TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3120-5p
miRNA Sequence: CCUGUCUGUGCCUGCUGUACA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr52601 58 --11789 1323
NM_000104chr252986 2881 2191 418 311 1465 ----
NM_000112chr5115472 4120 3953 3941 3567 3540 2106 1803 1342 483 227 2643 185 ----
NM_000125chr673177 2642 2636 1276 364 314 30 1620 --13448
NM_000216chrX83854 3666 3337 3208 1315 1005 810 85 33605 3416 199 ----
NM_000217chr1285014 4665 4617 4375 3767 2127 921 459 ------
NM_000232chr482807 2747 2706 2473 2428 1286 1005 860 22302 520 12634 12869
NM_000335chr372022 2003 1945 646 607 231 169 12154 32046 1926 1506 2207 146
NM_000337chr5165961 5845 5622 5132 4270 4256 2506 2231 2221 2184 1869 1595 1528 1361 615 57 ------
NM_000376chr1292992 2925 2833 2285 1975 1195 621 580 277 22179 373 1344 --
NM_000461chr354591 4147 1805 1251 140 ------
NM_000486chr12112994 2233 2198 2190 1272 1138 1117 1032 864 780 292 33030 3003 54 22525 1182 12973
NM_000555chrX117395 7273 6381 5197 1835 1551 1515 1229 664 490 482 37316 644 216 17784 --
NM_000599chr2114241 4155 3791 3627 3585 3421 3264 3019 2983 1350 588 23381 1162 33384 1822 394 21263 779
NM_000618chr12106331 5567 5479 5433 5120 4234 4097 2579 1082 636 45778 5127 4548 2530 ----
NM_000618chr12106331 5567 5479 5433 5120 4234 4097 2579 1082 636 45778 5127 4548 2530 ----
NM_000633chr1853870 3707 678 270 182 --14802 2414 147
NM_000719chr12126297 5596 5346 4800 4713 4631 4503 4373 4276 2699 2278 136 25493 1478 1634 --
NM_000724chr1061748 1259 737 560 409 357 1481 ----
NM_000806chr551747 1653 1205 761 195 1245 ----
NM_000809chr4109202 8061 7310 6413 5944 3633 2848 1693 1621 1145 58761 6198 2357 1190 230 ----
NM_000813chr555500 4389 1059 356 242 1562 11517 14227
NM_000831chr1105397 5338 4883 4313 2447 2371 1864 1361 352 235 44267 2526 2000 604 ----
NM_000833chr1631520 451 213 11446 1221 --
NM_000872chr1081537 1449 1396 1203 1147 1115 1105 192 21196 366 ----
NM_000875chr15105100 4260 2655 2579 2087 2079 1806 1237 746 145 26323 1538 34763 2815 921 --
NM_000891chr1753160 3088 2486 1003 282 --11317 12896
NM_000961chr2073487 3399 2925 871 752 685 301 33748 3233 308 12496 --
NM_001001331chr362710 893 669 592 284 79 ----1995
NM_001001419chr575019 4026 3296 1347 613 98 72 24201 1481 --23329 1352
NM_001001420chr575019 4026 3296 1347 613 98 72 24201 1481 --23329 1352
NM_001001669chr582175 2160 2049 1826 1790 925 267 139 12065 1435 12069
NM_001001890chr2184120 4104 3127 3094 1154 1035 787 763 --12888 --
NM_001002919chr22459 170 ----1120
NM_001002926chr762815 2588 2560 1853 738 724 11022 ----
NM_001003406chr22113039 2829 2806 2544 2371 2360 2307 2207 1143 878 652 33121 2465 273 22887 75 12086
NM_001003674chr18125495 4875 4457 2630 2322 2087 1967 1686 1467 846 349 230 --14584 --
NM_001003675chr18125495 4875 4457 2630 2322 2087 1967 1686 1467 846 349 230 --14584 --
NM_001004419chr1283128 2877 1687 923 790 460 62 24 --1416 --
NM_001005473chr596457 6015 6006 5965 5484 5316 5273 2089 648 56483 4122 1382 984 882 ----
NM_001005502chr12145000 4698 4233 4193 4083 3769 3735 3630 3584 3232 1470 1286 636 588 44834 3908 3797 1497 11941 --
NM_001005845chr851894 1786 1513 1378 172 ------
NM_001007094chr1063963 3673 3654 3260 1040 140 33385 3301 462 1623 --
NM_001007097chr974915 4801 4159 4148 3236 1442 1430 45063 4425 3763 22 32044 1295 223 13703
NM_001007237chr171981 1969 1918 1856 1114 1067 69 22573 159 --1312
NM_001007466chr663851 1707 642 572 448 417 25144 3196 1789 --
NM_001008239chr1852606 884 605 328 252 32495 709 520 --1724
NM_001008408chr776210 2400 1404 1258 702 684 291 24982 2262 14985 --
NM_001008701chr1982515 2269 2246 2234 1975 497 484 90 31134 490 81 1193 --
NM_001008925chr452837 2248 2195 989 649 12898 ----
NM_001009554chr464491 3966 3939 3797 1602 677 14343 --1226
NM_001009554chr464491 3966 3939 3797 1602 677 14343 --1226
NM_001009899chr3136322 5342 4905 2569 2251 2161 1603 1515 1469 694 393 162 71 25676 4967 15969 --
NM_001010867chr1146175 5028 4984 4817 4550 4415 4277 2681 2206 2122 1467 1264 1072 184 45823 5161 4577 4205 21176 870 --
NM_001010891chr5105942 5536 5222 4962 4784 4768 2686 2639 1728 856 45740 5101 2518 1584 ----
NM_001011666chr796076 5889 5226 5015 4824 4246 2259 1806 474 21352 393 11693 --
NM_001013406chr741370 1204 1079 561 ------
NM_001013620chr1276898 5937 3370 1165 1049 559 239 27989 6276 27806 974 --
NM_001014797chr10147650 7637 7329 6872 6673 6658 6571 6557 6277 6168 5772 5747 5626 647 47130 6520 1196 266 ----
NM_001017368chr1752854 2223 1821 842 322 32608 1048 560 12611 --
NM_001017440chr7137707 7356 6813 6724 6597 5903 5416 3246 2790 2707 1902 925 84 27937 808 12828 13267
NM_001017535chr1292992 2925 2833 2285 1975 1195 621 580 277 22179 373 1344 --
NM_001017970chr1462367 2323 916 862 569 134 12647 21003 372 --
NM_001017995chr553903 3605 1644 1389 162 21083 104 23197 1071 34062 1409 108
