TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3127-3p
miRNA Sequence: UCCCCUUCUGCAGGCCUGCUGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000719chr1254807 4515 4378 2229 439 15815 36596 2416 2234 24367 802
NM_001043318chr1451496 1198 1073 952 736 --31155 978 52 33806 79 73
NM_002501chr19133628 3501 2663 1466 1421 1155 1033 891 742 704 641 507 88 11049 2429 249 31472 917 644
NM_003099chr1535385 4739 1404 45496 5322 4975 4281 --56296 5502 4961 4900 4388
NM_003108chr2116996 2681 2502 2468 2362 2324 2296 1793 1718 657 34 24689 1687 42219 1943 1931 403 32227 420 138
NM_003482chr1252157 1886 1706 949 633 12221 2791 248 42160 1889 290 70
NM_003498chr1662713 2599 1899 735 456 95 --21935 57 2985 980
NM_004397chr1174153 3396 3374 3172 1399 1212 1121 21084 274 13926 23987 304
NM_004774chr1763012 817 566 396 295 78 12064 32903 277 266 --
NM_004992chrX68154 7264 6125 3223 2577 1870 37530 7293 914 47823 2583 903 665 27542 7271
NM_004992chrX68154 7264 6125 3223 2577 1870 37530 7293 914 47823 2583 903 665 27542 7271
NM_005477chr1572371 2001 1770 1674 425 241 224 ----21754 231
NM_005477chr1572371 2001 1770 1674 425 241 224 ----21754 231
NM_005920chr1103635 3613 3558 3433 1522 1096 813 801 793 756 21029 500 33640 323 283 23458 210
NM_005937chr17134135 3830 3462 3227 2761 2752 1147 487 434 386 330 59 38 53399 2689 1126 893 176 23070 581 23978 2798
NM_005938chrX51004 976 489 240 189 1209 11156 31141 988 202
NM_006203chr535102 4833 1719 24375 1694 --25205 4998
NM_007050chr2096775 5536 2915 2636 1882 1554 1480 917 169 --32963 953 722 12034
NM_014293chr2273805 3787 3569 3251 3202 3077 676 13512 23894 56 53630 3388 683 451 349
NM_015090chr1136139 5020 4470 4143 2344 2302 2138 2078 2058 2016 1759 1680 248 12039 --31619 56 48
NM_015315chr5113135 3039 3012 2997 2819 2758 2321 258 245 95 38 185 130 --
NM_015686chrX72160 1949 1663 1614 1013 635 624 1389 2676 71 22014 1902
NM_017590chr22122494 2333 1989 1082 948 921 731 382 261 90 72 41 --1266 21718 907
NM_020766chrX33188 1820 1813 24248 3652 11834 13295
NM_022648chr284097 3610 3600 3092 3075 1797 854 735 44016 3194 414 161 33478 3118 40 2167 55
NM_032932chr17134899 4883 4751 2141 2094 2069 1405 1395 797 774 544 243 171 11447 22324 533 26329 1408
NM_033133chr1763429 3158 2865 2731 2519 33 --21066 827 2472 40
NM_033551chr5113135 3039 3012 2997 2819 2758 2321 258 245 95 38 185 130 --
NM_052906chr22204639 4363 4171 4025 4007 3714 3425 3242 3228 3108 1896 1778 1468 1216 1158 1038 1011 823 539 61 14485 44650 4092 2043 516 23248 2039
NM_133170chr2096775 5536 2915 2636 1882 1554 1480 917 169 --32963 953 722 12034
NM_148955chr1535385 4739 1404 45496 5322 4975 4281 --56296 5502 4961 4900 4388
NM_152826chr1535385 4739 1404 45496 5322 4975 4281 --56296 5502 4961 4900 4388
NM_173595chr12105053 4515 4445 4284 4084 3993 3907 3762 977 795 11724 74847 1728 1612 1325 1114 535 110 44580 4061 3375 120
NM_213589chr222056 1105 35039 4759 1561 1582 22194 307