2944 1397 1154 312 ------
NM_007212chr142208 1710 794 103 ------
NM_007214chr631278 932 466 --153 --
NM_007216chr112320 263 ------
NM_007225chr1731002 757 679 ------
NM_007236chr1521860 116 ------
NM_007238chr2074815 4424 3484 983 430 370 127 13532 13157 --
NM_007249chr1389051 8391 8046 7774 7165 6357 1152 260 --68112 7213 1694 1691 1682 1159 --
NM_007260chr11490 --1767 --
NM_007269chr11187 --170 --
NM_007270chr721513 408 ------
NM_007274chr12218 116 ------
NM_007275chr311170 ------
NM_007279chr19----1418 1638
NM_007292chr1745042 4201 4134 560 1738 14991 --
NM_007294chr1741342 1203 1168 330 ----11029
NM_007295chr1741342 1203 1168 330 ----11029
NM_007296chr1741342 1203 1168 330 ----11029
NM_007297chr1741342 1203 1168 330 ----11029
NM_007298chr1741342 1203 1168 330 ----11029
NM_007299chr1741342 1203 1168 330 ----11029
NM_007300chr1741342 1203 1168 330 ----11029
NM_007302chr1741342 1203 1168 330 ----11029
NM_007303chr1741342 1203 1168 330 ----11029
NM_007304chr1741342 1203 1168 330 ----11029
NM_007305chr1741342 1203 1168 330 ----11029
NM_007317chr16_random151 ------
NM_007324chr1138 ------
NM_007345chr1811877 --31470 1467 1464 --
NM_007347chr1532656 2261 1101 --13107 --
NM_007373chr1091790 1582 1479 1366 1132 615 357 228 203 21720 1126 ----
NM_007375chr121103 239 32156 1113 593 12223 --
NM_012064chr121868 --1159 --
NM_012069chrX32266 1854 260 --12544 --
NM_012081chr513631 --21499 920 --
NM_012082chr83996 954 47 --1708 --
NM_012089chr121118 306 --11129 --
NM_012090chr111061 11267 11086 --
NM_012096chr31402 12888 --1125
NM_012104chr1123760 722 12590 ----
NM_012104chr1123760 722 12590 ----
NM_012110chr4138 ------
NM_012115chr6----1626 --
NM_012120chr662702 2534 1929 571 549 96 22858 2778 199 22642 881
NM_012129chr7--1331 12310 12472
NM_012137chr132387 685 73 ------
NM_012141chr1374071 3806 1228 1017 720 101 68 ------
NM_012153chr1142587 2581 2095 453 1244 ----
NM_012156chr2023319 2742 13393 22638 699 --
NM_012158chr13----11664 167
NM_012164chr975074 1943 1848 1799 1323 663 432 16429 14701 --
NM_012183chr1--1600 ----
NM_012193chr1175047 3495 2007 1054 722 542 183 --24546 3909 --
NM_012197chr941607 1458 1393 50 ------
NM_012199chr154286 4153 3543 2986 1601 ------
NM_012207chr101181 ------
NM_012214chr296309 6271 4643 4594 2570 2338 1852 1788 936 --25707 4130 --
NM_012218chr1921186 1132 --1127 --
NM_012234chr363351 3174 2616 1288 341 291 --1895 --
NM_012249chr233057 2315 1379 1287 ----
NM_012250chr1121048 77 1560 ----
NM_012252chr734948 989 117 ------
NM_012262chr165199 4701 4095 3750 1339 84 31318 959 532 13781 25130 3821
NM_012264chr22----11804 12046
NM_012264chr22----11804 12046
NM_012281chr721824 523 1765 1790 2794 754
NM_012286chrX2499 467 ------
NM_012293chr242002 1605 136 34 ------
NM_012294chr773950 3853 3723 1553 871 278 96 ------
NM_012296chr1143626 3616 3529 670 13809 13886 --
NM_012297chr422400 927 --2961 600 12521
NM_012300chr51808 11901 32046 957 954 1518
NM_012304chr521645 963 12554 32518 2515 2512 --
NM_012307chr18----1688 --
NM_012308chr1132290 536 251 --12053 --
NM_012309chr1113065 24786 4534 24047 3299 --
NM_012319chr18--179 1134 --
NM_012320chr1641399 249 150 45 ------
NM_012325chr2041570 1434 1095 522 1385 ----
NM_012328chr7----11062 11281
NM_012329chr1751577 1491 1261 1244 1227 21687 554 ----
NM_012330chr1031790 506 118 --1294 --
NM_012333chr121304 659 --11113 --
NM_012334chr524642 1353 23552 851 14681 1784
NM_012347chr632134 287 172 --22318 1133 --
NM_012395chr723409 2609 ------
NM_012399chr2221497 1401 11705 ----
NM_012405chr143092 2499 1407 773 ------
NM_012412chr71656 ------
NM_012416chr93481 276 59 --21260 1254 --
NM_012419chr61584 ------
NM_012420chr1021981 515 ------
NM_012432chr1168 ------
NM_012464chr462807 2699 1848 945 938 431 --1908 22839 926
NM_012482chr12617 599 ------
NM_012484chr5--194 259 44 --
NM_013229chr1231967 1074 609 --1103 22675 261
NM_013230chrY1548 11711 1560 --
NM_013231chr1444393 3466 2783 252 1774 22818 345 --
NM_013233chr2--1466 1408 --
NM_013237chr52373 105 ------
NM_013238chr1311912 ------
NM_013242chr161381 1109 ----
NM_013253chr111146 ------
NM_013255chr778629 7591 6029 5384 5357 1219 401 38835 7646 1282 1407 --
NM_013261chr412792 12630 23701 2539 --
NM_013269chr1263884 3432 1510 1482 974 689 ------
NM_013280chr111224 ------
NM_013281chr2031405 1224 322 --1348 --
NM_013283chr51862 1296 ----
NM_013286chr322642 247 ------
NM_013293chr7--1531 4587 584 198 155 --
NM_013302chr1623816 2945 1115 21829 1826 --
NM_013309chr1532058 1994 440 ------
NM_013316chr71201 ------
NM_013322chr731189 408 163 ------
NM_013333chr19168 ------
NM_013372chr1512861 --23272 2147 --
NM_013374chr323069 190 12184 ----
NM_013381chr121406 1720 --1276
NM_013396chr2131348 1004 82 11412 ----
NM_013410chr1168 21149 939 1318 --
NM_013433chr1942040 1986 727 571 ------
NM_013436chr22597 39 1682 ----
NM_013437chr831357 1302 1017 ----21059 1038
NM_013438chr92671 104 1439 ----
NM_013444chrX2412 310 ------
NM_013446chr751394 1285 1243 179 115 --11050 --
NM_013449chr1222870 2661 ------
NM_013450chr221204 1120 ------
NM_013943chr133290 2854 2671 ------
NM_013958chr8132 ------
NM_013959chr8132 ------
NM_013960chr8------1673
NM_013961chr8132 ------
NM_013962chr8132 ------
NM_013995chrX42236 1613 895 502 ------
NM_013996chr71513 ------
NM_013996chr71513 ------
NM_013997chr71513 ------
NM_013997chr71513 ------
NM_013998chr71513 ------
NM_013998chr71513 ------
NM_014000chr103543 480 86 --21697 444 --
NM_014011chr252113 1995 912 894 145 --1782 --
NM_014016chr321267 1219 11514 ----
NM_014021chr122840 1162 23007 2855 11165 --
NM_014023chr1082554 2265 1830 1815 1780 494 402 280 --12255 --
NM_014035chr521364 1033 11136 ----
NM_014048chr1695078 5010 4819 4384 3248 1975 921 112 95 24529 592 15117 --
NM_014071chr20--1401 --1441
NM_014089chr1332209 1836 310 ------
NM_014109chr811182 --11025 --
NM_014112chr884154 3866 3680 3364 2180 1963 1288 430 34021 2144 995 ----
NM_014117chr1622674 379 ------
NM_014155chr11116540 6449 6098 5879 5839 5399 4599 2397 2262 1174 728 34909 705 691 11017 --
NM_014157chr1613398 1949 --21033 857
NM_014181chr232896 791 513 1730 ----
NM_014184chr1------1138
NM_014191chr121971 ------
NM_014210chr172475 80 ------
NM_014217chr13601 195 70 11528 11374 --
NM_014231chr1231380 841 25 ------
NM_014233chr1731834 1449 671 11960 1865 --
NM_014240chr344178 3110 2932 51 ------
NM_014243chr442121 1840 677 473 ----12129
NM_014248chr22162 --1123 --
NM_014253chrX12064 --1585 --
NM_014263chr1031397 1135 27 ------
NM_014264chr42607 48 ------
NM_014278chr42357 177 ------
NM_014279chr9------1686
NM_014283chr121483 1326 --31197 42 39 --
NM_014299chr1921936 1847 --11363 --
NM_014309chr2265367 4969 2060 1841 1367 974 --12064 12083
NM_014319chr1221245 379 ------
NM_014325chr1231989 1764 262 ------
NM_014331chr456866 5658 2192 1316 588 ------
NM_014333chr1172508 2138 1056 626 585 318 188 --2703 145 --
NM_014342chr1121465 924 ------
NM_014345chr61857 1409 1403 --
NM_014351chr2221219 85 11247 ----
NM_014363chr1311260 2515 42 1855 2502 61
NM_014376chr522398 673 11676 ----
NM_014392chr441265 1193 363 156 1274 ----
NM_014393chr821580 206 --1697 --
NM_014397chr941381 1354 915 232 1477 ----
NM_014399chr72375 179 ------
NM_014415chr331716 1636 1086 1612 ----
NM_014417chr191330 1883 ----
NM_014421chr42542 355 ------
NM_014423chr555289 4751 3646 868 134 --34761 4344 137 --
NM_014426chr20--1701 ----
NM_014431chr1041649 1167 466 271 ------
NM_014452chr62852 255 --185 --
NM_014454chr62747 257 ----1831
NM_014472chr10--1705 ----
NM_014482chr21103 ----1135
NM_014494chr1622163 1880 1607 ----
NM_014502chr111319 ------
NM_014504chr71478 --1719 --
NM_014521chr241274 492 366 65 ------
NM_014552chr221424 955 --1943 --
NM_014554chr1232119 1767 208 1103 2368 53 --
NM_014572chr1331698 1644 334 ------
NM_014574chr1431243 985 404 ------
NM_014584chr1431677 1138 444 11604 11220 --
NM_014585chr2--21241 827 ----
NM_014592chr5------1775
NM_014601chr1931500 1329 28 ------
NM_014612chr921471 1094 11074 11098 --
NM_014613chr522483 2271 --1750 --
NM_014615chr1633584 3523 2889 --1922 13621
NM_014616chr363270 3244 2696 1387 526 296 ------
NM_014618chr93330 143 34 1278 --138
NM_014620chr122543 235 ------
NM_014629chr851340 1008 954 895 23 1290 ----
NM_014630chr1543491 740 363 307 ----23187 2998
NM_014635chr241356 1172 640 598 ------
NM_014636chr923912 1166 1488 22689 770 14296
NM_014647chr1632254 1884 1845 --22240 1925 --
NM_014655chr13723 164 27 --11968 --
NM_014660chr721076 311 ------
NM_014665chr853222 3153 2772 603 65 --23225 3156 --
NM_014667chr31138 --31928 606 603 --
NM_014670chr221222 156 --11499 --
NM_014671chr731145 1074 326 ------
NM_014676chr11233 21103 308 ----
NM_014677chr8199 --121 --
NM_014682chr821822 446 12323 ----
NM_014683chr1721641 389 --11537 --
NM_014686chr1972349 1897 1880 1868 1840 776 349 ------
NM_014701chr1533340 3096 664 1482 12665 --
NM_014705chr772122 1940 1527 1404 1332 596 167 1348 1585 --
NM_014706chr122782 495 ------
NM_014707chr711558 12237 11572 --
NM_014710chrX2317 196 ------
NM_014717chr191678 1785 ----
NM_014718chr121693 ------
NM_014720chr1031322 1186 479 --11289 --
NM_014721chr696356 5863 5588 1797 1083 720 610 370 215 24849 2677 27029 6834 25078 2721
NM_014729chr812206 --21525 262 --
NM_014730chr1254779 3755 1813 1000 914 ------
NM_014730chr1254779 3755 1813 1000 914 ------
NM_014732chr1645667 4527 3657 829 --15827 --
NM_014735chrX2818 618 --12023 --
NM_014736chr15197 1299 --1324
NM_014741chr1131723 767 380 ------
NM_014743chr431967 1080 239 --12412 --
NM_014746chr284269 2888 2855 1117 900 707 362 260 12752 1774 1649
NM_014747chr164574 3825 3676 992 310 286 13843 15685 --
