TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3131
miRNA Sequence: UCGAGGACUGGUGGAAGGGCCUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000037chr831000 832 535 --11727 --
NM_000038chr521579 167 11285 1428 --
NM_000044chrX155 ------
NM_000052chrX32800 609 570 --1576 --
NM_000084chrX126538 6010 5939 5806 4816 2548 2215 2096 1999 1219 725 532 1829 ----
NM_000092chr263327 3106 3012 1633 701 148 12982 ----
NM_000114chr2021059 207 1399 ----
NM_000125chr644021 3268 1161 180 ------
NM_000134chr421550 111 ------
NM_000141chr102966 309 1994 ----
NM_000151chr1761683 1364 1288 389 341 263 --11777 --
NM_000161chr142677 118 ------
NM_000168chr783321 3220 3035 2237 2184 2103 1293 200 ------
NM_000189chr252271 2202 1880 1847 246 12307 ----
NM_000202chrX63779 2638 2611 2547 2520 2446 ------
NM_000217chr1243785 3600 1775 1101 ------
NM_000222chr42428 292 ----12006
NM_000227chr181415 ------
NM_000248chr331954 775 357 ------
NM_000259chr1596010 4911 4846 4639 2482 1871 1468 651 301 ------
NM_000264chr943330 823 750 599 ------
NM_000267chr1763461 3288 3189 2747 2469 727 1159 171 --
NM_000276chrX52002 520 511 407 322 ------
NM_000278chr1032225 1703 877 11962 11990 --
NM_000280chr111686 ----1642
NM_000284chrX51932 1906 1869 268 52 ------
NM_000332chr6106615 6332 6287 6126 5917 4694 2853 2534 2137 497 22308 2298 ----
NM_000362chr2233628 1250 281 --12876 --
NM_000367chr642260 2177 1661 1432 ------
NM_000368chr964810 4119 3588 803 312 132 14068 12957 --
NM_000378chr112827 784 ------
NM_000379chr241269 1152 351 25 ------
NM_000394chr212430 80 ------
NM_000399chr101733 --1857 --
NM_000408chr222180 800 ------
NM_000421chr171315 ------
NM_000430chr1732521 1177 99 13530 ----
NM_000435chr192178 130 ------
NM_000449chr131317 1268 1043 ------
NM_000451chrX3587 424 312 ------
NM_000461chr384340 4327 4277 4132 3161 1118 987 194 13342 1131 --
NM_000462chr1521300 729 ------
NM_000484chr2121068 753 ------
NM_000489chrX2703 262 ------
NM_000533chrX22015 410 1765 ----
NM_000555chrX56972 5548 4830 2944 339 12309 ----
NM_000557chr20121 ------
NM_000587chr52979 161 ------
NM_000599chr234311 4273 3187 14591 ----
NM_000610chr1152294 2262 995 796 603 22606 688 ----
NM_000621chr1321323 1152 ------
NM_000633chr1855229 4449 3184 2107 177 ------
NM_000634chr231230 344 151 --11269 --
NM_000635chr1921586 1344 124 ----
NM_000719chr1276331 5196 4479 4335 2537 1991 112 --182 --
NM_000726chr211367 ------
NM_000793chr1454204 3590 3291 1140 561 13317 --1462
NM_000809chr457410 6930 6760 3222 631 ------
NM_000811chr51282 ------
NM_000813chr575295 5010 4624 1848 1629 1165 408 --25078 193 --
NM_000814chr1533173 2649 1311 13108 ----
NM_000826chr412403 ------
NM_000829chr111370 12253 ----
NM_000837chr82363 207 ------
NM_000838chr632612 546 330 ------
NM_000844chr31802 ------
NM_000868chrX21632 785 ------
NM_000872chr1051442 1320 1069 180 69 ------
NM_000875chr1565955 4915 4377 635 323 313 15173 12179 --
NM_000876chr631259 928 258 ------
NM_000891chr1743630 2844 1124 918 ------
NM_000901chr42563 251 ------
NM_000912chr8133 --121 --
NM_000917chr101874 ------
NM_000921chr121133 ------
NM_000944chr411602 ----12142
NM_000965chr321141 952 ------
NM_000983chr12196 73 ------
NM_000990chr1153122 403 387 141 46 13459 13349 --
NM_001001132chr2161374 1332 1287 1250 263 41 ------
NM_001001323chr1232937 818 161 ------
NM_001001331chr322477 2415 ------
NM_001001344chrX22376 281 --12059 --
NM_001001389chr1152294 2262 995 796 603 22606 688 ----
NM_001001390chr1152294 2262 995 796 603 22606 688 ----
NM_001001391chr1152294 2262 995 796 603 22606 688 ----
NM_001001392chr1152340 2308 1041 842 649 22652 734 ----
NM_001001433chr2053141 2455 1144 874 522 ------
NM_001001438chr213263 133 81 ------
NM_001001481chr883087 2928 2629 2430 1332 1090 329 299 ------
NM_001001523chr121327 996 1856 ----
NM_001001549chr722567 540 1855 11060 --
NM_001001550chr722567 540 1855 11060 --
NM_001001555chr722567 540 1855 11060 --
NM_001001664chr233785 3584 429 22858 1000 ----
NM_001001791chr1031706 1545 1473 --140 --
NM_001001936chr1041091 977 479 467 ------
NM_001001971chr1041285 514 231 70 ------
NM_001002032chr171594 ----170
NM_001002233chr821431 866 --11953 --
NM_001002243chr21298 ------
NM_001002838chrX31348 1277 1162 ------
NM_001002860chr1434290 4004 3200 14251 13451 --
NM_001002909chr1731579 1487 203 ------
NM_001003396chr6141 ----1481
NM_001003397chr6141 ----1481
NM_001003652chr1888332 8316 7918 7340 6293 3067 2363 759 35722 1095 609 ----
NM_001003674chr1865132 4684 4545 4374 2507 2439 24620 1150 14720 12749
NM_001003675chr1865132 4684 4545 4374 2507 2439 24620 1150 14720 12749
NM_001003679chr111550 1618 ----
NM_001003698chr621831 1235 --1583 --
NM_001003699chr621831 1235 --1583 --
NM_001003712chr121786 11258 ----
NM_001003792chr32416 187 ------
NM_001003793chr32416 187 ------
NM_001003800chr9103556 3284 2680 1487 1219 1105 819 801 398 216 ------
NM_001003940chr1572765 1535 1511 1245 1048 1011 336 1289 ----
NM_001003942chr1572765 1535 1511 1245 1048 1011 336 1289 ----
NM_001004342chr185603 4776 4760 4746 4202 4061 1875 668 --45759 1974 1601 961 --
NM_001004419chr1294313 4251 4091 3633 1506 1326 544 520 270 ------
NM_001005271chr171261 ------
NM_001005273chr171261 ------
NM_001005366chr122793 186 ------
NM_001005404chr1744423 1586 1081 642 23605 275 11734 --
NM_001005463chr1021028 840 ------
NM_001005473chr565929 5515 4998 4167 1545 316 26253 5005 ----
NM_001005474chr31539 ------
NM_001005505chr331799 1476 48 ------
NM_001005527chr331206 373 285 --1410 --
NM_001005611chrX----3512 451 121 --
NM_001005739chr21868 ------
NM_001005746chr211367 ------
NM_001005747chr211367 ------
NM_001005845chr82417 32 1191 ----
NM_001005849chr171398 ------
NM_001005910chr31497 ------
NM_001005911chr31497 ------
NM_001006115chr332587 1745 827 11895 ----
NM_001006610chr161767 ------
NM_001006617chr941315 1302 1110 335 --192 11074
NM_001006619chr941315 1302 1110 335 --192 11074
NM_001006620chr941315 1302 1110 335 --192 11074
NM_001006621chr941315 1302 1110 335 --192 11074
NM_001006656chr1941694 1497 1479 296 ------
NM_001006657chr252962 2737 888 598 497 ------
NM_001006932chr672691 2206 2082 1309 572 301 42 --1848 --
NM_001006938chrX3588 568 526 ------
NM_001007023chr1454204 3590 3291 1140 561 13317 --1462
NM_001007024chr1754360 3925 3751 2805 1720 ------
NM_001007025chr1754360 3925 3751 2805 1720 ------
NM_001007156chr1561640 1519 721 451 84 22 ------
NM_001007157chr71106 ------
NM_001007226chr1731297 1260 495 ------
NM_001007227chr1731297 1260 495 ------
NM_001007228chr1731297 1260 495 ------
NM_001007229chr1731297 1260 495 ------
NM_001007230chr1731297 1260 495 ------
NM_001007237chr132564 974 751 ------
NM_001007246chr211172 ------
NM_001007466chr654247 4067 1485 687 39 --21491 148 --
NM_001007538chr1311748 160 ----
NM_001007559chr1831723 1498 606 ------
NM_001008222chrX2460 257 ------
NM_001008239chr1863232 2740 659 557 504 462 ------
NM_001008392chr372878 2735 1343 1277 993 315 69 1803 ----
NM_001008397chr52693 128 ------
NM_001008408chr775778 5307 4858 1501 466 438 128 12430 ----
NM_001008660chr112453 372 ----11039
NM_001008701chr1932968 2495 1895 ------
NM_001008707chr1411386 ------
NM_001008708chr22566 491 ------
NM_001008925chr463437 3123 2188 654 600 240 --11041 --
NM_001009184chr82363 207 ------
NM_001009554chr4104576 4032 2908 1869 1713 1373 1064 525 507 51 ------
NM_001009554chr4104576 4032 2908 1869 1713 1373 1064 525 507 51 ------
NM_001009566chr161389 1062 528 521 221 58 ------
NM_001009571chr751555 1353 1171 1113 435 11737 172 --
NM_001009880chr2264333 4006 3586 1911 1250 858 ----14478
NM_001009894chr121575 ------
NM_001009899chr335862 1236 686 15351 ----
NM_001009993chr284361 4325 3658 3474 1600 1521 938 817 ------
NM_001010862chrX52951 2878 2826 2145 1102 ------
NM_001010867chr1116593 6272 5772 5469 5342 5099 2320 2313 1972 1899 73 11762 16247 --
NM_001010888chrX74178 4150 3308 3013 1297 1065 264 --13042 --
NM_001010895chr911446 ----1785
NM_001010897chr13----1392 --
NM_001010924chr104903 455 330 247 ------
NM_001010971chr1------123
NM_001011537chr322162 381 ------
NM_001011546chr201674 ------
NM_001011645chrX155 ------
NM_001011658chrX22105 201 ------
NM_001011666chr746092 4740 2099 54 11721 ----
NM_001011713chr141602 ------
NM_001012329chr151912 1742 1640 1574 1535 --12289 --
NM_001012393chr1154846 3586 2063 2041 886 ------
NM_001012512chr182207 94 ------
NM_001012513chr182218 105 ------
NM_001012642chr1532022 1870 738 --21760 321 --
NM_001012732chr4144 ------
NM_001012751chr1021606 707 ------
NM_001012755chrX43377 982 369 297 11096 ----
NM_001012756chr1952986 2441 2254 1005 110 ------
NM_001012968chrX42712 2420 813 317 --2928 61 --
NM_001013031chr1072620 2499 2146 1211 852 841 758 ------
NM_001013399chr62922 69 ------
NM_001013415chr421063 106 ------
NM_001013438chr31914 ------
NM_001013439chr31760 ------
NM_001013635chr1221184 285 --1880 --
NM_001013690chr1242044 1771 775 336 ------
NM_001014797chr1046511 6248 783 665 23029 2499 ----
NM_001014812chr15------1114
NM_001015048chr1443183 2478 929 239 --12471 --
NM_001015049chr1443183 2478 929 239 --12471 --
NM_001015053chr1761531 1513 533 275 265 211 --11595 --
NM_001015877chrX32326 705 570 ------
NM_001015882chr9------1868
NM_001015887chr321536 1481 ------
NM_001017368chr1752512 552 406 305 161 ------
NM_001017395chr373184 3074 2975 1359 1352 265 240 --11289 --
NM_001017423chr10140 ------
NM_001017440chr7187592 7447 6249 6238 6055 5908 5205 3178 3028 2820 2292 1612 1091 881 829 581 208 183 --11045 --
NM_001017926chr831628 1153 338 ------
NM_001017930chrX31426 1018 109 ----11440
NM_001017962chr101874 ------
NM_001017963chr143968 897 795 ------
NM_001017979chr41168 --1285 --
NM_001017995chr524305 3734 14245 24098 38 --
NM_001017999chr121957 1718 12293 ----
NM_001017999chr121957 1718 12293 ----
NM_001018000chr121957 1718 12293 ----
NM_001018000chr121957 1718 12293 ----
NM_001018001chr121957 1718 12293 ----
NM_001018050chr2283154 2762 2567 2401 2136 1281 351 333 ------
NM_001018052chr2283154 2762 2567 2401 2136 1281 351 333 ------
NM_001018057chr113925 903 176 ------
NM_001018065chr985442 5432 5301 4657 895 619 602 543 2426 245 11103 --
NM_001018066chr985442 5432 5301 4657 895 619 602 543 2426 245 11103 --
NM_001018091chr1582900 2693 2328 2182 961 667 97 52 ------
NM_001018108chr152885 725 1278 ----
NM_001018111chr743587 1434 1083 890 ------
NM_001020658chr121488 1274 ------
NM_001020658chr121488 1274 ------
NM_001023567chr15----21886 328 --
NM_001024218chr141563 1852 ----
NM_001024455chrX21033 967 32198 2178 837 ----
NM_001024463chr1531050 367 256 ------
NM_001024465chr6159 ------
NM_001024649chr522357 846 11839 ----
NM_001024660chr331216 1116 107 ------
NM_001024680chr221465 1408 ----11186
NM_001024934chr6146 165 ----
NM_001024935chr6146 165 ----
NM_001024936chr6146 165 ----
NM_001024948chr133487 3145 1247 13295 ----
NM_001025068chr321670 144 ------
NM_001025069chr321670 144 ------
NM_001025076chr1074690 4674 4421 3836 2217 2210 166 ------
NM_001025077chr1086048 6032 5779 5194 1524 1390 948 444 ------
NM_001025079chr363356 2524 841 736 658 600 12660 ----
NM_001025081chr1841326 474 280 30 ------
NM_001025090chr1841326 474 280 30 ------
NM_001025092chr1841326 474 280 30 ------
NM_001025101chr1841326 474 280 30 ------
NM_001025232chr121142 ------
NM_001025242chrX61208 1172 887 79 62 46 ----11330
NM_001025243chrX61208 1172 887 79 62 46 ----11330
NM_001025266chr384665 4396 3960 3557 1898 1274 372 359 14888 ----
NM_001025366chr63602 467 133 ------
NM_001025366chr63602 467 133 ------
NM_001025367chr63602 467 133 ------
NM_001025367chr63602 467 133 ------
NM_001025368chr63602 467 133 ------
NM_001025368chr63602 467 133 ------
NM_001025369chr63618 483 149 ------
NM_001025369chr63618 483 149 ------
NM_001025370chr63602 467 133 ------
NM_001025370chr63602 467 133 ------
NM_001025579chr1751126 825 476 294 44 ------
NM_001025580chrX63742 3486 3362 1386 590 318 ------
NM_001025596chr113388 207 37 ------
NM_001025603chr131317 1268 1043 ------
NM_001029875chr522234 551 ------
NM_001029955chr443330 3236 565 208 ----1643
NM_001029998chr431408 1349 1006 1526 ----
NM_001030006chr1762521 2237 2050 620 537 246 --12689 --
NM_001030007chr1633015 775 182 ------
NM_001030055chr1423977 3558 1988 ----
NM_001030272chr111423 ------
NM_001030273chr111423 ------
NM_001030287chr13874 87 34 ------
NM_001031628chr121413 ------
NM_001031690chr752390 1168 960 375 131 --12786 --
NM_001031695chr2285207 5092 4378 3591 1420 1294 618 487 --13565 --
NM_001031732chr443282 1177 1076 551 ------
NM_001031812chr511431 1476 ----
NM_001032280chr641493 1337 1109 583 ------
NM_001032282chr811275 ------
NM_001032288chr2021139 58 --1999 --
NM_001032730chr11683 ------
NM_001033025chr13507 237 201 --11163 --
NM_001033044chr1------1631
NM_001033047chr422347 322 1193 ----
NM_001033056chr1------1631
NM_001033059chr641501 638 564 379 ------
NM_001033087chr2042729 937 751 251 --22665 2038 --
NM_001033117chr354289 3962 3550 3129 893 14525 11260 --
NM_001033557chr22293 37 ------
NM_001033564chr631814 798 358 ------
NM_001033723chr842405 1988 1768 741 ------
NM_001033756chr63536 401 67 ------
NM_001033756chr63536 401 67 ------
NM_001033925chr1021342 163 ------
NM_001034025chr1221035 53 ------
NM_001034850chr521519 1301 ------
NM_001034853chrX1960 ------
NM_001034915chr821239 454 ------
NM_001034954chr1022503 786 ------
NM_001034955chr1022503 786 ------
NM_001034956chr1022503 786 ------
NM_001034957chr1022503 786 ------
NM_001035chr111195 1314 ----
NM_001035254chr952392 2107 958 660 558 ------
