TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3135b
miRNA Sequence: GGCUGGAGCGAGUGCAGUGGUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000020chr1252366 1633 476 426 299 --11553 1466
NM_000024chr52497 417 ------
NM_000035chr9----129 --
NM_000037chr832257 2046 221 --42306 2284 1948 1571 --
NM_000052chrX32887 2436 2200 1208 ----
NM_000053chr1351776 661 383 250 130 --21790 97 --
NM_000074chrX1916 ------
NM_000080chr172255 229 ----136
NM_000084chrX136911 6371 6248 5810 5765 2601 2473 2397 1832 1773 1724 820 749 --15245 12018
NM_000088chr17----11096 --
NM_000089chr71664 1672 ----
NM_000090chr22714 101 ------
NM_000092chr293913 3762 3552 3309 2921 2895 897 866 647 24503 4025 ----
NM_000093chr931837 1593 850 --22203 297 --
NM_000094chr3--128 ----
NM_000109chrX32584 1061 904 ------
NM_000111chr7--1145 ----
NM_000115chr131277 ------
NM_000125chr684240 4066 2949 1539 1214 876 864 712 ----21578 100
NM_000138chr1512627 1307 ----
NM_000141chr1031275 1120 1097 ------
NM_000161chr1421825 1548 ------
NM_000165chr621640 535 ------
NM_000168chr762523 2493 2412 2263 691 427 12175 11169 --
NM_000176chr593461 3239 3221 3113 3087 2828 1045 859 797 ----1743
NM_000188chr10------135
NM_000192chr1221181 334 ------
NM_000210chr23905 508 45 --1894 --
NM_000214chr20--11272 ----
NM_000216chrX23205 79 12697 --12524
NM_000217chr12104919 4293 4189 3791 3625 3455 3407 2116 2040 1414 24698 1111 24972 1596 1422
NM_000222chr441824 373 97 30 ------
NM_000259chr1596158 6151 4914 2532 2485 1661 1107 980 65 16172 21288 304 --
NM_000264chr941329 882 578 65 1343 ----
NM_000266chrX--1293 ----
NM_000267chr1742387 2268 2163 1357 --1770 --
NM_000276chrX42050 1911 1865 875 31976 1729 1418 ----
NM_000280chr111118 ------
NM_000314chr1053107 3099 2807 293 186 --1569 --
NM_000315chr11135 ------
NM_000321chr1321697 1661 --21377 113 --
NM_000328chrX1128 ------
NM_000332chr6186913 6644 6623 6601 6334 6290 5983 5524 4955 1775 1663 1489 1267 1064 1000 940 542 241 15548 1293 --
NM_000333chr321140 220 ----2453 184
NM_000335chr352120 1791 1528 788 475 --11412 --
NM_000337chr511329 24587 662 25463 5029 --
NM_000340chr331359 1178 1048 ------
NM_000351chrX54066 2912 1732 1302 938 --13931 --
NM_000361chr2071952 1602 1575 1537 1394 1322 442 ----1420
NM_000362chr2233016 2816 966 --12682 --
NM_000368chr993864 3812 3273 3015 1770 1357 1134 458 88 21565 546 --13348
NM_000369chr1451456 1363 1296 752 682 1376 ----
NM_000374chr1153 ------
NM_000378chr111101 ------
NM_000386chr172147 125 --1691 --
NM_000401chr114883 851 287 274 11128 1952 --
NM_000408chr252701 989 753 666 203 --1532 --
NM_000411chr2173253 2863 2826 2455 1310 1296 1269 12033 ----
NM_000419chr17--125 ----
NM_000425chrX------164
NM_000430chr1763478 3364 3276 3260 2747 1313 ------
NM_000434chr6249 35 --1118 --
NM_000435chr192665 173 ------
NM_000439chr51187 1873 11590 --
NM_000441chr7174 12240 11892 --
NM_000447chr1174 ------
NM_000448chr1163059 2891 2670 2475 2410 673 22142 2009 ----
NM_000449chr151257 957 946 400 179 ------
NM_000458chr17----1739 --
NM_000461chr374488 3235 3069 2849 982 450 197 --11375 --
NM_000462chr1531270 571 208 ------
NM_000474chr7158 ------
NM_000484chr211423 ------
NM_000489chrX32900 2366 1273 1901 ----
NM_000492chr711121 --1442 --
NM_000503chr84311 213 198 89 157 ----
NM_000522chr7145 11195 ----
NM_000523chr231148 330 273 ------
NM_000525chr111294 --11449 --
NM_000530chr141139 882 831 328 --1115 --
NM_000533chrX31707 1441 1304 11628 ----
NM_000539chr321222 1083 2611 337 11381 21253 1048
NM_000555chrX105736 3151 3048 2989 2142 1843 1127 992 786 247 1543 ----
NM_000572chr12383 31 --1861 --
NM_000597chr21102 ------
NM_000599chr294167 3124 3076 1622 1559 1347 869 542 416 --43667 3300 573 56 1159
NM_000610chr1142006 717 499 243 12645 1964 --
NM_000615chr113720 569 137 --12611 --
NM_000618chr1265240 2576 2321 1987 1079 333 34104 2197 383 ----
NM_000618chr1265240 2576 2321 1987 1079 333 34104 2197 383 ----
NM_000619chr121355 ------
NM_000633chr18104798 4206 3587 3575 1671 1541 1169 1049 637 179 1777 15156 11641
NM_000639chr11587 ------
NM_000663chr1622435 565 22799 2764 ----
NM_000719chr12186619 6464 6294 5959 5888 5205 5024 5003 4751 4338 4158 4056 2633 2383 1986 501 458 166 --16335 15903
NM_000720chr3--1440 ----
NM_000721chr132463 895 342 --11819 --
NM_000724chr1051821 1727 1530 383 227 ----11471
NM_000725chr125966 859 222 137 61 ------
NM_000726chr241380 977 495 345 11256 ----
NM_000738chr114957 832 738 166 --1862 --
NM_000740chr11191 ------
NM_000756chr81436 ------
NM_000788chr42299 36 1261 146 --
NM_000793chr1454632 4450 4027 540 532 34704 1255 269 ----
NM_000794chr52246 163 ------
NM_000799chr71412 --1133 --
NM_000801chr20166 ----1936
NM_000807chr41676 ------
NM_000810chr152171 40 ------
NM_000812chr41106 ------
NM_000813chr554658 4565 2116 1907 204 15578 21943 1171 --
NM_000814chr1533915 3805 788 13519 ----
NM_000817chr22374 55 11036 --1324
NM_000824chr41278 ------
NM_000826chr42268 88 1246 ----
NM_000827chr541593 826 467 66 --32170 2041 1851 11603
NM_000829chr1141955 1932 460 427 ------
NM_000831chr1135335 4760 4427 4036 2503 1921 1771 1438 1416 1203 776 716 300 1451 25813 5738 11721
NM_000838chr662714 978 651 593 199 56 --12299 --
NM_000839chr32340 160 ------
NM_000842chr111306 1553 ----
NM_000849chr132234 2174 108 ------
NM_000859chr521462 565 --11088 --
NM_000868chrX------12031
NM_000870chr531353 1340 402 21037 165 ----
NM_000875chr1585958 5942 4750 2386 1323 1011 377 117 35598 4843 1907 16427 --
NM_000878chr224754 540 350 106 --1309 --
NM_000879chr51114 ------
NM_000880chr8----1198 --
NM_000883chr71123 --1113 --
NM_000883chr71123 --1113 --
NM_000891chr1711382 22674 1159 ----
NM_000899chr123436 386 344 14008 13058 11624
NM_000903chr1621136 56 ------
NM_000919chr51547 1400 ----
NM_000921chr121520 ------
NM_000922chr111710 --1805 --
NM_000944chr4----11973 --
NM_000945chr211757 174 ----
NM_000949chr52167 46 1744 --1156
NM_000950chrX31452 1379 775 161 ----
NM_000961chr2053852 3741 947 862 397 1464 22503 1497 --
NM_000962chr983073 2744 2625 2323 373 211 183 52 ------
NM_000965chr34989 945 47 41 ------
NM_000984chr171471 ------
NM_000990chr1183853 3474 2772 2676 1512 1394 1316 69 23268 801 11558 --
NM_001001132chr2141390 1243 960 505 1116 ----
NM_001001323chr1212686 --1157 --
NM_001001330chr101893 1418 ----
NM_001001331chr311913 32622 2185 1739 ----
NM_001001389chr1142006 717 499 243 12645 1964 --
NM_001001390chr1142006 717 499 243 12645 1964 --
NM_001001391chr1142006 717 499 243 12645 1964 --
NM_001001392chr1142052 763 545 289 12691 11010 --
NM_001001394chr2--1564 ----
NM_001001395chr1222448 816 ----12612
NM_001001396chr184248 4221 3817 3556 3394 1558 1370 982 11438 41720 1707 1696 1518 --
NM_001001419chr584857 4488 3916 3779 3382 1211 625 406 15111 11545 14725
NM_001001420chr584857 4488 3916 3779 3382 1211 625 406 15111 11545 14725
NM_001001438chr212128 107 ------
NM_001001479chr223787 127 51 ------
NM_001001481chr833220 1328 293 ------
NM_001001484chr104975 177 64 55 ------
NM_001001522chr11----199 --
NM_001001523chr1----3989 941 218 11165
NM_001001549chr762505 1953 831 576 431 245 11750 2942 919 --
NM_001001550chr762505 1953 831 576 431 245 11750 2942 919 --
NM_001001555chr762505 1953 831 576 431 245 11750 2942 919 --
NM_001001664chr254031 3714 3425 1579 48 --1174 --
NM_001001668chr1924276 811 53750 1251 1031 47 26 ----
NM_001001890chr2154281 3479 2936 1141 52 13003 14050 --
NM_001001936chr101474 --1143 --
NM_001001974chr1021876 64 ------
NM_001001995chrX41616 682 162 149 11592 ----
NM_001002233chr842003 869 818 56 1131 2656 383 --
NM_001002243chr22361 112 ------
NM_001002252chr12166 ------
NM_001002296chr84460 176 84 28 ------
NM_001002759chr10--2651 165 ----
NM_001002762chr1042247 700 270 171 --72758 2088 895 534 355 227 165 1384
NM_001002814chr873334 3262 3090 1007 869 818 56 1131 42508 1261 656 383 --
NM_001002838chrX31499 311 141 ------
NM_001002860chr1484318 4023 3753 3546 2968 1271 967 634 13435 21197 623 --
NM_001002909chr1742143 2026 900 589 ------
NM_001002919chr21524 ------
NM_001002926chr732585 2506 256 --12267 --
NM_001003406chr2273136 2967 2411 1177 1008 321 191 --1965 23173 2879
NM_001003679chr12778 210 ------
NM_001003681chr2241418 1367 386 80 ------
NM_001003682chr11563 --21228 256 --
NM_001003698chr63674 651 217 --1657 --
NM_001003699chr63674 651 217 --1657 --
NM_001003712chr1243743 3155 1210 230 --1922 --
NM_001003760chr663289 3175 2775 2572 2517 245 13550 --23452 3314
NM_001003786chr172488 121 --129 --
NM_001003787chr172488 121 --129 --
NM_001003788chr172488 121 --129 --
NM_001003790chr81586 --1293 --
NM_001003791chr81586 --1293 --
NM_001003792chr331154 245 75 ------
NM_001003793chr331154 245 75 ------
NM_001003799chr71632 --1584 1550
NM_001003800chr972516 1367 1360 1115 856 444 122 12277 ----
NM_001003810chr41228 ------
NM_001003895chrY125 ------
NM_001004065chr943353 1404 1385 1346 ----1491
NM_001004196chr341115 1034 858 422 ------
NM_001004304chr1222460 482 12209 2408 327 --
NM_001004317chr641455 705 564 514 11689 ----
NM_001004360chr231434 594 84 1578 ----
NM_001004419chr12----11147 --
NM_001004439chr155419 413 405 354 156 ------
NM_001005207chr17153 ------
NM_001005217chr4176 ------
NM_001005242chr1251594 1553 1212 1105 169 --1426 --
NM_001005291chr17----137 --
NM_001005366chr12----1645 1674
NM_001005375chrY21648 227 ------
NM_001005386chr242088 1874 921 80 ------
NM_001005463chr1032311 2016 51 ------
NM_001005473chr596217 5543 5429 5254 4228 2462 1146 325 153 15067 ----
NM_001005502chr1294323 3487 3435 2048 1709 1051 956 84 58 11257 53840 3476 1535 1033 653 --
NM_001005609chrX143749 3635 3571 3392 3367 3293 3199 2688 2611 1503 1022 369 177 150 --33672 3473 611 --
NM_001005739chr21639 ------
NM_001005746chr241380 977 495 345 11256 ----
NM_001005747chr241380 977 495 345 11256 ----
NM_001005782chr2--1349 ----
NM_001005845chr82419 112 --1205 --
NM_001005861chr32815 114 ------
NM_001005920chr163997 404 123 ------
NM_001006115chr321098 460 12044 11772 --
NM_001006610chr162694 42 ------
NM_001006636chr22172 57 ------
NM_001006684chrX1169 ------
NM_001007023chr1454632 4450 4027 540 532 34704 1255 269 ----
NM_001007094chr1023914 1392 33435 3154 722 23373 1564 --
NM_001007098chr13882 741 345 --1638 --
NM_001007102chr621340 1089 ------
NM_001007156chr1571835 1653 1645 1614 740 377 73 --31680 482 388 --
NM_001007226chr1731189 1033 36 1461 ----
NM_001007227chr1731189 1033 36 1461 ----
NM_001007228chr1731189 1033 36 1461 ----
NM_001007229chr1731189 1033 36 1461 ----
NM_001007230chr1731189 1033 36 1461 ----
NM_001007237chr152876 1139 1011 976 269 --12518 --
NM_001007246chr2131920 1898 1380 ------
NM_001007277chr11--1379 ----
NM_001007466chr645196 1966 406 171 54947 3412 1979 923 30 14919 14441
NM_001007471chr9140 --164 --
NM_001007553chr1----11194 --
NM_001007559chr1831350 699 217 ------
NM_001007565chr31271 ----162
NM_001008220chr5103555 3318 2656 2640 2588 2564 2496 2432 911 365 13003 23650 3488 --
NM_001008225chr71726 ------
NM_001008239chr1853663 2742 2580 2411 1139 11458 187 12902
NM_001008392chr333532 456 110 13491 12835 --
NM_001008393chr442276 739 596 420 1100 ----
NM_001008401chr191438 11429 --11307
NM_001008407chr751368 1310 1292 558 41 --11799 --
NM_001008408chr7155799 5268 5148 5031 4409 4014 3908 1671 1504 1025 912 418 161 131 103 1944 ----
NM_001008495chr81440 22200 54 --12191
NM_001008529chr1731319 852 199 11020 1438 --
NM_001008540chr2--1466 ----
NM_001008564chr1331473 373 194 --1756 --
NM_001008660chr1121121 998 169 1449 --
NM_001008701chr1992633 2576 2552 2506 2444 1950 1022 309 114 ------
NM_001008740chr1127 ------
NM_001008801chr1922107 564 11359 ----
NM_001009185chr51519 142 ----
NM_001009555chr421724 511 ------
NM_001009881chr12402 22 1100 ----
NM_001009882chr12402 22 1100 ----
NM_001009909chr111155 12724 ----
NM_001009923chr201612 162 ----
NM_001009955chr1--1411 ----
NM_001009955chr1--1411 ----
NM_001009958chr72223 216 ------
NM_001009959chr211608 1788 ----
NM_001009993chr294364 3844 3741 3012 2865 1581 1572 1060 556 --1171 --
NM_001010000chr1852895 2602 2173 1108 242 12952 ----
NM_001010852chr6--155 ----
NM_001010853chr621129 1049 22039 864 ----
NM_001010861chr122050 1880 3792 482 417 ----
NM_001010867chr1145874 5742 5642 4716 2078 1901 1855 1748 1532 1506 1366 1219 656 253 1471 56471 5669 4615 1601 1454 14996
NM_001010888chrX53784 3311 1866 1633 501 ------
NM_001010891chr5166801 6447 6252 6058 5920 5762 5637 4634 4600 4292 2332 1683 781 757 498 173 35707 1623 1600 26740 5509 --
NM_001010895chr931488 699 678 --11385 --
NM_001010898chr182990 2861 2679 1318 1252 888 230 148 --13053 23188 629
NM_001010942chr121432 2254 181 ----
NM_001010971chr121020 646 ------
NM_001010986chrX42382 1835 989 751 ------
NM_001011513chr463797 3277 3237 3166 3036 132 --31410 1386 775 --
NM_001011546chr202815 676 ------
NM_001011553chr71258 ------
NM_001011554chr2032090 1971 467 12045 42025 1721 804 135 --
NM_001011657chrX2417 117 ------
NM_001011666chr766097 5656 4488 4372 2137 471 16533 1237 11796
NM_001011708chr232713 2695 385 1864 12399 --
NM_001011713chr1451442 1054 610 439 203 ------
NM_001012264chr145804 775 693 284 194 ------
NM_001012329chr122162 1873 ------
NM_001012393chr1134447 1758 165 34544 1841 1536 21504 1481 23623 896
NM_001012398chr1611035 1329 ----
NM_001012420chr1542792 2549 2331 1058 ----1786
NM_001012423chr1552792 2549 2331 1992 1058 ------
NM_001012755chrX75082 4341 3405 3075 1088 372 361 --14358 --
NM_001012977chrX31292 1196 473 ------
NM_001012989chrX1123 ------
NM_001013031chr1083100 2722 2599 2385 1247 1071 343 117 22378 2212 ----
NM_001013399chr621014 71 --11164 --
NM_001013406chr711694 1120 ----
NM_001013415chr4----1316 --
NM_001013438chr33916 879 83 ------
NM_001013439chr32762 725 ------
NM_001013624chr1741013 323 198 107 --1428 --
NM_001013693chr131864 322 166 --32373 2259 964 --
NM_001013693chr131864 322 166 --32373 2259 964 --
NM_001013839chr1732296 1035 129 1580 32561 2098 355 22212 1606
NM_001013843chr151351 ------
NM_001014380chr1354793 4176 3978 3757 3731 11241 --35322 1581 986
NM_001014434chr11319 ------
NM_001014445chr172831 727 ----1665
NM_001014797chr1057993 6891 5200 2927 1395 --12391 1371
NM_001014839chr11336 ----1935
NM_001014841chr11336 ----1935
NM_001014972chr2146 ------
NM_001015045chr43648 635 124 --1578 --
NM_001015048chr1432923 2175 1102 13127 ----
NM_001015049chr1432923 2175 1102 13127 ----
NM_001015053chr1751278 1179 1164 380 175 --2427 327 --
NM_001015508chr82556 204 ------
NM_001015877chrX1788 --21971 622 --
NM_001015881chrX31227 339 59 --1165 --
NM_001017368chr1762435 2208 2124 2079 287 22 12136 1447 --
NM_001017371chr2--11110 ----
NM_001017392chr195871 846 372 349 275 --11346 --
NM_001017395chr323284 2518 --22857 2456 --
NM_001017415chr11121 ------
NM_001017416chr11121 ------
NM_001017424chr1----1508 --
NM_001017425chr1----1508 --
NM_001017440chr7197049 6562 6150 6110 5886 5643 5161 3301 3243 3031 2927 2738 2294 1876 1410 1178 463 291 210 47104 3275 1526 325 44987 1792 584 171 15602
NM_001017916chr1771765 1466 717 666 238 81 66 --31884 1316 434 --
NM_001017917chr1771765 1466 717 666 238 81 66 --31884 1316 434 --
NM_001017926chr821288 352 ------
NM_001017969chr91498 ------
NM_001017973chr51246 --137 --
NM_001017974chr51246 --137 --
NM_001017975chr11464 ------
NM_001017979chr41705 ------
NM_001018003chr81276 --1487 --
NM_001018050chr22113308 3156 3090 2790 2432 2308 1374 1284 1155 801 354 --1365 --
NM_001018052chr22113308 3156 3090 2790 2432 2308 1374 1284 1155 801 354 --1365 --
NM_001018053chr161780 1454 622 613 425 375 21416 1409 ----
NM_001018056chr9----1198 --
NM_001018057chr1131420 179 159 1535 1479 --
NM_001018060chr22----182 --
NM_001018064chr911529 12041 1399 --
NM_001018067chr143764 3279 1470 723 11896 14216 --
NM_001018068chr143764 3279 1470 723 11896 14216 --
NM_001018069chr143764 3279 1470 723 11896 14216 --
NM_001018074chr593461 3239 3221 3113 3087 2828 1045 859 797 ----1743
NM_001018075chr593461 3239 3221 3113 3087 2828 1045 859 797 ----1743
NM_001018076chr593461 3239 3221 3113 3087 2828 1045 859 797 ----1743
NM_001018077chr593461 3239 3221 3113 3087 2828 1045 859 797 ----1743
NM_001018108chr1572091 1585 1424 920 887 531 448 12238 --12098
NM_001018111chr752432 1245 1085 539 42 ----2468 25
NM_001020658chr141530 1348 604 117 ------
NM_001020658chr141530 1348 604 117 ------
NM_001020825chr53936 562 303 ------
NM_001023567chr1522184 2009 ------
NM_001023587chr32458 40 ------
NM_001024094chr593461 3239 3221 3113 3087 2828 1045 859 797 ----1743
NM_001024455chrX72299 2156 2121 599 255 146 100 ----22312 569
NM_001024596chr1943224 2448 1030 508 13553 1765 --
NM_001024647chr12106833 6796 6654 5781 4854 1605 964 437 303 208 15984 37401 5384 1414 --
NM_001024649chr582467 2316 2107 1980 1927 1869 1048 833 22056 166 1131 --
NM_001024660chr3----1563 --
NM_001024688chr842016 581 375 55 ------
NM_001024847chr352114 1980 1860 980 430 --12360 --
NM_001024858chr1462340 2185 661 531 259 216 12149 12477 1750
NM_001024912chr1921745 277 --178 --
NM_001024948chr131249 622 343 11015 ----
NM_001024959chr31755 --1339 --
NM_001024960chr31755 --1339 --
NM_001025068chr311601 ------
NM_001025069chr311601 ------
NM_001025076chr1064424 1717 1121 956 504 221 34925 1769 1036 25165 2206 --
NM_001025077chr1085782 2479 2314 1862 1579 1214 981 956 36283 5009 2394 26523 228 --
NM_001025079chr332933 329 235 1868 13705 --
NM_001025105chr51552 --1401 --
NM_001025108chr274012 3939 3184 1016 679 368 216 ------
NM_001025205chr31446 ------
NM_001025232chr123285 278 145 ------
NM_001025233chr1252709 2200 1026 902 661 22185 437 ----
NM_001025356chr1282515 2499 2436 2015 689 535 415 149 --12506 --
NM_001025580chrX43481 2823 1090 76 24100 3302 ----
NM_001025596chr111390 --1121 --
NM_001025603chr151257 957 946 400 179 ------
NM_001029858chr652663 2650 1281 883 685 ------
NM_001029863chr662653 2620 2376 1050 617 568 ------
NM_001029864chr2082247 1852 1707 450 310 269 170 33 ------
NM_001029875chr572706 2402 2367 1910 747 722 65 12126 12062 --
NM_001029998chr421130 915 ------
NM_001030007chr1633501 762 466 ------
NM_001030055chr1444731 3904 1523 377 ------
NM_001030272chr111169 --1196 --
NM_001030273chr111169 --1196 --
NM_001030287chr13259 220 101 2473 153 ----
NM_001031679chr1273482 2935 2866 2608 2428 2294 483 --53167 2640 2597 1102 924 --
NM_001031680chr16998 956 466 369 106 82 --1311 --
NM_001031681chr1732259 850 396 12172 11549 --
NM_001031684chr2--11284 11213 --
NM_001031685chr11135 1361 ----
NM_001031690chr782866 1940 1229 847 826 378 181 126 11963 31130 808 297 23062 2313
NM_001031695chr2275158 4273 3583 3400 1879 1518 1222 13350 24988 3611 --
NM_001031702chr34946 773 216 141 ------
NM_001031710chr73701 342 63 1214 ----
NM_001031723chr41414 ------