NM_014752chr112371 40 ------
NM_014755chr221645 606 --13746 --
NM_014764chr121111 ------
NM_014767chr1023037 1073 --1326 --
NM_014772chr1832456 1339 457 ------
NM_014774chr142978 2885 2403 539 --33115 2855 2068 --
NM_014779chr3----1937 --
NM_014781chr821152 948 ------
NM_014784chr121083 723 ------
NM_014787chr1--12670 22132 1782 1826
NM_014791chr91247 ------
NM_014802chr121874 ------
NM_014810chr122992 908 ------
NM_014812chr141476 643 582 323 ------
NM_014820chr342004 301 156 122 1422 ----
NM_014824chr1111245 --21558 191 11814
NM_014827chr111319 31460 1280 1153 --21207 357
NM_014828chr142840 305 ----1185
NM_014829chr51110 1801 158 --
NM_014830chr1253737 2795 2565 174 125 ----13810
NM_014832chr1322112 1738 --1207 --
NM_014835chr2042088 784 627 187 ------
NM_014836chr1031921 694 373 1365 21997 499 --
NM_014840chr1243022 2983 556 86 --1822 --
NM_014841chr62539 319 --11085 11002
NM_014847chr1--1180 ----
NM_014849chr1--11290 ----
NM_014850chr354749 4472 4431 4246 3914 11015 14378 --
NM_014858chr141177 1059 1029 751 ------
NM_014862chr1534106 3322 620 128 21355 603 --
NM_014868chr121851 2371 80 ----
NM_014870chr114088 14221 13954 --
NM_014871chr121171 ----1622
NM_014873chr134658 2954 1564 24687 4638 23660 1788 --
NM_014874chr141819 1521 1481 184 --11801 --
NM_014876chr2241857 606 514 57 --32211 579 576 --
NM_014877chr1756572 2426 802 591 138 --16578 1595
NM_014883chr442194 2076 1567 506 --32468 878 444 --
NM_014901chr532270 760 545 12154 ----
NM_014902chr2041579 1405 1356 254 ------
NM_014903chr1232031 815 478 ------
NM_014905chr2--1358 12003 --
NM_014906chr1733353 2489 1278 ------
NM_014909chr1443975 3933 944 646 13856 12620 --
NM_014912chr1053470 2872 886 693 366 --32945 358 355 --
NM_014913chr1831466 1431 74 11446 ----
NM_014917chr11969 ------
NM_014918chr1531172 370 193 ------
NM_014920chr642518 1135 588 522 13299 ----
NM_014921chr1943088 2314 2004 1928 ----1899
NM_014923chr131441 11573 ----
NM_014932chr331345 566 474 --11802 --
NM_014934chr1343823 3678 1062 399 13717 ----
NM_014938chr1221948 916 --1213 --
NM_014939chr184361 299 141 46 ------
NM_014942chr642669 2319 1979 426 ------
NM_014945chr521824 192 --11990 --
NM_014946chr232560 882 440 22627 802 2608 197 --
NM_014947chr173105 2968 2052 1917 734 327 238 13073 ----
NM_014949chr1--11031 ----
NM_014950chr14------21224 196
NM_014952chr1531750 818 110 ------
NM_014961chr41132 ------
NM_014969chr12262 206 11147 ----
NM_014974chr1021734 240 --21832 1104 --
NM_014978chr1031837 1564 702 11447 ----
NM_014982chr1443847 2030 1628 1238 --13654 --
NM_014988chr41968 --11779 --
NM_014989chr63453 447 87 ------
NM_014991chr442945 2391 841 795 ----11087
NM_014992chr141190 ------
NM_014996chr3--1739 --1223
NM_014997chr762939 2232 1999 1156 1119 573 --1731 --
NM_014999chr121674 --11087 --
NM_015000chr1243024 2715 2203 316 11157 ----
NM_015002chr1221896 29 ------
NM_015008chr333594 2641 2596 --13416 22631 1000
NM_015015chr1911785 --3530 527 72 --
NM_015017chr131292 1072 275 ------
NM_015018chr61187 ------
NM_015020chr1653233 3200 2491 703 372 ------
NM_015023chr121805 167 ------
NM_015024chr831446 1256 947 ------
NM_015025chr232596 2055 428 162 12640 --
NM_015026chr122772 112 13579 11184 --
NM_015027chr1641990 1349 597 103 --2430 210 --
NM_015032chr1342656 2606 1121 495 12172 ----
NM_015039chr134331 1265 114 --23595 1613 --
NM_015040chr263173 2988 2964 2382 2276 577 ------
NM_015042chr1513620 --23378 3178 14345
NM_015044chr1652444 2199 1188 589 440 --22759 55 --
NM_015045chr1051458 491 377 357 342 --1548 --
NM_015046chr962685 2648 2493 2309 632 109 1293 ----
NM_015049chr232865 2393 334 22871 934 12440 --
NM_015059chr152329 305 --12656 --
NM_015061chr92621 91 ------
NM_015068chr722469 1598 --43972 3382 2674 367 13924
NM_015071chr576206 5258 4530 1894 1778 1370 1173 16324 12146 --
NM_015074chr194519 4512 4325 4167 3723 3570 2002 1659 406 ----14905
NM_015076chr623655 1803 23982 326 11181 --
NM_015090chr195705 5527 4841 2479 2457 1293 1095 708 636 15429 ----
NM_015091chr141306 ------
NM_015092chr1673998 3776 1509 1423 1097 763 483 --24172 2941 --
NM_015094chr2233348 1715 312 --1586 14181
NM_015097chr322332 1592 --1800 --
NM_015107chrX32406 2378 1995 11782 11985 --
NM_015110chr912517 ------
NM_015115chr422615 891 12933 3264 164 70 --
NM_015130chr431305 1203 204 --1309 --
NM_015132chr721613 86 ------
NM_015137chr842384 2110 2040 2025 12203 3790 408 405 12311
NM_015138chr1521029 348 1777 --1156
NM_015144chr1633482 3360 2593 --183 --
NM_015149chr121938 1429 ------
NM_015153chr6--151 --1243
NM_015155chr1032704 790 751 ------
NM_015156chr1434016 3601 975 33844 3830 3777 101599 1596 1593 1590 1587 1446 1443 1440 1437 1434 --
NM_015161chr1611333 21296 64 11356 --
NM_015172chr121471 1367 1170 ----
NM_015176chr111761 ------
NM_015178chr831851 346 33 ------
NM_015184chr32452 211 ------
NM_015185chrX42899 2697 669 213 23004 2600 ----
NM_015192chr202741 571 ------
NM_015198chr73483 262 184 ------
NM_015199chr332650 2468 2142 1626 11072 --
NM_015206chr1543550 3276 462 90 11271 43331 3328 3325 2365 --
NM_015208chr1823016 1317 11244 ----
NM_015209chr12423 278 ------
NM_015215chr11440 13187 11986 --
NM_015236chr45336 310 299 108 47 11080 --21484 602
NM_015238chr52163 120 ------
NM_015239chr92378 361 ------
NM_015247chr1675371 3983 3536 3355 1170 1145 602 11111 ----
NM_015252chr23810 782 77 --2383 380 --
NM_015263chr152962 343 ------
NM_015265chr232165 2113 173 --11014 --
NM_015267chr122415 378 22054 731 --1146
NM_015271chr423810 2952 ------
NM_015272chr1611528 --11756 11953
NM_015277chr1831563 1544 263 ------
NM_015278chr622559 2171 12190 23261 2775 --
NM_015285chr1821750 298 ------
NM_015288chr562387 1531 1066 648 275 167 11056 12663 --
NM_015291chr163453 3042 2858 1068 592 428 ------
NM_015294chr1721110 1102 11054 --155
NM_015296chr1321255 921 11212 ----
NM_015310chr858161 6109 2899 2455 1554 11629 68299 5762 5759 5170 2513 564 15174
NM_015313chr112585 34 --54166 3002 2999 2996 2993 14507
NM_015314chr721042 659 --1382 --
NM_015315chr531175 1124 555 --11195 --
NM_015317chr221803 237 11153 11756 1713
NM_015326chr132827 1992 1901 --11905 --
NM_015327chr131316 277 188 ------
NM_015328chr762866 2801 2145 2004 708 579 --1851 12076
NM_015330chr2242586 2071 1838 1807 --11811 --
NM_015336chr1232081 531 30 --12476 --
NM_015339chr201866 1978 --11046
NM_015344chr852079 1597 603 171 47 ------
NM_015347chr1222706 585 --1602 --
NM_015349chr652648 2274 971 576 521 11065 1513 --
NM_015353chr1722795 936 --1608 --
NM_015355chr171657 11234 ----
NM_015359chr832983 2391 617 1164 22401 1880 --
NM_015375chr145003 4697 501 120 15030 ----
NM_015379chr7159 ------
NM_015382chr141748 ------
NM_015385chr1032044 610 138 --42105 2102 2099 2096 13248
NM_015393chr433180 3053 116 --23164 644 13813
NM_015396chr3------1482
NM_015397chr91255 ------
NM_015409chr1232651 2320 978 12635 ----
NM_015428chr1941688 1646 1250 1146 11534 11070 --
NM_015429chr321027 156 1295 ----
NM_015431chr133615 1217 118 12854 1122 --
NM_015444chr3--189 --1427
NM_015446chr111305 11045 ----
NM_015455chr522915 2699 --74057 1274 1271 1268 1265 1262 1259 --
NM_015458chr814975 24994 4798 73706 3703 3700 3697 3694 3691 3688 11626
NM_015460chr351839 1554 1547 1453 1428 --11735 --
NM_015464chr72406 86 1799 11012 --
NM_015470chr261109 1088 1038 872 841 46 ------
NM_015475chr221019 941 ------
NM_015483chr71925 ------
NM_015497chr153855 734 285 ------
NM_015503chr161468 --3690 687 684 --
NM_015508chr341412 1406 1299 1114 ------
NM_015509chr1241548 1185 548 174 11643 ----
NM_015515chr17--127 ----
NM_015527chr163610 273 106 1837 ----
NM_015530chr22639 251 ------
NM_015532chr152641 89 --1855 --
NM_015534chr1----11013 --
NM_015535chr233132 1374 1078 1310 --13657
NM_015541chr321305 497 --1336 --
NM_015542chr102860 45 11271 ----
NM_015549chr14----1564 --
NM_015554chr152668 540 2432 37 11971 1560
NM_015559chr183810 733 360 1788 ----
NM_015560chr332758 1111 88 1731 2682 302 1217
NM_015565chr2122099 364 1887 ----
NM_015567chr1331276 272 88 ------
NM_015569chr144145 3759 3638 434 1222 ----
NM_015570chr711613 --11735 --
NM_015571chr622310 2233 12218 12358 --
NM_015575chr272681 2582 1404 1391 1357 290 179 ----11009
NM_015576chr34987 639 337 302 --12933 --
NM_015577chr531341 718 678 11780 ----
NM_015578chr1922057 1565 ------
NM_015607chr1--1181 ----
NM_015610chr742799 2789 2244 69 ------
NM_015626chr1721228 1162 --1988 1354
NM_015635chr931432 580 387 ------
NM_015640chr175329 4835 4681 3938 814 504 284 13736 11956 --
NM_015652chr101618 ------
NM_015670chr172478 172 ------
NM_015678chr1311467 --1266 --
NM_015686chrX32481 852 424 ------
NM_015687chr62207 26 ------
NM_015691chrX32851 2041 276 --1199 --
NM_015695chr641982 1946 820 192 11783 ----
NM_015700chr2142 ------
NM_015702chr2------125
NM_015726chr121792 1557 11735 --11841
NM_015844chr182887 682 ------
NM_015846chr182887 682 ------
NM_015847chr182887 682 ------
NM_015850chr892318 2056 1990 1761 1706 890 588 530 226 --22415 827 --
NM_015866chr121476 1192 --41466 1403 1235 537 1392
NM_015872chr121271 109 ------
NM_015878chr821788 515 --11798 --
NM_015881chr111146 ------
NM_015885chr112832 45 --1198 --
NM_015891chr632003 1565 626 1534 ----
NM_015902chr83284 146 94 --124 --
NM_015904chr21265 148 ----
NM_015906chr174680 4590 3336 1091 1020 555 92 14775 11553 --
NM_015907chr4----1377 --
NM_015912chr832210 2133 1992 11821 12525 --
NM_015920chr15138 1593 ----
NM_015955chr2--1487 ----
NM_015975chrX21757 1218 ------
NM_015976chr1--1338 ----
NM_015980chr521383 206 --11376 --
NM_015981chr531984 297 92 12157 22475 30 --
NM_015986chr173570 450 170 ------