NM_001018050chr22143285 3159 3144 3096 2587 2295 2265 1356 916 882 481 285 112 95 33047 2236 2201 23100 387 --
NM_001018052chr22143285 3159 3144 3096 2587 2295 2265 1356 916 882 481 285 112 95 33047 2236 2201 23100 387 --
NM_001018064chr951752 508 392 354 178 --146 --
NM_001018065chr965236 4411 4159 3659 2170 112 22091 1544 --15255
NM_001018066chr965236 4411 4159 3659 2170 112 22091 1544 --15255
NM_001018067chr175155 4395 3899 3349 2006 1798 776 14663 24121 1110 --
NM_001018068chr175155 4395 3899 3349 2006 1798 776 14663 24121 1110 --
NM_001018069chr175155 4395 3899 3349 2006 1798 776 14663 24121 1110 --
NM_001018111chr773911 3296 3074 2747 2635 1239 1117 53733 3518 3416 2799 1345 22751 1229 --
NM_001024372chr842166 1428 880 520 32233 682 73 154 --
NM_001025108chr274004 2856 1529 784 682 346 259 13456 ----
NM_001025366chr651871 1633 1454 1169 336 21201 727 --2719 715
NM_001025366chr651871 1633 1454 1169 336 21201 727 --2719 715
NM_001025367chr651871 1633 1454 1169 336 21201 727 --2719 715
NM_001025367chr651871 1633 1454 1169 336 21201 727 --2719 715
NM_001025368chr651871 1633 1454 1169 336 21201 727 --2719 715
NM_001025368chr651871 1633 1454 1169 336 21201 727 --2719 715
NM_001025369chr651887 1649 1470 1185 352 21217 743 --2735 731
NM_001025369chr651887 1649 1470 1185 352 21217 743 --2735 731
NM_001025370chr651871 1633 1454 1169 336 21201 727 --2719 715
NM_001025370chr651871 1633 1454 1169 336 21201 727 --2719 715
NM_001029864chr2051960 1778 1764 900 744 1406 42266 2140 927 329 1334
NM_001031695chr22123962 3771 3736 3650 3403 3354 1655 661 553 511 336 30 53509 1991 1529 1111 919 1716 21176 399
NM_001032394chr642048 1909 107 77 1477 --1650
NM_001033507chr151645 1550 461 270 78 51459 760 386 378 253 --1390
NM_001033551chr1774062 3398 2997 2712 1261 1149 405 --2721 292 11154
NM_001033756chr641805 1567 1388 270 21135 661 --2653 649
NM_001033756chr641805 1567 1388 270 21135 661 --2653 649
NM_001034841chr1675370 5322 4513 4037 1831 1327 366 54392 1931 1599 1027 277 11177 --
NM_001034954chr1073165 2508 881 815 500 180 121 1128 1701 --
NM_001034955chr1073165 2508 881 815 500 180 121 1128 1701 --
NM_001034956chr1073165 2508 881 815 500 180 121 1128 1701 --
NM_001034957chr1073165 2508 881 815 500 180 121 1128 1701 --
NM_001037165chr7158810 8706 8682 8247 7843 7445 7121 5860 2823 1678 1626 1258 839 340 207 55694 3113 1796 626 390 --46083 447 394 89
NM_001039547chr3197764 7253 6804 6653 6496 6151 5664 3113 3020 2799 2364 2237 1799 1200 1110 1025 575 561 199 36241 6127 1431 ----
NM_001039569chr2103328 3074 2836 2820 2639 1182 1105 487 268 92 23101 1313 ----
NM_001039574chr13104 74 25 --2731 727 338 34 30
NM_001039580chr4124994 4928 4487 4389 3235 1704 1674 1610 1534 1207 526 115 11001 1877 --
NM_001039618chr1155306 1383 624 613 91 15432 14344 13709
NM_001039840chrX86044 5821 4363 1794 1217 1012 810 251 --13987 --
NM_001039937chr1333720 2975 1388 1788 --1784
NM_001040202chr452508 761 702 667 527 ------
NM_001040272chr962382 1998 1640 1507 324 198 42052 676 521 222 2343 259 2256 66
NM_001040441chr1135193 5147 4947 4639 4011 3963 3412 1816 1683 1243 962 829 679 32157 1843 989 ----
NM_001040450chr1592879 2857 2831 2785 2696 2404 2015 698 618 12134 22137 860 --
NM_001040453chr1592879 2857 2831 2785 2696 2404 2015 698 618 12134 22137 860 --
NM_001040712chr952968 2455 939 758 255 ----12437
NM_001042355chr1684950 3615 3388 3287 2137 2064 997 916 34427 1224 38 ----
NM_001042412chr1684950 3615 3388 3287 2137 2064 997 916 34427 1224 38 ----
NM_001042599chr286086 5183 4919 4830 2009 1065 958 195 26990 1868 ----
NM_001042601chr332530 2147 168 12162 12706 12020
NM_001042604chr353916 3851 1900 359 145 33420 3227 3213 13896 --
NM_001043318chr1463910 3852 3022 2799 1522 527 23810 2626 ----
NM_001046chr552503 2188 1985 1854 907 ------
NM_001083621chr1144379 4199 3771 3623 3497 3264 3119 3033 1535 1353 1325 718 606 476 11126 74373 3486 1487 1227 897 893 223 13483
NM_001099678chr374920 4739 4410 4006 2548 2240 55 44997 4780 976 939 11461 14790
NM_001100108chr1117365 6909 6619 6384 5596 2982 1640 429 326 230 220 37430 6235 3259 12128 15974
NM_001106chr379499 6596 6200 3599 3229 2536 236 36966 6812 3533 46719 2780 2528 1063 --
NM_001167chrX116376 6318 6196 6063 6003 5665 5617 4436 4203 2040 994 46625 5388 4399 463 21994 346 --
NM_001204chr2147731 7302 7029 6851 6309 5933 5349 4961 4874 3090 2841 1785 1664 385 15002 16706 17448
NM_001259chr7106277 5961 5576 5383 3929 2479 1038 540 340 131 ----1866
NM_001271chr1542841 2397 2342 960 23084 1141 22749 1013 12746
NM_001364chr1144271 4262 4255 1837 54320 3670 1761 1387 189 13398 --
NM_001387chr543091 2954 579 524 43054 995 771 330 53057 1019 764 583 252 11998
NM_001397chr172191 2012 1736 294 235 209 200 21929 27 32380 2067 571 1659
NM_001419chr1994703 3722 3647 3394 3335 1671 1431 732 661 1413 23811 495 --
NM_001420chr1972366 1148 1087 906 897 866 95 2927 917 41118 809 534 104 2845 835