NM_001031748chr12--1510 ----
NM_001031804chr1644160 3629 452 55 ------
NM_001031812chr521455 300 ------
NM_001032221chr921620 494 --21208 740 --
NM_001032282chr81509 ------
NM_001032290chr12486 29 ----190
NM_001032291chr12486 29 ----190
NM_001032296chr1372374 2017 1841 1132 1046 280 217 ------
NM_001032363chr121490 858 --32253 1392 663 1129
NM_001032363chr121490 858 --32253 1392 663 1129
NM_001032380chr1031484 334 314 ------
NM_001032393chrX2567 31 194 ----
NM_001032394chr652408 2182 719 587 338 --22809 115 11738
NM_001032395chr652275 2049 586 454 205 --12676 --
NM_001032999chr20105071 4481 4455 4188 3934 3839 3578 3472 1452 1094 34608 4328 747 24182 1776 13950
NM_001033025chr13532 192 103 1550 --11527
NM_001033045chr242844 2827 285 40 --23307 599 14162
NM_001033047chr42764 705 1276 ----
NM_001033059chr63580 450 410 ------
NM_001033081chr161395 1222 1181 1174 662 473 --1351 --
NM_001033082chr161395 1222 1181 1174 662 473 --1351 --
NM_001033087chr2032069 617 553 1725 32698 2235 140 --
NM_001033117chr374660 1959 1495 1347 692 675 174 --11860 1238
NM_001033503chr5122 ------
NM_001033507chr111468 --11571 --
NM_001033518chr752683 1869 1067 341 187 --1491 --
NM_001033519chr752683 1869 1067 341 187 --1491 --
NM_001033520chr752683 1869 1067 341 187 --1491 --
NM_001033578chr821516 363 22101 1780 ----
NM_001033602chr1342431 882 501 44 --31803 1025 30 --
NM_001034025chr1231030 974 126 --1667 --
NM_001034837chr52602 23 ------
NM_001034838chr52602 23 ------
NM_001034845chr41899 1482 ----
NM_001035chr121043 887 ------
NM_001035254chr951948 625 503 416 84 21606 799 4844 834 545 132 --
NM_001035260chr1021312 50 1147 ----
NM_001035521chr22812 797 ------
NM_001037132chr761773 890 842 652 449 35 ------
NM_001037133chr761773 890 842 652 449 35 ------
NM_001037164chr711321 ------
NM_001037172chr311381 ------
NM_001037277chr12322 98 ------
NM_001037278chr12322 98 ------
NM_001037317chr122050 1880 3792 482 417 ----
NM_001037324chr3------1199
NM_001037334chr1842404 2195 544 452 1342 ----
NM_001037339chr121533 644 11697 ----
NM_001037340chr121533 644 11697 ----
NM_001037341chr121533 644 11697 ----
NM_001037341chr121533 644 11697 ----
NM_001037494chr12189 ------
NM_001037495chr12189 ------
NM_001037553chr21114852 4780 4562 3705 3465 3365 901 891 271 238 47 --23336 181 --
NM_001037631chr22960 113 --1996 --
NM_001037954chr1143117 2351 1355 529 22692 925 12915 --
NM_001038493chr231173 330 233 --41270 481 360 141 --
NM_001038702chr542488 947 889 59 1900 2793 121 1427
NM_001038707chr142026 1727 295 51 ------
NM_001038707chr142026 1727 295 51 ------
NM_001039091chrX41037 959 380 178 285 24 ----
NM_001039199chr2044942 4861 430 366 11703 23715 1507 --
NM_001039350chr721343 348 --1699 --
NM_001039459chr751104 841 474 216 159 --1143 1132
NM_001039479chr1441912 1853 1779 756 11605 --11844
NM_001039538chr211101 12938 12797 --
NM_001039547chr377735 6650 6611 6379 6329 5728 5146 ------
NM_001039574chr11416 --1872 --
NM_001039577chr184393 4376 3242 1790 1675 700 96 67 --158 11561
NM_001039618chr1145263 4412 1658 1263 24527 1514 ----
NM_001039619chr142305 41 ------
NM_001039690chr1651976 1589 865 687 216 1248 11808 --
NM_001039709chr20105071 4481 4455 4188 3934 3839 3578 3472 1452 1094 34608 4328 747 24182 1776 13950
NM_001039711chr121139 1028 ------
NM_001039712chr121139 1028 ------
NM_001039775chr1----123 --
NM_001039802chr121260 1192 ------
NM_001039840chrX55333 5315 3983 1879 1019 35453 1941 1244 --14926
NM_001039844chr1042837 2664 2453 1896 --21982 1071 --
NM_001039885chr1951350 1041 502 368 199 ------
NM_001039916chr121318 1232 11042 --
NM_001039917chr121318 1232 11042 --
NM_001039918chr121318 1232 11042 --
NM_001039919chr121318 1232 11042 --
NM_001039920chr121318 1232 11042 --
NM_001039937chr1333583 3478 946 12941 ----
NM_001039960chr1241298 383 311 178 --21110 458 --
NM_001040002chr172282 186 --11019 --
NM_001040020chr721541 1097 11470 ----
NM_001040057chr72371 208 ------
NM_001040101chr421539 1076 1195 ----
NM_001040118chr113502 389 26 --1491 --
NM_001040142chr221620 1582 ------
NM_001040143chr221620 1582 ------
NM_001040144chr1651976 1589 865 687 216 1248 11808 --
NM_001040146chr1651976 1589 865 687 216 1248 11808 --
NM_001040152chr784360 1440 1249 1201 1168 1071 773 83 1512 22014 1927 1575
NM_001040153chr13--11008 ----
NM_001040157chr421829 992 21173 239 1941 --
NM_001040158chr53226 145 45 --1390 --
NM_001040172chr531353 1340 402 21037 165 ----
NM_001040173chr531353 1340 402 21037 165 ----
NM_001040179chr61656 1265 ----
NM_001040202chr462319 829 758 588 524 425 12432 ----
NM_001040214chr61949 11726 1710 --
NM_001040284chr1635910 5609 4639 23886 2060 25387 3968 --
NM_001040424chr2172808 2536 1917 1902 934 181 138 12784 22726 669 --
NM_001040429chr13--22823 460 ----
NM_001040436chr12174 --1621 --
NM_001040446chr562178 587 436 380 349 317 --11737 --
NM_001040450chr1522463 537 ------
NM_001040453chr1522463 537 ------
NM_001040455chr1181048 1042 1009 959 902 520 432 138 ------
NM_001040619chr13551 394 22 1603 ----
NM_001040624chr892378 2266 2219 1865 1729 1009 831 492 339 --22211 150 --
NM_001040625chr892378 2266 2219 1865 1729 1009 831 492 339 --22211 150 --
NM_001040626chr892378 2266 2219 1865 1729 1009 831 492 339 --22211 150 --
NM_001040627chr892378 2266 2219 1865 1729 1009 831 492 339 --22211 150 --
NM_001040628chr892378 2266 2219 1865 1729 1009 831 492 339 --22211 150 --
NM_001040629chr892378 2266 2219 1865 1729 1009 831 492 339 --22211 150 --
NM_001040630chr892378 2266 2219 1865 1729 1009 831 492 339 --22211 150 --
NM_001040709chr162238 1847 1617 623 382 63 --42352 2023 513 57 --
NM_001040712chr962991 2786 1236 777 161 103 1366 --13286
NM_001040715chr1631003 992 45 --2366 241 1407
NM_001042355chr1694947 4587 4311 3581 2020 1609 466 200 124 25219 4775 ----
NM_001042403chr12--1949 ----
NM_001042404chr111260 ------
NM_001042406chr6144 ------
NM_001042412chr1694947 4587 4311 3581 2020 1609 466 200 124 25219 4775 ----
NM_001042413chr983969 3592 3192 2536 1634 1588 1250 1035 --13828 1764
NM_001042437chr22841 764 ------
NM_001042453chrX2557 371 --11743 --
NM_001042459chr3121 ------
NM_001042473chr10--1121 ----
NM_001042479chrX11673 --21326 397 --
NM_001042480chrX11673 --21326 397 --
NM_001042492chr1742387 2268 2163 1357 --1770 --
NM_001042494chr1522348 1354 53620 2821 2500 1042 358 13037 --
NM_001042495chr1522348 1354 53620 2821 2500 1042 358 13037 --
NM_001042496chr1522348 1354 53620 2821 2500 1042 358 13037 --
NM_001042497chr1522348 1354 53620 2821 2500 1042 358 13037 --
NM_001042506chrX21206 473 ------
NM_001042537chrX2711 681 11907 ----
NM_001042539chr161293 --1958 --
NM_001042555chr1244278 1271 847 562 24643 1044 12987 1442
NM_001042599chr286410 6176 6020 3124 3039 2946 2549 529 57409 5664 3062 3002 1604 --16556
NM_001042601chr322616 2055 12310 --12069
NM_001042603chr12104823 4678 4045 1854 1481 925 911 350 284 117 14668 ----
NM_001042604chr344052 3876 3783 1447 34779 4182 3300 14151 21767 437
NM_001042632chr2032053 2046 528 --1889 --
NM_001042633chr2032053 2046 528 --1889 --
NM_001042678chr11143 ------
NM_001042679chr11143 ------
NM_001042683chr641370 1306 1168 412 ------
NM_001042749chrX11439 1762 ----
NM_001042750chrX11439 1762 ----
NM_001042751chrX11439 1762 ----
NM_001043318chr1453301 1015 829 660 652 --13238 13404
NM_001043351chr151627 883 600 545 189 ------
NM_001044305chr611525 ------
NM_001044385chr282936 2800 2461 1596 1348 1262 918 870 1193 1840 --
NM_001044387chr1974009 1104 1092 969 869 456 201 --33765 3257 602 --
NM_001044388chr1974009 1104 1092 969 869 456 201 --33765 3257 602 --
NM_001044722chr521455 300 ------
NM_001044723chr521455 300 ------
NM_001071775chr1321709 482 ------
NM_001077628chr11529 --173 --
NM_001083620chr42267 88 1245 ----
NM_001083621chr1104561 4546 4254 3733 3475 3044 1322 1062 734 295 13835 11522 --
NM_001087chr21123 ------
NM_001092chr173377 231 108 --32281 2226 48 1354
NM_001099678chr355885 5131 2179 1169 176 56360 5737 701 673 162 14985 --
NM_001100108chr167042 5937 5288 2994 2677 1520 37266 5805 5765 36296 5661 5218 --
NM_001106chr3118487 8361 8128 7685 7123 6947 6725 6211 2949 1261 1198 37105 3781 3501 17175 11992
NM_001113490chrX43345 2449 2220 574 13432 1943 --
NM_001116chr1672504 2235 2051 1217 1156 258 127 1233 --12552
NM_001117chr1842227 994 677 497 ------
NM_001119chr421537 1253 --11501 --
NM_001121chr101289 ------
NM_001122631chr111541 ------
NM_001126chr12180 131 ------
NM_001128chr1633501 762 466 ------
NM_001130chr19--1706 1171 --
NM_001135chr151284 ------
NM_001140chr172167 27 ------
NM_001144chr16--21205 983 ----
NM_001146chr8182 2566 111 ----
NM_001148chr441661 1513 750 642 --1107 1120
NM_001149chr10--11238 ----
NM_001154chr41178 ----161
NM_001155chr52140 78 ------
NM_001159chr22276 235 ------
NM_001163chr9--1389 --1978
NM_001167chrX55425 5349 4720 2621 2369 --36261 4469 4268 --
NM_001172chr14141 ----1523
NM_001173chr1444731 3904 1523 377 ------
NM_001174chrX12189 --1102 --
NM_001175chr12--2351 61 ----
NM_001177chr12--32069 1968 1603 11587 11535
NM_001178chr111169 --1196 --
NM_001186chr2152118 721 662 650 267 ------
NM_001189chr4----3961 128 42 --
NM_001191chr2041425 1109 1058 66 ------
NM_001204chr2136396 6158 6129 5951 5346 5311 5301 4740 2006 1904 1670 1098 148 --25447 5075 --
NM_001206chr91518 ----1626
NM_001222chr1041505 1486 1342 31 --11778 --
NM_001237chr41293 1952 ----
NM_001237chr41293 1952 ----
NM_001241chr231875 837 737 1179 ----
NM_001241chr231875 837 737 1179 ----
NM_001258chr171405 1114 ----
NM_001259chr776120 4847 4780 1683 735 255 113 12405 ----
NM_001260chr13--1125 ----
NM_001265chr133973 644 34 ------
NM_001270chr51133 ------
NM_001273chr12----1477 --
NM_001278chr102293 89 ------
NM_001290chr4----2938 271 --
NM_001293chr111445 ------
NM_001299chr19----1106 --
NM_001300chr103120 80 41 ------
NM_001304chr1773682 2734 2675 2624 2341 1510 469 1750 23597 1025 --
NM_001310chr1232346 2003 1125 2804 552 ----
NM_001331chr1132233 1997 872 1406 ----
NM_001332chr55630 433 426 244 23 ------
NM_001343chr52486 107 --1238 --
NM_001349chr21234 --127 --
NM_001351chr331153 442 139 --11622 --
NM_001356chrX1671 12280 ----
NM_001357chr1--177 ----
NM_001364chr1133813 3044 1092 --13507 --
NM_001386chr821995 658 --2845 787 --
NM_001387chr5--12875 12940 --
NM_001389chr212421 234 ------
NM_001390chr1812682 13237 11081 --
NM_001391chr18171 ------
NM_001394chr81574 ------
NM_001396chr2112438 1297 2568 546 --
NM_001397chr192525 2136 1905 1026 603 385 132 70 64 --1711 21849 231
NM_001399chrX143749 3635 3571 3392 3367 3293 3199 2688 2611 1503 1022 369 177 150 --33672 3473 611 --
NM_001400chr111173 21038 282 ----
NM_001406chr1761486 1418 1137 547 424 33 --2700 56 --
NM_001408chr141364 1190 522 314 ------
NM_001412chrX33642 3213 399 23347 301 11019 --
NM_001417chr1221496 502 ----1738
NM_001418chr111488 ------
NM_001418chr111488 ------
NM_001419chr19114503 3550 3484 3235 3008 844 729 710 627 572 491 13424 --1702
NM_001423chr1222053 478 --1267 --
NM_001427chr721404 563 11993 ----
NM_001431chr62774 93 ------
NM_001433chr172847 310 ------
NM_001438chr152790 2678 1361 1078 854 --11206 13527
NM_001439chr13532 192 103 1550 --11527
NM_001448chrX21632 1521 ------
NM_001453chr62308 158 ------
NM_001483chr73901 744 274 1236 ----
NM_001493chrX1746 ----162
NM_001494chr101676 1186 ----
NM_001495chr81266 --1491 --
NM_001497chr961894 1706 764 664 604 142 --12581 1617
NM_001498chr62943 339 1521 11231 --
NM_001514chr12467 119 ------
NM_001521chr22812 797 ------
NM_001542chr152876 1139 1011 976 269 --12518 --
NM_001543chr5124766 4547 4436 4308 3510 2956 1896 1466 1311 1286 681 399 --13347 11659
NM_001584chr1111207 ------
NM_001587chrX42050 1911 1865 875 31976 1729 1418 ----
NM_001604chr111118 ------
NM_001609chr1053705 3021 2786 1112 363 1732 ----
NM_001613chr10------131
NM_001616chr243131 2813 2338 862 ------
NM_001621chr741863 1033 720 578 12431 12221 --
NM_001621chr741863 1033 720 578 12431 12221 --
NM_001634chr63580 450 410 ------
NM_001654chrX1153 ------
NM_001655chr1162162 2012 1875 1661 1481 273 --11922 --
NM_001656chr51748 ------
NM_001659chr1292548 2307 2271 2234 1884 1804 1071 901 785 12370 ----
NM_001662chr72312 257 ------
NM_001663chr1431987 899 659 1291 ----
NM_001664chr31398 --1996 --
NM_001665chr111110 --1584 --
NM_001668chr142027 1975 1793 685 --11537 --
NM_001674chr13259 220 101 2473 153 ----
NM_001678chr1731471 1442 424 --11711 21612 742
NM_001679chr31146 ------
NM_001681chr121239 --1519 --
NM_001682chr1212400 ------
NM_001683chr311913 32622 2185 1739 ----
NM_001684chr183965 3938 3534 3273 3111 1275 1087 699 11155 41437 1424 1413 1235 --
NM_001690chr322462 843 ------
NM_001694chr16160 ------
NM_001695chr863423 2636 1700 618 450 88 33872 3449 810 --13334
NM_001699chr1951825 1461 1319 1130 267 ------
NM_001701chr91559 11090 ----
NM_001702chr82522 437 ------
NM_001703chr1----1228 --
NM_001707chr72299 280 1691 1773 --
NM_001709chr1112005 12450 ----
NM_001714chr122379 74 ------
NM_001722chr83555 135 54 --1114 --
NM_001737chr5153 --126 --
NM_001744chr5------160
NM_001746chr582467 2316 2107 1980 1927 1869 1048 833 22056 166 1131 --
NM_001754chr2154281 3479 2936 1141 52 13003 14050 --
NM_001755chr1611952 ----12109
NM_001759chr1264028 4017 3981 3762 3361 1395 14010 ----
NM_001760chr62365 71 --1252 1833
NM_001769chr121309 ------
NM_001777chr332933 329 235 1868 13705 --
NM_001783chr192302 88 --151 --
NM_001788chr71258 ------
NM_001791chr121260 1192 ------
NM_001792chr181754 ------
NM_001800chr192484 395 ----122
NM_001830chrX43774 3162 1508 1122 ------
NM_001845chr131416 ------
NM_001851chr61125 ----1102
NM_001858chr641308 1097 888 745 14908 ----
NM_001859chr943295 2774 857 814 --43813 3530 761 426 --
NM_001865chr6142 ------
NM_001874chr1294323 3487 3435 2048 1709 1051 956 84 58 11257 53840 3476 1535 1033 653 --
NM_001891chr41345 ------
NM_001892chr51552 --1401 --
NM_001893chr172285 122 --1304 --
NM_001894chr222871 235 ------
NM_001895chr2041222 1035 428 97 ------
NM_001901chr6----1425 --
NM_001903chr52359 205 ------
NM_001915chr1771765 1466 717 666 238 81 66 --31884 1316 434 --
NM_001918chr157385 5918 5835 5664 1354 33158 3048 2860 78682 8327 6206 2605 1872 1105 545 12043
NM_001923chr111230 ------
NM_001931chr1121286 288 ----11107
NM_001936chr721343 348 --1699 --
NM_001945chr52905 340 --1478 --
NM_001946chr123955 440 286 --1915 146
NM_001949chr672751 2325 2134 1232 759 232 132 12415 23201 524 --
NM_001954chr61706 --1283 --
NM_001961chr191190 1415 1456 --
NM_001962chr52161 137 ------
NM_001964chr51924 --2839 217 --
NM_001965chr22128 116 2394 166 ----
NM_001969chr1493353 3207 2933 2592 2417 1106 882 484 309 13822 ----
NM_001975chr12----1797 --
NM_001977chr421507 668 ------
NM_001981chr122082 1667 ----1932
NM_001987chr1274144 3777 2826 2669 1637 1482 696 ------
NM_001995chr411168 --1584 --
NM_002006chr475501 5421 5242 3627 3530 2163 739 24162 133 ----
NM_002009chr1522342 1897 21089 33 ----
NM_002015chr1331181 737 36 ------
NM_002023chr141610 1519 1059 213 ------
NM_002024chrX2864 239 22046 472 ----
NM_002025chrX128380 8319 7401 7337 6475 3255 3057 2740 2679 1468 849 491 37821 3720 3395 --123
NM_002037chr6----1296 --
NM_002040chr2132941 2675 350 --12272 --
NM_002052chr821199 112 1337 1389 1226
NM_002061chr1----21949 1474 --
NM_002069chr71236 11410 ----
NM_002070chr32771 160 --2927 352 --
NM_002074chr111359 11437 ----
NM_002076chr1232442 724 689 22698 959 ----
NM_002077chr931705 1519 1357 --41940 1797 1535 265 --
NM_002080chr162884 115 1729 2801 44 --
NM_002086chr1731952 532 501 --21498 876 --
NM_002092chr453773 3110 857 191 85 24123 343 24383 3630 --
NM_002099chr431944 157 56 ------
NM_002103chr195778 213 180 88 45 --31019 159 153 --
NM_002106chr4271 57 ------
NM_002112chr152260 39 1207 ----
NM_002114chr61485 --1161 --
NM_002129chr4199 ------
NM_002130chr52444 27 ------
NM_002134chr16----165 1565
NM_002135chr123439 380 134 ------
NM_002137chr751876 924 820 772 77 11637 ----
NM_002138chr41228 ------
NM_002140chr91992 ------
NM_002146chr1741390 1240 582 562 11018 --1266
NM_002148chr2161 1444 ----
NM_002156chr2178 ------
NM_002157chr21130 ------
NM_002160chr9--1241 ----
NM_002182chr342803 2385 2099 42 --1682 --
NM_002184chr51165 ----131
NM_002193chr231314 279 62 ------
NM_002199chr4----1184 1153
NM_002202chr511077 ----1438
NM_002204chr1731252 1112 122 ------
NM_002214chr784964 4946 4905 4887 4765 4110 3648 1743 34379 2066 637 11849 --
NM_002223chr1263718 3438 3292 1354 962 584 ----13551
NM_002227chr121018 134 1846 ----
NM_002230chr175832 809 701 421 52 ------
NM_002232chr141383 994 851 87 --1952 --
NM_002247chr102521 261 ------
NM_002252chr21114 ------
NM_002253chr4--11421 --11063
NM_002254chr241704 1572 564 335 --1624 --
NM_002264chr373357 3337 3222 631 588 523 463 11347 2625 174 --
NM_002265chr1731161 796 393 ------
NM_002267chr1322049 959 --2747 294 --
NM_002269chr63384 372 45 ------
NM_002270chr524391 44 13918 1245 --
NM_002271chr1341822 905 583 576 ------
NM_002282chr12----1222 --
NM_002285chr274012 3939 3184 1016 679 368 216 ------
NM_002290chr61363 --1977 --
NM_002293chr162710 2526 1829 1112 645 454 1988 22532 1086 12340
NM_002296chr12647 41 ----11474
NM_002298chr1351588 1542 1077 273 64 ------
NM_002310chr595281 5249 5221 2636 1977 1655 1088 890 22 1930 --11256
NM_002333chr1941226 985 286 104 1447 ----
NM_002350chr82979 800 11022 ----
NM_002351chrX--1138 ----
NM_002355chr123196 122 21 --185 --
NM_002356chr621043 1008 ------
NM_002360chr742401 1923 827 538 1386 12368 --
NM_002374chr211101 12938 12797 --
NM_002382chr1421100 219 --1349 --
NM_002383chr162376 116 --1781 --
NM_002384chr18--2640 338 1167 --
NM_002387chr545051 4119 4039 3918 23687 282 11498 1463
NM_002390chr1732078 105 72 --21640 1597 --
NM_002397chr511410 ------
NM_002399chr1521021 420 ------
NM_002401chr1722182 695 --1226 --
NM_002402chr711029 ------
NM_002419chr111495 --130 --
NM_002430chr2261829 1689 776 700 297 139 ------
NM_002451chr953754 3533 2968 938 44 1482 ----
NM_002473chr224888 370 200 155 ------
NM_002479chr13536 235 201 ------
NM_002480chr1221437 391 ----1295
NM_002481chr1177742 7719 7385 6813 6642 6329 3165 3006 2085 1758 1703 1637 1374 1224 436 134 65 --35899 2297 379 --
NM_002485chr842016 581 375 55 ------
NM_002489chr7146 ----1410
NM_002499chr1531700 873 155 ------
NM_002500chr221298 977 ------
NM_002501chr1953291 3263 1499 1449 557 --54123 3909 2960 610 191 --
NM_002505chr631088 484 51 --21031 606 --
NM_002519chr1121132 434 ------
NM_002522chr1753269 2887 1552 1180 1169 --1909 1990
NM_002524chr12825 104 ------
NM_002527chr121215 ----1120
NM_002545chr1134447 1758 165 34544 1841 1536 21504 1481 23623 896
NM_002547chrX64181 3470 3271 3092 1206 44 23905 1313 ----
NM_002563chr32844 386 1450 ----
NM_002568chr8--2282 166 ----
