TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3127-5p
miRNA Sequence: AUCAGGGCUUGUGGAAUGGGAAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000020chr1291716 1708 1590 1571 535 432 420 373 218 ------
NM_000037chr882497 2466 2413 1884 1817 1786 1713 599 31670 811 64 ----
NM_000044chrX195 1143 ----
NM_000046chr5102756 2564 2462 1077 907 853 789 765 729 252 ------
NM_000052chrX53080 2480 1253 1126 808 ----1178
NM_000053chr1351566 645 197 157 142 21551 120 ----
NM_000055chr31317 ------
NM_000084chrX86712 4932 4909 4406 2668 2508 1864 1745 1830 24485 355 --
NM_000088chr1721231 999 11178 1534 --
NM_000091chr232826 610 435 1421 --1994
NM_000092chr273313 3184 3053 3017 2958 1839 1644 ------
NM_000109chrX42321 1964 1809 104 ------
NM_000110chr1----1789 --
NM_000112chr595106 4721 4376 4132 3988 3960 3471 1890 620 34495 1620 1143 25367 3773 --
NM_000125chr693660 2720 1560 1308 1203 1128 794 684 376 33586 3276 842 41242 1194 1008 990 12896
NM_000129chr651323 1281 1183 1049 28 ------
NM_000138chr1532519 2340 2232 ------
NM_000141chr101994 ------
NM_000176chr563271 3053 1313 1199 929 76 23159 2859 ----
NM_000183chr21153 ------
NM_000188chr102624 217 ------
NM_000189chr232307 611 569 ------
NM_000202chrX63768 2616 1508 1496 1221 433 21515 767 ----
NM_000206chrX136 1293 ----
NM_000208chr1994571 4011 3741 3368 1842 1541 1363 447 182 --21587 1328 13189
NM_000210chr21277 1136 --11916
NM_000212chr1762141 2110 1970 1630 447 435 1382 1237 --
NM_000216chrX43226 1341 1091 764 31600 1356 319 --13012
NM_000217chr1295181 4721 4677 4635 3755 2107 1607 794 645 63823 3693 3536 1824 1618 1143 23390 624 --
NM_000237chr831446 1418 1329 1121 ----
NM_000238chr72399 75 --2276 90 --
NM_000240chrX61987 1428 809 602 312 246 21940 850 11648 --
NM_000243chr164990 683 264 39 1291 ----
NM_000244chr115620 602 515 187 63 ------
NM_000248chr312663 --12345 1660
NM_000259chr1585006 4964 4260 4153 1994 1316 999 909 24523 2467 --12408
NM_000262chr2281667 1441 1184 433 311 280 162 59 1330 ----
NM_000264chr973173 2248 2118 2079 1122 1004 110 --1712 --
NM_000267chr1762742 2637 2593 2444 368 166 ------
NM_000275chr154508 359 145 75 1112 ----
NM_000278chr10112145 1880 1736 1531 1449 913 898 891 812 603 545 11963 ----
NM_000280chr111136 ------
NM_000285chr19141 ------
NM_000304chr17----130 --
NM_000310chr111032 --11187 --
NM_000314chr1063137 3093 2662 2561 2339 133 ------
NM_000318chr862777 2659 2515 2026 663 466 22680 763 ----
NM_000319chr1221098 204 11166 ----
NM_000325chr4--160 ----
NM_000332chr6106656 6637 6578 5473 5201 4363 2298 1762 1271 362 ------
NM_000333chr311062 1169 ----
NM_000335chr351750 1596 1470 247 239 1418 ----
NM_000337chr576380 5351 1628 1601 1340 1234 1080 25118 4965 1467 --
NM_000340chr331015 270 73 ------
NM_000353chr163947 208 58 ------
NM_000362chr22103085 2957 2803 2317 1456 1435 1374 1365 777 681 12580 22771 2332 13445
NM_000368chr964410 4326 4274 4111 3734 3400 21885 1316 --1994
NM_000373chr32693 256 162 ----
NM_000398chr225734 713 653 216 49 1153 1123 --
NM_000399chr103940 865 263 2821 365 ----
NM_000408chr213181 2657 84 ----
NM_000411chr2132323 2021 183 22987 901 22071 821 22782 2092
NM_000430chr1793547 3055 2896 2556 2495 2404 1184 79 50 13501 13571 --
NM_000434chr62203 122 ------
NM_000435chr195974 688 313 135 50 ------
NM_000439chr532386 1031 615 12277 ----
NM_000445chr86989 885 820 265 197 25 --2850 377 --
NM_000448chr1132610 2261 395 ------
NM_000458chr173746 253 140 1774 ----
NM_000459chr9155 --1175 --
NM_000460chr33443 348 68 1104 1118 --
NM_000461chr393278 1635 1245 1208 1165 1159 390 302 202 33394 889 161 34381 3331 1074 1220
NM_000462chr1531859 1761 1430 ------
NM_000474chr71531 ------
NM_000476chr961271 610 453 445 307 96 --3475 460 51 11067
NM_000478chr11507 1653 --1629
NM_000484chr212744 297 124 ----
NM_000489chrX1175 11059 ----
NM_000493chr61271 1157 ----
NM_000503chr821338 36 1397 ----
NM_000533chrX31384 765 311 11835 ----
NM_000537chr1263 27 --2138 40 --
NM_000544chr6_cox_hap183108 1251 1094 876 809 558 210 104 12291 --12223
NM_000555chrX117826 6587 5712 5356 4817 2766 2309 2297 860 517 315 37507 6945 475 15752 --
NM_000572chr14403 139 95 72 ------
NM_000575chr231150 865 114 ------
NM_000598chr711312 21594 1358 ----
NM_000599chr234591 3821 3655 33987 679 601 23309 421 --
NM_000609chr1092926 2798 2708 2559 2391 694 557 321 291 --22776 943 148
NM_000610chr1172353 1050 933 812 431 382 320 22548 594 12572 --
NM_000612chr1193556 3327 3248 2963 2940 2524 125 113 55 1562 22712 2547 --
NM_000616chr1251443 1175 542 392 264 --1318 --
NM_000618chr1275518 5414 1480 1371 1173 202 55 46085 2394 2386 354 ----
NM_000618chr1275518 5414 1480 1371 1173 202 55 46085 2394 2386 354 ----
NM_000633chr1863476 1359 1159 1015 846 563 --41957 1254 790 506 11689
NM_000635chr192576 218 2497 306 --11088
NM_000678chr203318 138 126 1173 --1312
NM_000685chr31317 ----1156
NM_000685chr31317 ----1156
NM_000688chr31122 ------
NM_000693chr1521543 215 ------
NM_000719chr12126035 5868 5752 5427 5333 2649 2312 2011 1216 828 516 423 25661 5014 ----
NM_000720chr32503 27 ------
NM_000723chr1761559 1385 1308 1066 1049 648 --31616 1512 36 --
NM_000726chr221446 168 ------
NM_000789chr172245 24 ------
NM_000791chr532544 737 275 144 ----
NM_000793chr1494980 4943 4337 3776 3707 3509 3317 3284 400 21146 463 34159 4086 1264 13463
NM_000794chr5298 58 ------
NM_000801chr2031026 681 102 2894 700 1137 --
NM_000806chr511879 ------
NM_000809chr468442 6818 3412 1552 634 161 28841 7660 28052 1996 --
NM_000810chr15----1150 --
NM_000814chr1573826 3126 3108 3020 2887 2762 1314 33874 3385 3258 1363 --
NM_000815chr14449 343 159 32 --1166 --
NM_000818chr102188 128 ------
NM_000826chr41130 ------
NM_000827chr531040 591 290 32382 744 149 1844 --
NM_000829chr1112253 12103 164 11565
NM_000831chr1125987 5953 5602 5388 5326 5113 4808 4432 4178 4106 573 326 24768 799 35792 2179 1824 24445 3917
NM_000832chr95827 684 266 112 58 --1257 --
NM_000833chr1621217 89 ------
NM_000836chr195662 603 226 147 137 1728 ----
NM_000838chr632687 2575 704 22592 2557 ----
NM_000839chr32453 181 --122 --
NM_000842chr11--1531 ----
NM_000859chr521136 426 21451 291 ----
NM_000868chrX31937 1798 467 ------
NM_000870chr541331 527 279 155 --11098 --
NM_000872chr1011072 21470 1420 ----
NM_000883chr75587 537 510 451 257 --4560 493 215 146 --
NM_000883chr75587 537 510 451 257 --4560 493 215 146 --
NM_000891chr1733549 3542 289 1829 13403 1789
NM_000899chr1244020 817 703 611 13890 ----
NM_000901chr44909 640 540 284 ------
NM_000912chr8103540 3228 2864 2759 2726 2649 2251 864 840 254 33439 1329 934 12642 --
NM_000914chr62408 155 1423 ----
NM_000922chr111150 ------
NM_000926chr1179182 7999 7575 6677 5824 2939 1130 26446 6419 13096 15883
NM_000935chr32946 262 1441 1188 --
NM_000939chr22173 73 ------
NM_000942chr15145 --166 --
NM_000944chr432343 122 103 ------
NM_000945chr221778 1525 152 ----
NM_000946chr121128 ------
NM_000960chr194762 254 162 32 --1535 2784 262
NM_000964chr1771299 1184 875 276 252 130 88 11341 --1855
NM_000965chr341211 957 352 310 ------
NM_000966chr124362 215 176 96 --1821 --
NM_001001132chr2111147 --199 --
NM_001001323chr1242162 604 286 69 ----2654 567
NM_001001331chr342263 1024 903 741 12115 1940 --
NM_001001342chr1031350 1274 72 31315 1159 172 ----
NM_001001344chrX72392 2051 1906 1733 1640 560 511 ------
NM_001001389chr1172353 1050 933 812 431 382 320 22548 594 12572 --
NM_001001390chr1172353 1050 933 812 431 382 320 22548 594 12572 --
NM_001001391chr1172353 1050 933 812 431 382 320 22548 594 12572 --
NM_001001392chr1172399 1096 979 858 477 428 366 22594 640 12618 --
NM_001001396chr1113549 3220 3113 1740 1565 1478 1412 1133 971 298 135 53831 3267 1759 621 70 13399 --
NM_001001436chr161847 ------
NM_001001484chr1042476 2124 150 28 --1980 --
NM_001001502chr5----1119 --
NM_001001522chr112378 122 --2104 21 --
NM_001001549chr742481 2101 923 855 12533 --1341
NM_001001550chr742481 2101 923 855 12533 --1341
NM_001001555chr742481 2101 923 855 12533 --1341
NM_001001557chr86877 745 695 614 55 22 2845 236 1701 --
NM_001001664chr231418 1000 271 12859 ----
NM_001001852chr227704 357 188 125 118 70 41 --2618 229 1777
NM_001001890chr2173996 3180 3111 1441 465 380 119 13967 33241 3143 102 13210
NM_001001924chr832097 1439 620 130 ----
NM_001001925chr832097 1439 620 130 ----
NM_001001931chr832097 1439 620 130 ----
NM_001001971chr10--1970 1961 --
NM_001001974chr1022063 686 ----1541
NM_001001994chrX133 ------
NM_001001995chrX2579 65 --142 --
NM_001001996chrX133 ------
NM_001002032chr17170 ------
NM_001002233chr841827 593 285 75 ------
NM_001002257chr212765 22992 184 23039 1024 --
NM_001002762chr1082820 2068 1791 953 862 704 264 256 12311 3621 409 82 --
NM_001002814chr893429 3133 2954 2825 2578 932 593 285 75 --23116 2636 12806
NM_001002838chrX21303 708 11683 ----
NM_001002860chr1434243 4175 3959 14281 --1646
NM_001002909chr1721828 1407 ------
NM_001002919chr2147 ------
NM_001003398chr122586 49 --134 --
NM_001003407chr10125006 4794 4623 3893 3127 1796 1740 1626 1452 1244 1144 563 24580 3955 22013 526 11692
NM_001003408chr10125006 4794 4623 3893 3127 1796 1740 1626 1452 1244 1144 563 24580 3955 22013 526 11692
NM_001003652chr18138665 8570 8249 8022 6649 5722 5611 5465 3416 2320 2082 1403 609 47406 7388 7289 2516 48152 7542 3409 2534 --
NM_001003676chr115930 848 646 217 155 1367 ----
NM_001003679chr1--1619 ----
NM_001003682chr131366 1220 151 --31341 124 25 1508
NM_001003688chr4141 --199 --
NM_001003712chr1212749 21326 1259 11387 --
NM_001003760chr663517 2842 2653 1134 844 69 13268 1143 --
NM_001003792chr3------139
NM_001003793chr3------139
NM_001003794chr382515 2463 1905 1119 948 514 416 296 12302 12042 12884
NM_001003800chr972957 2444 1316 1242 344 338 304 --1599 --
NM_001003891chr221132 ------
NM_001003940chr1593618 3386 3340 3224 2682 1208 453 192 140 23651 1432 33721 744 273 --
NM_001003942chr1593618 3386 3340 3224 2682 1208 453 192 140 23651 1432 33721 744 273 --
NM_001003943chr1593622 3390 3344 3228 2686 1212 457 196 144 23655 1436 33725 748 277 --
NM_001004065chr943217 3105 2512 945 33748 3617 3156 ----
NM_001004105chr5130 ------
NM_001004127chr134910 695 372 296 2765 660 ----
NM_001004303chr1163 ------
NM_001004303chr1163 ------
NM_001004304chr1252924 2084 1139 452 174 1247 23040 2406 --
NM_001004317chr664209 3376 3295 1653 1403 664 ----13053
NM_001004323chr7----130 --
NM_001004329chr12--11114 1263 --
NM_001004330chr1221160 194 11655 ----
NM_001004342chr1125370 4905 4749 4623 3809 2300 2033 1925 1319 1169 1081 384 12350 45444 5266 2240 1175 15572
NM_001004419chr1274428 4030 1811 619 553 507 492 24095 1019 ----
NM_001004722chr22230 163 ------
NM_001005158chr3296 88 ------
NM_001005159chr3296 88 ------
NM_001005266chr153695 274 237 2497 155 ----
NM_001005267chr153695 274 237 2497 155 ----
NM_001005268chr153695 274 237 2497 155 ----
NM_001005269chr153695 274 237 2497 155 ----
NM_001005271chr173817 398 369 --11115 1210
NM_001005273chr173817 398 369 --11115 1210
NM_001005291chr173452 379 66 ------
NM_001005336chr91561 --148 --
NM_001005366chr122886 388 1776 ----
NM_001005386chr21699 21974 1707 ----
NM_001005404chr17103200 3014 716 667 565 545 404 275 136 110 1901 21191 611 --
NM_001005408chr172459 55 ------
NM_001005463chr1011870 ----1254
NM_001005473chr576655 6253 6045 5549 4942 774 77 56312 5748 1272 827 103 25974 1333 --
NM_001005502chr1265039 4375 1895 1221 474 95 25207 122 --13917
NM_001005505chr32487 151 --1132 --
NM_001005609chrX83577 3042 2658 2593 1527 779 188 39 23086 712 ----
NM_001005612chrX147 166 ----
NM_001005732chr21133 ------
NM_001005733chr21133 ------
NM_001005739chr21326 ------
NM_001005743chr1441210 893 203 87 ------
NM_001005744chr1441210 893 203 87 ------
NM_001005745chr1441210 893 203 87 ------
NM_001005746chr221446 168 ------
NM_001005747chr221446 168 ------
NM_001005752chr11101 1766 ----
NM_001005782chr2----1339 --
NM_001005910chr32560 66 ------
NM_001005911chr32560 66 ------
NM_001006115chr3132561 2445 2276 2253 2149 2071 1876 1817 1070 782 433 350 267 1673 41021 965 373 224 --
NM_001006600chr511603 22155 434 1343 --
NM_001006623chr222225 2035 ------
NM_001006656chr1961697 1507 1342 1205 217 200 ------
NM_001007023chr1494980 4943 4337 3776 3707 3509 3317 3284 400 21146 463 34159 4086 1264 13463
NM_001007024chr1763120 1513 1051 732 481 47 11560 13155 --
NM_001007025chr1763120 1513 1051 732 481 47 11560 13155 --
NM_001007067chr821047 1005 ------
NM_001007068chr821047 1005 ------
NM_001007069chr821047 1005 ------
NM_001007070chr821047 1005 ------
NM_001007097chr954939 4869 3110 1276 1215 33659 2011 984 21420 1106 11310
NM_001007098chr13357 325 199 ------
NM_001007156chr1551735 1502 471 425 56 ------
NM_001007226chr1731325 1302 1136 ------
NM_001007227chr1731325 1302 1136 ------
NM_001007228chr1731325 1302 1136 ------
NM_001007229chr1731325 1302 1136 ------
NM_001007230chr1731325 1302 1136 ------
NM_001007237chr111033 --1920 --
NM_001007246chr2111717 ------
NM_001007248chr192822 620 ------
NM_001007271chr1091074 996 977 930 758 744 89 57 40 --1962 --
NM_001007273chr104169 91 72 25 --157 --
NM_001007277chr113305 256 223 1784 145 --
NM_001007466chr664229 4219 4125 3796 3759 3562 --21522 68 --
NM_001007471chr9--182 ----
NM_001007538chr1351192 1171 642 452 277 --11254 --
NM_001008220chr5123814 3733 3675 3573 3456 2862 2574 1304 896 729 370 127 13875 53714 3206 2509 503 449 --
NM_001008222chrX41353 1254 1225 215 --1246 1962
NM_001008270chr7135 ------
NM_001008405chr711649 ----1111
NM_001008407chr751782 695 252 196 187 21585 500 1231 --
NM_001008408chr7106101 5854 5601 5480 4698 1896 1717 955 869 115 53946 2431 2082 1349 543 56064 5685 5224 4485 2218 --
NM_001008410chr252186 1756 1713 485 257 2690 503 32056 1865 51 1462
NM_001008539chr844996 3962 1270 189 14944 13500 --
NM_001008541chr1062259 1801 1576 1456 577 391 ------
NM_001008541chr1062259 1801 1576 1456 577 391 ------
NM_001008660chr11--11040 ----
NM_001008701chr1992546 2310 2253 832 819 772 704 63 52 32766 605 531 12691 --
NM_001008726chr1451694 1628 1592 1545 121 21622 1268 ----
NM_001008738chr552366 2327 2129 2100 433 12028 ----
NM_001008777chr171225 ------
NM_001008860chr153810 728 619 ------
NM_001008892chr153810 728 619 ------
NM_001008894chr153810 728 619 ------
NM_001008925chr432948 2739 1214 12930 ----
NM_001008938chr111187 ----1401
NM_001009185chr52648 571 ------
NM_001009555chr42690 56 1682 ----
NM_001009566chr141348 1274 1130 939 --1579 --
NM_001009567chr101587 ------
NM_001009571chr741737 1682 272 36 ------
NM_001009598chr11178 ----123
NM_001009881chr1----1144 --
NM_001009882chr1----1144 --
NM_001009899chr3136373 5395 4717 4695 4609 4257 3951 2404 2200 1832 1554 1360 1012 25856 1954 --14508
NM_001009959chr221970 276 12095 11020 --
NM_001009993chr2104434 3504 3154 2960 2844 1655 1638 1494 585 75 --23835 3148 --
NM_001010000chr1833252 3022 3005 1541 21192 529 --
NM_001010846chr193890 3366 3058 3043 3028 1329 828 553 369 44635 4619 4328 120 123 23177 3051
NM_001010867chr1156651 6619 6494 6410 6130 6118 5407 5260 4300 2013 1762 1717 886 344 151 21677 206 41436 1421 1270 115 --
NM_001010888chrX14310 --23880 3265 --
NM_001010891chr566957 6805 5628 5306 4210 2725 14882 --14566
NM_001010895chr93785 378 122 ------
NM_001010898chr193550 3437 3027 706 678 638 411 200 130 43448 2429 1022 1007 53653 3467 2764 671 177 --
NM_001010903chr641532 983 604 80 271 31 11257 --
NM_001010908chr101505 ------
NM_001010917chr10142249 2054 1925 1903 1848 1616 795 709 637 607 576 438 214 49 21867 777 ----
NM_001010926chr13522 498 127 ------
NM_001010935chr11188 1172 124 --
NM_001010938chr33282 160 91 --1306 1678
NM_001010942chr1221344 1064 --125 --
NM_001010971chr12979 801 ------
NM_001010983chr3143 ------
NM_001010984chr13748 256 154 22157 839 --11716
NM_001011513chr41256 12946 --1118
NM_001011515chr431135 1071 954 ------
NM_001011516chr431135 1071 954 ------
NM_001011537chr341465 807 690 37 1567 --1177
NM_001011553chr7------1173
NM_001011645chrX195 1143 ----
NM_001011666chr775580 5208 5142 5104 4477 4269 1451 36126 1722 1701 24795 958 15070
NM_001011708chr21425 11957 11112 --
NM_001011722chr11452 ------
NM_001011722chr11452 ------
NM_001012267chr921354 399 1104 11415 --
NM_001012329chr1132307 2129 1985 1853 1774 1586 1558 1482 832 799 717 351 126 2335 26 11938 11815
NM_001012393chr1153158 1948 1708 268 22 34516 3202 386 ----
NM_001012398chr161247 ------
NM_001012415chr97733 628 360 282 245 222 207 ----1706
NM_001012426chr6153374 2880 2441 2385 2093 1341 1335 1232 1209 1200 799 598 408 396 206 22329 2210 1518 --
NM_001012427chr6153374 2880 2441 2385 2093 1341 1335 1232 1209 1200 799 598 408 396 206 22329 2210 1518 --
NM_001012614chr44695 648 187 176 --195 --
NM_001012732chr431219 805 274 --11016 --
NM_001012751chr1011868 ------
NM_001012756chr1923143 2560 ----13066
NM_001012761chr53875 824 127 ----11917
NM_001012974chr62230 184 --180 --
NM_001012979chrX3161 51 31 ------
NM_001012989chrX----1170 --
NM_001013031chr1062222 899 753 505 442 172 12953 ----
NM_001013398chr711312 21594 1358 ----
NM_001013415chr4----11258 --
NM_001013438chr31749 1303 1370 1141
NM_001013439chr31595 1149 1216 --
NM_001013624chr174866 375 234 115 1875 161 --
NM_001013635chr122982 482 --11088 --
NM_001013690chr12152476 2287 2255 2142 1900 1812 1692 1640 1568 1543 619 554 539 522 454 --11851 --
NM_001013693chr1162690 2634 2233 2143 1853 917 904 864 852 656 442 389 308 261 228 31 ------
NM_001013693chr1162690 2634 2233 2143 1853 917 904 864 852 656 442 389 308 261 228 31 ------
NM_001014283chr1342161 1819 1620 1469 ------
NM_001014445chr174769 721 324 22 --2871 792 1981
NM_001014797chr10108087 7511 7421 6705 3029 2772 2499 1852 1428 937 37244 5649 2104 35639 2901 2805 28130 289
NM_001014812chr15--1115 ----
NM_001015045chr462445 2342 963 97 85 72 2788 361 11682 --
NM_001015053chr1751134 372 220 154 113 11546 ----
NM_001015508chr81519 --1270 --
NM_001015877chrX2825 318 ------
NM_001015881chrX51282 1214 930 884 178 1865 1259 --
NM_001015882chr91868 ------
NM_001015887chr331555 1283 217 1625 ----
NM_001017368chr1772819 2576 2367 1935 678 300 147 1314 ----
NM_001017392chr193991 828 382 1513 --3503 71 34
NM_001017395chr32598 397 181 12398 --
NM_001017396chr271856 1745 1496 1471 828 611 112 ------
NM_001017405chr41744 ------
NM_001017415chr1----1520 --
NM_001017416chr1----1520 --
NM_001017440chr7177452 7439 6556 6335 5950 5220 3212 3203 2936 2844 2773 2159 1931 1764 1595 1342 501 46242 6190 5912 3143 32713 2078 573 --
NM_001017523chr1211247 21497 361 ----
NM_001017923chr141202 11666 ----
NM_001017924chr1011169 2503 48 ----
NM_001017926chr821766 492 11838 --11317
NM_001018005chr15266 60 ------
NM_001018008chr152514 150 1251 ----
NM_001018025chrX1742 --1352 --
NM_001018050chr22183376 3176 2902 2872 2824 2777 2550 2542 2527 2100 1365 1189 1101 1039 1026 1004 235 170 1262 12437 23067 1292
NM_001018052chr22183376 3176 2902 2872 2824 2777 2550 2542 2527 2100 1365 1189 1101 1039 1026 1004 235 170 1262 12437 23067 1292
NM_001018056chr9--1234 ----
NM_001018064chr961922 1521 1469 784 426 110 11384 ----
NM_001018065chr9105344 5319 5217 4928 3966 3858 3801 1477 634 426 ----15280
NM_001018066chr9105344 5319 5217 4928 3966 3858 3801 1477 634 426 ----15280
NM_001018067chr165022 4085 3998 3832 3511 24 --13488 --
NM_001018068chr165022 4085 3998 3832 3511 24 --13488 --
NM_001018069chr165022 4085 3998 3832 3511 24 --13488 --
NM_001018072chr1211247 21497 361 ----
NM_001018074chr563271 3053 1313 1199 929 76 23159 2859 ----
NM_001018075chr563271 3053 1313 1199 929 76 23159 2859 ----
NM_001018076chr563271 3053 1313 1199 929 76 23159 2859 ----
NM_001018077chr563271 3053 1313 1199 929 76 23159 2859 ----
NM_001018089chr1573105 2667 2601 2469 1032 1011 814 33715 565 192 --1126
NM_001018091chr1542874 2550 800 100 ------
NM_001018108chr1551460 1408 738 278 182 1519 2797 125 21773 1553
NM_001018115chr34612 571 495 250 ------
NM_001020658chr141537 1352 1052 229 ------
NM_001020658chr141537 1352 1052 229 ------
NM_001020825chr51528 1334 ----
NM_001023560chr6--1157 ----
NM_001023587chr331050 716 148 ------
NM_001024094chr563271 3053 1313 1199 929 76 23159 2859 ----
NM_001024218chr141852 ------
NM_001024401chr16102760 2709 2679 2564 1922 579 533 482 411 365 12596 42851 2253 1834 811 1373
NM_001024455chrX72674 2321 2240 985 837 659 391 22350 462 ----
NM_001024457chr21385 1565 ----
NM_001024465chr6154 ------
NM_001024599chr141324 1058 1048 186 --21198 548 --
NM_001024649chr542874 2270 2062 977 11840 ----
NM_001024666chrX3257 196 37 ------
NM_001024808chr1272367 2292 2109 1868 1125 434 425 12209 ----
NM_001024809chr1771299 1184 875 276 252 130 88 11341 --1855
NM_001024847chr321907 501 3791 371 82 ----
NM_001024858chr14102943 2222 2061 605 569 555 319 286 170 62 12753 32927 1825 839 --