NM_001035260chr101211 ------
NM_001035511chr151765 1468 1356 790 27 1664 21481 1436 --
NM_001035512chr161872 1575 1463 897 134 94 1771 21588 1543 --
NM_001035513chr161872 1575 1463 897 134 94 1771 21588 1543 --
NM_001037131chr231004 847 60 ------
NM_001037174chr221899 613 --11770 --
NM_001037331chr181360 ----1913
NM_001037339chr11539 138 ----
NM_001037340chr11539 138 ----
NM_001037341chr11539 138 ----
NM_001037341chr11539 138 ----
NM_001037533chr11220 ----190
NM_001037535chrX31518 1471 1076 ------
NM_001037536chrX31518 1471 1076 ------
NM_001037540chrX31518 1471 1076 ------
NM_001037738chr51109 ------
NM_001037954chr1152988 2517 677 226 153 1806 ----
NM_001038493chr251476 1102 623 606 311 ------
NM_001038707chr142171 1712 681 292 189 ----
NM_001038707chr142171 1712 681 292 189 ----
NM_001039029chr1221856 150 ------
NM_001039199chr2044879 3335 710 98 ------
NM_001039348chr231035 913 231 ------
NM_001039349chr231035 913 231 ------
NM_001039479chr1461987 1588 1553 444 392 276 --12245 --
NM_001039538chr222679 921 ------
NM_001039574chr14934 683 282 110 ------
NM_001039577chr174389 3957 3870 1642 928 498 147 ----12883
NM_001039585chr133963 113 82 ------
NM_001039590chrX53323 2940 2877 2850 1523 ------
NM_001039591chrX53323 2940 2877 2850 1523 ------
NM_001039618chr1155292 3770 1586 1335 1260 ------
NM_001039762chr1041947 1678 194 123 ------
NM_001039772chr112151 62 ------
NM_001039840chrX55686 4604 4323 4265 128 14953 14150 11592
NM_001039916chr1251038 1011 116 82 52 193 ----
NM_001039917chr1251038 1011 116 82 52 193 ----
NM_001039918chr1251038 1011 116 82 52 193 ----
NM_001039919chr1251038 1011 116 82 52 193 ----
NM_001039920chr1251038 1011 116 82 52 193 ----
NM_001039937chr1393873 3581 3295 2912 2735 2703 2547 1021 1003 ------
NM_001040001chr672038 1551 1375 1323 1271 635 332 ------
NM_001040100chr32432 81 ------
NM_001040135chr72785 53 ------
NM_001040142chr22949 917 ------
NM_001040143chr22949 917 ------
NM_001040152chr761888 1792 1735 1165 853 770 1698 ----
NM_001040158chr51538 ------
NM_001040167chr721186 1150 ------
NM_001040181chr321008 964 ------
NM_001040182chr321008 964 ------
NM_001040183chr321008 964 ------
NM_001040199chr321008 964 ------
NM_001040200chr321008 964 ------
NM_001040214chr642311 1882 836 417 ------
NM_001040260chr431126 483 125 ------
NM_001040261chr431126 483 125 ------
NM_001040284chr1645607 4590 3692 26 14039 ----
NM_001040402chr441018 781 239 178 ------
NM_001040446chr541852 847 683 97 ------
NM_001040455chr1141046 482 370 288 --11146 --
NM_001040619chr141324 1182 537 484 ------
NM_001040624chr832323 2174 1859 ------
NM_001040625chr832323 2174 1859 ------
NM_001040626chr832323 2174 1859 ------
NM_001040627chr832323 2174 1859 ------
NM_001040628chr832323 2174 1859 ------
NM_001040629chr832323 2174 1859 ------
NM_001040630chr832323 2174 1859 ------
NM_001040653chr342522 2409 1925 239 1280 ----
NM_001040712chr923208 90 ----1496
NM_001042353chr203556 394 382 --1482 --
NM_001042355chr1664928 4872 4749 4237 820 366 ------
NM_001042388chr182845 272 ------
NM_001042404chr121591 123 ------
NM_001042412chr1664928 4872 4749 4237 820 366 ------
NM_001042413chr944069 3731 1584 610 ----11210
NM_001042425chr641493 1337 1109 583 ------
NM_001042476chr1651995 1766 1750 1633 651 12098 ----
NM_001042492chr1763461 3288 3189 2747 2469 727 1159 171 --
NM_001042493chr62410 158 ------
NM_001042494chr1563744 3491 1331 821 475 52 ------
NM_001042495chr1563744 3491 1331 821 475 52 ------
NM_001042496chr1563744 3491 1331 821 475 52 ------
NM_001042497chr1563744 3491 1331 821 475 52 ------
NM_001042510chr842003 1498 1405 225 ------
NM_001042511chr842003 1498 1405 225 ------
NM_001042533chr323067 2667 ----1640
NM_001042555chr1254286 4158 1893 1294 896 13380 ----
NM_001042599chr277698 6438 5763 5039 3095 963 78 --22338 1489 --
NM_001042601chr341305 821 697 220 ------
NM_001042603chr1263886 1823 1561 1541 1431 204 ------
NM_001042604chr324312 3617 ------
NM_001042632chr2052124 2010 1805 1665 252 12203 12215 --
NM_001042633chr2052124 2010 1805 1665 252 12203 12215 --
NM_001042681chr142615 2193 2085 922 1307 --12460
NM_001042682chr142615 2193 2085 922 1307 --12460
NM_001042682chr142615 2193 2085 922 1307 --12460
NM_001042762chr72935 42 ------
NM_001043318chr1463710 3472 3391 1378 1067 227 23217 1539 1695 --
NM_001044305chr6147 11533 ----
NM_001044385chr263649 3636 1614 1289 836 634 13710 --13933
NM_001044722chr511431 1476 ----
NM_001044723chr511431 1476 ----
NM_001046chr51462 ------
NM_001048183chr163770 3737 3375 3180 1136 569 33233 2893 2577 ----
NM_001068chr3257 49 ------
NM_001083620chr412401 ------
NM_001099678chr322112 1146 --12128 --
NM_001100108chr188327 7767 6922 2195 1748 903 833 142 ------
NM_001106chr3109677 8099 7398 7228 6785 6608 3660 3374 2198 315 ----18671
NM_001113490chrX33373 3053 614 ------
NM_001117chr1812072 ------
NM_001119chr441493 1343 982 204 --180 --
NM_001122631chr111555 ------
NM_001127chr223843 358 79 ------
NM_001128chr1633015 775 182 ------
NM_001146chr831994 1573 521 ------
NM_001148chr431497 739 186 11358 ----
NM_001160chr1232440 438 223 12467 ----
NM_001167chrX65934 1958 1786 1500 1206 773 ------
NM_001173chr1423977 3558 1988 ----
NM_001178chr111423 ------
NM_001198chr632095 2038 434 ------
NM_001205chr5--1415 ----
NM_001219chr731741 1553 1462 ------
NM_001221chr42101 30 ------
NM_001254chr173422 315 60 ------
NM_001256chr1732888 2780 1170 ------
NM_001259chr7105388 4446 1629 1310 1297 1023 733 605 576 124 ------
NM_001280chr193613 97 27 ------
NM_001282chr1762521 2237 2050 620 537 246 --12689 --
NM_001286chr152901 2866 822 538 505 ------
NM_001300chr103448 350 132 ------
NM_001304chr1723810 2371 ------
NM_001310chr1232445 700 462 ------
NM_001316chr202372 90 ------
NM_001331chr1172777 2647 2228 1900 1868 729 84 ------
NM_001364chr1144531 3371 3307 2985 ------
NM_001380chr103804 741 149 ------
NM_001386chr832012 1681 656 --11637 --
NM_001387chr552900 2621 2514 2210 2121 12445 ----
NM_001389chr212476 464 ------
NM_001390chr1833308 2673 232 --1644 --
NM_001396chr2142646 1133 915 493 ------
NM_001412chrX33375 3046 341 ------
NM_001418chr111262 1524 ----
NM_001418chr111262 1524 ----
NM_001419chr1974433 3100 1785 1316 1087 934 922 13353 ----
NM_001420chr1962509 2494 2224 2149 1229 1192 ------
NM_001423chr1211991 ------
NM_001424chr161732 ------
NM_001427chr711603 --1571 --
NM_001438chr133142 2999 851 ------
NM_001439chr13507 237 201 --11163 --
NM_001448chrX31519 1450 1443 ------
NM_001449chrX3116 98 57 ------
NM_001478chr126900 817 662 341 241 46 ------
NM_001523chr193252 92 34 ------
NM_001542chr132564 974 751 ------
NM_001546chr611192 ------
NM_001567chr113730 657 587 ------
NM_001569chrX61208 1172 887 79 62 46 ----11330
NM_001584chr1131062 1011 984 ------
NM_001587chrX52002 520 511 407 322 ------
NM_001604chr111686 ----1642
NM_001614chr17--1610 --1131
NM_001614chr17--1610 --1131
NM_001629chr132254 30 ------
NM_001634chr641501 638 564 379 ------
NM_001635chr71874 ------
NM_001643chr1121 ------
NM_001650chr1873846 3166 1622 1520 1357 1086 47 ------
NM_001660chr32644 203 ------
NM_001663chr1441959 1757 700 332 ------
NM_001674chr13874 87 34 ------
NM_001679chr33275 167 47 ------
NM_001682chr1222651 532 ------
NM_001683chr322477 2415 ------
NM_001695chr833375 1538 868 --133 --
NM_001701chr931065 1013 258 11168 ----
NM_001709chr1132703 425 336 1230 ----
NM_001716chr1161598 1419 1362 1312 251 35 ------
NM_001717chr1541477 983 610 577 ------
NM_001744chr52189 55 ------
NM_001745chr521175 1087 ------
NM_001746chr522357 846 11839 ----
NM_001759chr1264633 3833 3211 1853 1087 604 13742 --14788
NM_001768chr241060 280 87 64 ------
NM_001773chr131323 585 548 --11408 --
NM_001777chr363356 2524 841 736 658 600 12660 ----
NM_001781chr122642 89 ------
NM_001794chr203242 105 81 ------
NM_001829chr41616 ----1341
NM_001839chr1287 33 ------
NM_001854chr111499 ------
NM_001858chr645007 1201 410 41 ------
NM_001894chr22139 --1777 --
NM_001895chr2011203 158 ----
NM_001907chr16176 ------
NM_001921chr4144 ------
NM_001923chr112612 81 ------
NM_001933chr1431338 1152 54 ------
NM_001935chr23924 356 178 --1861 --
NM_001941chr1843810 3748 1172 1099 ------
NM_001946chr122388 21 ------
NM_001949chr633197 1137 306 ------
NM_001964chr53921 130 116 ------
NM_001981chr122319 2157 ------
NM_001987chr1263922 3274 2952 1585 1315 648 ------
NM_002006chr414633 1816 1619 --
NM_002015chr1332392 1259 1176 13064 ----
NM_002024chrX21435 411 ------
NM_002025chrX99152 8868 8330 7875 6334 3054 795 776 98 ------
NM_002028chr142464 122 11315 ----
NM_002037chr61361 ------
NM_002040chr2132939 2195 1025 12874 ----
NM_002065chr1------1631
NM_002076chr1252844 2704 260 161 84 ------
NM_002080chr163348 231 41 ------
NM_002081chr241700 1450 642 203 --21762 1104 --
NM_002084chr53663 578 342 ------
NM_002086chr1742067 1788 1389 438 ------
NM_002089chr41144 ------
NM_002091chr182207 94 ------
NM_002092chr443792 1470 1265 1167 ------
NM_002101chr2----1326 1428
NM_002107chr11479 ------
NM_002126chr1733267 579 532 ------
NM_002136chr12----1479 --
NM_002137chr721953 1810 ------
NM_002139chrX3580 468 446 ------
NM_002146chr171179 ------
NM_002148chr21657 --1567 --
NM_002167chr12354 343 ------
NM_002188chr52696 160 ------
NM_002227chr12266 43 ------
NM_002228chr11880 ------
NM_002241chr121907 666 ------
NM_002249chr11416 ------
NM_002253chr431209 203 153 ------
NM_002254chr242120 1743 1568 164 ------
NM_002264chr384229 3428 1839 1590 1441 983 76 56 ------
NM_002270chr565436 4389 4251 4114 1641 41 ------
NM_002271chr1331519 796 299 11939 ----
NM_002298chr1321448 285 1239 1560 --
NM_002334chr1131797 1322 103 --160 --
NM_002336chr1234837 1421 1046 ------
NM_002355chr1221055 995 ------
NM_002359chr1743043 2888 1612 1078 --12682 --
NM_002374chr222679 921 ------
NM_002375chr352057 1701 848 774 24 12244 1214 --
NM_002385chr1841326 474 280 30 ------
NM_002390chr1731733 366 102 11288 ----
NM_002395chr631525 1037 240 ------
NM_002408chr14129 ------
NM_002430chr2282560 2195 1762 1593 983 843 721 354 --11791 --
NM_002444chrX61681 1662 1438 754 390 42 ------
NM_002480chr122527 92 ------
NM_002499chr1532315 912 455 --1447 --
NM_002501chr1963454 3008 1447 1172 1149 230 182 11585 --
NM_002507chr1721913 1240 ------
NM_002508chr131952 1632 85 31985 1683 418 ----
NM_002515chr1451840 1627 688 606 210 ------
NM_002519chr1131387 1218 1070 ------
NM_002522chr1743298 1375 1097 151 ------
NM_002524chr12178 102 ------
NM_002545chr1154846 3586 2063 2041 886 ------
NM_002547chrX23217 208 --13184 --
NM_002576chr1141121 290 143 92 ------
NM_002577chr363949 3792 3503 3084 2881 791 ------
NM_002581chr955553 5207 1338 565 459 ------
NM_002588chr541685 1376 1273 668 11771 --11588
NM_002595chr1231750 214 118 ------
NM_002599chr113462 327 158 ------
NM_002600chr11539 138 ----
NM_002607chr72246 128 ------
NM_002613chr1645381 3622 1858 1353 ------
NM_002628chr32384 34 ------
NM_002636chr6142 --1156 --
NM_002646chr142180 1737 796 82 --1582 --
NM_002655chr843912 2017 1236 800 ------
NM_002657chr2083238 3195 2530 2490 2468 1511 1143 515 ------
NM_002668chrX2339 147 ------
NM_002687chr142497 74 --1405 --
NM_002705chr16378 67 22 ------
NM_002713chr11187 ------
NM_002716chr11103696 3531 3398 3273 3110 2627 2278 2234 461 192 --1895 --
NM_002718chr342325 1878 1863 305 --169 --
NM_002719chr1431494 520 315 11869 31558 469 222 --
NM_002731chr132572 1275 917 1685 180 --
NM_002738chr163239 150 24 ------
NM_002745chr22104108 4021 3998 3481 3207 2847 2759 1546 1145 580 14074 ----
NM_002747chr1841799 745 694 506 ------
NM_002750chr10152 ------
NM_002806chr141372 ------
NM_002809chr171371 ------
NM_002814chrX1287 ------
NM_002819chr1931487 1105 329 ------
NM_002827chr2031698 1483 1268 ------
NM_002836chr202358 179 ------
NM_002839chr923208 90 ----1496
NM_002847chr72546 83 ------
NM_002850chr1941008 941 768 358 ------
NM_002854chr22125 ------
NM_002858chr13555 419 236 ------
NM_002859chr123530 171 120 ------
NM_002860chr10140 ------
NM_002866chr19137 ------
NM_002868chr1242071 1751 1658 804 ------
NM_002869chr1142066 594 384 189 ------
NM_002874chr912355 --12098 --
NM_002892chr141605 --11103 --
NM_002895chr203905 838 67 1856 ----
NM_002902chr151678 ------
NM_002924chr11518 --1483 --
NM_002938chr451771 1301 778 749 54 ------
NM_002941chr311667 ------
NM_002955chr621831 1235 --1583 --
NM_002959chr174145 4067 3950 3195 1583 953 249 13130 ----
NM_002968chr162238 71 ------
NM_002970chrX1269 ------
NM_002971chr321018 72 ------
NM_003001chr161872 1575 1463 897 134 94 1771 21588 1543 --
NM_003009chr191263 --1113 --
NM_003011chr931288 625 152 ------
NM_003026chr921126 269 ------
NM_003028chr953781 3207 2501 1493 363 1238 --12980
NM_003030chr311819 1561 ----
NM_003031chr161767 ------
NM_003043chr374139 3849 3811 2868 2801 906 420 ------
NM_003045chr1341373 962 551 182 14200 ----
NM_003060chr541199 879 112 81 ------
NM_003071chr341901 1623 1375 99 --1426 --
NM_003076chr1231654 1413 334 ------
NM_003077chr172683 158 --162 --
NM_003081chr203389 272 176 1238 ----
NM_003091chr202243 232 ------
NM_003099chr1565940 5687 2124 1305 794 57 16213 --14259
NM_003100chr51455 ------
NM_003108chr297027 5027 2857 2152 1999 1135 674 258 53 46313 5686 1370 867 ----
NM_003113chr21165 ------
NM_003131chr682114 792 664 521 408 368 248 188 ------
NM_003137chr63746 732 505 ----11436
NM_003139chr11195 --1609 --
NM_003150chr1752165 1879 1502 918 232 ------
NM_003155chr822392 909 ------
NM_003156chr113164 157 37 ------
NM_003161chr1731260 951 238 ------
NM_003173chrX31376 1238 1199 ------
NM_003182chr71491 ------
NM_003182chr71491 ------