NM_002581chr9114711 4227 3988 3872 1568 1489 1428 1240 792 698 272 --14296 12274
NM_002583chr12--1127 ----
NM_002588chr531431 1094 543 ------
NM_002594chr2022505 2078 ------
NM_002600chr121533 644 11697 ----
NM_002605chr151230 1370 1834 --
NM_002608chr2231542 1275 460 --1203 11262
NM_002610chr242972 1973 829 271 ------
NM_002613chr1685115 4501 4325 3952 1813 1264 721 80 13456 1974 --
NM_002616chr172431 24 ------
NM_002628chr31853 1352 ----
NM_002644chr131675 1152 45 ------
NM_002645chr1132920 453 312 --12398 --
NM_002648chr631200 197 144 1255 2463 68 --
NM_002651chr13737 274 257 --1597 --
NM_002655chr864943 4370 4312 3959 802 499 ------
NM_002656chr61855 ------
NM_002657chr20103703 3549 2755 836 695 373 230 177 165 122 33744 1410 569 33060 2878 1391 --
NM_002668chrX1150 ------
NM_002687chr1431253 446 286 ------
NM_002693chr15177 ------
NM_002698chr1932568 1180 890 ----2695 170
NM_002709chr232367 627 84 --12272 --
NM_002711chr72827 93 ------
NM_002715chr53959 849 838 ------
NM_002716chr1163686 3588 3482 3092 2601 327 1875 23527 1333 13464
NM_002717chr81106 160 ----
NM_002719chr142669 661 ------
NM_002721chr91373 1412 ----
NM_002730chr192968 136 --31135 384 317 --
NM_002731chr132355 2220 1095 1735 ----
NM_002733chr122234 219 ------
NM_002734chr1742173 792 591 377 --1894 1905
NM_002736chr731715 627 489 --11568 --
NM_002738chr1611014 11158 --1741
NM_002740chr332184 1831 197 ------
NM_002745chr22124467 4383 4123 4111 4024 3484 3078 1113 572 401 251 182 24548 1492 189 --
NM_002752chr51402 1363 ----
NM_002753chr42287 166 ------
NM_002765chrX41037 959 380 178 285 24 ----
NM_002814chrX1184 ----1291
NM_002819chr1961409 1288 1007 949 908 52 --1580 --
NM_002822chr1221621 46 ------
NM_002823chr2--1485 ----
NM_002826chr15887 873 699 296 42 --1140 --
NM_002830chr2------1135
NM_002833chr152631 493 ------
NM_002837chr1273739 3564 2798 1277 1090 621 360 24482 3494 ----
NM_002839chr962991 2786 1236 777 161 103 1366 --13286
NM_002840chr161499 624 606 587 86 44 --1599 --
NM_002841chr3180 ------
NM_002843chr1132737 1380 431 --22990 1083 --
NM_002844chr631354 1061 460 ------
NM_002845chr181473 ------
NM_002849chr123897 718 163 ------
NM_002850chr1921191 438 ------
NM_002855chr1152527 938 738 329 86 11044 1750 --
NM_002857chr1112489 2123 2070 2042 1910 1748 633 605 513 246 172 --22549 1777 22539 2507
NM_002858chr141193 421 361 29 1408 ----
NM_002868chr1241938 1757 1671 468 ----1165
NM_002869chr1161434 794 613 235 103 29 1227 ----
NM_002874chr912425 ------
NM_002880chr36763 682 607 587 79 22 ------
NM_002886chr3125183 4804 4326 4235 3416 3379 1577 1351 1210 1068 551 332 --14154 --
NM_002890chr52113 60 135 ----
NM_002892chr1421476 126 1516 ----
NM_002893chrX--1135 ----
NM_002911chr1941437 1361 1353 654 --21597 1300 --
NM_002912chr6------1258
NM_002918chr194914 895 380 260 --190 --
NM_002923chr1194 ------
NM_002926chr421175 44 ------
NM_002938chr461785 1538 1403 1354 278 229 1650 3772 164 58 --
NM_002942chr311003 11014 ----
NM_002945chr172594 262 ------
NM_002955chr63674 651 217 --1657 --
NM_002956chr123541 375 85 ------
NM_002958chr32815 114 ------
NM_002959chr184109 4032 3645 3631 3300 1692 1192 76 --13160 22765 390
NM_002968chr162834 360 ------
NM_002998chr812248 ------
NM_003010chr17124 ------
NM_003011chr91370 --149 --
NM_003012chr843162 2973 2196 125 1874 12742 --
NM_003013chr43577 63 37 --1107 --
NM_003016chr1751823 1772 1741 1473 357 ------
NM_003026chr931227 836 119 ------
NM_003031chr162694 42 ------
NM_003034chr1277518 6845 5938 3259 3214 3191 156 15848 12351 17281
NM_003043chr374003 3370 3248 3213 3181 2695 921 22851 454 33361 3015 2790 --
NM_003045chr13104587 4207 4096 2022 1755 1432 766 557 202 185 14415 33491 1308 753 44674 3783 3333 3217
NM_003051chr11308 --11647 --
NM_003054chr10155 ------
NM_003060chr54894 413 193 84 ----11028
NM_003062chr5----138 --
NM_003069chrX1223 ------
NM_003070chr9--1827 ----
NM_003071chr331641 495 254 ------
NM_003074chr332142 1823 909 ------
NM_003076chr1261185 1161 1090 366 261 101 11281 ----
NM_003077chr17--1213 3679 650 124 1688
NM_003096chr21176 ------
NM_003108chr2116821 6475 6304 4855 4472 2860 2561 2454 2109 521 437 37044 6757 5990 32881 2209 1829 --
NM_003110chr17------1762
NM_003111chr2--11110 ----
NM_003112chr73762 132 27 --12835 --
NM_003113chr23574 314 167 ------
NM_003118chr532052 809 788 ------
NM_003128chr231911 985 311 31817 1109 54 ----
NM_003131chr621589 612 --2533 153 --
NM_003137chr632087 1813 652 ----21787 1399
NM_003139chr11197 1159 ----
NM_003144chr62747 578 ----11999
NM_003150chr1772396 1939 1481 945 936 903 114 ----11928
NM_003155chr852238 1803 1116 887 774 --1326 --
NM_003156chr1141166 491 308 254 ------
NM_003161chr172554 127 1445 23508 954 --
NM_003162chr22978 27 ------
NM_003164chr11----1476 --
NM_003173chrX41354 1229 239 174 ------
NM_003174chr101294 ------
NM_003175chr1----129 --
NM_003178chr351728 880 707 281 231 ------
NM_003179chrX51368 984 578 462 364 ----1420
NM_003182chr7127 ------
NM_003182chr7127 ------
NM_003186chr11----199 --
NM_003189chr1103289 2583 2558 2298 1092 1049 599 558 513 64 1375 ----
NM_003194chr61556 ----1492
NM_003199chr181850 23551 159 1926 --
NM_003201chr102928 133 ------
NM_003202chr521615 246 11168 21645 1193 11260
NM_003204chr1721539 475 ------
NM_003211chr124669 634 228 106 ------
NM_003214chr621324 575 11143 1308 1316
NM_003216chr2263155 3031 2964 1107 864 781 --1352 --
NM_003217chr1231927 1382 311 --21621 1293 1683
NM_003221chr644179 3233 3097 1553 --12786 --
NM_003234chr352309 2126 2052 1688 239 ------
NM_003239chr145776 435 391 234 122 ------
NM_003242chr352114 1980 1860 980 430 --12360 --
NM_003246chr1541433 432 275 197 ------
NM_003247chr62728 170 124 --194
NM_003253chr2141682 1554 1462 613 --11747 --
NM_003255chr1742045 694 630 65 --12108 --
NM_003262chr343679 1959 1277 894 --13469 23213 645
NM_003269chr63531 120 88 21225 155 ----
NM_003274chr2121193 96 --185 --
NM_003275chr921294 1032 31259 1150 281 1937 --
NM_003286chr201222 ------
NM_003288chr202555 73 ------
NM_003290chr1921216 219 11046 1965 --
NM_003291chr13--1111 ----
NM_003292chr152275 1745 844 523 465 ------
NM_003298chr3116101 4513 4362 4318 3986 3823 2483 1389 781 707 42 --15191 24003 874
NM_003304chr321217 587 1446 ----
NM_003305chr4------1360
NM_003320chr1183979 3649 3273 3136 2764 683 666 538 11385 1318 1424
NM_003337chr531197 421 129 --21585 481 --
NM_003338chr10----1264 --
NM_003339chr521115 1016 --11555 --
NM_003340chr441356 1162 180 83 1419 ----
NM_003342chr172859 239 --13090 12317
NM_003347chr2212108 124 41784 625 593 539 --
NM_003348chr1231599 1244 123 --1472 11323
NM_003350chr81105 ------
NM_003352chr2--1349 ----
NM_003359chr431283 845 50 ------
NM_003363chr31546 ------
NM_003368chr11121 ------
NM_003369chr1152604 1915 1752 1092 244 ------
NM_003371chr91346 11962 271 52 --
NM_003373chr1031762 391 269 ------
NM_003374chr55633 161 140 123 56 --1643 --
NM_003375chr101400 ------
NM_003383chr9----1198 --
NM_003387chr22509 199 --1217 11987
NM_003390chr112244 74 ------
NM_003392chr353528 1557 773 428 391 1967 ----
NM_003394chr122290 59 ----1673
NM_003403chr14145 ------
NM_003404chr2021762 1391 --11367 --
NM_003409chr1841285 923 445 293 ------
NM_003410chrX32604 1943 1030 11971 12217 --
NM_003411chrY11585 2565 510 ----
NM_003412chr342680 2619 1086 964 --11100 --
NM_003413chrX21918 1682 ------
NM_003417chr19139779 8802 8778 8770 8750 7169 6818 6657 6246 2504 2195 930 370 39036 8726 3047 59338 6199 6149 3342 142 18907
NM_003421chr1023914 1392 33435 3154 722 23373 1564 --
NM_003439chr763464 3322 2655 2570 2226 1070 11412 33159 2812 2492 --
NM_003442chr111664 ------
NM_003445chr19----2543 328 --
NM_003458chr393992 3395 3256 2543 1151 886 535 334 266 12911 13787 23178 2873
NM_003467chr2--1466 ----
NM_003468chr264212 3684 2793 877 639 487 12718 --13263
NM_003470chr1631561 1439 424 --2549 84 198
NM_003471chr331753 305 115 ------
NM_003478chr1142972 2511 2442 385 --12379 12942
NM_003482chr1232501 913 242 --21020 394 --
NM_003483chr1242879 2205 2196 630 ------
NM_003485chr1431395 338 116 --146 --
NM_003488chr172741 102 ----1967
NM_003498chr1642008 397 275 188 --11109 1811
NM_003507chr21546 --11267 --
NM_003559chr17103547 2830 2723 1304 1234 1101 1028 943 488 372 ------
NM_003563chr1731189 1033 36 1461 ----
NM_003564chr11130 ------
NM_003566chr121933 ----1926
NM_003576chr1372374 2017 1841 1132 1046 280 217 ------
NM_003583chr1253228 2978 900 548 414 1126 1858 --
NM_003586chr16--146 ----
NM_003590chr262816 1224 897 576 353 183 ------
NM_003603chr462110 2022 1849 1512 345 332 11613 ----
NM_003618chr22104 30 ------
NM_003620chr17--1133 ----
NM_003626chr11184 --11089 --
NM_003629chr133078 2727 185 13202 23161 1387 23505 610
NM_003632chr173837 305 29 --1738 --
NM_003644chr17146070 4704 4485 4468 2435 2391 2066 2017 1212 858 841 461 377 134 26029 4067 1359 --
NM_003655chr172714 488 1552 ----
NM_003659chr22277 225 ------
NM_003663chr332770 2549 491 ------
NM_003670chr341357 1104 440 382 ------
NM_003671chr973182 2701 748 706 348 207 37 --12768 12231
NM_003677chr1211952 --12301 --
NM_003692chr92915 142 ------
NM_003709chr2178 ----1313
NM_003716chr31832 ------
NM_003718chr7152 --1390 --
NM_003722chr332651 1820 733 ------
NM_003735chr531431 1094 543 ------
NM_003736chr531431 1094 543 ------
NM_003743chr282170 1925 1896 1849 1829 1803 617 108 ----21919 522
NM_003746chr12189 ------
NM_003748chr141271 1152 416 26 --175 --
NM_003749chr133973 595 78 ------
NM_003750chr102971 292 ------
NM_003760chr11564 ------
NM_003766chr171173 ------
NM_003768chr131513 181 65 21726 1181 ----
NM_003769chr12173 ------
NM_003787chr1831061 335 215 ------
NM_003791chr162106 100 ------
NM_003794chr31121 ------
NM_003795chr63491 194 108 ------
NM_003806chr122230 105 ------
NM_003812chr21256 ------
NM_003816chr82501 33 ------
NM_003829chr93821 362 94 ------
NM_003831chr1851233 696 685 466 21 --11203 --
NM_003845chr12178 ------
NM_003858chr143705 564 246 ------
NM_003861chr1452744 2720 2446 913 180 --1538 --
NM_003872chr282376 2321 2280 934 600 513 472 394 140 ----
NM_003873chr1041950 1664 894 587 ------
NM_003877chr122931 180 ----1345
NM_003884chr321610 575 ------
NM_003885chr1731985 1884 1724 189 ----
NM_003887chr251840 913 681 552 417 --11783 --
NM_003888chr1541355 1336 1265 388 21559 270 ----
NM_003895chr213842 776 336 11661 --1755
NM_003896chr22841 764 ------
NM_003899chr1362341 1047 1016 578 417 299 12097 ----
NM_003901chr1061873 1865 861 463 41 34 22730 917 1284 --
NM_003902chr1--2560 247 ----
NM_003913chr644127 2959 1324 750 14002 23786 2846 1100
NM_003934chr911019 ------
NM_003939chr1074027 4004 2956 1650 808 324 215 --13357 --
NM_003941chr732403 1970 1912 --12318 --
NM_003945chr5----1398 --
NM_003953chr132857 2791 940 21133 371 ----
NM_003966chr596965 6424 6291 6216 3078 1923 1167 765 84 --17718 --
NM_003971chr171213 ------
NM_003972chr10--2124 61 ----
NM_003983chr1643478 1353 899 200 23628 800 --11362
NM_003993chr1150 ------
NM_003994chr123436 386 344 14008 13058 11624
NM_004006chrX32584 1061 904 ------
NM_004007chrX32584 1061 904 ------
NM_004009chrX32584 1061 904 ------
NM_004010chrX32584 1061 904 ------
NM_004011chrX32584 1061 904 ------
NM_004012chrX32584 1061 904 ------
NM_004013chrX32584 1061 904 ------
NM_004014chrX32584 1061 904 ------
NM_004015chrX32584 1061 904 ------
NM_004016chrX42498 1021 975 818 ------
NM_004017chrX32584 1061 904 ------
NM_004018chrX42498 1021 975 818 ------
NM_004020chrX32584 1061 904 ------
NM_004021chrX42498 1021 975 818 ------
NM_004022chrX42498 1021 975 818 ------
NM_004023chrX42498 1021 975 818 ------
NM_004024chr15618 579 460 303 22 1512 ----
NM_004033chr52140 78 ------
NM_004035chr1734921 1604 32 14638 ----
NM_004036chr21237 ------
NM_004050chr1442471 1100 688 242 ------
NM_004056chr83314 143 100 ------
NM_004068chr31446 ------
NM_004077chr1231341 903 294 11161 ----
NM_004081chrY21648 227 ------
NM_004082chr22342 124 ------
NM_004085chrX1612 ------
NM_004087chr321932 416 ------
NM_004089chrX31227 339 59 --1165 --
NM_004093chr133891 622 479 --22133 601 --
NM_004094chr1422743 296 183 32475 1962 885 --
NM_004096chr1021545 1445 ------
NM_004097chr22824 322 --2748 578 --
NM_004099chr962073 2042 1948 1671 428 406 ------
NM_004100chr622005 133 ------
NM_004102chr13591 521 140 ------
NM_004103chr8188 ------
NM_004112chr1731379 1216 638 11316 11759 --
NM_004113chr311663 21609 76 12005 --
NM_004124chr1452806 2261 2216 2201 235 ------
NM_004132chr1051091 968 333 93 84 ------
NM_004133chr812110 12482 ----
NM_004134chr53603 234 86 ------
NM_004162chr311030 --1882 --
NM_004170chr931398 1299 127 1649 1510 --
NM_004171chr11108761 7368 7013 6035 6011 3392 2032 1753 464 365 38337 6407 1864 16865 17152
NM_004176chr17----137 --
NM_004181chr4186 ------
NM_004193chr10190 --1395 --
NM_004199chr51246 --137 --
NM_004200chr1162762 2158 1186 1038 313 193 --1391 --
NM_004225chr81508 --11049 --
NM_004227chr772655 2586 2319 2284 811 214 121 --22014 1950 --
NM_004228chr19----1116 --
NM_004229chrX4697 570 69 63 ------
NM_004231chr72270 39 ------
NM_004238chr21310 ------
NM_004261chr11299 ------
NM_004263chr221602 1511 --21590 1415 --
NM_004267chr3--1340 ----
NM_004274chr1433192 2831 1156 1243 1306 --
NM_004279chr7--1326 11991 --
NM_004280chr6161 ------
NM_004287chr1762406 2294 2246 2010 1996 851 ------
NM_004293chr943850 2817 1107 471 12964 ----
NM_004295chr1731245 925 514 --1172 11218
NM_004296chr1443212 3105 2935 710 1435 12769 1584
NM_004311chr1042861 782 503 323 1159 2852 109 --
NM_004319chr143127 1132 763 165 --1867 --
NM_004323chr972451 2388 2076 669 521 361 87 1224 12054 --
NM_004326chr1276 46 1894 ----
NM_004329chr1021201 29 --1299 --
NM_004331chr812092 32038 1703 132 ----
NM_004349chr821268 959 --21015 1009 1133
NM_004350chr16998 956 466 369 106 82 --1311 --
NM_004362chr4--1110 ----
NM_004364chr191267 --21212 39 1859
NM_004365chr51313 ------
NM_004384chr521455 300 ------
NM_004385chr52227 38 --1264 --
NM_004393chr352062 1803 900 799 418 ------
NM_004397chr1144188 2979 2854 2652 ----23903 889
NM_004419chr105997 784 734 242 158 ------
NM_004420chr1152297 910 787 552 252 11596 62364 2334 2215 2135 2105 2025 --
NM_004423chr392658 2109 2077 1018 928 751 710 654 407 --11947 1898
NM_004426chr1231998 1816 429 ------
NM_004427chr14784 770 427 313 --2468 275 --
NM_004429chrX11336 ------
NM_004430chr842048 1978 1934 259 --21031 37 --
NM_004432chr941726 1474 371 288 --11480 --
NM_004437chr153533 2562 2400 693 95 --2745 298 --
NM_004438chr252648 2576 2550 2154 546 11053 22200 1066 --
NM_004439chr41170 ------
NM_004443chr32305 148 --1485 1268
NM_004449chr21----11102 --
NM_004450chr141272 --1115 --
NM_004451chr11----1505 --
NM_004454chr322177 512 ------
NM_004458chrX32312 1744 59 ------
NM_004459chr173538 470 346 ------
NM_004463chrX141 --169 --
NM_004468chr14609 555 236 122 ----1143
NM_004475chr1731080 982 802 ----251 28
NM_004480chr142831 65 ------
NM_004481chr132555 821 262 ------
NM_004484chrX----1121 --
NM_004491chr1944153 4123 1550 311 1715 21680 254 --
NM_004494chr131070 292 198 ------
NM_004499chr52174 166 ------
NM_004500chr1441417 1332 754 533 11428 --1102
NM_004501chr164150 4028 3522 1615 1609 798 ------
NM_004504chr2------1175
NM_004519chr8--1199 ----
NM_004520chr5162 ------
NM_004527chr172282 186 --11019 --
NM_004529chr921246 1027 --21037 153 --
NM_004535chr202568 177 --1287 --
NM_004537chr1211497 ------
NM_004540chr211106 ------
NM_004544chr22356 302 --122 --
NM_004549chr111620 --21072 24 --
NM_004554chr1441345 636 364 357 --21590 403 11672
NM_004575chr441250 1200 1165 268 1101 ----
NM_004578chr13955 827 632 ------
NM_004584chr113680 634 227 --1293 --
NM_004586chrX65375 5157 4165 3443 1359 1251 --23466 1733 --
NM_004588chr11103717 3555 3413 2949 2695 1371 929 717 553 374 ------
NM_004592chr121246 ------
NM_004593chr31776 ------
NM_004602chr2011095 --194 --
NM_004603chr72312 29 --2391 368 --
NM_004612chr953936 3705 1045 978 37 --12976 --
NM_004626chr112736 108 --1730 --
NM_004630chr112799 373 ------
NM_004637chr32866 116 --1221 --
NM_004643chr141820 --1621 --
NM_004645chr172671 646 --1836 --
NM_004656chr341026 857 812 774 --31223 950 507 --
NM_004660chrY32209 667 215 ------
NM_004663chr1511001 ------
NM_004664chr12163 ------
NM_004673chr151496 1018 452 395 49 ------
NM_004680chrY125 ------
NM_004684chr4157 132 ----
NM_004685chr1343011 2574 2141 298 1187 ----
NM_004687chr17156 --1265 --
NM_004705chr111191 ------
NM_004709chrX2507 380 ----1185
NM_004716chr11----2691 201 --
NM_004719chr1222780 2054 --11020 --
NM_004721chr31259 ------
NM_004725chr101432 ------
NM_004726chrX65094 1440 979 594 570 374 33758 2227 298 11151 25333 4498
NM_004730chr52613 112 ----143
NM_004733chr3--126 ----
NM_004734chr1333176 2160 205 12474 ----
NM_004736chr152231 1635 1533 85 74 ----11787
NM_004739chr11----1663 --
NM_004742chr311699 ------
NM_004745chr8135585 5499 5435 4909 4872 4794 4389 2736 1650 1402 1202 1104 642 26443 2747 ----
NM_004747chr1031425 570 69 1256 --1446
NM_004748chr1533134 2618 1154 --13166 --
NM_004755chr141315 ------
NM_004760chr772490 2435 2278 2066 1993 1587 270 ------
NM_004762chr1721748 221 2754 211 1135 --
NM_004774chr1722690 1939 ------
NM_004781chr12391 254 --11609 --
NM_004781chr12391 254 --11609 --
NM_004783chr16----1116 --
NM_004788chr1122693 1878 --11845 --
NM_004804chr242777 689 188 123 --12284 --
NM_004808chr101168 --33155 2189 962 --
NM_004809chr153269 165 21 ------
NM_004811chr112490 26 ------
NM_004815chr131980 1710 1088 23380 779 ----
NM_004817chr91268 --2122 87 --
NM_004818chr122558 83 ------
NM_004822chr1773482 2887 2630 1337 965 635 285 1544 ----
NM_004824chr641448 1175 1168 1149 --164 --
NM_004834chr233010 2592 33 --1312 --
NM_004837chr12322 98 ------
NM_004840chrX5570 519 350 339 35 ------
NM_004842chr621699 1509 ------
NM_004845chrX93917 3727 3257 2688 1151 809 553 514 209 23849 3396 --13815
NM_004850chr23339 246 49 --11758 --
NM_004856chr15180 --2396 101 --
NM_004859chr171856 ------
NM_004863chr1455107 3589 3386 3296 73 --34908 4210 1766 --
NM_004865chr6----1140 --
NM_004866chr511956 11134 54350 4010 1661 1027 51 --
NM_004869chr181126 187 ----
NM_004873chr1432923 2175 1102 13127 ----
NM_004874chr81113 ------
NM_004879chr111379 1257 ----
NM_004884chr1541457 668 631 21 ------
NM_004893chr53226 145 45 --1390 --
NM_004896chr1021227 596 162 ----
NM_004898chr432918 2140 311 42829 2157 440 94 12531 --
NM_004902chr202770 270 ------
NM_004904chr766097 5656 4488 4372 2137 471 16533 1237 11796
NM_004905chr1------1188
NM_004906chr6------1654
NM_004912chr711694 1120 ----
NM_004915chr213694 329 201 ------
NM_004922chr103794 668 41 ------
NM_004926chr1421673 308 --2416 35 --
NM_004932chr521563 211 ------
NM_004937chr1742624 1662 761 254 12537 11914 --