NM_015995chr1574419 4163 2082 2007 1119 955 236 ------
NM_016003chr742799 2789 2244 69 ------
NM_016009chr124046 1098 24130 3186 34826 4384 1022 --
NM_016019chr72987 329 --1870 --
NM_016022chr11902 --1256 --
NM_016032chrX1157 ----1569
NM_016033chr831950 431 107 11788 ----
NM_016037chr12250 45 ------
NM_016040chr122514 889 ------
NM_016041chr17174 ------
NM_016045chr2021246 200 2687 401 ----
NM_016048chr521000 727 ------
NM_016057chr12155 ----1323
NM_016061chr21520 --11664 --
NM_016072chr1231677 612 277 ------
NM_016073chr152884 157 --1105 --
NM_016076chr122500 502 12897 12422 22059 2040
NM_016078chr1721018 992 1973 ----
NM_016083chr663704 3099 2449 1230 1175 216 13008 1938 --
NM_016090chr1121033 76 ------
NM_016096chr821546 140 32170 2055 1353 ----
NM_016107chr5149 --11276 --
NM_016127chr8--1199 1606 1744
NM_016131chr261969 1950 1597 686 164 54 ------
NM_016132chr1531127 759 41 23081 2487 31000 976 264 --
NM_016133chr22553 476 --11666 --
NM_016147chr11--142 ----
NM_016162chr122613 117 1287 ----
NM_016185chr173745 725 125 1803 ----
NM_016201chr341777 1667 1471 1421 --22286 595 --
NM_016205chr431240 1200 903 1252 ----
NM_016206chr356723 6153 3005 2642 481 27017 2426 37175 2892 1841 --
NM_016217chr633566 2310 546 --12230 22677 123
NM_016227chr121483 1326 --31197 42 39 --
NM_016231chr172618 601 --11479 --
NM_016234chr103973 749 690 ------
NM_016247chr31435 ------
NM_016248chr1333669 3050 1002 12569 12563 23629 2994
NM_016257chr143298 2757 2529 1009 ------
NM_016260chr255945 5757 5119 1653 1279 27406 6802 36144 5461 544 15001
NM_016269chr4185 ----1966
NM_016271chr1811472 1260 --1608
NM_016272chr2232682 806 598 --1846 --
NM_016279chr51127 ------
NM_016283chr5136 ------
NM_016284chr161222 2921 22 ----
NM_016287chr11289 12054 5720 717 714 711 708 --
NM_016289chr231851 358 106 --21612 45 --
NM_016290chr5187 ------
NM_016306chr3----1378 --
NM_016308chr112083 ----1533
NM_016316chr21633 ------
NM_016322chr932351 1170 505 32029 413 130 1433 --
NM_016339chr1731505 551 215 11435 ----
NM_016374chr121484 1434 11099 --11342
NM_016374chr121484 1434 11099 --11342
NM_016377chr671600 1437 1260 1134 491 159 85 ------
NM_016395chr1511357 --11920 --
NM_016396chr1533005 2130 1960 ------
NM_016404chr11147 ------
NM_016410chr9----1468 --
NM_016424chr1741503 1295 782 647 ------
NM_016436chr201493 --12117 21747 892
NM_016441chr272269 2070 1833 903 883 677 436 12238 21730 860 21811 1612
NM_016463chr5----1160 --
NM_016467chr231123 546 144 ------
NM_016479chr341178 133 93 40 ------
NM_016481chr9180 ------
NM_016485chr62918 108 1792 ----
NM_016512chr81258 ------
NM_016513chr642518 1135 588 522 13299 ----
NM_016518chr172888 713 ------
NM_016519chr41186 ------
NM_016522chr111481 11113 ----
NM_016525chr92386 338 1881 ----
NM_016529chr13147 ------
NM_016530chr1531423 1226 1048 12692 ----
NM_016531chr433888 3078 689 --13194 13119
NM_016542chrX11516 11417 11408 --
NM_016544chr263742 3360 1143 739 463 120 ------
NM_016545chr1------1836
NM_016547chr1----1707 --
NM_016559chr31562 1190 1597 --
NM_016575chr1294831 4676 4118 3732 1697 1600 1514 1264 475 13546 ----
NM_016577chr393972 3918 3173 2886 1481 1135 1107 1047 809 --145 --
NM_016578chr11------1192
NM_016588chr62688 318 ------
NM_016604chr521278 81 ------
NM_016605chr532459 1070 681 11953 ----
NM_016607chrX21653 208 ------
NM_016617chr1352214 2007 1983 1637 697 --2149 59 21425 63
NM_016620chr121148 223 ------
NM_016621chr1123396 1589 --13371 --
NM_016623chr81549 2452 26 ----
NM_016626chr1811468 ----11728
NM_016628chr10--1912 ----
NM_016630chr151381 ----1389
NM_016653chr211049 ------
NM_016654chr1541136 379 362 255 ------
NM_016824chr10--11669 ----
NM_016834chr1752663 1487 1165 717 409 --13365 14127
NM_016835chr1752663 1487 1165 717 409 --13365 14127
NM_016836chr21752 1629 --1512
NM_016839chr21752 1629 --1512
NM_016841chr1752663 1487 1165 717 409 --13365 14127
NM_016929chr63661 611 126 ------
NM_016937chrX21000 948 1766 ----
NM_016946chr151391 1150 1049 1031 998 11424 22997 621 --
NM_016953chr235854 3817 1583 15293 15691 --
NM_017409chr12--1764 ----
NM_017410chr1221182 1087 ------
NM_017412chr8133 ----21143 918
NM_017420chr1433550 1353 1174 23041 1429 ----
NM_017423chr42428 308 --1240 --
NM_017425chr112123 100 ------
NM_017437chr1432024 1936 1881 --2886 641 --
NM_017452chr2011183 --1199 --
NM_017453chr2011183 --1199 --
NM_017454chr2011183 --1199 --
NM_017519chr6--1319 2254 191 --
NM_017548chr331930 576 347 1496 ----
NM_017563chr365670 1630 1235 1152 770 281 46277 4842 798 472 15319 --
NM_017580chr1061956 1939 1655 1630 1549 716 ------
NM_017582chr151547 1223 582 291 233 21229 64 11241 --
NM_017583chr1121705 634 --11482 --
NM_017588chr941865 1789 1742 190 11922 ----
NM_017593chr42178 127 --1464 --
NM_017596chr134542 4147 4011 14638 11251 --
NM_017599chr1231808 817 230 ------
NM_017610chr152764 699 1508 ----
NM_017617chr911310 ------
NM_017626chr1021517 574 ------
NM_017633chr653675 3330 3002 2593 986 --23457 3454 1326
NM_017635chr1121047 510 21031 243 ----
NM_017637chr9108752 8015 6436 2944 2615 2478 2109 1384 1061 645 36628 5764 1366 49314 3457 2198 1822 1390
NM_017641chr1251003 976 730 69 35 ------
NM_017643chr1742038 778 545 468 1217 ----
NM_017644chr344941 4654 3513 1537 11514 44095 3546 605 476 --
NM_017645chr913178 --1821 1365
NM_017649chr102414 336 1103 ----
NM_017650chr775346 5310 5115 1375 812 355 285 13685 16065 --
NM_017657chr22252 122 ------
NM_017658chr1444363 3741 3400 139 13193 13254 11387
NM_017660chr1943113 2344 911 727 22766 573 11122 12423
NM_017661chr152798 297 21272 83 ----
NM_017666chrX22184 1730 ------
NM_017667chr71179 ----1211
NM_017672chr1541071 961 499 120 ------
NM_017686chr12805 83 --11070 188
NM_017693chr1321600 278 --11271 --
NM_017699chr331295 1169 47 ------
NM_017709chr133333 1180 677 1648 ----
NM_017719chr311836 --1307 --
NM_017724chr31227 1710 --1194
NM_017730chr32593 251 ------
NM_017736chr1641250 219 117 57 11159 --1396
NM_017737chr1--21402 704 1275 --
NM_017742chr18----2640 299 --
NM_017752chrX41877 1775 1632 828 --1155 --
NM_017758chr172485 150 ------
NM_017762chr1572353 1943 1587 957 904 626 255 1847 32469 2227 1838 --
NM_017768chr1--1217 ----
NM_017769chr14--12412 6885 882 879 876 873 870 --
NM_017772chr6--1107 ----
NM_017778chr811083 ----1931
NM_017780chr81917 --1856 --
NM_017784chr321084 80 ------
NM_017785chr5--2422 393 ----
NM_017787chr1042865 850 584 210 ----1414
NM_017789chr21755 ----1840
NM_017794chr92318 92 ------
NM_017799chr1421762 1498 ------
NM_017811chr922809 2687 12838 ----
NM_017813chr844213 2274 1787 660 33831 870 507 --15754
NM_017824chr102331 50 1949 --22675 1765
NM_017831chr1821482 1281 ----12925
NM_017848chrX34632 1774 909 ------
NM_017866chr811065 --1451 --
NM_017873chr963109 2498 2459 1002 725 362 ------
NM_017896chr2073419 3303 2536 1249 693 632 326 ------
NM_017902chr1085701 5263 4981 4834 4704 4012 2076 2064 11996 ----
NM_017919chr985812 5462 4130 3811 2012 736 163 55 13869 1157 --
NM_017922chr142580 425 ----192
NM_017925chr921432 1263 --11957 --
NM_017933chr221568 201 ------
NM_017938chrX21966 584 ----11995
NM_017944chr1153129 2917 2110 664 189 1674 ----
NM_017955chr143931 472 99 ------
NM_017958chr242985 2203 1924 1160 1358 ----
NM_017987chr102721 583 159 1737 --
NM_017994chr742925 2562 2202 751 --12610 --
NM_018004chr31385 ------
NM_018011chr131646 ----1209
NM_018014chr21369 11264 ----
NM_018027chr1043298 2870 2191 938 ------
NM_018030chr181381 --21061 283 --
NM_018032chr161838 2787 377 ----
NM_018036chr1464191 3957 2918 1563 587 240 14397 11167 --
NM_018048chr1221958 1682 ------
NM_018063chr101405 ------
NM_018064chr6249 41 ----1239
NM_018067chr11131 ------
NM_018078chr4--1402 --1694
NM_018084chr222704 803 1468 ----
NM_018086chr221200 325 --1345 --
NM_018098chr31342 --1955 --
NM_018110chr1621380 1012 --11079 --
NM_018112chr92879 232 ------
NM_018121chr1041129 979 717 642 11003 11188 --
NM_018133chr3----31532 1529 1526 --
NM_018144chr101348 --1266 --
NM_018149chr171169 ------
NM_018155chr31292 --32963 1034 603 32554 1273 137
NM_018159chrX21645 1498 --21083 234 1184
NM_018178chr111831 ------
NM_018181chr1821651 1402 --11713 --
NM_018195chr1131629 839 792 ----1697
NM_018202chr11119 1798 ----
NM_018206chr161631 ------
NM_018211chr15885 611 347 132 52 11651 ----
NM_018214chr631231 140 43 ------
NM_018227chr41613 1630 22247 2093 --
NM_018230chr11482 --2380 220 --
NM_018243chr433529 157 149 --13815 --
NM_018247chr652938 2538 2016 518 327 11247 1140 --
NM_018254chr132219 1544 794 22038 2020 ----
NM_018257chr2051946 1667 1602 72 42 ------
NM_018263chr242088 933 790 712 --12417 --
NM_018266chr311057 ------
NM_018270chr20--1720 ----
NM_018287chr102185 177 1834 ----
NM_018293chr353004 2862 2498 2455 504 12698 ----
NM_018299chr832560 1317 822 --33091 1261 1258 1712
NM_018313chr32665 296 --22649 2441 --
NM_018315chr421199 214 ------
NM_018320chr1111236 ------
NM_018323chr42243 77 --1246 1612
NM_018325chr931168 1098 1041 11453 11045 --
NM_018327chr2031390 650 513 --1147 --
NM_018330chr1041070 686 274 107 11705 21096 1093 --
NM_018334chr7--1360 ----
NM_018339chr931747 1646 137 ------
NM_018351chr1254307 3810 1724 1169 588 ------
NM_018361chr821474 113 ------
NM_018362chr1131612 1118 516 --23809 3774 --
NM_018364chr113614 13776 21501 368 --
NM_018369chr5140 --143 --
NM_018371chr81305 ------
NM_018373chr1425924 4572 --36401 5287 135 15982
NM_018374chr71528 --25128 1235 --
NM_018387chr9------1376
NM_018388chrX1482 1473 --1521
NM_018394chr341593 1490 1475 181 --11161 --
NM_018399chr61278 ------
NM_018403chr343477 2743 1535 841 --11595 22563 986
NM_018412chr7------1161
NM_018416chr1232571 2346 2332 --12610 12374