NM_003204chr1751737 1283 1164 607 228 ------
NM_003216chr2273134 2912 2815 2338 637 508 412 ------
NM_003220chr641493 1337 1109 583 ------
NM_003221chr653519 2953 2779 594 202 ------
NM_003223chr16----1761 --
NM_003234chr342430 1694 860 559 ------
NM_003236chr273157 2396 2149 1293 1020 777 326 ------
NM_003244chr182142 25 ------
NM_003262chr333604 1233 150 ----1443
NM_003274chr2141198 963 911 337 ------
NM_003290chr1921020 95 ------
NM_003298chr336099 4919 795 12205 1378 --
NM_003300chr14167 --180 --
NM_003309chr631880 1748 147 ------
NM_003336chrX2404 131 ------
NM_003337chr52550 126 ------
NM_003338chr1011951 ------
NM_003339chr521403 64 ------
NM_003340chr41296 ------
NM_003342chr173974 687 593 --12808 --
NM_003347chr2242268 2171 1738 597 --1870 --
NM_003348chr1241579 1291 1208 128 ------
NM_003349chr2021139 58 --1999 --
NM_003374chr52774 197 ------
NM_003376chr63602 467 133 ------
NM_003376chr63602 467 133 ------
NM_003379chr621081 215 1228 ----
NM_003390chr113918 800 202 192 ----
NM_003392chr333611 1543 931 ------
NM_003404chr2031371 1360 590 ------
NM_003405chr222535 64 --1686 --
NM_003430chr192326 242 ------
NM_003458chr393961 3930 3535 3405 3304 3049 2800 2556 833 ------
NM_003463chr621358 686 ------
NM_003466chr262344 1758 1715 693 545 196 ------
NM_003468chr223017 171 ------
NM_003470chr163539 532 94 --11534 --
NM_003474chr1031465 789 781 ------
NM_003478chr1123043 2737 ------
NM_003482chr1242600 2486 1776 574 --12673 --
NM_003483chr1222796 1183 ------
NM_003558chr91725 ------
NM_003559chr1773199 3048 2507 1290 840 776 484 ------
NM_003563chr1731297 1260 495 ------
NM_003566chr1222304 858 13187 ----
NM_003574chr1885330 3715 3492 2050 1773 940 438 249 ------
NM_003583chr1231203 1042 848 12875 ----
NM_003600chr202580 298 127 ----
NM_003601chr4161 ------
NM_003602chr73438 376 42 --2444 285 --
NM_003603chr42450 387 ------
NM_003607chr134084 3882 749 ------
NM_003615chr333718 2888 816 ------
NM_003618chr22893 102 ------
NM_003620chr172806 775 ------
NM_003629chr172985 2940 2816 2185 813 182 28 ------
NM_003630chr61129 ------
NM_003633chr51718 --1259 --
NM_003644chr17105794 4443 4351 4000 2063 2024 1054 819 752 597 --35203 4720 294 --
NM_003651chr121487 ------
NM_003654chr112114 107 ------
NM_003657chr20251 30 --1841 --
NM_003663chr332546 1109 340 ------
NM_003671chr943089 920 745 554 ------
NM_003677chr1221498 881 --31979 287 281 --
NM_003679chr1--22536 1122 ----
NM_003688chrX1213 ------
NM_003701chr131704 ------
NM_003716chr32701 55 ------
NM_003722chr332663 2097 764 12293 --11992
NM_003735chr541685 1376 1273 668 11771 --11588
NM_003736chr541685 1376 1273 668 11771 --11588
NM_003749chr1322312 1593 1837 1549 --
NM_003758chr1541274 1082 1016 1007 1376 ----
NM_003758chr1541274 1082 1016 1007 1376 ----
NM_003759chr443369 427 375 41 13056 ----
NM_003760chr1199 --169 --
NM_003762chr111227 1962 ----
NM_003763chr2053141 2455 1144 874 522 ------
NM_003783chr11278 ------
NM_003787chr18------1139
NM_003797chr111170 ------
NM_003800chr631585 777 763 ------
NM_003816chr82546 31 ------
NM_003827chr19130 --1197 --
NM_003829chr91103 ------
NM_003861chr1452332 2056 1086 860 377 ------
NM_003870chr1521944 68 12011 ----
NM_003872chr252365 2001 1022 537 241 12667 ----
NM_003873chr1032090 743 721 ------
NM_003877chr12------1858
NM_003887chr242256 1943 348 111 1448 ----
NM_003888chr153398 372 102 ------
NM_003895chr2132065 302 276 ------
NM_003908chr2031097 1061 313 --1141 --
NM_003913chr664049 3716 2843 1322 1249 901 ------
NM_003916chrX21427 1125 ------
NM_003930chr722032 96 ------
NM_003931chr6146 165 ----
NM_003941chr722250 1910 12033 ----
NM_003948chr432705 2518 975 ------
NM_003987chr1032225 1703 877 11962 11990 --
NM_003988chr1032302 1780 954 12039 12067 --
NM_003989chr1032161 1639 813 11898 11926 --
NM_003990chr1032161 1639 813 11898 11926 --
NM_003996chr6251 26 ------
NM_004024chr141233 1091 446 393 ------
NM_004028chr1873846 3166 1622 1520 1357 1086 47 ------
NM_004050chr1442333 763 584 418 --11810 --
NM_004055chr117662 654 438 230 209 193 97 11795 ----
NM_004063chr81121 1653 ----
NM_004087chr331517 1346 458 --11327 --
NM_004093chr1332122 491 133 1273 ----
NM_004098chr1021190 805 ------
NM_004103chr8285 31 ------
NM_004105chr231035 913 231 ------
NM_004112chr1731256 1240 433 ------
NM_004114chrX2926 74 ------
NM_004124chr1443455 2779 2321 2278 ------
NM_004130chr32645 546 ------
NM_004134chr52650 442 1639 ----
NM_004136chr1522360 2189 ------
NM_004161chr23462 347 251 ------
NM_004162chr3132 ------
NM_004171chr11148883 8768 8502 7813 7743 6212 6183 2775 2507 1695 1178 1165 1004 417 19201 ----
NM_004227chr722510 1954 22379 243 ----
NM_004230chr1942091 1539 1515 450 ------
NM_004232chr181301 11320 ----
NM_004235chr93750 579 71 ------
NM_004263chr261722 1638 1606 1347 147 106 --1408 --
NM_004274chr1443138 543 258 215 ------
NM_004279chr751987 1898 878 699 178 ------
NM_004296chr1433969 3029 830 ------
NM_004302chr1232791 2287 2186 ------
NM_004311chr1052955 2763 2478 1219 800 ------
NM_004319chr142560 2550 177 144 ------
NM_004321chr242485 1238 1225 56 12706 ----
NM_004323chr992571 2265 2038 667 650 617 560 359 142 ------
NM_004326chr151034 923 341 324 29 --1953 --
NM_004338chr1865132 4684 4545 4374 2507 2439 24620 1150 14720 12749
NM_004379chr221242 594 1360 1618 --
NM_004384chr511431 1476 ----
NM_004386chr1941894 1816 894 224 11463 ----
NM_004392chr1331642 424 90 ------
NM_004393chr33836 256 164 ------
NM_004397chr111569 ------
NM_004414chr2141432 633 500 84 ------
NM_004420chr1142197 2087 1811 611 ----1184
NM_004430chr842255 2187 1042 695 ------
NM_004434chr1411386 ------
NM_004436chr1------1579
NM_004437chr142396 1405 1111 362 ------
NM_004438chr211062 --192 --
NM_004441chr321292 1207 ------
NM_004444chr71571 --1593 --
NM_004450chr144402 366 277 252 ------
NM_004454chr331548 885 586 ------
NM_004457chr21605 ------
NM_004458chrX21941 378 12284 ----
NM_004459chr1711789 ------
NM_004468chr12540 418 ----1403
NM_004481chr172480 2468 2453 2289 1815 1728 527 12625 ----
NM_004482chr22752 656 ------
NM_004494chr12807 238 ------
NM_004500chr144740 647 128 118 11385 ----
NM_004501chr141624 1360 1082 440 13896 ----
NM_004503chr121211 --1233 1825
NM_004505chr1731465 357 52 ------
NM_004514chr1772879 2796 2585 1926 805 435 269 ------
NM_004520chr53537 261 120 ------
NM_004543chr22326 89 ------
NM_004569chr142197 32 ------
NM_004575chr431460 1197 37 ------
NM_004576chr5177 ------
NM_004580chr1531623 1226 410 11684 ----
NM_004586chrX44682 4295 4016 161 --1869 --
NM_004598chr552786 2579 1104 940 816 ------
NM_004600chr131373 1331 1081 ------
NM_004606chrX4355 266 40 21 ------
NM_004612chr944575 1611 1520 189 1445 ----
NM_004630chr1141102 938 249 240 1904 ----
NM_004660chrY12147 ----11568
NM_004667chr151221 ----1110
NM_004686chr82569 311 ------
NM_004687chr1761737 1345 810 181 133 78 ------
NM_004703chr1742547 2154 1709 283 ------
NM_004709chrX31761 1437 178 ------
NM_004717chr711400 11212 ----
NM_004723chr11137 --1118 1355
NM_004726chrX85384 5329 4469 4001 1085 1057 733 293 ------
NM_004730chr532002 1609 1519 ------
NM_004731chr121282 ------
NM_004742chr311255 ----11761
NM_004744chr421576 328 --13839 --
NM_004745chr8166852 6220 5522 4952 4903 4396 2615 1557 1478 1415 1365 1153 794 639 575 289 22246 1886 1109 --
NM_004769chr7176 ------
NM_004772chr541352 586 507 279 --11160 --
NM_004774chr1742824 2159 1026 213 22887 431 ----
NM_004779chr52489 214 1513 ----
NM_004788chr1142041 1719 1062 472 ------
NM_004795chr1321721 208 21900 1871 ----
NM_004798chr2033130 1263 847 13508 ----
NM_004800chr132230 175 ------
NM_004801chr22455 41 ------
NM_004821chr51187 1512 ----
NM_004834chr252685 326 139 67 40 ----11248
NM_004836chr21100 ------
NM_004845chrX53725 1117 1095 321 158 --11202 --
NM_004866chr534006 1725 154 ------
NM_004871chr1754360 3925 3751 2805 1720 ------
NM_004873chr1443183 2478 929 239 --12471 --
NM_004893chr51538 ------
NM_004896chr102620 126 ------
NM_004898chr432610 2413 1956 ------
NM_004904chr746092 4740 2099 54 11721 ----
NM_004921chr11243 ----21624 941
NM_004932chr521587 278 11335 ----
NM_004952chr11776 ------
NM_004961chrX3550 543 196 ------
NM_004969chr10149 ------
NM_004973chr621161 491 ------
NM_004976chr11124825 4761 4714 4448 3881 3604 3471 1480 844 564 489 397 --13633 --
NM_004978chr151597 1346 1232 651 59 ----11303
NM_004985chr1233388 1784 1338 12798 ----
NM_004992chrX97087 7074 5700 2607 2293 2010 1377 993 760 17525 ----
NM_004992chrX97087 7074 5700 2607 2293 2010 1377 993 760 17525 ----
NM_004999chr642845 1370 1012 312 ------
NM_005028chr1032036 1563 117 12326 ----
NM_005030chr162272 266 ------
NM_005045chr73849 730 205 ------
NM_005056chr1264130 2067 1805 1785 1675 448 ------
NM_005060chr121327 996 1856 ----
NM_005067chr32798 89 ------
NM_005087chr31760 ------
NM_005096chrX1203 ------
NM_005105chr131534 807 27 ------
NM_005110chr53735 642 556 ------
NM_005116chr20114148 4097 1570 984 969 671 407 305 266 210 55 14318 12847 --
NM_005121chr1723003 1455 ------
NM_005134chr182845 272 ------
NM_005135chr1563744 3491 1331 821 475 52 ------
NM_005156chr921424 956 ------
NM_005157chr931954 1888 714 ----1226
NM_005184chr193244 51 33 ------
NM_005187chr1641305 1291 522 370 ------
NM_005188chr11177927 7794 7285 6896 5928 5774 5658 5436 3075 2841 2781 1916 1738 1682 1176 583 226 --25472 401 --
NM_005190chr62922 69 ------
NM_005197chr1476194 6096 4982 4568 1733 903 755 ----1618
NM_005207chr2223565 289 ------
NM_005222chr71959 ------
NM_005227chr12456 43 ------
NM_005235chr277698 6438 5763 5039 3095 963 78 --22338 1489 --
NM_005241chr31457 1187 ----
NM_005256chr111945 ------
NM_005257chr1831285 1155 113 ------
NM_005276chr1241184 623 606 109 ------
NM_005276chr1241184 623 606 109 ------
NM_005277chr411328 1642 ----
NM_005311chr722567 540 1855 11060 --
NM_005312chr952493 2478 2440 974 825 11846 ----
NM_005324chr1741457 695 650 319 ------
NM_005329chr1642176 1574 1496 383 ------
NM_005339chr413841 --1573 --
NM_005342chrX41927 447 265 24 --12144 --
NM_005347chr911648 ------
NM_005348chr143968 897 795 ------
NM_005349chr42546 482 ------
NM_005359chr1846027 4984 1680 396 ------
NM_005374chr1772428 2261 2096 1803 1479 655 386 --32187 1555 116 1882
NM_005375chr61162 1392 ----
NM_005380chr121299 227 ------
NM_005392chr931725 1363 348 ------
NM_005397chr743587 1434 1083 890 ------
NM_005399chr174241 3478 3364 3269 1315 485 368 1963 12725 --
NM_005400chr252760 2507 2107 1961 102 ------
NM_005402chr721563 387 ------
NM_005409chr41196 ------
NM_005433chr1852665 2509 2165 907 688 ------
NM_005445chr101124 ------
NM_005458chr952418 2233 2160 246 206 --1798 --
NM_005474chr1761531 1513 533 275 265 211 --11595 --
NM_005475chr1272240 2147 1204 777 742 431 338 ------
NM_005497chr1754800 4785 1516 402 241 15324 15122 --
NM_005503chr151259 ------
NM_005512chr1151678 1477 1265 1257 556 ------
NM_005513chr331466 205 120 ------
NM_005522chr7140 ----1394
NM_005544chr22913 688 ------
NM_005561chr132914 854 --1757 --
NM_005562chr151708 1458 552 491 185 ------
NM_005574chr11164 ------
NM_005595chr11875 1367 ----
NM_005596chr996051 5835 4476 4107 3945 2007 1106 925 810 ------
NM_005599chr141361 1188 335 153 ------
NM_005603chr1821494 142 ------
NM_005604chr61708 --154 --
NM_005607chr84880 869 87 47 ------
NM_005610chr1--1797 --1834
NM_005634chrX2625 455 ------
NM_005637chr1831723 1498 606 ------
NM_005639chr1261906 1850 1593 1276 179 82 ------
NM_005642chr5299 28 ------
NM_005655chr811275 ------
NM_005664chr151184 ------
NM_005665chr121902 426 ----13719
NM_005708chr131377 ------
NM_005717chr131083 933 164 ------
NM_005725chr11667 ------
NM_005736chr1021357 638 ------
NM_005746chr711866 ------
NM_005754chr521186 270 ------
NM_005756chrX31377 533 104 ------
NM_005759chr264699 4403 3928 3481 1893 45 ------
NM_005766chr1311001 ----11123
NM_005768chr121151 ------
NM_005786chr182891 885 ------
NM_005789chr1752078 1776 1418 1336 791 ------
NM_005802chr91256 ------
NM_005808chr372878 2735 1343 1277 993 315 69 1803 ----
NM_005813chr221927 302 11644 ----
NM_005822chr651768 450 370 274 121 12200 ----
NM_005828chr17104700 4454 4223 1965 1677 1610 1600 1506 1099 558 ------
NM_005840chrX57391 5607 2405 1575 1076 12599 15896 26253 5546
NM_005841chr42929 872 ------
NM_005850chr13221 82 54 ------
NM_005852chr171261 ------
NM_005863chr1041002 493 191 69 ------
NM_005871chr1011019 ------
NM_005885chr551416 1390 166 127 43 1228 ----
NM_005898chr1133089 863 91 ------
NM_005901chr1888332 8316 7918 7340 6293 3067 2363 759 35722 1095 609 ----
NM_005906chr611067 158 ----
NM_005909chr542911 2844 2679 1266 ------
NM_005910chr1764010 3792 1122 1010 634 107 --23244 692 --
NM_005911chr221457 99 --1367 --
NM_005920chr183485 3049 2897 1234 1198 1142 940 195 --11037 13828
NM_005923chr6--123 ----
NM_005928chr152219 26 ------
NM_005933chr1152518 2354 2133 1969 742 ------
NM_005934chr1982155 2117 1705 962 821 544 478 148 --1121 --
NM_005935chr465216 4388 4139 3389 1931 1237 ----11133
NM_005941chr863654 1486 1311 742 730 220 ------
NM_005955chr174989 4939 4930 4091 1629 1491 814 --1752 --
NM_005966chr22950 23 ------
NM_005990chr562750 2584 2418 2082 542 332 1244 ----
NM_006007chr943970 2885 2747 99 ------
NM_006011chr1544211 4077 3363 3327 13667 ----
NM_006015chr12911 207 --21047 363 --
NM_006022chr1331028 889 345 ------
NM_006030chr331799 1476 48 ------
NM_006033chr1852278 1716 497 426 163 ------
NM_006037chr233090 995 24 --13104 --
NM_006038chr2042218 1457 1402 862 ------
NM_006041chr174473 350 333 206 ------
NM_006047chr2041146 886 749 463 --21273 540 --