NM_001447chr571418 1045 944 431 409 293 24 11285 1413 --
NM_001542chr171981 1969 1918 1856 1114 1067 69 22573 159 --1312
NM_001543chr544296 1479 792 753 1435 24420 4258 24710 829
NM_001650chr1863371 3184 2612 1412 1154 26 1745 ----
NM_001683chr362710 893 669 592 284 79 ----1995
NM_001754chr2184120 4104 3127 3094 1154 1035 787 763 --12888 --
NM_001759chr1264569 4307 4137 4076 1190 734 41974 1625 1304 806 --13986
NM_001858chr6114554 4402 4358 3819 3784 3762 3735 3592 1563 1296 129 24412 3769 ----
NM_001874chr12145000 4698 4233 4193 4083 3769 3735 3630 3584 3232 1470 1286 636 588 44834 3908 3797 1497 11941 --
NM_001918chr1147578 7248 7177 7042 6736 6265 5921 2541 2496 2409 2133 1807 610 480 68201 7686 7584 6046 6016 2793 36795 6354 628 16804
NM_001987chr1232891 1725 172 11248 33743 3302 1304 1852
NM_002025chrX118412 7919 7275 6778 3544 3258 2256 2239 1605 395 344 13497 16421 17267
NM_002033chr1143737 3518 3123 1413 33199 2542 1441 --1934
NM_002040chr2173168 2678 2190 2009 1020 575 234 12650 ----
NM_002214chr7105077 3651 1438 1368 1348 1303 1054 936 536 479 23704 1182 ----
NM_002223chr1264007 3336 3208 3119 2441 1402 13540 23804 663 --
NM_002264chr385010 4605 4191 3635 3316 3178 1037 591 ------
NM_002285chr274004 2856 1529 784 682 346 259 13456 ----
NM_002310chr566151 6088 5937 5734 2422 1859 15715 11010 --
NM_002336chr1254514 2020 1446 989 921 1104 1448 14399
NM_002387chr5104809 4322 1937 1850 1185 1116 711 616 593 339 31074 538 64 11520 --
NM_002581chr975518 4895 4461 3665 2056 1838 1757 15631 24231 4017 13543
NM_002716chr11103066 3034 3009 2896 2673 2604 1268 357 330 307 ------
NM_002837chr1274351 4316 4140 3379 481 397 165 13887 ----
NM_002839chr952968 2455 939 758 255 ----12437
NM_003034chr1277364 6742 6631 6497 5380 2981 1135 46374 2862 922 304 --16172
NM_003045chr1383848 3751 3584 3518 3444 1960 840 438 11440 23184 206 23929 319
NM_003051chr141419 628 455 105 11407 --11836
NM_003108chr276959 6355 4588 4534 2099 1785 1029 36726 2546 398 26011 882 --
NM_003161chr1753267 3052 1027 620 130 12946 --12492
NM_003199chr1845580 3780 2108 144 --11574 13498
NM_003203chr221777 813 ----12245
NM_003298chr3145448 5171 4905 4857 4536 4394 4371 4130 3905 2141 1757 839 720 147 21810 1782 --14323
NM_003320chr1184434 4397 4206 1077 707 585 180 68 --23653 1398 23861 1696
NM_003376chr651871 1633 1454 1169 336 21201 727 --2719 715
NM_003376chr651871 1633 1454 1169 336 21201 727 --2719 715
NM_003409chr1841091 926 913 129 ----1450
NM_003421chr1063963 3673 3654 3260 1040 140 33385 3301 462 1623 --
NM_003439chr773304 3292 3169 2981 2573 2428 452 12455 --13469
NM_003474chr1042252 864 674 340 134 2626 554 1947
NM_003507chr251412 782 767 555 218 1775 ----
NM_003574chr1864889 4880 4245 3845 526 196 34451 2299 2005 24416 3602 --
NM_003590chr274024 3750 3200 2479 1291 1210 813 --13642 --
NM_003607chr163604 2944 2877 1602 971 128 43705 339 301 198 ----
NM_003644chr1776198 5292 5183 5103 2599 2414 1121 26095 194 46074 6046 1170 151 15648
NM_003759chr444030 1261 409 292 11363 --1572
NM_003816chr841508 1400 1127 992 ------
NM_003983chr16114468 3552 3018 3005 2939 1633 1593 1505 1208 280 35 1808 23556 2964 23046 761
NM_004028chr1863371 3184 2612 1412 1154 26 1745 ----
NM_004170chr931536 1376 338 ----1710
NM_004171chr11149185 8175 7075 6773 5912 2554 2279 2082 1720 1618 1387 619 589 168 39046 7543 1957 11255 --
NM_004172chr561691 1536 1530 786 663 452 1542 11612 1546
NM_004200chr1152672 2313 1273 621 356 32982 704 585 3641 299 291 1304
NM_004227chr7133127 2866 2718 2606 2384 2334 2089 1148 740 519 370 343 92 12593 1391 --
NM_004253chr93967 898 76 ----2888 630
NM_004293chr983853 3349 3320 3139 3033 1217 998 930 ------
NM_004296chr1493784 3592 2859 2843 2647 1376 995 546 381 --149 21343 77
NM_004311chr1042418 916 647 316 42288 2199 618 552 1449 22039 1035
NM_004321chr283112 2788 2219 2206 1321 1294 513 498 32839 829 311 53327 2270 832 502 99 23324 2971
NM_004338chr18125495 4875 4457 2630 2322 2087 1967 1686 1467 846 349 230 --14584 --
NM_004370chr631968 1547 118 ----11427
NM_004397chr1183907 3719 3605 2643 915 859 498 131 ------
NM_004429chrX61216 450 295 280 260 34 --1287 --
NM_004464chr443522 3500 618 389 ------
NM_004485chr194249 3656 3483 3337 3254 3179 1480 957 740 33090 2924 1316 11690 --
NM_004505chr1731581 293 24 ----1212
NM_004703chr1742245 2067 1822 941 1303 --1441
NM_004726chrX95097 5037 4643 3983 2148 1970 1483 722 468 12271 ----
NM_004745chr886640 6214 5384 4367 1166 434 255 135 25476 5110 --21520 558
NM_004747chr1041432 1296 248 235 1155 11550 11517
NM_004748chr1574118 3536 3303 3137 2972 2649 1610 --1929 --
NM_004798chr2043551 3488 2472 2369 32458 1417 1028 13481 11156
NM_004815chr144768 3556 1675 246 --13674 --
NM_004863chr1474514 4057 3436 3425 1701 1565 46 24870 4072 --14712
NM_004904chr796076 5889 5226 5015 4824 4246 2259 1806 474 21352 393 11693 --