NM_004947chr351742 1681 1030 383 57 22316 987 ----
NM_004948chr181393 --11441 --
NM_004952chr11849 --1707 --
NM_004956chr753043 3028 2921 2814 891 --11303 14459
NM_004961chrX1381 --136 --
NM_004965chr211107 ------
NM_004969chr10152 ------
NM_004975chr202139 59 --1379 --
NM_004976chr1194425 3783 1828 1637 855 648 414 42 35 1144 1691 --
NM_004978chr131250 1079 420 --11535 --
NM_004981chr22------1166
NM_004985chr1264351 3186 2956 1725 1323 1072 ------
NM_004992chrX188275 7754 7213 6848 6153 6135 5743 3263 3021 3011 2610 2143 2017 1715 1574 1311 936 154 55342 3377 3129 2437 2285 58167 6687 6496 1348 645 --
NM_004992chrX188275 7754 7213 6848 6153 6135 5743 3263 3021 3011 2610 2143 2017 1715 1574 1311 936 154 55342 3377 3129 2437 2285 58167 6687 6496 1348 645 --
NM_004995chr142284 240 --1434 --
NM_004996chr1631287 598 378 --1401 --
NM_004999chr653794 3152 1372 1283 315 1642 ----
NM_005006chr2--1994 ----
NM_005010chr761773 890 842 652 449 35 ------
NM_005016chr12189 ------
NM_005020chr73515 180 53 ------
NM_005028chr1051696 1682 341 196 130 --12188 --
NM_005032chrX165 1406 ----
NM_005045chr71969 ------
NM_005056chr12115067 4922 4289 2098 1725 1169 1155 594 528 361 107 24912 181 ----
NM_005057chr111898 --11545 1737
NM_005060chr1----3989 941 218 11165
NM_005063chr1061486 1383 976 887 370 316 1122 1471 13528
NM_005066chr12617 26 ------
NM_005068chr621293 339 ------
NM_005073chr131106 ------
NM_005080chr221209 --1770 --
NM_005087chr32762 725 ------
NM_005088chrX2880 210 ------
NM_005093chr20105071 4481 4455 4188 3934 3839 3578 3472 1452 1094 34608 4328 747 24182 1776 13950
NM_005095chr132131 230 63 --11376 --
NM_005096chrX31194 269 146 ------
NM_005109chr32634 447 21902 505 31973 695 660 --
NM_005110chr54608 534 282 46 ------
NM_005116chr20124171 4022 3847 3816 3661 3587 3459 3390 3056 357 311 261 24125 4074 32867 1714 1631 --
NM_005121chr1773331 2725 2706 1131 894 375 265 ------
NM_005124chr61879 1242 --1221
NM_005135chr1522348 1354 53620 2821 2500 1042 358 13037 --
NM_005144chr811095 --1950 172
NM_005148chr173378 116 107 --2424 34 --
NM_005151chr1842404 2195 544 452 1342 ----
NM_005154chr152528 508 ------
NM_005156chr974377 4350 4078 1976 1567 232 55 --11903 --
NM_005168chr221513 501 11229 ----
NM_005180chr101583 ------
NM_005184chr191537 199 1314 --
NM_005187chr16157 1449 11628 --
NM_005190chr621014 71 --11164 --
NM_005197chr1456197 6046 4484 1587 1215 25092 48 21694 310 12063
NM_005201chr331125 1056 299 1101 1362 --
NM_005206chr1721433 984 1969 1127 --
NM_005207chr2273649 2607 2469 2421 1229 803 112 --22533 823 --
NM_005214chr22923 76 --1959 --
NM_005216chr1----1508 --
NM_005219chr5----21786 170 --
NM_005220chr177564 526 317 279 227 154 136 --11338 --
NM_005224chr192702 509 ------
NM_005233chr3----1258 --
NM_005235chr286410 6176 6020 3124 3039 2946 2549 529 57409 5664 3062 3002 1604 --16556
NM_005238chr1162784 2757 535 511 122 102 ------
NM_005241chr31298 ------
NM_005245chr42547 159 ------
NM_005249chr142650 131 ------
NM_005252chr141249 ------
NM_005254chr1521286 542 ------
NM_005256chr111383 ----157
NM_005257chr1841007 373 254 231 --1217 --
NM_005261chr81195 1852 ----
NM_005263chr15362 332 233 122 108 ------
NM_005264chr10187 ------
NM_005274chr1148 ------
NM_005276chr1241791 1324 238 86 11419 11375 --
NM_005276chr1241791 1324 238 86 11419 11375 --
NM_005277chr41221 11672 ----
NM_005281chr14251 187 62 45 --1850 --
NM_005308chr101504 ------
NM_005311chr762505 1953 831 576 431 245 11750 2942 919 --
NM_005324chr1751757 1438 1376 768 622 --21902 721 --
NM_005329chr1661748 1646 1472 894 602 286 12155 12179 11981
NM_005334chrX61549 1499 1146 468 49 34 ------
NM_005336chr252014 1846 1667 1525 173 --3479 260 29 --
NM_005338chr784011 3407 3124 1518 1341 820 713 320 --43693 2879 2771 739 11355
NM_005339chr464070 3542 3385 1115 1079 323 13994 ----
NM_005342chrX42113 2047 557 150 11098 12134 --
NM_005347chr921448 489 --21340 1327 --
NM_005349chr43617 569 251 ------
NM_005358chr1321761 676 1241 ----
NM_005359chr1895965 5615 5293 5179 4192 1954 612 279 189 1367 ----
NM_005370chr1931040 864 431 ------
NM_005373chr11603 11397 11507 --
NM_005374chr1731818 910 693 ----1155
NM_005375chr6------1377
NM_005381chr2----1405 --
NM_005385chr332699 607 355 --12124 --
NM_005387chr11147 ------
NM_005388chr941592 318 268 91 ----1564
NM_005389chr6--1172 ----
NM_005391chrX170 ------
NM_005392chr93595 419 287 --1152 --
NM_005397chr752432 1245 1085 539 42 ----2468 25
NM_005398chr10--11099 11438 --
NM_005399chr173745 3211 1639 1157 1093 1087 595 1774 13501 --
NM_005402chr721539 1469 11310 ----
NM_005406chr1841379 1201 530 114 21248 641 ----
NM_005407chr1431524 1371 515 --1268 --
NM_005410chr52253 141 157 ----
NM_005413chr21434 ------
NM_005418chr11127 ------
NM_005426chr11135 1361 ----
NM_005433chr1832511 683 443 22573 1848 ----
NM_005436chr1033798 2832 2652 31222 457 283 ----
NM_005438chr11171 --1559 2214 105
NM_005440chr1752744 2503 2412 1196 434 --1194 --
NM_005443chr42498 478 ------
NM_005450chr17----192 --
NM_005455chr131238 665 359 1139 11440 --
NM_005458chr9--12071 22265 354 --
NM_005465chr111655 --21548 187 --
NM_005474chr1751278 1179 1164 380 175 --2427 327 --
NM_005475chr1252610 2466 2399 1162 93 --22695 2208 11001
NM_005476chr951076 394 341 154 33 ------
NM_005477chr1562620 2146 1851 1007 293 57 --1750 --
NM_005477chr1562620 2146 1851 1007 293 57 --1750 --
NM_005483chr19----1367 --
NM_005487chr2241418 1367 386 80 ------
NM_005497chr1796140 5936 5428 4639 4024 2293 1289 244 103 22240 445 45717 5376 4810 4471 13965
NM_005506chr452637 1090 569 553 292 1234 ----
NM_005512chr114695 433 189 21 ----1673
NM_005517chr13996 526 461 1372 ----
NM_005520chr51192 296 87 ----
NM_005522chr71880 ------
NM_005523chr73628 576 422 ------
NM_005537chr1331134 1072 850 ------
NM_005539chr1021376 152 --1146 1352
NM_005542chr7----11224 --
NM_005563chr11256 ------
NM_005593chr12132 1239 ----
NM_005596chr976361 5300 5245 4312 2345 1628 680 11446 34554 4141 929 --
NM_005598chr151489 1464 1456 403 365 11710 11322 --
NM_005599chr11243 ------
NM_005603chr1831562 811 669 --1456 --
NM_005604chr622110 1745 11812 ----
NM_005607chr83931 773 409 --151 --
NM_005610chr12217 94 ------
NM_005611chr162160 91 11122 1832 --
NM_005613chr152189 1889 403 396 207 --188 11671
NM_005614chr73888 347 143 ------
NM_005630chr341936 1602 274 29 --11904 --
NM_005637chr1831350 699 217 ------
NM_005638chrX51581 1512 1332 195 151 11492 ----
NM_005639chr1241908 1807 1766 94 1458 ----
NM_005644chr11420 ------
NM_005647chrX2881 249 12953 --12722
NM_005650chr221927 ------
NM_005655chr81509 ------
NM_005668chr5114340 4172 4100 3652 3459 3379 2897 1375 1008 778 473 22879 92 ----
NM_005686chr111455 --11203 --
NM_005707chr153493 43 28 --11141 --
NM_005711chr511034 ------
NM_005715chr652468 2444 1775 411 41 32621 2357 1944 22724 591 1882
NM_005717chr131310 945 935 ------
NM_005718chr31755 --1339 --
NM_005721chr22861 815 ------
NM_005722chr242088 1874 921 80 ------
NM_005730chr12103672 3322 3209 2920 2725 2466 1121 577 564 480 --2620 510 --
NM_005734chr113774 249 219 ------
NM_005736chr10----11323 --
NM_005737chr242124 789 768 658 ------
NM_005738chr711321 ------
NM_005741chr165892 788 769 319 110 ------
NM_005742chr23659 635 21 161 ----
NM_005746chr732337 2100 145 12093 ----
NM_005748chr121187 12631 12973 --
NM_005759chr244721 3425 3217 3046 ----21841 83
NM_005760chr2198 ------
NM_005764chr12379 55 --1119 --
NM_005766chr1331225 1082 978 21428 1387 1197 --
NM_005768chr122551 123 ------
NM_005775chr81276 --1487 --
NM_005776chr14127 172 ----
NM_005779chr541135 855 630 155 13587 ----
NM_005785chr1281686 1604 1434 1261 614 547 459 290 11216 --158
NM_005789chr1762080 1496 1485 598 577 252 ------
NM_005796chr162294 71 ------
NM_005801chr172759 271 ------
NM_005802chr91721 ------
NM_005808chr333532 456 110 13491 12835 --
NM_005813chr232277 1897 388 2860 853 ----
NM_005822chr661897 1824 1771 848 584 543 ------
NM_005826chr1148 ------
NM_005828chr1775031 3986 3654 1717 805 141 87 1914 13205 --
NM_005832chr31578 ------
NM_005840chrX97640 6529 5959 5862 5026 1921 890 444 206 11662 37576 4719 1440 --
NM_005857chr121108 62 11398 ----
NM_005859chr511050 ------
NM_005871chr102443 129 ----1373
NM_005872chr12418 185 ------
NM_005876chr24800 630 315 67 ------
NM_005898chr1142643 1245 916 483 --1958 11233
NM_005902chr1593995 3301 1737 1723 1590 1297 1104 910 481 22947 636 1888 22859 530
NM_005903chr584857 4488 3916 3779 3382 1211 625 406 15111 11545 14725
NM_005906chr621268 322 ------
NM_005909chr594205 4176 3673 3546 2915 2681 1136 694 44 14039 ----
NM_005910chr1733731 3329 2511 --13890 13032
NM_005911chr231035 131 106 11218 1594 --
NM_005920chr163605 2507 1249 991 942 451 ------
NM_005923chr6--1114 ----
NM_005924chr73386 346 229 ------
NM_005933chr1152841 1872 1129 864 565 32873 2166 76 ----
NM_005935chr494878 4194 4124 3530 3352 1771 1759 1228 1017 --1829 15059
NM_005941chr832686 505 215 13393 11454 --
NM_005943chr621361 1105 1428 3386 164 111 --
NM_005944chr341115 1034 858 422 ------
NM_005955chr155171 4105 1822 1015 1008 --24416 4285 2734 615
NM_005964chr1741232 981 309 158 --1133 --
NM_005966chr2199 ------
NM_005967chr122254 21 --1640 --
NM_005977chr131792 --1954 --
NM_005990chr542719 1084 431 120 --11742 --
NM_005996chr1231236 1068 30 1290 ----
NM_005999chr131577 1478 282 41337 1223 1195 1151 ----
NM_006007chr974471 3748 3121 2905 1056 926 102 21444 1005 ----
NM_006010chr32251 200 ------
NM_006011chr1543484 3412 1106 840 33746 1100 205 --13000
NM_006016chr62558 102 --1684 --
NM_006032chr141210 --166 --
NM_006035chr14----279 48 --
NM_006036chr231020 297 284 --12295 --
NM_006038chr2072008 1896 1874 1551 572 404 21 1598 11366 --
NM_006040chr1641370 1169 484 402 --2381 143 --
NM_006043chr162585 243 2720 235 2535 102 --
NM_006047chr2033199 563 80 ------
NM_006055chr24646 511 465 279 ------
NM_006060chr754116 4093 3670 3317 418 33994 3593 3325 13611 --
NM_006062chr23939 270 117 ------
NM_006070chr31271 ----162
NM_006079chr61250 --1304 --
NM_006080chr732442 613 128 ------
NM_006082chr12150 --156 --
NM_006094chr822122 1598 --1813 --
NM_006095chr474266 3017 1439 1280 1019 603 83 23090 1297 --12887
NM_006099chr1------1605
NM_006106chr1133153 1005 429 1123 1415 --
NM_006109chr142305 41 ------
NM_006121chr12129 ------
NM_006122chr1562518 2443 2186 1068 693 418 1933 12112 --
NM_006135chr161343 1264 952 413 128 23 --1465 --
NM_006139chr222275 711 --21068 89 --
NM_006145chr1951066 232 175 133 40 --1287 --
NM_006153chr33578 495 77 ------
NM_006154chr1531983 1018 599 ------
NM_006162chr182643 559 175 11468 31547 95 30
NM_006166chr1211644 22065 496 12282 --
NM_006180chr911529 12041 1399 --
NM_006183chr12------1189
NM_006190chr22386 61 1107 ----
NM_006191chr121293 ------
NM_006194chr14--11141 ----
NM_006196chr2180 ------
NM_006203chr542212 910 238 147 11841 13719 --
NM_006206chr442450 2415 2340 718 22407 2332 --1346
NM_006210chr192282 196 ------
NM_006211chr8----155 --
NM_006224chr1772260 2234 2195 788 673 163 118 11019 --1586
NM_006241chr332208 1682 734 ------
NM_006243chr12765 663 ------
NM_006245chr61922 --1113 --
NM_006251chr513344 32692 1254 457 --1912
NM_006256chr1----1192 11070
NM_006258chr10------1134
NM_006265chr851314 1230 1174 1031 973 1146 1595 --
NM_006267chr241519 596 523 84 ------
NM_006275chr20--21798 323 ----
NM_006283chr894061 3931 3924 3246 3175 3107 3099 3017 1098 13518 --11528
NM_006288chr114861 228 140 42 ------
NM_006298chr6--136 --1625
NM_006301chr121168 1264 ----
NM_006306chrX75838 5087 4506 3845 2252 1503 731 --14535 --
NM_006310chr171158 1198 1873 --
NM_006313chr1211095 ------
NM_006315chr484269 3574 2924 1153 1136 352 326 272 14325 1248 --
NM_006317chr53775 611 266 ------
NM_006321chr331966 1505 1394 --1419 --
NM_006322chr131134 ------
NM_006323chr4--1251 ----
NM_006325chr12198 ------
NM_006327chr10135 ------
NM_006328chr112552 218 ------
NM_006329chr142660 277 ------
NM_006330chr821375 1221 1271 ----
NM_006350chr52263 35 ------
NM_006352chr111976 --1392 1654
NM_006359chrX2711 681 11907 ----
NM_006364chr141857 1462 ----
NM_006367chr12968 430 ------
NM_006371chr3125131 4655 4442 3912 3795 3734 2094 1658 1578 1349 756 441 1864 1820 --
NM_006373chr172562 85 1434 1465 --
NM_006377chr94932 903 353 114 ------
NM_006378chr931078 577 389 11343 1346 --
NM_006380chr1733537 114 42 22704 194 23645 2790 --
NM_006382chr17--1225 ----
NM_006386chr2232334 2131 209 12069 --21597 28
NM_006390chr1211257 11237 ----
NM_006391chr11168 ------
NM_006393chr1084211 4181 4128 2921 1201 984 941 873 --24275 3337 --
NM_006400chr12------194
NM_006402chr1--186 --122
NM_006411chr62937 691 --1281 --
NM_006416chr6--1789 ----
NM_006420chr2042534 2324 986 804 2299 46 ----
NM_006421chr8----1159 --
NM_006431chr12--141 ----
NM_006451chr51916 ------
NM_006454chr462325 1947 760 293 190 70 --52156 1060 809 123 60 --
NM_006455chr173960 920 877 --2635 360 --
NM_006457chr463797 3277 3237 3166 3036 132 --31410 1386 775 --
NM_006459chr1051444 1314 467 191 80 ------
NM_006469chr11619 31641 1608 1210 ----
NM_006475chr13186 ------
NM_006482chr1253228 2978 900 548 414 1126 1858 --
NM_006497chr171797 ------
NM_006504chr1042394 2166 858 762 22679 1857 ----
NM_006516chr141528 1494 491 174 --1130 --
NM_006517chrX62077 1774 863 205 152 119 ------
NM_006527chr42279 245 ------
NM_006534chr2072405 2263 611 483 450 412 83 12703 ----
NM_006537chr15150 ------
NM_006540chr841339 598 378 60 --2634 28 --
NM_006544chr1465206 5129 3947 1572 1478 1245 1456 --25691 63
NM_006546chr17136638 6227 5980 5753 5394 4810 4336 4157 4085 336 279 236 153 16163 26611 5150 --
NM_006547chr722112 1953 ------
NM_006548chr311784 11186 1256 --
NM_006557chr92459 25 11243 ----
NM_006558chr82366 202 ------
NM_006560chr111390 --1121 --
NM_006561chr1064424 1717 1121 956 504 221 34925 1769 1036 25165 2206 --
NM_006565chr1621150 321 ------
NM_006572chr1752321 1163 979 862 248 13223 ----
NM_006577chr22886 421 ------
NM_006589chr1133 --1443 --
NM_006593chr21712 ------
NM_006595chr111820 --1161 179
NM_006599chr16137792 7578 7378 6446 6327 6061 5644 5568 5238 2654 2647 1323 250 17738 ----
NM_006602chr201551 ----1134
NM_006603chrX11439 1762 ----
NM_006612chr171465 ------
NM_006614chr353451 2564 1437 1025 187 12688 11363 12291
NM_006618chr12372 148 1405 ----
NM_006621chr151432 676 527 417 217 ------
NM_006624chr1042066 1769 1390 459 1256 ----
NM_006625chr1--1862 ----
NM_006625chr1--1862 ----
NM_006625chr1--1862 ----
NM_006626chr942597 1855 962 324 1293 ----
NM_006628chr1544368 1351 595 532 ------
NM_006629chr1852045 1876 1035 669 494 --2327 184 --
NM_006646chr131518 22325 701 1792 --
NM_006650chr5103555 3318 2656 2640 2588 2564 2496 2432 911 365 13003 23650 3488 --
NM_006654chr1244278 1271 847 562 24643 1044 12987 1442
NM_006670chr6--1267 ----
NM_006675chr1283126 2954 2536 2283 1116 670 278 87 --13013 12858
NM_006682chr732552 2145 22 ----2578 60
NM_006686chr9------133
NM_006690chr2032044 1927 1885 --21453 827 --
NM_006696chr5181 ------
NM_006700chr122815 106 --1213 --
NM_006706chr51221 ------
NM_006717chr972835 2607 2549 2448 1234 632 79 12093 ----
NM_006718chr61855 ------
NM_006726chr41300 1869 --1451
NM_006729chrX55055 4825 2019 627 405 21231 640 34696 2223 1597 13745
NM_006731chr985819 5743 4638 4109 3928 3717 2331 2214 --25261 2170 --
NM_006734chr6180 ------
NM_006738chr1564622 2912 2864 1687 1665 116 1804 --13753
NM_006742chr1652012 1510 1338 716 604 --41652 708 489 129 1150
NM_006749chr831062 486 136 11056 ----
NM_006750chr16107210 7056 7035 6931 6232 3002 1578 924 636 473 26287 196 35985 5572 2748 37540 2414 98
NM_006751chr22239 205 1897 --1118
NM_006761chr17--1269 ----
NM_006766chr842439 1860 837 91 22662 482 22419 1916 --
NM_006769chr12744 74 ------
NM_006772chr641314 388 287 164 ------
NM_006775chr622320 2143 ------
NM_006777chrX32263 1970 226 ------
NM_006788chr1841963 1789 679 225 ------
NM_006802chr11262 1119 ----
NM_006806chr21--1313 ----
NM_006818chr13389 355 268 --2871 719 --
NM_006819chr111339 ------
NM_006822chr173666 503 37 ------
NM_006826chr21876 ------
NM_006838chr121358 11349 11538 --
NM_006851chr1252548 2087 1163 1078 248 --1890 1314
NM_006852chr1771912 1842 1009 826 398 355 233 160 1196 --
NM_006854chr731626 734 34 ------
NM_006856chr1221091 267 ------
NM_006861chr1241862 1401 547 439 ------
NM_006870chr202815 676 ------
NM_006875chrX--1123 ----
NM_006885chr1633868 958 586 ------
NM_006888chr1432406 2389 34 --13179 1787
NM_006896chr73857 814 356 --1177 --
NM_006902chr162753 1024 633 457 446 436 ------
NM_006906chr111108 --1273 1158
NM_006908chr7----11399 --
NM_006913chr6----129 --
NM_006915chrX22524 479 ------
NM_006920chr231833 1496 702 11460 ----
NM_006922chr2--1706 12542 --
NM_006924chr1723894 239 11745 ----
NM_006927chr1672104 699 650 596 241 229 27 --22022 54 --
NM_006930chr531881 1774 1631 1469 ----
NM_006931chr121803 --11946 --
NM_006940chr121260 --11842 --
NM_006941chr222899 744 --11129 1188
NM_006946chr112551 198 --2532 514 --
NM_006950chrX2602 239 ------
NM_006951chr101834 --1643 1710
NM_006981chr932337 918 823 ------
NM_006988chr2121030 86 ----1990
NM_006990chr14750 723 713 577 --31721 1625 1544 --
NM_007007chr1253415 3284 1524 1350 692 2495 71 13118 --
NM_007008chr21590 ------
NM_007011chr15136525 5682 4705 2659 2493 1580 1417 1089 840 629 439 260 175 25163 267 25631 825 26697 28
NM_007013chr81294 ------
NM_007017chr5--3596 205 198 1814 --
NM_007023chr21147 --2208 37 --
NM_007024chr32180 68 --1509 --
NM_007026chr171440 ------
NM_007027chr31118 ------
NM_007030chr533159 1346 380 ------
NM_007034chr11825 ------
NM_007038chr2145805 915 515 103 25188 46 ----
NM_007042chr361763 1698 784 607 463 137 1215 12499 --
NM_007052chrX2565 50 ----1171
NM_007054chr543824 2983 1027 903 --23004 1417 11283
NM_007064chr3----1563 --
NM_007067chr1741342 1084 418 292 --21442 1224 --
NM_007078chr1082691 2400 1118 884 789 647 559 247 --12775 --
NM_007084chr1321185 360 ------
NM_007106chr133903 259 79 12483 ----
NM_007111chr13129 ------
NM_007114chr313005 ----12530
NM_007124chr6--155 ----
NM_007125chrY5584 195 185 164 43 ------
NM_007126chr91130 --1116 --
NM_007129chr13------1667
NM_007137chrX54439 3916 1954 1941 1099 --45241 4089 1627 1052 --
NM_007144chr172402 27 ------
NM_007146chr1752740 2726 2369 1063 831 ------
NM_007158chr1----11194 --
NM_007159chr341636 1346 637 37 ------
NM_007166chr1121121 998 169 1449 --
NM_007170chr1--1231 2264 42 --
NM_007173chr1121736 970 11704 ----
NM_007174chr1221682 158 --1289 --
NM_007176chr1441552 309 295 21 11134 ----
NM_007178chr122383 72 --1134 --
NM_007189chr731209 441 208 --21510 252 --
NM_007191chr121508 ------
NM_007192chr141167 --139 --
NM_007195chr1873566 2809 2739 2546 774 395 120 ------
NM_007200chr1564622 2912 2864 1687 1665 116 1804 --13753
NM_007202chr172777 125 --2758 508 --