NM_001024912chr1951804 1407 616 486 147 21559 42 1522 --
NM_001024934chr61629 2211 66 ----
NM_001024935chr61629 2211 66 ----
NM_001024936chr61629 2211 66 ----
NM_001024937chr174733 152 145 89 ------
NM_001024947chr51752 155 ----
NM_001024948chr133295 2633 1079 21292 859 --1389
NM_001024959chr34706 547 230 64 ------
NM_001024960chr34706 547 230 64 ------
NM_001025076chr1075793 5673 4832 2453 1950 1745 1292 25241 1970 24947 2304 12229
NM_001025077chr1067151 7031 6190 4883 4871 2650 26599 397 16305 --
NM_001025079chr342660 2647 1118 909 21051 720 2379 82 --
NM_001025081chr1821487 1005 11562 ----
NM_001025090chr1821487 1005 11562 ----
NM_001025092chr1821487 1005 11562 ----
NM_001025101chr1821487 1005 11562 ----
NM_001025105chr531415 463 184 11567 ----
NM_001025107chr152682 2335 2137 1944 824 32493 2269 689 ----
NM_001025107chr152682 2335 2137 1944 824 32493 2269 689 ----
NM_001025108chr253365 3129 2750 1230 31 11433 11260 --
NM_001025233chr1262510 2441 2434 1913 628 505 12638 ----
NM_001025266chr394919 4888 3835 3795 1702 1546 803 424 213 23659 1905 11529 13546
NM_001025366chr641498 1480 1420 530 --2760 684 --
NM_001025366chr641498 1480 1420 530 --2760 684 --
NM_001025367chr641498 1480 1420 530 --2760 684 --
NM_001025367chr641498 1480 1420 530 --2760 684 --
NM_001025368chr641498 1480 1420 530 --2760 684 --
NM_001025368chr641498 1480 1420 530 --2760 684 --
NM_001025370chr641498 1480 1420 530 --2760 684 --
NM_001025370chr641498 1480 1420 530 --2760 684 --
NM_001025579chr1721116 243 ------
NM_001025780chr931138 1035 561 11379 ----
NM_001029851chr53619 322 246 1134 ----
NM_001029852chr53619 322 246 1134 ----
NM_001029853chr53619 322 246 1134 ----
NM_001029854chr53619 322 246 1134 ----
NM_001029858chr662983 2573 676 495 360 225 22912 2157 ----
NM_001029861chr1981030 1017 690 329 261 201 123 33 1135 ----
NM_001029871chr2061734 1439 547 526 515 442 21829 508 11694 1729
NM_001029998chr421327 526 ------
NM_001030002chr172350 246 ------
NM_001030006chr17102642 2537 2509 2401 2312 2265 1820 674 562 493 21887 785 ----
NM_001030007chr1693599 2862 2824 2644 2482 1219 525 304 296 1158 --13386
NM_001030055chr1423930 1450 34624 4221 989 ----
NM_001031623chr6------137
NM_001031685chr11345 ------
NM_001031692chr71286 ------
NM_001031695chr2275140 4873 4848 4341 4070 4015 1611 34178 1772 1141 11369 --
NM_001031702chr33680 155 119 ------
NM_001031711chr5101769 1726 1198 1167 569 417 228 62 48 33 ----11249
NM_001031740chr13543 386 134 --1147 181
NM_001031746chr1051389 1011 940 258 61 1554 1237 --
NM_001031804chr1674401 4093 3386 1459 829 640 32 23690 3548 ----
NM_001031812chr51476 ------
NM_001032282chr811005 ------
NM_001032283chr121235 ------
NM_001032284chr121235 ------
NM_001032288chr2031210 629 519 21194 1060 ----
NM_001032296chr1332626 568 413 21032 314 12511 11183
NM_001032363chr161509 788 667 627 331 269 1343 --175
NM_001032363chr161509 788 667 627 331 269 1343 --175
NM_001032730chr12481 38 ------
NM_001032999chr20185260 5101 4874 4844 4642 4396 4222 4082 3925 1928 1769 1606 1587 1195 1001 803 327 23 1434 ----
NM_001033045chr284426 4004 3976 3144 1634 1413 1160 102 33725 3520 295 ----
NM_001033047chr452223 975 510 433 305 1194 1853 --
NM_001033081chr191482 1431 1370 752 700 636 458 269 201 1178 --1296
NM_001033082chr191482 1431 1370 752 700 636 458 269 201 1178 --1296
NM_001033087chr2023015 35 32247 1102 899 22074 655 11122
NM_001033117chr3124427 4406 4397 4309 4114 3911 3400 3279 1544 879 93 62 24526 3661 23513 1671 11938
NM_001033506chr111159 ------
NM_001033521chr204582 160 94 57 1492 ----
NM_001033522chr204582 160 94 57 1492 ----
NM_001033551chr17213562 3491 3481 3385 3251 3175 2978 2938 2651 1411 1072 1048 1037 1029 858 822 680 550 368 302 187 33675 1144 436 32574 2556 1249 --
NM_001033581chr1----1359 --
NM_001033581chr1----1359 --
NM_001033582chr1----1359 --
NM_001033602chr1371891 1753 1046 802 141 92 56 --42629 2241 2205 163 --
NM_001033677chr122388 361 ------
NM_001033723chr892559 2468 2319 2205 2198 2163 2096 2047 2006 12633 32068 49 33 --
NM_001033756chr641432 1414 1354 464 --2694 618 --
NM_001033756chr641432 1414 1354 464 --2694 618 --
NM_001033925chr1032144 449 428 2422 62 ----
NM_001033952chr111250 ------
NM_001034845chr41464 --1389 --
NM_001034954chr1072947 2595 2119 1259 1089 749 741 22009 439 1635 --
NM_001034955chr1072947 2595 2119 1259 1089 749 741 22009 439 1635 --
NM_001034956chr1072947 2595 2119 1259 1089 749 741 22009 439 1635 --
NM_001034957chr1072947 2595 2119 1259 1089 749 741 22009 439 1635 --
NM_001035chr11138 --11323 --
NM_001035003chr431337 980 919 ------
NM_001035004chr431337 980 919 ------
NM_001035235chr54608 506 201 44 ------
NM_001035256chr22173 73 ------
NM_001035511chr12247 222 1665 21426 262 --
NM_001035512chr12354 329 1772 21533 369 --
NM_001035513chr12354 329 1772 21533 369 --
NM_001035534chr981437 1254 973 944 453 96 85 70 11034 21356 1298 --
NM_001037131chr22444 305 ------
NM_001037132chr711953 ------
NM_001037133chr711953 ------
NM_001037164chr731486 660 156 ------
NM_001037331chr186927 913 868 797 755 266 ------
NM_001037334chr1852199 2020 706 631 564 12261 11523 --
NM_001037339chr1138 --1197 --
NM_001037340chr1138 --1197 --
NM_001037341chr1138 --1197 --
NM_001037341chr1138 --1197 --
NM_001037494chr12193 ------
NM_001037495chr12193 ------
NM_001037553chr21154873 3641 3425 3340 1872 1574 1451 1310 1238 1224 1166 1133 708 638 588 --23652 33 --
NM_001037582chr441219 540 430 325 --11126 --
NM_001037954chr1142499 2447 259 46 1807 11386 --
NM_001038493chr24578 552 371 25 11255 ----
NM_001038633chr131234 1190 910 172 ----
NM_001038640chr153822 727 259 ------
NM_001038702chr521886 803 --12592 184
NM_001038707chr111632 2324 90 11775 22045 264
NM_001038707chr111632 2324 90 11775 22045 264
NM_001039140chr204387 357 125 50 ------
NM_001039141chr2262229 2151 2141 2060 733 394 22424 699 21097 448 11042
NM_001039199chr20114838 4810 4796 4528 4236 3852 3269 1255 1184 1037 905 35055 3817 1919 1705 --
NM_001039350chr741724 1438 1169 678 ----11531
NM_001039459chr72894 83 11143 2189 148 --
NM_001039479chr1472372 1737 1501 964 812 323 156 ------
NM_001039538chr231377 338 248 --166 --
NM_001039570chr22154255 4157 3953 3746 3682 3598 3523 3363 3285 3269 3176 1154 435 263 82 --1234 13259
NM_001039571chr22154255 4157 3953 3746 3682 3598 3523 3363 3285 3269 3176 1154 435 263 82 --1234 13259
NM_001039574chr15993 986 919 876 784 ------
NM_001039577chr184147 4047 3624 3077 3014 1718 410 150 --43304 2798 1795 1244 21407 374
NM_001039590chrX23228 1480 ------
NM_001039591chrX23228 1480 ------
NM_001039615chr832245 1843 1522 31922 1599 105 11664 --
NM_001039618chr114564 427 324 206 45903 5319 1221 438 --11946
NM_001039690chr1672067 1791 1495 699 404 105 87 --22018 505 1536
NM_001039709chr20185260 5101 4874 4844 4642 4396 4222 4082 3925 1928 1769 1606 1587 1195 1001 803 327 23 1434 ----
NM_001039762chr1021562 128 11777 1377 11642
NM_001039771chr143956 869 38 1823 ----
NM_001039840chrX85928 4953 4574 4173 1592 499 381 56 25950 1811 ----
NM_001039916chr126973 489 195 102 93 44 ------
NM_001039917chr126973 489 195 102 93 44 ------
NM_001039918chr126973 489 195 102 93 44 ------
NM_001039919chr126973 489 195 102 93 44 ------
NM_001039920chr126973 489 195 102 93 44 ------
NM_001039937chr1342668 1104 1013 606 ----1937
NM_001040059chr171570 ------
NM_001040092chr81314 ------
NM_001040100chr31361 ------
NM_001040101chr43617 572 552 11310 1213 --
NM_001040102chr1032363 506 124 12138 ----
NM_001040103chr1032363 506 124 12138 ----
NM_001040110chr731435 1272 1236 11429 11379 --
NM_001040144chr1672067 1791 1495 699 404 105 87 --22018 505 1536
NM_001040146chr1672067 1791 1495 699 404 105 87 --22018 505 1536
NM_001040152chr754912 4461 3643 1449 1399 11275 13527 --
NM_001040153chr132687 260 122 ----
NM_001040167chr75430 400 187 37 27 --175 1424
NM_001040172chr541331 527 279 155 --11098 --
NM_001040173chr541331 527 279 155 --11098 --
NM_001040214chr622302 412 1260 ----
NM_001040272chr94922 860 792 31 1275 1761 --
NM_001040284chr1665869 5762 5277 3944 1554 727 15246 ----
NM_001040402chr433124 2374 156 12733 --12329
NM_001040409chr22207 117 ------
NM_001040429chr1321160 702 ----1491
NM_001040439chr1641467 1442 333 321 21112 359 1399 --
NM_001040441chr134037 2168 533 34021 1297 542 ----
NM_001040446chr54933 816 734 579 160 ----
NM_001040450chr1522188 1947 32639 894 384 ----
NM_001040451chr51471 ------
NM_001040452chr51471 ------
NM_001040453chr1522188 1947 32639 894 384 ----
NM_001040624chr852292 2128 974 783 343 ----12048
NM_001040625chr852292 2128 974 783 343 ----12048
NM_001040626chr852292 2128 974 783 343 ----12048
NM_001040627chr852292 2128 974 783 343 ----12048
NM_001040628chr852292 2128 974 783 343 ----12048
NM_001040629chr852292 2128 974 783 343 ----12048
NM_001040630chr852292 2128 974 783 343 ----12048
NM_001040633chr7------2973 264
NM_001040694chr1151062 893 788 397 258 ------
NM_001040712chr942462 1129 496 220 12533 13276 --
NM_001042355chr1664831 4760 3603 3585 1546 1163 31874 1196 170 35321 1614 421 --
NM_001042388chr181276 --1748 --
NM_001042404chr111328 1393 ----
NM_001042406chr6----186 --
NM_001042412chr1664831 4760 3603 3585 1546 1163 31874 1196 170 35321 1614 421 --
NM_001042413chr9134063 3184 2967 2929 2693 2575 1139 852 834 514 441 114 38 ----13202
NM_001042428chr161184 ------
NM_001042453chrX11712 ------
NM_001042473chr10--1262 ----
NM_001042481chr1451724 1677 498 475 152 ------
NM_001042486chr2041175 439 389 113 --21263 433 --
NM_001042492chr1762742 2637 2593 2444 368 166 ------
NM_001042510chr831382 580 195 ------
NM_001042511chr831382 580 195 ------
NM_001042537chrX22396 1571 193 1475 --
NM_001042555chr1223380 1286 1769 ----
NM_001042599chr296719 5794 5585 5555 5527 5446 4835 2985 2657 1449 1667 --
NM_001042601chr32561 39 13020 ----
NM_001042603chr1234470 1166 969 24641 1952 1978 --
NM_001042604chr324033 544 1345 ----
NM_001042610chr16101354 1345 1288 948 934 557 377 167 133 121 --11190 --
NM_001042632chr2072203 1749 1004 584 464 393 314 2998 434 11700 --
NM_001042633chr2072203 1749 1004 584 464 393 314 2998 434 11700 --
NM_001042646chr351480 1307 574 518 212 21674 637 ----
NM_001042681chr152196 839 307 239 186 --22346 2028 --
NM_001042682chr152196 839 307 239 186 --22346 2028 --
NM_001042682chr152196 839 307 239 186 --22346 2028 --
NM_001042728chr124362 215 176 96 --1821 --
NM_001043318chr14153459 3217 3170 2838 2727 1539 1491 1302 1118 971 919 774 533 486 425 --53828 1390 1329 1049 631 --
NM_001043351chr142155 1620 683 39 1788 --1354
NM_001044385chr263983 3710 3306 3283 1119 897 43934 3775 3076 1490 11049 --
NM_001044722chr51476 ------
NM_001044723chr51476 ------
NM_001046chr532983 2885 678 --1328 --
NM_001048183chr143720 3476 1324 374 43234 2894 2578 691 1380 12562
NM_001049chr142998 291 12230 248 24 11585
NM_001065chr123547 84 37 ------
NM_001066chr1152106 2031 2019 1557 1532 1355 554 530 522 397 386 380 277 161 105 11774 274 47 11468
NM_001074chr4197 ------
NM_001077628chr1355 42 23 --1166 1127
NM_001079874chr11282 21419 627 1656 --
NM_001080418chr12219 168 1615 ----
NM_001083620chr41130 ------
NM_001092chr1751843 1734 812 658 432 --1563 2553 544
NM_001094chr17142 ------
NM_001095chr1241921 1607 1198 643 21433 1378 2623 87 --
NM_001100108chr1146872 6862 6688 6005 5798 2485 2451 2430 2001 1678 1362 500 375 136 28305 1403 ----
NM_001106chr3148011 7802 6277 3832 3806 3797 3434 3263 3142 2866 1126 1054 871 126 28672 3878 46901 843 825 590 --
NM_001109977chr42244 109 ------
NM_001111chr152682 2335 2137 1944 824 32493 2269 689 ----
NM_001113490chrX52780 2312 1327 1269 687 --1803 --
NM_001116chr1642770 2283 822 32 1201 ----
NM_001117chr1871985 1566 832 706 610 601 491 1941 21008 37 --
NM_001119chr471263 486 323 271 74 40 24 --1932 21486 526
NM_001121chr1031859 1507 231 ------
NM_001123chr10157 ----1745
NM_001126chr1132 1780 ----
NM_001128chr1693599 2862 2824 2644 2482 1219 525 304 296 1158 --13386
NM_001140chr173480 447 74 ------
NM_001144chr1631014 514 37 21351 889 1362 --
NM_001152chrX1221 ------
NM_001160chr1252796 2467 1769 817 71 11817 --22475 2372
NM_001173chr1423930 1450 34624 4221 989 ----
NM_001174chrX2643 419 --129 --
NM_001177chr1221897 1622 124 12401 --
NM_001189chr45967 884 336 258 155 --2232 178 --
NM_001199chr81264 ------
NM_001204chr227514 7117 42468 1735 1047 462 ----
NM_001205chr5263 55 1416 ----
NM_001206chr91244 2233 217 12834 --
NM_001218chr1582586 1870 1786 929 618 478 369 159 32577 2258 907 --32598 2393 2085
NM_001222chr1071664 1642 1410 469 431 92 64 21982 1495 --1372
NM_001235chr113451 97 48 ----1269
NM_001241chr211910 ------
NM_001241chr211910 ------
NM_001251chr171570 ------
NM_001256chr1752754 2488 757 406 147 1940 ----
NM_001259chr756375 5992 1540 1097 137 33848 1941 309 --11051
NM_001262chr1161 --1329 --
NM_001267chr174523 193 139 25 ------
NM_001270chr52926 373 ------
NM_001274chr11185 1110 ----
NM_001275chr143342 159 71 1409 145 --
NM_001277chr1161011 920 911 865 823 697 21048 253 ----
NM_001282chr17102642 2537 2509 2401 2312 2265 1820 674 562 493 21887 785 ----
NM_001284chr51552 ------
NM_001292chr154976 877 845 247 3766 739 187 1703 --
NM_001300chr101162 ------
NM_001304chr1723372 2465 11206 ----
NM_001310chr1222969 1079 12948 11089 11131
NM_001312chr144480 387 100 71 ------
NM_001315chr642172 2100 1828 402 12182 --12038
NM_001316chr201156 ------
NM_001319chr1941071 897 798 107 21083 25 --2965 932
NM_001324chr204582 160 94 57 1492 ----
NM_001326chr111406 ------
NM_001328chr44695 648 187 176 --195 --
NM_001329chr101613 11540 --1322
NM_001331chr1172872 2785 1057 749 693 576 448 22479 303 --1982
NM_001343chr531479 1393 1249 1297 ----
NM_001345chr12173 154 --134
NM_001346chr352680 2600 1962 436 349 1934 2916 297 --
NM_001351chr3--11253 --11764
NM_001352chr19143 ------
NM_001356chrX2348 188 ----1956
NM_001362chr144947 691 675 181 --1397 --
NM_001363chrX1181 ------
NM_001364chr1184472 3885 3827 3571 3329 3204 2963 257 13988 33644 3542 3489 --
NM_001379chr191119 ------
NM_001380chr102253 72 --2347 269 1931
NM_001383chr172679 25 --1228 1767
NM_001387chr593096 2859 2778 2626 2550 2315 2215 2072 2054 32930 2747 2594 22973 206 --
NM_001396chr211795 12821 ----
NM_001397chr1152328 2179 2170 2148 2003 1830 1721 1696 1637 880 732 676 587 542 106 22371 860 ----
NM_001399chrX83577 3042 2658 2593 1527 779 188 39 23086 712 ----
NM_001402chr611412 --21822 1680 --
NM_001406chr1731651 1173 279 2235 27 1621 --
NM_001407chr351714 1508 1369 1276 557 --21336 352 --
NM_001408chr161088 619 583 232 148 62 1655 11241 --
NM_001412chrX53617 3070 2640 419 336 --1363 --
NM_001417chr1241490 1444 1348 1306 31838 109 45 ----
NM_001418chr111524 1613 1720 --
NM_001418chr111524 1613 1720 --
NM_001419chr19133846 3668 3353 3219 3194 3019 1945 1752 1541 881 758 548 535 23083 1717 11103 13729
NM_001421chrX41617 1281 181 135 11695 2583 268 --
NM_001423chr122548 221 --21505 183 11433
NM_001431chr61176 148 ----
NM_001432chr472848 1564 1281 1234 556 519 239 23169 1413 ----
NM_001438chr142304 1260 583 173 11004 ----
NM_001448chrX31477 1428 354 ------
NM_001449chrX122 ------
NM_001453chr631579 230 111 ------
NM_001455chr694900 3451 3218 1840 1715 1132 1117 986 186 13930 11434 13959
NM_001458chr73626 217 129 ------
NM_001460chr133000 2622 477 32793 2683 586 --198
NM_001483chr72964 202 1691 ----
NM_001489chr9161 ------
NM_001493chrX2673 253 ------
NM_001497chr962622 2374 2078 1756 634 205 --12120 1576
NM_001508chr21597 --2179 22 --
NM_001518chr731004 910 856 --1309 --
NM_001541chr111156 ------
NM_001542chr111033 --1920 --
NM_001543chr5133964 3920 3898 3850 3035 1827 1573 1319 1228 983 711 660 647 33874 3338 1608 24150 1426 14553
NM_001552chr1791028 968 887 792 718 421 395 96 51 --1282 --
NM_001554chr11124 1440 ----
NM_001560chrX41974 1620 309 37 --11965 --
NM_001604chr111136 ------
NM_001609chr1053303 1729 142 82 28 43768 3486 3172 1138 1348 --
NM_001611chr192227 58 --124 --
NM_001616chr222721 154 141 ----
NM_001620chr112710 53 ------
NM_001626chr1993531 2484 2259 2249 1287 1211 873 797 587 1976 23232 2240 --
NM_001642chr113925 425 114 11032 125 --
NM_001659chr12112713 2563 2542 2403 2346 2224 2038 1999 819 139 40 12086 2203 107 --
NM_001663chr14--42581 2140 704 26 1237 --
NM_001664chr31351 ------
NM_001665chr115456 189 138 63 55 1123 ----
NM_001668chr172132 2126 1766 347 270 155 116 --12166 11486
NM_001677chr13718 318 232 ------
NM_001678chr1771331 1243 479 464 322 142 55 31449 730 588 --11568
NM_001681chr121279 ------
NM_001682chr1221876 318 ----2368 281
NM_001683chr342263 1024 903 741 12115 1940 --
NM_001684chr1103266 2937 2830 1643 1457 1282 1195 1129 850 688 43548 2984 1476 338 13116 --
NM_001690chr312552 22509 67 11637 --
NM_001693chr841194 1092 1047 445 1359 11059 --
NM_001695chr844224 3099 2901 339 ----1977
NM_001699chr193637 525 112 1182 1734 --
NM_001701chr921168 622 ------
NM_001704chr6----1543 --
NM_001709chr1142698 1796 1150 230 ------
NM_001714chr123470 202 173 ------
NM_001723chr6----1217 --
NM_001741chr111250 ------
NM_001743chr21471 ------
NM_001745chr51161 --1387 --
NM_001746chr542874 2270 2062 977 11840 ----
NM_001753chr721849 1521 1734 ----
NM_001754chr2173996 3180 3111 1441 465 380 119 13967 33241 3143 102 13210
NM_001759chr12115338 4318 4302 4048 3934 3861 3847 3219 1954 1598 876 24789 3743 14040 11826
NM_001773chr181328 1311 1213 1187 988 522 251 142 1568 ----
NM_001777chr342660 2647 1118 909 21051 720 2379 82 --
NM_001788chr7------1173
NM_001792chr1811149 ------
NM_001802chr161178 2260 82 ----
NM_001806chr192292 172 ------
NM_001826chr1----1447 --
NM_001839chr11696 --167 --
NM_001842chr96526 493 472 403 255 172 ------
NM_001854chr11485 1444 ----
NM_001855chr91633 ------
NM_001859chr933131 2571 397 22802 175 --12614
NM_001874chr1265039 4375 1895 1221 474 95 25207 122 --13917
NM_001892chr531415 463 184 11567 ----
NM_001895chr20158 1229 ----
NM_001903chr51733 142 1285 --
NM_001908chr872282 1683 897 818 510 154 29 --11612 11815
NM_001914chr18----1103 --
NM_001921chr431219 805 274 --11016 --
NM_001923chr112496 49 1204 1257 --
NM_001927chr24714 295 230 121 159 ----
NM_001935chr22810 308 ------
NM_001936chr741724 1438 1169 678 ----11531
NM_001939chrX113439 3252 3180 2492 1474 1343 828 794 630 323 130 23841 509 13445 --
NM_001941chr1833575 1291 1155 ------
NM_001946chr123444 341 234 ------
NM_001949chr631298 1042 221 ------
NM_001954chr62689 253 ------
NM_001955chr64801 113 75 48 --1753 --
NM_001956chr14508 407 154 106 ----1388
NM_001957chr4190 1782 12289 --
NM_001964chr52792 387 ------
NM_001969chr1422941 422 --12725 1324
NM_001970chr174556 424 219 81 143 ----
NM_001980chr1242231 1722 592 31 1210 --1261
NM_001981chr132322 876 415 147 ----
NM_001987chr1273521 3231 3055 1690 881 656 622 24065 160 ----
NM_001991chr1742222 1734 1629 1435 21783 471 ----
NM_002006chr454093 4014 2237 976 502 11733 25249 5089 --
NM_002013chr141186 ----157
NM_002015chr1373195 3064 2577 2404 2329 1198 544 --11037 --
NM_002017chr1111216 ----176
NM_002024chrX21381 439 1489 ----
NM_002025chrX168762 8755 8662 8512 7855 7777 6959 6396 6075 2853 2529 2439 1762 1322 647 352 27105 2024 28390 7085 26206 5802
NM_002028chr1451097 980 809 523 158 11316 ----
NM_002029chr192140 55 ------
NM_002035chr1862730 1437 1411 1356 589 173 22432 1295 --11276
NM_002037chr6127 1128 ----
NM_002040chr2112752 12875 ----
NM_002045chr33330 100 45 184 ----
NM_002054chr2174 1414 ----
NM_002063chrX------1939
NM_002069chr731397 450 196 11853 ----
NM_002072chr94397 114 36 25 ------
NM_002073chr2261325 1313 1225 998 447 324 11597 11268 --
NM_002076chr1283199 2821 2062 1119 802 614 247 127 ------
NM_002077chr91220 ------
NM_002083chr142218 105 --146 --
NM_002086chr1752150 1904 1604 615 79 11439 ----
NM_002089chr42613 50 140 ----
NM_002092chr484815 4181 3802 1423 1156 938 734 647 --1409 --
NM_002101chr21428 126 ----
NM_002103chr1951011 882 850 246 31 ----1237
NM_002128chr1342576 2194 332 180 1788 ----
NM_002130chr52611 247 1670 ----
NM_002133chr222565 238 ------
NM_002146chr174931 918 154 59 ----11341
NM_002147chr172121 76 --153 --
NM_002148chr21598 ------
NM_002158chr233761 552 439 ------
NM_002167chr11116 --1376 --
NM_002181chr21253 ----178
NM_002188chr52585 540 1751 1231 --
NM_002193chr231659 712 539 1392 ----
NM_002198chr54758 687 295 213 ------
NM_002199chr4181 --1118 --
NM_002202chr51419 167 ----
NM_002203chr573561 2873 2850 2684 1620 1542 1405 --13474 --
NM_002205chr123870 746 408 4781 301 273 31 ----
NM_002211chr102729 432 ------
NM_002214chr775568 2188 1972 1888 1868 1387 1284 44076 3694 1839 287 14682 --
NM_002223chr1233651 669 43 23863 3460 11426 --
NM_002241chr163088 2861 2345 1143 825 438 --158 --
NM_002247chr101184 ------
NM_002254chr272334 709 490 472 433 205 59 --22103 1467 --
NM_002264chr364997 4467 4348 1869 1645 135 --23150 972 --
NM_002267chr1342232 1747 859 264 ------