NM_004912chr741370 1204 1079 561 ------
NM_004936chr921903 391 22313 1196 22826 638 1778
NM_004952chr13808 787 201 --1612 2659 655
NM_004976chr11104957 4917 4650 4042 3525 1925 884 475 379 148 54612 4606 4535 4263 346 22066 1832 --
NM_004983chr16355 335 325 318 48 42 1275 --21447 436
NM_004985chr1274080 3744 3462 3046 2925 1534 917 1721 ----
NM_004992chrX218118 8048 7666 7232 6742 6042 5457 2987 2158 2126 964 895 791 620 495 486 471 316 300 286 47 22631 364 65747 3163 3134 1866 1315 810 --
NM_004992chrX218118 8048 7666 7232 6742 6042 5457 2987 2158 2126 964 895 791 620 495 486 471 316 300 286 47 22631 364 65747 3163 3134 1866 1315 810 --
NM_005065chr1464948 4547 1652 887 881 554 ----14088
NM_005076chr173893 3833 3167 3019 725 404 51 --54208 3955 3933 1130 221 13034
NM_005105chr151611 1433 1394 499 404 1288 --1657
NM_005116chr2064174 4086 3931 3110 2964 1532 1126 12980 --
NM_005188chr11167301 7202 6230 5912 5779 5366 5303 5265 5035 2516 2177 2110 1873 1475 1440 1112 47912 7479 6859 902 36668 3005 443 16422
NM_005207chr22143652 3560 3514 3501 3191 3185 3116 3075 2671 2610 2478 1057 758 593 13203 ----
NM_005235chr286086 5183 4919 4830 2009 1065 958 195 26990 1868 ----
NM_005329chr1691872 1860 1847 1841 1629 1623 762 265 71 --12085 --
NM_005338chr7103958 3628 3487 3447 3390 3317 3127 2567 1552 1149 43655 1564 1493 1114 ----
NM_005359chr1894851 4465 4414 4245 2265 1409 1254 682 202 36326 4586 387 35166 4211 2123 1154
NM_005385chr382436 2395 2346 2216 831 510 173 116 --1937 --
NM_005397chr773911 3296 3074 2747 2635 1239 1117 53733 3518 3416 2799 1345 22751 1229 --
NM_005399chr174320 4053 2853 2706 1459 923 680 1790 --12833
NM_005436chr1053771 3106 831 561 195 12837 22859 2630 12681
NM_005440chr1743296 3112 2552 1121 ----32185 663 114
NM_005497chr17155879 5518 4971 4228 4147 4066 3936 3724 2396 2166 2102 1752 1631 263 193 36112 5338 4881 ----
NM_005504chr12116565 6245 5666 5469 4877 4174 4108 2379 1842 1646 306 26135 60 ----
NM_005526chr84359 353 328 68 --1381 1364
NM_005596chr995801 5147 3971 2029 1666 1631 1394 1336 1205 44438 2310 2291 206 14697 --
NM_005665chr184578 4038 3954 3851 3083 1027 446 357 1516 14375 --
NM_005748chr1242937 2670 1048 90 --1404 12726
NM_005759chr263648 3431 2945 1324 863 807 12994 ----
NM_005902chr1554102 3877 3127 1746 655 21785 1460 24228 864 14048
NM_005903chr575019 4026 3296 1347 613 98 72 24201 1481 --23329 1352
NM_005920chr193296 3173 2497 1563 1434 809 715 690 358 33350 2539 512 --1405
NM_005941chr863907 3535 2597 1138 640 549 12860 ----
NM_005955chr1104395 2028 1984 1674 1442 684 626 526 511 129 21866 1730 11554 --
NM_005964chr1771471 1427 1252 1137 1061 195 38 --1394 --
NM_006007chr973768 3108 2808 2762 1667 1123 260 13652 11405 24271 171
NM_006016chr642248 2213 666 325 11822 --12230
NM_006180chr951752 508 392 354 178 --146 --
NM_006197chr832018 1396 869 1179 --12122
NM_006203chr595293 5213 4886 3602 2163 1628 1479 913 262 23637 2031 1308 --
NM_006282chr20103221 1840 1709 1636 1502 1460 1443 1434 787 583 23533 3055 ----
NM_006306chrX145588 5511 4898 4835 4431 4089 3805 3639 1492 1334 790 626 566 504 45671 5195 1078 821 25044 824 14840
NM_006364chr1431150 1075 93 1504 --1323
NM_006393chr1084331 3591 3437 3289 3091 804 503 131 23756 66 ----
NM_006434chr1073165 2508 881 815 500 180 121 1128 1701 --
NM_006544chr1474857 4660 4187 1946 1700 1282 638 14326 ----
NM_006547chr752115 1643 698 304 138 31332 50 32 ----
NM_006599chr16118135 7112 7001 6859 6269 5596 5520 5461 2707 2267 568 23033 598 12232 --
NM_006620chr653775 3296 3238 1363 675 34501 1946 1215 1419 --
NM_006629chr1892870 2778 2492 2319 2075 2053 741 682 299 1114 ----
NM_006690chr2052236 2118 1694 836 279 --62122 1698 1562 1445 630 552 12246
NM_006729chrX85392 5243 4391 3893 2022 1000 945 756 14402 ----
NM_006738chr1594468 3628 3569 3534 1352 1254 1053 731 24 13331 23542 958 11029
NM_006750chr16107073 6793 6196 5034 2133 1880 1590 1281 333 188 46726 5947 1981 999 1477 --
NM_006912chr152548 1984 857 760 493 1435 12047 --
NM_006924chr1753519 1321 547 367 203 23220 834 13616 --
NM_006943chr2093204 3022 3016 2572 2080 957 183 170 151 --43215 2525 2269 2049 --
NM_006948chr2152453 2372 2027 1896 478 11635 11948 --
NM_007007chr1263726 3296 3186 1294 1128 764 14063 ----
NM_007011chr15116390 5957 4982 4948 4942 4926 4617 2636 2325 2245 156 36373 5593 1586 35045 4967 2329 15059
NM_007030chr5223929 3876 3841 3806 3800 3771 3736 3701 3666 3631 3221 2083 2052 2021 1990 1959 1928 1897 825 498 421 372 23969 1831 33503 1656 104 --
NM_007038chr2165860 5583 5460 4170 3882 1404 13722 --14253
NM_007050chr20127966 6972 6250 3166 2991 2981 2358 2091 1654 1584 1046 503 26430 2224 22900 1871 16784
NM_007073chr654117 3168 2805 1197 707 53450 2815 1373 1302 31 ----
NM_007200chr1594468 3628 3569 3534 1352 1254 1053 731 24 13331 23542 958 11029
NM_007249chr13129421 9250 8597 6992 6002 3330 1894 965 938 901 315 241 47664 7437 6244 2850 22492 553 --