NM_006051chr53231 214 123 193 1222 --
NM_006055chr233213 2985 2861 ------
NM_006062chr231256 936 450 ------
NM_006079chr62703 46 ------
NM_006080chr71606 ------
NM_006089chrX21864 1817 ------
NM_006091chr1541770 1441 1250 583 ------
NM_006095chr454500 3842 3184 2847 1656 11582 ----
NM_006106chr1133198 2628 156 --12683 --
NM_006135chr141410 1250 571 180 ------
NM_006153chr32576 206 ------
NM_006158chr821583 357 ------
NM_006166chr1242549 1660 1055 883 ------
NM_006176chr112685 287 ------
NM_006191chr122717 276 ------
NM_006195chr921396 517 ------
NM_006197chr84632 455 235 33 ------
NM_006202chr193617 408 94 ------
NM_006203chr554004 3831 1959 1652 503 25121 1668 ----
NM_006206chr422553 1000 ------
NM_006223chrX1127 ------
NM_006226chr211169 1359 ----
NM_006237chr1322117 131 ------
NM_006242chr2041595 322 163 112 1441 ----
NM_006246chr1431071 268 238 ------
NM_006251chr5--13352 ----
NM_006267chr221175 752 ------
NM_006275chr2042192 2180 1907 848 ------
NM_006282chr2074766 4713 4247 4225 2962 1721 1228 23791 3579 12953 11412
NM_006306chrX25913 4708 11520 ----
NM_006310chr17198 11280 ----
NM_006313chr12--1499 ----
NM_006330chr82570 78 ------
NM_006345chr411386 ------
NM_006353chr631376 1211 135 ------
NM_006372chr61327 ------
NM_006375chrX2507 441 ------
NM_006379chr73813 199 49 ------
NM_006386chr2242438 1593 546 79 ------
NM_006420chr2033343 3125 1180 3897 764 348 ----
NM_006421chr82263 253 ------
NM_006434chr1022503 786 ------
NM_006451chr51342 ------
NM_006454chr463075 2674 551 274 64 21 --21212 927 --
NM_006458chr111408 ------
NM_006459chr1021646 22 ------
NM_006465chr1542267 1696 830 577 ----12319
NM_006469chr121132 617 ------
NM_006480chr5------1482
NM_006482chr1231203 1042 848 12875 ----
NM_006489chr1451840 1627 688 606 210 ------
NM_006496chr121238 689 ------
NM_006509chr191378 ------
NM_006526chr2021415 719 21485 756 ----
NM_006532chr1952026 1989 1771 591 431 --1820 --
NM_006544chr1445686 2132 1270 1057 ------
NM_006546chr1786196 5936 5371 5122 4865 4378 2511 883 --25453 5036 --
NM_006547chr721681 469 11419 ----
NM_006548chr311488 ------
NM_006557chr921766 1102 ------
NM_006559chr131242 1133 120 --11147 --
NM_006560chr113388 207 37 ------
NM_006561chr1074690 4674 4421 3836 2217 2210 166 ------
NM_006565chr161357 ------
NM_006572chr1743129 2981 2652 351 ------
NM_006591chr112500 455 ------
NM_006593chr22582 93 ------
NM_006595chr1111452 ------
NM_006599chr16128151 7964 7144 7064 6983 6835 6197 6183 5263 1520 1069 670 12244 ----
NM_006609chr211927 ----12338
NM_006618chr131382 1151 1060 ------
NM_006621chr142016 1699 1641 673 ------
NM_006622chr51486 1221 ----
NM_006624chr1021605 1434 ------
NM_006628chr1534218 3539 2884 ------
NM_006646chr1342183 2058 1139 401 ------
NM_006654chr1254286 4158 1893 1294 896 13380 ----
NM_006670chr62160 143 ------
NM_006690chr2041654 928 595 485 ------
NM_006694chr11257 ------
NM_006698chr2041292 1142 565 375 ------
NM_006699chr152604 2287 1972 1820 850 ------
NM_006700chr124782 630 577 37 ------
NM_006708chr631082 1007 990 ----1209
NM_006717chr943304 3128 3064 2442 --13201 --
NM_006722chr331954 775 357 ------
NM_006729chrX74884 4851 4822 4786 3654 3610 1865 ------
NM_006732chr1952059 819 658 412 178 1664 ----
NM_006738chr1553460 2900 1830 1787 120 14560 13669 --
NM_006746chrX31518 1471 1076 ------
NM_006769chr1172 ------
NM_006775chr632524 353 175 ------
NM_006777chrX32332 2261 910 ------
NM_006788chr183511 475 110 ------
NM_006795chr1141576 1448 1159 113 --11504 --
NM_006801chr193693 571 27 ------
NM_006815chr1231026 436 236 ------
NM_006818chr1293 43 ------
NM_006825chr123854 718 187 --1775 --
NM_006826chr21421 1164 ----
NM_006827chr1442259 2252 825 446 ------
NM_006846chr5190 ------
NM_006851chr1222611 647 1940 ----
NM_006854chr751957 1563 1437 545 31 1389 ----
NM_006870chr201674 ------
NM_006884chr311819 1561 ----
NM_006885chr1653056 2756 2696 1368 256 ------
NM_006888chr1442712 1309 1222 547 ------
NM_006898chr23752 680 186 ------
NM_006908chr721003 448 11515 ----
NM_006924chr1753528 2847 1732 1442 869 ------
NM_006936chr2151296 1209 1103 976 34 ------
NM_006937chr171398 ------
NM_006940chr1231584 1244 638 ------
NM_006947chr421547 1180 --11202 --
NM_006950chrX4882 212 189 110 --1804 --
NM_006981chr932639 2427 95 ------
NM_006999chr531652 592 144 ----11700
NM_007007chr1233544 539 43 ------
NM_007010chr1741609 1486 1296 743 ------
NM_007011chr1566810 6227 5882 1395 821 407 --12668 16795
NM_007017chr52170 58 ------
NM_007034chr12838 749 ------
NM_007038chr2135202 3846 836 ------
NM_007054chr523628 703 ------
NM_007064chr331216 1116 107 ------
NM_007067chr1761587 1309 1168 344 316 303 ------
NM_007073chr643650 1681 1130 233 ------
NM_007114chr312778 1251 ----
NM_007124chr641833 1765 1440 102 ------
NM_007146chr1722445 2212 ------
NM_007153chr1944337 370 116 32 ------
NM_007166chr112453 372 ----11039
NM_007173chr11136 11895 ----
NM_007174chr1241553 926 594 184 ------
NM_007175chr84827 618 386 102 ------
NM_007195chr1863619 3475 3231 2595 1496 892 12490 ----
NM_007200chr1553460 2900 1830 1787 120 14560 13669 --
NM_007202chr171540 ------
NM_007212chr13750 497 345 ------
NM_007222chr831628 1153 338 ------
NM_007236chr1552133 766 443 58 21 12466 ----
NM_007238chr2044289 3928 1169 367 ------
NM_007246chr4----1913 --
NM_007249chr1387708 7147 6331 2868 2796 1288 1270 266 18616 ----
NM_007260chr12731 117 ------
NM_007313chr931954 1888 714 ----1226
NM_007345chr182897 200 22171 1681 ----
NM_007350chr1234393 1424 73 2963 485 13940 13106
NM_007365chr141578 585 175 42 ----1815
NM_007368chr1341307 1244 1008 245 ------
NM_007372chr173725 282 35 --1195 --
NM_012069chrX3894 620 133 --1815 --
NM_012081chr533054 2516 190 ------
NM_012086chr2156 ------
NM_012089chr131476 565 163 ------
NM_012095chr1033480 1211 1046 --11329 --
NM_012096chr32703 651 ----13135
NM_012097chr221899 613 --11770 --
NM_012102chr142615 2193 2085 922 1307 --12460
NM_012104chr1153768 3078 2671 1389 997 11408 ----
NM_012104chr1153768 3078 2671 1389 997 11408 ----
NM_012115chr61406 ------
NM_012137chr162324 1911 1886 1874 987 345 182 ----
NM_012141chr1393873 3581 3295 2912 2735 2703 2547 1021 1003 ------
NM_012156chr2073357 3138 2873 2634 1382 777 202 ------
NM_012164chr996806 6260 5689 1544 1406 861 808 548 96 26466 6194 ----
NM_012175chr114651 617 249 84 ------
NM_012180chr42669 168 --1490 --
NM_012193chr1165202 4798 4778 1627 1287 681 ------
NM_012199chr143255 1540 1374 748 23103 1804 ----
NM_012214chr286224 6160 4628 4075 2004 731 530 189 --14606 15096
NM_012215chr1041675 377 288 69 ------
NM_012218chr1941043 871 649 203 ------
NM_012232chr1762046 2040 1781 1762 1675 32 --11681 --
NM_012247chr102949 360 ------
NM_012249chr243406 2609 1366 129 ------
NM_012281chr71527 ------
NM_012287chr343792 910 662 383 ------
NM_012288chr6115385 4966 4536 4151 1292 962 766 538 489 431 248 ------
NM_012294chr763447 3396 2675 2529 1195 944 ------
NM_012297chr442348 1854 870 300 ------
NM_012300chr532084 1713 682 ------
NM_012301chr721555 588 ----1494
NM_012306chr1293420 3329 3115 2933 2402 1086 714 433 26 --12496 --
NM_012309chr1154138 3838 1124 393 169 ------
NM_012316chr1115479 4492 4182 3463 1683 1656 1459 1309 1284 972 409 --1998 12121
NM_012323chr2231575 598 147 ------
NM_012330chr1021158 1115 ------
NM_012333chr131184 1062 336 ------
NM_012341chr101428 ------
NM_012382chr514199 12887 ----
NM_012398chr1972921 2585 1893 783 367 254 130 ----11908
NM_012428chr153932 284 84 ------
NM_012432chr1158 ------
NM_012433chr21276 ------
NM_012446chr5----1645 --
NM_012471chrX153 21801 320 ----
NM_012478chr172406 99 ------
NM_012479chr742574 2327 1973 784 ------
NM_012482chr1131 ------
NM_013229chr1232440 438 223 12467 ----
NM_013230chrY41607 564 99 25 1285 ----
NM_013231chr1434287 3212 1142 ------
NM_013246chr112681 21 ------
NM_013253chr113925 903 176 ------
NM_013261chr433423 2727 61 ------
NM_013269chr1294240 4178 4018 3560 1433 1253 471 447 197 ------
NM_013279chr1141738 1619 1475 149 ------
NM_013281chr202385 264 ------
NM_013283chr52670 325 ------
NM_013316chr72911 795 ------
NM_013351chr171722 ------
NM_013363chr3160 ------
NM_013364chrX1540 11644 ----
NM_013368chr194467 441 199 42 ------
NM_013372chr1553083 2918 2654 2406 442 ------
NM_013381chr123954 747 271 ------
NM_013382chr1432375 1751 728 ------
NM_013396chr211969 ------
NM_013400chr721027 45 ------
NM_013433chr1921776 756 ------
NM_013446chr741349 1031 145 83 21257 449 ----
NM_013449chr123695 541 223 ------
NM_013450chr22461 348 ------
NM_013951chr262344 1758 1715 693 545 196 ------
NM_013952chr262421 1835 1792 770 622 273 ------
NM_013953chr262421 1835 1792 770 622 273 ------
NM_013979chr5--1415 ----
NM_013989chr1454204 3590 3291 1140 561 13317 --1462
NM_013992chr262421 1835 1792 770 622 273 ------
NM_013996chr71491 ------
NM_013996chr71491 ------
NM_013997chr71491 ------
NM_013997chr71491 ------
NM_013998chr71491 ------
NM_013998chr71491 ------
NM_014021chr143039 2967 2327 136 ------
NM_014023chr1042772 2274 1953 221 --12198 --
NM_014057chr921496 659 ------
NM_014079chr321046 168 ------
NM_014109chr82480 409 ------
NM_014110chr11187 ------
NM_014112chr874908 4699 4589 1166 710 683 527 --12093 1773
NM_014155chr11106866 6649 5976 5377 4773 2745 2208 1596 1095 256 ------
NM_014157chr16124026 3107 2869 1456 1432 1256 1088 1045 863 741 684 501 ------
NM_014189chr441493 1343 982 204 --180 --
NM_014190chr461845 1695 1334 1216 556 318 --1432 --
NM_014212chr12184 1372 ----
NM_014231chr1272043 1793 1715 1368 638 97 51 ----11762
NM_014245chr32223 130 ------
NM_014246chr2251572 788 576 412 154 ----11696
NM_014252chr131124 ------
NM_014253chrX3557 498 330 ------
NM_014264chr4192 ------
NM_014294chr821334 462 ------
NM_014299chr1961800 1770 735 282 272 34 ------
NM_014309chr2285197 5082 4368 3581 1410 1284 608 477 --13555 --
NM_014316chr1651995 1766 1750 1633 651 12098 ----
NM_014319chr1221640 68 ------
NM_014333chr1112818 ------
NM_014351chr222484 82 ------
NM_014374chr721027 45 ------
NM_014388chr1115425 4681 4612 4500 4388 4239 4186 3738 2020 1572 705 ------
NM_014393chr852311 369 312 302 268 ------
NM_014397chr92217 60 167 ----
NM_014423chr544530 2103 1510 118 ------
NM_014426chr202250 208 ------
NM_014445chr322161 1696 ------
NM_014455chr11430 ------
NM_014469chr111255 ------
NM_014472chr101169 ------
NM_014494chr1641735 940 731 411 ------
NM_014507chr2221205 450 ----11027
NM_014517chr321250 779 ------
NM_014554chr1231970 1605 691 ------
NM_014562chr2198 ------
NM_014563chrX22105 201 ------
NM_014572chr1321673 1165 11504 ----
NM_014574chr1411359 ------
NM_014600chr241660 582 529 273 --21441 199 --
NM_014613chr552699 2268 889 754 350 1495 ----
NM_014614chr211319 ------
NM_014634chr2253577 2753 2633 1106 41 ------
NM_014636chr943281 878 471 315 14061 11442 --
NM_014653chr1232062 1596 92 --12144 --
NM_014659chr1531050 367 256 ------
NM_014660chr73801 129 28 ------
NM_014665chr863314 3289 2755 2433 2284 297 --1697 --
NM_014670chr221616 1076 ------
NM_014676chr121488 1274 ------
NM_014677chr82145 105 ------
NM_014690chr752390 1168 960 375 131 --12786 --
NM_014701chr1521352 870 ------
NM_014702chr673333 3275 2724 2222 525 129 88 22395 2287 ----
NM_014705chr71420 11906 ----
NM_014707chr711707 ------
NM_014723chr2043211 2295 1052 339 ------
NM_014729chr831574 772 84 ------
NM_014730chr12134866 4827 4821 4678 4324 3836 3784 3590 3231 1319 891 876 687 14066 1204 --
NM_014730chr12134866 4827 4821 4678 4324 3836 3784 3590 3231 1319 891 876 687 14066 1204 --
NM_014735chrX32108 1707 512 --1323 --
NM_014741chr1151536 1423 774 744 672 ------
NM_014743chr442991 2829 1117 420 ------
NM_014746chr264001 3774 1702 926 887 339 1718 ----
NM_014747chr185353 5140 5128 4395 4320 1784 900 62 12108 180 --
NM_014752chr11--2406 211 ----
NM_014755chr263210 1331 1271 991 497 66 ------
NM_014757chr542365 2044 1795 700 ------
NM_014759chr851104 1090 572 279 166 ------
NM_014761chr162183 73 ------
NM_014765chr121863 616 ------
NM_014767chr1082863 2646 2385 2332 2253 582 405 301 22716 2660 12411 1248
NM_014774chr132008 92 84 --12592 --
NM_014776chr1272963 2915 2482 2451 2424 2231 2115 ------
NM_014810chr123458 658 ------
NM_014812chr121591 123 ------
NM_014819chr521944 778 ------
NM_014824chr1121330 629 ----11765
NM_014826chr134084 3882 749 ------
NM_014827chr11159 1319 ----
NM_014839chr12923 531 1961 ----
NM_014840chr1272737 2542 2362 2316 1044 818 421 ------
NM_014850chr354289 3962 3550 3129 893 14525 11260 --
NM_014862chr1594138 3667 3464 3430 3011 2904 1622 985 279 ------
NM_014871chr121570 ------
NM_014872chr941748 944 860 225 --12131 --
NM_014873chr153820 3687 3589 1062 400 ----1809
NM_014877chr17107366 6775 5917 5403 5221 2954 2687 2363 1321 121 ------
NM_014897chr1773122 2313 2258 2043 922 88 24 13103 ----
NM_014899chr543028 2445 510 141 ------
NM_014901chr531999 1404 347 1500 ----
NM_014903chr1231933 611 520 ------
NM_014905chr21277 ------
NM_014906chr1723919 2877 23387 3140 --13096
NM_014912chr1022884 2789 ----1109
NM_014914chr231004 847 60 ------
NM_014918chr151498 ------
NM_014920chr633596 2834 954 ------
NM_014921chr1932968 2495 1895 ------
NM_014924chr141529 --1359 --
NM_014925chr123775 654 197 ------
NM_014934chr1323453 3082 ------
NM_014939chr181498 --11054 --
NM_014944chr161389 1062 528 521 221 58 ------
NM_014946chr241142 750 387 275 ------
NM_014947chr122810 446 ------
NM_014949chr12849 686 ------
NM_014950chr141109 ------
NM_014959chr1933146 2334 44 ------
NM_014962chr2022373 2119 ------
NM_014969chr131095 323 185 1840 ----
NM_014974chr1031475 311 51 --11252 --
NM_014978chr103731 289 246 ------