NM_002268chr341160 561 445 386 ------
NM_002270chr544365 3945 1013 508 ----11103
NM_002271chr1341939 1909 379 215 1591 --11897
NM_002278chr171106 --1139 --
NM_002285chr253365 3129 2750 1230 31 11433 11260 --
NM_002293chr142702 2140 1688 33 22622 178 21789 68 --
NM_002298chr1331435 496 42 ------
NM_002309chr22113035 2851 2803 2784 2763 2567 2401 1975 1134 1023 923 --52432 2426 2114 914 346 --
NM_002313chr10125006 4794 4623 3893 3127 1796 1740 1626 1452 1244 1144 563 24580 3955 22013 526 11692
NM_002336chr1233093 1638 21 ------
NM_002351chrX1120 ------
NM_002355chr1251382 1167 1095 987 578 ------
NM_002356chr61263 ------
NM_002358chr4--154 --1431
NM_002359chr17214192 4173 3990 3930 3815 3714 3628 3610 3532 3401 3157 2845 2802 2762 1686 1604 1535 1429 662 485 66 33852 3682 2837 33263 517 491 --
NM_002360chr772617 2573 2456 2182 927 771 436 --1478 --
NM_002361chr192249 136 --1310 --
NM_002374chr231377 338 248 --166 --
NM_002375chr3102192 2014 1727 1685 1614 1592 1551 691 327 185 21625 544 --1927
NM_002382chr1461073 418 384 353 326 311 --11105 --
NM_002383chr162945 321 1246 2836 786 1588
NM_002384chr182688 188 ------
NM_002385chr1821487 1005 11562 ----
NM_002397chr552236 1639 1477 814 785 ------
NM_002402chr7190 21052 346 1173 --
NM_002404chr173368 126 76 2649 36 ----
NM_002412chr101103 ------
NM_002427chr1111027 134 ----
NM_002429chr1281389 1377 1154 420 410 352 217 40 --11138 11041
NM_002430chr2272602 2156 1994 1641 955 860 780 12177 ----
NM_002436chrX2187 63 1171 ----
NM_002438chr101587 ------
NM_002442chr124676 599 250 165 21628 662 21552 1406 1620
NM_002444chrX41775 1744 614 180 --1403 1112
NM_002449chr531153 188 96 --1245 --
NM_002490chr222609 223 ------
NM_002499chr1572287 2277 2084 2059 842 611 179 21950 61 ----
NM_002501chr19173539 3488 3449 3397 2989 2794 2521 1651 1461 1127 1014 951 781 763 361 35 25 1715 --1791
NM_002505chr661469 1322 1173 1136 528 307 ------
NM_002507chr1751829 1608 1488 1434 161 11947 ----
NM_002508chr161985 1622 1228 418 406 261 21684 172 --1502
NM_002509chr202773 204 ------
NM_002515chr1441731 1322 1276 425 11610 ----
NM_002516chr192100 79 ------
NM_002522chr1783412 2848 2539 1475 821 805 651 189 23051 630 43194 2453 1529 923 --
NM_002524chr1160 176 2255 66 --
NM_002544chr172134 42 ------
NM_002545chr1153158 1948 1708 268 22 34516 3202 386 ----
NM_002547chrX93067 1670 1156 1005 833 551 378 123 23 3950 421 344 13707 --
NM_002553chr71330 ------
NM_002570chr1561209 1177 424 275 139 100 31264 1119 829 ----
NM_002576chr1141142 114 97 76 --11195 --
NM_002581chr955585 3772 1263 822 525 34507 2090 1049 24362 1283 --
NM_002586chr641648 1078 444 420 ----11416
NM_002587chr54473 467 345 126 2193 186 ----
NM_002590chr131456 ------
NM_002594chr2012340 31541 460 274 1723 --
NM_002599chr115903 883 819 264 91 1125 1999 --
NM_002600chr1138 --1197 --
NM_002605chr15158 11117 --2823 26
NM_002609chr5121715 1505 1211 739 583 488 356 324 235 160 138 24 --21187 517 --
NM_002612chr72659 241 3533 260 62 ----
NM_002613chr16184510 3647 1981 1788 1715 1691 1522 1498 1322 1312 1003 877 843 602 480 453 395 373 24261 1437 11833 15211
NM_002628chr321086 335 1222 ----
NM_002633chr12509 476 ------
NM_002645chr1152609 2214 968 667 641 23094 279 ----
NM_002648chr641122 1075 1028 988 2270 160 ----
NM_002649chr71292 31229 1186 148 1617 --
NM_002650chr22282 66 ------
NM_002653chr52905 798 --1767 --
NM_002655chr845110 4278 3287 1982 11965 1213 --
NM_002656chr61849 --1179 --
NM_002657chr2073632 3410 2946 2442 743 445 36 23429 1054 1189 --
NM_002660chr2061042 884 432 399 201 45 --1256 --
NM_002673chr35531 434 408 156 144 ----154
NM_002687chr1421211 512 --11182 --
NM_002693chr15----1345 --
NM_002698chr1962903 2811 2684 2546 1019 339 22835 256 42495 817 723 54 --
NM_002706chr21130 ------
NM_002709chr243485 3142 2398 1004 ------
NM_002710chr12------1388
NM_002714chr62394 280 1919 ----
NM_002715chr52828 281 ------
NM_002716chr1183383 3298 3215 3115 2560 2318 866 237 1508 13020 --
NM_002717chr81163 ------
NM_002719chr1451869 1684 1504 750 740 ----1715
NM_002736chr71513 ------
NM_002738chr16--1721 1761 11036
NM_002742chr14174 1219 ----
NM_002744chr1----1359 --
NM_002745chr22104506 4371 4034 3439 1462 1353 939 352 209 76 24183 330 12836 --
NM_002748chr15------1319
NM_002752chr51127 ------
NM_002758chr171168 ------
NM_002768chr16131550 1514 1495 1452 1339 1266 1246 586 502 383 364 273 196 11629 --11047
NM_002779chr104574 536 364 56 ------
NM_002809chr172236 151 ------
NM_002822chr123688 479 434 1593 ----
NM_002823chr21226 ------
NM_002824chr123346 106 99 1375 ----
NM_002827chr2041758 1620 1112 489 1368 ----
NM_002829chr91493 2122 50 1476 --
NM_002830chr21391 ------
NM_002835chr71653 ------
NM_002837chr1253998 3729 3547 3078 2887 23959 3671 11710 14637
NM_002839chr942462 1129 496 220 12533 13276 --
NM_002841chr31274 ----1559
NM_002843chr1173212 3030 2689 2277 830 261 218 12555 ----
NM_002844chr61989 ------
NM_002848chr1221236 102 --175 --
NM_002854chr22------142
NM_002855chr11103168 3042 2342 1499 1297 1167 1026 846 610 297 1833 1690 --
NM_002861chr173459 104 37 ------
NM_002868chr1282274 1714 889 842 719 672 602 131 --2491 110 11966
NM_002869chr11------11982
NM_002874chr922368 337 ------
NM_002880chr33754 721 218 --1183 --
NM_002884chr11188 1172 124 --
NM_002886chr353551 3313 247 190 29 --11685 --
NM_002890chr52247 241 ------
NM_002896chr111100 ------
NM_002897chr21704 ------
NM_002900chr101122 ------
NM_002912chr6--2362 171 ----
NM_002918chr1931028 406 200 --1419 --
NM_002923chr1149 2258 88 ----
NM_002942chr31326 ----133
NM_002959chr183998 3680 3130 430 424 254 182 111 23494 3051 23082 206 --
NM_002968chr162758 316 ------
NM_002977chr262645 2191 990 422 306 134 ------
NM_003001chr12354 329 1772 21533 369 --
NM_003011chr991427 1154 1137 681 318 284 178 117 55 ------
NM_003013chr42689 165 ------
NM_003015chr104181 171 35 21 ------
NM_003016chr1741786 1714 1339 715 ------
NM_003022chrX1859 131 ----
NM_003026chr921198 487 ------
NM_003027chr152374 97 ------
NM_003028chr9143742 3496 3202 2980 2516 2490 2402 1248 1213 847 729 344 238 24 22506 1031 22446 870 13094
NM_003029chr141390 1311 312 102 1491 ----
NM_003035chr1188 148 1229 --
NM_003042chr381573 751 512 381 354 265 174 164 ------
NM_003045chr1344937 3642 3592 170 1264 53308 1024 820 624 192 14019
NM_003046chr844996 3962 1270 189 14944 13500 --
NM_003047chr1131255 1182 1164 1070 1041 577 526 517 425 415 249 101 86 11084 ----
NM_003051chr121660 1619 ------
NM_003060chr521297 1156 ------
NM_003069chrX1115 ------
NM_003074chr361691 750 655 300 263 164 11923 1228 --
NM_003076chr1271683 541 521 452 243 80 52 11441 11480 --
NM_003081chr202238 131 ----1407
NM_003085chr5----1119 --
NM_003090chr15174 ------
NM_003098chr204450 393 137 85 ----126
NM_003099chr15115873 5531 4728 4438 4259 1291 1235 811 797 344 68 26214 977 ----
NM_003100chr51168 ------
NM_003106chr31980 ------
NM_003107chr622022 1799 ------
NM_003108chr295686 4971 4486 2630 1976 1637 1150 1100 867 26509 374 12553 --
NM_003110chr178699 415 185 146 90 79 64 56 --1442 126
NM_003112chr713083 ------
NM_003113chr24616 585 324 176 ------
NM_003131chr6102209 2123 2038 1451 862 824 586 539 428 374 --1461 --
NM_003136chr141349 ------
NM_003137chr661635 1492 1417 265 222 211 11681 ----
NM_003139chr113879 794 705 ------
NM_003144chr63880 769 396 ----1403
NM_003150chr1782274 2173 2137 2103 1725 1659 1583 235 11828 ----
NM_003153chr1251007 836 317 80 61 1863 1249 --
NM_003156chr1151322 1056 870 206 43 11333 --1916
NM_003161chr1723072 832 ------
NM_003164chr113494 144 107 1117 1466 --
NM_003170chr174466 228 159 33 ------
NM_003173chrX51286 1243 1192 1125 521 ----1960
NM_003174chr102737 699 ------
NM_003178chr322159 1584 ------
NM_003179chrX51244 1019 408 290 173 ------
NM_003182chr71344 1424 ----
NM_003182chr71344 1424 ----
NM_003183chr2----1706 --
NM_003185chr201954 ------
NM_003186chr112378 122 --2104 21 --
NM_003189chr153298 2551 741 387 159 11262 31137 731 652 22403 96
NM_003199chr182882 812 --1555 14898
NM_003200chr19122371 2100 1843 1787 1776 1660 1475 895 300 193 49 42 1283 22045 201 --
NM_003202chr53719 306 84 2336 262 --11331
NM_003204chr1731600 1207 462 1625 ----
NM_003211chr1241436 618 507 21 11155 1598 --
NM_003216chr2263140 3127 2170 1075 1036 185 22869 333 1669 --
NM_003217chr1231602 776 551 --11362 --
NM_003221chr663955 3302 1347 1320 828 618 ------
NM_003222chr2021051 330 3461 287 161 ----
NM_003234chr3--42385 1888 491 329 ----
NM_003242chr321907 501 3791 371 82 ----
NM_003246chr1541274 668 419 342 ------
NM_003247chr63124 112 32 ------
NM_003255chr1782626 2490 964 789 653 647 497 297 --2795 70 --
NM_003257chr15--1160 1385 11082
NM_003269chr61396 --2252 175 11036
NM_003270chrX1442 2485 299 ----
NM_003272chr11197 ------
NM_003274chr214953 568 433 104 --1251 --
NM_003291chr132240 188 ------
NM_003292chr11680 ------
NM_003298chr3144982 4517 2446 2239 2205 2040 1942 1681 1025 925 758 750 737 182 31830 1670 1076 33991 3773 1697 --
NM_003309chr641649 634 418 391 1333 11713 --
NM_003314chr55444 407 294 179 73 1332 ----
NM_003317chr14134 ------
NM_003319chr22981 644 ------
NM_003320chr11113741 3735 3496 3074 2897 2795 1673 819 749 134 73 32976 973 796 11198 --
NM_003325chr225251 174 167 153 128 --1265 --
NM_003339chr511409 151 ----
NM_003342chr1732114 779 496 --12489 --
NM_003344chr741498 1320 660 607 --1312 --
NM_003348chr1211443 --1170 --
NM_003349chr2031210 629 519 21194 1060 ----
NM_003352chr2----1339 --
NM_003368chr1----1520 --
NM_003369chr1152693 2090 2045 893 39 ----1606
NM_003371chr991835 1501 1486 1334 772 751 615 446 287 2830 436 --158
NM_003376chr641498 1480 1420 530 --2760 684 --
NM_003376chr641498 1480 1420 530 --2760 684 --
NM_003383chr9--1234 ----
NM_003385chr21352 ------
NM_003387chr231171 1124 358 12424 11824 --
NM_003392chr353564 1624 1607 1142 1042 13712 ----
NM_003403chr141210 ------
NM_003404chr201596 2658 614 11464 --
NM_003406chr81358 21701 1214 ----
NM_003410chrX62382 2364 2018 563 317 251 32157 856 371 --141
NM_003411chrY--11714 --2168 38
NM_003412chr322146 722 ------
NM_003413chrX2434 312 ------
NM_003418chr31305 2316 58 ----
NM_003427chr64684 607 492 167 1448 ----
NM_003430chr19------1496
NM_003442chr111104 1795 ----
NM_003455chr1171665 1359 1185 1153 1140 462 110 --2490 191 --
NM_003456chr161184 ------
NM_003458chr3153971 3574 3559 3426 3366 3127 2938 2779 2473 1590 1235 1024 568 478 88 13754 1512 --
NM_003459chr22501 451 1690 171 --
NM_003462chr151206 1193 280 246 112 11441 ----
NM_003463chr61727 1899 ----
NM_003466chr262348 1973 1615 859 783 536 1936 --11535
NM_003468chr213185 21316 1169 ----
NM_003470chr1651668 1553 715 377 302 11273 11657 --
NM_003471chr332361 1520 693 1129 ----
NM_003472chr611074 11209 ----
NM_003481chr12193 ------
NM_003482chr1272265 1064 587 479 465 371 177 31027 134 56 12205 --
NM_003483chr1222238 1902 ------
NM_003489chr211604 1796 ----
NM_003498chr1692263 2160 1844 1116 1057 756 247 168 26 32132 453 350 ----
NM_003505chr731669 169 86 1745 ----
NM_003507chr221322 424 1809 ----
NM_003557chr121105 445 1157 11317 --
NM_003559chr17113390 3185 2844 2580 1443 1422 1274 1044 969 537 236 1826 12850 23464 2812
NM_003563chr1731325 1302 1136 ------
NM_003576chr1332626 568 413 21032 314 12511 11183
NM_003583chr1222688 441 11344 12556 --
NM_003590chr231593 1048 621 1906 --1462
NM_003593chr178685 604 538 503 495 444 266 50 ------
NM_003607chr153917 3671 1589 1003 744 24002 424 1833 13805
NM_003609chr16265 29 ------
NM_003615chr353790 2624 2537 2479 823 1377 12500 --
NM_003620chr172271 150 1248 ----
NM_003629chr182653 2569 2549 2406 1200 1062 830 401 2633 345 22877 1395 --
NM_003631chr104723 648 188 49 ------
NM_003632chr174656 101 52 36 ------
NM_003633chr541974 1884 1598 412 ------
NM_003637chr161454 1349 1208 1118 1031 33 1631 ----
NM_003644chr17216591 6498 6452 5929 5337 5220 4992 4201 4192 4097 2254 2037 1951 1219 1049 923 409 236 219 206 29 11280 24795 944 44422 1460 336 263
NM_003655chr171277 ------
NM_003663chr343513 3425 1342 304 32284 2204 277 ----
NM_003670chr31965 11395 ----
NM_003671chr912691 13471 --23110 2447
NM_003672chr121875 1318 ------
NM_003684chr13945 174 102 155 1140 --
NM_003688chrX172 ------
NM_003692chr91846 ------
NM_003693chr174583 247 239 151 ------
NM_003701chr131313 ----1775
NM_003704chr42502 217 ------
NM_003705chr22233 64 ----138
NM_003713chr11218 ------
NM_003719chr53619 322 246 1134 ----
NM_003722chr332293 2201 1992 11737 ----
NM_003728chr4--1225 ----
NM_003741chr32349 118 ------
NM_003743chr241939 1787 1475 211 12305 ----
NM_003744chr1441210 893 203 87 ------
NM_003746chr12193 ------
NM_003749chr1312307 31789 1667 917 ----
NM_003758chr1521391 139 2377 50 ----
NM_003758chr1521391 139 2377 50 ----
NM_003762chr11962 ------
NM_003768chr141849 1464 529 159 ------
NM_003787chr182179 139 21313 187 ----
NM_003791chr161221 ------
NM_003796chr191106 2510 211 ----
NM_003800chr61310 12112 ----
NM_003822chr143036 1140 521 22 193 --12515
NM_003829chr9----172 --
NM_003842chr842423 2285 2191 35 --1480 --
NM_003872chr252719 2667 2380 2177 529 1951 22480 2330 12492
NM_003873chr102820 564 31627 663 457 --1912
NM_003877chr122299 84 1859 ----
NM_003883chr54445 379 363 86 ------
NM_003887chr22804 127 1706 --1439
NM_003893chr103450 332 30 --1181 --
NM_003901chr1031680 792 713 11857 2330 320 --
NM_003930chr732506 2297 162 ------
NM_003931chr61629 2211 66 ----
NM_003934chr91229 ------
NM_003938chr192326 274 1301 2427 60 --
NM_003939chr1063745 3682 3420 2822 1505 1010 1121 ----
NM_003949chr1781889 1650 1623 1446 1355 638 516 107 11273 11548 --
NM_003953chr192699 2574 2498 2242 1937 1848 1811 183 89 22518 642 22422 1905 11013
NM_003954chr1781441 1023 988 981 587 574 285 191 ----171
NM_003955chr1771508 1211 1126 542 245 111 103 --1453 --
NM_003958chr6123903 3620 3032 2796 2712 2463 2439 1475 1123 669 657 175 1390 23418 2542 195
NM_003966chr5157755 7302 6069 4793 4751 4745 2591 2470 2095 1786 1532 1514 1196 1041 631 55966 3121 2626 1405 393 --1828
NM_003968chr3--1155 ----
NM_003980chr611021 ------
NM_003983chr1691606 1432 1156 823 652 476 404 255 55 187 11700 --
NM_003987chr10112145 1880 1736 1531 1449 913 898 891 812 603 545 11963 ----
NM_003988chr1082222 1957 1813 1608 1526 889 680 622 12040 ----
NM_003989chr10112081 1816 1672 1467 1385 849 834 827 748 539 481 11899 ----
NM_003990chr10112081 1816 1672 1467 1385 849 834 827 748 539 481 11899 ----
NM_003994chr1244020 817 703 611 13890 ----
NM_003998chr41499 ------
NM_004006chrX42321 1964 1809 104 ------
NM_004007chrX42321 1964 1809 104 ------
NM_004009chrX42321 1964 1809 104 ------
NM_004010chrX42321 1964 1809 104 ------
NM_004011chrX42321 1964 1809 104 ------
NM_004012chrX42321 1964 1809 104 ------
NM_004013chrX42321 1964 1809 104 ------
NM_004014chrX42321 1964 1809 104 ------
NM_004015chrX42321 1964 1809 104 ------
NM_004016chrX32235 1878 1723 ------
NM_004017chrX42321 1964 1809 104 ------
NM_004018chrX32235 1878 1723 ------
NM_004020chrX42321 1964 1809 104 ------
NM_004021chrX32235 1878 1723 ------
NM_004022chrX32235 1878 1723 ------
NM_004023chrX32235 1878 1723 ------
NM_004035chr1795070 4949 4531 4426 3631 3411 3321 1464 442 11079 25055 1250 --
NM_004036chr25658 480 470 273 167 --2283 156 --
NM_004050chr1462540 2249 2127 1725 739 674 --52141 1047 799 627 319 22134 1780
NM_004055chr1182014 1970 1891 1821 1433 789 636 294 2749 448 21483 25 --
NM_004059chr93393 378 335 --125 --
NM_004061chr51518 ------
NM_004063chr84653 381 358 166 ------
NM_004089chrX51282 1214 930 884 178 1865 1259 --
NM_004090chr17133242 2850 2308 2171 785 727 640 470 412 249 219 165 145 32555 2123 1122 22923 707 1885
NM_004093chr1362708 2689 2051 524 185 63 32186 778 207 ----
NM_004096chr1051789 1691 1608 559 290 ----11819
NM_004098chr103962 947 361 ------
NM_004099chr961978 1965 1932 1883 1859 1581 ----11728
NM_004100chr61309 --22119 387 --
NM_004114chrX21189 26 ------
NM_004116chr23478 155 61 ------
NM_004130chr32648 44 ------
NM_004132chr1041165 1102 978 46 --11031 --
NM_004134chr54639 617 456 65 ------
NM_004161chr22263 172 ------
NM_004171chr11169476 9079 8648 8387 7359 6829 6454 6416 6250 6015 2166 1968 1647 1373 1291 431 39252 9202 5979 --11262
NM_004172chr541983 1944 1703 817 --1571 --
NM_004176chr173452 379 66 ------
NM_004185chr14229 217 154 95 --1173 --
NM_004186chr32952 853 --1752 --
NM_004187chrX101403 1357 1331 921 467 379 220 144 135 28 1205 ----
NM_004193chr10271 51 --1380 --
NM_004200chr11123265 2876 2723 2572 2530 2376 1217 1161 529 247 211 113 --12173 1493
NM_004202chrY1287 ------
NM_004206chr31239 --136 --
NM_004209chr16--11120 1219 --
NM_004225chr831469 1106 931 ------
NM_004227chr782526 2483 2379 2068 720 193 177 100 22710 954 32677 1238 1197 12449
NM_004235chr9--1350 ----
NM_004236chr15------1103
NM_004241chr10--155 ----
NM_004252chr174641 511 425 157 184 ----
NM_004262chr431325 1180 311 11021 ----
NM_004263chr271566 1531 1257 277 193 152 100 31422 1380 1248 31191 493 401 1375
NM_004272chr531816 300 71 11677 ----
NM_004274chr142747 189 13002 188 --
NM_004276chr122388 361 ------
NM_004279chr732373 709 181 1144 ----
NM_004293chr923742 2404 ------
NM_004302chr1262696 2409 2217 753 487 221 1767 3463 379 120 --
NM_004308chr1181728 1664 1474 1374 1299 1196 654 471 187 1156 --
NM_004311chr1082991 2718 2363 2276 2168 2053 881 180 ----152
NM_004319chr182834 1282 1087 567 492 486 325 296 1711 ----
NM_004320chr164330 140 79 24 ------
NM_004321chr2153560 3420 3389 3356 3167 2706 2666 2510 2292 855 811 624 422 220 65 13175 23198 818 --
NM_004326chr11776 --2933 53 --
NM_004327chr22102510 2388 1964 1922 1887 1553 750 485 450 86 22008 1527 22396 277 --
NM_004329chr103502 308 285 ------
NM_004337chr871916 1884 1858 1561 700 420 162 ----1332
NM_004342chr721962 69 ------
NM_004349chr811102 ------
NM_004356chr112493 368 ------
NM_004358chr2071124 1101 894 793 433 380 132 1205 --1327
NM_004362chr41570 ------
NM_004364chr194989 837 348 291 1129 21250 26 --
NM_004370chr631681 1336 215 11567 ----
NM_004379chr221325 360 ------
NM_004380chr1652239 2103 2047 1694 649 2532 433 ----
NM_004383chr153617 415 258 ------
NM_004384chr51476 ------
NM_004391chr341440 1371 528 112 21570 1424 2308 298 --
NM_004392chr1312030 2560 108 ----
NM_004393chr352243 1971 1650 720 358 --2702 666 1282
NM_004397chr1144208 3475 1389 404 --33291 2702 1340 --
NM_004398chr11--129 1443 --
NM_004407chr42920 375 1125 ----
NM_004416chr126678 410 283 201 74 40 ------
NM_004417chr5154 ------
NM_004420chr1152002 1779 1605 1570 477 --22191 2081 1970
NM_004422chr172363 55 ------
NM_004423chr372703 2283 2147 800 693 544 180 12447 ----
NM_004426chr1221319 714 ------
NM_004430chr821095 925 --2287 104 1708
NM_004432chr921804 703 ----1330
NM_004433chr121793 159 --21554 216 --
NM_004436chr13446 61 28 2580 197 ----
NM_004437chr122280 1154 --1540 --
NM_004438chr242240 1104 346 295 1101 12608 --
NM_004440chr62265 100 --1686 11636
NM_004441chr331030 517 433 ------
NM_004443chr33733 521 24 ------
NM_004444chr73693 306 82 ------
NM_004447chr121458 ----172
NM_004449chr21------11274
NM_004451chr116675 592 519 263 207 136 2512 480 ----
NM_004454chr321944 1486 --2746 396 --
NM_004458chrX42438 2284 2038 1760 21658 928 ----
NM_004459chr172671 98 ----1695
NM_004468chr11165 1404 ----
NM_004472chr51181 ------
NM_004474chr12974 762 ------
NM_004475chr1741101 859 806 344 --1410 1372
NM_004481chr172695 2226 2219 1665 1042 1013 27 22626 767 12206 --
NM_004491chr1984243 2992 1593 669 562 527 184 44 2415 275 43508 2791 386 359 166
NM_004494chr131230 1096 332 1246 21291 1251 --
NM_004499chr5----1477 --
NM_004501chr124080 2686 23549 2897 33653 2710 2693 --
NM_004503chr122269 158 1286 ----
NM_004514chr17122575 2541 1929 1902 1185 1159 1110 1043 873 855 737 91 13074 12534 22717 2478
NM_004516chr19--11239 11015 --
NM_004529chr921338 960 ----1277
NM_004530chr163985 459 285 --1301 11001
NM_004535chr2051798 1620 689 523 57 1630 ----
NM_004537chr1211158 2227 59 122 --
NM_004554chr1481841 1691 1564 1435 524 192 105 50 --1408 --
NM_004555chr161145 1100 191 --
NM_004560chr94231 183 166 148 ------
NM_004566chr10101930 1895 601 564 290 211 204 129 84 55 31846 1676 907 32231 888 315 --
NM_004580chr15--11685 --1729
NM_004583chr171644 --1638 --
NM_004586chrX43589 3456 726 518 13901 --11921
NM_004588chr11123352 3153 2517 1621 1524 1053 1026 828 436 261 206 54 34079 513 131 32808 603 223 --
NM_004594chr165934 861 716 702 55 1950 ----
NM_004598chr573169 3034 1294 1107 901 687 431 --13310 --
NM_004600chr111532 1419 ----
NM_004603chr73787 380 346 --3475 414 54 --
NM_004608chr163318 146 110 --1458 161
NM_004612chr924711 445 --23134 1661 --
NM_004615chrX4375 284 218 114 ------
NM_004622chr252159 2108 881 300 25 ------
NM_004635chr331006 292 158 --3399 298 68 --
NM_004642chr12------1138
NM_004651chrX1350 ------
NM_004656chr351276 826 497 490 411 --3484 166 124 --