NM_007327chr9163 ----455 51 47 43
NM_012072chr2083437 3155 3075 3041 2910 902 781 619 --11161 21562 967
NM_012104chr1183640 3459 3374 2718 916 695 615 488 43717 2949 647 24 ----
NM_012104chr1183640 3459 3374 2718 916 695 615 488 43717 2949 647 24 ----
NM_012137chr142755 2441 360 42 --21154 646 12585
NM_012141chr1333720 2975 1388 1788 --1784
NM_012164chr9106771 6445 5412 4997 4940 2756 2534 2392 1178 1044 22226 1981 12831 --
NM_012214chr2105992 4876 4304 4120 2555 2458 2273 1443 976 52 11470 11632 --
NM_012250chr114926 251 177 98 ------
NM_012252chr754913 4758 3799 934 476 21414 973 ----
NM_012262chr174114 3850 3464 1974 1163 1010 190 --24586 135 --
NM_012287chr383995 3293 3264 3079 1420 1375 920 297 1242 ----
NM_012309chr1154370 3529 1757 1119 1041 31259 568 353 24440 1707 --
NM_012316chr1115565 5523 5119 4796 4345 3779 3609 3468 2216 957 299 35499 5146 178 1454 1182
NM_012334chr5124396 4079 3842 3802 3262 2994 2915 1867 1617 1037 864 495 24027 1497 24432 3651 --
NM_013231chr1464046 3891 3295 1039 488 32 11648 --23179 2954
NM_013255chr798272 7078 6084 2547 1822 1121 1078 533 308 57990 7488 2234 1192 602 25504 2857 --
NM_013261chr483541 2977 2914 2849 2838 1308 989 52 22448 216 11045 --
NM_013286chr383614 3388 3293 2596 2447 1260 925 512 33781 865 687 11389 --
NM_013401chr115965 796 322 140 79 4176 124 111 37 4832 746 179 127 --
NM_013943chr163221 2887 2652 2425 2256 138 22228 608 1392 --
NM_014028chr672814 2646 2526 2469 973 897 206 12455 ----
NM_014048chr1673536 3327 3270 1500 779 505 466 31725 393 77 33445 1714 396 --
NM_014112chr865040 4569 4407 4339 4263 3556 34286 3459 465 25471 1048 --
NM_014141chr784974 4940 4300 3963 3687 1849 1036 126 34540 3839 1192 ----
NM_014157chr1674021 3364 2827 1134 812 589 372 43505 3423 3221 997 ----
NM_014186chr1142155 918 804 117 --31434 430 103 2923 475
NM_014240chr3123858 3650 3278 1535 1235 1074 947 761 692 643 626 380 13885 ----
NM_014309chr22113952 3761 3726 3640 3393 3344 1645 651 543 501 326 53499 1981 1519 1101 909 1706 21166 389
NM_014331chr446322 5703 1529 278 --16620 --
NM_014368chr981659 1629 1451 1392 865 646 634 574 1224 11572 --
NM_014586chr2184508 4369 4110 1860 1562 1271 1128 1012 21634 1555 31538 1466 859 --
NM_014630chr1573791 3059 2666 1600 779 680 407 --33329 832 684 --
NM_014634chr22103617 3564 3277 3108 1401 1370 1357 487 209 94 --33175 2771 87 11256
NM_014711chr1651975 1391 696 581 79 11552 ----
NM_014746chr253298 3253 2737 1368 203 23132 3074 1278 2933 402
NM_014747chr1135582 5441 5086 4793 4787 4645 2262 1845 1740 1646 1600 1558 1277 21512 660 1861 --
NM_014755chr264168 3957 2965 2643 782 623 14235 32917 2913 1504 --
NM_014772chr18123294 3247 2941 2546 2471 2362 1296 1242 519 433 79 67 22695 2587 43206 2572 850 151 33324 3320 124
NM_014783chr1551625 1175 647 506 420 ----11376
NM_014826chr163604 2944 2877 1602 971 128 43705 339 301 198 ----
NM_014864chr184040 4023 2955 2818 1734 1459 1362 1097 54343 3032 543 119 43 --24310 2823
NM_014870chr1144379 4199 3771 3623 3497 3264 3119 3033 1535 1353 1325 718 606 476 11126 74373 3486 1487 1227 897 893 223 13483
NM_014877chr1796178 6090 6044 5875 4840 2860 1799 1778 641 12142 25273 1621 --
NM_014906chr1773908 3863 3693 3343 1593 1178 73 12589 1934 --
NM_014920chr643608 3555 458 350 32857 1435 1206 13623 --
NM_014921chr1982515 2269 2246 2234 1975 497 484 90 31134 490 81 1193 --
NM_014924chr1482920 2289 2047 1154 597 504 337 90 ------
NM_014946chr252877 2801 2771 661 593 12552 ----
NM_014947chr172975 2945 2538 2250 2133 1241 1188 --22566 1147 1314
NM_014962chr2092881 2486 781 704 570 489 424 163 125 ------
NM_014989chr641801 1769 1605 64 195 ----
NM_015020chr1652701 941 850 293 246 2966 127 23754 1245 12835
NM_015026chr1263790 3712 1152 996 94 33 24232 3605 ----
NM_015035chr20106658 6519 5002 4828 2606 2143 1947 1527 865 299 24801 2515 2494 146 --
NM_015039chr143012 2810 1088 1055 23650 188 33399 1540 1318 13296
NM_015042chr15113543 2760 2690 1649 1546 1322 1099 1019 704 433 85 1141 --22753 945
NM_015046chr942152 1857 844 265 2654 477 1992 1919
NM_015059chr1593481 3180 3063 2914 2754 2457 1212 1050 314 31243 432 55 33273 2847 58 --
NM_015071chr5115848 5705 5475 4721 4111 4084 3942 2541 2064 1994 1511 64599 4400 4139 3969 2553 874 1501 1347
NM_015074chr1144930 4026 3891 3748 3441 3299 3066 1946 1732 1433 1256 740 415 290 11283 ----
NM_015090chr195491 4991 4630 2231 2042 1891 1143 526 489 45640 4926 1605 990 ----
NM_015092chr16103675 3505 1862 1699 922 589 287 169 70 42 11071 ----
NM_015192chr2052866 1943 1068 861 304 12184 1733 --
NM_015205chr1394398 3703 3568 3294 3260 1507 967 793 257 1944 24287 1075 11823
NM_015208chr1883990 3773 3565 3219 3144 2819 2808 1433 ------
NM_015245chr662353 2093 1826 601 376 353 ----22401 507
NM_015247chr1684950 3615 3388 3287 2137 2064 997 916 34427 1224 38 ----
NM_015271chr452677 1216 628 302 262 42968 1232 1144 939 ----