NM_014982chr1413721 21362 526 ----
NM_014996chr34328 316 145 76 ------
NM_014997chr752352 2337 2266 2154 1945 1257 --11100
NM_014999chr121624 ------
NM_015005chr1431697 1672 92 --11656 --
NM_015008chr373184 3074 2975 1359 1352 265 240 --11289 --
NM_015009chr31107 ------
NM_015023chr141777 469 344 89 ------
NM_015024chr81972 ------
NM_015026chr1254620 4499 3290 1070 65 ------
NM_015027chr1651501 1237 611 547 387 ------
NM_015032chr1321946 977 ------
NM_015035chr2086169 4673 2047 1624 1296 446 212 139 12574 25879 1215 --
NM_015039chr143549 3343 3329 89 13432 1258 --
NM_015042chr1573659 3473 3430 1488 1431 841 590 ------
NM_015044chr1683257 3098 2989 2755 2572 1078 656 444 ------
NM_015045chr1021433 150 ----184
NM_015046chr942394 2352 452 257 ----1222
NM_015051chr942848 2524 1342 615 12984 ----
NM_015052chr71414 ------
NM_015059chr15103623 2628 2436 1460 966 598 508 335 309 139 12612 ----
NM_015064chr1271442 1085 1051 1005 988 713 361 ------
NM_015068chr741412 740 644 587 ------
NM_015075chrX32249 1958 1624 ------
NM_015076chr664173 3809 3633 3422 3283 1076 ------
NM_015086chr1251380 245 120 97 43 1128 ----
NM_015090chr1105693 5162 5094 4709 2436 1786 1530 1487 705 583 ------
NM_015091chr141777 ------
NM_015092chr1664471 3527 3481 3475 733 469 ------
NM_015093chr61522 ------
NM_015094chr2254375 3933 3310 1735 1127 1490 ----
NM_015097chr33906 291 77 ----1898
NM_015100chr131890 1317 793 ------
NM_015101chr132083 965 647 12484 ----
NM_015113chr1711998 2586 110 ----
NM_015115chr441018 781 239 178 ------
NM_015132chr711661 1498 ----
NM_015143chr431223 1047 147 ------
NM_015144chr1673316 3227 3066 1366 1237 928 379 ------
NM_015149chr131669 1433 470 ------
NM_015155chr1052928 2522 2388 2326 2232 13231 12303 --
NM_015156chr1442567 1113 1062 355 ------
NM_015161chr1641459 1127 173 107 ------
NM_015176chr141657 1641 1418 634 ------
NM_015192chr202651 311 ------
NM_015199chr362287 2231 2170 1068 935 24 ------
NM_015200chr442134 1909 233 176 ------
NM_015205chr1394947 3880 1469 1414 1273 1212 596 435 124 --24595 1897 --
NM_015206chr1541218 1070 722 619 1834 1906 --
NM_015208chr1843780 3358 1256 504 ------
NM_015209chr121957 1718 12293 ----
NM_015215chr133028 2605 542 ------
NM_015226chr1623455 2526 13288 --1172
NM_015236chr431330 225 112 ------
NM_015247chr1664928 4872 4749 4237 820 366 ------
NM_015250chr941858 1586 387 308 ------
NM_015252chr21620 1230 ----
NM_015260chr1941549 1301 1004 469 ------
NM_015263chr151985 ------
NM_015264chr2264333 4006 3586 1911 1250 858 ----14478
NM_015265chr222151 322 ------
NM_015271chr444113 3946 3009 1635 1866 ----
NM_015284chr152099 1760 1533 1343 406 138 ----
NM_015285chr1872227 1820 1609 646 448 69 37 --12365 --
NM_015291chr142278 873 804 644 --1289 --
NM_015294chr171243 ------
NM_015296chr131404 --1113 --
NM_015299chr1443606 3242 1318 746 --13680 --
NM_015305chr1451894 1819 463 174 126 --1189 --
NM_015310chr898024 7994 7013 6222 3187 3042 1262 1030 982 11198 ----
NM_015313chr1133658 1471 1261 ------
NM_015314chr732536 2422 124 ------
NM_015315chr533435 1317 964 1754 11182 --
NM_015317chr262380 2369 2279 2087 1116 446 ------
NM_015326chr162371 2296 1989 1008 856 439 --12584 --
NM_015332chr7123355 2776 2388 1171 1067 1038 783 688 542 505 376 53 ----13340
NM_015336chr1232447 535 278 ------
NM_015338chr2021844 389 ------
NM_015339chr20176 1731 ----
NM_015345chr662760 2706 2387 1993 976 645 ------
NM_015346chr1421607 1222 11571 ----
NM_015347chr1222853 2299 ------
NM_015349chr622694 222 ------
NM_015355chr1731336 521 428 11518 ----
NM_015365chrX63742 3486 3362 1386 590 318 ------
NM_015379chr71229 ------
NM_015385chr1022503 786 ------
NM_015397chr941777 1494 736 54 11657 ----
NM_015401chr122908 49 ------
NM_015428chr1941694 1497 1479 296 ------
NM_015429chr331024 1001 758 ------
NM_015435chr811325 ------
NM_015436chr453256 2942 473 419 59 --1860 --
NM_015455chr564100 4032 3137 2788 1167 958 ------
NM_015458chr854868 3825 635 61 55 --21682 498 --
NM_015460chr321871 1544 ------
NM_015463chr22775 741 --1255 --
NM_015475chr21142 ------
NM_015481chr1221072 1009 ------
NM_015497chr153807 347 68 1121 ----
NM_015511chr2031136 959 950 ----11178
NM_015520chr321889 1880 ------
NM_015527chr165735 643 521 513 136 ------
NM_015528chr173168 65 53 ------
NM_015530chr22729 290 ------
NM_015550chr733335 3169 2969 12674 --1792
NM_015554chr1562780 2676 2087 1967 1912 1835 ------
NM_015564chr532597 740 447 ------
NM_015568chr2064157 3206 2822 2746 1643 1504 --1602 --
NM_015569chr134714 4666 4090 12954 ----
NM_015570chr761814 1760 1448 734 239 215 ------
NM_015575chr252806 2772 982 676 648 ------
NM_015576chr331974 1959 1822 ----12067
NM_015604chr142636 213 ------
NM_015627chr141647 1622 1311 506 --11881 --
NM_015635chr921940 172 1623 ----
NM_015652chr102225 179 ------
NM_015691chrX22453 195 1369 ----
NM_015711chr192682 650 ------
NM_015834chr213982 862 21 ------
NM_015850chr852347 2267 1908 1729 419 --22411 2358 --
NM_015855chr112585 221 ------
NM_015874chr42546 482 ------
NM_015881chr113925 903 176 ------
NM_015886chr835704 3932 658 ------
NM_015888chr123248 54 ------
NM_015906chr164481 4324 4053 4033 3259 881 23666 124 ----
NM_015912chr842483 2035 1737 1684 ------
NM_015987chr122398 55 ------
NM_016018chr84764 549 463 283 ------
NM_016019chr72333 27 1163 ----
NM_016022chr14777 713 145 105 1734 1442 --
NM_016025chr1621830 22 ------
NM_016032chrX2460 257 ------
NM_016061chr221359 556 ------
NM_016073chr15----2988 101 --
NM_016075chr1342694 2596 911 484 ----12787
NM_016076chr173015 2226 1244 1197 1133 833 351 ------
NM_016083chr633741 1014 79 ------
NM_016096chr842003 1498 1405 225 ------
NM_016131chr252295 1496 945 761 746 ------
NM_016147chr111357 1384 ----
NM_016152chr321141 952 ------
NM_016162chr125762 669 319 306 259 ------
NM_016173chr372992 2949 1658 1634 1603 488 421 --13750 --
NM_016205chr42934 224 ------
NM_016206chr387195 3325 2875 2353 2322 2079 1748 1721 ------
NM_016221chr51292 12327 ----
NM_016230chr6121 --1436 --
NM_016235chr1631356 1266 1039 ------
NM_016257chr173169 2542 2440 499 212 197 125 ------
NM_016260chr235675 5181 1142 24672 1120 11455 --
NM_016272chr2261869 961 914 850 528 493 ------
NM_016284chr162794 386 ------
NM_016287chr13686 260 198 ------
NM_016338chr51969 1985 ----
NM_016376chr1784269 2950 2903 2868 1542 741 368 103 --133 11051
NM_016396chr1552887 2515 1968 1195 1181 12386 ----
NM_016410chr91182 ------
NM_016418chr2273320 3136 1298 1127 843 312 276 12674 ----
NM_016422chr1132292 916 172 ------
NM_016467chr23993 467 134 ------
NM_016486chr11182 ------
NM_016487chr6191 ------
NM_016507chr1742066 968 140 59 ------
NM_016513chr633596 2834 954 ------
NM_016516chr21868 ------
NM_016530chr1533428 3306 247 ------
NM_016531chr443715 915 326 172 --1394 --
NM_016577chr374277 4215 3304 2942 756 407 37 ------
NM_016588chr61250 ------
NM_016596chr122908 49 ------
NM_016603chr52482 219 148 ----
NM_016605chr531716 1683 142 ------
NM_016607chrX1394 ------
NM_016621chr1194368 4151 4102 3977 3866 3409 3025 1639 1291 11503 11182 --
NM_016631chr212882 138 ------
NM_016830chr123405 155 77 ----1124
NM_016834chr1764010 3792 1122 1010 634 107 --23244 692 --
NM_016835chr1764010 3792 1122 1010 634 107 --23244 692 --
NM_016841chr1764010 3792 1122 1010 634 107 --23244 692 --
NM_016936chr1651938 1389 576 140 124 ------
NM_017415chr574435 3516 1728 735 702 634 550 34423 696 617 11204 --
NM_017420chr1443532 2712 1376 927 ------
NM_017423chr432047 830 312 ------
NM_017455chr153932 284 84 ------
NM_017488chr211555 --11487 --
NM_017544chrX1620 ------
NM_017550chr194947 841 746 74 ------
NM_017551chr1042538 2250 2227 731 ------
NM_017553chr152475 345 ------
NM_017554chr342092 1979 1550 424 ------
NM_017577chr32589 513 ------
NM_017582chr121792 1148 ------
NM_017588chr911972 --1715 21703 1550
NM_017590chr2262649 2538 1975 665 406 387 ------
NM_017596chr1104546 4156 3509 3453 2852 1561 1445 1041 508 187 ------
NM_017602chrX1655 --1937 --
NM_017610chr1531978 1864 253 ------
NM_017628chr473928 3235 2032 1872 1216 1006 391 13445 ----
NM_017629chr131948 660 106 ------
NM_017633chr61280 --1603 --
NM_017637chr9129078 9025 8822 8815 8252 7066 6669 3768 3609 2607 2596 368 1163 18749 --
NM_017640chr62230 23 ------
NM_017643chr1742536 838 782 660 ------
NM_017644chr335047 4494 326 11105 ----
NM_017650chr775871 4513 4075 3863 1849 1368 956 ------
NM_017657chr21298 ------
NM_017664chr1341067 793 217 37 ------
NM_017667chr72490 161 ------
NM_017668chr163792 256 51 1149 1679 173
NM_017693chr132213 138 ------
NM_017709chr143461 2818 1630 964 --11185 --
NM_017719chr322231 644 ------
NM_017724chr32684 34 ------
NM_017728chr1772959 2583 1987 219 187 152 93 --1423 --
NM_017737chr142196 1854 398 345 12004 ----
NM_017749chr113702 646 355 ------
NM_017754chr664975 4664 3382 944 392 274 ------
NM_017757chr182984 884 --11034 --
NM_017758chr1761226 489 415 388 194 141 ------
NM_017778chr831003 995 551 ------
NM_017779chr132722 2279 1999 --12583 --
NM_017799chr1421287 247 ------
NM_017801chr332443 1653 948 ------
NM_017824chr1042057 764 579 29 ------
NM_017830chr4194 ------
NM_017831chr1854533 1766 1588 1524 1209 1195 ----
NM_017848chrX43519 1876 1818 1771 ------
NM_017849chr263083 1198 980 473 323 25 ------
NM_017866chr831069 954 779 ------
NM_017890chr811687 ----11757
NM_017902chr10195494 4784 4686 4547 4411 4382 4206 4132 4016 3949 3782 3620 2158 2003 1978 1791 1562 1002 807 --12061 --
NM_017919chr984389 4182 4122 4043 2334 2310 1029 704 ------
NM_017922chr141109 ------
NM_017954chr751555 1353 1171 1113 435 11737 172 --
NM_017955chr142825 229 ------
NM_017964chr23885 185 40 ------
NM_018027chr1042802 2650 1104 834 1593 12771 1652
NM_018047chr52834 811 ------
NM_018062chr22409 403 ------
NM_018078chr4------182
NM_018084chr23293 151 51 1193 ----
NM_018092chr161311 ------
NM_018107chr143981 745 28 ------
NM_018116chr12247 69 ----1583
NM_018117chr102705 534 ------
NM_018121chr1032138 2094 1220 ------
NM_018155chr353220 2126 730 694 308 --1723 --
NM_018157chr1232303 654 345 ------
NM_018164chr122241 201 ------
NM_018176chr421451 522 ------
NM_018181chr1851719 1617 1217 751 587 2516 160 ----
NM_018182chr1751769 907 515 173 165 ------
NM_018184chr3289 27 ------
NM_018195chr1131363 146 57 ------
NM_018200chr15122375 1937 1831 1762 1590 1033 1026 928 560 457 254 212 ------
NM_018201chr951568 905 885 348 252 22495 2210 ----
NM_018202chr12681 231 ------
NM_018205chr1052210 1987 1956 1715 532 ------
NM_018211chr1135 1276 ----
NM_018214chr6287 34 ------
NM_018239chr1052210 1987 1956 1715 532 ------
NM_018240chr14769 589 218 98 ------
NM_018243chr453803 3447 1612 1579 1100 1718 ----
NM_018246chr811902 1459 1590 --
NM_018247chr623015 2893 ------
NM_018254chr122260 1674 1820 1710 --
NM_018263chr242543 1616 113 72 11771 ----
NM_018286chr172835 172 ------
NM_018293chr322859 933 --13001 --
NM_018299chr883087 2928 2629 2430 1332 1090 329 299 ------
NM_018315chr421063 106 ------
NM_018325chr92610 142 --1621 --
NM_018330chr1021551 248 ------
NM_018351chr1244006 3921 3642 3313 13279 13839 --
NM_018357chr151409 ----1368
NM_018362chr1173780 3496 2759 876 388 124 55 ------
NM_018364chr154146 3598 2933 2817 2570 --1673 --
NM_018374chr754494 4280 2078 1674 1619 14988 ----
NM_018383chr221599 150 ------
NM_018387chr91165 ------
NM_018388chrX21272 70 11358 ----
NM_018394chr3------1213
NM_018403chr343565 3139 1586 203 1915 11229 --
NM_018416chr1272539 2120 1997 989 772 565 555 ------
NM_018424chr91493 1601 ----
NM_018429chr512354 ------
NM_018440chr858325 7649 5488 576 144 ------
NM_018509chr1741628 1514 1319 602 ------
NM_018553chr1731329 1282 1210 ------
NM_018566chr141252 919 252 150 34717 906 692 13786 --
NM_018590chr1011486 1457 ----
NM_018639chr1231016 455 418 ------
NM_018650chr132233 1736 578 ------
NM_018683chr2061633 1453 537 420 356 201 --1251 --
NM_018689chr1562590 2486 2355 2206 531 410 ------
NM_018715chr132160 1898 199 --1873 --
NM_018717chr431061 916 81 ------
NM_018718chr741968 1960 928 699 ------
NM_018719chr721125 1119 11270 ----
NM_018840chr201390 1339 ----
NM_018841chr182634 1259 980 861 740 162 115 23 21298 61 ----
NM_018890chr721003 448 11515 ----
NM_018912chr541685 1376 1273 668 11771 --11588
NM_018913chr541685 1376 1273 668 11771 --11588
NM_018914chr541685 1376 1273 668 11771 --11588
NM_018915chr541685 1376 1273 668 11771 --11588
NM_018916chr541685 1376 1273 668 11771 --11588
NM_018917chr541685 1376 1273 668 11771 --11588
NM_018918chr541685 1376 1273 668 11771 --11588
NM_018919chr541685 1376 1273 668 11771 --11588
NM_018920chr541685 1376 1273 668 11771 --11588
NM_018921chr541685 1376 1273 668 11771 --11588
NM_018922chr541685 1376 1273 668 11771 --11588
NM_018923chr541685 1376 1273 668 11771 --11588
NM_018924chr541685 1376 1273 668 11771 --11588
NM_018925chr541685 1376 1273 668 11771 --11588
NM_018926chr541685 1376 1273 668 11771 --11588
NM_018927chr541685 1376 1273 668 11771 --11588
NM_018928chr541685 1376 1273 668 11771 --11588
NM_018929chr541685 1376 1273 668 11771 --11588
NM_018945chr643488 3440 3118 663 ------
NM_018948chr131255 124 49 ------
NM_018951chr7161 --1335 --
NM_018953chr122821 149 ------
NM_018959chr192577 248 ------
NM_018963chr2121443 395 ------
NM_018976chr1242280 2233 823 118 ------
NM_018979chr1221709 771 ------
NM_018999chr1044742 4530 1296 699 --1340 --
NM_019000chr521519 1301 ------
NM_019001chr324312 3617 ------
NM_019004chr762168 2124 2087 1674 454 303 --1690 --
NM_019008chr2263767 3722 3295 2962 2573 1295 13733 ----
NM_019015chr71134 ------
NM_019027chr41948 ------
NM_019035chr42827 788 ------