NM_004660chrY32318 346 122 ------
NM_004663chr1521544 1115 ------
NM_004667chr15--1453 ----
NM_004685chr1322979 570 ------
NM_004687chr1751952 1706 699 477 399 --11550 --
NM_004689chr141375 ------
NM_004690chr61114 1539 ----
NM_004703chr1712492 ----12427
NM_004707chr511164 11640 --163
NM_004709chrX31299 235 169 1353 1519 11498
NM_004714chr192326 86 130 160 --
NM_004723chr12348 190 2782 356 1912 --
NM_004725chr1031078 1056 277 ------
NM_004726chrX84908 4342 3580 2077 2054 1861 777 444 55436 5113 5025 3545 1231 ----
NM_004730chr521746 1623 ------
NM_004734chr1341313 993 437 154 22610 2292 ----
NM_004736chr11344 --1853 --
NM_004740chr17----178 --
NM_004742chr32441 329 ------
NM_004745chr8116738 6001 5787 5571 5040 5009 4378 2498 2246 2156 514 31914 1887 423 31563 248 72 --
NM_004748chr1523748 1063 1365 1735 --
NM_004758chr1771168 1099 892 358 198 96 82 --1248 --
NM_004759chr181713 1540 1345 779 618 504 205 63 --11838 1605
NM_004760chr7--21798 669 ----
NM_004761chr62171 122 165 1327 --
NM_004762chr1731991 1484 36 21399 524 41763 1426 718 499 1114
NM_004765chr16121 ------
NM_004768chr11791 1740 1109 --
NM_004772chr531292 125 119 1992 1601 --
NM_004774chr1742887 1172 987 431 12213 12537 --
NM_004779chr52406 385 ----1197
NM_004796chr142283 252 ------
NM_004798chr2073121 2878 2479 931 882 693 108 43509 3431 2935 839 13326 --
NM_004800chr13----179 --
NM_004805chr231207 886 204 1231 ----
NM_004807chr232676 1777 635 11649 --1130
NM_004808chr1032594 2329 28 1701 ----
NM_004815chr123852 3471 --34608 4525 4148 --
NM_004821chr5187 145 ----
NM_004822chr17103114 2640 2567 2537 2514 1323 836 306 193 66 13532 21473 352 23356 245
NM_004827chr42675 295 --21639 1593 --
NM_004834chr22678 50 1334 ----
NM_004835chr31317 ----1156
NM_004835chr31317 ----1156
NM_004838chr192160 82 ------
NM_004842chr61320 ------
NM_004845chrX83682 3297 3188 1572 1381 585 428 400 31088 837 125 ----
NM_004849chr611686 ------
NM_004869chr1811435 --11282 --
NM_004871chr1763120 1513 1051 732 481 47 11560 13155 --
NM_004879chr113183 134 101 1662 ----
NM_004884chr1571769 1442 708 477 229 122 96 11475 2387 159 --
NM_004902chr201737 2628 133 --1748
NM_004904chr775580 5208 5142 5104 4477 4269 1451 36126 1722 1701 24795 958 15070
NM_004906chr62643 505 ------
NM_004921chr131906 1612 528 ----151
NM_004922chr104988 766 309 181 ------
NM_004923chr114307 246 121 90 1151 ----
NM_004924chr191403 --2355 317 --
NM_004925chr91623 --242 36 --
NM_004930chr13517 487 150 ------
NM_004932chr541614 1335 1103 307 ------
NM_004938chr91917 --11110 --
NM_004943chr1931205 832 202 2952 243 11184 --
NM_004947chr322600 997 21965 971 11037 --
NM_004952chr18886 760 684 307 294 287 231 223 --1855 --
NM_004960chr163308 85 41 ------
NM_004965chr211494 --1254 --
NM_004966chr102913 363 ------
NM_004973chr631666 1586 706 ------
NM_004976chr11185062 4768 4680 4632 4435 3961 3694 3232 2017 1992 1628 1374 1316 1069 790 316 282 183 --54028 3451 2041 1795 537 --
NM_004978chr181656 1649 1582 1539 1447 1303 425 368 --1402 --
NM_004985chr1251553 1161 1008 511 466 ------
NM_004991chr33407 321 84 1112 ----
NM_004992chrX248257 8067 7982 7615 7525 6691 5826 5330 5209 3196 3171 3139 2840 2532 2514 2507 2477 2229 1689 1512 1433 1426 1205 649 21545 678 43156 1416 1026 81 --
NM_004992chrX248257 8067 7982 7615 7525 6691 5826 5330 5209 3196 3171 3139 2840 2532 2514 2507 2477 2229 1689 1512 1433 1426 1205 649 21545 678 43156 1416 1026 81 --
NM_004993chr142555 462 11319 ----
NM_004995chr1491266 524 423 408 384 310 211 157 138 2402 49 11042 1440
NM_005010chr711953 ------
NM_005011chr731435 1272 1236 11429 11379 --
NM_005017chr31224 ------
NM_005025chr31188 ------
NM_005027chr1991091 1035 419 390 318 306 296 118 36 --11136 --
NM_005032chrX2310 276 11055 ----
NM_005045chr71926 1666 --1936
NM_005053chr192558 481 ----1449
NM_005056chr1234714 1410 1213 24885 2196 11222 --
NM_005063chr1043396 1540 966 388 33836 1395 1163 ----
NM_005065chr1455230 4704 4375 4277 659 45176 4199 3516 974 44447 4302 801 22 --
NM_005077chr92316 122 ------
NM_005078chr1541507 1250 516 343 1236 153 --
NM_005087chr31595 1149 1216 --
NM_005093chr20185260 5101 4874 4844 4642 4396 4222 4082 3925 1928 1769 1606 1587 1195 1001 803 327 23 1434 ----
NM_005096chrX6930 423 349 321 155 46 11259 2198 108 --
NM_005099chr181297 1142 997 402 380 363 250 159 1524 2178 165 --
NM_005105chr1157 12147 --11658
NM_005110chr51559 1546 1711 1192
NM_005117chr111626 --2655 87 --
NM_005119chr11155 --21109 412 --
NM_005121chr1722588 2473 ------
NM_005124chr6147 ------
NM_005128chr211478 ------
NM_005134chr181276 --1748 --
NM_005137chr22142416 2082 1720 1628 883 803 775 698 685 612 605 589 200 65 --2854 628 --
NM_005151chr1852199 2020 706 631 564 12261 11523 --
NM_005153chr163725 274 145 ------
NM_005156chr924915 111 --14673 11909
NM_005159chr1531598 880 248 11948 1837 --
NM_005165chr172323 301 --2370 358 --
NM_005168chr21153 2588 312 11153 --
NM_005180chr102367 39 ------
NM_005187chr1651632 1512 532 325 246 11278 21576 1530 --
NM_005188chr11207585 7461 7409 7270 6969 6802 6761 6723 6540 6210 5761 5516 5221 5208 5074 2866 2835 2322 1840 962 27632 1687 26572 6053 37009 6748 2664
NM_005197chr1475729 4267 4144 1709 1681 1646 806 1635 ----
NM_005202chr172207 780 745 434 362 274 120 --3606 244 27 1293
NM_005207chr22123548 3509 3401 3148 2830 2425 2290 1464 945 797 663 170 1999 ----
NM_005219chr541615 1590 117 51 --3421 346 234 --
NM_005220chr1771139 1099 972 554 452 392 25 1188 ----
NM_005221chr7------1220
NM_005225chr2051008 963 409 145 73 --1461 158
NM_005229chrX31165 1087 442 11049 1107 --
NM_005233chr322189 977 --1682 --
NM_005235chr296719 5794 5585 5555 5527 5446 4835 2985 2657 1449 1667 --
NM_005238chr1131000 959 269 169 12906 11127
NM_005249chr141361 ------
NM_005252chr141705 ------
NM_005254chr15--21276 497 1144 --
NM_005257chr1821026 280 ------
NM_005259chr21302 ------
NM_005260chr52260 24 ------
NM_005261chr82883 135 ------
NM_005273chr72115 40 --1232 --
NM_005276chr1271618 1539 1464 1318 1307 1265 227 1170 1652 --
NM_005276chr1271618 1539 1464 1318 1307 1265 227 1170 1652 --
NM_005277chr421276 642 --1541 --
NM_005278chrX133 ------
NM_005281chr12318 28 ------
NM_005310chr172350 246 ------
NM_005311chr742481 2101 923 855 12533 --1341
NM_005324chr1722128 1723 ------
NM_005327chr41258 --122 --
NM_005329chr1652040 1709 1527 734 172 --21687 899 --
NM_005339chr43628 246 161 14356 12760 --
NM_005342chrX52544 1946 1936 438 376 1202 --12034
NM_005358chr1341850 1548 1358 417 ------
NM_005359chr18116062 5151 4824 4555 4312 2611 2371 2303 2202 1719 139 15830 --15300
NM_005370chr1931271 1072 454 ------
NM_005374chr17142111 2002 1980 1822 1812 1750 1505 882 800 726 461 252 225 67 11585 1713 --
NM_005375chr611159 ------
NM_005381chr21115 ------
NM_005388chr9----1523 --
NM_005398chr1011447 ----1390
NM_005399chr164371 4183 1516 883 142 129 22966 964 ----
NM_005402chr71683 ----2399 241
NM_005406chr1811583 ------
NM_005409chr4125 1201 ----
NM_005417chr20101917 1667 1433 1399 1393 1339 1327 557 443 272 --11371 --
NM_005418chr113628 265 33 ------
NM_005424chr13325 87 28 ------
NM_005426chr11345 ------
NM_005430chr124661 396 330 210 11000 ----
NM_005436chr1053826 3131 2924 2623 246 ----22798 2582
NM_005437chr1021365 991 ------
NM_005442chr31111 ------
NM_005456chr114711 702 672 645 --1452 --
NM_005458chr942145 747 385 85 ----1576
NM_005461chr2041793 1345 1339 1259 --2542 108 --
NM_005465chr111796 ------
NM_005474chr1751134 372 220 154 113 11546 ----
NM_005475chr1242997 2984 530 37 --22616 2335 22829 1249
NM_005476chr941217 1063 347 42 1371 1484 --
NM_005477chr1572345 1823 1787 1715 963 703 597 --72463 2305 2075 1639 494 446 434 --
NM_005477chr1572345 1823 1787 1715 963 703 597 --72463 2305 2075 1639 494 446 434 --
NM_005479chr1061591 1474 1057 1031 432 57 11188 11006 --
NM_005493chr6166 ------
NM_005497chr1766133 2449 1457 1164 458 92 15325 ----
NM_005502chr932252 645 566 --1910 --
NM_005503chr151430 1328 1922 11038
NM_005506chr422203 870 --143 1211
NM_005509chr51139 ------
NM_005517chr131328 315 278 21436 559 ----
NM_005520chr51133 --1694 --
NM_005522chr7--1395 11055 --
NM_005523chr73386 248 68 21099 328 1633 --
NM_005530chr151254 ------
NM_005539chr101257 --1462 --
NM_005542chr72573 199 1187 --2333 231
NM_005562chr151442 1290 324 193 144 11470 ----
NM_005566chr111185 2560 141 ----
NM_005570chr181242 21095 292 ----
NM_005575chr5159 ------
NM_005578chr323770 3417 23640 2050 ----
NM_005584chr13--1256 ----
NM_005595chr12917 367 ------
NM_005596chr975920 5338 4988 2122 1490 1345 585 ----11497
NM_005598chr151598 1578 675 418 171 --41448 554 531 119 --
NM_005604chr642176 2031 822 412 ------
NM_005605chr81312 ------
NM_005609chr11132 ------
NM_005610chr13834 797 54 ------
NM_005613chr14870 855 818 47 22118 1835 11374 --
NM_005614chr73821 698 159 2848 71 ----
NM_005625chr821047 1005 ------
NM_005627chr61802 21007 236 ----
NM_005628chr19289 27 ------
NM_005630chr371857 1844 1515 1447 234 43 23 1714 1332 --
NM_005632chr164966 728 393 352 1178 ----
NM_005634chrX3555 112 80 ------
NM_005638chrX--11603 --11362
NM_005639chr1211450 ----11834
NM_005643chr61141 --1189 --
NM_005647chrX73024 2604 2136 1223 1137 692 312 32881 2247 117 ----
NM_005652chr1661113 983 866 311 117 58 ------
NM_005653chr121363 148 ----
NM_005655chr811005 ------
NM_005656chr2121054 22 11307 --1507
NM_005665chr133646 3074 1671 ------
NM_005667chr21162 ------
NM_005668chr564346 1738 904 883 689 485 14125 ----
NM_005676chrX1186 ------
NM_005677chr361398 1124 1036 989 415 79 ------
NM_005704chr16826 778 376 314 248 88 11134 ----
NM_005707chr152432 151 1127 ----
NM_005717chr1183 1832 ----
NM_005718chr34706 547 230 64 ------
NM_005721chr2--11048 1264 --
NM_005722chr21699 21974 1707 ----
NM_005725chr131892 274 171 12360 ----
NM_005735chr24667 321 266 120 --1213 1113
NM_005736chr103453 231 157 2646 31 2412 149 11005
NM_005737chr242592 2514 598 319 --12846 --
NM_005738chr731486 660 156 ------
NM_005740chr225763 592 369 138 81 ------
NM_005744chr15--129 ----
NM_005749chr17170 ------
NM_005751chr71339 ------
NM_005776chr14--2875 298 ----
NM_005778chr33500 408 93 ------
NM_005779chr563451 3327 2636 2617 1342 32 22353 1072 ----
NM_005781chr33282 160 91 --1306 1678
NM_005789chr1751690 1678 799 780 57 22153 2068 1500 --
NM_005792chr162546 218 ------
NM_005797chr1121606 1358 ------
NM_005813chr21644 31645 1610 654 ----
NM_005819chr182361 2324 1276 1022 773 652 495 280 ----12886
NM_005822chr642086 1616 636 172 22201 1890 1352 --
NM_005828chr1744100 4072 1513 614 31545 1132 790 24084 3293 34665 3799 697
NM_005840chrX197356 6883 6614 6253 5854 5716 5527 5498 4701 3026 2992 2842 2599 2588 2497 2395 1508 1098 171 66565 5645 5547 5407 2387 2101 22656 356 --
NM_005842chr131527 ------
NM_005851chr113355 110 66 --1363 --
NM_005852chr173817 398 369 --11115 1210
NM_005853chr162605 52 ------
NM_005857chr1148 --11425 1394
NM_005860chr1951652 1645 1180 1093 144 1376 ----
NM_005862chr31906 ------
NM_005864chr144570 255 59 21 --1604 --
NM_005871chr102979 761 ------
NM_005875chr3167 ------
NM_005876chr22652 616 --2778 644 --
NM_005877chr22142158 2113 2047 2013 1908 1592 757 749 454 377 164 145 95 83 11852 ----
NM_005880chr1621476 1385 ----1374
NM_005882chr41744 ------
NM_005885chr531644 395 228 1172 ----
NM_005895chr12103854 3828 3747 3652 3099 2891 2683 1441 1105 773 21615 1303 ----
NM_005896chr2--1814 ----
NM_005898chr1143079 2699 2622 231 22994 2090 ----
NM_005900chr4141 --199 --
NM_005901chr18138665 8570 8249 8022 6649 5722 5611 5465 3416 2320 2082 1403 609 47406 7388 7289 2516 48152 7542 3409 2534 --
NM_005902chr15104386 1798 1766 1705 1684 1579 1279 1088 457 252 24269 1715 14234 13566
NM_005904chr185951 920 561 254 77 11221 ----
NM_005906chr63489 64 58 11704 11234 11253
NM_005907chr611219 11056 ----
NM_005909chr543271 3265 1599 845 --11670 --
NM_005910chr17114160 3910 3061 3022 2770 2735 1512 1484 1264 840 405 13008 12579 1351
NM_005911chr22431 112 --163 --
NM_005920chr1123715 3419 3266 3015 2913 1476 1185 981 896 371 122 33 13090 11552 --
NM_005924chr71984 1829 ----
NM_005933chr1172789 2732 2676 2611 2216 847 440 --12851 12601
NM_005934chr1992293 2168 1717 1638 456 312 275 115 39 22398 441 2911 193 --
NM_005935chr485105 3414 3209 1885 1871 1159 1133 28 1364 21926 687 --
NM_005937chr1774031 3740 3385 1473 1052 667 21 197 33379 397 106 --
NM_005941chr863316 3010 2672 1379 557 152 21433 949 12815 --
NM_005943chr651715 1485 1381 1285 1255 --31306 640 535 --
NM_005955chr194599 3925 3800 3492 3372 1632 1577 1001 668 13907 33768 1887 1497 --
NM_005962chr1062259 1801 1576 1456 577 391 ------
NM_005962chr1062259 1801 1576 1456 577 391 ------
NM_005964chr1751525 1366 1291 624 371 21002 104 ----
NM_005968chr19--2258 39 ----
NM_005969chr1171037 982 949 359 335 324 309 --1778 --
NM_005996chr1221351 1003 ------
NM_006011chr15104183 4094 3943 3685 3477 3369 3142 3115 1217 895 34030 3806 2817 ----
NM_006015chr11265 ------
NM_006020chr1421313 143 ------
NM_006030chr32487 151 --1132 --
NM_006032chr141201 --150 --
NM_006034chr1182097 1734 1547 750 233 112 101 24 2574 531 32021 1821 840 --
NM_006036chr22488 333 1791 ----
NM_006037chr284146 3353 3231 3199 3140 1967 1331 692 23825 1564 ----
NM_006039chr175850 816 752 440 255 1760 155 1933
NM_006043chr163276 95 74 1627 ----
NM_006047chr2053493 3162 2697 1087 557 ----11332
NM_006062chr24981 842 254 26 ----1188
NM_006064chrX--1141 --176
NM_006079chr6----1212 --
NM_006080chr71890 ------
NM_006085chr12880 291 ------
NM_006091chr1541339 1147 282 168 --11106 --
NM_006094chr822077 197 3593 94 68 1827 --
NM_006095chr454207 3782 1011 476 27 14274 ----
NM_006096chr841565 1368 138 33 --21571 351 --
NM_006106chr1122373 592 --12658 --
NM_006108chr1131931 622 609 11654 --11475
NM_006113chr11282 21419 627 1656 --
NM_006133chr11141954 1776 1709 1689 1573 927 876 736 717 681 607 483 443 49 12133 2935 841 --
NM_006135chr141051 499 341 187 ------
NM_006139chr232396 1964 63 1176 ----
NM_006141chr1642770 2724 2586 1023 ------
NM_006154chr1521853 292 ----1868
NM_006164chr21420 ------
NM_006166chr1252467 2208 617 253 131 12231 ----
NM_006180chr961922 1521 1469 784 426 110 11384 ----
NM_006190chr2--41098 1064 977 762 ----
NM_006195chr92251 23 21382 923 137 --
NM_006197chr8----1191 --
NM_006198chr211249 ------
NM_006201chrX1919 21183 1075 21113 411 11122
NM_006203chr565121 3921 2204 1585 507 133 34220 3611 2096 25129 4330 --
NM_006209chr81314 ------
NM_006211chr81100 ------
NM_006212chr165277 2152 1402 674 342 121 34170 2093 1953 3808 792 57 11890
NM_006224chr1762410 2315 2068 1760 1639 847 --2973 547 1728
NM_006226chr21359 ------
NM_006237chr1342291 889 864 157 12063 1188 --
NM_006243chr13800 350 159 ----1910
NM_006245chr631053 732 680 --4703 303 57 44 --
NM_006246chr1421100 521 --11237 --
NM_006251chr543352 2266 719 615 --11154 --
NM_006252chr177607 6848 5639 1821 1468 1028 935 37464 2424 667 ----
NM_006258chr10128 --1293 1232
NM_006267chr21236 ------
NM_006268chr1131022 295 281 11094 1168 --
NM_006275chr2022439 1642 ------
NM_006277chr24526 240 214 133 ------
NM_006281chr831015 968 903 1293 ----
NM_006281chr831015 968 903 1293 ----
NM_006288chr113771 102 64 --2869 466 --
NM_006293chr155955 339 241 216 40 ------
NM_006301chr123520 454 145 1667 ----
NM_006306chrX115010 4568 2285 1520 1114 1048 813 765 598 462 24 54880 4378 3996 212 186 ----
NM_006307chrX182 ------
NM_006310chr171280 21281 832 ----
NM_006312chr123203 110 61 ------
NM_006313chr12--11136 ----
NM_006317chr51288 ------
NM_006320chr421106 841 1231 ----
NM_006321chr341919 1899 121 80 1240 1488 11978
NM_006322chr133778 102 75 ------
NM_006323chr41272 ------
NM_006324chr161222 ------
NM_006325chr122234 53 ------
NM_006336chr9121488 1456 1378 1075 1062 1038 614 544 446 424 257 32 11201 11360 --
NM_006352chr132008 1762 269 --11376 --
NM_006353chr65404 274 253 223 23 --11097 --
NM_006356chr17124 ------
NM_006359chrX22396 1571 193 1475 --
NM_006367chr121045 1024 2772 349 1118 --
NM_006369chr12296 150 --1160 --
NM_006371chr384118 3815 3678 3635 3478 3301 1491 458 24824 3415 24857 1547 --
NM_006375chrX21426 1276 21584 31 21204 265 --
NM_006377chr951167 1013 980 877 515 --1186 1836
NM_006379chr7144 1122 ----
NM_006380chr1723297 2747 --22673 685 --
NM_006384chr15123 ------
NM_006386chr2221754 493 ------
NM_006389chr1141016 915 907 92 --1527 --
NM_006391chr111260 1267 ----
NM_006405chr14149 --1223 --
NM_006411chr64883 821 794 725 ----173
NM_006420chr20132 4898 833 765 349 ----
NM_006421chr8----11065 --
NM_006424chr451861 1547 1480 196 41 ------
NM_006425chr541309 587 481 289 11237 ----
NM_006434chr1072947 2595 2119 1259 1089 749 741 22009 439 1635 --
NM_006451chr51827 ------
NM_006454chr492910 2852 2800 2525 2193 1044 841 785 641 1382 22097 246 --
NM_006457chr41256 12946 --1118
NM_006459chr1041538 748 740 132 --21915 728 11811
NM_006460chr1751745 1439 1349 633 127 21535 542 11264 --
NM_006465chr1582171 2123 1681 1611 724 380 232 162 12146 1696 11510
NM_006466chr2011030 192 ----
NM_006469chr11653 ------
NM_006472chr141212 1124 989 122 2397 284 ----
NM_006480chr56482 409 191 99 77 68 --1388 --
NM_006482chr1222688 441 11344 12556 --
NM_006483chr192326 86 130 160 --
NM_006484chr192326 86 130 160 --
NM_006489chr1441731 1322 1276 425 11610 ----
NM_006494chr191231 ----2740 76
NM_006504chr1032339 2307 2081 21994 428 12853 --
NM_006516chr121395 343 21487 309 ----
NM_006517chrX61909 1818 1504 483 287 252 --21748 1643 --
NM_006520chrX11697 11283 --11588
NM_006521chrX9947 934 525 500 446 268 183 100 22 --1486 --
NM_006526chr2031485 756 737 1272 ----
NM_006532chr1971999 1630 1396 722 465 245 193 --31697 459 150 --
NM_006538chr254080 3297 3033 2957 552 ------
NM_006539chr163539 66 40 --1429 --
NM_006544chr1445247 4388 2212 1209 12068 11649 --
NM_006546chr17116282 5891 5674 4747 4112 2012 1994 1129 962 869 166 24394 1476 35429 4735 2005 --
NM_006547chr732121 1419 267 31685 1486 187 ----
NM_006548chr3--21533 291 1158 11602
NM_006557chr921149 617 --11270 --
NM_006558chr8145 ------
NM_006561chr1075793 5673 4832 2453 1950 1745 1292 25241 1970 24947 2304 12229
NM_006565chr163850 441 219 ----1507
NM_006572chr1722883 973 12664 ----
NM_006575chr1411067 ------
NM_006599chr16108063 5616 5384 3269 2244 1793 1157 1023 136 31 12544 26799 47 --
NM_006602chr20181 175 1285 --
NM_006609chr262338 2218 980 682 596 62 ------
NM_006618chr111002 ------
NM_006621chr151875 1828 1816 1780 499 ----11277
NM_006622chr51221 ------
NM_006624chr102553 415 --12103 --
NM_006628chr1544558 3659 1331 969 13099 --1482
NM_006631chr191624 141 ----
NM_006636chr22207 117 ------
NM_006640chr1751824 601 536 428 354 21909 437 11762 --
NM_006650chr5123814 3733 3675 3573 3456 2862 2574 1304 896 729 370 127 13875 53714 3206 2509 503 449 --
NM_006651chr461460 1278 1269 930 128 70 --11353 --
NM_006654chr1223380 1286 1769 ----
NM_006690chr2071689 1507 855 694 426 228 76 --21812 1580 --
NM_006698chr203919 246 114 ------
NM_006699chr1--32363 2074 324 11006 2832 301
NM_006711chr162608 101 1579 ----
NM_006718chr61849 --1179 --
NM_006720chr10125006 4794 4623 3893 3127 1796 1740 1626 1452 1244 1144 563 24580 3955 22013 526 11692
NM_006721chr10157 ----1745
NM_006722chr312663 --12345 1660
NM_006729chrX85407 5224 3415 2216 1962 1937 930 891 35533 3670 940 15326 11639
NM_006734chr611176 --1465 --
NM_006736chr261714 1438 1428 467 200 82 --2491 318 --
NM_006738chr15113908 3740 3574 3229 1867 1536 1375 1181 932 140 35 11246 13549 31747 1405 1043
NM_006742chr1681735 1292 543 501 468 443 375 276 21251 226 31859 1819 524 --
NM_006744chr102236 207 1176 ----
NM_006750chr1688004 7697 7344 5342 2195 2069 667 464 55934 5625 1483 1434 537 2401 28 1572
NM_006754chr7164 --1437 --
NM_006761chr172135 31 ------
NM_006763chr161975 1704 1304 565 538 455 --2392 21 --
NM_006766chr8----11810 --
NM_006775chr612518 32511 437 23 --12440
NM_006777chrX12128 31864 275 166 ----
NM_006804chr17135 ------
NM_006805chr52682 653 1196 ----
NM_006809chr205625 323 250 130 67 2612 81 1604 1109
NM_006813chr62252 90 151 ----
NM_006815chr1221029 497 ------
NM_006826chr22956 164 ------
NM_006827chr1453270 2709 2606 2124 301 1928 ----
NM_006833chr74405 134 113 73 ------
NM_006836chr121496 ------
NM_006837chr8------1108
NM_006841chr34621 604 205 43 1226 ----
NM_006846chr5----1240 --
NM_006851chr121940 12285 12476 --
NM_006852chr1742108 2068 342 205 31156 945 454 1264 --
NM_006854chr761981 1824 1281 816 389 135 ------
NM_006856chr123784 738 88 ------
NM_006861chr1271789 1714 706 688 634 583 327 --31732 1413 417 --
NM_006874chr42856 815 ------
NM_006876chr111206 --1184 --
NM_006885chr1623923 2873 12762 12983 --
NM_006887chr21748 --1577 --
NM_006888chr1473459 3218 2529 2297 1024 593 188 33209 3035 2543 12452 --
NM_006892chr2031366 447 85 168 ----
NM_006892chr2031366 447 85 168 ----