NM_015275chr1241975 1765 704 137 21713 1351 ----
NM_015313chr1184760 4754 4069 3574 1348 911 766 533 11229 ----
NM_015317chr242399 2032 854 580 1900 1987 1918
NM_015328chr752937 2492 1126 964 695 ----11956
NM_015375chr1124255 3655 3518 1919 1742 1472 1178 1057 876 696 335 162 54328 3645 1946 1630 295 24664 145 13729
NM_015385chr1073165 2508 881 815 500 180 121 1128 1701 --
NM_015455chr563873 3319 798 206 171 21 22948 770 23575 1592 --
NM_015535chr293795 3606 3449 2620 1152 1017 900 714 381 --33468 1062 240 --
NM_015553chr664673 4322 2019 764 627 566 14055 ----
NM_015564chr583378 2470 2325 1388 1314 780 362 32 11346 12266 --
NM_015569chr153930 3501 1517 365 357 --23351 1352 --
NM_015571chr642644 2163 131 65 12209 12372 --
NM_015575chr272630 2624 2461 884 684 457 271 --1510 13011
NM_015640chr175155 4395 3899 3349 2006 1798 776 14663 24121 1110 --
NM_015691chrX42026 1913 324 222 1305 12474 12497
NM_015886chr874331 4155 1905 1562 1099 865 773 ------
NM_015995chr15105205 4916 4783 4688 4462 3631 1884 1853 779 573 35271 1538 364 --23434 1164
NM_016018chr832082 2053 665 ----22611 1797
NM_016257chr172972 2956 1303 1266 1100 959 191 --23367 2702 --
NM_016260chr2116860 6003 3003 2762 2445 1733 1331 821 730 367 150 21674 1645 15315 --
NM_016275chr372047 1908 1087 743 484 165 91 ------
NM_016297chr273653 2549 2460 2300 1278 570 92 --21351 1113 --
NM_016315chr2178 1465 11546 11611
NM_016513chr643608 3555 458 350 32857 1435 1206 13623 --
NM_016530chr1534001 3260 373 23509 1037 23512 2677 12770
NM_016544chr293755 3196 3177 2513 1092 861 455 292 160 1794 11079 --
NM_016617chr1362097 1813 1768 1576 478 79 11711 ----
NM_016953chr2126063 5091 4344 4140 3943 3864 2463 1947 1888 1731 703 302 35081 1151 818 ----
NM_017563chr3166076 5877 5629 5603 5436 4565 4434 3979 2428 2420 1603 1568 1488 1302 676 481 15904 56033 4634 4540 4211 2286 --
NM_017580chr1032252 621 411 42205 965 237 185 12086 --
NM_017594chr933176 1293 958 --11297 22696 400
NM_017628chr484666 4238 2049 1534 543 294 249 241 ------
NM_017633chr64742 457 47 41 ----13830
NM_017637chr9149166 8069 7650 7433 7261 7131 6391 6005 3210 3081 1954 1428 1225 638 --12863 12497
NM_017644chr354726 4312 4208 3850 560 33867 858 650 1861 11702
NM_017650chr7106071 5495 5044 4739 4372 4111 1458 1182 764 525 14505 ----
NM_017658chr1463973 3031 1237 916 659 310 1428 ----
NM_017693chr1361197 370 194 182 144 67 1242 1384 --
NM_017770chr662939 2179 2151 1977 1190 992 21999 520 ----
NM_017787chr1062692 2254 2166 780 748 434 32883 2534 2094 21794 1064 12116
NM_017801chr352164 2020 806 178 136 ----11048
NM_017831chr1863990 3049 1555 1135 412 260 34167 751 725 --24517 4493
NM_018014chr251350 1251 1050 950 508 1128 ----
NM_018036chr1454283 3735 3081 3041 576 23635 413 13109 --
NM_018045chr152266 2178 736 518 319 42724 2072 950 832 22139 1226 --
NM_018085chr1137200 6962 6150 3179 3094 2560 2396 2228 1777 1731 1356 886 504 36312 3286 1804 26276 431 45392 5286 3290 675
NM_018155chr362840 2768 1018 1001 361 276 ----186
NM_018243chr444037 3908 1080 955 2505 307 --1734
NM_018313chr372075 1808 1729 818 742 607 148 ------
NM_018356chr551033 504 419 379 126 1447 ----
NM_018373chr14136414 6308 5599 5362 4705 4272 2588 2550 2091 1951 1920 1462 1329 35437 5089 1495 12124 11334
NM_018440chr8107141 6850 6610 6325 6279 6187 3065 2345 1732 221 46352 5920 3229 169 ----
NM_018638chr1254782 3685 1876 1531 1099 14032 --11306
NM_018708chr1951566 1379 416 212 101 --41353 557 553 149 11350
NM_018711chr1281526 1514 1460 1330 1200 999 659 305 ----11573
NM_018717chr452629 2237 1027 565 398 22056 425 22059 1830 --
NM_018999chr1064278 3889 3593 3291 1037 250 11924 ----
NM_019001chr353916 3851 1900 359 145 33420 3227 3213 13896 --
NM_019072chr594210 3345 3217 3131 3007 1678 1633 172 69 14170 ----
NM_019859chr1081568 1480 1427 1234 1178 1146 1136 223 21227 397 ----
NM_019860chr1081616 1528 1475 1282 1226 1194 1184 271 21275 445 ----
NM_020122chr285640 4655 3890 3675 2191 1260 1254 21 34882 3702 967 25121 4645 --
NM_020133chr675398 4679 4391 2509 2216 1486 555 16305 11660 12319
NM_020245chr663757 1613 548 478 354 323 25050 3102 1695 --
NM_020405chr1784056 3929 3573 1675 1011 835 637 48 11171 21192 843 --
NM_020440chr193254 2796 2203 2034 1058 840 478 168 63 ----12684
NM_020455chr642048 1909 107 77 1477 --1650
NM_020466chr664746 4397 3665 1694 569 483 1940 23868 739 --
NM_020647chr832171 1589 108 11730 11993 1100
NM_020673chr20107646 7210 7098 6507 6152 5385 5312 5014 4800 1931 36681 6288 5984 ----
NM_020718chr1686368 5940 4921 4285 2490 2206 1792 1303 ----25076 674
NM_020727chr2153652 980 751 380 31 ----11037
NM_020728chr7103008 2972 2795 2376 2191 2130 974 803 152 72 12123 ----
NM_020739chr1574118 3536 3303 3137 2972 2649 1610 --1929 --
NM_020766chrX93284 3045 1847 1288 1227 1071 710 683 430 --22999 176 --
NM_020813chr1972581 1832 1119 899 506 392 246 11045 11872 --