NM_018425chr1052649 2589 2403 2219 601 ------
NM_018427chr16--1500 4357 185 182 179 --
NM_018440chr847628 6091 5630 2158 28668 2272 26990 1822 16779
NM_018442chr11367 ------
NM_018444chr811593 12094 1339 --
NM_018448chr12----1159 --
NM_018452chr6_random32855 2822 113 --12432 11234
NM_018457chr125539 460 436 195 135 173 ----
NM_018464chr101154 ------
NM_018469chr17----11387 --
NM_018482chr832217 263 90 22441 149 ----
NM_018486chrX1489 ------
NM_018489chr141966 798 764 126 --1932 --
NM_018490chr11--11646 1749 11555
NM_018534chr22621 206 ------
NM_018553chr1751544 1368 1290 662 630 ------
NM_018557chr241729 1466 1147 160 125 --11490
NM_018569chr411106 1117 11253 --
NM_018638chr1243719 2055 589 95 1280 24809 2237 24543 4102
NM_018640chr1222569 377 --22597 2548 --
NM_018649chr101229 ------
NM_018667chr1622610 2387 ------
NM_018682chr71177 1262 ----
NM_018686chr12--186 ----
NM_018691chr51144 ----1201
NM_018695chr51266 21944 1909 --12449
NM_018697chr752081 1662 1631 1475 707 --1248 --
NM_018703chr162353 127 ------
NM_018704chr131582 773 256 --1801 --
NM_018710chr82324 185 11351 ----
NM_018890chr7----1344 --
NM_018897chr2137 ------
NM_018898chr511524 --21893 891 --
NM_018899chr511524 --21893 891 --
NM_018900chr511524 --21893 891 --
NM_018901chr511524 --21893 891 --
NM_018902chr511524 --21893 891 --
NM_018903chr511524 --21893 891 --
NM_018904chr511524 --21893 891 --
NM_018905chr511524 --21893 891 --
NM_018906chr511524 --21893 891 --
NM_018907chr511524 --21893 891 --
NM_018908chr511524 --21893 891 --
NM_018909chr511524 --21893 891 --
NM_018910chr511524 --21893 891 --
NM_018911chr511524 --21893 891 --
NM_018912chr531624 1612 609 1238 ----
NM_018913chr531624 1612 609 1238 ----
NM_018914chr531624 1612 609 1238 ----
NM_018915chr531624 1612 609 1238 ----
NM_018916chr531624 1612 609 1238 ----
NM_018917chr531624 1612 609 1238 ----
NM_018918chr531624 1612 609 1238 ----
NM_018919chr531624 1612 609 1238 ----
NM_018920chr531624 1612 609 1238 ----
NM_018921chr531624 1612 609 1238 ----
NM_018922chr531624 1612 609 1238 ----
NM_018923chr531624 1612 609 1238 ----
NM_018924chr531624 1612 609 1238 ----
NM_018925chr531624 1612 609 1238 ----
NM_018926chr531624 1612 609 1238 ----
NM_018927chr531624 1612 609 1238 ----
NM_018928chr531624 1612 609 1238 ----
NM_018929chr531624 1612 609 1238 ----
NM_018945chr632671 2345 106 1712 ----
NM_018948chr141428 994 929 158 ------
NM_018951chr731237 470 398 --2298 208 --
NM_018972chr822664 2428 --22397 895 --
NM_018975chr163796 292 125 1536 1780 --
NM_018976chr1222843 1955 1948 ----
NM_018977chrX----2977 974 --
NM_018979chr1232659 893 700 ------
NM_018993chr2021398 1145 11429 ----
NM_018999chr1074715 4617 4079 4059 3268 1561 1054 --14083 --
NM_019000chr52414 246 ------
NM_019001chr364802 4480 4262 563 537 158 --2940 583 23528 210
NM_019003chrX1136 ------
NM_019004chr752388 2120 813 748 223 1869 ----
NM_019006chr15--1705 1627 --
NM_019008chr2273718 3136 2654 2623 1137 323 112 ------
NM_019009chr1142117 1777 910 72 --1490 1300
NM_019015chr7193 ----198
NM_019022chr1833170 2275 2030 1987 ----
NM_019024chr2132 ------
NM_019027chr421700 887 1266 3898 296 293 --
NM_019028chr11------1379
NM_019045chrX2904 823 ------
NM_019046chr103724 257 41 ------
NM_019053chr1011131 ----1990
NM_019058chr10--1523 ----
NM_019067chrX54733 3843 1929 674 169 ------
NM_019072chr51349 ----164
NM_019083chr12659 118 --11311 --
NM_019087chr521742 267 ------
NM_019091chr211121 4855 756 117 53 ----
NM_019096chr631027 343 119 --131 --
NM_019098chr821745 1200 ------
NM_019102chr71352 ------
NM_019102chr71352 ------
NM_019106chr2243418 2856 2289 2263 13437 13454 --
NM_019114chr922025 433 ----11734
NM_019116chr1673356 3065 2915 2330 1329 820 278 --21336 730 --
NM_019556chrX1257 ------
NM_019558chr2280 56 ------
NM_019590chr10------197
NM_019596chr2122510 864 ------
NM_019610chr111638 1259 --21679 1525
NM_019857chrX11549 31753 389 361 1355 --
NM_019859chr1021515 68 1143 --1412
NM_019860chr1021563 116 1191 --1460
NM_019885chr222918 586 12333 22861 2706 --
NM_019895chr31462 --1426 --
NM_019903chr10--11669 ----
NM_020039chr1211611 1630 --11339
NM_020066chr12330 154 ------
NM_020116chr431417 1263 404 11206 1547 --
NM_020122chr266060 4375 1744 960 889 312 138 --14638
NM_020144chr72550 281 11729 ----
NM_020145chr9179 ------
NM_020148chr1853036 2170 649 538 160 --12912 --
NM_020150chr1032095 1944 1744 --1744 --
NM_020151chr251625 1501 1433 1213 209 2108 67 ----
NM_020156chr72426 415 --1528 --
NM_020159chr4----51663 1660 1657 1648 1188 --
NM_020177chr5171 1557 1279 --
NM_020182chr2033386 2569 233 --33577 3294 3291 13325
NM_020184chr21687 1698 12260 --
NM_020189chr8121 --124 --
NM_020193chr112538 145 ------
NM_020198chr1721219 373 --11263 --
NM_020205chr143368 2622 2602 711 ------
NM_020235chr31116 ------
NM_020238chr111359 --11048 --
NM_020239chr142318 2062 703 422 ------
NM_020244chr12239 32 ------
NM_020245chr631548 1516 263 14544 54513 1470 1467 1457 1454 --
NM_020248chr162202 2036 1847 956 600 32 --12373 --
NM_020336chr2023495 1075 --13215 --
NM_020337chr431000 963 86 ------
NM_020338chr10--13710 ----
NM_020340chr631735 874 303 31758 645 557 ----
NM_020341chr2021319 1255 ------
NM_020342chr242563 2291 2260 2129 ------
NM_020346chr1111715 --11681 1120
NM_020362chr11136 1760 1335 --
NM_020374chr1211545 ------
NM_020381chr62566 504 ----11935
NM_020384chrX51934 1559 1315 425 237 ------
NM_020390chr354231 1449 1122 574 446 --11429 --
NM_020403chr1331187 1137 480 1593 31265 663 651 11141
NM_020416chr442657 2472 739 727 ------
NM_020420chrY31841 1744 124 ------
NM_020429chr752922 860 730 288 169 --11991 --
NM_020432chr742280 2266 2169 229 12301 ----
NM_020443chr146444 5935 2320 2199 26801 163 15724 --
NM_020445chr71104 1526 1756 --
NM_020449chrX2679 199 ------
NM_020452chr12556 489 ------
NM_020455chr632864 2574 2318 --12666 --
NM_020456chr1341832 614 118 111 --1542 --
NM_020457chr163248 134 67 ------
NM_020463chr21423 --1426 --
NM_020465chr1611752 1563 11558 --
NM_020466chr643962 1312 697 48 1771 ----
NM_020529chr142447 170 ------
NM_020532chr23815 296 149 ------
NM_020640chr341933 1762 556 345 ------
NM_020644chr113113 94 71 --3364 361 358 --
NM_020647chr812086 --32234 655 497 --
NM_020651chr241655 1510 367 70 11748 ----
NM_020654chr331341 405 165 --11381 --
NM_020673chr2053098 2276 815 291 248 11689 --27756 7609
NM_020689chr2031451 613 114 ------
NM_020697chr851173 1072 1034 976 36 21162 1008 1909 --
NM_020699chr133471 1041 372 11301 11424 --
NM_020703chr11412 1575 ----
NM_020708chr2012450 ------
NM_020713chr2042695 2218 906 663 ------
NM_020717chrX64479 3675 1695 1421 729 274 --13269 --
NM_020718chr1675342 5291 4762 4431 1987 1852 1693 --11566 12238
NM_020731chr543299 2856 2199 496 12381 ----
NM_020732chr6--1319 2254 191 --
NM_020734chr12181 ----13362
NM_020739chr1544259 3785 3766 2674 11393 --12688
NM_020747chr5--2880 647 --1167
NM_020748chr1742023 1982 207 34 ------
NM_020752chr1022895 1989 ------
NM_020762chr121131 ------
NM_020766chrX34347 3739 3611 --34025 3793 540 34372 1391 588
NM_020769chrX5799 772 701 675 98 ------
NM_020772chr17128679 8032 6416 6046 5634 2843 2817 2235 1984 1622 951 356 --27255 6786 26650 5330
NM_020774chr1874159 3932 1601 1561 1397 1354 323 15168 --16212
NM_020783chr1832438 1905 802 12323 4117 114 111 108 --
NM_020791chr1731316 1274 941 --11305 --
NM_020794chr121016 89 ------
NM_020796chr522097 1858 12962 52361 2358 2334 2103 2100 12876
NM_020801chr542171 2027 887 775 --51640 1637 1634 1631 1628 21644 651
NM_020805chr18----11710 --
NM_020809chr1142290 1957 900 653 ----12044
NM_020810chr1422976 864 --23002 1000 --
NM_020824chr101238 1648 ----
NM_020830chr22752 409 ------
NM_020839chr3----2581 524 1997
NM_020841chr1233441 1300 753 11612 1782 --
NM_020850chr1622562 1280 13316 1919 --
NM_020854chr182571 172 1163 --11305
NM_020856chr1921525 183 --182 --
NM_020858chr15146 21734 64 1564 --
NM_020859chr463050 2959 2680 1294 913 363 --1515 --
NM_020860chr431045 993 305 ------
NM_020868chr231948 1607 1300 ------
NM_020871chrX21877 789 ------
NM_020872chr341693 1210 509 473 ------
NM_020873chr31293 --2754 273 1611
NM_020922chrX2546 332 ------
NM_020927chr164815 696 418 155 193 ----
NM_020940chr102232 182 1173 --22018 117
NM_020948chr122606 598 ------
NM_020951chr192519 461 --12155 --
NM_020962chr1531896 1831 271 12401 ----
NM_020964chr1834527 4069 1064 --259 34 11892
NM_020977chr441984 1701 818 651 1385 22060 401 --
NM_020987chr1041318 1267 940 281 ----1490
NM_020988chr1611133 1179 152 --
NM_020993chr1221854 185 22783 302 ----
NM_021003chr143813 574 64 1235 --1262
NM_021005chr151931 ------
NM_021007chr222155 406 --12236 --
NM_021009chr12159 ------
NM_021033chr1353376 3117 3075 2532 2483 --13121 11051
NM_021038chr342329 2100 735 647 ----23365 3029
NM_021069chr451884 1558 626 427 164 2776 557 ----
NM_021072chr511819 21984 756 ----
NM_021096chr2273298 3228 2991 2928 2263 2116 1071 ------
NM_021101chr321754 867 21687 883 12149 --
NM_021111chr941324 1267 1097 199 ------
NM_021120chrX63108 3055 2671 1002 983 439 12413 ----
NM_021136chr14------1591
NM_021144chr9----1452 --
NM_021145chr72321 139 ------
NM_021148chr71868 11747 ----
NM_021151chr71330 ------
NM_021159chr4--1270 11631 --
NM_021161chr141575 ------
NM_021168chr1631577 1479 659 ------
NM_021180chr1--1613 ----
NM_021188chr141445 ------
NM_021189chr11932 ------
NM_021190chr121203 137 ------
NM_021191chr1232334 2036 946 11786 ----
NM_021205chr122396 1142 12874 11059 --
NM_021215chr2042482 2137 1736 1617 ------
NM_021239chr14----1150 --
NM_021242chrX1862 1833 --1866
NM_021249chr1451678 1464 1439 1376 378 ------