NM_006893chr1148 ------
NM_006895chr212087 21613 1513 ----
NM_006896chr741092 756 283 223 --1880 --
NM_006897chr124632 596 541 409 ------
NM_006899chr203315 297 242 ------
NM_006901chr152206 108 --1348 --
NM_006902chr132092 221 61 22465 748 ----
NM_006906chr115798 681 335 80 68 ------
NM_006908chr7128 11516 ----
NM_006910chr16181 ------
NM_006914chr921520 113 ------
NM_006930chr531957 757 419 ------
NM_006939chr142891 208 ------
NM_006946chr11----2582 443 --
NM_006948chr211708 22165 1866 1911 11966
NM_006950chrX6869 650 290 153 90 31 1275 --3915 371 54
NM_006951chr101720 ------
NM_006955chr1032709 2501 857 2948 90 --21365 1105
NM_006956chr721645 1603 11915 ----
NM_006979chr61413 --2473 78 --
NM_006981chr912875 2832 445 1814 --
NM_006990chr162480 2420 961 774 214 202 22211 132 12204 11640
NM_006993chr10153 188 ----
NM_006999chr541358 1332 820 794 11541 1826 1740
NM_007005chr9152 21097 1010 ----
NM_007008chr2189 ------
NM_007011chr15106795 6562 6172 4222 2305 2250 905 567 559 360 45852 5739 2561 954 1935 12431
NM_007013chr8--1191 ----
NM_007014chr164473 298 168 110 --31188 513 45 --
NM_007030chr5165065 4717 4697 4668 4447 4377 4284 4204 1790 1379 1331 1049 745 633 485 362 25002 1866 1389 14455
NM_007032chr2262229 2151 2141 2060 733 394 22424 699 21097 448 11042
NM_007034chr11223 ------
NM_007038chr2165960 5475 3733 427 318 235 15714 ----
NM_007039chr1441940 1682 1494 232 ------
NM_007040chr1941053 994 308 150 ------
NM_007042chr321971 1053 22090 625 ----
NM_007045chr61111 ------
NM_007050chr20218106 8050 7650 7533 6867 6813 6373 6351 5803 5592 5318 5051 2591 1778 1619 1041 784 461 278 155 136 11186 2633 93 16418
NM_007051chr1134 ------
NM_007073chr653766 3389 3251 793 228 154 11432 11058
NM_007084chr13----1549 --
NM_007087chr162791 217 --1292 --
NM_007106chr1322631 188 ----12567
NM_007112chr1272 50 ------
NM_007114chr3--22205 252 ----
NM_007118chr51723 --1568 --
NM_007122chr13229 204 145 2405 134 ----
NM_007124chr631731 636 31 12017 ----
NM_007125chrY11318 ------
NM_007137chrX85274 5119 4883 4360 4343 3784 2207 982 34895 4692 2179 13944 1882
NM_007144chr1781257 1243 1213 1101 1064 510 503 351 --21281 1045 --
NM_007146chr1712117 22808 2270 1584 --
NM_007150chrX31888 410 368 21555 745 1359 --
NM_007159chr321385 425 1341 ----
NM_007162chr62398 113 ------
NM_007166chr11--11040 ----
NM_007174chr1232385 1795 622 --2684 213 11993
NM_007175chr862409 2227 1423 1286 974 94 12305 ----
NM_007192chr1441053 937 846 829 150 ----
NM_007200chr15113908 3740 3574 3229 1867 1536 1375 1181 932 140 35 11246 13549 31747 1405 1043
NM_007202chr172654 614 ------
NM_007203chr943217 3105 2512 945 33748 3617 3156 ----
NM_007210chr1232070 2050 667 --22035 564 --
NM_007212chr121680 651 --1877 --
NM_007214chr62462 164 ------
NM_007222chr821766 492 11838 --11317
NM_007236chr1561893 1699 805 741 693 364 --1928 --
NM_007238chr2094716 4499 4466 3772 3673 3321 1910 1431 1299 34854 4541 3614 34273 3465 306 --
NM_007243chr63582 489 26 --173 --
NM_007245chr165717 349 293 210 117 1656 ----
NM_007249chr13148799 8616 7299 7161 6680 6602 3289 2735 2506 2391 2317 1442 1163 728 58724 7394 6381 6013 2608 1741 1619
NM_007256chr1171344 1116 573 308 265 90 56 1548 ----
NM_007270chr711275 31420 1294 1125 11492 --
NM_007271chr61515 21249 129 ----
NM_007275chr331109 971 353 1108 ----
NM_007282chr32980 797 ------
NM_007283chr382515 2463 1905 1119 948 514 416 296 12302 12042 12884
NM_007286chr582095 2066 1329 576 486 404 199 126 1439 11967 --
NM_007292chr1795070 4949 4531 4426 3631 3411 3321 1464 442 11079 25055 1250 --
NM_007322chr193562 401 148 ------
NM_007326chr225734 713 653 216 49 1153 1123 --
NM_007327chr981142 999 845 822 798 427 373 224 ------
NM_007331chr472602 2412 1725 1701 1092 847 752 11109 11719 --
NM_007345chr182822 565 22172 1682 ----
NM_007347chr1532890 2812 1053 ------
NM_007350chr1254330 3599 3259 1152 546 13107 ----
NM_007351chr42815 80 ------
NM_007353chr792310 2119 2105 691 525 433 399 362 89 13033 22292 671 1116
NM_007358chr12543 35 --11971 --
NM_007361chr142415 113 ------
NM_007365chr172124 834 815 780 597 156 146 1179 2857 247 1394
NM_007373chr102684 529 ----1421
NM_009585chr31317 ----1156
NM_009585chr31317 ----1156
NM_012069chrX62046 1943 1779 1079 626 199 1590 ----
NM_012071chr10153 1283 ----
NM_012081chr51607 12568 ----
NM_012082chr81684 1611 ----
NM_012090chr131250 1208 969 ------
NM_012095chr1012663 12941 32929 2547 560 --
NM_012102chr152196 839 307 239 186 --22346 2028 --
NM_012104chr1153287 1408 992 955 406 43086 2762 2336 36 1140 1291
NM_012104chr1153287 1408 992 955 406 43086 2762 2336 36 1140 1291
NM_012110chr4156 ------
NM_012120chr652737 2632 2453 2057 1864 ------
NM_012137chr192798 2224 1131 966 721 596 513 421 82 12627 ----
NM_012141chr1342668 1104 1013 606 ----1937
NM_012153chr1152380 1640 727 317 97 ------
NM_012156chr2083323 2967 2415 2381 1372 1284 1045 771 --22600 415 --
NM_012158chr1321322 686 11675 11628 --
NM_012164chr9146466 5811 5794 5498 5479 4771 2766 2454 2431 2098 1936 1525 1364 912 34874 1331 775 25925 719 --
NM_012175chr11--2869 600 1130 --
NM_012183chr12145 76 ----1417
NM_012193chr11105183 5158 5083 4150 4048 3958 3484 3477 1910 294 25232 4327 24948 4655 25303 2177
NM_012199chr1144544 4083 3103 1804 1577 1543 1493 1377 1157 1048 677 366 196 123 11532 1249 11774
NM_012200chr111148 --194 --
NM_012202chr111272 ------
NM_012214chr2106339 5912 5804 5096 4863 4340 4195 2161 861 736 --14786 12209
NM_012223chr21193 11210 ----
NM_012224chr421056 484 ------
NM_012229chr102915 42 ------
NM_012232chr1782199 1921 1359 557 402 395 306 247 22060 1697 21420 626 --
NM_012234chr333488 2959 176 2258 83 11242 --
NM_012245chr142414 384 ------
NM_012247chr101651 ------
NM_012249chr222441 1194 22858 830 ----
NM_012250chr1111287 11136 ----
NM_012252chr734506 1254 67 1255 11329 --
NM_012257chr7----1924 --
NM_012259chr6--176 1332 --
NM_012262chr144500 4262 4036 3237 24161 2039 14527 --
NM_012279chr561803 1531 1323 810 520 193 1641 1766 11547
NM_012286chrX132 ------
NM_012287chr352993 1458 775 445 407 11130 ----
NM_012288chr695332 3508 2032 1303 1010 747 426 316 260 24192 3527 25489 2138 --
NM_012294chr743274 3180 2821 2780 13239 1579 11075
NM_012296chr1153525 3102 2782 1021 162 2885 150 1348 12424
NM_012297chr412159 1491 ----
NM_012300chr52703 175 --21704 1697 --
NM_012302chr12926 441 ------
NM_012304chr5102485 2237 2202 2099 1999 1838 865 654 614 279 --12170 --
NM_012307chr181141 ------
NM_012308chr11102439 2120 1938 1703 998 594 412 338 129 44 --189 --
NM_012309chr1194854 4736 3617 3544 1179 950 452 380 179 ------
NM_012316chr1135490 4577 4487 4198 4103 3881 1909 1509 1361 1003 984 925 708 42122 1926 758 158 2519 417 1121
NM_012323chr2251549 1106 421 185 142 --21128 611 --
NM_012325chr2031449 1352 600 ----11394
NM_012326chr22314 183 --1687 --
NM_012329chr1711442 1236 ----
NM_012330chr1021786 1262 --1543 --
NM_012333chr151445 1390 1048 617 556 1214 ----
NM_012339chr102528 215 --1498 --
NM_012382chr544167 2746 1486 394 22888 866 --11441
NM_012384chr20122243 2194 1757 1701 1499 924 866 850 812 599 437 24 12223 21814 288 12111
NM_012399chr2231539 1506 1375 1613 1719 --
NM_012402chr1171292 493 380 346 319 280 196 --1927 --
NM_012408chr201211 1791 ----
NM_012428chr151287 2818 31 ----
NM_012430chr32104 26 1301 --1290
NM_012434chr64615 527 412 317 11458 1645 --
NM_012448chr1772044 1982 1897 1868 1684 1623 915 22557 713 1845 --
NM_012458chr1961243 1123 476 409 197 150 2444 209 ----
NM_012461chr143667 526 116 ------
NM_012464chr422654 994 1599 --11855
NM_012465chr1062448 1338 1013 887 732 339 176 32306 1086 766 --
NM_012471chrX21801 367 1321 11875 --
NM_012479chr762041 1717 555 534 433 133 12578 ----
NM_012482chr11164 1639 ----
NM_013229chr1252796 2467 1769 817 71 11817 --22475 2372
NM_013230chrY1592 2325 286 ----
NM_013231chr1484329 4292 3866 3305 2797 2734 703 530 14133 ----
NM_013233chr231340 957 25 ------
NM_013245chr166697 685 651 507 464 163 --1191 --
NM_013246chr114834 211 154 65 1779 ----
NM_013247chr22556 386 1463 134 1144
NM_013255chr798636 8078 7827 7478 6042 3258 1758 1387 891 13373 ----
NM_013261chr452401 1066 1030 938 883 1709 --12786
NM_013269chr1274355 3957 1738 546 480 434 419 24022 946 ----
NM_013279chr11102258 2252 2223 2011 1818 907 662 615 519 105 --22023 339 2785 314
NM_013280chr111553 2860 324 145 1540
NM_013281chr20----11322 --
NM_013283chr53735 220 181 ------
NM_013286chr393214 2478 2399 2359 1524 1112 792 342 140 33644 3270 2992 33544 2579 1168 --
NM_013305chr183189 133 96 --2292 250 --
NM_013316chr73903 868 853 ------
NM_013323chr171934 ------
NM_013325chr251473 1096 1084 397 352 ------
NM_013336chr381892 1870 1705 1696 1618 1396 1274 732 --21635 1341 --
NM_013341chr21425 11957 11112 --
NM_013368chr193496 416 401 2204 60 ----
NM_013372chr1532922 2825 395 ------
NM_013381chr1231503 551 366 ----12161
NM_013385chr22111825 1675 1585 1434 1166 709 614 607 423 213 37 11252 --1345
NM_013386chr1------1265
NM_013390chr931452 1089 461 ------
NM_013399chr1641525 687 356 128 --51726 1623 1451 1253 304 --
NM_013400chr771017 916 700 438 423 256 154 --1248 2925 265
NM_013401chr113690 673 367 --3806 99 31 --
NM_013411chr172283 2244 2182 1814 871 609 411 22771 1719 12375 12306
NM_013433chr1961489 1460 1308 674 513 259 --21911 90 --
NM_013434chr271997 1845 1839 1725 1276 589 444 ------
NM_013434chr271997 1845 1839 1725 1276 589 444 ------
NM_013436chr22649 44 ------
NM_013438chr931143 538 282 ------
NM_013443chr941048 1005 378 315 1808 1127 --
NM_013446chr771290 1257 1220 1099 449 361 167 11299 ----
NM_013447chr1943038 3010 871 193 2813 259 ----
NM_013448chr141690 1479 ----
NM_013449chr1262903 2281 2009 1995 1981 117 --188 1503
NM_013450chr211061 ------
NM_013451chr102362 157 ------
NM_013951chr262348 1973 1615 859 783 536 1936 --11535
NM_013952chr262425 2050 1692 936 860 613 11013 --11612
NM_013953chr262425 2050 1692 936 860 613 11013 --11612
NM_013958chr8--1357 1168 --
NM_013959chr8--1357 1168 --
NM_013961chr8--1357 1168 --
NM_013962chr8--1357 1168 --
NM_013979chr5263 55 1416 ----
NM_013989chr1494980 4943 4337 3776 3707 3509 3317 3284 400 21146 463 34159 4086 1264 13463
NM_013992chr262425 2050 1692 936 860 613 11013 --11612
NM_013993chr62689 253 ------
NM_013994chr62689 253 ------
NM_013996chr71344 1424 ----
NM_013996chr71344 1424 ----
NM_013997chr71344 1424 ----
NM_013997chr71344 1424 ----
NM_013998chr71344 1424 ----
NM_013998chr71344 1424 ----
NM_014001chr1781621 1293 617 578 554 438 257 66 131 41487 130 90 50 --
NM_014016chr3----1172 --
NM_014023chr1042457 2212 806 365 2376 105 11785 11037
NM_014048chr16105003 4329 4122 3685 3359 2018 1675 1457 1135 517 25130 3337 21108 797 --
NM_014067chr11121 --162 --
NM_014079chr34821 785 761 201 ------
NM_014106chr1541908 691 412 127 ------
NM_014109chr81144 --1465 --
NM_014112chr854427 3922 1609 670 640 --15321 --
NM_014117chr1632531 1954 526 12049 --12021
NM_014154chr311587 1264 1593 --
NM_014155chr1136158 5647 4595 12684 --1425
NM_014157chr16103325 2976 2903 2799 2459 1568 1546 1425 1355 837 21296 184 23344 2844 11327
NM_014159chr34560 542 252 121 ------
NM_014171chr2----1726 152
NM_014176chr1--168 ----
NM_014181chr242791 2767 2675 2483 11966 22777 1175 11034
NM_014188chr12340 62 ------
NM_014189chr471263 486 323 271 74 40 24 --1932 21486 526
NM_014190chr491615 675 623 426 392 376 360 255 78 1353 11284 11838
NM_014191chr1221007 758 171 ----
NM_014216chr1461622 1242 1187 1172 467 140 --11629 --
NM_014231chr1262117 1997 1871 1846 1621 501 ------
NM_014232chr1761256 1120 392 295 243 21 21270 100 1535 --
NM_014232chr1761256 1120 392 295 243 21 21270 100 1535 --
NM_014233chr1751791 1667 1399 1391 101 11534 31606 623 515 --
NM_014238chr1771710 1433 1238 1211 530 388 345 --1516 --
NM_014243chr41588 1274 ----
NM_014251chr72913 788 1318 ----
NM_014253chrX42123 1813 1699 1574 12359 --12488
NM_014267chr111678 ------
NM_014268chr181979 1458 1965 --
NM_014282chr921298 898 1997 ----
NM_014283chr11997 11427 ----
NM_014286chr9113568 3357 2813 2797 2544 1277 1222 977 447 166 131 33525 3117 1459 63469 2877 2689 2321 763 70 --
NM_014289chrX5994 939 583 427 24 ------
NM_014290chr9121 ------
NM_014292chr2251863 1786 1691 1212 592 1188 31403 1301 604 --
NM_014299chr1971479 1410 817 632 605 497 253 2558 439 42054 1998 1384 132 --
NM_014309chr2275130 4863 4838 4331 4060 4005 1601 34168 1762 1131 11359 --
NM_014319chr1211959 1121 ----
NM_014325chr1222057 1449 1306 ----
NM_014333chr1132296 967 300 ------
NM_014351chr222981 61 1592 ----
NM_014368chr951811 1777 1726 1558 587 2415 234 11891 --
NM_014372chr1----1213 --
NM_014374chr771017 916 700 438 423 256 154 --1248 2925 265
NM_014388chr1155767 5728 5205 5115 5045 5031 4486 4308 4190 3793 1946 1793 1231 642 238 45905 5497 5244 167 14561 --
NM_014392chr43617 572 552 11310 1213 --
NM_014393chr81307 ----21555 869
NM_014397chr921282 575 11153 ----
NM_014399chr71954 1208 ----
NM_014415chr31440 --11356 --
NM_014423chr562215 2109 1973 1309 935 26 23656 828 11028 12248
NM_014437chr11390 ------
NM_014445chr34481 195 75 60 11941 ----
NM_014452chr62988 982 ------
NM_014454chr62849 762 ------
NM_014488chr112122 97 --143 --
NM_014491chr71351 ------
NM_014494chr1631860 692 628 11808 21502 505 --
NM_014507chr2281188 1113 1027 1006 895 759 454 83 1315 21080 291 --
NM_014515chr125873 784 164 118 104 ------
NM_014517chr32269 233 --11381 --
NM_014548chr1531382 1203 549 21618 1531 ----
NM_014553chr293046 2269 1198 958 856 533 401 268 41 1413 --1307
NM_014554chr1252253 2189 1451 113 26 12209 1131 1664
NM_014567chr164350 121 110 56 ----1131
NM_014572chr1321120 713 11505 11715 --
NM_014575chr3--1539 ----
NM_014585chr2199 --1122 --
NM_014586chr21104451 4178 3615 3476 2939 1620 1543 1531 879 466 34170 4064 3411 1911 --
NM_014603chr17101619 1418 1281 633 510 416 292 284 176 123 1656 41334 1238 558 227 --
NM_014607chr21604 ----21880 633
NM_014613chr531936 1072 421 2996 496 2985 634 11126
NM_014614chr221399 369 --1465 1520
NM_014615chr1663165 2666 2313 780 680 169 2593 63 13389 --
NM_014616chr322646 891 43020 2816 2203 1330 1429 188
NM_014630chr15153900 3823 3300 2742 2703 1080 1001 754 707 545 514 486 437 86 60 23910 120 2570 136 1204
NM_014634chr22163477 3452 3405 3282 3059 2875 2782 2533 2451 2229 1185 645 503 401 363 163 ------
NM_014636chr993829 3794 3107 1390 1084 1057 611 587 75 --13469 --
NM_014637chr8------1535
NM_014646chr1852655 2094 1106 904 841 23003 431 ----
NM_014647chr161589 11560 ----
NM_014653chr1251706 1331 753 745 70 11325 253 38 11549
NM_014655chr191749 1440 923 843 702 440 329 321 107 22334 2263 21489 113 --
NM_014661chr10183754 3696 3332 2981 2773 2753 2404 1308 1285 1238 1212 1199 1041 785 607 361 350 115 177 23267 1124 --
NM_014665chr893349 3299 3229 2331 2293 291 253 75 34 13560 ----
NM_014666chr52398 365 1390 ----
NM_014667chr332184 539 277 22219 752 12343 --
NM_014670chr23467 324 69 ------
NM_014671chr731219 1003 347 --1980 --
NM_014676chr141537 1352 1052 229 ------
NM_014686chr1972481 2367 2212 678 433 345 291 ----22374 207
NM_014700chr1641284 530 428 384 149 21488 299 --
NM_014701chr1511074 13357 2991 939 --
NM_014702chr642920 2287 1138 695 12396 ----
NM_014705chr721906 652 ------
NM_014707chr7--12213 ----
NM_014712chr167510 490 441 427 417 205 44 1161 152 --
NM_014717chr192594 296 ------
NM_014718chr125781 735 587 553 168 --2580 42 --
NM_014721chr675403 5306 5208 2795 1024 526 54 25232 63 --15325
NM_014723chr20103085 2881 2798 2586 2420 1268 1221 405 383 315 23251 2678 52738 2410 2386 2374 2274 12530
NM_014726chr1761321 1167 473 425 178 157 11391 ----
NM_014729chr82866 321 21886 220 ----
NM_014730chr12154771 4530 3792 2117 1962 1956 1748 1692 1477 1394 997 938 700 630 455 44812 1446 931 320 23658 2056 11405
NM_014730chr12154771 4530 3792 2117 1962 1956 1748 1692 1477 1394 997 938 700 630 455 44812 1446 931 320 23658 2056 11405
NM_014731chr2041558 1431 504 36 11119 11155 --
NM_014732chr16115859 5154 4776 4686 4348 3847 3744 1641 1365 1290 570 11474 11854 --
NM_014733chr532272 2179 638 31935 1481 872 ----
NM_014735chrX21618 441 --1724 --
NM_014739chr634086 2744 310 ------
NM_014743chr422841 1940 ------
NM_014746chr293486 3337 3194 2884 2826 2817 1551 1093 718 ------
NM_014747chr1265760 5356 5242 5030 4955 4695 4652 4619 4463 4398 4334 4014 3952 3693 3659 2098 1368 1345 1195 904 840 639 492 388 330 104 11427 64212 3628 3524 924 912 651 --
NM_014748chr22275 58 ------
NM_014750chr141221 ------
NM_014752chr1131901 1327 211 1407 1189 1127
NM_014755chr282683 2661 1454 1200 874 446 229 58 --13513 --
NM_014756chr111187 ----1401
NM_014762chr192219 2212 922 728 658 557 495 273 123 --12316 1815
NM_014766chr733304 2933 585 41385 1258 613 157 --1334
NM_014767chr10183547 3198 2832 2748 2673 2660 2482 1408 1364 1269 1219 1190 1170 663 514 461 439 248 1934 42933 1475 419 49 1920
NM_014770chr1231143 362 251 ------
NM_014772chr18123594 3477 3051 3014 2901 2867 2610 2233 1335 1017 1002 171 12675 41316 259 91 46 --
NM_014774chr173063 2891 2607 2472 2177 1035 626 ------
NM_014776chr1242968 2749 952 908 ----11156
NM_014779chr32337 163 ------
NM_014781chr8151 ------
NM_014783chr1521145 457 ------
NM_014786chr1181101 945 879 807 520 263 154 128 21082 270 1508 --
NM_014790chr5----1401 --
NM_014798chr1791869 1642 1439 1404 1181 751 637 366 187 --31876 1730 279 126
NM_014800chr72894 83 11143 2189 148 --
NM_014802chr122406 199 ------
NM_014803chr1032230 788 232 1532 ----
NM_014807chr115675 525 299 241 129 ------
NM_014810chr182947 2555 1484 1409 603 303 62 44 --12300 --
NM_014811chr93169 122 27 --1676 --
NM_014812chr111328 1393 ----
NM_014819chr522070 356 1614 ----
NM_014820chr331836 1293 546 11826 ----
NM_014826chr153917 3671 1589 1003 744 24002 424 1833 13805
NM_014827chr141316 606 319 150 3687 618 132 ----
NM_014828chr1442376 2064 1624 944 11754 ----
NM_014830chr12103153 2721 2477 1417 1393 1382 1146 904 680 102 43700 2846 2449 2435 11405 12865
NM_014832chr1311752 31618 1353 91 ----
NM_014838chr2262547 2264 1790 481 226 79 22431 704 --1821
NM_014839chr12961 615 21909 319 ----
NM_014840chr12102758 2609 2516 2108 1122 851 840 751 387 219 12892 32495 648 148 1773
NM_014841chr611377 11397 ----
NM_014848chr1572772 2687 2369 1969 1892 1879 539 --1197 --
NM_014849chr151108 412 243 83 74 --1370 --
NM_014850chr3124427 4406 4397 4309 4114 3911 3400 3279 1544 879 93 62 24526 3661 23513 1671 11938
NM_014858chr161189 1050 837 742 459 359 1855 ----
NM_014859chr1731472 1293 508 ------
NM_014860chr252472 2390 1759 1049 785 ----1920
NM_014862chr15133865 2933 2863 2608 1347 1332 1186 959 697 626 432 95 86 13931 21045 205 24232 1265
NM_014864chr154052 3942 1408 332 128 1914 --11505
NM_014868chr123817 366 116 --1666 --
NM_014872chr942035 2018 1874 1719 22174 209 ----
NM_014873chr164631 4227 4009 3962 1426 884 13556 --1873
NM_014874chr181856 1683 1477 1436 770 598 576 99 ------
NM_014876chr2252219 2151 1806 1569 817 ------
NM_014877chr17127370 7241 7023 6952 6615 6383 5935 5177 2422 2020 1442 1331 12968 15944 --
NM_014883chr462445 2342 963 97 85 72 2788 361 11682 --
NM_014897chr1743103 2687 1979 172 ------
NM_014898chr1932044 2021 1879 ------
NM_014899chr531139 706 262 1839 ----
NM_014901chr581992 692 659 532 500 472 250 44 --21898 1420 1403
NM_014902chr2041175 439 389 113 --21263 433 --
NM_014903chr1231997 1549 379 --1110 --
NM_014906chr1733387 1331 1148 33141 3097 1533 ----
NM_014909chr14103838 3519 3510 3271 2800 2677 851 747 625 367 23596 2977 21071 481 --
NM_014912chr1032868 2853 1168 ----22534 1056
NM_014913chr1861328 1155 927 495 281 121 ------
NM_014914chr22444 305 ------
NM_014921chr1992546 2310 2253 832 819 772 704 63 52 32766 605 531 12691 --
NM_014924chr1463150 2111 2088 1063 580 380 --11003 --
NM_014927chrX--145 ----
NM_014931chr193634 572 106 --1613 --
NM_014932chr321578 1451 ------
NM_014935chr1113063 2722 2481 2448 1159 1120 361 319 247 103 89 11170 33272 1203 325 23216 220
NM_014939chr182358 206 11570 ----
NM_014944chr141348 1274 1130 939 --1579 --
NM_014945chr521892 1487 21307 1256 11352 1630
NM_014946chr253001 2620 2392 822 208 11930 1214 --
NM_014948chr2092489 2363 2321 2278 2120 1623 1543 782 78 12350 ----
NM_014961chr441923 603 354 316 --189 --
NM_014962chr2031150 1121 461 2334 312 ----
NM_014969chr11840 ------
NM_014982chr14135213 5119 4850 4769 3636 1832 1416 1362 913 888 526 415 167 --13582 --
NM_014988chr482770 2702 2474 2401 1107 1067 505 56 2564 250 ----
NM_014989chr61398 ----11287
NM_014991chr453214 3002 2078 914 258 ------
NM_014992chr142685 78 2879 333 ----
NM_014994chr1552268 1538 914 753 181 31786 849 799 --11989
NM_014997chr762622 2538 2180 1100 212 102 ------
NM_015000chr1233070 2590 2381 22224 95 ----
NM_015001chr14917 845 137 44 ------
NM_015002chr1242178 1657 1564 258 1476 ----
NM_015008chr32598 397 181 12398 --
NM_015012chr111357 ------
NM_015017chr11446 --150 --