NM_020844chr8137031 6556 6168 5563 5071 4870 2973 2765 2191 1544 1532 846 464 34689 2025 721 ----
NM_020850chr1683159 3105 2702 2329 2189 1145 536 483 52961 2894 1035 750 105 23031 1224 --
NM_020917chr1983874 3828 3475 3099 2463 1031 848 699 13233 12549 --
NM_020951chr1982454 1967 1903 1840 1774 1601 1511 414 11655 ----
NM_021020chr8113372 3169 3045 2788 2419 1409 855 734 582 204 47 12331 22831 586 13349
NM_021096chr22113039 2829 2806 2544 2371 2360 2307 2207 1143 878 652 33121 2465 273 22887 75 12086
NM_021116chr7208710 8367 8118 7909 7880 7521 6976 5888 5774 2839 1912 1897 1763 1615 1284 692 568 434 180 144 22667 1236 26170 2477 11776
NM_021569chr9163 ----455 51 47 43
NM_021629chr353516 3239 3193 1900 405 33368 1927 624 11454 1419
NM_021638chr494764 4400 4029 3854 3517 3319 3173 1528 1011 1617 31980 1866 301 21960 1359
NM_021645chr1352292 1976 1707 558 181 ------
NM_021647chr464491 3966 3939 3797 1602 677 14343 --1226
NM_021813chr6125831 5222 4978 4878 3962 3604 1240 1048 828 387 226 215 25071 1603 15437 11121
NM_021815chr272790 2703 2619 1968 1124 355 230 12336 ----
NM_021911chr555500 4389 1059 356 242 1562 11517 14227
NM_021949chrX72831 2495 2278 2049 1035 522 194 12068 ----
NM_021961chr1177443 6677 5821 2361 2355 1953 1063 35346 2564 356 --11510
NM_021964chr356259 5345 5133 4420 4242 ----1428
NM_022114chr193970 2965 1645 1486 1273 1033 767 497 262 2708 321 1748 --
NM_022166chr1695197 4973 4438 2221 1977 1533 1044 993 307 --24063 2204 11996
NM_022340chr3103481 3368 3326 3181 3144 2814 2713 2308 958 824 63708 1398 985 457 448 63 173 1829
NM_022459chr1375018 4299 2011 1369 1213 390 282 36228 5264 449 ----
NM_022473chr15104099 4000 1456 1327 1081 724 672 241 210 124 21483 558 --11332
NM_022477chr2041370 1235 371 293 21117 454 --21655 1524
NM_022719chr2293676 3613 3425 3306 3098 2858 1313 1112 780 32715 1140 800 23578 3331 13362
NM_022898chr1494628 4408 1567 1480 1357 1132 882 815 188 11768 ----
NM_022912chr282571 2266 1115 885 732 709 600 345 11944 --11983
NM_024345chr975985 5148 2182 1432 582 552 176 21752 788 --15409
NM_024590chr4----11612 11233
NM_024665chr343212 3080 1508 371 11370 ----
NM_024740chr1193440 3228 3203 3067 1212 1169 1142 1136 772 22947 229 13755 1253
NM_024761chr985045 4953 3731 3683 3504 1735 1213 911 1212 11001 --
NM_024770chr2105877 5439 5055 4990 4811 2099 1610 1090 782 693 24196 2126 26388 4655 1698
NM_024881chr1993211 3121 3075 2529 1493 1234 1055 482 359 11261 33276 515 187 --
NM_024947chr3158817 8659 8460 7576 7486 7146 6481 3182 2636 1716 1588 1223 981 821 508 28073 3047 ----
NM_024949chr4104418 4272 4083 3949 3811 3076 1665 1246 468 304 34118 1804 896 ----
NM_024989chr297571 6366 6277 2677 2363 2318 1494 1006 85 37755 6283 1212 11732 --
NM_024991chr1073165 2508 881 815 500 180 121 1128 1701 --
NM_145259chr275982 5754 2741 2158 2042 136 109 21953 1078 11173 --
NM_145307chr1033969 233 223 33329 1544 303 21407 284 11548
NM_145912chr2294319 4271 3771 3326 3245 2995 1613 1129 515 63132 3022 1107 733 609 563 64469 3568 1246 1242 523 236 13156
NM_147147chr654117 3168 2805 1197 707 53450 2815 1373 1302 31 ----
NM_152263chr1126104 6003 5700 5016 4883 4363 4193 4013 1982 1725 1444 1145 45580 3901 2155 1902 ----
NM_152380chr121475 1200 ----1369
NM_152699chr383597 3462 3078 2959 2868 2615 2283 91 32703 2676 270 ----
NM_152754chr753595 1071 856 461 407 33671 845 726 ----
NM_152890chr11322 169 --173
NM_152924chr15116390 5957 4982 4948 4942 4926 4617 2636 2325 2245 156 36373 5593 1586 35045 4967 2329 15059
NM_153035chr183132 3043 2918 2654 2518 1136 431 165 ----33048 140 33
NM_153042chr651593 1514 1323 734 399 1501 2712 680 --
NM_153235chr642077 1793 1764 1711 32171 1987 140 32058 818 255 --
NM_153456chr13106160 6145 5763 5129 4209 3840 2147 698 284 44 14957 --11665
NM_153487chr681746 1695 940 511 460 296 190 172 2897 163 13256 13810
NM_153836chr262121 2049 1832 828 222 208 --168 --
NM_170665chr12124589 3669 3598 3436 3396 3076 2817 1578 1022 903 772 320 24444 847 24387 2855 --
NM_170706chr143012 2810 1088 1055 23650 188 33399 1540 1318 13296
NM_172071chr147381 5008 2649 2335 12853 1518 15747
NM_173065chr1123097 3050 1196 1059 1046 1012 673 663 615 547 333 82 ----21299 298
NM_173214chr16118135 7112 7001 6859 6269 5596 5520 5461 2707 2267 568 23033 598 12232 --
NM_173468chr455787 5765 4985 2121 1101 14178 --11860
NM_173495chrX112467 2069 1868 1768 1652 1596 926 227 150 112 102 1407 ----
NM_173496chr1072376 2276 2186 1951 1902 1880 1042 11981 2476 424 1421
NM_173531chr1963594 3451 1456 1114 776 129 13330 ----
NM_173582chr1185747 5279 2115 1882 1638 1420 1287 381 --1782 --
NM_173602chr1283757 3307 2812 2397 1136 1012 482 208 151 ----
NM_173642chr196652 6237 5780 5726 5651 2869 1136 1045 383 27135 2056 48049 6057 3115 2059 12569
NM_173829chr586077 5959 5261 4861 1980 852 481 119 --12354 --
NM_173851chr893561 3101 1550 1489 1140 1133 923 885 793 ------