NM_007203chr943353 1404 1385 1346 ----1491
NM_007212chr1----11454 --
NM_007213chrX2271 252 --1567 --
NM_007218chr82960 81 ------
NM_007219chr202975 779 ------
NM_007222chr821288 352 ------
NM_007235chr12143 --1502 --
NM_007236chr1532027 631 288 --1380 --
NM_007245chr161815 2695 158 ----
NM_007246chr4--180 ----
NM_007249chr1399193 7641 7010 3567 3176 2911 2870 2741 1644 26398 61 18949 --
NM_007278chr171274 --1146 --
NM_007282chr31224 11033 --1737
NM_007292chr1734921 1604 32 14638 ----
NM_007331chr452632 1779 1041 431 239 ------
NM_007347chr1542121 1285 946 331 ------
NM_007349chr71101 ------
NM_007350chr1244397 3477 2824 1779 11524 13777 --
NM_007353chr772762 2485 2469 2115 989 483 164 ------
NM_007363chrX2283 130 ------
NM_007372chr175899 658 647 304 232 ------
NM_012073chr531381 1021 100 ------
NM_012081chr552881 2719 2330 341 72 12437 --11469
NM_012082chr81989 ------
NM_012083chr1031262 484 57 ------
NM_012090chr1----11069 --
NM_012095chr1063516 3397 1112 707 502 115 2953 348 ----
NM_012096chr343712 3450 653 353 ------
NM_012104chr1162827 2418 1336 947 787 174 23423 1534 1285 --
NM_012104chr1162827 2418 1336 947 787 174 23423 1534 1285 --
NM_012137chr152812 2745 2618 982 751 21014 787 12555 --
NM_012141chr1333583 3478 946 12941 ----
NM_012154chr82651 142 ------
NM_012158chr132394 117 ------
NM_012160chr62530 472 ------
NM_012164chr9137095 6610 6072 5933 5672 5409 4814 4583 2827 2111 1876 1360 551 37161 5722 1581 26367 1657 11808
NM_012166chr951142 459 415 223 139 --1150 --
NM_012175chr111226 --1253 --
NM_012180chr44512 119 36 24 ------
NM_012193chr11105222 4423 4298 3291 2050 2038 1765 1348 660 306 13662 14522 11652
NM_012199chr184567 4357 3517 3473 1856 1753 689 563 14462 1897 --
NM_012210chr951427 1183 457 131 109 ------
NM_012215chr1041857 323 87 81 11702 ----
NM_012216chrX135 142 ----
NM_012224chr4173 1334 ----
NM_012234chr351237 956 847 754 440 23634 410 11303 --
NM_012238chr1011626 ------
NM_012243chr12690 204 ------
NM_012249chr232332 1359 1098 1433 21116 395 --
NM_012250chr1131383 174 90 ------
NM_012262chr123899 1115 ----11229
NM_012264chr2271954 1749 815 477 352 189 150 --165 --
NM_012264chr2271954 1749 815 477 352 189 150 --165 --
NM_012266chr92962 255 --11046 --
NM_012281chr73802 529 328 21912 1540 ----
NM_012287chr344313 3076 1739 271 1609 ----
NM_012288chr6115352 5267 4751 4620 2264 2201 1330 970 895 815 571 --65537 4050 3752 1605 1054 1023 1869
NM_012290chr2143 ----1463
NM_012293chr241626 1546 787 127 32138 1586 1439 ----
NM_012294chr773458 3289 2581 1022 483 475 285 12810 ----
NM_012297chr442244 919 772 650 1555 ----
NM_012300chr52409 182 12450 12531 --
NM_012301chr711935 11791 ----
NM_012302chr121228 305 11161 ----
NM_012306chr1293450 2319 2278 1397 1273 1199 1116 423 29 --33213 1231 899 --
NM_012307chr182790 284 1199 ----
NM_012308chr1172089 1898 1845 1017 972 716 443 ------
NM_012309chr11124241 4133 3842 3811 3161 1774 1639 850 842 542 369 171 11492 ----
NM_012316chr164294 3761 3734 808 464 364 34042 3590 3515 44924 4861 4186 1357 --
NM_012317chrX3551 172 104 --1187 --
NM_012318chr451328 1317 1238 1130 254 1912 --1878
NM_012319chr1821021 947 ------
NM_012325chr2011346 ------
NM_012326chr2------1711
NM_012330chr1021628 1133 ----1450
NM_012334chr574145 4073 3394 3259 2905 1574 1079 --2919 68 --
NM_012382chr534296 3996 645 13682 ----
NM_012384chr2072188 1974 1839 1774 1648 919 203 --2988 561 --
NM_012399chr2231794 1411 1356 ----1332
NM_012402chr111300 --11388 --
NM_012420chr1062284 1493 622 552 373 241 11735 ----
NM_012421chr1----1178 --
NM_012425chr1031925 1709 719 132 12437 --
NM_012428chr152188 162 ------
NM_012448chr1742265 2069 948 897 11890 2436 24 --
NM_012463chr1211303 ------
NM_012464chr422868 561 21996 163 ----
NM_012465chr1032312 279 132 22680 2425 ----
NM_012478chr174952 389 339 106 ------
NM_012479chr762650 2031 1950 748 683 445 1364 12191 --
NM_012482chr11662 ------
NM_012486chr1174 ------
NM_013227chr151284 ------
NM_013230chrY31702 529 466 11567 ----
NM_013233chr2------1213
NM_013236chr2231013 505 354 1453 ----
NM_013253chr1131420 179 159 1535 1479 --
NM_013255chr7156331 6131 5893 5878 5587 3161 3078 2503 1894 1702 1342 1059 965 528 232 45952 2411 1657 379 12593 --
NM_013257chr821516 363 22101 1780 ----
NM_013261chr423244 967 33403 3096 229 ----
NM_013263chr161135 ------
NM_013269chr12----11074 --
NM_013275chr162519 156 ----1328
NM_013277chr124782 351 245 108 ------
NM_013279chr1141939 446 278 170 12032 ----
NM_013281chr2041344 1193 1152 604 ------
NM_013293chr71298 ------
NM_013300chr121217 ------
NM_013305chr182878 129 ------
NM_013312chr19----282 53 --
NM_013314chr10134 1107 ----
NM_013316chr721044 790 2209 112 ----
NM_013341chr232713 2695 385 1864 12399 --
NM_013348chr1941140 1097 1047 965 ------
NM_013354chr81576 ------
NM_013357chr83238 136 121 ------
NM_013361chr19--1144 1648 --
NM_013364chrX32019 1676 542 1270 --1177
NM_013374chr31805 12754 ----
NM_013377chr121692 ------
NM_013381chr1252074 1848 949 749 401 31731 577 380 1258 --
NM_013382chr1461883 841 696 583 78 21 --22334 2251 --
NM_013390chr91105 1446 ----
NM_013396chr2111503 1365 ----
NM_013423chrX21151 134 --149 --
NM_013427chrX21151 134 --149 --
NM_013438chr91294 --11812 --
NM_013443chr921136 791 1423 1146 1907
NM_013446chr72992 108 11002 ----
NM_013448chr141703 ------
NM_013449chr1232591 822 765 ------
NM_013989chr1454632 4450 4027 540 532 34704 1255 269 ----
NM_013993chr61706 --1283 --
NM_013994chr61706 --1283 --
NM_013995chrX22330 100 ------
NM_013996chr7127 ------
NM_013996chr7127 ------
NM_013997chr7127 ------
NM_013997chr7127 ------
NM_013998chr7127 ------
NM_013998chr7127 ------
NM_014000chr1031762 391 269 ------
NM_014001chr1721538 1465 --11134 --
NM_014007chr91191 ------
NM_014010chr9------1447
NM_014015chr161509 ----1652
NM_014016chr31248 11302 ----
NM_014021chr153191 2784 2126 1336 1114 ------
NM_014042chr11135 ------
NM_014043chr31646 ------
NM_014045chr14----1397 --
NM_014055chr121449 1428 ----
NM_014089chr1331473 373 194 --1756 --
NM_014112chr825467 3974 ------
NM_014145chr201612 162 ----
NM_014154chr32470 254 1240 ----
NM_014155chr11106935 6652 6382 6361 5788 5525 2287 1834 792 291 --25476 5222 --
NM_014157chr1643236 1251 649 425 13334 ----
NM_014159chr3149 ------
NM_014178chr14--155 ----
NM_014181chr242599 1884 1853 1142 12064 ----
NM_014183chr203273 218 120 ------
NM_014189chr421537 1253 --11501 --
NM_014190chr461889 1605 1204 1160 272 89 --11853 --
NM_014213chr2190 --2553 102 --
NM_014217chr1----1508 --
NM_014223chr1------1167
NM_014231chr1261388 807 790 719 641 105 ------
NM_014238chr172695 646 11443 1128 --
NM_014241chr10131 ------
NM_014243chr421958 1885 ------
NM_014245chr32179 61 ------
NM_014246chr2232242 1637 351 --12290 --
NM_014250chr2241418 1367 386 80 ------
NM_014253chrX31664 760 457 --1501 --
NM_014264chr4194 ------
NM_014268chr184951 924 901 291 ------
NM_014271chrX4714 702 112 56 ------
NM_014279chr91970 ------
NM_014284chr11336 ----1935
NM_014285chr91240 --2728 136 --
NM_014294chr811346 163 ----
NM_014299chr1981763 1469 1463 864 550 504 42 36 1167 ----
NM_014309chr2275148 4263 3573 3390 1869 1508 1212 13340 24978 3601 --
NM_014319chr121129 ------
NM_014325chr1231746 1496 813 1157 ----
NM_014332chrX------1121
NM_014345chr6----1397 --
NM_014352chr1161449 1396 1016 610 161 91 --21089 26 --
NM_014368chr9167 1798 1299 --
NM_014372chr1------1263
NM_014382chr31473 ------
NM_014392chr421539 1076 1195 ----
NM_014397chr931245 907 272 1113 1333 --
NM_014399chr7----1677 --
NM_014405chr1752162 1801 1699 766 128 11878 128 12330
NM_014409chr11396 --150 --
NM_014411chr72676 635 11249 3818 347 50 --
NM_014417chr191347 --1158 --
NM_014421chr42740 348 ------
NM_014423chr5104967 4772 4650 4599 4350 4223 4022 3805 3419 270 34065 2190 1776 ----
NM_014456chr101517 ------
NM_014458chr1--11401 ----
NM_014472chr104681 521 76 58 --1606 --
NM_014488chr111202 ------
NM_014494chr1622126 1619 ------
NM_014497chr2146 ------
NM_014498chr33335 313 81 ------
NM_014500chrX156 ------
NM_014515chr122654 218 1900 ----
NM_014517chr321478 229 ------
NM_014554chr123847 555 265 11434 1296 11592
NM_014562chr22721 309 --1278 --
NM_014574chr14------1219
NM_014575chr31134 ------
NM_014583chr32405 330 ------
NM_014586chr21104588 4505 2998 1778 1766 1706 1604 1295 206 31 ----11236
NM_014592chr52602 23 ------
NM_014612chr911032 ------
NM_014614chr22206 24 ------
NM_014615chr1663355 2634 1349 203 145 138 --2776 469 13038
NM_014623chr6136 ------
NM_014634chr2273559 2667 2649 918 729 700 589 --22731 2636 --
NM_014636chr964305 3785 3498 800 757 28 ----14145
NM_014647chr1621719 725 ----1908
NM_014660chr741001 955 766 723 ------
NM_014665chr883538 3208 3136 2903 2528 643 421 321 22991 2718 32498 1165 969 23102 2760
NM_014666chr52221 192 1163 ----
NM_014676chr141530 1348 604 117 ------
NM_014680chr17153 ----1133
NM_014682chr822046 50 ------
NM_014683chr1721739 698 11414 1719 --
NM_014686chr1942389 2252 2106 241 --11689 12222
NM_014689chr22231 134 ------
NM_014690chr782866 1940 1229 847 826 378 181 126 11963 31130 808 297 23062 2313
NM_014693chr3------1199
NM_014701chr15112649 2476 2269 2165 2129 1292 1215 842 702 360 221 22853 91 130 --
NM_014702chr623205 131 12605 23185 3026 13131
NM_014705chr72734 699 11392 ----
NM_014709chr24185 162 100 90 ------
NM_014711chr1611542 1829 --11779
NM_014717chr19--1226 ----
NM_014721chr6137246 7157 6736 6671 6409 5874 5379 4513 2838 2733 1908 859 625 27363 2652 ----
NM_014726chr1731226 375 334 ------
NM_014729chr831559 495 279 ------
NM_014730chr12154621 4345 4329 4310 3849 3682 3492 3353 1776 1379 1208 1024 581 447 198 1657 23439 1590 --
NM_014730chr12154621 4345 4329 4310 3849 3682 3492 3353 1776 1379 1208 1024 581 447 198 1657 23439 1590 --
NM_014733chr521961 673 ----157
NM_014735chrX42085 1977 756 594 --11864 --
NM_014739chr634064 2818 1162 11425 ----
NM_014741chr1162072 1809 1519 1367 711 405 ------
NM_014742chr205613 589 452 240 197 --1517 --
NM_014743chr442879 1987 385 61 32140 541 518 32455 1181 395 --
NM_014746chr264021 928 796 417 397 36 ------
NM_014747chr1155423 4745 4708 4612 3701 2186 1597 1476 1274 1219 1166 1109 753 729 341 13908 25024 1093 44008 3798 1154 581
NM_014751chr82854 430 --12173 --
NM_014752chr1121478 197 ------
NM_014754chr83908 358 29 ----1233
NM_014755chr21666 12865 ----
NM_014758chr1181961 1741 1707 1581 857 662 536 386 --11640 1829
NM_014761chr164824 415 178 161 ------
NM_014764chr1221214 1047 ----149
NM_014766chr723788 3343 13249 1581 --
NM_014767chr1043543 3334 2478 1321 --43090 3075 2703 409 --
NM_014770chr1241084 1012 985 158 ------
NM_014771chr161870 ------
NM_014772chr1853602 2773 2359 940 826 ------
NM_014774chr132290 681 87 ------
NM_014776chr1242578 2526 2318 77 --11128 --
NM_014779chr31192 21091 1033 ----
NM_014782chrX1117 ------
NM_014787chr13950 613 594 11738 --195
NM_014788chr972176 626 502 477 416 268 28 --22755 750 --
NM_014795chr23518 141 106 141 ----
NM_014800chr751104 841 474 216 159 --1143 1132
NM_014802chr122348 218 --1384 --
NM_014810chr163559 3542 3451 2821 2734 1202 --11329 --
NM_014812chr111260 ------
NM_014822chr42570 122 --1148 --
NM_014828chr1421731 1584 ----1146
NM_014829chr532074 1899 842 ------
NM_014830chr1263336 1169 1004 785 508 315 23901 1429 23104 2663 --
NM_014832chr1311512 ------
NM_014836chr1031484 334 314 ------
NM_014838chr2282798 2315 2240 2001 1947 1061 928 172 12063 22533 131 1806
NM_014839chr122016 71 ------
NM_014840chr1242926 2443 2169 1093 1471 ----
NM_014844chr1474167 4061 1464 1370 333 167 61 --33257 850 308 13433
NM_014849chr13324 315 90 ------
NM_014850chr374660 1959 1495 1347 692 675 174 --11860 1238
NM_014868chr122871 181 ------
NM_014870chr1104561 4546 4254 3733 3475 3044 1322 1062 734 295 13835 11522 --
NM_014871chr121420 1102 ----
NM_014873chr184129 3958 3933 3058 3015 1189 545 403 --54652 1502 857 523 500 --
NM_014876chr223349 121 39 ----11534
NM_014877chr17107584 7307 6826 5430 5343 2892 2835 1748 1696 1666 --25231 912 1962
NM_014883chr43648 635 124 --1578 --
NM_014888chr721541 1097 11470 ----
NM_014890chr3121 ------
NM_014891chr721673 585 --11487 11116
NM_014892chr61452 ------
NM_014897chr1763124 988 809 780 444 27 --13262 --
NM_014900chr22870 41 ------
NM_014901chr531510 598 123 ------
NM_014903chr122496 463 --12398 --
NM_014904chr1073796 3055 2794 1351 1028 407 307 1733 --13161
NM_014905chr231546 1524 679 11714 --11516
NM_014906chr1783887 3802 3690 3298 2846 1165 308 143 ------
NM_014912chr1021352 829 2497 185 ----
NM_014913chr182361 135 1954 21078 414 --
NM_014917chr12634 203 --1351 --
NM_014918chr153513 500 452 --1292 --
NM_014920chr662359 1372 1225 957 504 347 ------
NM_014921chr1992633 2576 2552 2506 2444 1950 1022 309 114 ------
NM_014934chr1372989 2908 2591 718 288 275 26 11540 ----
NM_014935chr123759 1474 13831 33401 1463 347 --
NM_014938chr1262281 2051 1626 948 602 591 --32370 2005 827 --
NM_014939chr1831276 1085 399 ------
NM_014946chr263065 2854 2768 2224 896 340 --12410 --
NM_014947chr142599 2092 391 76 ------
NM_014949chr11323 --1689 --
NM_014950chr141142 ------
NM_014951chr1052602 2056 1044 585 55 12554 --1287
NM_014961chr422072 1378 ------
NM_014964chr1742063 1757 316 115 --41877 1714 960 121 --
NM_014974chr102368 233 --21479 1458 --
NM_014978chr1031316 1221 1203 11380 ----
NM_014982chr1424925 1015 23674 3562 ----
NM_014991chr432777 2097 733 12928 1249 --
NM_015002chr1242038 1458 843 62 --11667 --
NM_015008chr323284 2518 --22857 2456 --
NM_015013chr1--168 ----
NM_015015chr1912050 --11507 --
NM_015020chr1643558 3240 2749 1417 ----33468 3315 2827
NM_015023chr171656 1470 1286 1154 511 471 346 --31571 1180 1172 --
NM_015024chr831285 1279 107 --1260 --
NM_015025chr2----1810 --
NM_015027chr1621829 381 ------
NM_015032chr1332732 972 565 11972 ----
NM_015033chr963043 2184 1053 901 742 417 --174 1145
NM_015035chr20126553 5117 5023 4718 4058 2678 2230 2208 2174 1937 1713 131 26148 4726 15516 16173
NM_015039chr1104148 3995 3552 3406 1639 1382 372 294 206 199 --23566 1301 1682
NM_015040chr243337 2812 1320 589 ------
NM_015042chr1564075 4068 3746 3216 1065 174 ------
NM_015044chr1642822 2652 2393 2253 12558 --13103
NM_015045chr1021488 862 ------
NM_015049chr243212 2406 2098 251 21294 1287 ----
NM_015052chr751292 958 459 392 188 ------
NM_015060chr71195 ------
NM_015063chr191929 11284 1240 --
NM_015064chr1262734 2218 1012 233 48 22 1509 13644 1301
NM_015068chr773212 1319 1097 988 292 101 53 --31415 866 779 --
NM_015071chr596286 5274 2360 1991 1573 1508 615 328 61 1919 14007 --
NM_015072chr142406 241 ------
NM_015073chr1971831 801 710 669 373 358 299 ------
NM_015074chr1103636 3470 3438 3423 1861 1824 1806 1235 798 144 21464 134 44091 3680 1853 1321 --
NM_015075chrX42068 1631 280 142 --41990 1431 658 624 11602
NM_015076chr622826 396 ----2285 50
NM_015077chr1754228 3299 1876 1656 1508 23422 1382 23314 1163 --
NM_015086chr1231066 571 563 1450 21276 1248 --
NM_015090chr195558 5420 5100 4916 2409 2189 1422 391 101 11455 34357 1745 193 46114 1408 1139 877
NM_015092chr1634316 1038 881 --11764 --
NM_015093chr621726 487 ------
NM_015094chr2274116 3479 1873 782 679 113 102 --21885 1738 --
NM_015097chr322377 2229 11493 ----
NM_015100chr121647 636 ------
NM_015101chr11271 22311 585 179 12467
NM_015107chrX61875 778 602 491 472 242 --22168 411 --
NM_015113chr1752366 2212 2131 384 281 2527 421 22081 125 --
NM_015116chr133345 157 109 ------
NM_015132chr711663 11645 --1304
NM_015138chr151699 ----12084
NM_015143chr421161 328 11135 2934 211 --
NM_015144chr162334 145 13412 ----
NM_015150chr34737 340 314 248 --1292 --
NM_015155chr1032482 1049 415 --2886 676 --
NM_015156chr1463442 3370 2539 1303 338 136 23886 736 ----
NM_015157chr111767 11178 31055 1009 733 --
NM_015158chr92733 611 ------
NM_015170chr832330 1968 398 1689 ----
NM_015172chr131189 1051 244 ------
NM_015176chr131474 1426 24 ------
NM_015178chr892309 2129 1903 1871 1708 1677 671 525 320 ------
NM_015184chr3140 1262 ----
NM_015185chrX22352 2180 22071 627 2594 568 11869
NM_015187chr4124 --1770 --
NM_015191chr1152658 874 716 670 64 ------
NM_015193chr861162 434 240 128 106 40 --21307 604 --
NM_015194chr17161 22086 599 ----
NM_015199chr332864 2330 2037 ------
NM_015200chr441944 1784 300 109 2977 848 152 --
NM_015206chr1511095 11541 ----
NM_015208chr1883969 3584 2834 1610 1357 1201 846 450 --14055 --
NM_015215chr1--1796 ----
NM_015219chr1732296 1035 129 1580 32561 2098 355 22212 1606
NM_015221chr1031204 1144 195 1541 2975 533 1336
NM_015225chr952381 2286 2168 1003 755 11232 12589 --
NM_015233chr1342431 882 501 44 --31803 1025 30 --
NM_015242chr113502 389 26 --1491 --
NM_015245chr652720 2210 330 235 206 --22345 1958 --
NM_015247chr1694947 4587 4311 3581 2020 1609 466 200 124 25219 4775 ----
NM_015250chr91818 1579 ----
NM_015251chr1622141 1651 ------
NM_015256chr51519 142 ----
NM_015265chr211923 ------
NM_015267chr1231640 878 600 --11349 --
NM_015268chr3----159 --
NM_015269chr12402 22 1100 ----
NM_015270chr1282011 1819 1633 1574 696 257 100 23 11564 11552 --
NM_015271chr463458 3141 3070 1245 788 702 ----11257
NM_015272chr1611802 --11729 --
NM_015278chr643481 2723 2712 171 31246 703 577 43325 2890 665 301 --
NM_015282chr242165 657 620 143 --1325 --
NM_015284chr142001 1898 1763 224 1684 11945 22068 1517
NM_015288chr583820 3025 2693 2531 2511 1344 568 77 12542 2324 217 --
NM_015291chr152473 1258 806 482 32 ------
NM_015296chr13--1928 ----
NM_015299chr1473533 2722 1573 1557 1453 1345 755 --32715 51 41 12898
NM_015305chr144396 282 158 34 11256 ----
NM_015308chr111353 1736 1849 --
NM_015310chr8157706 7015 6469 6072 2650 2366 2309 2087 1765 1606 1535 1481 1318 669 415 --15707 26591 494
NM_015313chr1133553 1373 1249 1591 177 --
NM_015314chr752505 2146 744 134 126 ----11617
NM_015315chr543392 2828 2188 634 12216 13176 --
NM_015317chr222871 205 ------
NM_015323chr611407 ------
NM_015326chr172811 1160 1075 435 380 220 89 ----12083
NM_015328chr73930 817 722 2393 81 22404 1967 --
NM_015329chr1972838 2407 444 250 237 108 22 --32272 1185 47 2548 323
NM_015332chr7112835 2784 2494 2381 2364 2221 1233 1070 174 164 82 --22941 1136 --
NM_015335chr125381 353 303 234 101 12358 ----
NM_015336chr1242482 2157 782 428 ------
NM_015339chr203183 138 56 ------
NM_015344chr841650 1369 1353 809 ------
NM_015349chr612516 12337 1112 --
NM_015353chr1772233 2225 1719 499 82 30 22 11997 12706 1690
NM_015355chr1711338 11437 ----
NM_015356chr8------152
NM_015359chr822497 1814 --3452 431 201 --
NM_015365chrX43481 2823 1090 76 24100 3302 ----
NM_015374chr2231491 1286 456 ----1192
NM_015375chr174834 4597 4436 3576 1810 1175 30 34638 4538 193 44366 1984 941 399 --
NM_015379chr7189 ------
NM_015381chr2222049 181 11682 11881 1337
NM_015393chr41681 22545 61 12794 --
NM_015396chr31460 11188 ----