NM_021252chr1021886 1608 --21879 1654 --
NM_021255chr1451572 1175 860 575 88 --24024 995 --
NM_021620chr61714 1732 ----
NM_021622chr1022267 1978 1484 1853 --
NM_021629chr355087 4557 3866 3541 1534 --1254 1992
NM_021637chrX21223 230 ------
NM_021639chr12583 94 ------
NM_021643chr211766 11271 --11405
NM_021644chr101181 ------
NM_021648chr632607 2047 160 ------
NM_021804chrX------139
NM_021807chr721026 272 --1488 --
NM_021809chr2021651 379 --31957 1641 519 --
NM_021813chr674795 3881 3699 3661 1711 1339 82 14512 14819 --
NM_021814chr651646 1396 562 392 264 188 ----
NM_021905chr62822 43 --1664 --
NM_021911chr53390 262 123 14084 ----
NM_021912chr1554203 2895 2802 768 648 --14057 --
NM_021914chr14------192
NM_021925chr241455 1345 1161 657 ------
NM_021935chr31687 --1991 --
NM_021940chr641540 1321 507 50 11222 --11098
NM_021946chrX2564 221 ----1524
NM_021949chrX32607 2393 741 12551 ----
NM_021954chr132884 663 12744 1176 --
NM_021956chr6--1976 11514 --
NM_021960chr121735 313 ------
NM_021964chr385686 4735 4676 2236 1988 1905 1289 198 25141 85 ----
NM_021988chr2021320 347 --11338 --
NM_021999chr131662 1543 ----
NM_022037chr21271 --1767 --
NM_022041chr1641920 1713 1702 894 1362 ----
NM_022048chr1536396 747 228 --24593 4590 --
NM_022051chr13638 515 168 ------
NM_022073chr1431644 641 548 ----11455
NM_022080chr2052734 872 536 330 100 --22117 155 --
NM_022093chr11677 ------
NM_022114chr123661 1623 14719 ----
NM_022118chr131506 ------
NM_022130chr5----21370 1367 --
NM_022137chr1452031 1762 1472 424 307 1340 1395 --
NM_022154chr4123 1936 1170 --
NM_022162chr1611100 11222 ----
NM_022166chr1645753 2414 1626 1078 15396 ----
NM_022170chr72515 460 ----1188
NM_022173chr21271 --1767 --
NM_022351chr813439 ------
NM_022362chr101334 ------
NM_022374chr21195 197 ----
NM_022442chr2021320 347 --11338 --
NM_022456chr1297587 7459 7160 4983 2670 1728 1165 936 166 --14664 --
NM_022458chr732940 2731 1984 1670 ----
NM_022459chr1395824 5395 3916 1934 1551 672 497 185 56 14042 ----
NM_022463chr1741493 1480 1471 1282 ------
NM_022473chr1543669 3074 759 187 ------
NM_022474chr1432751 2317 2081 22049 1021 --12357
NM_022482chr2032399 1786 563 --12454 12528
NM_022497chr332938 2547 411 ------
NM_022574chr751770 1714 1524 583 294 --12009 --
NM_022650chr51655 --1351 2925 748
NM_022652chr122838 24 1208 ----
NM_022658chr1211067 --11058 --
NM_022659chr8--1512 ----
NM_022716chr132282 1107 560 23149 2797 32348 808 790 --
NM_022719chr2233483 1547 794 --1215 13787
NM_022726chr661786 1673 1512 1244 492 24 ------
NM_022733chr12927 260 2363 193 ----
NM_022735chr141248 1235 343 139 11370 ----
NM_022753chr122650 988 --2899 76 12549
NM_022756chr121097 1052 1244 1461 --
NM_022757chr32964 140 ------
NM_022763chr342891 2799 1219 449 ------
NM_022771chr123994 254 38 ------
NM_022781chr983324 3107 2414 1296 1083 827 636 291 --2855 620 --
NM_022826chr231186 849 173 ------
NM_022828chr521758 1716 ------
NM_022831chr121676 316 ----11311
NM_022836chr1----3539 406 400 11271
NM_022838chrX1310 ------
NM_022841chr1532399 1999 120 12688 22680 375 --
NM_022845chr162521 252 11731 ----
NM_022893chr22413 338 --1430 --
NM_022894chr21225 2392 175 ----
NM_022898chr1443968 3435 3331 316 --14545 --
NM_022900chr7--11070 ----
NM_022901chr921804 1491 ------
NM_022910chr1611752 1563 11558 --
NM_022912chr263048 2745 2560 1211 1107 248 12273 ----
NM_022913chr5--1202 ----
NM_022918chr1131855 1831 1561 ------
NM_022965chr42623 232 --11193 11326
NM_022970chr101528 --188 --
NM_022977chrX41764 591 558 77 --21006 155 --
NM_023000chr143440 169 34 11453 1259 --
NM_023001chr143440 169 34 11453 1259 --
NM_023009chr1148 1637 ----
NM_023012chr12--1173 1548 --
NM_023037chr1331039 1007 225 ------
NM_023039chr51393 1280 ----
NM_023068chr2021541 1158 ------
NM_023074chr191863 ------
NM_023079chr1711693 ------
NM_023105chr892318 2056 1990 1761 1706 890 588 530 226 --22415 827 --
NM_023106chr892318 2056 1990 1761 1706 890 588 530 226 --22415 827 --
NM_023110chr892318 2056 1990 1761 1706 890 588 530 226 --22415 827 --
NM_023111chr892318 2056 1990 1761 1706 890 588 530 226 --22415 827 --
NM_023925chr12----1325 --
NM_023929chr832539 2358 67 --22262 120 --
NM_024007chr522759 1932 --1644 --
NM_024036chr111269 ------
NM_024052chr1762768 2705 2627 2136 2082 1922 12935 ----
NM_024082chrX1110 ------
NM_024090chr421843 1761 1553 ----
NM_024095chr121100 ------
NM_024117chr91935 ----11184
NM_024312chr121132 11611 61128 1125 1122 1119 1116 1113 --
NM_024345chr976150 5057 4949 4362 2092 471 357 ------
NM_024408chr153603 3327 2929 1279 662 23262 1181 1857 --
NM_024423chr1834208 2690 369 12705 11252 23431 3342
NM_024430chr1811786 ------
NM_024496chr142697 627 --1556 --
NM_024520chr21232 --142 --
NM_024523chr71941 ----1966
NM_024524chr333118 2343 28 22551 764 ----
NM_024525chr12611 431 ------
NM_024539chrX11169 11216 ----
NM_024551chr12----11018 12569
NM_024551chr12----11018 12569
NM_024554chr121169 108 --31586 1459 172 --
NM_024556chr111374 ------
NM_024561chr1331148 1053 904 --11056 --
NM_024563chr511592 --21737 1437 --
NM_024569chr132381 892 689 --1328 --
NM_024612chr172413 278 --1417 --
NM_024613chr831824 1779 550 --1313 --
NM_024620chr1931286 1274 139 ------
NM_024624chr221509 1453 ----11439
NM_024625chr7124 --2633 480 --
NM_024626chr121618 1290 1395 ----
NM_024630chr62561 554 ------
NM_024645chr811327 --11502 --
NM_024646chr123296 833 1826 13570 --
NM_024652chr1531204 1162 129 ------
NM_024659chr22969 961 1298 ----
NM_024665chr354545 1648 1139 656 232 24438 4195 64655 4652 4649 4646 2877 1001 12881
NM_024669chr52379 340 ------
NM_024674chr122286 1302 12426 1857 13148
NM_024676chr11991 --11333 --
NM_024700chr151047 945 905 283 142 ------
NM_024711chr732328 1701 477 ------
NM_024715chr51131 1606 ----
NM_024719chr13--199 ----
NM_024721chr822682 2605 ------
NM_024733chr192883 781 ------
NM_024744chr21147 ------
NM_024755chr15--1179 1917 --
NM_024769chr113748 386 266 ------
NM_024779chr123443 306 263 --1410 --
NM_024780chr161196 ----1243
NM_024811chr1131918 1317 724 ------
NM_024828chr921512 1067 --31277 1274 1271 --
NM_024834chr1031915 358 285 ------
NM_024835chr17--1293 ----
NM_024854chr1221496 476 ------
NM_024899chr18------1655
NM_024900chr471935 1594 872 866 812 792 694 11557 ----
NM_024900chr471935 1594 872 866 812 792 694 11557 ----
NM_024909chr621590 320 ------
NM_024915chr832231 1773 114 12008 11817 --
NM_024920chr4--11498 ----
NM_024930chr552776 2124 850 610 279 ----1640
NM_024939chr161535 11123 ----
NM_024944chr212508 183 ------
NM_024945chr941132 1102 801 313 ------
NM_024946chr1631620 527 431 ------
NM_024947chr379405 8562 7197 3054 2476 2392 1256 12316 49362 8896 5889 3119 19510
NM_024953chr1242605 2314 2304 2049 ------
NM_024989chr278064 7891 6502 6071 3050 921 731 --11634 37493 6940 5846
NM_024991chr1032044 610 138 --42105 2102 2099 2096 13248
NM_024997chr1641043 946 353 236 ------
NM_025027chr19----1470 --
NM_025054chr83964 589 56 --1658 12638
NM_025065chr1299 31 1594 ----
NM_025073chr154728 4179 3185 3158 1058 --14231 --
NM_025074chr443141 3013 2888 2835 --11061 --
NM_025076chr22616 286 --2271 72 --
NM_025083chr1531558 696 30 ------
NM_025125chr1021622 425 ------
NM_025126chr122512 293 --1516 --
NM_025133chr21360 ------
NM_025134chr163709 494 252 ------
NM_025135chr182443 52 ------
NM_025141chr151436 --1406 --
NM_025146chr341709 809 700 590 --12733 --
NM_025151chr81441 --22018 1771 --
NM_025154chr711166 ------
NM_025160chr153726 1277 640 337 210 --12786 --
NM_025179chr124949 4806 --34791 3251 106 --
NM_025181chr2------1730
NM_025191chr143400 1369 308 166 13387 31344 1288 1285 11292
NM_025195chr81188 11772 11620 --
NM_025202chr221026 83 ----1974
NM_025219chr202265 116 ------
NM_025222chr311062 1143 ----
NM_025235chr1032054 1416 80 --1870 --
NM_025238chr15--11526 1524 --
NM_025263chr62451 314 ------
NM_030583chr82379 102 ------
NM_030594chr1521240 139 ------
NM_030621chr1453777 2977 1538 1173 504 14032 ----
NM_030625chr1052494 2355 1783 78 59 --2725 572 12422
NM_030627chr554052 3509 3285 1641 247 ------
NM_030629chr16----21689 1686 1521
NM_030647chr766024 5870 5769 5593 1105 1032 14573 44823 4663 4509 280 --
NM_030648chr434278 1415 97 ------
NM_030660chr1421275 546 ------
NM_030664chr1022267 414 --2655 289 --
NM_030667chr1221184 309 --1834 --
NM_030668chr1221184 309 --1834 --
NM_030669chr1221184 309 --1834 --
NM_030670chr1222216 874 --11866 --
NM_030671chr1222216 874 --11866 --
NM_030674chr1265420 5008 2292 1286 908 32 --12353 --
NM_030762chr1251610 1559 1378 1371 1255 ------
NM_030763chrX2769 254 150 ----
NM_030771chr111210 ------
NM_030780chr831438 1401 1162 ----11424
NM_030786chr131611 227 207 ------
NM_030791chr141439 ------
NM_030799chr5--12221 11963 --
NM_030805chr22340 226 --11060 --
NM_030806chr1117943 7131 7028 6987 6696 6295 3046 2448 582 241 221 ------
NM_030811chr202374 146 ------
NM_030820chr61754 ----1776
NM_030881chr2262326 2122 1817 844 691 568 ------
NM_030884chr331861 751 686 12293 ----
NM_030885chr322141 1922 12065 ----
NM_030915chr252281 2053 1712 838 285 --11969 --
NM_030918chr165051 4868 4782 4078 322 197 --1308 --
NM_030922chr151669 ----1229
NM_030925chr1321369 481 2842 118 11979 --
NM_030934chr111419 11873 ----
NM_030945chr51127 ----199
NM_030958chr8131 ------
NM_031157chr122585 516 ------
NM_031203chr192218 75 ------
NM_031216chr18243 36 12231 129 --
NM_031243chr772418 2104 1996 1914 842 638 594 1482 1276 11496
NM_031262chr91244 11028 1121 --
NM_031263chr91301 11085 1178 --
NM_031268chr16115107 5097 4380 4341 3311 1726 1479 1248 979 629 399 14887 11205 15189
NM_031291chr41694 ------
NM_031305chr441462 518 433 318 ------
NM_031369chr41563 ------