NM_019045chrX1735 ------
NM_019050chr421625 735 ------
NM_019058chr101730 ------
NM_019063chr232068 1750 777 ------
NM_019072chr513384 11432 12677 --
NM_019074chr151870 ------
NM_019102chr71457 --1113 --
NM_019102chr71457 --1113 --
NM_019106chr2242172 2132 741 293 ------
NM_019114chr962100 2029 969 594 59 51 ------
NM_019116chr1693622 3336 2774 2751 1497 1363 1240 1100 1071 ------
NM_019556chrX11271 ------
NM_019592chr93888 699 240 181 ----
NM_019593chr2053080 3030 2745 2437 2109 --1803 --
NM_019610chr142119 1614 589 476 ------
NM_019859chr1051473 1351 1100 211 100 ------
NM_019895chr321008 964 ------
NM_019896chr21197 ------
NM_020066chr14858 664 386 344 ------
NM_020116chr441705 1393 580 370 ------
NM_020122chr265525 4539 3904 2307 1381 29 13911 15113 --
NM_020134chr261069 1015 937 890 793 219 ------
NM_020141chr121550 1468 12412 1232 --
NM_020144chr731719 285 177 ------
NM_020148chr1833084 1100 694 1306 ----
NM_020159chr431521 1499 586 ------
NM_020166chr3137 ------
NM_020182chr2083357 3176 3084 2871 2637 2468 2304 2295 ------
NM_020192chr71141 ------
NM_020193chr112535 258 ------
NM_020211chr1531001 499 37 ------
NM_020228chr1151976 1942 927 652 47 ------
NM_020239chr142171 1712 681 292 189 ----
NM_020248chr151912 1742 1640 1574 1535 --12289 --
NM_020310chr1762414 2383 2225 2184 779 428 ------
NM_020337chr442837 2437 2264 375 ----13060
NM_020338chr1023181 1086 ------
NM_020340chr61869 21502 250 ----
NM_020341chr201771 ------
NM_020353chr341550 459 424 310 ------
NM_020354chr101168 ------
NM_020357chr31662 11275 ----
NM_020374chr1231391 798 787 ------
NM_020382chr1231459 1062 542 1558 11398 --
NM_020403chr1321752 628 ------
NM_020416chr452157 1082 703 686 613 1932 ----
NM_020425chr62410 158 ------
NM_020440chr143138 1188 1070 106 ------
NM_020445chr72785 53 ------
NM_020452chr152034 1604 1504 98 90 1479 ----
NM_020456chr1341937 1633 933 424 ------
NM_020478chr831000 832 535 --11727 --
NM_020526chr141649 1298 686 338 ------
NM_020640chr33349 327 196 ------
NM_020651chr221561 207 ------
NM_020654chr321564 32 ------
NM_020676chr31262 ------
NM_020699chr154628 1605 1222 380 229 132 ----
NM_020714chr1964443 4342 3480 3029 1625 1466 --21804 1254 --
NM_020718chr1656635 6098 1926 947 425 12613 12440 --
NM_020728chr751969 1129 939 486 24 ------
NM_020748chr171542 ------
NM_020752chr1052833 2815 2691 2506 210 --12539 --
NM_020766chrX44554 4184 3751 2845 ------
NM_020772chr1778549 7242 5934 3436 2865 1503 959 22661 2056 ----
NM_020778chr1564727 4037 3043 1162 451 323 2562 282 1607 --
NM_020779chr252962 2737 888 598 497 ------
NM_020783chr1831657 945 459 ------
NM_020792chr31744 11945 ----
NM_020794chr111049 ------
NM_020795chr1741674 1612 1357 1251 --1251 --
NM_020796chr542741 1023 135 72 12477 ----
NM_020800chr321139 1042 ------
NM_020801chr522637 248 --12573 --
NM_020805chr1821501 690 ------
NM_020806chr141563 1852 ----
NM_020810chr1443374 3198 713 339 ------
NM_020830chr253316 2713 1064 875 444 ------
NM_020841chr121786 11258 ----
NM_020845chr1242113 972 832 274 --1172 --
NM_020858chr1522134 367 1903 ----
NM_020859chr443828 3206 917 360 ------
NM_020861chr631350 364 82 --1108 --
NM_020866chr1311048 ------
NM_020888chr141861 1498 1492 173 1818 ----
NM_020918chr1042601 954 588 49 ------
NM_020919chr2165 ------
NM_020921chr1442609 925 725 67 ------
NM_020922chrX31348 1277 1162 ------
NM_020935chr243478 3028 1489 580 23225 483 ----
NM_020940chr1022488 347 21903 955 ----
NM_020946chr93585 424 252 ------
NM_020948chr132971 2722 719 193 ----
NM_020962chr1542495 802 648 322 ------
NM_020967chr2021106 90 ----1957
NM_020977chr431497 739 186 11358 ----
NM_020988chr161203 ------
NM_021003chr141720 --1297 --
NM_021007chr22949 917 ------
NM_021033chr1341381 984 389 204 1626 ----
NM_021069chr42450 387 ------
NM_021072chr562117 1816 1689 667 311 234 ------
NM_021079chr1742559 2246 907 741 ----12500
NM_021083chrX53666 2855 812 344 117 13212 ----
NM_021100chr203371 210 182 ------
NM_021116chr7108765 8578 7231 5843 2400 2081 2071 1852 708 698 28656 985 26001 1595 12565
NM_021133chr131678 1233 657 --152 --
NM_021135chr672691 2206 2082 1309 572 301 42 --1848 --
NM_021136chr142292 159 ------
NM_021137chr1741996 1812 926 801 1626 ----
NM_021140chrX21008 363 ------
NM_021145chr72414 121 1765 ----
NM_021155chr1962444 1922 1164 1008 179 123 12848 13009 --
NM_021165chr12839 607 ------
NM_021183chrX1252 1338 ----
NM_021202chr2031121 314 67 --11943 --
NM_021213chr173326 229 153 ------
NM_021215chr2022318 2197 ------
NM_021222chr12121 92 --1328 --
NM_021239chr1451221 586 199 193 139 ------
NM_021240chr91470 ------
NM_021249chr1411484 ----11639
NM_021252chr1011287 11622 ----
NM_021255chr1411364 12991 ----
NM_021260chr145533 392 107 43 24 --21087 480 --
NM_021627chr32802 104 ------
NM_021629chr344537 3626 612 23 ------
NM_021637chrX21232 979 ------
NM_021647chr4104576 4032 2908 1869 1713 1373 1064 525 507 51 ------
NM_021783chrX32290 628 48 ------
NM_021808chr122616 485 ------
NM_021809chr201132 ------
NM_021813chr675637 5606 5374 5047 4231 822 267 1167 ----
NM_021814chr621573 1473 ------
NM_021905chr661979 1558 474 281 188 47 ------
NM_021907chr2181 ------
NM_021908chr73849 727 302 1831 1256 --
NM_021911chr575295 5010 4624 1848 1629 1165 408 --25078 193 --
NM_021912chr1533173 2649 1311 13108 ----
NM_021940chr6147 11533 ----
NM_021942chr41939 ------
NM_021946chrX61378 1084 431 313 185 61 ------
NM_021949chrX22671 576 --12354 --
NM_021954chr1342981 2528 2512 2484 ------
NM_021959chr65928 877 264 253 188 ------
NM_021960chr132636 1780 310 ------
NM_021961chr1165371 4763 2686 2490 406 278 16629 15670 --
NM_021964chr324247 1732 ------
NM_021966chr142307 111 1861 ----
NM_021977chr642497 2479 546 52 13293 ----
NM_021984chrX3550 543 196 ------
NM_021987chrX3550 543 196 ------
NM_021988chr2021139 58 --1999 --
NM_021990chrX3550 543 196 ------
NM_021999chr13191 ------
NM_022003chr1131257 1204 495 ------
NM_022048chr1566362 6345 4951 4131 1919 22 16406 12249 --
NM_022049chr1--11874 150 --
NM_022051chr11605 ------
NM_022060chr1461118 1008 864 521 262 80 ------
NM_022075chr13973 135 118 ------
NM_022080chr2062370 1942 1757 1054 358 323 ------
NM_022116chr72935 42 ------
NM_022118chr131574 ------
NM_022123chr142234 110 ------
NM_022138chr62281 216 ------
NM_022166chr1695722 5584 5526 5512 2411 1318 1270 700 270 26084 898 ----
NM_022336chr232005 162 24 1664 ----
NM_022346chr431377 1204 877 ------
NM_022351chr823245 1348 ------
NM_022373chr71238 ------
NM_022442chr2021139 58 --1999 --
NM_022458chr742429 2276 934 421 12098 ----
NM_022461chr32115 56 ------
NM_022463chr1751477 1337 530 492 472 ------
NM_022465chr1252714 1873 850 725 443 21955 782 ----
NM_022473chr1553973 3063 1714 665 276 --11677 --
NM_022552chr241219 1179 1038 974 ------
NM_022652chr122388 21 ------
NM_022719chr2243747 2866 2469 83 --33292 2380 2362 --
NM_022726chr631198 1120 334 ------
NM_022735chr131421 706 387 1158 11714 --
NM_022737chr191837 --1899 165
NM_022753chr122364 895 11864 ----
NM_022755chr942581 2062 1677 866 --11010 --
NM_022756chr121500 351 ----11369
NM_022758chr653098 2388 2368 1069 792 ------
NM_022763chr332962 2786 935 ------
NM_022780chr22663 209 ------
NM_022781chr942833 2660 794 171 ------
NM_022823chr21457 ------
NM_022841chr1522736 2307 1440 ----
NM_022893chr222326 248 ------
NM_022898chr1484432 4018 3861 3568 3519 3097 3003 1163 ----13256
NM_022912chr242838 2764 303 43 ------
NM_022970chr102966 309 1994 ----
NM_022977chrX21941 378 12284 ----
NM_023000chr141605 --11103 --
NM_023001chr141605 --11103 --
NM_023037chr133988 107 74 1938 ----
NM_023039chr5148 ------
NM_023071chr1211031 1198 ----
NM_023074chr194948 885 428 296 1901 ----
NM_023079chr1741742 1284 464 187 11643 ----
NM_023105chr852347 2267 1908 1729 419 --22411 2358 --
NM_023106chr852347 2267 1908 1729 419 --22411 2358 --
NM_023110chr852347 2267 1908 1729 419 --22411 2358 --
NM_023111chr852347 2267 1908 1729 419 --22411 2358 --
NM_023923chr163770 3737 3375 3180 1136 569 33233 2893 2577 ----
NM_023929chr81306 1590 ----
NM_024046chr36912 866 830 425 279 235 --11198 --
NM_024076chr1952257 2016 1646 946 265 --12181 --
NM_024085chr21737 ------
NM_024095chr1231507 1163 66 ------
NM_024117chr941315 1302 1110 335 --192 11074
NM_024294chr653098 2388 2368 1069 792 ------
NM_024345chr974998 4284 2062 2052 1334 1216 1058 26064 3832 ----
NM_024408chr193049 1351 1240 818 697 637 591 461 444 1900 ----
NM_024416chr921496 659 ------
NM_024424chr112827 784 ------
NM_024425chr112827 784 ------
NM_024426chr112827 784 ------
NM_024496chr142781 541 ------
NM_024511chr433123 815 36 ------
NM_024523chr721104 129 ------
NM_024563chr531929 1570 679 --11873 --
NM_024582chr42736 422 ------
NM_024607chr853668 3247 3173 3126 3007 11326 ----
NM_024630chr62811 759 ------
NM_024639chr642490 1907 827 334 ------
NM_024643chr142205 130 ------
NM_024645chr821553 532 ------
NM_024665chr313660 24270 1064 ----
NM_024689chrX31252 696 350 ------
NM_024722chr171553 ------
NM_024726chr2----1535 --
NM_024740chr1194119 4109 3738 3295 2805 2538 529 377 104 ------
NM_024761chr974733 4026 3992 3593 3380 785 684 ------
NM_024762chr193685 140 106 ------
NM_024769chr112872 59 ------
NM_024770chr255747 5688 5660 1208 1197 1259 16632 --
NM_024779chr1241276 1096 186 88 ------
NM_024785chr251163 539 506 350 313 ------
NM_024786chr52164 38 ------
NM_024798chr1552545 2494 2369 2119 79 ------
NM_024817chr1595954 5067 4951 3731 2274 2212 1078 238 204 ------
NM_024830chr531982 296 115 ------
NM_024834chr1031756 770 412 ------
NM_024850chr53316 283 226 ------
NM_024857chr17145 196 ----
NM_024909chr631532 1400 306 ------
NM_024915chr832357 1825 1114 ----12252
NM_024920chr421290 1190 ------
NM_024921chrX21756 1452 ------
NM_024944chr2121280 846 ------
NM_024946chr16------1521
NM_024947chr399134 8682 7910 6673 5832 3260 2840 2338 667 ------
NM_024949chr474948 4039 3852 3820 1713 1213 585 --14298 --
NM_024953chr1232530 1954 1925 ----1417
NM_024989chr296968 6861 6839 6075 2711 1981 1397 696 552 ----26868 1420
NM_024991chr1022503 786 ------
NM_025054chr843350 3281 2932 2837 11064 ----
NM_025061chr1931071 426 70 ------
NM_025083chr1521920 708 ------
NM_025130chr101490 --1138 --
NM_025134chr1611710 1374 ----
NM_025146chr362583 886 534 495 395 110 ------
NM_025151chr821431 866 --11953 --
NM_025152chr1421855 131 ------
NM_025154chr731229 351 255 ------
NM_025160chr133579 2978 1015 14121 ----
NM_025187chr1611223 ------
NM_025191chr133110 848 662 ------
NM_025201chr1542062 1558 1486 162 12039 ----
NM_025219chr208902 875 775 720 706 578 547 209 --1762 --
NM_025222chr33958 798 184 ------
NM_025248chr1733176 2887 1295 2458 269 ----
NM_025251chr841135 811 322 155 --2962 412 --
NM_030625chr102799 721 12094 ----
NM_030647chr755939 5522 4752 2282 1020 14459 --16319
NM_030648chr485218 4796 4778 4269 3569 2010 737 139 1922 ----
NM_030670chr1221902 1769 ------
NM_030671chr1221902 1769 ------
NM_030674chr12115282 5244 5128 4641 4289 4250 4034 3888 3697 2136 673 ------
NM_030751chr1041867 1511 1304 62 ------
NM_030751chr1041867 1511 1304 62 ------
NM_030762chr1221901 488 ------
NM_030806chr1107156 7057 7034 5823 3782 2856 2089 2050 1362 776 ------
NM_030808chr1741040 739 390 208 ------
NM_030809chr1232444 602 407 ------
NM_030881chr2242438 1593 546 79 ------
NM_030884chr352057 1701 848 774 24 12244 1214 --
NM_030885chr31145 ------
NM_030918chr185383 4796 4443 2121 1807 1126 1093 224 ------
NM_030927chr1011024 ------
NM_030934chr141826 1286 53 22 ------
NM_030939chr61340 ------
NM_030948chr6134 ------
NM_030949chr631344 508 91 ------
NM_030952chr131100 902 198 ------
NM_030953chr5------1197
NM_030962chr1171183 1059 495 375 356 323 117 179 ----
NM_030964chr593260 3073 2551 2545 1499 800 748 486 46 ------
NM_031157chr12----1479 --
NM_031216chr1821599 1519 ------
NM_031243chr721953 1810 ------
NM_031268chr1645381 3622 1858 1353 ------
NM_031309chr82691 386 --2873 63 --
NM_031314chr144740 647 128 118 11385 ----
NM_031372chr441659 396 184 75 ------
NM_031417chr1962426 2256 778 512 426 197 ------
NM_031419chr31539 ------
NM_031424chr203556 394 382 --1482 --
NM_031427chr1475552 5499 2249 2216 2206 1978 243 ------
NM_031435chr1243063 3000 2611 2439 ------
NM_031438chr52463 220 ------
NM_031439chr861700 1438 1425 1407 1207 380 ------
NM_031442chrX22927 1204 ------
NM_031445chr252170 1275 1072 890 566 --22969 2794 --
NM_031452chr15167 ------
NM_031461chr832279 1707 611 --12011 --
NM_031468chr7187592 7447 6249 6238 6055 5908 5205 3178 3028 2820 2292 1612 1091 881 829 581 208 183 --11045 --
NM_031483chr2093597 3130 2407 1397 1207 480 364 134 55 ------
NM_031844chr141624 1360 1082 440 13896 ----
NM_031845chr222679 921 ------
NM_031847chr222679 921 ------
NM_031890chr2252247 1996 1112 501 57 --22621 22 --
NM_031892chrX2940 763 ------
NM_031899chr331022 403 93 --1418 --
NM_031900chr51404 ------
NM_031904chr1142121 2081 460 57 --11528 --
NM_031990chr1931487 1105 329 ------
NM_031991chr1931487 1105 329 ------
NM_032012chr945200 5136 4356 1023 ------
NM_032027chr11209 136 ----
NM_032041chr832323 2174 1859 ------
NM_032042chr51606 12783 ----
NM_032047chr341997 976 756 264 ------
NM_032088chr541685 1376 1273 668 11771 --11588
NM_032092chr541685 1376 1273 668 11771 --11588
NM_032109chr511140 --1134 --
NM_032139chr191118 ------
NM_032144chr23595 234 39 ------
NM_032145chr631816 1443 1306 ------
NM_032153chr321888 105 ------
NM_032160chr1854232 3282 3228 1286 453 1639 ----
NM_032211chr1021123 230 ------
NM_032233chr143846 684 77 1693 ----
NM_032236chr13923 893 350 ------
NM_032242chr353157 2825 2161 860 749 ------