NM_015397chr951959 1831 723 568 310 ------
NM_015419chrX2821 441 --1833 --
NM_015435chr811129 1141 ----
NM_015439chr63400 347 60 172 ----
NM_015442chr31197 ------
NM_015443chr1721452 53 ------
NM_015444chr33660 587 173 ------
NM_015455chr532960 1371 895 13304 --13340
NM_015460chr331934 1469 351 11537 2572 40 1182
NM_015466chr31213 ------
NM_015475chr2--170 ----
NM_015477chr151889 --1859 --
NM_015481chr124738 307 175 140 --3972 413 42 --
NM_015488chr241605 1575 1390 266 --21378 1168 --
NM_015493chr1911996 11631 1179 --
NM_015497chr152892 386 ------
NM_015509chr1231418 589 562 ------
NM_015525chr61994 ------
NM_015534chr12383 170 2406 184 ----
NM_015535chr253612 2568 1604 851 825 14046 23062 160 --
NM_015542chr1041233 1113 462 197 11047 --166
NM_015550chr752985 2533 2293 1415 96 --12609 --
NM_015553chr654417 3277 3174 316 275 --13902 14724
NM_015554chr1552612 2569 2477 1837 631 1342 127 --
NM_015557chr173530 2506 1022 625 430 283 41 --12971 --
NM_015559chr184247 198 137 114 11060 ----
NM_015564chr522547 554 ------
NM_015565chr2121431 740 11632 ----
NM_015568chr2094287 3477 3453 2951 2828 1685 1105 1009 312 --13002 13190
NM_015570chr731606 1590 1170 ----11807
NM_015571chr622368 952 1201 ----
NM_015575chr252962 2948 2809 2701 823 --12575 --
NM_015576chr33863 426 25 32551 2048 1093 --1457
NM_015577chr541615 1169 235 228 1399 ----
NM_015578chr193783 279 38 11526 ----
NM_015589chr14271 56 ------
NM_015601chr10--177 ----
NM_015609chr152652 2491 2023 1036 831 ----11094
NM_015610chr752683 1869 1067 341 187 --1491 --
NM_015626chr171326 ------
NM_015630chr2155 1736 ----
NM_015635chr911369 --12098 --
NM_015640chr143764 3279 1470 723 11896 14216 --
NM_015642chr3----1284 --
NM_015646chr121432 2254 181 ----
NM_015651chr961957 1924 1802 1388 191 78 --11498 --
NM_015668chr81159 ------
NM_015670chr17----172 --
NM_015678chr132381 335 ------
NM_015686chrX31967 1924 1891 --22235 48 1503
NM_015687chr61239 ------
NM_015711chr191548 --2705 164 --
NM_015713chr852320 2312 1317 858 755 --1288 --
NM_015719chr194773 215 195 156 ------
NM_015832chr18----152 --
NM_015844chr18--2640 338 1167 --
NM_015846chr18--2640 338 1167 --
NM_015847chr18--2640 338 1167 --
NM_015855chr112798 771 ------
NM_015874chr43617 569 251 ------
NM_015878chr8163 ------
NM_015879chr18117753 6125 2846 2729 2519 2413 1433 1361 1066 884 68 18009 15449 15859
NM_015881chr1131420 179 159 1535 1479 --
NM_015885chr111587 --1126 --
NM_015886chr854944 4560 1660 1365 1145 1154 15173 --
NM_015891chr611597 11948 11341 --
NM_015902chr82898 740 1346 ----
NM_015905chr71415 ------
NM_015906chr131169 876 733 14490 ----
NM_015912chr822171 677 ------
NM_015926chr31267 --170 159
NM_015955chr2----1461 --
NM_015980chr541266 1168 449 437 --170 --
NM_015981chr552234 1022 703 429 181 12402 12189 12886
NM_015984chr11535 ------
NM_015995chr1594957 4913 3661 1844 1298 924 689 461 229 24454 1432 31328 1229 653 --
NM_015999chr1----1140 --
NM_016001chr172111 21 ------
NM_016003chr752683 1869 1067 341 187 --1491 --
NM_016019chr751008 999 959 110 22 ------
NM_016021chr663011 2289 1065 881 767 537 22335 172 --11131
NM_016023chr821905 1493 ------
NM_016025chr1661492 738 635 567 40 24 ------
NM_016026chr142141 119 ------
NM_016045chr2031701 1531 35 21174 234 --1411
NM_016061chr231120 1100 438 ------
NM_016068chr7133 --1141 --
NM_016072chr122687 416 170 ----
NM_016075chr13--22959 892 --11050
NM_016076chr172971 2827 2633 903 580 461 130 22934 2002 11223 --
NM_016083chr633805 971 189 1490 ----
NM_016099chr84460 176 84 28 ------
NM_016100chr202164 33 --1302 --
NM_016103chr5122 ------
NM_016107chr531390 356 21 11205 --11018
NM_016120chrX2461 165 --1154 --
NM_016121chr11994 ------
NM_016125chr171106 1417 ----
NM_016131chr21278 11631 ----
NM_016132chr1533308 2972 680 --1309 --
NM_016133chr221550 79 ------
NM_016147chr113949 296 182 ------
NM_016152chr34989 945 47 41 ------
NM_016169chr1042601 1250 1027 59 22432 929 31269 974 185 --
NM_016190chr1177 124 ----
NM_016205chr421099 124 ------
NM_016206chr388958 8732 7971 6125 1797 1707 1521 880 47227 7102 6929 84 12740 --
NM_016217chr643690 2906 883 857 12268 13298 --
NM_016218chr51489 1367 11206 --
NM_016234chr102625 227 1808 ----
NM_016240chr811665 ------
NM_016248chr1333401 2982 365 23905 3456 ----
NM_016252chr21135 ------
NM_016255chr642912 2295 381 313 23309 2951 1112 13167
NM_016257chr1133363 3277 3174 3151 2641 2208 1094 1077 680 608 468 414 216 --31016 507 99 1202
NM_016258chr14748 735 219 107 ------
NM_016260chr296128 6109 5899 4979 2876 1877 1576 1258 479 ------
NM_016264chr191105 1468 1365 --
NM_016269chr411143 1915 ----
NM_016271chr1821756 498 ------
NM_016272chr2262779 2555 1947 1712 718 137 --12086 --
NM_016277chr631333 667 61 190 ----
NM_016281chr121914 ------
NM_016284chr16183 --1948 --
NM_016289chr241662 1635 914 422 41619 1511 58 37 ----
NM_016308chr131615 754 328 11282 ----
NM_016315chr21330 1550 11824 --
NM_016322chr933223 2593 2149 12643 ----
NM_016337chr142315 41 --183 --
NM_016356chr632566 776 360 ------
NM_016377chr621699 1509 ------
NM_016383chrX1181 ------
NM_016396chr1532755 2483 960 22114 977 22620 237 --
NM_016418chr2253689 2988 2617 381 179 --1795 162
NM_016436chr202461 116 --12398 --
NM_016441chr221943 836 --1913 --
NM_016442chr51892 21734 107 1854 --
NM_016451chr111122 ------
NM_016453chr3----134 1256
NM_016454chr15--1245 ----
NM_016463chr5------161
NM_016472chr1421448 386 ------
NM_016485chr6--11655 168 --
NM_016505chr12694 555 2612 274 ----
NM_016506chr112505 444 ------
NM_016507chr1721981 55 ------
NM_016513chr662359 1372 1225 957 504 347 ------
NM_016516chr21639 ------
NM_016521chrX124 ------
NM_016525chr93961 680 276 --2802 269 --
NM_016530chr1594096 3915 2765 1436 1285 1162 626 589 155 33542 3076 324 11430 --
NM_016531chr432789 822 110 14029 ----
NM_016542chrX2557 371 --11743 --
NM_016545chr12721 594 --1826 --
NM_016559chr31546 ------
NM_016569chr1231236 1068 30 1290 ----
NM_016577chr384304 4223 1733 1499 1248 655 521 493 --1534 23553 1717
NM_016578chr111218 ------
NM_016586chr142515 136 1167 ----
NM_016588chr61643 1921 ----
NM_016592chr2021059 545 --11248 --
NM_016598chr311418 ------
NM_016603chr541784 1777 822 735 ------
NM_016604chr51942 11061 21158 135 --
NM_016605chr552417 1885 1808 1786 1695 --31676 709 690 1150
NM_016607chrX2397 88 11045 ----
NM_016613chr41288 --12144 --
NM_016621chr11104353 4198 3980 3964 3827 3219 1713 1481 122 66 --34257 3750 3577 --
NM_016626chr181419 --11412 --
NM_016631chr211155 ------
NM_016644chr5--1117 ----
NM_016654chr1521286 542 ------
NM_016818chr213694 329 201 ------
NM_016823chr1721303 854 1839 ----
NM_016824chr101289 ------
NM_016829chr33530 262 24 --1170 --
NM_016834chr1733731 3329 2511 --13890 13032
NM_016835chr1733731 3329 2511 --13890 13032
NM_016841chr1733731 3329 2511 --13890 13032
NM_016929chr674580 4294 4217 3358 1846 1670 530 1203 2145 62 11119
NM_016930chr44829 398 184 72 ------
NM_016936chr1651755 1642 791 746 261 --11352 --
NM_016952chr1153953 3887 3263 2887 596 11639 11175 11245
NM_016953chr285786 5253 5072 4883 4782 4137 1487 673 162 35512 2328 1657 15047
NM_017409chr121817 ------
NM_017412chr821384 971 ------
NM_017413chrX72324 719 488 453 288 219 95 12555 --1408
NM_017414chr22122 1505 ----
NM_017415chr5123964 3856 3698 3485 3178 3154 1237 1066 820 773 737 501 14014 1800 --
NM_017416chrX1157 ------
NM_017420chr1452567 1515 710 626 100 1506 ----
NM_017423chr411706 ------
NM_017437chr1431747 566 277 --1496 --
NM_017447chr2121479 169 ----12753
NM_017452chr2011095 --194 --
NM_017453chr2011095 --194 --
NM_017454chr2011095 --194 --
NM_017455chr152188 162 ------
NM_017456chr1721748 221 2754 211 1135 --
NM_017457chr19----1116 --
NM_017488chr241434 1280 1229 588 11407 ----
NM_017512chr181112 ------
NM_017520chr13134 181 ----
NM_017544chrX2375 364 1179 ----
NM_017551chr1022672 2541 ------
NM_017553chr1521030 477 1124 --1950
NM_017554chr311650 --22096 148 --
NM_017558chr161409 --1480 --
NM_017563chr3115443 5422 5262 4817 4562 4473 4414 2471 2439 1840 1268 14516 15942 --
NM_017577chr331271 482 231 ------
NM_017580chr101751 1360 ----
NM_017590chr223688 676 545 --42220 298 291 285 1376
NM_017593chr4--126 ----
NM_017596chr1124362 3770 3739 2855 1465 1449 1352 1216 1000 548 435 255 14498 23686 1786 13483
NM_017610chr1531402 1305 451 ------
NM_017622chr173135 124 66 ------
NM_017628chr4105238 4055 3561 3534 3322 1387 1192 800 386 162 11075 ----
NM_017629chr151799 435 345 97 76 ------
NM_017632chr42363 109 ------
NM_017633chr663174 3131 3057 2690 647 89 12769 ----
NM_017634chr821540 626 ------
NM_017635chr1131641 1587 56 ------
NM_017637chr998904 8482 6089 5905 2273 1219 1012 893 614 36096 5963 2765 36377 6024 3613 18926
NM_017643chr173968 125 67 13054 22396 457 --
NM_017644chr355040 4843 4497 4298 1527 ------
NM_017649chr1041043 817 457 274 ------
NM_017650chr785900 5717 5376 4621 4247 731 116 73 2830 822 35489 4085 959 --
NM_017657chr22361 112 ------
NM_017658chr1434150 3924 780 ------
NM_017666chrX6577 563 294 279 145 135 --1223 1818
NM_017667chr71577 ------
NM_017668chr163779 107 23 ------
NM_017672chr15------1129
NM_017676chr531896 1863 276 ------
NM_017693chr1341350 1264 1160 141 ------
NM_017694chr211988 11560 ----
NM_017714chr20--1610 ----
NM_017719chr311633 12579 ----
NM_017730chr31709 ------
NM_017734chr13579 485 205 ------
NM_017736chr1652933 650 631 534 179 ----12583
NM_017737chr12632 461 ----2754 570
NM_017740chr1631715 353 41 1536 ----
NM_017741chr4----22317 421 --
NM_017742chr1831227 785 241 --1467 --
NM_017744chr142195 734 341 234 12046 1781 --
NM_017745chrX--1493 1139 --
NM_017749chr114799 358 339 206 ------
NM_017753chr91386 1924 ----
NM_017760chr71226 1277 ----
NM_017763chr172239 38 1417 1187 --
NM_017778chr841226 561 236 33 1460 ----
NM_017784chr3--128 ----
NM_017786chr8--1198 --1667
NM_017787chr1042818 2211 600 160 ------
NM_017791chr1421195 396 --11311 154
NM_017794chr9--1306 ----
NM_017798chr2021241 1149 --21044 78 --
NM_017799chr1441886 1632 257 36 1138 ----
NM_017811chr983031 2733 2641 2439 2358 2296 2001 536 ------
NM_017812chr7142 1142 ----
NM_017813chr875729 5089 3706 3621 1472 1078 955 1705 24896 1334 --
NM_017824chr1052453 2359 2147 615 279 11015 11985 --
NM_017830chr42308 41 --1896 --
NM_017831chr1874535 4512 4488 4360 3704 1776 1410 23346 1509 34603 3789 789 --
NM_017847chr14845 771 517 205 --1608 --
NM_017848chrX114558 3999 3515 3212 3018 1806 1488 1456 1270 173 108 --2544 352 --
NM_017849chr243174 2754 1201 504 --22805 1239 1290
NM_017851chr1531028 274 83 --1182 --
NM_017856chrX11673 --21326 397 --
NM_017866chr831071 739 130 ------
NM_017880chr21419 ------
NM_017902chr10145576 4920 4749 4482 4455 4442 4340 4324 3951 1154 1021 826 553 400 33591 1652 768 34787 4506 4371 --
NM_017911chr2221071 1034 --11527 --
NM_017919chr9115542 5502 4590 4313 2103 1932 1825 1621 1037 979 865 21960 1756 15520 12304
NM_017933chr21407 ----122
NM_017935chr41128 ------
NM_017938chrX31376 653 55 21534 295 ----
NM_017943chr143673 368 98 ------
NM_017944chr1143043 2284 1025 942 1736 ----
NM_017945chr32881 129 ------
NM_017953chr12864 36 11034 ----
NM_017955chr142827 429 11261 ----
NM_017987chr1041610 595 295 137 ------
NM_017994chr7112967 2196 2033 1910 1035 864 637 387 304 283 118 --22852 2488 --
NM_017999chr14------160
NM_018010chr321584 509 ------
NM_018014chr22928 148 ------
NM_018015chrX1954 194 ----
NM_018017chr1032736 1165 96 ----22194 468
NM_018027chr1093086 2831 2442 2077 2022 1028 508 498 64 --1842 --
NM_018030chr181806 1726 ----
NM_018036chr1444249 3378 3276 71 21195 932 ----
NM_018045chr152930 2483 2051 595 83 --12346 --
NM_018047chr51836 1298 --1815
NM_018056chr1----139 --
NM_018063chr101354 ------
NM_018070chr1--1411 ----
NM_018078chr41369 ------
NM_018084chr252845 2524 2030 428 54 1775 --12289
NM_018086chr211180 186 ----
NM_018087chr1--168 ----
NM_018092chr1631044 502 54 175 ----
NM_018095chr112505 444 ------
NM_018096chr172831 727 ----1665
NM_018107chr14--1715 ----
NM_018120chr821141 1123 ------
NM_018121chr1062698 2116 2103 2096 1233 431 --11243 --
NM_018126chr4179 ------
NM_018128chr173361 280 46 11031 1992 --
NM_018131chr101872 ----1125
NM_018133chr32474 431 11627 ----
NM_018137chr141290 1277 453 135 1433 ----
NM_018155chr343433 3033 2201 915 22848 410 ----
NM_018157chr1232417 608 60 1140 --1387
NM_018171chr122769 266 1331 ----
NM_018172chr1141546 1489 1384 1093 ------
NM_018178chr141999 1791 1370 144 21506 1458 1332 --
NM_018182chr1762054 1726 1455 686 430 277 --198 1183
NM_018184chr3122 1398 ----
NM_018200chr1522056 256 --2399 304 --
NM_018205chr1082352 2154 2074 2003 1609 853 534 360 1859 --1749
NM_018221chr21410 ------
NM_018223chr12--130 ----
NM_018231chr163331 177 128 ------
NM_018239chr1082352 2154 2074 2003 1609 853 534 360 1859 --1749
NM_018244chr2041189 503 436 50 ----1285
NM_018246chr892775 2728 2644 2309 2226 2214 2158 1904 511 --12665 --
NM_018247chr632873 967 538 32768 1916 548 22533 901 --
NM_018254chr141956 1901 1663 895 1234 1204 --
NM_018266chr32988 432 2865 229 ----
NM_018272chr121202 ------
NM_018287chr101915 11122 ----
NM_018293chr352663 2311 1911 582 221 12835 ----
NM_018299chr833220 1328 293 ------
NM_018302chr442458 1687 1518 505 21975 131 ----
NM_018315chr4----1316 --
NM_018323chr41296 --190 --
NM_018334chr7------1184
NM_018351chr1264199 4156 4024 3739 3238 728 11447 11523 --
NM_018354chr20----137 --
NM_018362chr1153849 2506 1478 1410 166 --13240 --
NM_018368chr61295 ------
NM_018374chr743498 1150 871 478 25260 4567 33602 314 240 --
NM_018388chrX--11205 1993 --
NM_018403chr343520 3510 1449 380 23683 1189 12998 --
NM_018416chr1232218 1959 1711 32340 972 841 1378 --
NM_018440chr837584 6738 1523 38162 6019 5661 16390 26587 2599
NM_018445chr151178 --1150 --
NM_018448chr1211221 2447 298 ----
NM_018449chr92676 304 ------
NM_018462chr31792 1830 176 --
NM_018469chr1731299 438 375 ------
NM_018482chr81436 1243 --2565 333
NM_018486chrX126 ------
NM_018488chr17198 ----144
NM_018489chr1139 1905 ----
NM_018553chr1721609 272 11851 ----
NM_018555chr1942095 768 175 105 21465 215 1181 11987
NM_018566chr154735 4644 3544 3282 1372 34070 3992 1559 14672 2744 507
NM_018593chr61634 --1558 --
NM_018602chr1541632 594 407 218 1120 ----
NM_018638chr1253999 3863 3441 1320 1082 ----126
NM_018640chr1222448 816 ----12612
NM_018644chr1131361 765 213 1260 2713 282 1743
NM_018649chr101584 ------
NM_018650chr121512 849 ------
NM_018682chr71221 ------
NM_018683chr2031676 337 297 ------
NM_018691chr551019 772 258 193 151 ----11049
NM_018698chrX21425 695 2144 42 --11736
NM_018704chr121567 367 12004 ----
NM_018710chr811228 141 ----
NM_018712chr1121354 193 1303 1326 --
NM_018713chr12366 232 ------
NM_018715chr132163 1647 354 --1868 --
NM_018717chr422357 760 1710 2896 336 --
NM_018718chr7111824 1715 1641 1484 828 498 443 371 333 226 81 --1149 --
NM_018844chr731983 195 64 ------
NM_018846chr73701 342 63 1214 ----
NM_018847chr931244 548 57 ------
NM_018890chr7----11399 --
NM_018898chr531682 601 328 --12086 --
NM_018899chr531682 601 328 --12086 --
NM_018900chr531682 601 328 --12086 --
NM_018901chr531682 601 328 --12086 --
NM_018902chr531682 601 328 --12086 --
NM_018903chr531682 601 328 --12086 --
NM_018904chr531682 601 328 --12086 --
NM_018905chr531682 601 328 --12086 --
NM_018906chr531682 601 328 --12086 --
NM_018907chr531682 601 328 --12086 --
NM_018908chr531682 601 328 --12086 --
NM_018909chr531682 601 328 --12086 --
NM_018910chr531682 601 328 --12086 --
NM_018911chr531682 601 328 --12086 --
NM_018912chr531431 1094 543 ------
NM_018913chr531431 1094 543 ------
NM_018914chr531431 1094 543 ------
NM_018915chr531431 1094 543 ------
NM_018916chr531431 1094 543 ------
NM_018917chr531431 1094 543 ------
NM_018918chr531431 1094 543 ------
NM_018919chr531431 1094 543 ------
NM_018920chr531431 1094 543 ------
NM_018921chr531431 1094 543 ------
NM_018922chr531431 1094 543 ------
NM_018923chr531431 1094 543 ------
NM_018924chr531431 1094 543 ------
NM_018925chr531431 1094 543 ------
NM_018926chr531431 1094 543 ------
NM_018927chr531431 1094 543 ------
NM_018928chr531431 1094 543 ------
NM_018929chr531431 1094 543 ------
NM_018948chr121077 59 122 ----
NM_018951chr721188 63 ------
NM_018958chr15103913 3480 3262 2967 2881 1426 1167 559 329 124 ------
NM_018959chr192709 269 --1251 --
NM_018963chr213584 272 136 ------
NM_018970chr712607 22261 2079 ----
NM_018976chr1232235 1905 261 11003 1942 --
NM_018979chr1222597 239 11013 1184 --
NM_018992chr161644 1411 11182 11332
NM_018994chr13463 138 52 ------
NM_018999chr1034335 592 247 1457 31866 467 387 13150
NM_019001chr344052 3876 3783 1447 34779 4182 3300 14151 21767 437
NM_019004chr72728 671 --11805 --
NM_019036chr6144 ------
NM_019044chr283754 3698 3468 3119 3084 2988 1111 599 44645 3231 1370 362 --1279
NM_019045chrX173 ------
NM_019046chr10199 --1778 --
NM_019050chr472233 2199 2165 2071 1997 1971 737 ------
NM_019058chr101253 ------
NM_019063chr262113 1791 1638 878 522 355 --21539 34 --
NM_019071chr73579 225 100 1532 138 --
NM_019072chr533285 2941 334 33195 2886 2758 ----
NM_019074chr153872 318 284 --1307 --
NM_019087chr531480 1466 98 ------
NM_019114chr922401 2291 --1558 182
NM_019555chr321171 605 ------
NM_019590chr101330 11488 ----
NM_019592chr95851 296 153 139 126 ------
NM_019593chr2033089 2840 2208 --12056 23164 3118
NM_019596chr2152783 2734 2717 1040 931 --2719 679 --
NM_019597chrX2567 31 194 ----
NM_019604chr111244 ------
NM_019613chr173278 261 44 1169 ----
NM_019859chr1041016 494 330 267 ------
NM_019862chr1631287 598 378 --1401 --
NM_019885chr272359 2352 2108 2049 1137 942 849 --3412 211 200 --
NM_019898chr1631287 598 378 --1401 --
NM_019899chr1631287 598 378 --1401 --
NM_019900chr1631287 598 378 --1401 --
NM_019903chr101289 ------
NM_020066chr12871 55 --1881 --
NM_020122chr233988 1498 1376 21909 189 24945 3743 --
NM_020123chr1031417 437 302 11444 ----
NM_020132chr21114852 4780 4562 3705 3465 3365 901 891 271 238 47 --23336 181 --
NM_020137chrX1393 1402 ----
NM_020141chr141701 1471 182 91 11878 1328 --
NM_020144chr73760 736 495 11406 ----
NM_020150chr1032199 1891 1784 ----11615
NM_020151chr271562 1159 534 388 380 116 37 ------
NM_020152chr211157 ------
NM_020159chr41641 ------
NM_020168chr1561200 1187 1163 1056 1021 552 --2411 148 --
NM_020178chr1721151 405 --11030 --
NM_020180chr182394 165 ------
NM_020182chr2063245 3006 2784 2652 1149 944 12850 12962 --
NM_020198chr172325 214 ------
NM_020204chr11319 ------
NM_020205chr133031 1380 810 ------
NM_020226chr41573 ------
NM_020239chr142026 1727 295 51 ------
NM_020240chr542488 947 889 59 1900 2793 121 1427
NM_020245chr645102 1872 312 77 44853 3318 1885 829 14825 14347
NM_020248chr122162 1873 ------
NM_020307chr32129 121 ------
NM_020309chr194952 431 359 32 --1751 --