NM_031370chr41563 ------
NM_031371chr121484 1434 11099 --11342
NM_031371chr121484 1434 11099 --11342
NM_031372chr441577 1460 672 563 ------
NM_031407chrX3484 337 43 ------
NM_031411chr511524 --21893 891 --
NM_031412chr122939 182 --1290 --
NM_031424chr203399 160 113 ------
NM_031431chr13----21848 1303 --
NM_031439chr851933 1793 1681 1595 1393 --1265 --
NM_031442chrX22992 2441 ------
NM_031471chr112392 126 ------
NM_031476chr1642766 982 610 530 ------
NM_031483chr2033319 3260 2415 ------
NM_031492chr11----1464 --
NM_031845chr223671 1129 ----13676
NM_031847chr223671 1129 ----13676
NM_031849chr511524 --21893 891 --
NM_031857chr511524 --21893 891 --
NM_031860chr511524 --21893 891 --
NM_031866chr101911 ------
NM_031890chr2232603 804 494 --12263 --
NM_031925chr7150 ------
NM_031940chr81209 ------
NM_031990chr1911218 ------
NM_031991chr1911218 ------
NM_031992chr72515 460 ----1188
NM_032012chr985213 3813 2060 948 753 364 237 168 11201 24496 1273 --
NM_032041chr832634 707 409 11758 12476 --
NM_032042chr532396 2087 1964 --1942 --
NM_032052chr2241332 1070 441 397 ------
NM_032088chr531624 1612 609 1238 ----
NM_032092chr531624 1612 609 1238 ----
NM_032102chr1133094 3065 2824 --1191 --
NM_032105chr155413 2142 1762 1209 178 --18023 --
NM_032116chr1345250 4152 673 37 24591 1597 ----
NM_032124chr181321 --1129 --
NM_032128chr43887 352 70 11032 ----
NM_032139chr192710 296 ------
NM_032144chr2--11503 11412 1385
NM_032145chr631650 1300 214 --21812 337 --
NM_032153chr332646 2356 2342 ------
NM_032154chr101730 --1100 --
NM_032156chr12----1325 --
NM_032160chr1853645 3530 2956 385 128 ------
NM_032169chr33669 540 214 1206 1658 --
NM_032186chr121148 223 ------
NM_032189chr1394529 4250 4176 3685 1212 1193 428 331 130 --1266 --
NM_032192chr172592 199 1741 ----
NM_032195chr21------1506
NM_032199chr1011304 13589 1728 --
NM_032208chr253310 2889 2400 2320 363 12760 ----
NM_032221chr202714 194 --21397 748 --
NM_032229chr132730 34 1811 ----
NM_032236chr111008 --1763 --
NM_032288chr312122 --31838 1491 411 --
NM_032291chr11352 ------
NM_032295chr71176 --163 --
NM_032312chr23659 91 65 ------
NM_032321chr232792 2744 2049 12183 13302 13306
NM_032329chr253852 2787 1159 1062 865 14345 2930 919 --
NM_032364chr1211014 ------
NM_032373chr1055386 1690 857 227 162 --21693 861 15319
NM_032403chr531624 1612 609 1238 ----
NM_032410chr81916 1249 ----
NM_032420chr52711 699 1804 ----
NM_032421chr712036 ------
NM_032433chr1921527 447 --1376 --
NM_032435chr132393 2185 88 12351 1164 --
NM_032438chr641594 1399 1059 349 --11598 --
NM_032439chr10164 ----1575
NM_032440chr1012110 --41842 329 326 323 1733
NM_032446chr532544 331 49 22511 952 23066 219 --
NM_032452chr142508 481 --1293 --
NM_032457chr442705 2683 1229 663 --13019 --
NM_032458chrX43216 1159 652 31 11213 ----
NM_032466chr831582 1540 1397 ------
NM_032468chr831582 1540 1397 ------
NM_032471chr621112 142 ------
NM_032499chr153584 186 117 ------
NM_032505chr321933 1867 ------
NM_032510chr1832228 2032 1975 --2408 89 --
NM_032521chr2032394 340 219 --1242 --
NM_032539chrX--1616 ----
NM_032547chr43523 336 34 ------
NM_032549chr74357 334 105 25 --1413 --
NM_032558chr921295 1168 ------
NM_032560chr141705 ------
NM_032569chr1611715 ------
NM_032575chr1611880 --11968 --
NM_032578chr1051433 1238 966 306 21 ------
NM_032582chr1731854 1735 403 ------
NM_032590chr1221077 723 ----11031
NM_032622chr421074 404 --11253 --
NM_032626chr161326 ------
NM_032632chr143769 484 49 ------
NM_032663chr1242053 685 406 213 --11720 --
NM_032682chr343535 2602 2248 205 1291 --198
NM_032711chr1753307 3187 2884 1302 293 ----14266
NM_032784chr61347 ------
NM_032813chr132997 947 ------
NM_032884chr11300 ------
NM_032900chr1062389 1510 1471 813 396 102 12781 ----
NM_032932chr1756005 5307 2256 1572 1541 --15356 --
NM_032947chr51120 1974 1124 --
NM_032949chr131117 177 ----
NM_032960chr121520 403 --1293 11511
NM_032961chr4--1496 11007 --
NM_032967chrX3923 357 240 ------
NM_032968chrX31368 613 578 --4511 508 490 293 --
NM_032969chrX31368 613 578 --4511 508 490 293 --
NM_032971chrY3950 384 267 ------
NM_032972chrY3950 384 267 ------
NM_032973chrY31368 613 578 --3511 508 293 --
NM_032975chr1853251 2476 2363 2268 376 --23520 3094 --
NM_032980chr1853251 2476 2363 2268 376 --23520 3094 --
NM_032982chr732503 2236 535 --11596 --
NM_032991chr421399 290 ----1552
NM_033012chr132905 673 ------
NM_033016chr2211223 ----154
NM_033020chr174680 4590 3336 1091 1020 555 92 14775 11553 --
NM_033023chr731271 1057 1010 ------
NM_033025chr192399 276 ------
NM_033044chr111061 11267 11086 --
NM_033056chr10139 --1688 --
NM_033082chr12----2190 170 --
NM_033083chr321200 473 12773 13389 --
NM_033089chr204565 522 459 442 ------
NM_033105chr8192 --1112 --
NM_033119chr162815 194 ------
NM_033132chr1341892 1867 1514 505 --11906 --
NM_033138chr72405 237 ----11938
NM_033139chr72405 237 ----11938
NM_033140chr72405 237 ----11938
NM_033143chr444602 4478 3837 840 --11594 --
NM_033157chr72405 237 ----11938
NM_033161chr92598 505 11954 12028 --
NM_033181chr663704 3099 2449 1230 1175 216 13008 1938 --
NM_033211chr52462 337 21610 68 11841 --
NM_033224chr763150 2211 1924 892 827 273 26489 2175 --12342
NM_033225chr842880 2586 423 328 12960 12052 --
NM_033228chr5153 1150 ----
NM_033285chr842785 1467 165 82 23055 685 ----
NM_033290chrX43000 2798 2629 2398 12387 13770 --
NM_033305chr921470 1376 11227 --11329
NM_033326chr1132377 998 389 12395 5210 207 204 201 186 --
NM_033331chr922378 340 3619 517 238 ----
NM_033360chr1244586 3697 3512 1198 ------
NM_033380chrX--21162 408 ----
NM_033381chrX--21162 408 ----
NM_033389chr1754061 3416 1643 1626 1010 11224 1286 --
NM_033401chr16----2394 218 --
NM_033402chr81187 ------
NM_033425chr112598 568 --11402 --
NM_033426chr1482691 2659 2591 2152 1887 311 156 116 --153 --
NM_033427chr71176 ------
NM_033430chr443776 3322 2887 605 1118 ----
NM_033437chr443776 3322 2887 605 1118 ----
NM_033449chr541941 1351 749 37 ------
NM_033480chr632134 287 172 --22318 1133 --
NM_033481chr632134 287 172 --22318 1133 --
NM_033495chrX1288 127 1941 --
NM_033503chr1533203 2724 831 --1104 --
NM_033505chr2116675 6428 5887 4747 4654 4605 4164 1838 1240 960 283 12076 25418 2292 --
NM_033512chr832939 943 389 12775 22943 767 --
NM_033515chr621275 53 ------
NM_033516chr921478 316 ------
NM_033542chr2031732 529 308 ------
NM_033551chr531175 1124 555 --11195 --
NM_033624chr1221896 29 ------
NM_033631chr133660 2934 2496 --11396 --
NM_033632chr421199 214 ------
NM_033642chrX4886 874 450 53 --21228 831 11232
NM_033644chr51808 11901 32046 957 954 1518
NM_033645chr51808 11901 32046 957 954 1518
NM_033656chr2154027 3790 1094 603 170 13688 ----
NM_052811chr1374306 3602 3563 3525 1455 1313 256 15273 ----
NM_052821chr941865 1789 1742 190 11922 ----
NM_052827chr1221001 255 ------
NM_052832chr852836 2760 1950 773 296 1316 1678 --
NM_052834chr1821750 298 ------
NM_052840chr1511534 11296 ----
NM_052845chr1253166 3008 1294 1167 282 ------
NM_052867chr1311144 --11229 --
NM_052879chr1283989 3235 3074 1438 1400 566 523 296 ----13034
NM_052900chr81105 --21377 1374 --
NM_052905chr231255 386 373 1350 ----
NM_052910chr1331513 800 242 ------
NM_052911chr182975 59 ------
NM_052917chr22999 82 1876 --11068
NM_052927chr522231 160 ------
NM_052934chr121937 633 1395 ----
NM_052936chrX2911 771 ------
NM_052937chr861945 1778 1090 476 463 217 ----1488
NM_053001chr83337 295 143 --1313 --
NM_053002chr31197 --1982 --
NM_053016chr987742 7707 7355 6693 2317 1895 540 463 37984 7880 1013 1425 --
NM_053023chr113895 832 210 13146 --12409
NM_053024chr311443 ------
NM_053025chr341801 1640 1459 564 ------
NM_053026chr341801 1640 1459 564 ------
NM_053027chr341801 1640 1459 564 ------
NM_053028chr341801 1640 1459 564 ------
NM_053031chr341801 1640 1459 564 ------
NM_053032chr341801 1640 1459 564 ------
NM_053043chr776345 6279 5837 3874 2075 2048 521 --11552 --
NM_053046chr193370 175 145 ------
NM_053056chr1132975 2713 2037 1349 32206 1059 129 --
NM_053064chr1422847 725 --1813 --
NM_054012chr9----170 --
NM_054016chr11157 ----12021
NM_054016chr11157 ----12021
NM_054016chr11157 ----12021
NM_057161chr63143 119 38 ------
NM_057164chr22651 235 ------
NM_057165chr22651 235 ------
NM_057166chr22651 235 ------
NM_057167chr22651 235 ------
NM_057175chr431921 437 397 22434 546 ----
NM_057749chr8192 ----11072
NM_058179chr93925 268 231 ------
NM_058191chr212862 705 ------
NM_058241chr271805 1496 1459 855 847 348 96 ------
NM_058241chr271805 1496 1459 855 847 348 96 ------
NM_058243chr191773 ------
NM_078473chr81209 ------
NM_078474chr151436 --1406 --
NM_078483chr533031 3023 2883 1473 31450 581 110 --
NM_078629chrX1129 --1601 --
NM_078630chrX1129 --1601 --
NM_080391chr11545 ----1550
NM_080392chr11594 --140 1599
NM_080425chr201317 ------
NM_080426chr201317 ------
NM_080491chr1143626 3616 3529 670 13809 13886 --
NM_080544chr331331 197 39 ------
NM_080552chr201202 ------
NM_080594chr163518 185 170 --1797 --
NM_080597chr181381 --21061 283 --
NM_080599chr102860 45 11271 ----
NM_080617chr201899 1938 ----
NM_080625chr2011200 ------
NM_080645chr622123 1698 12031 --1661
NM_080723chr62401 302 ------
NM_080732chr193370 175 145 ------
NM_080738chr131714 619 76 ------
NM_080759chr131264 12204 11850 12519
NM_080760chr131264 12204 11850 12519
NM_080764chr2242747 2525 797 770 12213 ----
NM_080872chr822573 815 13957 1964 --
NM_100264chr10--1912 ----
NM_100486chr10--1912 ----
NM_130385chr1133158 3021 674 1925 11243 --
NM_130391chr933574 2465 882 11322 --1685
NM_130392chr933574 2465 882 11322 --1685
NM_130393chr933574 2465 882 11322 --1685
NM_130435chr1032877 2480 618 1305 1757 --
NM_130436chr2112267 --22555 2118 --