NM_032281chr1962509 2494 2224 2149 1229 1192 ------
NM_032288chr322162 381 ------
NM_032312chr21613 ------
NM_032357chr22725 41 ------
NM_032361chr53268 68 40 ------
NM_032373chr1055354 4399 4318 1230 548 ------
NM_032403chr541685 1376 1273 668 11771 --11588
NM_032408chr731216 996 797 ------
NM_032434chr271039 536 504 314 219 209 152 ------
NM_032436chr132871 679 ------
NM_032440chr1032255 909 284 ------
NM_032446chr511210 ------
NM_032452chr1431430 297 172 ------
NM_032457chr433495 544 199 ------
NM_032458chrX32656 1035 900 ------
NM_032466chr811697 ------
NM_032468chr811697 ------
NM_032508chrX51340 1179 918 525 438 ------
NM_032509chr83727 618 329 ----11714
NM_032521chr2032032 830 591 ----13016
NM_032538chr672620 1988 1821 1096 543 248 236 ------
NM_032550chr1041091 977 479 467 ------
NM_032562chr10------170
NM_032578chr1011511 ------
NM_032582chr1731488 368 52 ------
NM_032590chr122965 358 ------
NM_032632chr1441986 773 467 53 ------
NM_032682chr343363 3252 753 87 ------
NM_032711chr1743043 2888 1612 1078 --12682 --
NM_032727chr1021431 108 ------
NM_032778chr323067 2667 ----1640
NM_032802chr15196 ------
NM_032827chr221094 96 ------
NM_032830chr16123 129 ----
NM_032833chr142225 942 260 84 ------
NM_032846chr1461479 1256 1203 440 169 28 21467 1039 ----
NM_032859chr1334022 1381 840 23164 468 ----
NM_032873chr1143285 665 242 198 ------
NM_032927chr42465 22 ------
NM_032932chr17106481 6157 6029 4955 4789 3939 1709 1671 1145 951 --25403 476 --
NM_032947chr52256 81 11152 ----
NM_032960chr111148 --1298 --
NM_032966chr1161598 1419 1362 1312 251 35 ------
NM_032975chr1833308 2673 232 --1644 --
NM_032980chr1833308 2673 232 --1644 --
NM_033012chr131704 ------
NM_033014chr921496 659 ------
NM_033020chr164481 4324 4053 4033 3259 881 23666 124 ----
NM_033023chr73519 222 104 ------
NM_033030chr2154 11572 ----
NM_033056chr102131 51 ------
NM_033083chr32686 180 ----1559
NM_033089chr2031452 1114 307 ------
NM_033129chr202699 190 11370 ----
NM_033132chr1321896 502 --147 --
NM_033147chr2181 ------
NM_033148chr2181 ------
NM_033181chr633741 1014 79 ------
NM_033224chr7107422 7176 6214 6064 5444 4902 2561 699 493 330 1506 ----
NM_033225chr852477 2014 537 414 174 ------
NM_033226chr163103 81 62 ------
NM_033228chr51428 ------
NM_033244chr154996 119 104 89 --174 --
NM_033254chr31582 ------
NM_033274chr583601 3420 1375 1294 1042 910 176 167 131 ----
NM_033278chr111408 ------
NM_033331chr943089 920 745 554 ------
NM_033389chr1764367 3740 3283 837 694 561 ------
NM_033394chr221045 298 ------
NM_033401chr162413 59 --1371 --
NM_033425chr1152988 2517 677 226 153 1806 ----
NM_033484chr52629 124 ------
NM_033503chr1572765 1535 1511 1245 1048 1011 336 1289 ----
NM_033505chr286227 4779 4531 4136 1207 1000 927 541 ----16247
NM_033515chr61320 ------
NM_033551chr533435 1317 964 1754 11182 --
NM_033626chrX51480 1370 509 406 392 11400 ----
NM_033631chr1103820 3470 2611 1509 1422 1392 342 334 243 231 ------
NM_033632chr421063 106 ------
NM_033642chrX2926 74 ------
NM_033644chr532084 1713 682 ------
NM_033645chr532084 1713 682 ------
NM_052821chr911972 --1715 21703 1550
NM_052834chr1872227 1820 1609 646 448 69 37 --12365 --
NM_052851chr131269 12139 ----
NM_052862chr121225 457 ------
NM_052867chr1321105 553 ----160
NM_052868chr1139 ------
NM_052879chr1224059 3905 23769 2713 ----
NM_052896chr142068 1909 122 110 ----1906
NM_052904chr621365 88 ------
NM_052905chr221293 381 ----1398
NM_052918chr1072819 2698 2345 1410 1051 1040 957 ------
NM_052936chrX3655 291 33 ------
NM_052978chr1421747 1688 ------
NM_053016chr9115830 5739 5530 5321 5194 5090 2530 2375 284 239 232 ------
NM_053023chr1173330 2621 2155 1307 1050 388 177 12840 ----
NM_053024chr32356 214 ------
NM_053025chr311708 1614 ----
NM_053026chr311708 1614 ----
NM_053027chr311708 1614 ----
NM_053028chr311708 1614 ----
NM_053031chr311708 1614 ----
NM_053032chr311708 1614 ----
NM_053042chr442540 1062 971 492 ------
NM_053043chr775778 5307 4858 1501 466 438 128 12430 ----
NM_053053chr12723 668 ------
NM_054110chr32378 232 ------
NM_057089chr73476 176 102 ------
NM_057169chr1272963 2915 2482 2451 2424 2231 2115 ------
NM_057170chr1272963 2915 2482 2451 2424 2231 2115 ------
NM_057178chr1752512 552 406 305 161 ------
NM_057749chr831240 919 231 ------
NM_058170chr111092 --1220 --
NM_058175chr213785 691 248 ------
NM_078469chr101549 ------
NM_080625chr202464 36 ------
NM_080629chr111499 ------
NM_080630chr111499 ------
NM_080655chr91198 ------
NM_080658chr112110 31 ------
NM_080667chr2164 ------
NM_080676chr2042729 937 751 251 --22665 2038 --
NM_080723chr631295 405 231 ------
NM_080725chr2031834 1681 1575 ------
NM_080742chr61209 ------
NM_080743chr632516 2329 446 ------
NM_080759chr1331642 424 90 ------
NM_080760chr1331642 424 90 ------
NM_080764chr2213217 12000 ----
NM_080840chr202358 179 ------
NM_080841chr202358 179 ------
NM_080872chr843416 3282 2980 220 13459 13707 --
NM_080927chr331015 771 652 12169 ----
NM_130387chr311113 ------
NM_130391chr923208 90 ----1496
NM_130392chr923208 90 ----1496
NM_130393chr923208 90 ----1496
NM_130436chr2142646 1133 915 493 ------
NM_130438chr2133223 1070 264 1284 ----
NM_130811chr203389 272 176 1238 ----
NM_130830chr363988 2650 543 505 394 304 12957 ----
NM_130838chr1521300 729 ------
NM_130839chr1521300 729 ------
NM_133172chr53231 214 123 193 1222 --
NM_133173chr53231 214 123 193 1222 --
NM_133174chr53231 214 123 193 1222 --
NM_133264chr1783575 1336 1305 991 708 573 280 141 ------
NM_133265chrX33373 3053 614 ------
NM_133370chr443282 1177 1076 551 ------
NM_133445chr963763 3634 3340 2674 1267 117 --12785 --
NM_133468chr742024 694 686 676 ------
NM_133476chr1251038 1011 116 82 52 193 ----
NM_133477chr463190 2635 900 508 218 114 ------
NM_133493chr634390 3778 1740 --13720 --
NM_133496chr153336 1325 408 396 282 ------
NM_133499chrX4952 282 259 180 --1874 --
NM_133631chr311667 ------
NM_133634chr2151684 1547 1445 1326 703 --1525 --
NM_133647chr1563744 3491 1331 821 475 52 ------
NM_134268chr1721155 1057 170 ----
NM_134325chr13719 653 629 ------
NM_134442chr221242 594 1360 1618 --
NM_138270chrX2703 262 ------
NM_138288chr1421945 31 ------
NM_138323chr153837 668 267 ------
NM_138338chr2283154 2762 2567 2401 2136 1281 351 333 ------
NM_138395chr23800 225 198 ------
NM_138444chr1363557 1880 1757 676 202 39 33874 3452 414 ----
NM_138459chr663375 2653 2394 1199 414 316 ------
NM_138468chr254237 4010 2023 1251 788 --14535 --
NM_138473chr1264611 4324 3138 1600 1373 1157 1839 ----
NM_138558chr11187 ------
NM_138576chr1484432 4018 3861 3568 3519 3097 3003 1163 ----13256
NM_138609chr51538 ------
NM_138610chr51538 ------
NM_138701chr71314 ------
NM_138713chr16128151 7964 7144 7064 6983 6835 6197 6183 5263 1520 1069 670 12244 ----
NM_138714chr16128151 7964 7144 7064 6983 6835 6197 6183 5263 1520 1069 670 12244 ----
NM_138735chr22455 41 ------
NM_138782chr532342 2066 1551 ------
NM_138811chr721140 820 ------
NM_138923chrX4355 266 40 21 ------
NM_138967chr1541875 1557 677 469 --11691 --
NM_138971chr1153768 3078 2671 1389 997 11408 ----
NM_138971chr1153768 3078 2671 1389 997 11408 ----
NM_138972chr1153768 3078 2671 1389 997 11408 ----
NM_138972chr1153768 3078 2671 1389 997 11408 ----
NM_138973chr1153768 3078 2671 1389 997 11408 ----
NM_138973chr1153768 3078 2671 1389 997 11408 ----
NM_138980chr42505 235 ------
NM_138982chr42505 235 ------
NM_138992chr214825 308 172 93 ------
NM_138994chr162413 59 --1371 --
NM_139015chr12141 --11218 --
NM_139046chr10152 ------
NM_139062chr17162 ------
NM_139068chr5128 ------
NM_139069chr5128 ------
NM_139071chr1231654 1413 334 ------
NM_139135chr12911 207 --21047 363 --
NM_139136chr122182 175 ------
NM_139167chr8--1101 ----
NM_139169chr1031609 806 296 ------
NM_139276chr1752165 1879 1502 918 232 ------
NM_139316chr71874 ------
NM_139323chr2031371 1360 590 ------
NM_144571chr486972 5621 5371 4967 4899 2476 1627 686 ------
NM_144578chr1455356 3578 3369 1071 492 1587 --24241 4200
NM_144579chr232833 841 577 ------
NM_144582chr252212 1925 356 260 150 12567 12280 --
NM_144583chr251528 1311 1181 404 182 ------
NM_144586chr23288 127 93 ------
NM_144590chr1032625 1973 465 ------
NM_144599chr1524190 1521 1542 --188
NM_144628chr2021130 824 --12329 --
NM_144632chr21353 1387 ----
NM_144633chr331484 1081 600 ------
NM_144641chr33292 282 223 ------
NM_144642chr331208 1150 131 ------
NM_144657chrX1494 ------
NM_144660chr102347 126 ------
NM_144664chr1122450 1638 --12010 --
NM_144665chr111100 1182 ----
NM_144671chr1221628 1611 1776 1624 --
NM_144691chr191565 1203 ----
NM_144726chr51227 ------
NM_144767chr1553460 2900 1830 1787 120 14560 13669 --
NM_144979chr4------1540
NM_144982chr124600 181 149 29 ------
NM_145049chr51125 ------
NM_145055chr1863232 2740 659 557 504 462 ------
NM_145117chr1172723 2503 2281 1160 1096 287 140 ----21167 1123
NM_145165chr1452880 2586 848 664 167 22515 793 ----
NM_145166chr362704 1984 1860 1826 808 443 21836 236 11087 --
NM_145185chr192657 368 --2728 434 --
NM_145203chr13----1650 --
NM_145206chr1052260 870 841 775 207 12180 ----
NM_145243chr1147 ------
NM_145259chr236990 5026 587 ------
NM_145261chr32859 669 --1304 --
NM_145268chr71163 ------
NM_145284chrX51986 1727 1584 416 349 11875 ----
NM_145313chr1031155 1096 440 ------
NM_145320chr733335 3169 2969 12674 --1792
NM_145321chr733335 3169 2969 12674 --1792
NM_145322chr733335 3169 2969 12674 --1792
NM_145351chr172586 208 ----1313
NM_145686chr252685 326 139 67 40 ----11248
NM_145687chr252685 326 139 67 40 ----11248
NM_145725chr14167 --180 --
NM_145726chr14167 --180 --
NM_145730chr223843 358 79 ------
NM_145735chr1352331 2001 1926 238 78 ------
NM_145756chr181440 ------
NM_145800chrX161 ------
NM_145808chr722420 542 12171 ----
NM_145891chr1631538 1464 1346 ------
NM_145892chr1631538 1464 1346 ------
NM_145893chr1631660 1586 1468 ------
NM_147147chr643650 1681 1130 233 ------
NM_147189chr811756 32225 288 72 ----
NM_147202chr932729 2239 633 ------
NM_148955chr1565940 5687 2124 1305 794 57 16213 --14259
NM_152221chr22139 --1777 --
NM_152227chr202250 208 ------
NM_152233chr1411484 ----11639
NM_152237chr2221152 419 ------
NM_152263chr185906 5361 5228 5104 2240 1504 906 47 ------
NM_152272chr81310 1883 ----
NM_152275chr251959 1865 1738 737 514 ------
NM_152280chr143491 2818 2803 1356 ------
NM_152300chr1741609 1486 1296 743 ------
NM_152309chr1061905 1648 1492 746 71 51 ------
NM_152332chr1421125 1118 12255 ----
NM_152341chr1651482 1447 1028 405 89 ------
NM_152344chr1731133 608 236 ------
NM_152375chr162110 911 843 788 258 133 --12423 --
NM_152380chr121357 1279 ------
NM_152388chr263649 3636 1614 1289 836 634 13710 --13933
NM_152417chr831203 900 70 ------
NM_152418chr82630 208 11244 ----
NM_152424chrX33870 1359 680 1452 13012 --
NM_152455chr1531748 140 58 ------
NM_152538chr321536 1481 ------
NM_152564chr811687 ----11757
NM_152588chr1221180 481 ------
NM_152594chr1512029 ------
NM_152608chr142188 1966 421 140 ------
NM_152624chr596412 6272 5774 5547 5282 4664 4500 1918 1832 11724 ----
NM_152629chr944069 3731 1584 610 ----11210
NM_152641chr1232598 2243 177 ------
NM_152678chr332398 1970 1922 ------
NM_152694chrX--1176 ----
NM_152699chr363172 3065 2563 2532 848 596 11394 ----
NM_152716chr1131398 512 501 ------
NM_152721chr181182 1164 ----
NM_152723chr111968 ------
NM_152726chr13192 ------
NM_152738chr61364 ------
NM_152745chr71886 ------
NM_152758chr853042 1896 1882 604 143 ------
NM_152765chr82839 337 ------
NM_152787chrX43292 1491 845 814 ------
NM_152826chr1565940 5687 2124 1305 794 57 16213 --14259
NM_152835chr122719 325 --12154 --
NM_152838chr2041146 886 749 463 --21273 540 --
NM_152857chr61363 ------
NM_152858chr61363 ------
NM_152860chr122403 160 1337 ----
NM_152878chr2231575 598 147 ------
NM_152924chr1566810 6227 5882 1395 821 407 --12668 16795
NM_152989chr1231584 1244 638 ------
NM_152991chr111700 ------
NM_153028chr163267 175 23 ------
NM_153029chr1684107 4083 3389 3133 2710 2700 1473 1085 --13931 --
NM_153038chr22607 505 ------
NM_153047chr61361 ------
NM_153182chr323067 2667 ----1640
NM_153184chr331559 490 287 ------
NM_153188chr565436 4389 4251 4114 1641 41 ------
NM_153207chr1233823 3029 187 ------
NM_153246chr611831 ------
NM_153260chr152250 212 ------
NM_153261chr162639 395 145 ----
NM_153262chr183133 2603 2377 1072 1012 727 462 246 ------
NM_153264chr32590 242 ------
NM_153273chr332587 1745 827 11895 ----
NM_153332chr843093 2062 1086 461 12921 ----
NM_153350chr162664 421 --1357 --
NM_153371chr1321457 203 ------
NM_153456chr1375968 5308 5046 4688 4136 1908 143 25979 5502 ----
NM_153487chr664066 3963 3951 3885 1924 803 21230 658 21173 359 --
NM_153490chr17130 ------
NM_153616chr1522134 367 1903 ----
NM_153617chr1522134 367 1903 ----
NM_153618chr1522134 367 1903 ----
NM_153619chr1523372 1159 ------
NM_153620chr741161 431 360 334 ------
NM_153634chr122462 237 ----1340
NM_153688chr1621550 420 11781 ----
NM_153693chr121211 --1233 1825
NM_153715chr7161 --1335 --
NM_153746chr62811 759 ------
NM_153748chr122182 175 ------
NM_153756chr181960 1444 1436 1387 687 676 154 132 ------
NM_153759chr241219 1179 1038 974 ------
NM_153831chr84880 869 87 47 ------
NM_170675chr151349 ------
NM_170676chr151349 ------
NM_170679chr551177 1156 476 249 138 ------
NM_170695chr182142 25 ------
NM_170696chr153398 372 102 ------
NM_170697chr153398 372 102 ------
NM_170706chr143549 3343 3329 89 13432 1258 --
NM_170731chr1132703 425 336 1230 ----
NM_170732chr1132703 425 336 1230 ----
NM_170733chr1132703 425 336 1230 ----
NM_170734chr1132703 425 336 1230 ----
NM_170735chr1132703 425 336 1230 ----