NM_015018chr6166 ------
NM_015020chr1693634 3096 2618 1162 1060 1015 484 405 195 11327 ----
NM_015023chr1101743 1709 1192 670 636 630 415 357 288 198 1280 31612 689 53 31298 559 215
NM_015024chr851236 943 594 321 306 ------
NM_015025chr222019 1772 1920 ----
NM_015026chr1214545 23727 188 ----
NM_015027chr1621366 676 ------
NM_015032chr131608 ----1646
NM_015033chr9103075 1181 820 751 698 513 397 338 162 80 ----12781
NM_015035chr20166456 6430 6306 6183 6120 5738 5010 4976 4807 4623 4582 2560 2447 2237 1124 633 34521 2672 2575 44951 4422 2419 1406 14752
NM_015039chr1133980 3130 1681 1586 1356 904 594 424 410 385 346 332 307 23433 1168 21271 912 --
NM_015040chr222281 2159 ----13382
NM_015042chr15173895 3765 3721 3688 3674 3434 3409 3307 3268 3121 2849 1746 1056 1026 816 507 335 34207 1692 1254 44085 3927 3839 688 --
NM_015044chr16133267 3148 3074 2912 2855 2581 2458 1273 402 157 137 122 110 32476 2012 685 13016 12205
NM_015045chr101763 2556 85 11594 --
NM_015046chr952681 2470 2284 2165 822 1223 ----
NM_015051chr943123 2669 973 252 12815 ----
NM_015054chr12135 ------
NM_015057chr131546 ------
NM_015068chr773764 3313 2495 1431 979 301 251 31505 1442 127 ----
NM_015069chr161215 ------
NM_015071chr5106377 5645 4546 4499 4208 4124 1898 1883 359 149 46464 1355 1253 281 ----
NM_015074chr13391 308 172 11457 11994 --
NM_015075chrX112141 2005 1903 1665 1648 1451 1408 888 605 317 286 --11854 1706
NM_015077chr17174314 4088 3641 3599 3378 3280 3219 3145 1329 914 773 655 531 523 236 85 24 43692 3536 3036 71 --1936
NM_015086chr1271541 1444 1237 1191 1038 624 356 1129 1984 --
NM_015090chr1175798 5756 5654 5518 4744 4601 4439 4201 4089 3983 3927 2426 2416 1781 1270 626 600 52135 2091 1360 808 437 24555 4476 11398
NM_015091chr141269 ------
NM_015092chr1624530 120 14587 ----
NM_015093chr631717 1226 511 1528 ----
NM_015097chr31898 ------
NM_015099chr175473 267 208 153 29 ------
NM_015101chr122484 831 11123 12799 --
NM_015106chr31153 ------
NM_015107chrX62160 1746 1504 913 295 116 --1852 191
NM_015113chr1731488 586 110 1737 11525 --
NM_015115chr433124 2374 156 12733 --12329
NM_015116chr1351711 1546 1220 81 32 11184 2565 323 --
NM_015120chr22204 27 ------
NM_015132chr731786 1774 1728 1499 ----
NM_015133chr1641467 1442 333 321 21112 359 1399 --
NM_015138chr1552092 875 857 403 358 12489 12817 --
NM_015141chr332507 975 908 22244 1863 ----
NM_015143chr411433 --1486 --
NM_015144chr1693377 3284 1525 1044 898 555 517 418 409 12568 ----
NM_015155chr1053014 2931 2471 823 451 ----1322
NM_015156chr1443473 775 559 141 13501 ----
NM_015157chr116985 791 428 189 97 80 1107 2738 242 --
NM_015171chr162394 89 --1432 --
NM_015176chr141262 1132 376 168 ------
NM_015185chrX92904 2110 1902 1087 675 665 598 402 120 --32618 2564 2230 --
NM_015191chr1122527 2505 22734 2639 2805 682 --
NM_015192chr2042574 2485 2204 351 ------
NM_015194chr17101840 1366 1334 684 673 632 468 240 220 47 --1445 --
NM_015197chr14133189 3058 2973 2897 2436 2128 1260 1173 1150 610 456 321 187 13370 21250 432 12721
NM_015199chr352744 2245 1987 920 798 12096 ----
NM_015200chr41179 187 --1131
NM_015205chr13164469 4429 4418 4048 3957 3935 3860 3852 1924 1363 1228 1126 837 733 300 279 --34745 1911 1889 14071
NM_015206chr1573369 3027 2623 2617 866 834 209 13680 11318 1915
NM_015221chr106442 214 176 102 89 27 ------
NM_015225chr952869 2718 2409 729 663 22813 2603 ----
NM_015226chr1693355 3288 3150 3118 3048 2601 2273 593 288 2173 145 22765 1110 --
NM_015229chr1751007 962 903 385 318 --2983 370 --
NM_015233chr1371891 1753 1046 802 141 92 56 --42629 2241 2205 163 --
NM_015236chr42330 296 ------
NM_015239chr91371 ----1513
NM_015247chr1664831 4760 3603 3585 1546 1163 31874 1196 170 35321 1614 421 --
NM_015250chr951259 746 431 256 35 ------
NM_015252chr21644 1231 ----
NM_015254chr8162472 2441 2250 2056 2025 1954 894 832 590 577 536 484 449 276 153 54 --32808 571 70 --
NM_015256chr52648 571 ------
NM_015265chr232121 638 231 --12053 --
NM_015269chr1----1144 --
NM_015270chr1282225 2136 1686 1484 841 660 565 502 22188 2051 11599 --
NM_015271chr424091 2863 21225 875 1561 1730
NM_015272chr1621886 1611 --11774 --
NM_015288chr5183799 3748 2775 2669 2400 1145 1124 1085 947 838 710 683 653 590 442 405 258 28 --134 22497 1187
NM_015291chr152660 2159 424 318 152 32583 877 461 1693 --
NM_015293chr6188 1237 ----
NM_015294chr172337 38 145 ----
NM_015296chr1321207 831 ------
NM_015299chr14153935 3686 3319 2835 1597 1522 1279 1038 971 561 388 377 107 91 30 33819 3786 2439 43671 2642 1580 456 23253 1302
NM_015305chr1491785 1387 1312 1249 1198 742 672 501 294 11752 21447 239 --
NM_015310chr8207820 7396 7343 7108 6758 6741 6665 6299 6231 5845 3347 3190 2886 2789 2494 2114 1844 1198 962 778 46941 3209 2742 1433 37636 7249 7087 17095
NM_015313chr1143386 1264 605 393 33192 1586 465 21179 693 --
NM_015315chr5153424 2851 2750 2202 1398 1219 1187 1149 739 515 478 436 375 348 175 43143 3103 2350 755 --12993
NM_015317chr232747 2178 1090 --22475 210 --
NM_015326chr172525 2335 2279 2205 1912 877 151 12571 32701 353 305 --
NM_015327chr151182 538 341 247 57 1935 ----
NM_015328chr742563 2170 2071 2021 2869 369 1199 --
NM_015329chr19102633 2591 2565 2500 2364 2342 629 273 123 98 --21880 398 --
NM_015332chr7133558 3417 3340 2966 2950 1311 1204 691 614 513 493 445 150 33098 2205 909 53538 3483 2499 1111 892 13397
NM_015335chr122187 120 ----12223
NM_015336chr1232309 731 655 ------
NM_015339chr204731 195 93 48 ------
NM_015344chr822085 251 ------
NM_015345chr6112318 2277 1115 912 548 416 367 288 247 121 109 --1219 --
NM_015346chr1471724 1571 1500 1308 624 421 107 21435 381 --11318
NM_015347chr1262933 2306 1881 903 818 732 1936 22213 1998 1467
NM_015349chr632270 1139 1102 22708 2152 1605 12763
NM_015353chr1792435 2327 2128 2039 1889 1113 1101 836 635 --21790 981 --
NM_015355chr1731880 1558 1518 ------
NM_015367chr2251597 1216 572 314 270 ------
NM_015374chr2241368 564 413 155 11098 2966 88 --
NM_015378chr1103008 2720 2658 2623 2555 2440 2433 2331 2085 282 --22340 1204 1550
NM_015385chr1072947 2595 2119 1259 1089 749 741 22009 439 1635 --
NM_015393chr473243 1458 1284 1176 713 239 108 ----1602
NM_015396chr31929 11083 ----
NM_015397chr921351 156 11285 11199 --
NM_015401chr128897 745 694 684 360 202 172 62 --2813 274 --
NM_015407chr31170 166 ----
NM_015428chr1961697 1507 1342 1205 217 200 ------
NM_015443chr173452 412 263 ------
NM_015444chr3130 ------
NM_015455chr5--22804 1134 127 --
NM_015457chr1121146 236 1244 1185 1283
NM_015460chr321794 1511 --2148 60 --
NM_015483chr731015 408 281 ------
NM_015488chr251523 1301 1251 1172 1128 --2665 508 1381
NM_015493chr1942069 663 150 82 ----22002 897
NM_015497chr154925 254 121 109 1292 --1974
NM_015509chr1221164 52 11598 ----
NM_015526chr193216 77 50 31138 514 358 21265 67 --
NM_015527chr162741 636 ----1279
NM_015531chr112129 56 ------
NM_015542chr10132 1419 ----
NM_015545chr75718 710 579 291 43 --1105 --
NM_015548chr64382 335 308 31 ------
NM_015553chr685172 4529 4243 4125 4066 3618 1944 1559 34655 4572 1988 33538 3302 1952 --
NM_015555chr6------137
NM_015557chr193128 2829 1439 1213 1045 980 643 457 446 23326 1079 43469 1235 998 960 23289 768
NM_015559chr1821068 314 ------
NM_015564chr553604 3442 3115 1054 917 --22293 1016 12319
NM_015565chr2121444 728 129 11436 1559
NM_015567chr131114 ------
NM_015568chr20114225 3955 3657 3583 3522 1623 1444 1075 673 542 111 24276 2908 171 11667
NM_015569chr114470 21065 975 ----
NM_015575chr253366 2500 2392 2262 713 21376 656 33161 1430 579 --
NM_015576chr332281 767 77 22843 2068 ----
NM_015578chr19------21745 54
NM_015601chr101665 1842 ----
NM_015607chr1160 ------
NM_015609chr1132948 2795 2762 2722 2702 2677 2521 2462 1044 957 789 767 692 21195 159 12164 --
NM_015627chr1131745 1706 1633 1452 1333 1208 642 588 514 406 328 188 176 21417 425 2334 34 2553 208
NM_015634chr102527 203 ------
NM_015635chr962012 1750 1729 1442 623 56 ------
NM_015640chr165022 4085 3998 3832 3511 24 --13488 --
NM_015646chr1221344 1064 --125 --
NM_015651chr9102115 2025 1747 1642 1474 762 307 272 185 134 --21439 341 130
NM_015657chr22719 676 1772 1975 --
NM_015670chr171451 ------
NM_015684chr141209 ------
NM_015686chrX82139 2117 1817 1676 1584 970 361 355 --1323 1957
NM_015691chrX42204 1984 831 555 2370 217 ----
NM_015695chr662156 1892 768 622 314 32 21873 785 ----
NM_015713chr843128 2695 996 791 ------
NM_015716chr174733 152 145 89 ------
NM_015719chr193565 527 181 1284 ----
NM_015726chr111747 --11714 1199
NM_015840chr152682 2335 2137 1944 824 32493 2269 689 ----
NM_015841chr152682 2335 2137 1944 824 32493 2269 689 ----
NM_015844chr182688 188 ------
NM_015846chr182688 188 ------
NM_015847chr182688 188 ------
NM_015850chr852295 1691 622 414 342 12308 2966 596 --
NM_015855chr111824 --1777 --
NM_015859chr141154 ------
NM_015872chr161610 1371 664 595 370 106 ------
NM_015878chr811508 ----11870
NM_015879chr18148591 7237 7181 6622 5689 5501 3230 2977 2024 1969 1396 976 696 339 37431 1548 416 27567 2747 --
NM_015888chr133010 291 198 ------
NM_015889chr221132 ------
NM_015906chr144763 3666 1400 281 21306 125 ----
NM_015920chr151636 ------
NM_015955chr2186 ------
NM_015980chr521494 1149 11195 11173 --
NM_015981chr552948 2722 2558 2366 971 1694 12462 --
NM_015982chr171143 1364 ----
NM_015993chr163744 281 90 1496 ----
NM_015995chr15245430 5023 5000 4758 4748 4554 4423 4286 3967 3602 3526 3508 3468 2154 2097 1863 1760 1729 1502 1383 1284 869 608 49 23710 1247 64879 3461 2170 1683 1403 742 14301
NM_016009chr194632 4493 4282 4225 4105 3955 1916 900 664 11680 --11141
NM_016018chr822305 884 ------
NM_016019chr73389 300 163 ------
NM_016026chr141124 ------
NM_016032chrX41353 1254 1225 215 --1246 1962
NM_016037chr121010 804 ------
NM_016038chr71486 ------
NM_016057chr1231293 1153 1108 --1292 --
NM_016063chr61559 ------
NM_016072chr1222113 1763 12347 ----
NM_016073chr15----1333 --
NM_016076chr153175 700 607 573 262 1945 32648 2619 557 --
NM_016083chr673182 2956 2797 1109 851 743 440 --12817 13156
NM_016096chr831382 580 195 ------
NM_016107chr521253 364 ------
NM_016131chr21508 --1709 1481
NM_016147chr1151109 410 384 191 37 ----11029
NM_016152chr341211 957 352 310 ------
NM_016156chr1132399 2253 504 --1424 --
NM_016166chr15175 ------
NM_016169chr10143080 2681 2609 2504 2135 1011 990 978 646 617 540 476 310 219 --22492 2287 1698
NM_016179chr13154 ------
NM_016192chr21102 ------
NM_016201chr342307 334 51 25 1913 1263 --
NM_016203chr7------2973 264
NM_016205chr431187 422 397 11166 1909 --
NM_016206chr377632 7611 7419 7084 2346 2072 567 22330 1047 12389 --
NM_016210chr341257 1228 217 70 190 2499 231 --
NM_016216chr32793 255 1870 ----
NM_016219chr92453 124 ----1115
NM_016221chr522327 87 ------
NM_016223chr114281 133 119 39 ----186
NM_016227chr11997 11427 ----
NM_016248chr1343164 2699 1355 1140 ----13501
NM_016250chr143737 155 130 --2745 287 --
NM_016252chr21859 1706 ----
NM_016255chr632576 2558 68 1135 --1811
NM_016257chr193444 3295 3259 2856 2545 2533 1310 406 26 13432 22862 983 --
NM_016260chr286698 2952 2102 1556 1412 736 664 164 36260 4904 4673 ----
NM_016270chr191312 ------
NM_016272chr2231785 535 162 2626 443 1743 11114
NM_016275chr322000 1926 --1677 --
NM_016287chr131862 1347 397 ------
NM_016289chr222335 1831 11776 ----
NM_016312chr121145 ------
NM_016315chr22280 22 11895 ----
NM_016322chr911963 12294 ----
NM_016329chr3296 88 ------
NM_016337chr14----1133 --
NM_016339chr1781766 1645 1627 1607 1398 1352 666 232 2608 145 21727 1527 --
NM_016364chr104169 91 72 25 --157 --
NM_016374chr111043 ----11601
NM_016374chr111043 ----11601
NM_016376chr1774225 3965 1361 1128 1051 727 57 33426 3180 2965 23584 1160 1509
NM_016377chr61320 ------
NM_016395chr151194 1149 ----
NM_016396chr1532386 2143 1189 ------
NM_016399chr122856 838 1875 ----
NM_016403chr111608 ------
NM_016418chr22143760 3669 3451 3373 2674 2431 1426 1151 995 955 900 647 336 279 23625 2403 23208 442 21136 234
NM_016423chr143490 465 376 ------
NM_016424chr1741969 1763 532 177 --11405 --
NM_016433chr1241233 362 126 95 ------
NM_016436chr2052589 2518 528 410 184 1936 ----
NM_016441chr232230 478 147 12301 --1419
NM_016448chr131474 1303 440 21885 352 ----
NM_016451chr11--122 ----
NM_016470chr201451 ------
NM_016486chr12411 161 ------
NM_016488chr1231924 1455 213 ------
NM_016507chr1733082 3069 2603 31212 200 63 --123
NM_016516chr21326 ------
NM_016522chr1161642 1587 1422 1342 1298 206 11550 ----
NM_016525chr94214 53 44 23 1786 1162 --
NM_016526chr1162387 2339 2305 1859 819 544 1681 12315 11729
NM_016529chr132332 269 11294 --1974
NM_016530chr1533489 722 478 23610 57 ----
NM_016531chr463964 3872 3106 2973 420 59 32659 1631 127 --11533
NM_016538chr172176 142 ------
NM_016542chrX11712 ------
NM_016559chr321001 33 ------
NM_016569chr1221351 1003 ------
NM_016575chr12155328 5312 5183 5003 4760 4189 3472 3372 3349 1675 1498 691 262 234 36 35480 580 368 ----
NM_016577chr354107 3923 3502 2736 1300 51337 1068 963 713 570 43508 1413 1317 583 1723
NM_016588chr61143 --2860 345 --
NM_016596chr128897 745 694 684 360 202 172 62 --2813 274 --
NM_016598chr341395 1036 591 490 --1411 --
NM_016603chr532067 864 749 149 ----
NM_016604chr551175 975 858 463 301 ------
NM_016605chr531901 1868 600 --1246 12195
NM_016607chrX1488 11486 --1575
NM_016620chr11354 ------
NM_016621chr11124297 4105 4088 4058 4019 3759 3552 3275 3005 2881 1790 1771 34221 1504 698 54142 3566 3293 3250 3179 --
NM_016623chr8--1195 ----
NM_016626chr18----11341 --
NM_016628chr10--1187 ----
NM_016631chr212841 722 ------
NM_016639chr163394 189 139 ----1370
NM_016653chr211075 --21092 239 --
NM_016654chr15--21276 497 1144 --
NM_016656chrX--1141 --176
NM_016824chr1031859 1507 231 ------
NM_016830chr124479 359 233 208 ------
NM_016834chr17114160 3910 3061 3022 2770 2735 1512 1484 1264 840 405 13008 12579 1351
NM_016835chr17114160 3910 3061 3022 2770 2735 1512 1484 1264 840 405 13008 12579 1351
NM_016836chr21704 ------
NM_016839chr21704 ------
NM_016841chr17114160 3910 3061 3022 2770 2735 1512 1484 1264 840 405 13008 12579 1351
NM_016929chr673867 3258 3079 956 689 667 180 31681 1655 1570 192 --
NM_016936chr1692088 2070 1543 1432 361 312 229 221 214 2799 431 ----
NM_016940chr212448 419 ------
NM_016946chr1133331 2938 2799 2754 2565 2492 2338 2317 2214 1303 1262 559 68 22695 569 ----
NM_016952chr1183723 2909 2867 1440 1373 742 652 559 43616 3580 3507 1364 14062 13667
NM_017409chr122718 91 ------
NM_017410chr1211287 ------
NM_017413chrX32169 2022 567 2837 243 1370 --
NM_017415chr5104347 3881 3704 1634 1314 696 467 201 192 131 2294 58 1214 --
NM_017420chr1443258 1339 1294 948 42843 1523 1461 619 ----
NM_017423chr42279 125 ------
NM_017433chr101562 --1112 --
NM_017447chr2144374 1757 1421 28 --13725 --
NM_017450chr1761474 1294 1139 925 545 55 1439 --132
NM_017455chr151287 2818 31 ----
NM_017456chr1731991 1484 36 21399 524 41763 1426 718 499 1114
NM_017488chr241377 1363 1297 581 2445 301 1335 --
NM_017514chrX11936 858 844 793 701 624 251 185 173 128 38 ----1100
NM_017540chr5112933 2671 2626 2419 2346 2079 997 512 355 175 167 42604 2399 1292 303 2860 802 --
NM_017544chrX2719 284 1989 ----
NM_017548chr321692 535 ------
NM_017550chr198968 899 882 832 788 398 103 78 ----11073
NM_017551chr1062213 2108 1774 751 602 414 ----22115 582
NM_017553chr1531046 1012 101 1498 2352 50 --
NM_017563chr3195138 5126 5099 5058 4912 4751 4530 4346 4018 3913 2397 2219 1867 1479 1339 389 356 71 50 --22391 1557 2916 214
NM_017575chr1731396 1386 517 21241 43 1581 --
NM_017582chr121312 125 1512 11744 --
NM_017590chr22111819 1785 1659 1015 1004 608 426 397 137 130 30 1855 ----
NM_017593chr41321 --1469 --
NM_017594chr973044 2741 1340 689 582 573 238 13142 11312 --
NM_017596chr1314509 4472 4455 4395 4372 4225 4062 4005 3956 3940 3774 3601 3504 3491 3246 3162 3096 1753 1731 1651 1458 1143 1080 1021 922 884 671 324 314 160 138 23733 3439 24387 2864 --
NM_017599chr1231381 829 134 ------
NM_017602chrX4900 877 754 217 ------
NM_017610chr152750 123 --2781 371 --
NM_017622chr173220 75 27 ------
NM_017633chr663704 3685 2568 1485 284 21 ------
NM_017634chr811917 ------
NM_017637chr9109181 8489 8212 7839 7785 6195 3076 791 163 132 29231 1348 36962 6053 540 27873 6060
NM_017640chr62600 344 ------
NM_017643chr1732816 2128 973 --12199 --
NM_017658chr1433506 1542 364 24514 1128 ----
NM_017660chr19103118 2880 2720 2575 2122 979 638 597 560 54 23428 366 22836 868 1606
NM_017662chr941797 1672 1364 36 ------
NM_017666chrX32236 1897 1534 ------
NM_017670chr115714 257 201 181 27 ------
NM_017680chr91915 ------
NM_017684chr1561363 1313 740 635 524 434 1239 ----
NM_017686chr111150 1293 ----
NM_017700chr43462 226 120 --1164 --
NM_017709chr1133551 3506 3423 3116 3032 2919 2772 2620 1566 1234 1192 657 310 13251 1114 --
NM_017715chr74566 543 495 55 ------
NM_017719chr321890 806 --2403 372 1619
NM_017724chr31315 ------
NM_017730chr32225 214 ------
NM_017737chr132004 521 358 ------
NM_017738chr92962 78 1138 ----
NM_017739chr11179 --1393 --
NM_017742chr182553 520 11973 ----
NM_017744chr142030 1667 927 439 1764 22455 1808 --
NM_017747chr5298 28 ------
NM_017753chr9----1167 --
NM_017757chr1861089 1004 952 944 300 74 --1126 --
NM_017758chr172516 481 --11514 --
NM_017763chr17171 1287 --1462
NM_017778chr8--1160 ----
NM_017779chr112735 12601 ----
NM_017780chr81265 ----1812
NM_017784chr3136 ------
NM_017789chr23567 150 100 ------
NM_017798chr2021217 1135 11192 ----
NM_017799chr14----11396 --
NM_017801chr321692 939 --162 --
NM_017811chr982907 2787 2453 2446 2339 2207 2188 31 --1676 --
NM_017813chr855628 5022 3564 1901 1800 15840 ----
NM_017824chr1022661 1841 --11056 --
NM_017831chr1863187 2979 1906 1519 1220 195 11884 13080 --
NM_017845chr4----1681 --
NM_017847chr11166 ------
NM_017848chrX24333 443 21534 523 11695 --
NM_017849chr2132745 2397 2305 2209 2058 1948 1225 970 938 853 677 442 107 --23069 553 1396
NM_017873chr972837 1202 614 571 489 409 182 2711 283 --12070
NM_017893chr104467 413 369 256 11189 --1432
NM_017896chr2083399 3270 1148 1140 1029 1018 851 37 ----12606
NM_017902chr10155629 5221 5205 4831 4661 4618 4404 3901 2181 1794 1663 1535 1512 528 251 11678 35328 3892 2152 --
NM_017919chr984919 4777 4678 2266 1843 730 295 43 45393 4651 358 267 1200 15526
NM_017923chr42683 130 ------
NM_017929chr2241051 996 980 89 1258 --11206
NM_017944chr1132348 2084 26 13107 ----
NM_017954chr741737 1682 272 36 ------
NM_017955chr1451046 959 104 96 33 --2911 249 --
NM_017957chr1771572 1563 1414 1316 1264 554 135 ------
NM_017964chr22678 379 1890 ----
NM_017966chr1131350 405 136 ----11283
NM_017994chr731202 665 83 --22895 210 --
NM_018011chr133541 510 145 ------
NM_018017chr1022453 1085 12486 ----
NM_018026chr1151363 1142 1013 555 102 1284 11372 --
NM_018027chr102593 308 23124 254 ----
NM_018031chr31127 1424 197 --
NM_018032chr164974 660 290 227 --1280 --
NM_018036chr1454270 3965 1535 1177 342 23729 3430 159 --
NM_018045chr192830 2322 2014 1920 969 885 444 386 119 12718 ----
NM_018047chr52803 26 ------
NM_018053chr13735 715 338 ----1229
NM_018061chr1------1273
NM_018064chr6131 ------
NM_018078chr41215 183 ----
NM_018084chr232925 2297 2141 1194 12860 11310
NM_018085chr1138096 7850 7473 6995 6879 6725 5516 2945 2550 2276 2201 546 483 37871 5135 218 67456 7378 6968 2927 2513 72 1469
NM_018092chr162353 114 ------
NM_018096chr174769 721 324 22 --2871 792 1981
NM_018107chr145840 658 273 125 104 1424 ----
NM_018110chr1631208 880 471 1916 11116 --
NM_018117chr101106 2511 275 ----
NM_018121chr1053072 2617 2217 1224 689 11165 ----
NM_018125chr11452 ------
NM_018133chr311835 --12087 --
NM_018154chr195332 294 163 146 63 1799 1840 --
NM_018156chr1103008 2720 2658 2623 2555 2440 2433 2331 2085 282 --22340 1204 1550
NM_018159chrX1175 ------
NM_018171chr122851 70 --1139 --
NM_018176chr421635 1092 2527 505 --21493 101
NM_018178chr12795 164 ------
NM_018181chr1821522 1220 21288 348 1530 --
NM_018191chr13135 ------
NM_018193chr152166 78 ------
NM_018200chr1531932 618 576 ------
NM_018201chr9102495 2249 2216 2210 1880 1754 747 456 315 194 32397 827 784 42300 1896 872 55 --
NM_018202chr11695 --1906 --
NM_018203chr13633 562 134 1232 1674 131
NM_018207chr171554 1524 1424 461 431 212 56 --41506 1191 340 206 --
NM_018208chr181137 884 872 793 396 366 216 67 --1773 2937 350
NM_018211chr141827 703 354 276 ------
NM_018223chr123166 134 100 ------
NM_018234chr252186 1756 1713 485 257 2690 503 32056 1865 51 1462
NM_018237chr101207 ------
NM_018240chr14738 341 176 65 --1566 --
NM_018245chr102472 159 --1343 --
NM_018250chr81451 127 ----
NM_018252chr12511 113 ------
NM_018254chr1--1821 --11716
NM_018265chr1131924 1888 1414 681 662 611 530 395 381 362 355 259 66 --1165 --
NM_018287chr101536 3338 253 231 ----
NM_018302chr42643 358 2894 68 ----
NM_018312chr1141772 1594 1357 59 11646 11567 --
NM_018313chr31798 11816 ----