NM_020310chr1782483 2267 1045 919 884 414 248 86 --1265 --
NM_020337chr4----152 1529
NM_020338chr1073280 2451 2306 1431 1172 360 348 --1434 12410
NM_020341chr202821 247 1260 ----
NM_020342chr23841 669 440 21927 1731 ----
NM_020348chr1092711 2421 2046 1938 1874 954 816 395 40 22330 629 1176 --
NM_020357chr321367 1311 ------
NM_020362chr13281 213 85 ------
NM_020381chr6------11838
NM_020382chr1231300 1018 112 --1362 --
NM_020390chr321563 456 14425 --1274
NM_020403chr1351793 1217 355 220 181 1105 ----
NM_020416chr421860 457 --1380 1816
NM_020420chrY21648 227 ------
NM_020423chr12215 134 ------
NM_020429chr7122494 2461 2302 2245 2237 1901 1233 745 484 102 57 28 --12083 --
NM_020432chr761537 900 526 451 90 36 ------
NM_020438chr961256 1096 429 345 30 24 ------
NM_020452chr131726 1446 496 ------
NM_020455chr652408 2182 719 587 338 --22809 115 11738
NM_020457chr163564 275 44 ------
NM_020463chr231240 542 376 1582 ----
NM_020465chr1651845 1785 1564 661 163 11980 ----
NM_020466chr644652 3768 1248 728 44284 3270 3205 1726 34809 4493 548 --
NM_020474chr18----1154 21877 1797
NM_020475chr832194 1983 158 --42243 2221 1885 1508 --
NM_020476chr832194 1983 158 --42243 2221 1885 1508 --
NM_020477chr832194 1983 158 --42243 2221 1885 1508 --
NM_020478chr832257 2046 221 --42306 2284 1948 1571 --
NM_020480chr832194 1983 158 --42243 2221 1885 1508 --
NM_020532chr21590 ------
NM_020630chr102601 124 ------
NM_020651chr211218 ------
NM_020654chr321097 504 ------
NM_020655chr1631491 1106 1007 --1266 --
NM_020666chr53916 260 36 ------
NM_020686chr1622435 565 22799 2764 ----
NM_020689chr202533 254 ------
NM_020690chr52238 31 ------
NM_020699chr174967 4711 3843 3375 1572 896 238 15337 ----
NM_020708chr2031915 1856 50 11547 31577 791 402 --
NM_020711chr211608 1788 ----
NM_020713chr2083185 2964 2493 1158 829 609 125 71 --3822 557 88 1491
NM_020717chrX94681 4435 4189 4074 3969 3892 3797 1527 111 --21885 1347 --
NM_020727chr2143211 1452 1032 739 --13542 11536
NM_020728chr732356 2062 200 --33080 2860 30 12250
NM_020734chr1211343 ------
NM_020739chr1533134 2618 1154 --13166 --
NM_020742chrX52323 1970 1880 1832 102 32739 2305 196 ----
NM_020747chr51827 ------
NM_020750chr621143 70 ------
NM_020752chr1042443 2257 1108 555 22769 247 ----
NM_020755chr621602 1132 11330 1110 --
NM_020764chr162924 189 --1127 11307
NM_020766chrX54240 4104 3708 1068 987 --13978 13163
NM_020769chrX2887 125 --2741 113 --
NM_020772chr1798106 6779 5338 2292 2022 1863 1581 917 252 --36172 2958 2206 --
NM_020774chr1876051 5857 2349 2053 1480 806 488 25674 4349 46057 4757 1971 1525 --
NM_020783chr183847 407 236 --1463 --
NM_020792chr342754 617 579 352 11719 ----
NM_020794chr121359 33 1435 ----
NM_020795chr1731919 1804 652 1116 ----
NM_020796chr572611 2488 2270 2152 1027 771 274 ------
NM_020799chr10182 ------
NM_020801chr521662 55 12415 1587 --
NM_020804chr682285 2195 2151 771 602 464 357 91 1789 42139 2117 1955 1934 1803
NM_020805chr1831697 1582 1281 ------
NM_020810chr1423310 750 13221 ----
NM_020813chr1952380 2294 855 799 207 11017 1114 2964 386
NM_020820chr2051406 1262 450 410 82 ------
NM_020824chr102623 499 155 --124
NM_020825chr1673810 2877 1268 1237 1178 813 286 --23370 3063 --
NM_020830chr242694 1257 608 391 11207 --1237
NM_020834chr1461748 1307 1260 405 355 126 11683 ----
NM_020839chr331241 1224 632 ------
NM_020841chr1243743 3155 1210 230 --1922 --
NM_020843chr15----1399 --
NM_020845chr1252039 914 696 416 189 12312 1582 --
NM_020850chr1682796 2734 2635 2616 2455 2422 2251 1166 1511 --12226
NM_020858chr1531903 859 728 1917 11954 --
NM_020860chr42469 120 ------
NM_020861chr631107 507 493 1854 ----
NM_020865chr31123 1474 ----
NM_020868chr231434 594 84 1578 ----
NM_020870chr4191 ------
NM_020872chr31229 11701 ----
NM_020873chr32203 195 ------
NM_020888chr161463 696 594 536 429 235 ------
NM_020899chr1752196 2095 779 770 220 --1268 --
NM_020917chr1952605 1249 600 483 455 13259 13939 21133 167
NM_020918chr1043063 2404 2255 1373 11062 ----
NM_020922chrX31499 311 141 ------
NM_020925chr12944 353 ----11400
NM_020927chr1672061 1851 1685 1667 593 381 100 22399 2044 ----
NM_020933chr1981932 1494 644 343 331 244 232 128 11796 ----
NM_020935chr244210 4199 3976 3186 --11745 --
NM_020940chr1022320 261 11115 1572 --
NM_020946chr951551 600 542 310 195 21541 555 1452 --
NM_020948chr11661 ------
NM_020952chr9140 --164 --
NM_020956chr1974550 1838 1760 1682 1589 312 231 --24222 773 13736
NM_020959chr19----187 --
NM_020962chr1562522 2421 1823 664 506 325 --11732 --
NM_020964chr1883123 3108 1876 1197 762 630 375 321 ------
NM_020967chr204826 400 288 243 --11138 11111
NM_020971chr19----1689 --
NM_020975chr1041777 1376 527 256 --11268 --
NM_020977chr441661 1513 750 642 --1107 1120
NM_020981chr22792 72 ------
NM_020983chr1282011 1819 1633 1574 696 257 100 23 11564 11552 --
NM_020987chr10--11238 ----
NM_021003chr14------2250 143
NM_021005chr15----1413 --
NM_021007chr221620 1582 ------
NM_021032chr311663 21609 76 12005 --
NM_021033chr13--13059 11384 --
NM_021038chr333161 2667 705 23048 281 13173 --
NM_021069chr462110 2022 1849 1512 345 332 11613 ----
NM_021072chr511691 --195 --
NM_021079chr1793294 3097 2960 2676 1323 541 487 222 194 --32634 2378 1043 --
NM_021083chrX53442 2276 978 355 347 12949 11085 --
NM_021090chr2274974 4865 4770 4060 3373 1652 953 --13810 13178
NM_021096chr2273136 2967 2411 1177 1008 321 191 --1965 23173 2879
NM_021097chr251016 805 574 253 117 1799 ----
NM_021116chr7198928 8506 7518 7006 3296 3068 3045 2473 2382 2342 2237 1909 1754 1559 1023 802 348 233 49 37734 1951 301 67098 6493 6075 6064 482 77 11008
NM_021132chr1031287 325 246 ------
NM_021136chr14------1108
NM_021140chrX3352 209 177 ------
NM_021144chr92147 42 ------
NM_021145chr7----1281 --
NM_021155chr1972880 2657 2609 2519 2309 2174 1933 12185 21001 986 --
NM_021156chr2041030 317 177 125 ----11068
NM_021158chr204808 573 104 94 ------
NM_021159chr431085 385 59 ------
NM_021183chrX------12222
NM_021189chr12414 289 ----1841
NM_021190chr11925 ------
NM_021202chr2072643 2627 2577 2346 1904 1246 353 --1310 1548
NM_021218chr9----1996 --
NM_021220chr20167 ------
NM_021222chr151320 927 491 483 102 181 ----
NM_021229chr121328 --1335 --
NM_021238chr1221815 409 ------
NM_021240chr91703 ------
NM_021242chrX1284 ------
NM_021255chr1473840 2864 2671 1607 624 394 65 13195 --13690
NM_021259chr16299 78 --142 --
NM_021260chr1441386 1367 1204 991 --1959 --
NM_021267chr194399 392 188 103 --2438 152 --
NM_021619chr921169 497 --3880 817 80 --
NM_021620chr61764 ------
NM_021622chr1021876 64 ------
NM_021627chr331162 345 154 --125 --
NM_021633chr171011 883 453 385 206 76 41 ------
NM_021637chrX41328 1132 1018 32 1462 ----
NM_021638chr474532 4449 4436 4026 3265 1020 111 --31934 1048 22 11300
NM_021643chr231527 550 33 ------
NM_021645chr1352376 1747 1697 763 58 --1663 --
NM_021648chr652346 2126 915 523 139 11846 11783 --
NM_021705chr631088 484 51 --21031 606 --
NM_021722chr7156 ------
NM_021728chr142270 59 11025 ----
NM_021738chr101294 ------
NM_021785chrX1137 ------
NM_021809chr2052005 1859 304 277 207 1826 2469 33 --
NM_021813chr675349 5300 5208 5167 4861 293 54 --21881 1835 --
NM_021814chr62589 552 ------
NM_021818chr1441431 1373 1333 1009 ------
NM_021824chr22218 91 ------
NM_021828chr101322 ----164
NM_021830chr101867 --1585 --
NM_021911chr554658 4565 2116 1907 204 15578 21943 1171 --
NM_021912chr1533915 3805 788 13519 ----
NM_021913chr1951825 1461 1319 1130 267 ------
NM_021914chr1442454 2312 2090 1856 --150 --
NM_021932chr113573 173 47 ------
NM_021940chr611525 ------
NM_021943chr631711 1686 334 ------
NM_021945chr663375 2449 2257 1034 636 27 --32577 2368 1174 1814
NM_021947chr171371 ------
NM_021954chr1373558 2605 2588 626 589 395 21 --11213 --
NM_021956chr61293 ------
NM_021959chr63720 390 158 --169 1858
NM_021960chr132639 2299 2022 1226 ----
NM_021961chr11107285 5639 5022 2776 2594 2558 2209 2002 1493 256 --35216 4796 1591 14994
NM_021962chr173377 231 108 --32281 2226 48 1354
NM_021964chr332602 1261 910 21241 381 14223 1400
NM_021969chr1156 ------
NM_021984chrX1381 --136 --
NM_021987chrX1381 --136 --
NM_021990chrX1381 --136 --
NM_021998chrX21378 1240 1489 ----
NM_022048chr15116274 5967 5221 4482 4384 4187 1790 1589 1531 1080 693 35636 5135 4745 14259 1380
NM_022060chr1431364 1184 362 --21100 985 --
NM_022062chr1151713 1448 1330 1301 62 --1589 --
NM_022075chr12617 369 1807 1696 --
NM_022079chr10--177 ----
NM_022097chr162931 165 --1836 --
NM_022098chr221310 --21412 1011 --
NM_022118chr131195 ------
NM_022123chr141198 182 ----
NM_022130chr521411 463 1367 1299 --
NM_022138chr64561 514 362 185 --1320 --
NM_022140chr532118 1674 1531 --11976 1115
NM_022162chr163790 770 189 ------
NM_022166chr1665612 4291 2243 770 495 284 --35643 1445 564 --
NM_022169chr112442 349 --1188 --
NM_022170chr771712 1664 1546 1264 1107 524 398 11191 ----
NM_022336chr251982 1946 851 693 588 ----1386
NM_022346chr421215 41 ------
NM_022351chr823276 2843 ------
NM_022366chr1--189 ----
NM_022367chr12571 287 ------
NM_022373chr72241 41 ------
NM_022450chr16------136
NM_022456chr12106833 6796 6654 5781 4854 1605 964 437 303 208 15984 37401 5384 1414 --
NM_022458chr762484 2207 346 210 106 47 --1976 --
NM_022459chr1383860 2477 2244 1267 1089 961 604 476 25077 642 ----
NM_022461chr321441 117 --1196 --
NM_022465chr1292641 2457 2396 2027 1102 1045 804 753 469 1380 ----
NM_022467chr191442 ------
NM_022470chr31826 --11251 --
NM_022475chr42544 134 ------
NM_022476chr1611035 1329 ----
NM_022477chr2021483 128 176 ----
NM_022491chr1242692 2388 737 208 --1401 --
NM_022553chr62206 92 ------
NM_022557chr17160 --1204 --
NM_022572chr241605 1575 1390 266 --21378 1168 --
NM_022640chr17160 --1202 --
NM_022648chr254357 3714 3579 3060 795 --23107 1245 13352
NM_022650chr52113 60 135 ----
NM_022652chr123955 440 286 --1915 146
NM_022658chr1211288 --1993 --
NM_022716chr162597 868 477 301 290 280 ------
NM_022719chr2273890 3662 3176 2948 1158 843 671 --33872 2959 76 --
NM_022726chr63522 285 232 11765 ----
NM_022728chr7--1676 ----
NM_022730chr25709 265 203 149 98 --1429 --
NM_022735chr131690 680 213 ------
NM_022737chr1921000 22 --1275 --
NM_022739chr172284 226 164 --1393
NM_022748chr772567 2552 2526 1138 436 139 111 22825 1927 12699 11973
NM_022753chr152367 1983 1843 938 882 ------
NM_022755chr932583 2286 1680 --1838 --
NM_022756chr131352 1091 27 ------
NM_022758chr632906 1061 555 ------
NM_022763chr353036 2757 2533 2325 761 ------
NM_022768chr1--142 ----
NM_022771chr121730 ------
NM_022776chr32486 271 ------
NM_022780chr251826 1262 530 446 121 --1562 --
NM_022781chr962799 2422 1115 722 385 89 1958 ----
NM_022824chr531219 527 496 138 ----
NM_022826chr21486 --1166 --
NM_022828chr511690 ------
NM_022829chr2032090 1971 467 12045 42025 1721 804 135 --
NM_022831chr131496 641 339 1169 ----
NM_022841chr1552416 757 536 264 138 11962 ----
NM_022845chr1611906 ----12063
NM_022893chr222112 436 22675 794 177 --
NM_022894chr241620 665 584 119 21533 1453 ----
NM_022897chr51150 ------
NM_022898chr1424008 3305 14769 --14195
NM_022900chr7255 34 1329 ----
NM_022910chr1651845 1785 1564 661 163 11980 ----
NM_022912chr252942 1978 1169 875 21 ----21053 663
NM_022918chr1132026 563 93 ------
NM_022970chr1031275 1120 1097 ------
NM_022977chrX32312 1744 59 ------
NM_023000chr1421476 126 1516 ----
NM_023001chr1421476 126 1516 ----
NM_023009chr1----1524 --
NM_023010chrX4755 710 563 79 ------
NM_023012chr12----186 --
NM_023016chr232554 2260 146 12471 11925 --
NM_023019chr22342 124 ------
NM_023068chr2041502 1384 1181 24 --2603 59 --
NM_023075chr18----1703 --
NM_023076chr1652719 2322 2260 736 297 --21201 45 --
NM_023079chr1761688 1653 1365 1297 466 96 ------
NM_023112chr14112915 2331 2017 1950 1924 1807 1053 724 709 452 67 --11073 12534
NM_023929chr81994 ------
NM_023940chr41101 ------
NM_024003chrX------164
NM_024007chr542651 1052 739 731 --1917 --
NM_024017chr1731736 336 192 11533 21268 472 --
NM_024045chr101174 ------
NM_024061chr72223 216 ------
NM_024087chrX2522 26 2607 93 ----
NM_024090chr431375 394 264 11902 ----
NM_024106chr19149 --1346 --
NM_024294chr632906 1061 555 ------
NM_024301chr1951350 1041 502 368 199 ------
NM_024312chr1211455 1123 2663 372 --
NM_024341chr1974009 1104 1092 969 869 456 201 --33765 3257 602 --
NM_024422chr1821350 521 --2749 392 --
NM_024424chr111101 ------
NM_024425chr111101 ------
NM_024426chr111101 ------
NM_024490chr151427 ------
NM_024501chr22475 162 --1499 --
NM_024503chr1257 34 143 --122
NM_024524chr322811 251 33175 2539 226 1461 --
NM_024529chr111070 ------
NM_024539chrX21009 415 ------
NM_024541chr1041738 502 250 232 11614 ----
NM_024546chr133900 845 399 ------
NM_024548chr321121 622 --11494 --
NM_024551chr1242517 1770 918 836 22172 1925 --11739
NM_024551chr1242517 1770 918 836 22172 1925 --11739
NM_024556chr111446 ------
NM_024561chr13164 ------
NM_024567chr82516 293 ------
NM_024569chr132934 2868 1017 1448 ----
NM_024574chr42184 37 ------
NM_024586chr12226 208 155 ----
NM_024595chr12282 88 --11225 --
NM_024607chr894327 3671 3349 3288 1745 1335 803 523 167 23450 700 ----
NM_024613chr8197 11797 ----
NM_024626chr131541 1395 1362 --11284 --
NM_024638chr342270 1825 975 738 ----11995
NM_024639chr652604 2109 2002 1910 380 ------
NM_024646chr123948 394 --22982 2480 --
NM_024659chr22172 57 ------
NM_024665chr344419 3175 3053 401 33900 2855 1777 --11119
NM_024670chr1041304 1264 700 584 ------
NM_024674chr151179 827 652 285 150 --12680 --
NM_024689chrX41354 1254 158 47 ------
NM_024692chr211357 --2591 369 --
NM_024700chr11786 188 ----
NM_024721chr822036 890 ------
NM_024740chr1143306 2827 1076 52 --33665 3041 1427 1542
NM_024744chr222255 1663 2904 557 ----
NM_024749chr12904 68 1403 ----
NM_024751chr412021 ------
NM_024755chr151351 ------
NM_024770chr276618 6376 5760 4260 2644 2393 441 45588 5482 5009 172 45637 4623 2164 1530 16675
NM_024780chr1611066 ----1434
NM_024798chr1552784 2357 2262 2228 1929 --1827 --
NM_024804chr1----1344 --
NM_024830chr551413 798 544 340 129 --31587 883 118 1702
NM_024834chr101423 --1310 --
NM_024837chr1541339 539 69 42 ------
NM_024852chr1167 --197 --
NM_024875chr1051673 1556 384 263 43 ------
NM_024881chr1943838 646 567 356 --11293 --
NM_024884chr1463786 1599 1019 625 565 479 --1291 --
NM_024911chr11606 ------
NM_024920chr431511 414 289 ------
NM_024939chr1621357 576 ----11382
NM_024947chr377189 6478 3796 3743 3595 1927 456 --12613 26036 2249
NM_024949chr444394 4356 3781 356 34268 3977 1849 34456 3860 1217 --
NM_024969chr23773 151 124 ------
NM_024971chr9140 --164 --
NM_024989chr2118127 7344 6927 5819 3283 2244 1794 1644 1361 898 882 15781 --17924
NM_025047chr33374 363 176 ------
NM_025054chr832840 1426 1049 ------
NM_025073chr134669 4090 142 11232 ----
NM_025083chr1551922 1503 1307 1299 229 --11521 21764 712
NM_025113chr1331160 516 450 ------
NM_025126chr122635 558 ------
NM_025130chr101547 1763 ----
NM_025134chr1642219 995 860 488 ------
NM_025146chr31841 --11805 --
NM_025147chr2--1947 1734 11064
NM_025151chr842003 869 818 56 1131 2656 383 --
NM_025160chr121615 527 21120 1047 22951 1493 --
NM_025164chr1122227 329 169 --12010
NM_025179chr1114131 3954 3883 3736 3505 3487 3443 3074 1125 704 183 23944 3595 34443 3192 1868 --
NM_025182chr93929 725 93 --1733 --
NM_025187chr16--11007 ----
NM_025191chr143561 3240 3213 874 --1905 --
NM_025211chr9143 1193 ----
NM_025222chr321178 960 --12502 --
NM_025235chr1052211 1792 785 562 227 1206 11424 --
NM_025237chr1741566 1302 289 141 --1617 --
NM_025239chr91287 1384 ----
NM_025248chr1763225 2735 1185 1070 747 99 ------
NM_025250chr753026 2044 1891 1132 818 --12875 1599
NM_030576chr1742571 1950 243 151 --11630 1322
NM_030594chr151516 ------
NM_030621chr1423690 3359 ----1382
NM_030625chr1012232 11621 11928 --
NM_030627chr553813 3050 2939 1424 1388 ------
NM_030647chr745541 3861 2475 2401 13851 --15685
NM_030648chr484142 3908 3574 2012 1832 1767 1531 1202 15292 11512 --
NM_030650chr233838 3101 2729 12679 24257 2992 --
NM_030664chr104975 177 64 55 ------
NM_030751chr101465 ------
NM_030751chr101465 ------
NM_030753chr172260 50 ------
NM_030758chr2231269 1138 401 --1200 --
NM_030759chr101317 159 1201 --
NM_030762chr1231967 581 563 11722 ----
NM_030763chrX1788 ------
NM_030766chr121108 1326 ----
NM_030767chr962524 2060 2054 1968 640 562 --32740 1071 309 1129
NM_030791chr1431785 1492 66 ------
NM_030792chr111604 1670 1126 --
NM_030795chr83372 61 26 ----147
NM_030799chr51647 --11922 --
NM_030800chr15184 171 ----
NM_030806chr1159186 8164 8062 7842 7060 6581 6525 6363 5713 3243 2783 2336 2286 796 90 68484 6432 2884 1830 1207 1081 --19256
NM_030809chr1252321 2269 1986 1683 523 --11963 --
NM_030813chr114888 682 296 232 ------
NM_030816chr122777 169 ------
NM_030817chr1261189 1171 632 467 443 58 ------
NM_030881chr2232334 2131 209 12069 --21597 28
NM_030911chr132416 62 --11440 --
NM_030912chr10----1614 --
NM_030914chr92134 76 1233 2365 262 --
NM_030918chr195231 4990 4764 3747 1674 1474 780 719 609 24828 44 14976 --
NM_030925chr1351431 1306 780 534 46 --11385 --
NM_030938chr17--21015 242 ----
NM_030939chr62868 465 ------
NM_030940chr941132 139 125 32 ------
NM_030952chr131119 1111 1103 --1201 --
NM_030953chr551445 1310 643 439 361 2451 107 ----
NM_030957chr192243 217 ----1203
NM_030968chr1751699 1668 1384 1131 421 --1327 --
NM_030979chr13--2311 174 ----
NM_030981chr112249 42 --11080 --
NM_031216chr1811661 11495 --11738
NM_031217chr11--1135 ----
NM_031243chr751876 924 820 772 77 11637 ----
NM_031244chr631122 880 278 --2304 290 --
NM_031262chr91935 ------
NM_031263chr91992 ------
NM_031266chr52174 166 ------
NM_031267chr7152 --1390 --
NM_031268chr1685115 4501 4325 3952 1813 1264 721 80 13456 1974 --
NM_031271chr81612 1671 ----
NM_031272chr173130 105 81 ------
NM_031284chr153876 375 126 ------
NM_031292chr1221498 693 11206 1352 --
NM_031309chr851910 1561 667 411 227 --11822 --
NM_031314chr1441417 1332 754 533 11428 --1102
NM_031369chr41228 ------
NM_031370chr41228 ------
NM_031411chr531682 601 328 --12086 --
NM_031427chr1485799 5596 5376 4353 2043 1427 1178 245 15259 34383 1908 1773 --
NM_031431chr1311511 ----1627
NM_031439chr83361 197 76 --21272 249 --
NM_031442chrX2905 548 12085 13132 1496
NM_031445chr243354 3340 479 88 12424 ----
NM_031453chr105940 847 806 687 96 ------
NM_031459chr191610 1488 1283 1256 513 440 407 393 30 11339 ----
NM_031468chr7197049 6562 6150 6110 5886 5643 5161 3301 3243 3031 2927 2738 2294 1876 1410 1178 463 291 210 47104 3275 1526 325 44987 1792 584 171 15602
NM_031469chr663792 3592 2991 868 819 614 22971 1392 --1826
NM_031477chr161120 --131 --
NM_031483chr2033531 1015 176 11170 13330 --
NM_031844chr164150 4028 3522 1615 1609 798 ------
NM_031845chr211101 12938 12797 --
NM_031847chr211101 12938 12797 --
NM_031849chr531682 601 328 --12086 --