NM_170768chr1141552 1366 1235 600 ------
NM_170782chr11416 ------
NM_171827chr241060 280 87 64 ------
NM_171999chr182330 84 ----1189
NM_172070chr232284 1600 719 ------
NM_172127chr481994 1959 1541 1470 1360 381 112 79 ------
NM_172128chr481950 1915 1497 1426 1316 337 68 35 ------
NM_172373chr1311210 ------
NM_173054chr73849 730 205 ------
NM_173075chr43370 153 108 11138 1335 --
NM_173083chr121015 466 ------
NM_173156chr142252 2070 375 110 ------
NM_173174chr8285 31 ------
NM_173175chr8285 31 ------
NM_173176chr8285 31 ------
NM_173198chr932639 2427 95 ------
NM_173200chr932639 2427 95 ------
NM_173207chr182142 25 ------
NM_173208chr182142 25 ------
NM_173209chr182142 25 ------
NM_173210chr182142 25 ------
NM_173211chr182142 25 ------
NM_173214chr16128151 7964 7144 7064 6983 6835 6197 6183 5263 1520 1069 670 12244 ----
NM_173355chr2198 ------
NM_173359chr32479 29 --1127 --
NM_173470chrX31040 702 420 1287 ----
NM_173485chr20167 ------
NM_173494chrX2673 190 1913 ----
NM_173495chrX12059 12180 ----
NM_173496chr1062014 1114 626 488 248 240 ------
NM_173500chr151925 ------
NM_173508chr111158 ------
NM_173510chr2252691 2369 2107 660 253 1347 ----
NM_173511chr253418 2527 1506 827 355 ------
NM_173515chr62828 75 ------
NM_173517chr71183 ------
NM_173535chr23602 432 54 1399 1190 --
NM_173554chr101285 ------
NM_173557chr181489 ------
NM_173576chr1022178 2090 ------
NM_173595chr1285236 5166 4722 4348 4307 2018 1819 1531 ------
NM_173602chr1263237 3140 2971 2741 1463 1076 13347 --12604
NM_173642chr163318 3219 3180 2505 2075 1054 16159 19218 18288
NM_173644chr2011662 1296 ----
NM_173670chr52964 197 ------
NM_173681chr741874 1667 567 45 1483 ----
NM_173822chr24782 742 407 268 ------
NM_173825chr353079 3013 3005 2975 189 12149 ----
NM_173829chr524550 65 11788 24752 2120 --
NM_174886chr182142 25 ------
NM_174916chr1551750 920 856 692 429 1948 ----
NM_174937chr10----1138 --
NM_175607chr32345 261 ------
NM_175612chr32345 261 ------
NM_175629chr241219 1179 1038 974 ------
NM_175733chr1132188 1482 1471 --11897 --
NM_175736chr12117783 5453 5346 5331 4881 2632 2456 2388 2076 1913 611 --21880 582 --
NM_175748chr1441511 857 186 99 ------
NM_175767chr531775 1258 669 ------
NM_175768chr62645 47 ------
NM_175847chr1931487 1105 329 ------
NM_175856chr53754 329 149 ------
NM_175898chr1551620 1085 321 233 78 ------
NM_175907chr1852303 1090 668 487 331 12102 ----
NM_175931chr1641305 1291 522 370 ------
NM_176801chr461845 1695 1334 1216 556 318 --1432 --
NM_176812chr202626 587 --1697 --
NM_176863chr1752078 1776 1418 1336 791 ------
NM_177553chr111945 ------
NM_177559chr2011203 158 ----
NM_177560chr2011203 158 ----
NM_177947chrX1394 ------
NM_177948chrX1394 ------
NM_177952chr141720 --1297 --
NM_177966chr321907 186 --1141 --
NM_177985chr221899 613 --11770 --
NM_177990chr201771 ------
NM_177996chr2073357 3138 2873 2634 1382 777 202 ------
NM_178006chr131269 12139 ----
NM_178007chr131269 12139 ----
NM_178010chr1231584 1244 638 ------
NM_178011chr1042974 2216 2042 701 ------
NM_178037chr1271442 1085 1051 1005 988 713 361 ------
NM_178038chr1271442 1085 1051 1005 988 713 361 ------
NM_178120chr251298 924 445 428 133 ------
NM_178126chr1732191 1778 537 ------
NM_178140chr532327 1728 30 --11004 --
NM_178151chrX56972 5548 4830 2944 339 12309 ----
NM_178152chrX56972 5548 4830 2944 339 12309 ----
NM_178153chrX56972 5548 4830 2944 339 12309 ----
NM_178191chr161299 1193 1048 425 330 297 --11377 --
NM_178270chrX3655 291 33 ------
NM_178313chr23790 673 113 ------
NM_178326chr251462 1394 648 572 320 122 ----
NM_178424chr51147 ------
NM_178441chr145533 392 107 43 24 --21087 480 --
NM_178470chrX3277 267 79 ------
NM_178493chr17197 ------
NM_178509chr1754052 1498 1149 832 686 13587 13330 --
NM_178554chr332682 1211 293 ----1439
NM_178583chr44935 864 642 190 ------
NM_178586chr1431494 520 315 11869 31558 469 222 --
NM_178815chr1022771 306 11049 ----
NM_178818chr1621962 630 ----125
NM_181310chr631629 1498 1280 ------
NM_181340chr142636 213 ------
NM_181354chr821631 1538 ------
NM_181358chr143556 3315 2885 195 13894 ----
NM_181425chr931190 401 22 ------
NM_181442chr20176 1731 ----
NM_181443chr2022373 2119 ------
NM_181458chr2--1522 147 --
NM_181481chr1865132 4684 4545 4374 2507 2439 24620 1150 14720 12749
NM_181482chr1865132 4684 4545 4374 2507 2439 24620 1150 14720 12749
NM_181483chr1865132 4684 4545 4374 2507 2439 24620 1150 14720 12749
NM_181504chr523315 1399 14115 ----
NM_181521chr1696743 5939 5411 2784 2290 2270 2201 399 108 --134 14806
NM_181523chr523315 1399 14115 ----
NM_181524chr523315 1399 14115 ----
NM_181552chr71777 ------
NM_181672chrX31268 348 273 ------
NM_181673chrX31268 348 273 ------
NM_181674chr5177 ------
NM_181675chr5177 ------
NM_181676chr5177 ------
NM_181677chr5177 ------
NM_181678chr5177 ------
NM_181704chr2151436 968 515 407 81 ------
NM_181714chr63739 369 98 ------
NM_181746chr13973 135 118 ------
NM_181762chrX2404 131 ------
NM_181777chrX2404 131 ------
NM_181782chr622224 1980 ------
NM_181784chr242126 1951 1773 1608 ------
NM_181789chr1562845 2146 2092 1994 231 56 ------
NM_181809chr163915 3433 1493 651 444 149 ------
NM_181828chr2273320 3136 1298 1127 843 312 276 12674 ----
NM_181829chr2273320 3136 1298 1127 843 312 276 12674 ----
NM_181830chr2273320 3136 1298 1127 843 312 276 12674 ----
NM_181832chr2273335 3151 1313 1142 858 327 291 12689 ----
NM_181836chr531781 274 50 ------
NM_181838chr521403 64 ------
NM_181861chr1232440 438 223 12467 ----
NM_181868chr1232440 438 223 12467 ----
NM_181869chr1232525 523 308 12552 ----
NM_181876chr452157 1082 703 686 613 1932 ----
NM_181886chr41296 ------
NM_181887chr41296 ------
NM_181888chr41296 ------
NM_181889chr41296 ------
NM_181890chr41296 ------
NM_181891chr41296 ------
NM_181892chr41343 ------
NM_181893chr41296 ------
NM_181897chr342325 1878 1863 305 --169 --
NM_182314chrX2507 441 ------
NM_182481chr2131341 300 192 ------
NM_182482chr2131341 300 192 ------
NM_182484chr2151436 968 515 407 81 ------
NM_182485chr411412 ------
NM_182487chr984245 3952 3550 3037 2996 1078 955 433 --1594 --
NM_182488chr133917 780 330 ------
NM_182522chr331206 373 285 --1410 --
NM_182540chrX1679 ------
NM_182580chr141723 1611 745 420 --12546 --
NM_182641chr1711789 ------
NM_182646chr411412 ------
NM_182687chr162190 25 ------
NM_182689chr11272 ------
NM_182690chr11334 ------
NM_182691chr71196 ------
NM_182692chr71196 ------
NM_182700chr741692 305 291 50 ------
NM_182717chr1021198 388 ------
NM_182720chr1021198 388 ------
NM_182721chr1021198 388 ------
NM_182722chr1021198 388 ------
NM_182723chr1021198 388 ------
NM_182744chr121299 227 ------
NM_182757chr642988 2275 602 92 1244 ----
NM_182762chr766088 5809 5496 4983 4791 2424 ------
NM_182765chr1032303 2240 1465 ------
NM_182767chr1231679 1474 1344 ------
NM_182789chr51342 ------
NM_182796chr52670 325 ------
NM_182830chr1422151 341 1540 ----
NM_182853chr1021198 388 ------
NM_182898chr746092 4740 2099 54 11721 ----
NM_182899chr746092 4740 2099 54 11721 ----
NM_182907chr632095 2038 434 ------
NM_182948chr132572 1275 917 1685 180 --
NM_182964chr1172723 2503 2281 1160 1096 287 140 ----21167 1123
NM_182970chr2084148 3651 3415 3227 1454 1388 920 341 ------
NM_182972chr132622 902 543 ------
NM_182978chr182770 667 ------
NM_183011chr1021198 388 ------
NM_183012chr1021198 388 ------
NM_183013chr1021198 388 ------
NM_183234chr1531623 1226 410 11684 ----
NM_183235chr1531623 1226 410 11684 ----
NM_183236chr1531623 1226 410 11684 ----
NM_183237chr32285 192 ------
NM_183323chr51342 ------
NM_183360chr2181 ------
NM_183361chr2181 ------
NM_183393chr32701 55 ------
NM_183394chr32701 55 ------
NM_183419chr811325 ------
NM_183422chr1331028 889 345 ------
NM_194247chr253430 2991 2964 1703 461 ------
NM_194278chr1463710 3472 3391 1378 1067 227 23217 1539 1695 --
NM_194285chr1112197 ----11300
NM_194286chr1276252 6113 6090 5371 2130 1592 114 25088 584 ----
NM_194291chr812990 ------
NM_194313chr921885 84 --11631 --
NM_194314chr165589 3874 3470 1758 852 114 ------
NM_194328chr942833 2660 794 171 ------
NM_194329chr942833 2660 794 171 ------
NM_194330chr942833 2660 794 171 ------
NM_194332chr942833 2660 794 171 ------
NM_194356chr1222060 94 1154 ----
NM_194434chr1885330 3715 3492 2050 1773 940 438 249 ------
NM_197941chr521893 317 --193 --
NM_197970chr2154 11572 ----
NM_198047chr22520 445 ------
NM_198066chr1432077 1058 736 ------
NM_198129chr181415 ------
NM_198158chr331954 775 357 ------
NM_198159chr331954 775 357 ------
NM_198177chr331954 775 357 ------
NM_198178chr331954 775 357 ------
NM_198181chr1532796 2107 999 ------
NM_198215chr1041285 514 231 70 ------
NM_198268chr143556 3315 2885 195 13894 ----
NM_198269chr143556 3315 2885 195 13894 ----
NM_198270chrX2911 259 ------
NM_198391chr202385 264 ------
NM_198392chr662367 1859 1813 1506 632 388 ------
NM_198395chr521186 270 ------
NM_198399chr321670 144 ------
NM_198401chr821731 61 --1316 --
NM_198402chr32296 286 ------
NM_198404chr132278 172 ------
NM_198434chr202580 298 127 ----
NM_198436chr202580 298 127 ----
NM_198468chr631538 1475 199 ----1952
NM_198490chr352468 2320 1081 298 42 2840 170 1973 --
NM_198503chr12860 460 --12342 --
NM_198513chr831921 704 698 --11395 --
NM_198581chr267056 4864 4704 1070 676 51 ----11348
NM_198679chr952493 2478 2440 974 825 11846 ----
NM_198700chr113388 207 37 ------
NM_198793chr363352 2520 837 732 654 596 12656 ----
NM_198829chr721003 448 11515 ----
NM_198843chr221467 36 1119 ----
NM_198859chr394838 4636 4372 3907 3883 3866 3694 1054 332 ------
NM_198896chr1142066 594 384 189 ------
NM_198900chr12117783 5453 5346 5331 4881 2632 2456 2388 2076 1913 611 --21880 582 --
NM_198904chr51763 --21342 648 --
NM_198956chr741692 305 291 50 ------
NM_198968chr1323453 3082 ------
NM_198992chr122475 201 --11176 --
NM_199000chr71364 ------
NM_199053chr41961 ------
NM_199144chr2021139 58 --1999 --
NM_199160chr941857 342 228 150 ------
NM_199169chr2083357 3176 3084 2871 2637 2468 2304 2295 ------
NM_199170chr2083357 3176 3084 2871 2637 2468 2304 2295 ------
NM_199171chr2083357 3176 3084 2871 2637 2468 2304 2295 ------
NM_199188chr1224059 3905 23769 2713 ----
NM_199190chr1224059 3905 23769 2713 ----
NM_199191chr2195 ------
NM_199192chr21188 ------
NM_199193chr21188 ------
NM_199194chr2195 ------
NM_199203chr2021139 58 --1999 --
NM_199245chr1282449 2199 2121 1774 1044 503 457 43 11620 --12168
NM_199262chr1741935 747 404 235 --172 --
NM_199324chr452740 2709 2427 1212 589 ------
NM_199327chr42929 872 ------
NM_199344chr1--2176 75 ----
NM_199355chr1651692 1272 1213 1099 369 ------
NM_199436chr241142 750 387 275 ------
NM_199437chr1151976 1942 927 652 47 ------
NM_199438chr1151976 1942 927 652 47 ------
NM_199439chr1151976 1942 927 652 47 ------
NM_199461chr1073122 2950 2679 2637 1257 1170 210 ------
NM_199478chrX22015 410 1765 ----
NM_199483chr201218 ------
NM_201263chr121521 719 --11877 --
NM_201266chr252365 2001 1022 537 241 12667 ----
NM_201279chr252365 2001 1022 537 241 12667 ----
NM_201413chr2121068 753 ------
NM_201414chr2121068 753 ------
NM_201432chr17105794 4443 4351 4000 2063 2024 1054 819 752 597 --35203 4720 294 --
NM_201433chr17105794 4443 4351 4000 2063 2024 1054 819 752 597 --35203 4720 294 --
NM_201568chr142252 2070 375 110 ------
NM_201569chr142252 2070 375 110 ------
NM_201591chr411328 1642 ----
NM_201592chr411328 1642 ----
NM_201599chrX1203 ------
NM_201628chr121135 78 --12784 --
NM_201995chr114673 509 177 138 1475 ----
NM_201998chr114738 574 242 203 1540 ----
NM_203283chr42546 482 ------
NM_203284chr42546 482 ------
NM_203305chr952392 2107 958 660 558 ------
NM_203327chr20114148 4097 1570 984 969 671 407 305 266 210 55 14318 12847 --
NM_203342chr142396 1405 1111 362 ------
NM_203343chr142396 1405 1111 362 ------
NM_203344chr194467 441 199 42 ------
NM_203349chr1541845 1515 177 144 ------
NM_203364chr1111198 ------
NM_203372chr21605 ------
NM_203394chr1221696 97 ------
NM_203406chr512092 ------
NM_203417chr2141432 633 500 84 ------
NM_203418chr2141432 633 500 84 ------
NM_203434chr941175 1122 1046 823 ------
NM_203437chr21298 ------
NM_203446chr2172875 1884 1112 1086 409 380 265 12090 ----
NM_203454chr121220 1038 11104 ----
NM_203458chr153693 3030 2428 1097 792 11503 13089 --
NM_203459chr12919 394 ------
NM_203487chr1321752 628 ------
NM_203499chr173725 282 35 --1195 --
NM_203504chr442348 1854 870 300 ------
NM_203505chr442348 1854 870 300 ------
NM_203506chr1742067 1788 1389 438 ------
NM_205848chr182787 2083 1884 898 739 726 626 166 ------
NM_206594chr133142 2999 851 ------
NM_206595chr133142 2999 851 ------
NM_206832chr171219 1226 ----
NM_206852chr142292 159 ------
NM_206853chr633700 2609 1592 ------
NM_206854chr644961 3870 3383 1195 ------
NM_206855chr645926 4835 4348 2160 ------
NM_206857chr142292 159 ------
NM_206907chr5--13352 ----
NM_206909chr898024 7994 7013 6222 3187 3042 1262 1030 982 11198 ----
NM_206914chr1241777 1410 623 109 12173 ----
NM_207012chr1033480 1211 1046 --11329 --
NM_207015chr32962 881 ------
NM_207042chr1------1579
NM_207045chr1------1579
NM_207046chr1------1579
NM_207119chr1052210 1987 1956 1715 532 ------
NM_207121chr203556 394 382 --1482 --
NM_207171chr131890 1317 793 ------
NM_207303chr1043898 2898 1397 1076 ------
NM_207356chr13555 264 236 ----125
NM_207361chr1365500 3871 2314 1341 867 642 ------
NM_207406chr495390 5366 4611 4110 1961 1884 1446 471 35 --12120 11034
NM_207481chr21386 --11428 --
NM_212464chr1551920 838 377 368 356 11731 ----
NM_212551chr15829 267 237 153 135 ------
NM_213589chr235277 2030 1437 ------
NM_213662chr1742259 1973 1596 326 ------