NM_018315chr4----11258 --
NM_018361chr863730 1016 702 540 245 110 182 ----
NM_018362chr1123395 3195 13733 ----
NM_018370chr1232139 544 90 ------
NM_018381chr191327 --3901 637 601 --
NM_018383chr251909 1268 766 193 22 22016 677 1654 1104
NM_018388chrX11358 ------
NM_018394chr341562 1234 213 75 11337 ----
NM_018399chr61617 2539 176 ----
NM_018403chr383950 3558 3372 2612 915 680 622 469 23929 100 13665 --
NM_018416chr1222210 558 1909 ----
NM_018419chr202148 80 ------
NM_018424chr951824 1803 1741 601 291 ----1118
NM_018425chr1092174 2000 1955 1770 1737 1658 985 872 463 1306 --22480 2080
NM_018434chr5------139
NM_018440chr8107698 7661 7525 7397 6999 5729 5596 1297 132 21 47135 2128 649 449 16550 13346
NM_018446chr3143 ------
NM_018452chr6_random53761 2830 1385 489 51 32382 1483 724 --12372
NM_018462chr31152 ------
NM_018471chr21548 ------
NM_018489chr141944 1560 152 56 12359 ----
NM_018490chr1121176 543 ------
NM_018509chr1741463 1419 392 34 1181 ----
NM_018557chr221357 1160 ------
NM_018566chr164031 3114 1025 728 692 54 44718 907 794 532 ----
NM_018584chr11194 11202 1984 --
NM_018602chr154655 396 105 89 ------
NM_018638chr1243836 2159 1479 1338 24362 4189 ----
NM_018645chr25462 215 152 126 21 147 1375 196
NM_018650chr1--11389 1681 --
NM_018652chr153822 727 259 ------
NM_018660chr872901 2473 2346 856 769 123 35 --1835 --
NM_018667chr16102339 2223 1809 1093 1021 905 779 770 157 55 --11911 11996
NM_018682chr71524 ------
NM_018684chrX21035 49 --170 --
NM_018689chr1582103 1901 1810 1798 549 452 205 161 12551 2356 130 --
NM_018695chr511603 22155 434 1343 --
NM_018698chrX21994 500 ------
NM_018699chr42244 223 ------
NM_018700chr521606 155 ------
NM_018703chr16181 ------
NM_018715chr1101991 1875 1794 1702 1541 1524 915 810 635 135 21741 327 ----
NM_018717chr46991 900 745 716 663 304 32784 1990 1876 11119 --
NM_018718chr742138 1739 568 54 1763 1736 --
NM_018719chr721270 856 --1898 --
NM_018841chr173517 3486 3370 1588 1298 1238 902 43127 889 138 62 1390 13350
NM_018844chr711891 ----1353
NM_018890chr7128 11516 ----
NM_018898chr542090 773 732 320 ------
NM_018899chr542090 773 732 320 ------
NM_018900chr542090 773 732 320 ------
NM_018901chr542090 773 732 320 ------
NM_018902chr542090 773 732 320 ------
NM_018903chr542090 773 732 320 ------
NM_018904chr542090 773 732 320 ------
NM_018905chr542090 773 732 320 ------
NM_018906chr542090 773 732 320 ------
NM_018907chr542090 773 732 320 ------
NM_018908chr542090 773 732 320 ------
NM_018909chr542090 773 732 320 ------
NM_018910chr542090 773 732 320 ------
NM_018911chr542090 773 732 320 ------
NM_018948chr12986 176 --1396 --
NM_018951chr73502 100 69 --1280 1919
NM_018952chr172566 416 --1184 --
NM_018953chr121780 1827 ----
NM_018963chr211176 ----1288
NM_018970chr742486 542 305 27 ------
NM_018976chr1222194 960 12204 ----
NM_018979chr1231976 910 766 11793 --1387
NM_018992chr1661526 1027 516 468 250 146 21674 312 11243 --
NM_018993chr2031388 1032 52 --1244 --
NM_018994chr11532 ------
NM_018999chr1024545 3216 24931 1505 13620 --
NM_019001chr324033 544 1345 ----
NM_019004chr742289 2130 2049 1572 1145 ----
NM_019006chr15--1156 ----
NM_019008chr22103733 3558 2611 1425 1197 1041 618 343 227 125 21346 424 13700 2920 43
NM_019009chr11112487 2305 2284 1863 1818 1003 963 811 679 600 251 ------
NM_019032chr13466 457 77 2682 69 ----
NM_019036chr6----186 --
NM_019041chr632612 1765 513 1772 1864 --
NM_019057chr5----245 37 --
NM_019064chr174865 805 568 118 ------
NM_019069chr312625 ------
NM_019071chr71234 ------
NM_019084chr1031006 766 242 ------
NM_019087chr531738 1678 369 ----2591 38
NM_019091chr221034 305 ------
NM_019096chr631000 86 71 --1190 --
NM_019102chr71107 ------
NM_019102chr71107 ------
NM_019106chr2223409 802 1236 23271 1013 --
NM_019114chr932410 2059 104 ------
NM_019116chr1663636 2876 2833 2824 2735 2294 33741 1288 77 13046 --
NM_019555chr341127 541 416 274 --11176 1690
NM_019556chrX11433 ------
NM_019592chr92198 81 1333 ----
NM_019593chr2032250 2189 548 13018 --22083 1013
NM_019594chr991586 1351 1312 1244 1121 569 323 291 194 1280 ----
NM_019595chr24526 240 214 133 ------
NM_019845chr21336 2211 167 1756 --
NM_019849chr191181 1196 ----
NM_019854chr123740 196 161 --1202 2734 126
NM_019857chrX21702 1546 149 ----
NM_019859chr1011103 21501 1451 ----
NM_019885chr2132306 2181 1824 1063 1011 856 715 655 634 606 265 243 138 11918 21131 664 12059
NM_019903chr1031859 1507 231 ------
NM_020039chr1241921 1607 1198 643 21433 1378 2623 87 --
NM_020116chr431802 1582 442 ----1472
NM_020122chr295984 3911 1886 1391 637 629 616 572 239 34445 2293 1593 --15728
NM_020123chr1021273 181 ------
NM_020127chr191735 1564 1456 595 421 228 155 105 94 --1515 11194
NM_020132chr21154873 3641 3425 3340 1872 1574 1451 1310 1238 1224 1166 1133 708 638 588 --23652 33 --
NM_020133chr6146433 4942 4929 4909 4139 3948 2291 2242 1806 1653 1103 987 903 698 24376 780 1993 --
NM_020142chr122487 198 --1410 --
NM_020144chr721682 1603 1673 ----
NM_020147chr151926 --123 --
NM_020151chr251593 1422 510 315 41 ------
NM_020153chr111129 ------
NM_020168chr1521152 236 ----1494
NM_020177chr522447 909 12713 ----
NM_020178chr1711116 1374 2863 457 --
NM_020182chr2053461 2966 2830 880 759 ------
NM_020184chr271961 1826 1634 1562 878 441 169 12094 21835 179 1201
NM_020198chr1721455 192 ----146
NM_020225chr41397 ------
NM_020228chr1131759 885 261 --166 --
NM_020235chr3150 ------
NM_020238chr1151062 893 788 397 258 ------
NM_020239chr111632 2324 90 11775 22045 264
NM_020240chr521886 803 --12592 184
NM_020246chr72100 54 --1259 --
NM_020248chr1132307 2129 1985 1853 1774 1586 1558 1482 832 799 717 351 126 2335 26 11938 11815
NM_020309chr1921085 98 ------
NM_020310chr17161976 1854 1810 1715 1134 932 925 911 729 601 516 344 328 226 208 153 12584 2864 522 --
NM_020314chr16160 ----2642 70
NM_020336chr2053464 3284 3049 1355 699 23558 3199 ----
NM_020337chr443139 2355 810 277 33061 2034 908 ----
NM_020338chr1093293 3223 3217 2648 2517 1454 754 610 486 --12923 22626 2461
NM_020341chr2011515 ------
NM_020342chr212472 ------
NM_020346chr1111557 ------
NM_020357chr3--21276 1061 ----
NM_020383chr10268 38 ------
NM_020390chr321145 394 13961 11709 --
NM_020416chr462512 2412 948 883 526 388 12285 32586 2005 1018 --
NM_020429chr732683 2203 2057 --2429 325 195
NM_020431chr1452483 2121 2058 1964 366 22606 2163 22190 165 22748 1097
NM_020433chr2091669 1634 1569 1471 1372 625 343 281 206 --1264 --
NM_020438chr97941 930 512 440 256 196 52 11067 --1910
NM_020440chr132896 2807 304 ----1692
NM_020443chr195959 5932 5856 5268 4815 1114 766 386 285 ----56227 4641 4577 4508 1495
NM_020452chr1111369 850 841 777 759 679 658 479 317 128 21 1399 11679 --
NM_020456chr1321855 900 32237 363 153 ----
NM_020466chr644306 3148 1224 601 31617 1193 864 13773 --
NM_020474chr1831444 1339 408 ------
NM_020475chr892434 2403 2350 1821 1754 1723 1650 992 536 21607 748 ----
NM_020476chr892434 2403 2350 1821 1754 1723 1650 992 536 21607 748 ----
NM_020477chr892434 2403 2350 1821 1754 1723 1650 992 536 21607 748 ----
NM_020478chr882497 2466 2413 1884 1817 1786 1713 599 31670 811 64 ----
NM_020480chr892434 2403 2350 1821 1754 1723 1650 992 536 21607 748 ----
NM_020526chr161809 1778 1690 1429 1279 203 ----11180
NM_020530chr224846 699 330 45 ------
NM_020532chr2189 ------
NM_020548chr22179 56 ------
NM_020630chr10----1549 188
NM_020640chr322032 1779 ------
NM_020651chr221741 94 ------
NM_020663chr141137 1617 ----
NM_020673chr2077410 6393 6191 5995 5261 5158 1948 25777 1563 --26304 47
NM_020689chr2041341 1135 574 159 ------
NM_020698chr1263023 2324 2310 1996 1955 856 53123 1110 999 809 317 ----
NM_020699chr1144643 4209 4038 3861 3815 2040 1217 1169 866 828 295 273 224 169 45144 3830 1647 33 15071 --
NM_020702chr941533 1330 1161 265 154 2689 487 --
NM_020703chr13607 234 110 154 ----
NM_020704chr73683 203 59 1148 1176 --
NM_020708chr20102198 1890 1770 736 658 414 390 324 223 112 11872 11590 --
NM_020711chr221970 276 12095 11020 --
NM_020713chr2093062 2554 2293 2283 2264 675 395 369 352 2805 155 73104 2620 2439 1186 958 896 787 --
NM_020715chr1431849 1412 542 11811 ----
NM_020717chrX124087 4023 3735 3634 3526 3519 1818 1781 1518 1101 393 179 54009 1633 1200 1070 125 44520 1435 656 455 --
NM_020718chr1685473 5428 4413 2613 1896 1870 1802 996 32184 2070 1423 ----
NM_020724chr472625 2610 2451 2169 939 512 207 1578 12520 11857
NM_020728chr762916 2544 2514 2459 1276 313 --22223 2186 --
NM_020734chr1222125 778 12996 --1462
NM_020739chr1523748 1063 1365 1735 --
NM_020740chr171289 1116 ----
NM_020748chr1721863 296 ------
NM_020749chr832097 1439 620 130 ----
NM_020750chr651299 1114 1017 924 154 --11052 --
NM_020752chr101441 --1282 --
NM_020766chrX41576 1162 1083 387 23117 974 1233 1955
NM_020772chr17136685 6449 2661 2251 2056 1963 1947 1719 1529 1265 1104 526 496 ----36130 5418 552
NM_020773chr4122585 2061 2030 1805 1758 946 743 696 685 669 594 531 --1610 --
NM_020774chr1864613 3929 1576 1317 914 408 22306 2168 --14765
NM_020777chr4172386 2176 2111 2020 1991 1739 1696 857 724 677 643 555 430 337 215 146 107 11563 ----
NM_020778chr15154759 4245 3320 1961 1777 1613 1602 1361 1292 1155 933 743 562 317 134 23158 283 1437 --
NM_020783chr1842392 732 503 377 11826 ----
NM_020792chr341945 425 357 313 12558 ----
NM_020794chr1--11191 11511 --
NM_020795chr1771999 1702 1540 1340 752 705 39 3459 450 350 --21854 1379
NM_020796chr5--32478 2439 2431 ----
NM_020801chr552582 2433 2381 1785 1695 --11667 --
NM_020804chr6112532 2278 2202 1878 1032 952 860 420 384 314 289 1473 52418 2181 1726 1696 296 --
NM_020806chr141852 ------
NM_020807chr1631398 231 90 --11440 --
NM_020808chr13760 293 245 ------
NM_020809chr1131606 832 241 --1335 --
NM_020821chr1561363 1313 740 635 524 434 1239 ----
NM_020828chr191910 --1272 --
NM_020830chr223213 2653 22428 218 ----
NM_020834chr142688 451 ------
NM_020841chr1212749 21326 1259 11387 --
NM_020845chr12112499 2334 2202 1938 1826 1699 939 312 291 159 119 ------
NM_020850chr1661044 876 738 318 60 22 --42739 2672 1099 984 12174
NM_020851chr1551535 1513 1500 358 136 ------
NM_020856chr1951514 984 461 390 74 ----1547
NM_020858chr151903 ------
NM_020859chr452865 717 381 173 117 31052 922 466 ----
NM_020870chr431441 222 131 2774 683 ----
NM_020871chrX32040 1881 1840 --12143 --
NM_020888chr131912 1627 818 1557 21685 306 12016
NM_020895chr191270 ------
NM_020898chr123780 210 143 1242 1314 --
NM_020899chr1762378 2036 932 400 352 71 31665 130 46 --1332
NM_020918chr1042955 2755 175 108 12528 --13476
NM_020921chr1413670 1930 11071 --
NM_020922chrX21303 708 11683 ----
NM_020927chr164806 438 375 285 ------
NM_020935chr223225 483 13482 11239 13900
NM_020940chr1042941 2898 2324 1903 11880 ----
NM_020944chr92210 88 172 ----
NM_020946chr991650 1564 1474 1088 651 408 262 219 163 --1176 --
NM_020947chr1631968 1891 1492 1158 32181 1542 170 --
NM_020948chr131379 1341 436 2521 94 ----
NM_020949chr31209 ------
NM_020951chr1932320 1854 1661 ------
NM_020952chr9--182 ----
NM_020958chr14178 ------
NM_020962chr1552190 953 655 408 364 11651 1555 31940 1869 490
NM_020967chr2041083 898 477 41 ------
NM_020973chr41234 ------
NM_020974chr111509 --1446 --
NM_020975chr1051858 1832 1817 1506 802 --2460 224 --
NM_020983chr1282225 2136 1686 1484 841 660 565 502 22188 2051 11599 --
NM_020993chr1272367 2292 2109 1868 1125 434 425 12209 ----
NM_021003chr141693 ------
NM_021005chr151395 ------
NM_021012chr17123092 3039 2993 2835 2529 2185 2154 1143 1046 667 627 610 --42815 2105 1247 100 --
NM_021013chr171152 1288 173 --
NM_021020chr8163286 2909 2783 2720 2616 2583 2546 2410 2289 785 678 444 408 190 167 110 12981 32463 793 215 --
NM_021033chr1363450 2383 626 361 160 21 --32598 1279 1216 --
NM_021064chr661276 1186 1146 610 587 445 11457 11380 --
NM_021072chr5181 ------
NM_021078chr174493 431 350 181 --277 25 --
NM_021079chr17122934 2527 2476 2425 2124 2089 1056 995 986 950 650 102 ----12880
NM_021083chrX83627 3446 3183 2281 1097 578 422 187 2395 284 --1681
NM_021088chr271856 1745 1496 1471 828 611 112 ------
NM_021101chr321729 809 1668 ----
NM_021109chrX1306 ------
NM_021109chrX1306 ------
NM_021111chr9--11229 --151
NM_021120chrX132933 2911 2884 2578 2255 2234 1947 1207 1154 1120 870 852 152 --13135 33073 1106 453
NM_021148chr7--1375 --11943
NM_021156chr205978 402 372 364 337 2734 93 ----
NM_021161chr141162 --1477 --
NM_021163chr733411 2750 1164 297 33 --1422
NM_021174chr81650 ------
NM_021183chrX32376 1746 108 ------
NM_021188chr141442 ------
NM_021192chr2----1363 --
NM_021198chr271305 933 539 403 365 254 31 ------
NM_021201chr111456 171 --1446
NM_021202chr2092874 2727 2335 2021 1139 592 489 360 156 22284 176 32741 1180 501 1872
NM_021213chr1731283 1146 852 11051 11095 --
NM_021227chr4--1508 ----
NM_021229chr1211199 11193 ----
NM_021237chr31125 ------
NM_021238chr1221832 1575 21426 396 ----
NM_021240chr92196 55 ------
NM_021249chr1421597 1314 11305 ----
NM_021253chr6169 2448 250 21401 905 1107
NM_021255chr1433527 2773 489 ------
NM_021259chr1691034 965 887 797 790 364 356 307 245 11009 3469 403 29 2917 84
NM_021260chr1431342 528 461 ----11319
NM_021569chr981142 999 845 822 798 427 373 224 ------
NM_021574chr22102510 2388 1964 1922 1887 1553 750 485 450 86 22008 1527 22396 277 --
NM_021622chr1022063 686 ----1541
NM_021627chr3----21067 160 --
NM_021629chr32543 501 1468 ----
NM_021631chr8123 ------
NM_021633chr131342 181 167 ----21317 904
NM_021638chr4114055 3944 3588 3368 3159 1783 1753 1240 1103 455 81 23988 1343 33446 494 133 1336
NM_021639chr1----1602 --
NM_021643chr251876 1693 1621 1498 325 21320 646 ----
NM_021648chr632426 2114 1943 22197 1008 1429 --
NM_021649chr531489 682 414 2351 295 ----
NM_021705chr661469 1322 1173 1136 528 307 ------
NM_021728chr142899 242 1654 1893 --
NM_021738chr102737 699 ------
NM_021783chrX72424 2221 2106 2055 602 35 27 ------
NM_021813chr694668 4394 2319 1842 1760 1512 1457 576 491 11362 35145 4843 1311 11905
NM_021814chr62498 210 11310 ----
NM_021831chr21331 ------
NM_021872chr2071124 1101 894 793 433 380 132 1205 --1327
NM_021873chr2071124 1101 894 793 433 380 132 1205 --1327
NM_021905chr672194 2174 1745 1697 1569 557 54 31506 845 237 ----
NM_021908chr73887 831 55 ------
NM_021912chr1573826 3126 3108 3020 2887 2762 1314 33874 3385 3258 1363 --
NM_021913chr193637 525 112 1182 1734 --
NM_021914chr1441913 867 715 453 ----1347
NM_021943chr651975 1835 763 490 347 11376 ----
NM_021946chrX61428 1238 1104 591 392 352 --1575 1344
NM_021949chrX72687 2346 2201 2028 1935 855 806 --11832 --
NM_021951chr91675 1873 ----
NM_021954chr1343301 2987 1370 428 --11311 --
NM_021959chr62307 285 1135 ----
NM_021960chr122790 2111 --11096 --
NM_021961chr1186528 5292 2902 2477 2402 1996 1421 324 16630 1120 15910
NM_021962chr1751843 1734 812 658 432 --1563 2553 544
NM_021963chrX2153 67 ----123
NM_021964chr366478 4898 2589 1652 1559 545 ------
NM_021967chr541188 997 911 476 --11256 --
NM_021973chr4----1100 --
NM_021976chr631019 308 102 1234 3917 225 68 1739
NM_021977chr693504 3462 3293 2892 2843 700 651 290 67 12414 ----
NM_021988chr2031210 629 519 21194 1060 ----
NM_021991chr172581 180 --1228 --
NM_021998chrX11348 ------
NM_022041chr1622077 31 1338 --12622
NM_022048chr1585875 5464 4492 2374 2009 1218 566 40 14845 2208 31 --
NM_022049chr121874 524 --1403 --
NM_022051chr11274 ------
NM_022060chr1451371 1200 912 895 495 --1205 1921
NM_022062chr114772 608 354 295 21572 210 --11225
NM_022066chr173739 423 389 ------
NM_022073chr143606 349 26 150 ----
NM_022075chr12362 86 ------
NM_022079chr101665 1842 ----
NM_022080chr2032791 2644 999 --12782 --
NM_022114chr174351 3706 1833 1389 1051 1040 311 11028 54082 3489 3325 1110 777 24512 3472
NM_022123chr141428 ------
NM_022130chr5------11011
NM_022133chr821162 417 --1628 --
NM_022157chr1125 ------
NM_022166chr16166084 4886 4575 2368 1938 1872 1854 1715 1542 1395 985 568 510 405 298 90 55367 4526 1359 1286 899 34158 1431 679 1625
NM_022169chr1151299 1164 556 171 30 11118 21321 455 --
NM_022336chr262179 1877 1582 1539 664 57 ----11729
NM_022346chr411197 ------
NM_022442chr2031210 629 519 21194 1060 ----
NM_022458chr752267 2249 2110 2071 756 12327 22046 1948 --
NM_022459chr1352197 2080 1659 1469 812 ----16158
NM_022465chr1292462 2057 1955 1893 1176 910 510 168 135 22118 783 22308 43 --
NM_022473chr1554141 3828 3588 2722 614 ------
NM_022474chr1422352 272 1735 ----
NM_022476chr161247 ------
NM_022482chr2032153 355 192 1131 ----
NM_022491chr1263041 2647 1400 1047 319 116 22667 1388 21090 1000 --
NM_022497chr3122960 2935 2883 2796 1430 807 793 774 744 338 205 87 1100 ----
NM_022552chr22201 174 ------
NM_022553chr62421 119 --1367 --
NM_022557chr171218 ------
NM_022572chr251523 1301 1251 1172 1128 --2665 508 1381
NM_022574chr772106 1974 1632 869 836 467 24 11657 11456 --
NM_022640chr171216 ----1188
NM_022644chr172488 380 1120 --1459
NM_022648chr2153847 3551 3416 3399 1401 1315 1213 1174 1164 1069 874 804 384 234 69 22874 1092 11835 43840 3360 2939 1039
NM_022650chr52247 241 ------
NM_022652chr123444 341 234 ------
NM_022658chr1231321 1123 154 142 ----
NM_022659chr8141 --1174 --
NM_022716chr141936 1262 1243 65 22309 592 ----
NM_022719chr2293736 3463 3316 3114 2485 1408 1338 308 199 21106 232 32904 741 314 23685 2516
NM_022726chr6----1222 --
NM_022730chr23948 761 748 ------
NM_022735chr11158 ------
NM_022739chr172954 44 ------
NM_022742chr72292 62 ------
NM_022744chr1661149 1118 1027 953 927 898 --1530 --
NM_022748chr7122777 2358 2256 2052 1949 1860 1007 922 664 377 336 144 1190 12599 148
NM_022749chr85939 899 885 552 427 1562 --11242
NM_022750chr73590 507 36 ----143
NM_022755chr952237 1834 1612 964 829 --31913 907 254 --
NM_022756chr131369 55 41 ------
NM_022758chr682171 2133 2049 1072 911 565 541 107 22066 704 2743 113 12109
NM_022763chr322845 2742 11201 12712 --
NM_022776chr3196 --11436 --
NM_022780chr21596 --1384 --
NM_022802chr101613 11540 --1322
NM_022822chr115815 667 585 555 62 ----1167
NM_022824chr521435 508 --1486 --
NM_022831chr13583 549 65 1529 ----
NM_022833chr981437 1254 973 944 453 96 85 70 11034 21356 1298 --
NM_022836chr121367 1248 1522 ----
NM_022841chr1532629 1760 1117 31797 998 441 ----
NM_022842chr393163 2991 2747 2690 2547 2387 958 682 455 1990 12079 1312
NM_022843chr1311131 ------
NM_022893chr232978 2093 731 ----21059 664
NM_022894chr21211 1134 --1341
NM_022897chr51812 2203 51 --1266
NM_022898chr1444613 4445 3256 765 23449 2974 1904 21606 545
NM_022912chr231027 1007 439 1843 ----
NM_022970chr101994 ------
NM_022977chrX42438 2284 2038 1760 21658 928 ----
NM_022978chr541188 997 911 476 --11256 --
NM_023010chrX----128 --
NM_023011chr13------1329
NM_023015chr13711 301 264 ----1611
NM_023016chr232837 2453 199 ----1238
NM_023067chr341332 1055 245 220 ------
NM_023071chr121198 21062 1044 ----
NM_023074chr1931189 901 326 ------
NM_023076chr1672686 2276 770 698 279 56 38 23030 868 32513 2423 338 --
NM_023079chr1741748 1428 1401 1234 11574 ----
NM_023105chr852295 1691 622 414 342 12308 2966 596 --
NM_023106chr852295 1691 622 414 342 12308 2966 596 --
NM_023110chr852295 1691 622 414 342 12308 2966 596 --
NM_023111chr852295 1691 622 414 342 12308 2966 596 --
NM_023923chr143720 3476 1324 374 43234 2894 2578 691 1380 12562
NM_024007chr522804 2662 --12964 --
NM_024009chr11101 1766 ----
NM_024016chr172269 92 ------
NM_024043chr16101354 1345 1288 948 934 557 377 167 133 121 --11190 --
NM_024046chr381260 1227 1141 1128 837 438 407 365 --1413 --
NM_024050chr191167 ------
NM_024052chr1772060 717 696 651 605 474 367 62466 2438 2393 2358 1141 1126 --12866
NM_024085chr24840 99 88 52 ----1864
NM_024086chr1773445 3293 3173 2990 2477 594 295 11025 1434 --
NM_024087chrX1618 ------
NM_024090chr421867 1403 ------
NM_024294chr682171 2133 2049 1072 911 565 541 107 22066 704 2743 113 12109
NM_024306chr165742 181 174 123 23 --3486 155 41 --
NM_024336chr16175 ------
NM_024422chr18--31715 437 23 ----
NM_024429chr7------2973 264
NM_024430chr1831524 1420 1233 1624 ----
NM_024492chr641322 538 474 132 ------
NM_024494chr14229 217 154 95 --1173 --
NM_024496chr143822 772 52 ------
NM_024507chr164321 129 118 47 ------
NM_024509chr191112 ------
NM_024522chr191748 1589 1346 752 590 510 415 285 88 --21434 36 1699
NM_024524chr312729 12636 ----
NM_024529chr121122 332 ----11116
NM_024536chr24296 160 154 143 --1310 --
NM_024541chr1051851 1690 1423 379 27 21505 365 ----
NM_024546chr13----136 11124
NM_024551chr1262348 2043 1027 273 240 142 --11628 --
NM_024551chr1262348 2043 1027 273 240 142 --11628 --
NM_024554chr131520 1093 439 ------
NM_024556chr111324 ------
NM_024565chr561371 521 471 200 112 30 1104 ----
NM_024569chr192776 2651 2575 2319 2014 1925 1888 260 166 22595 719 22499 1982 11090
NM_024581chr6124 ------
NM_024586chr11491 --1214 --
NM_024590chr421537 175 --1268 21579 482