NM_130438chr2112844 --23132 2695 --
NM_130439chr1032173 2005 1547 ------
NM_130439chr1032173 2005 1547 ------
NM_130440chr121353 105 21572 1557 ----
NM_130808chr31308 ------
NM_130811chr2071041 1009 883 319 285 127 33 --1922 --
NM_130831chr332758 1111 88 1731 2682 302 1217
NM_130832chr332758 1111 88 1731 2682 302 1217
NM_130833chr332758 1111 88 1731 2682 302 1217
NM_130834chr332758 1111 88 1731 2682 302 1217
NM_130835chr332758 1111 88 1731 2682 302 1217
NM_130836chr332758 1111 88 1731 2682 302 1217
NM_130837chr332758 1111 88 1731 2682 302 1217
NM_130838chr1521317 565 ------
NM_130839chr1521317 565 ------
NM_130847chr1175822 5790 5312 1935 1405 1295 1249 --24333 712 --
NM_133170chr2067889 7181 6921 2431 1512 42 12866 --15105
NM_133264chr1723311 1274 12800 22597 312 --
NM_133265chrX42932 2306 987 426 --13063 --
NM_133329chr22720 76 11320 1758 --
NM_133334chr496406 5273 5201 4932 4740 4532 2470 2040 995 15925 16052 1925
NM_133338chr5--1437 ----
NM_133339chr5--1437 ----
NM_133340chr5--1437 ----
NM_133341chr5--1437 ----
NM_133342chr5--1437 ----
NM_133343chr5--1437 ----
NM_133344chr5--1437 ----
NM_133372chr532271 1099 325 --12250 --
NM_133378chr23970 876 167 ------
NM_133432chr23970 876 167 ------
NM_133433chr51178 ------
NM_133437chr23970 876 167 ------
NM_133452chr1941208 941 928 879 ------
NM_133468chr7--1260 ----
NM_133478chr2------12416
NM_133493chr644257 4091 2990 730 24597 3534 11063 --
NM_133496chr144492 3342 1399 518 ------
NM_133503chr121605 ------
NM_133504chr121605 ------
NM_133505chr121605 ------
NM_133506chr121605 ------
NM_133507chr121783 ------
NM_133625chr331354 549 145 1131 ----
NM_133631chr31522 --31209 178 175 --
NM_133638chr51490 1564 ----
NM_133646chr254913 3710 3635 1793 1617 ------
NM_133647chr1532961 2541 854 1532 23838 3835 --
NM_134265chr1721228 1162 --1988 1354
NM_134325chr121472 168 ------
NM_134428chr92327 92 ------
NM_134442chr23669 590 474 21292 1196 ----
NM_138270chrX53172 2642 2583 985 864 --12717 --
NM_138288chr141167 --21970 892 --
NM_138290chr7--137 ----
NM_138316chr1021257 56 --1441 --
NM_138317chr141575 ------
NM_138318chr141575 ------
NM_138328chr1782180 1040 1032 833 591 481 410 208 ----13380
NM_138340chr18--181 ----
NM_138357chr1021484 709 11279 ----
NM_138370chr21763 ------
NM_138373chr1951853 1725 1644 228 221 --1205 --
NM_138391chr12401 301 ----2793 312
NM_138423chr1511700 138 --180
NM_138426chr712324 12240 1353 --
NM_138437chrX------189
NM_138444chr1344574 3490 1746 1301 13437 14314 13953
NM_138457chr633067 1037 697 ------
NM_138459chr623024 2291 ------
NM_138468chr246055 4706 4638 365 15837 ----
NM_138471chr112552 214 1536 ----
NM_138473chr1244905 4466 1153 584 --1555 --
NM_138479chr11255 --11444 --
NM_138494chr752054 1126 864 664 337 --12440 --
NM_138559chr21359 11254 ----
NM_138576chr1443968 3435 3331 316 --14545 --
NM_138609chr53534 365 209 ------
NM_138610chr53534 365 209 ------
NM_138621chr223483 3210 24149 2845 1208 --
NM_138633chr671600 1437 1260 1134 491 159 85 ------
NM_138635chr752696 2075 1227 285 43 1975 ----
NM_138638chr14------192
NM_138713chr1657284 2285 1570 1057 167 15849 23127 2410 --
NM_138714chr1657284 2285 1570 1057 167 15849 23127 2410 --
NM_138731chr1433481 2667 174 ------
NM_138736chr1634156 3396 1531 ------
NM_138771chr7174 1212 ----
NM_138782chr5--2721 196 --11678
NM_138799chr24649 470 282 85 1478 ----
NM_138927chr212915 667 2871 222 ----
NM_138931chr31417 ------
NM_138959chr175762 5129 4715 1171 1071 521 104 --15677 11513
NM_138970chr1452365 1892 1603 780 755 1257 12162 --
NM_138971chr1123760 722 12590 ----
NM_138971chr1123760 722 12590 ----
NM_138972chr1123760 722 12590 ----
NM_138972chr1123760 722 12590 ----
NM_138973chr1123760 722 12590 ----
NM_138973chr1123760 722 12590 ----
NM_138981chr41124 ------
NM_138994chr16----2394 218 --
NM_139012chr631646 302 93 ------
NM_139015chr1261706 1663 1605 1363 1337 627 11152 21709 1222 1600
NM_139035chrX2572 21 --2733 493 --
NM_139045chr91648 ------
NM_139048chr341126 1023 484 256 ------
NM_139056chr541132 1091 1073 936 ------
NM_139057chr1552696 2146 1784 780 737 1936 12137 --
NM_139071chr123598 516 111 ------
NM_139072chr21740 ------
NM_139076chr421420 231 ------
NM_139078chr121247 1118 ----
NM_139131chr111253 --1189 --
NM_139135chr12309 116 11024 11051 1485
NM_139136chr121431 2912 40 ----
NM_139156chr13811 713 73 --2835 186 --
NM_139157chr112476 86 1178 ----
NM_139201chr121754 ------
NM_139211chr43720 124 76 2140 98 ----
NM_139212chr43720 124 76 2140 98 ----
NM_139276chr1742270 2141 466 300 --3352 349 346 12379
NM_139279chr223177 1051 ------
NM_139283chr122931 159 12566 ----
NM_139312chr1031397 1135 27 ------
NM_139316chr721070 212 11031 ----
NM_139319chr1221862 299 ------
NM_144498chr2042088 784 627 187 ------
NM_144571chr456385 6078 1393 1200 632 --25929 5822 1132
NM_144578chr1454542 1835 1767 1203 80 14767 15005 14590
NM_144582chr231869 1758 1059 --21921 419 --
NM_144599chr1535455 4386 3528 14755 21525 401 --
NM_144632chr221742 208 ------
NM_144633chr311003 1162 ----
NM_144643chr4----1127 --
NM_144644chr41185 ------
NM_144657chrX2581 113 ------
NM_144660chr101395 ------
NM_144664chr1111982 ------
NM_144709chr2------1150
NM_144736chr21766 1130 ----
NM_144767chr1531224 978 62 14488 13395 --
NM_144778chr13------12044
NM_144949chr252113 1995 912 894 145 --1782 --
NM_144963chr852679 1840 1803 1784 696 --12522 --
NM_144973chr1265058 4754 3562 1485 1464 1042 1156 ----
NM_144979chr4----1594 --
NM_144992chr2--1535 ----
NM_145012chr101971 --1809 --
NM_145014chr111340 --1312 --
NM_145025chr61189 --1180 --
NM_145055chr1833583 2892 666 33352 1210 990 33464 3461 2574 --
NM_145109chr171885 --1976 --
NM_145112chr1411198 11269 ----
NM_145113chr1411470 11541 ----
NM_145117chr111252 1227 32972 2863 256 12839
NM_145203chr131887 1177 ----
NM_145206chr102636 388 13154 ----
NM_145234chrX1915 ------
NM_145239chr1611013 ------
NM_145251chr1421141 145 ------
NM_145259chr265684 5280 4608 2765 2550 583 ------
NM_145279chr111799 --11903 --
NM_145284chrX3774 203 35 --22202 617 --
NM_145307chr1044706 2950 1266 248 --11758 --
NM_145349chr1741725 1637 1444 224 ------
NM_145649chr622590 1755 --1229 --
NM_145655chr622590 1755 --1229 --
NM_145686chr243398 2648 2522 237 ------
NM_145687chr243398 2648 2522 237 ------
NM_145690chr82620 68 ------
NM_145698chr101198 --1115 --
NM_145733chr2231207 78 52 11226 11243 --
NM_145735chr1342061 949 900 494 --2255 72 137
NM_145753chr321545 433 ------
NM_145754chr81113 --1194 --
NM_145808chr752812 1142 1090 605 414 --1901 12016
NM_145858chr21176 --1419 --
NM_145861chr131714 619 76 ------
NM_145891chr1631521 590 228 ------
NM_145892chr1631521 590 228 ------
NM_145893chr1631643 712 350 ------
NM_145899chr621023 982 ------
NM_145901chr621023 982 ------
NM_145902chr621023 982 ------
NM_145903chr621023 982 ------
NM_145904chr621023 982 ------
NM_145905chr621023 982 ------
NM_147150chr953437 2944 1397 1154 312 ------
NM_147156chr1011136 ------
NM_147157chr92900 68 1124 ----
NM_147164chr9------1565
NM_147175chrX21930 1436 --21998 269 --
NM_147189chr83717 710 80 --31431 893 111 --
NM_148174chr821788 515 --11798 --
NM_148894chr42933 827 1112 ----
NM_148977chr1021257 56 --1441 --
NM_148978chr1021257 56 --1441 --
NM_152227chr20--1701 ----
NM_152233chr1451678 1464 1439 1376 378 ------
NM_152238chr1--1338 ----
NM_152253chr2253922 3661 1305 1038 692 --1521 --
NM_152261chr1252238 1934 741 642 114 ----12368
NM_152265chr11134 --11303 --
NM_152267chr2212385 --1554 --
NM_152271chr811079 ------
NM_152277chr542077 1965 1701 776 --158 --
NM_152280chr132723 712 260 11377 ----
NM_152282chr321342 167 1912 --21035 926
NM_152300chr1761731 771 657 640 497 222 ------
NM_152308chr163843 682 220 --1814 --
NM_152309chr1042258 2207 2155 123 ------
NM_152323chr122192 154 ------
NM_152345chr171463 ----1235
NM_152387chr22342 320 ------
NM_152388chr263153 2820 2718 2569 1232 1211 1949 21170 165 --
NM_152417chr831106 844 414 --11199 --
NM_152418chr851450 1223 645 241 142 11328 ----
NM_152423chrX141 1491 ----
NM_152424chrX104719 4275 4166 3930 3914 3591 3550 1745 1313 860 24416 286 21492 92 --
NM_152437chr1222359 148 ------
NM_152447chr14198 ------
NM_152470chr1834161 1471 449 ------
NM_152475chr193390 91 29 ------
NM_152493chr111647 ------
NM_152538chr321815 140 ------
NM_152556chr71708 ----12541
NM_152557chr731366 1332 122 ------
NM_152581chrX21428 364 ------
NM_152588chr122477 345 ----1161
NM_152594chr1532308 2133 2113 ------
NM_152609chr12977 370 --11049 --
NM_152622chr522812 1349 ----13477
NM_152624chr587136 7068 6670 5968 5228 2917 2077 659 --12945 17072
NM_152629chr933455 905 434 ------
NM_152638chr1211198 --1295 --
NM_152641chr1242616 1790 917 227 22358 817 12527 --
NM_152653chr32220 140 ------
NM_152676chr18----124 --
NM_152678chr322284 475 ------
NM_152688chr6----1284 --
NM_152692chrX2320 49 ------
NM_152715chr11143 ------
NM_152716chr1121269 1056 11423 ----
NM_152721chr181690 1759 ----
NM_152737chr6----11545 --
NM_152744chr712321 13094 1929 --
NM_152745chr711088 --1402 --
NM_152756chr52665 196 --14268 --
NM_152758chr82943 252 ----1404
NM_152789chr711139 --21188 995 --
NM_152835chr152261 1128 1081 1043 521 --22729 2726 --
NM_152838chr2053455 3306 819 622 572 --143 2545 187
NM_152856chrX1160 ------
NM_152879chr272424 2210 629 565 507 492 299 12589 ----
NM_152890chr12968 48 ----1813
NM_152896chr92618 23 ------
NM_152902chr151788 1600 1489 1393 169 ------
NM_152914chr1742864 1606 1010 821 14348 ----
NM_152989chr12----31605 403 21 --
NM_152991chr111223 --1569 --
NM_153013chr532360 682 96 --12057 --
NM_153022chr1231643 1601 537 ------
NM_153029chr1654058 3975 3560 1278 544 ------