NM_175624chr12105788 5692 5152 2566 2547 2274 1537 1068 962 701 35441 2234 2228 --17070
NM_175625chr12105788 5692 5152 2566 2547 2274 1537 1068 962 701 35441 2234 2228 --17070
NM_175736chr12127109 6791 5802 5732 5538 5101 4958 2918 2611 2170 2008 1261 53116 2899 2135 1607 1559 32216 1562 1252 --
NM_175854chr1342525 2234 761 675 1968 ----
NM_175907chr1812389 1714 --22815 2017
NM_176815chr362420 1962 1836 1148 405 156 1899 ----
NM_176823chr183789 1180 1154 1049 801 381 371 63 --2959 926 12945
NM_177398chr151645 1550 461 270 78 51459 760 386 378 253 --1390
NM_177399chr151645 1550 461 270 78 51459 760 386 378 253 --1390
NM_177438chr1463931 3693 3376 2893 1018 763 2575 115 ----
NM_177538chr2188572 8484 7481 7218 6694 6560 6423 6377 6287 3263 2739 2277 2034 1700 1552 1293 984 433 22900 1727 12308 12744
NM_177972chr1184434 4397 4206 1077 707 585 180 68 --23653 1398 23861 1696
NM_177974chr1572207 2088 710 621 550 508 374 2429 120 ----
NM_178123chr24716 416 391 281 ------
NM_178151chrX117395 7273 6381 5197 1835 1551 1515 1229 664 490 482 37316 644 216 17784 --
NM_178152chrX117395 7273 6381 5197 1835 1551 1515 1229 664 490 482 37316 644 216 17784 --
NM_178153chrX117395 7273 6381 5197 1835 1551 1515 1229 664 490 482 37316 644 216 17784 --
NM_178539chr1251614 1520 654 309 179 ------
NM_178554chr3103202 3130 2464 2354 1383 1323 1223 1197 1166 214 ------
NM_181443chr2092881 2486 781 704 570 489 424 163 125 ------
NM_181481chr18125495 4875 4457 2630 2322 2087 1967 1686 1467 846 349 230 --14584 --
NM_181482chr18125495 4875 4457 2630 2322 2087 1967 1686 1467 846 349 230 --14584 --
NM_181483chr18125495 4875 4457 2630 2322 2087 1967 1686 1467 846 349 230 --14584 --
NM_181489chr3125551 5323 5167 4760 4173 2447 2095 1517 1356 1154 892 653 1332 --24408 994
NM_181491chr9112786 2660 2313 2135 1174 1070 1062 762 483 477 157 22283 1983 31976 515 57 --
NM_181521chr1687111 6597 4895 4397 1569 1541 1093 369 --2495 405 --
NM_181809chr163048 1268 1177 1131 820 731 21004 63 21427 1164 21575 566
NM_182493chr16104912 3871 3653 3510 1890 1740 1300 1165 935 480 14530 --11170
NM_182515chr19105979 5303 5215 4866 1990 1441 1184 977 845 386 65048 4756 4185 4058 54 22 21900 722 --
NM_182527chr2231765 1724 378 62118 1936 1918 848 704 458 1451 12001
NM_182898chr796076 5889 5226 5015 4824 4246 2259 1806 474 21352 393 11693 --
NM_182899chr796076 5889 5226 5015 4824 4246 2259 1806 474 21352 393 11693 --
NM_183416chr141756 1606 1345 379 --146 --
NM_194071chr795117 3835 2065 2058 1767 1093 1084 871 632 13487 ----
NM_194278chr1463910 3852 3022 2799 1522 527 23810 2626 ----
NM_194286chr1294161 1984 1845 1706 1467 826 809 630 349 33946 709 654 16041 --
NM_194314chr154608 3503 1649 1333 656 24798 2020 12023 --
NM_194434chr1864889 4880 4245 3845 526 196 34451 2299 2005 24416 3602 --
NM_194454chr741370 1204 1079 561 ------
NM_194455chr741370 1204 1079 561 ------
NM_194456chr741370 1204 1079 561 ------
NM_198056chr372022 2003 1945 646 607 231 169 12154 32046 1926 1506 2207 146
NM_198320chr12145000 4698 4233 4193 4083 3769 3735 3630 3584 3232 1470 1286 636 588 44834 3908 3797 1497 11941 --
NM_198465chrX92681 2670 2414 1956 1948 670 286 277 48 32324 2181 846 1894 --
NM_198595chr494764 4400 4029 3854 3517 3319 3173 1528 1011 1617 31980 1866 301 21960 1359
NM_198859chr394992 4334 4229 4117 3902 3527 1253 1214 1178 21093 1017 14173 11021
NM_198900chr12127109 6791 5802 5732 5538 5101 4958 2918 2611 2170 2008 1261 53116 2899 2135 1607 1559 32216 1562 1252 --
NM_199160chr981600 1570 1392 1333 806 587 575 515 1165 11513 --
NM_199421chr1465005 4637 3976 3836 310 95 23581 1357 ----
NM_199436chr252877 2801 2771 661 593 12552 ----
NM_199454chr193970 2965 1645 1486 1273 1033 767 497 262 2708 321 1748 --
NM_199462chr1124255 3655 3518 1919 1742 1472 1178 1057 876 696 335 162 54328 3645 1946 1630 295 24664 145 13729
NM_201432chr1776198 5292 5183 5103 2599 2414 1121 26095 194 46074 6046 1170 151 15648
NM_201433chr1776198 5292 5183 5103 2599 2414 1121 26095 194 46074 6046 1170 151 15648
NM_201570chr1061748 1259 737 560 409 357 1481 ----
NM_201571chr1061748 1259 737 560 409 357 1481 ----
NM_201572chr1061748 1259 737 560 409 357 1481 ----
NM_201590chr1061748 1259 737 560 409 357 1481 ----
NM_201593chr1061748 1259 737 560 409 357 1481 ----
NM_201596chr1061748 1259 737 560 409 357 1481 ----
NM_201597chr1061748 1259 737 560 409 357 1481 ----
NM_203327chr2064174 4086 3931 3110 2964 1532 1126 12980 --
NM_203350chr141709 1633 1282 332 ------
NM_206855chr694615 4168 3960 2114 2037 1062 681 570 467 1833 ----
NM_207306chr153691 1677 1538 232 196 261388 1352 1316 1280 1244 1208 1172 1136 1100 1064 1028 992 956 920 852 816 780 744 708 672 636 600 564 528 492 456 2365 329 --
NM_207380chr1553111 2778 2717 2396 723 13219 23313 852 32580 2427 868
NM_207481chr24986 587 404 191 2446 128 1177 --
NM_213589chr284730 4169 2169 1322 1226 1002 769 656 15386 ----