NM_024607chr894379 4282 4211 4037 4010 3793 3330 2919 52 11500 13502 --
NM_024611chr1573105 2667 2601 2469 1032 1011 814 33715 565 192 --1126
NM_024612chr1721002 941 ------
NM_024617chr92868 668 ------
NM_024624chr22606 21 --127 --
NM_024628chr351099 804 380 277 187 ------
NM_024639chr662070 1971 1114 703 485 439 22803 2103 ----
NM_024645chr851377 1193 1158 614 240 ------
NM_024652chr152809 500 2205 119 ----
NM_024665chr374549 4299 4260 3803 744 346 64 34271 3849 168 11322 13911
NM_024666chr1521622 47 --1443 11206
NM_024674chr153224 3049 2309 2209 193 13070 --1975
NM_024692chr231373 1262 595 11494 ----
NM_024698chr1191190 1082 1032 946 880 866 516 507 482 --21160 270 --
NM_024704chr202332 186 1698 1205 --
NM_024721chr862417 2098 811 758 649 578 11938 --12022
NM_024740chr1194113 3889 3760 3298 3154 3048 2958 589 134 23792 3607 ----
NM_024742chr16101750 1706 1629 1292 1211 587 484 458 145 74 --61587 1332 739 711 536 89 --
NM_024757chr93448 372 336 --11120 --
NM_024761chr974551 3877 1461 1293 243 138 79 14922 41678 551 513 54 23314 1904
NM_024770chr296286 5310 2379 1839 1649 1537 1447 1377 259 16410 --25153 4740
NM_024771chr1161900 1680 410 348 145 107 11853 1129 12068
NM_024779chr1251420 1340 1259 1106 22 11031 1284 --
NM_024780chr16--2453 413 ----
NM_024785chr241146 202 102 22 21075 326 1259 --
NM_024786chr52242 71 2157 47 ----
NM_024787chr81277 2930 195 1367 --
NM_024792chr1731018 284 207 --178 --
NM_024811chr1151858 1346 444 277 59 ------
NM_024818chr331390 1221 965 152 ----
NM_024828chr911293 11284 ----
NM_024850chr5151 --1733 --
NM_024854chr1211044 ----11317
NM_024884chr14134183 4112 3964 3899 3581 1800 1746 1669 1230 1148 1044 914 818 24467 3406 14065 24475 1223
NM_024887chr151782 1601 186 92 30 --1779 --
NM_024909chr661326 1242 1056 603 438 214 21525 1488 2570 531 1122
NM_024915chr892428 2252 2199 1967 1911 1087 573 515 52 ------
NM_024920chr4--21431 126 ----
NM_024922chr1661645 734 679 637 588 130 1213 1811 --
NM_024927chr17----158 --
NM_024939chr165427 374 294 240 58 --11281 --
NM_024944chr2141244 1012 881 127 ------
NM_024946chr1631616 1543 521 21373 505 ----
NM_024948chr101693 ------
NM_024949chr494730 4260 4160 3331 3261 3115 1280 881 176 44056 3802 3371 1441 14502 --
NM_024953chr1231919 700 417 11821 ----
NM_024954chr102574 203 ------
NM_024971chr9--182 ----
NM_024989chr267857 7453 6801 6262 1603 1559 16745 16312 16783
NM_024991chr1072947 2595 2119 1259 1089 749 741 22009 439 1635 --
NM_024997chr1631131 517 387 31184 912 410 ----
NM_025004chr112270 55 --1276 --
NM_025054chr842830 1117 1064 1009 11165 14025 1196
NM_025057chr141354 2155 67 ----
NM_025073chr184198 4107 3893 3316 694 480 417 254 23490 303 ----
NM_025074chr462700 2681 2665 1991 795 428 1617 ----
NM_025076chr21193 ------
NM_025083chr1581786 1740 1704 1569 1322 576 361 46 --11402 --
NM_025099chr176809 795 400 216 167 61 --1252 --
NM_025106chr171866 1823 1320 1226 751 722 123 --21753 406 --
NM_025109chr17148 ------
NM_025133chr22871 26 ------
NM_025134chr1622376 374 ------
NM_025146chr32315 145 ------
NM_025151chr841827 593 285 75 ------
NM_025158chr51471 ------
NM_025160chr133968 3901 531 34122 1449 899 ----
NM_025179chr1154493 4148 3778 3115 1919 1882 1574 1481 1295 1134 1020 983 745 413 113 24222 570 14319 --
NM_025181chr22751 635 ------
NM_025182chr95936 850 377 313 262 --1777 --
NM_025187chr162386 154 --1255 --
NM_025195chr861693 748 657 651 471 202 ------
NM_025201chr15102039 1885 1858 1374 793 641 514 381 176 65 1778 21361 830 --
NM_025208chr1122163 144 ----11539
NM_025219chr2062262 1857 1591 630 511 158 22022 1620 3826 492 108 --
NM_025221chr431337 980 919 ------
NM_025222chr362581 2043 1197 773 399 253 22604 1909 ----
NM_025224chr20142090 1926 1800 1768 1531 1489 805 796 770 688 552 392 193 153 1127 21628 656 --
NM_025230chr1451191 603 440 426 285 --1132 1151
NM_025236chr62257 42 ------
NM_025237chr1731056 484 478 1510 2324 148 145
NM_025248chr17182821 2747 2133 2036 1264 1221 1212 1197 1169 1147 1137 877 832 738 713 599 538 269 2413 351 32985 2168 108 1123
NM_025251chr871113 796 417 371 298 133 32 --1360 1106
NM_030576chr1772246 2016 2003 1884 881 275 145 12597 32663 2461 843 --
NM_030579chr1642798 2668 854 754 1616 --13373
NM_030621chr1463518 3464 2974 2606 701 442 13371 23292 2690 --
NM_030625chr1032542 2509 267 ------
NM_030627chr512766 22916 893 ----
NM_030629chr1641880 483 95 81 --1103 --
NM_030630chr175789 738 688 54 46 --1126 --
NM_030645chr151170 523 511 245 124 --1164 --
NM_030647chr785775 4916 4898 4874 4765 4389 3975 2033 46320 4958 4460 237 ----
NM_030648chr4125101 4978 4890 4726 4251 3871 2161 2139 1316 1089 922 196 15231 --22124 1306
NM_030651chr66797 720 687 659 156 86 ------
NM_030660chr142555 462 11319 ----
NM_030661chr741539 1098 624 267 21612 1556 ----
NM_030664chr1042476 2124 150 28 --1980 --
NM_030665chr1731138 347 129 --1447 --
NM_030667chr1221236 102 --175 --
NM_030668chr1221236 102 --175 --
NM_030669chr1221236 102 --175 --
NM_030674chr1275865 5540 5247 5199 4326 1717 875 13648 1585 --
NM_030755chr1431163 945 919 ------
NM_030761chr162621 2098 1749 1088 928 684 --32592 2036 514 --
NM_030762chr1221973 500 ------
NM_030763chrX1575 ------
NM_030786chr11363 21932 1736 ----
NM_030795chr81391 ------
NM_030796chr781605 1596 1554 1485 823 652 116 48 31952 1802 860 ----
NM_030799chr532087 1407 752 155 ----
NM_030802chr174576 296 72 44 1177 1144 --
NM_030806chr1189222 8858 8235 8175 7940 7882 7627 7501 7261 6571 5790 3738 3585 2859 1174 1053 530 474 38851 7439 6751 28339 6689 12254
NM_030808chr1731030 421 157 ------
NM_030809chr1242299 1614 605 197 22448 1599 11550 --
NM_030816chr122430 1309 12829 12513 --
NM_030881chr2221754 493 ------
NM_030884chr3102192 2014 1727 1685 1614 1592 1551 691 327 185 21625 544 --1927
NM_030885chr331473 512 198 ------
NM_030911chr132593 66 ------
NM_030914chr97972 662 621 615 287 115 69 ------
NM_030915chr261959 1603 1479 777 231 211 21947 49 ----
NM_030918chr1104347 4195 4003 1945 1738 1607 469 255 203 88 33590 1907 973 ----
NM_030922chr153810 728 619 ------
NM_030927chr1051386 1069 636 518 350 1269 ----
NM_030934chr111753 2712 437 ----
NM_030935chr72327 44 1430 1172 --
NM_030937chr141111 1011 588 41 --1268 --
NM_030949chr631355 1166 46 ----11399
NM_030952chr11205 1943 1138 --
NM_030953chr51197 1114 ----
NM_030962chr114533 359 271 79 11610 ----
NM_030964chr5133471 3130 3033 2968 2924 2849 2688 2341 1351 793 535 96 28 23247 2335 --1222
NM_030965chr1169 1615 ----
NM_030981chr1151098 1071 1023 369 122 156 3474 408 163 --
NM_031203chr19--2258 39 ----
NM_031205chr122388 361 ------
NM_031266chr5----1477 --
NM_031268chr16184510 3647 1981 1788 1715 1691 1522 1498 1322 1312 1003 877 843 602 480 453 395 373 24261 1437 11833 15211
NM_031275chr11--1133 ----
NM_031286chr12388 329 ------
NM_031309chr862022 1877 895 764 686 161 2361 304 ----
NM_031362chr232752 536 361 1347 --1920
NM_031365chr232888 672 497 1483 --11056
NM_031366chr232888 672 497 1483 --11056
NM_031371chr111043 ----11601
NM_031371chr111043 ----11601
NM_031372chr421667 311 ----1544
NM_031411chr542090 773 732 320 ------
NM_031417chr1962694 2159 621 507 44 25 1387 3272 225 33 12501
NM_031418chr1162258 1778 1034 940 709 473 11806 22595 977 --
NM_031434chr73347 172 131 ----1120
NM_031439chr821361 255 --155 11511
NM_031444chr2281778 1685 1590 813 795 739 675 609 12231 3625 252 73 --
NM_031445chr243172 997 714 412 33317 354 176 1787 12529
NM_031453chr101162 22442 84 11958 --
NM_031468chr7177452 7439 6556 6335 5950 5220 3212 3203 2936 2844 2773 2159 1931 1764 1595 1342 501 46242 6190 5912 3143 32713 2078 573 --
NM_031469chr683304 3265 3182 1504 1471 1398 962 47 24016 3343 --11346
NM_031483chr2032868 1226 250 --12257 --
NM_031492chr112405 233 1184 ----
NM_031844chr124080 2686 23549 2897 33653 2710 2693 --
NM_031845chr231377 338 248 --166 --
NM_031847chr231377 338 248 --166 --
NM_031849chr542090 773 732 320 ------
NM_031850chr31317 ----1156
NM_031850chr31317 ----1156
NM_031857chr542090 773 732 320 ------
NM_031860chr542090 773 732 320 ------
NM_031889chr431863 1365 753 21715 1595 1411 --
NM_031890chr2282757 2393 2342 635 551 330 242 147 22471 660 22936 2210 1402
NM_031892chrX4827 257 196 37 ------
NM_031911chr42708 33 --21757 286 --
NM_031936chr12276 182 ------
NM_031942chr2--11161 ----
NM_031948chr16237 26 ------
NM_032012chr9125130 4910 4731 4686 4375 3930 3580 3319 921 814 602 280 --13562 14742
NM_032017chr172120 1904 1755 1603 1330 802 80 --11309 --
NM_032026chr8159 ------
NM_032027chr12246 36 ------
NM_032028chr51576 1138 --157
NM_032041chr852292 2128 974 783 343 ----12048
NM_032042chr541044 732 477 269 12121 133 1304
NM_032049chr31317 ----1156
NM_032049chr31317 ----1156
NM_032052chr225968 924 348 245 230 ----1148
NM_032102chr1142928 767 696 343 185 --1703
NM_032108chr192903 23 ------
NM_032109chr541179 1151 309 91 ------
NM_032124chr1841183 1095 900 179 ------
NM_032128chr41835 2685 103 ----
NM_032139chr1921090 365 2725 135 1953 --
NM_032144chr2------11838
NM_032153chr342373 1798 1020 783 21122 172 ----
NM_032169chr33639 532 237 1692 1525 --
NM_032174chr131466 966 41 1917 21067 480 --
NM_032181chr22331 91 ------
NM_032182chr10------1388
NM_032186chr11354 ------
NM_032189chr13164271 4231 4220 3850 3759 3737 3662 3654 1726 1165 1030 928 639 535 102 81 --34547 1713 1691 13873
NM_032199chr1023637 269 12641 23426 1258 --
NM_032208chr243566 2981 1203 514 23645 412 11067 --
NM_032233chr141773 1694 1742 --
NM_032236chr1----1954 1423
NM_032256chr123928 893 42 --1314 --
NM_032268chr1662311 2095 706 574 162 77 32498 2279 1270 --12253
NM_032283chr171377 1336 1154 412 362 301 200 1148 21773 1751 11385
NM_032288chr341465 807 690 37 1567 --1177
NM_032289chr571810 1783 1307 792 783 430 215 1678 ----
NM_032291chr111287 1303 ----
NM_032294chr1731448 1322 614 ----11277
NM_032295chr751379 923 378 339 118 ----1205
NM_032319chr2138 ------
NM_032320chr111503 ------
NM_032325chr1191795 1620 1485 711 683 358 158 79 45 1125 1789 --
NM_032339chr173120 64 28 ------
NM_032364chr124655 341 229 140 ------
NM_032389chr113412 259 80 ------
NM_032408chr73456 238 119 1133 ----
NM_032413chr151138 ------
NM_032431chr115930 741 282 241 62 --1119 --
NM_032435chr142364 784 648 565 ------
NM_032440chr10----12690 --
NM_032442chr172459 55 ------
NM_032445chr153925 769 70 153 --1226
NM_032452chr1451366 1250 1204 516 302 1627 ----
NM_032458chrX21155 648 ------
NM_032466chr831633 1320 1083 ------
NM_032468chr831633 1320 1083 ------
NM_032490chr141559 3526 504 217 ----
NM_032499chr1531439 618 564 ----197
NM_032505chr312716 ------
NM_032508chrX31335 493 132 ------
NM_032509chr822417 1714 1653 --12238
NM_032523chr21494 ------
NM_032536chr92472 189 ------
NM_032538chr682370 2209 2055 1000 965 905 430 241 12808 32643 2405 1976 --
NM_032552chr951461 1378 679 556 526 --1366 21414 86
NM_032557chr41768 ------
NM_032564chr114904 736 196 58 2265 27 --11003
NM_032569chr1641638 504 171 42 --1679 --
NM_032575chr16151744 1630 1565 1513 1493 1475 1416 1401 1278 765 734 626 515 425 317 --51701 1606 1307 827 488 --
NM_032581chr741664 134 95 74 1692 1107 1613
NM_032582chr171697 1441 --1122
NM_032632chr141744 1443 ----
NM_032682chr393281 2963 2874 2578 1207 1198 1158 903 342 1137 --11284
NM_032687chr8134 --1229 --
NM_032711chr17214192 4173 3990 3930 3815 3714 3628 3610 3532 3401 3157 2845 2802 2762 1686 1604 1535 1429 662 485 66 33852 3682 2837 33263 517 491 --
NM_032727chr1051503 1270 620 451 194 175 ----
NM_032731chr1731485 950 485 1361 135 --
NM_032741chr64883 821 794 725 ----173
NM_032765chr51386 1871 ----
NM_032777chr831354 1214 605 ------
NM_032780chr113458 422 254 --2960 898 --
NM_032781chr115798 681 335 80 68 ------
NM_032784chr61110 ------
NM_032788chr211090 ------
NM_032800chr122523 2086 --2979 633 --
NM_032808chr152933 839 ------
NM_032829chr1231101 1038 1021 ------
NM_032830chr16--130 ----
NM_032832chr61595 2420 251 ----
NM_032833chr1----1186 11996
NM_032836chr1951068 410 250 137 22 1266 --1122
NM_032837chr1712033 ------
NM_032840chr1281077 1016 797 486 314 215 201 67 2426 104 ----
NM_032842chr73605 502 70 ------
NM_032859chr1323164 624 21309 469 ----
NM_032876chr1452096 2016 618 474 64 --1828 11690
NM_032884chr1----156 --
NM_032900chr10103786 3691 3094 2603 1549 1382 1064 1039 960 212 13374 ----
NM_032924chr78914 871 856 751 393 386 220 35 ------
NM_032932chr17166311 6266 6223 5883 5710 5501 5485 5140 5055 4426 4194 2572 2360 1825 576 38 24104 4000 36349 5921 4969 --
NM_032947chr531018 508 358 ------
NM_032949chr131456 ------
NM_032982chr772513 2500 2036 821 716 651 217 22384 1855 --1503
NM_032995chr261565 576 546 515 371 180 1248 2464 416 1404
NM_032999chr731004 910 856 --1309 --
NM_033000chr731004 910 856 --1309 --
NM_033001chr731004 910 856 --1309 --
NM_033012chr131313 ----1775
NM_033018chrX1919 21183 1075 21113 411 11122
NM_033020chr144763 3666 1400 281 21306 125 ----
NM_033027chr351130 1103 1042 978 392 --1951 --
NM_033030chr211572 ------
NM_033036chr11276 31 ----11667
NM_033044chr131250 1208 969 ------
NM_033055chr1------1794
NM_033056chr101605 ------
NM_033071chr6188 1237 ----
NM_033083chr362572 2318 1117 589 559 128 1695 21311 296 --
NM_033089chr2031268 1079 374 1351 --1601
NM_033118chr201866 ------
NM_033129chr2091687 1661 823 778 611 492 443 393 242 11324 21620 501 --
NM_033133chr17133257 3215 3117 3088 2469 1353 1139 1025 922 903 615 535 344 12839 22911 464 13379
NM_033135chr1122163 144 ----11539
NM_033136chr531283 612 261 ------
NM_033137chr531283 612 261 ------
NM_033138chr721962 69 ------
NM_033139chr721962 69 ------
NM_033140chr721962 69 ------
NM_033143chr41348 1229 12896 1102
NM_033157chr721962 69 ------
NM_033181chr673182 2956 2797 1109 851 743 440 --12817 13156
NM_033207chr1032363 506 124 12138 ----
NM_033222chr921247 577 ------
NM_033224chr7117357 7285 6819 6326 5719 3223 2529 2297 2170 914 506 37784 6900 315 ----
NM_033225chr852314 2302 1994 993 43 42614 2338 1214 462 ----
NM_033226chr162679 39 1668 198 --
NM_033240chr1581593 1384 1349 1295 1156 646 474 123 ------
NM_033246chr152293 113 --1287 --
NM_033260chr6------1716
NM_033274chr5123296 2988 2905 2864 2306 1159 731 702 635 520 98 31 23120 75 33035 1341 866 --
NM_033284chrY174 ----154
NM_033285chr883891 3651 3281 1701 1482 1070 960 183 23936 1497 ----
NM_033290chrX32696 2625 698 --23751 1040 --
NM_033309chr164901 876 865 87 ------
NM_033315chr17112020 1945 1885 1788 1411 1391 1375 777 753 330 186 --21698 1431 --
NM_033326chr1141845 909 158 33 11869 ----
NM_033331chr912691 13471 --23110 2447
NM_033334chr9161 ------
NM_033360chr1251674 1282 1129 632 587 ------
NM_033364chr321359 702 21573 806 ----
NM_033375chr17121374 1344 1333 1265 1203 1026 548 470 449 433 383 300 --11220 --
NM_033386chr22131187 931 912 761 715 471 445 355 225 169 161 78 60 --1451 --
NM_033387chr982354 2236 2156 1949 1897 1794 974 813 22420 299 12556 --
NM_033389chr17104623 4393 4158 4076 3817 3731 3705 827 612 327 34692 4323 524 34228 3723 3382 14446
NM_033394chr211441 --11176 --
NM_033421chr2041547 606 542 348 2715 342 ----
NM_033425chr1142499 2447 259 46 1807 11386 --
NM_033429chr1572224 830 824 770 291 285 28 22519 2244 --22987 965
NM_033430chr433318 3294 785 23363 544 ----
NM_033437chr433318 3294 785 23363 544 ----
NM_033438chr1----126 --
NM_033449chr5132012 1917 1659 1644 1487 1481 1470 1446 1357 789 678 397 329 11835 ----
NM_033496chr102624 217 ------
NM_033497chr102624 217 ------
NM_033498chr102624 217 ------
NM_033500chr102624 217 ------
NM_033503chr1593618 3386 3340 3224 2682 1208 453 192 140 23651 1432 33721 744 273 --
NM_033505chr276638 6402 6201 5785 5723 1599 741 26189 525 1764 --
NM_033514chr24194 157 67 41 --1122 --
NM_033515chr61265 ----1936
NM_033549chr54930 895 238 130 --2850 291 --
NM_033551chr5153424 2851 2750 2202 1398 1219 1187 1149 739 515 478 436 375 348 175 43143 3103 2350 755 --12993
NM_033624chr1242178 1657 1564 258 1476 ----
NM_033626chrX61621 1417 683 401 313 154 --41259 1143 647 624 1223
NM_033631chr1113890 3706 3399 3366 3275 3053 2780 2463 753 108 60 ----12377
NM_033632chr4----11258 --
NM_033637chr1063745 3682 3420 2822 1505 1010 1121 ----
NM_033642chrX21189 26 ------
NM_033644chr52703 175 --21704 1697 --
NM_033645chr52703 175 --21704 1697 --
NM_033656chr2145035 1824 1658 526 25211 3780 ----
NM_052818chr1341904 1829 1669 689 11985 --1348
NM_052840chr1551551 1430 1400 1269 509 ------
NM_052845chr12103213 2859 2581 2111 2010 1323 852 540 198 79 42652 663 446 88 22995 2775 12826
NM_052849chr151300 ------
NM_052851chr1341844 1837 504 481 --1553 --
NM_052864chr421706 45 ------
NM_052867chr1321005 60 ------
NM_052868chr11238 ------
NM_052872chr6273 61 ------
NM_052879chr1262923 2885 2713 688 486 473 ------
NM_052880chr2261457 1214 1132 943 494 158 1302 ----
NM_052885chr1253120 1212 913 478 77 21873 258 ----
NM_052896chr1102540 2533 2149 1855 1822 906 749 417 161 85 22560 187 --1210
NM_052897chr124846 158 58 31 ------
NM_052900chr82213 121 --1429 --
NM_052905chr22603 343 --1502 190
NM_052906chr22194917 4845 4656 4626 4542 4536 4520 4408 4060 3617 3548 3321 3078 1862 1754 1422 1207 834 650 13378 44867 4359 1836 1526 34927 4875 3295
NM_052913chr61966 1779 --11039
NM_052918chr1062421 1098 952 704 641 371 13152 ----
NM_052934chr151860 577 532 332 306 2776 739 1256 --
NM_052937chr81587 11845 ----
NM_052958chr81244 ------
NM_052966chr133446 2458 995 33388 2553 32 ----
NM_052968chr113595 115 49 182 2535 56 --
NM_052970chr202787 328 --1913 --
NM_052978chr143767 252 70 149 ----
NM_052996chr1641600 1526 1343 1135 --1593 --
NM_053001chr81282 ------
NM_053002chr31956 1846 ----
NM_053016chr9117664 6525 6266 6224 6190 6122 5436 2056 1058 821 111 57855 7069 7038 7005 2361 ----
NM_053023chr1152840 756 582 350 341 11010 ----
NM_053024chr311408 1544 ----
NM_053041chr205583 257 112 54 24 --167 --
NM_053043chr7106101 5854 5601 5480 4698 1896 1717 955 869 115 53946 2431 2082 1349 543 56064 5685 5224 4485 2218 --
NM_053056chr1183034 2967 2789 933 519 253 170 69 --22924 2795 --
NM_053067chr91282 ------
NM_053279chr891951 1884 1827 941 930 713 405 229 113 12047 1174 21907 807
NM_054033chr24607 393 190 41 ------
NM_054035chr173327 181 53 --1344 1150
NM_057161chr62497 29 2516 91 2401 394 --
NM_057169chr1242968 2749 952 908 ----11156
NM_057170chr1242968 2749 952 908 ----11156
NM_057175chr442257 1838 946 891 12292 12319 --
NM_057178chr1772819 2576 2367 1935 678 300 147 1314 ----
NM_058004chr22282 66 ------
NM_058170chr121240 515 11042 11115 --
NM_058241chr211810 ------
NM_058241chr211810 ------
NM_058243chr193661 280 247 ------
NM_078469chr102483 290 ------
NM_078471chr1731100 866 124 --1996 --
NM_078476chr681532 1508 728 537 466 345 220 172 ------
NM_078487chr923234 625 22855 993 --1915
NM_078625chr621197 222 11119 ----
NM_078626chr1161 --1329 --
NM_080415chr174899 332 208 65 --1604 1841
NM_080491chr1153525 3102 2782 1021 162 2885 150 1348 12424
NM_080538chr361398 1124 1036 989 415 79 ------
NM_080539chr361398 1124 1036 989 415 79 ------
NM_080541chr361398 1124 1036 989 415 79 ------
NM_080546chr932318 1654 409 ----12116
NM_080594chr162608 101 1579 ----
NM_080599chr10132 1419 ----
NM_080616chr202272 250 --1218 --
NM_080629chr11485 1444 ----
NM_080630chr11485 1444 ----
NM_080632chrX----128 --
NM_080645chr631681 1336 215 11567 ----
NM_080664chr1441769 1547 522 328 ------
NM_080666chr1451694 1628 1592 1545 121 21622 1268 ----
NM_080669chr17153881 3605 3444 1939 1557 1532 1312 1254 1102 1003 897 795 642 579 471 41901 1495 1425 1241 64564 3869 3619 1578 728 318 --
NM_080670chr59832 746 715 697 671 331 112 98 22 --1678 --
NM_080671chr282101 1845 1641 1551 829 777 670 130 22128 664 1329 --
NM_080672chr202417 358 176 ----
NM_080676chr2023015 35 32247 1102 899 22074 655 11122
NM_080725chr2051676 1647 1489 375 159 1229 ----
NM_080738chr131563 746 400 1318 1346 --
NM_080759chr1312030 2560 108 ----
NM_080760chr1312030 2560 108 ----
NM_080764chr2242693 2000 586 523 22254 376 1759 --
NM_080862chr331057 864 484 1433 ----
NM_080867chr1454669 4487 3786 3558 928 33495 3243 732 ----
NM_080872chr843730 3459 1393 660 34042 1219 1165 ----
NM_080874chr441694 738 669 574 129 ----
NM_080927chr343376 1260 349 219 22431 2170 12913 --
NM_100264chr10--1187 ----
NM_100486chr10--1187 ----
NM_130385chr113916 732 27 12944 2206 33 12897
NM_130391chr942462 1129 496 220 12533 13276 --
NM_130392chr942462 1129 496 220 12533 13276 --
NM_130393chr942462 1129 496 220 12533 13276 --
NM_130435chr1032339 2307 2081 21994 428 12853 --
NM_130436chr211795 12821 ----
NM_130438chr2152217 2182 563 470 157 13398 ----
NM_130439chr1062259 1801 1576 1456 577 391 ------
NM_130439chr1062259 1801 1576 1456 577 391 ------
NM_130442chr72894 83 11143 2189 148 --
NM_130446chr393642 3408 1672 1624 1231 1200 796 379 126 23871 1689 11496 13486
NM_130459chr971385 1212 1190 1182 478 210 71 11116 21412 1326 --
NM_130468chr153