NM_153184chr321890 1873 21797 1483 ----
NM_153188chr555114 4765 4450 4346 1210 --15117 --
NM_153207chr1232585 2518 310 12836 ----
NM_153223chr511450 ----1300
NM_153226chr10----3231 228 225 --
NM_153235chr6----1171 --
NM_153256chr1011826 ------
NM_153260chr15183 --186 --
NM_153261chr16--1547 --11293
NM_153262chr133217 3037 2599 13210 ----
NM_153333chrX--1231 ----
NM_153362chr61257 ------
NM_153367chr1043082 1035 1008 187 13996 13069 --
NM_153374chr15----2398 375 --
NM_153456chr1336350 4122 1215 --25273 562 --
NM_153487chr664332 4117 3662 2949 1370 362 13202 14736 --
NM_153499chr1242615 2390 517 28 --21174 247 --
NM_153500chr1242615 2390 517 28 --21174 247 --
NM_153607chr512699 --22793 1123 --
NM_153616chr15146 21734 64 1564 --
NM_153617chr15146 21734 64 1564 --
NM_153618chr15146 21734 64 1564 --
NM_153619chr1542440 2431 1284 27 22972 1302 ----
NM_153633chr122543 235 ------
NM_153634chr1241489 629 296 183 ------
NM_153649chr141430 877 587 271 --1305 --
NM_153690chr32824 731 --1799 --
NM_153702chr4--163 ----
NM_153715chr731237 470 398 --2298 208 --
NM_153746chr62561 554 ------
NM_153748chr121431 2912 40 ----
NM_153810chr1094642 4246 3410 3130 1374 1211 1105 639 191 ------
NM_153828chr23815 296 149 ------
NM_153836chr22387 92 --1312 --
NM_170587chr82670 266 1223 ----
NM_170606chr71725 --11770 --
NM_170665chr1254095 2933 2848 1433 983 ------
NM_170674chr1521351 1281 ------
NM_170675chr1531027 957 371 ------
NM_170676chr1531027 957 371 ------
NM_170677chr1521351 1281 ------
NM_170679chr511333 ------
NM_170692chr131054 371 328 ------
NM_170706chr134331 1265 114 --23595 1613 --
NM_170725chr11165 ------
NM_170731chr1182555 2267 2084 942 673 502 248 239 12329 12600 --
NM_170732chr1182555 2267 2084 942 673 502 248 239 12329 12600 --
NM_170733chr1182555 2267 2084 942 673 502 248 239 12329 12600 --
NM_170734chr1182555 2267 2084 942 673 502 248 239 12329 12600 --
NM_170735chr1182555 2267 2084 942 673 502 248 239 12329 12600 --
NM_170750chrX1179 --1187 --
NM_170768chr1121355 233 ------
NM_171825chr531984 297 92 12157 22475 30 --
NM_171998chrX3490 198 177 --12475 --
NM_172020chr731511 1287 517 ------
NM_172037chr841009 202 106 77 1430 11045 --
NM_172058chr821830 1650 --1127 --
NM_172059chr821830 1650 --1127 --
NM_172060chr821830 1650 --1127 --
NM_172070chr242261 668 581 98 ------
NM_172071chr167210 6852 5033 4977 1078 915 --14552 --
NM_172103chr652142 651 566 249 154 ------
NM_172105chr652142 651 566 249 154 ------
NM_172127chr441444 735 643 549 --1430 --
NM_172128chr441400 691 599 505 --1386 --
NM_172159chr331788 149 103 11764 --1243
NM_172160chr331788 149 103 11764 --1243
NM_172169chr1021717 600 1195 --1653
NM_172170chr1021717 600 1195 --1653
NM_172171chr1021717 600 1195 --1653
NM_172173chr1021717 600 1195 --1653
NM_172216chr1232517 2292 419 --21076 149 --
NM_172226chr1242615 2390 517 28 --21174 247 --
NM_172240chr12125 ------
NM_172315chr1521351 1281 ------
NM_172316chr1521351 1281 ------
NM_172344chr22720 76 11320 1758 --
NM_173054chr7--1241 ----
NM_173075chr421167 95 --11680 2472 210
NM_173078chrX160 ------
NM_173079chr1711829 ------
NM_173082chr6--1497 ----
NM_173083chr131217 914 168 ------
NM_173156chr131499 425 246 1783 11417 --
NM_173171chr21367 2926 484 2978 309 --
NM_173172chr2133 11234 21286 617 --
NM_173173chr21367 2926 484 2978 309 --
NM_173177chr21503 1682 ----
NM_173198chr932491 1864 626 ------
NM_173199chr91170 ------
NM_173200chr932491 1864 626 ------
NM_173214chr1657284 2285 1570 1057 167 15849 23127 2410 --
NM_173354chr21--12040 21948 370 --
NM_173355chr211025 ------
NM_173359chr3134 1386 1493 --
NM_173468chr434652 2413 298 1487 --14620
NM_173469chr1511432 ------
NM_173470chrX42839 2431 1069 386 --22846 2069 --
NM_173475chr1641189 1177 478 246 1151 ----
NM_173478chr17--11048 ----
NM_173491chr5150 21295 60 11303 --
NM_173495chrX32401 1994 360 ------
NM_173500chr1511418 11323 11363 --
NM_173510chr2222894 2121 ------
NM_173511chr283938 2480 1436 1191 1060 747 566 24 --11063 --
NM_173546chr32636 71 ------
NM_173576chr1022139 932 12240 11614 --
NM_173582chr11105614 4769 4241 3809 2079 1972 1772 1580 1149 839 12305 16052 --
NM_173591chr124973 893 241 94 --1981 --
NM_173595chr1255263 4538 4261 4038 1809 ------
NM_173602chr1273622 3431 3253 746 723 710 674 1282 13440 --
NM_173609chr15----1112 1665
NM_173631chr19----11186 --
NM_173642chr1108562 8235 6751 6531 6329 6120 3325 725 288 242 17201 17572 --
NM_173644chr203658 273 41 ----11846
NM_173654chr311790 1149 2454 451 --
NM_173672chr61759 12566 12507 --
NM_173694chrX22511 1604 --21764 1744 11751
NM_173797chr5--11216 1410 --
NM_173798chrX2482 446 ------
NM_173808chr122745 1489 13668 13904 --
NM_173814chr152406 63 --1469 1533
NM_173825chr362594 2202 2070 724 365 257 --163 --
NM_173829chr535107 1763 369 44279 1306 531 173 ----
NM_173830chr62683 247 ------
NM_173848chr82850 840 ------
NM_173851chr874008 3163 3007 2527 1563 1512 784 --11515 --
NM_174890chr102796 63 ------
NM_174902chr1141634 1462 201 49 ------
NM_174909chr52714 131 1260 ----
NM_174911chr843783 2864 1275 1005 1841 23673 1572 --
NM_174916chr152954 718 ------
NM_174938chr91394 ------
NM_175061chr732083 307 46 ------
NM_175607chr311078 1518 3629 90 26 --
NM_175610chr1521269 474 ------
NM_175612chr311078 1518 3629 90 26 --
NM_175613chr3----290 26 --
NM_175623chr1297587 7459 7160 4983 2670 1728 1165 936 166 --14664 --
NM_175741chr151236 ------
NM_175747chr6----1858 1322
NM_175748chr1411951 ------
NM_175767chr52630 146 ------
NM_175768chr6--11180 11718 --
NM_175847chr1911218 ------
NM_175848chr2011167 1546 ----
NM_175848chr2011167 1546 ----
NM_175849chr2011167 1546 ----
NM_175849chr2011167 1546 ----
NM_175850chr2011167 1546 ----
NM_175850chr2011167 1546 ----
NM_175854chr1331072 864 622 ------
NM_175856chr53763 165 52 --2119 60 --
NM_175859chrX11549 31753 389 361 1355 --
NM_175863chr6--1319 2254 191 --
NM_175866chr12422 399 ------
NM_175876chr122755 611 12286 ----
NM_175884chr7----11198 --
NM_175907chr1822865 2339 11935 ----
NM_175920chr5127 ----1647
NM_175929chr13121 --1125 --
NM_176812chr203700 226 146 --1704 --
NM_176814chr751408 1373 328 232 145 ------
NM_176863chr1731768 1552 1414 ------
NM_177398chr121794 119 21881 133 ----
NM_177399chr121794 119 21881 133 ----
NM_177424chr131499 812 52 --5845 842 839 836 833 12001
NM_177438chr1453777 2977 1538 1173 504 14032 ----
NM_177559chr201801 --11177 --
NM_177560chr201801 --11177 --
NM_177947chrX21653 208 ------
NM_177948chrX21653 208 ------
NM_177952chr143813 574 64 1235 --1262
NM_177966chr321301 361 ------
NM_177969chr21499 ------
NM_177974chr1511700 138 --180
NM_177977chr1721659 61 ------
NM_177983chr2--1357 ----
NM_177990chr2021319 1255 ------
NM_177996chr2023319 2742 13393 22638 699 --
NM_177999chr963672 3061 3022 2335 1288 925 12347 ----
NM_178010chr12----31605 403 21 --
NM_178011chr1023192 524 ------
NM_178014chr63961 179 90 --1889 --
NM_178120chr211194 --11149 --
NM_178140chr522713 78 ------
NM_178151chrX47741 7560 1587 1104 --51644 537 122 119 116 --
NM_178152chrX47741 7560 1587 1104 --51644 537 122 119 116 --
NM_178153chrX47741 7560 1587 1104 --51644 537 122 119 116 --
NM_178232chr15----1587 --
NM_178270chrX2911 771 ------
NM_178424chr52415 94 ----1635
NM_178426chr162040 1944 1926 1612 839 583 ------
NM_178427chr161940 1844 1826 1512 739 483 ------
NM_178498chr1123744 701 --12501 --
NM_178544chr1921646 245 ----11690
NM_178548chr1--1631 1604 --
NM_178565chr821717 469 11582 ----
NM_178585chr442945 2391 841 795 ----11087
NM_178812chr841479 1398 483 59 ------
NM_178818chr1622303 259 --21786 59 --
NM_178832chr102317 54 ------
NM_178860chr1721006 86 ------
NM_180989chr1331917 1659 224 --12481 --
NM_181291chr141646 ------
NM_181349chr752922 860 730 288 169 --11991 --
NM_181351chr1121106 220 ------
NM_181354chr831504 1203 326 ------
NM_181356chr62140 124 --1839 --
NM_181358chr163778 2842 2671 1448 719 412 --12916 1189
NM_181361chr31903 --11075 --
NM_181442chr201866 1978 --11046
NM_181453chr241356 1172 640 598 ------
NM_181458chr22974 102 11450 ----
NM_181460chr2--11263 ----
NM_181481chr18157052 7007 6626 6449 6384 6059 5430 4645 4594 1311 777 643 560 504 81 35474 4993 1890 56354 6351 5522 5295 4924 --
NM_181482chr18157052 7007 6626 6449 6384 6059 5430 4645 4594 1311 777 643 560 504 81 35474 4993 1890 56354 6351 5522 5295 4924 --
NM_181483chr18157052 7007 6626 6449 6384 6059 5430 4645 4594 1311 777 643 560 504 81 35474 4993 1890 56354 6351 5522 5295 4924 --
NM_181492chr2211103 ------
NM_181504chr563095 1196 1180 1095 888 785 --2905 461 --
NM_181505chr172592 199 1741 ----
NM_181507chr112320 263 ------
NM_181508chr112320 263 ------
NM_181523chr563095 1196 1180 1095 888 785 --2905 461 --
NM_181524chr563095 1196 1180 1095 888 785 --2905 461 --
NM_181659chr2053413 2729 2595 1079 212 ------
NM_181659chr2053413 2729 2595 1079 212 ------
NM_181672chrX42062 611 518 104 ------
NM_181673chrX42062 611 518 104 ------
NM_181702chr8142 ------
NM_181704chr2121340 46 11261 ----
NM_181711chr121650 ------
NM_181714chr61382 ------
NM_181723chr832109 612 239 --1644 1769
NM_181762chrX3909 379 112 1251 ----
NM_181777chrX3909 379 112 1251 ----
NM_181782chr622218 217 ------
NM_181784chr211912 12485 1936 --
NM_181787chr873933 3680 1416 931 780 129 108 11353 13684 --
NM_181794chr621112 142 ------
NM_181795chr621112 142 ------
NM_181807chr111307 ------
NM_181825chr223767 743 286 ------
NM_181836chr532185 1854 119 --146 --
NM_181838chr5--1153 ----
NM_181839chr831287 1119 477 11004 ----
NM_181844chr1731703 1486 191 1714 --11465
NM_181861chr1231967 1074 609 --1103 22675 261
NM_181864chr12218 116 ------
NM_181865chr12218 116 -