NM_031857chr531682 601 328 --12086 --
NM_031860chr531682 601 328 --12086 --
NM_031866chr102876 299 ------
NM_031886chr1942322 593 533 380 --22118 1705 --
NM_031935chr13768 743 67 ------
NM_031937chr22122 --1264 --
NM_031989chr12189 ------
NM_031990chr1961409 1288 1007 949 908 52 --1580 --
NM_031991chr1961409 1288 1007 949 908 52 --1580 --
NM_031992chr771712 1664 1546 1264 1107 524 398 11191 ----
NM_032012chr953685 2079 774 83 57 25054 872 23557 1679 --
NM_032013chr2021483 128 176 ----
NM_032017chr181837 1735 1636 1292 721 591 333 43 11531 ----
NM_032041chr892378 2266 2219 1865 1729 1009 831 492 339 --22211 150 --
NM_032088chr531431 1094 543 ------
NM_032092chr531431 1094 543 ------
NM_032102chr1162895 2663 804 753 722 474 --12265 --
NM_032104chr15569 267 198 145 46 --1512 --
NM_032105chr1187875 7852 7518 6946 6775 6462 3139 2218 1891 1836 1770 1507 1357 569 267 198 145 46 --36032 2430 512 --
NM_032116chr1354793 4176 3978 3757 3731 11241 --35322 1581 986
NM_032121chrX32513 564 550 --11733 --
NM_032139chr19--1239 --1122
NM_032144chr22646 465 177 ----
NM_032146chr31154 ------
NM_032147chr12--1949 ----
NM_032148chr122370 115 ------
NM_032160chr1821438 1406 13380 ----
NM_032174chr151092 1003 512 106 80 ------
NM_032181chr23783 212 139 1316 ----
NM_032199chr1053616 3474 2493 1315 243 --21271 180 --
NM_032208chr2103273 2805 2700 915 875 619 253 243 65 40 12363 23047 1383 --
NM_032214chr2041139 216 189 58 21032 318 11245 --
NM_032221chr2021842 238 32045 1696 249 11818 --
NM_032228chr1133018 3000 943 11335 ----
NM_032233chr143768 164 30 ------
NM_032236chr11683 ------
NM_032242chr393314 2250 2242 2202 2179 990 957 721 354 123 21257 1244 1567
NM_032246chr1511072 ------
NM_032268chr1682603 2415 2408 2022 1131 1111 137 54 ------
NM_032272chr8133 --1332 --
NM_032283chr141865 1664 1280 1209 ----1571
NM_032289chr55490 387 276 195 67 --295 44 --
NM_032291chr11522 21902 260 ----
NM_032312chr22232 111 ------
NM_032315chr1247 23 ------
NM_032316chr352285 2271 2111 2063 2054 --2936 250 2645 173
NM_032319chr2122 --1318 --
NM_032320chr113657 588 204 ----1190
NM_032321chr243327 2619 1237 866 ------
NM_032325chr111622 --21907 560 --
NM_032353chr172445 43 --1120 --
NM_032373chr1044462 3887 1839 662 21498 111 14140 11571
NM_032376chr171656 ------
NM_032403chr531431 1094 543 ------
NM_032420chr52293 66 --190 --
NM_032424chr113329 292 41 --11312 --
NM_032434chr23591 379 92 ------
NM_032436chr131874 ------
NM_032438chr621340 1089 ------
NM_032440chr104904 703 692 62 ------
NM_032441chrX2417 117 ------
NM_032445chr15--12041 22184 100 12191
NM_032457chr453633 3219 3031 1505 139 ------
NM_032458chrX11118 --22301 952 --
NM_032491chr12--11197 ----
NM_032499chr152554 488 --1104 --
NM_032503chr61656 1265 ----
NM_032505chr311081 ------
NM_032509chr882429 2370 2107 2025 1836 1602 913 572 --186 --
NM_032510chr1822087 823 21835 1638 2737 33 --
NM_032521chr2032640 2444 844 ------
NM_032538chr692630 2398 1806 981 782 531 496 475 452 11869 1512 --
NM_032550chr101474 --1143 --
NM_032552chr91250 --21863 777 --
NM_032557chr42885 318 ------
NM_032560chr14----1219 --
NM_032575chr1621892 527 --11601 --
NM_032594chr142948 186 ------
NM_032595chr172149 91 --1335 --
NM_032603chr22481 162 ----1729
NM_032623chr41371 125 ----
NM_032632chr1441733 584 509 417 ------
NM_032636chr12486 29 ----190
NM_032682chr363588 2523 2292 951 790 517 11415 ----
NM_032689chr1921565 266 1355 21411 1081 --
NM_032727chr102388 118 11440 1243 --
NM_032737chr1942554 1041 897 586 --1170 --
NM_032741chr62937 691 --1281 --
NM_032765chr53898 835 185 --11000 --
NM_032777chr83589 430 216 11569 11002 --
NM_032781chr111108 --1273 1158
NM_032784chr6----172 --
NM_032786chr121443 --1527 --
NM_032788chr251037 502 419 335 28 1276 21598 586 --
NM_032801chr1131981 1975 1662 1372 12237 12107
NM_032810chr1041387 549 245 211 ------
NM_032824chr21329 ------
NM_032826chr765427 5178 4325 3354 1446 131 14301 23384 539 1441
NM_032838chr192129 81 1232 ----
NM_032846chr1431362 175 44 ------
NM_032859chr1331088 643 237 --1843 --
NM_032867chr112492 177 --1232 --
NM_032870chr61505 ------
NM_032871chr1141799 1219 691 671 1441 1591 --
NM_032873chr1164160 3536 1825 877 623 442 13716 --13639
NM_032875chr17--1310 2186 73 --
NM_032905chr1021030 31 --1519 --
NM_032924chr71450 ----1924
NM_032936chr7--1187 ----
NM_032947chr52365 258 ------
NM_032961chr4195 ------
NM_032967chrX1380 --1826 --
NM_032968chrX32994 2697 1100 --1453 --
NM_032969chrX32994 2697 1100 --1453 --
NM_032971chrY1407 --1853 --
NM_032972chrY1407 --1853 --
NM_032973chrY32989 2692 1100 --1453 --
NM_032975chr1812682 13237 11081 --
NM_032978chr18171 ------
NM_032979chr18171 ------
NM_032980chr1812682 13237 11081 --
NM_032981chr18171 ------
NM_032983chr782843 1152 1060 985 889 350 143 22 --32704 2354 332 --
NM_032995chr251357 1101 500 359 286 11634 ----
NM_032998chr121139 1028 ------
NM_033016chr2231542 1275 460 --1203 11262
NM_033020chr131169 876 733 14490 ----
NM_033030chr23186 71 24 ------
NM_033044chr1----11069 --
NM_033055chr12969 57 ------
NM_033058chr81954 1793 136 --
NM_033082chr121176 --132 --
NM_033089chr2031058 937 162 11383 ----
NM_033105chr82340 55 ------
NM_033125chr6--124 ----
NM_033129chr2071811 1781 1415 1343 816 701 225 --1743 22025 762
NM_033132chr1321898 698 ------
NM_033181chr633805 971 189 1490 ----
NM_033201chr16--1391 1307 --
NM_033211chr52742 375 ------
NM_033222chr92553 250 11008 ----
NM_033224chr797915 7185 6547 3090 2403 1440 1161 715 428 25479 1216 25324 3000 --
NM_033225chr842673 2267 592 261 --13056 --
NM_033226chr16164 --1106 --
NM_033240chr1531530 609 486 --21364 638 --
NM_033254chr31511 ------
NM_033255chr13185 ------
NM_033274chr572984 2920 2666 2363 288 211 119 ------
NM_033285chr844017 3882 1713 1129 13110 11427 --
NM_033290chrX43052 2870 1019 953 --23535 3025 --
NM_033315chr174705 654 356 225 --3869 648 446 --
NM_033326chr1142093 1675 955 681 ------
NM_033331chr973182 2701 748 706 348 207 37 --12768 12231
NM_033360chr1264472 3307 3077 1846 1444 1193 ------
NM_033387chr952437 1869 986 893 75 22584 85 42546 2475 388 112 --
NM_033389chr1764200 3225 987 572 501 437 33974 3832 1720 ----
NM_033401chr163477 165 150 ------
NM_033425chr1143117 2351 1355 529 22692 925 12915 --
NM_033429chr1552251 1008 280 229 165 12528 --12266
NM_033430chr432801 736 645 23045 1492 ----
NM_033437chr432801 736 645 23045 1492 ----
NM_033449chr54754 708 298 204 12111 ----
NM_033496chr10------135
NM_033497chr10------135
NM_033498chr10------135
NM_033500chr10------135
NM_033505chr276230 4562 4491 4179 4109 2329 581 15344 35262 1011 728 14685
NM_033516chr941342 438 288 70 --21453 995 --
NM_033542chr2072026 1672 1363 1332 636 81 69 ------
NM_033551chr543392 2828 2188 634 12216 13176 --
NM_033624chr1242038 1458 843 62 --11667 --
NM_033631chr11529 12430 1794 --
NM_033632chr4----1316 --
NM_033637chr1074027 4004 2956 1650 808 324 215 --13357 --
NM_033644chr52409 182 12450 12531 --
NM_033645chr52409 182 12450 12531 --
NM_033656chr2155558 5337 4901 4888 715 25087 192 11256 --
NM_048368chr18--242 30 --1163
NM_052840chr1521372 1096 ------
NM_052879chr1243952 3277 2987 361 ------
NM_052880chr2221245 902 --1575 --
NM_052885chr1274714 3980 1644 1505 617 359 294 --14480 --
NM_052896chr112168 11782 --149
NM_052905chr21562 --1675 --
NM_052907chr1263399 3192 2953 2831 1280 655 14267 11711 --
NM_052918chr1093299 2921 2798 2584 2263 1446 1270 542 316 22577 2411 ----
NM_052934chr141773 1709 339 173 --31479 1410 656 --
NM_052978chr144663 618 393 281 ------
NM_053002chr32925 900 1882 ----
NM_053016chr9147952 7923 7756 7697 7487 6839 6535 6248 5613 5312 2343 1572 1283 558 14947 27335 473 --
NM_053023chr1132850 2625 285 --11026 --
NM_053024chr311175 ----1226
NM_053025chr331376 435 143 ----1465
NM_053026chr331376 435 143 ----1465
NM_053027chr331376 435 143 ----1465
NM_053028chr331376 435 143 ----1465
NM_053031chr331376 435 143 ----1465
NM_053032chr331376 435 143 ----1465
NM_053043chr7155799 5268 5148 5031 4409 4014 3908 1671 1504 1025 912 418 161 131 103 1944 ----
NM_053046chr19145 --1416 --
NM_053056chr1152857 1981 754 739 86 23140 458 ----
NM_053064chr1462900 1205 972 903 127 30 --22636 1233 --
NM_053067chr91294 ------
NM_053279chr852682 2469 2414 2151 1939 --186 --
NM_053281chrX146 --1423 --
NM_054016chr11183 11864 1736 --
NM_054016chr11183 11864 1736 --
NM_054016chr11183 11864 1736 --
NM_054025chr1131361 765 213 1260 2713 282 1743
NM_054035chr171705 --2751 361 --
NM_054112chr201179 ------
NM_057158chr81574 ------
NM_057161chr61523 ------
NM_057169chr1242578 2526 2318 77 --11128 --
NM_057170chr1242578 2526 2318 77 --11128 --
NM_057175chr412560 1744 11809 --
NM_057178chr1762435 2208 2124 2079 287 22 12136 1447 --
NM_058170chr111095 ------
NM_058172chr411386 --11767 --
NM_058240chr1431324 657 580 ----21350 23
NM_058241chr231775 737 637 179 ----
NM_058241chr231775 737 637 179 ----
NM_078469chr102526 85 31308 1301 122 ----
NM_078476chr681390 1149 690 660 374 291 117 43 ------
NM_078485chr61125 ----1102
NM_078487chr943242 840 572 544 11254 1675 --
NM_079421chr192484 395 ----122
NM_080415chr171835 --2915 36 --
NM_080546chr932062 1820 934 --11628 --
NM_080591chr983073 2744 2625 2323 373 211 183 52 ------
NM_080597chr181806 1726 ----
NM_080599chr1041233 1113 462 197 11047 --166
NM_080604chr63624 469 235 ------
NM_080607chr2031055 324 93 ------
NM_080617chr201136 ------
NM_080632chrX4755 710 563 79 ------
NM_080664chr1411523 ----2741 100
NM_080669chr17104398 4251 4138 4119 3315 3189 3084 1288 375 335 --34862 3076 1280 21847 615
NM_080672chr20183 ------
NM_080676chr2032069 617 553 1725 32698 2235 140 --
NM_080717chr1221181 334 ------
NM_080732chr19145 --1416 --
NM_080738chr171844 1801 1580 1273 665 610 32 ----11890
NM_080740chr22123 ------
NM_080743chr622536 2322 --1142 --
NM_080792chr2021549 369 --1755 2171 24
NM_080832chrX127 ------
NM_080836chr2094415 4086 3948 3857 1782 1313 688 264 79 1144 33106 1385 1338 1906
NM_080867chr1463652 3474 3250 1125 1044 491 13661 --14473
NM_130385chr1182991 2691 2511 2406 2212 1069 1013 219 --22657 512 --
NM_130386chr18136 ------
NM_130391chr962991 2786 1236 777 161 103 1366 --13286
NM_130392chr962991 2786 1236 777 161 103 1366 --13286
NM_130393chr962991 2786 1236 777 161 103 1366 --13286
NM_130434chr152850 413 ------
NM_130435chr1042394 2166 858 762 22679 1857 ----
NM_130436chr2112438 1297 2568 546 --
NM_130438chr2113015 1874 21145 1123 --
NM_130440chr161499 624 606 587 86 44 --1599 --
NM_130442chr751104 841 474 216 159 --1143 1132
NM_130797chr721343 348 --1699 --
NM_130830chr343656 2478 1564 340 --33099 2771 2621 --
NM_130838chr1531270 571 208 ------
NM_130839chr1531270 571 208 ------
NM_130846chr123897 718 163 ------
NM_133171chr2031225 863 278 --2841 514 --
NM_133264chr1773702 3568 3432 3194 3118 1013 768 --1995 1240
NM_133265chrX43345 2449 2220 574 13432 1943 --
NM_133334chr4104639 4516 2447 2377 2262 2097 2012 1799 347 234 23970 2435 32527 2150 805 --
NM_133367chr683307 3113 3092 1315 1009 973 676 319 --11090 --
NM_133368chr16144 ------
NM_133443chr1611790 11771 ----
NM_133445chr9123782 3666 3442 3435 3220 3035 2869 2806 2433 1339 192 184 1213 33722 1155 1008 --
NM_133465chr91292 1305 ----
NM_133476chr121318 1232 11042 --
NM_133478chr241887 199 82 66 1434 22172 977 --
NM_133493chr644022 3945 2826 277 23789 42 ----
NM_133496chr124183 529 11085 23793 392 --
NM_133499chrX2672 309 ------
NM_133507chr122325 132 2105 92 ----
NM_133638chr5--1235 ----
NM_133645chr62542 483 ------
NM_133646chr235011 1004 764 25496 1040 34036 1802 648 --
NM_133647chr1522348 1354 53620 2821 2500 1042 358 13037 --
NM_134265chr171326 ------
NM_134325chr131308 1244 656 --1191 --
NM_134428chr9125 ------
NM_138270chrX32900 2366 1273 1901 ----
NM_138281chr171100 --1249 --
NM_138290chr74371 362 300 138 ------
NM_138316chr102392 147 ------
NM_138335chr43733 70 23 --1337 --
NM_138338chr22113308 3156 3090 2790 2432 2308 1374 1284 1155 801 354 --1365 --
NM_138346chr1125 ------
NM_138357chr1021447 1216 1519 ----
NM_138376chr143181 76 66 185 ----
NM_138410chr32415 59 --1198 --
NM_138415chr2241831 1498 1196 296 --11675 --
NM_138426chr762409 2349 515 506 297 288 31928 218 169 ----
NM_138430chr131411 ----1369
NM_138444chr1334588 754 317 11805 128 1121
NM_138458chr21347 1844 21062 277 --
NM_138459chr643011 568 544 494 --1319 --
NM_138468chr285327 4961 2008 1846 1530 1321 790 23 --45160 3968 2435 1607 --
NM_138473chr1234509 3694 3144 1818 14566 --
NM_138555chr15180 --2396 101 --
NM_138559chr22918 138 ------
NM_138576chr1424008 3305 14769 --14195
NM_138578chr2041425 1109 1058 66 ------
NM_138609chr53226 145 45 --1390 --
NM_138610chr53226 145 45 --1390 --
NM_138619chr1721538 1465 --11134 --
NM_138633chr621699 1509 ------
NM_138635chr782645 2626 1282 996 891 627 343 175 ------
NM_138638chr1442454 2312 2090 1856 --150 --
NM_138694chr653193 2496 2450 1441 922 ----12470
NM_138713chr16137792 7578 7378 6446 6327 6061 5644 5568 5238 2654 2647 1323 250 17738 ----
NM_138714chr16137792 7578 7378 6446 6327 6061 5644 5568 5238 2654 2647 1323 250 17738 ----
NM_138727chr142195 734 341 234 12046 1781 --
NM_138728chr142195 734 341 234 12046 1781 --
NM_138731chr1433832 3732 988 --13610 --
NM_138736chr1674173 3561 3287 3072 1271 868 812 --23331 434 --
NM_138766chr51547 1400 ----
NM_138771chr71570 ------
NM_138809chr532742 2463 2091 1250 2866 472 --
NM_138811chr71263 ----11274
NM_138821chr51547 1400 ----
NM_138822chr51547 1400 ----
NM_138927chr214831 414 277 133 ------
NM_138961chr11----1369 165
NM_138962chr17--1357 ----
NM_138967chr1542237 2070 2053 559 --31801 1658 576 --
NM_138969chr82423 404 --1515 --
NM_138971chr1162827 2418 1336 947 787 174 23423 1534 1285 --
NM_138971chr1162827 2418 1336 947 787 174 23423 1534 1285 --
NM_138972chr1162827 2418 1336 947 787 174 23423 1534 1285 --
NM_138972chr1162827 2418 1336 947 787 174 23423 1534 1285 --
NM_138973chr1162827 2418 1336 947 787 174 23423 1534 1285 --
NM_138973chr1162827 2418 1336 947 787 174 23423 1534 1285 --
NM_138980chr42156 35 ------
NM_138981chr42287 166 ------
NM_138982chr42156 35 ------
NM_138994chr163477 165 150 ------
NM_139015chr1211536 11313 ----
NM_139035chrX1223 ------
NM_139045chr9--1827 ----
NM_139062chr173367 64 54 --1386 --
NM_139068chr51533 1494 ----
NM_139069chr51533 1494 ----
NM_139070chr51402 1363 ----
NM_139071chr1261185 1161 1090 366 261 101 11281 ----
NM_139072chr22820 780 --1214 --
NM_139131chr11147 ------
NM_139157chr11127 ------
NM_139167chr81124 ------
NM_139168chr521828 125 ------
NM_139169chr101298 ------
NM_139181chr113502 389 26 --1491 --
NM_139201chr122630 533 ------
NM_139207chr1222171 365 1508 ----
NM_139211chr4--188 ----
NM_139212chr4--188 ----
NM_139214chrY266 51 ----187
NM_139244chr61840 --130 --
NM_139276chr1772396 1939 1481 945 936 903 114 ----11928
NM_139279chr252797 2656 1073 936 915 2890 687 ----
NM_139283chr1252526 2297 1022 878 733 --12036 --
NM_139321chr2023338 514 3968 816 186 13717 --
NM_139323chr2021762 1391 --11367 --
NM_144571chr475305 5242 5217 4751 2028 432 106 25496 607 11111 --
NM_144574chr14--1419 ----
NM_144578chr1433580 2203 1008 --11255 --
NM_144579chr272281 2031 859 778 706 671 387 --1938 11179
NM_144586chr24863 510 184 41 1918 1332 --
NM_144590chr1062739 2074 2036 505 261 241 ------
NM_144595chr13--11008 ----
NM_144598chr152136 53 163 ----
NM_144599chr1545546 4907 3707 3386 35497 4647 1280 ----
NM_144610chr171139 ----1398
NM_144628chr2082825 2718 2219 1899 1097 616 591 156 --22855 2509 13001
NM_144632chr261790 1588 1518 1475 174 149 1854 ----
NM_144642chr341271 1166 312 126 ------
NM_144685chr191315 ------
NM_144704chr22----182 --
NM_144726chr51279 ------
NM_144767chr1564622 2912 2864 1687 1665 116 1804 --13753
NM_144775chr1744272 3520 1146 478 23031 377 64954 4326 3190 1675 1621 979 --
NM_144778chr1372609 2206 2118 900 830 455 356 ------
NM_144973chr1284850 4329 3369 2015 1258 953 579 409 --11869 --
NM_145000chr52409 219 ------
NM_145008chr111704 ------
NM_145011chr102800 106 11969 ----
NM_145025chr621204 196 ------
NM_145036chr17134 159 ----
NM_145049chr53909 862 128 --1236 --
NM_145055chr1853663 2742 2580 2411 1139 11458 187 12902
NM_145112chr1421100 219 --1349 --
NM_145113chr1431372 491 257 --2621 212 --
NM_145117chr1133100 2992 464 --21197 144 --
NM_145175chr22975 468 ------
NM_145185chr1941790 1645 749 276 ------
NM_145203chr131391 ------
NM_145206chr1012591 2888 466 ----
NM_145234chrX2853 257 ------
NM_145244chr4153 11267 ----
NM_145247chr10--2651 165 ----
NM_145253chr164623 466 258 226 --1137 --
NM_145259chr276992 6607 5830 5672 5551 5153 4813 ----15061
NM_145274chr174912 821 668 636 ------
NM_145306chr101416 1177 ----
NM_145307chr1024551 3947 34584 4330 3188 --1208
NM_145313chr1031385 1099 385 ------
NM_145320chr752985 2533 2293 1415 96 --12609 --
NM_145321chr752985 2533 2293 1415 96 --12609 --
NM_145322chr752985 2533 2293 1415 96 --12609 --
NM_145341chr101517 ------
NM_145659chr161111 ------
NM_145686chr233010 2592 33 --1312 --
NM_145687chr233010 2592 33 --1312 --
NM_145698chr10--1121 ----
NM_145716chr1--1411 ----
NM_145753chr321138 26 ------
NM_145793chr10187 ------
NM_145798chr171589 ------
NM_145800chrX2973 883 ----165
NM_145802chrX2922 832 ------
NM_145805chr15176 ------
NM_145808chr742571 751 314 25 1729 2455 97 --
NM_145861chr171844 1801 1580 1273 665 610 32 ----11890
NM_145891chr1631676 1574 682 ------
NM_145892chr1631676 1574 682 ------
NM_145893chr1621798 1696 ------
NM_145909chr621408 27 176 ----
NM_146388chr19--124 21000 79 --
NM_147150chr943353 1404 1385 1346 ----1491
NM_147156chr1021458 333 1426 ----
NM_147161chr131028 974 782 1811 1350 1424
NM_147175chrX31718 756 417 ------
NM_147189chr821735 424 ----11607
NM_147190chr121182 ----125
NM_147202chr932653 2028 916 ------
NM_147223chr292353 2108 2079 2032 2012 1986 800 291 49 ----32102 705 167
NM_147233chr282170 1925 1896 1849 1829 1803 617 108 ----21919 522
NM_148174chr8163 ------
NM_148414chr161363 ------
NM_148894chr421030 915 --1315 --
NM_148904chr12226 208 155 ----
NM_148905chr12226 208 155 ----
NM_148906chr12226 208 155 ----
NM_148907chr12226 208 155 ----
NM_148908chr12226 208 155 ----
NM_148909chr12226 208 155 ----
NM_148921chr1742063 1757 316 115 --41877 1714 960 121 --
NM_148957chr1352191 639 413 215 150 ------
NM_148977chr102392 147 ------
NM_148978chr102392 147 ------
NM_152221chr222871 235 ------
NM_152222chr1141799 1219 691 671 1441 1591 --
NM_152237chr2241421 1247 507 211 --31782 1140 1112 --
NM_152240chr31826 --11251 --
NM_152253chr22103537 3290 2735 1707 1673 1517 1425 1368 432 423 11439 --24075 3850
NM_152261chr1222395 202 ------
NM_152264chr112747 395 --1685 1913
NM_152265chr1--2995 144 ----
NM_152272chr831262 848 330 ------
NM_152275chr221825 303 --1502 --
NM_152282chr311381 ------
NM_152283chr51190 -