TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3136-3p
miRNA Sequence: UGGCCCAACCUAUUCAGUUAGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr52298 104 ------
NM_000020chr1232420 1733 168 12050 1539 --
NM_000037chr832152 460 143 ------
NM_000044chrX1159 ------
NM_000068chr1911540 ------
NM_000092chr243459 1699 395 345 --13700 --
NM_000109chrX31842 363 32 ------
NM_000112chr544282 4030 3405 1861 13992 11647 --
NM_000138chr1532674 1961 1009 ------
NM_000168chr732130 910 510 ------
NM_000176chr513369 ------
NM_000217chr1224680 648 ----14589
NM_000232chr4------21282 1091
NM_000240chrX11831 ----188
NM_000252chrX1318 ------
NM_000264chr912548 11013 1303 --
NM_000288chr6--1267 ----
NM_000304chr171956 ------
NM_000314chr1022251 850 --12659 --
NM_000321chr1321609 155 ------
NM_000332chr646745 4875 2352 473 ------
NM_000333chr32941 119 --1814 --
NM_000337chr546266 4151 1880 1475 --11968 --
NM_000340chr321325 1024 ------
NM_000362chr2232891 2236 948 11227 ----
NM_000408chr213023 ------
NM_000430chr1743419 2386 1119 236 ------
NM_000449chr11194 2497 270 ----
NM_000459chr91213 ------
NM_000476chr921374 427 ------
NM_000484chr211928 --1676 --
NM_000533chrX11521 ------
NM_000546chr173994 793 69 --177 --
NM_000555chrX45679 3119 2833 154 1184 12280 17691
NM_000578chr251659 1543 1407 362 173 ------
NM_000598chr721532 1249 ------
NM_000599chr243818 3545 2889 943 ------
NM_000610chr1142447 1945 742 401 12429 ----
NM_000618chr1224183 1245 12340 ----
NM_000618chr1224183 1245 12340 ----
NM_000719chr1246558 5749 2096 1101 15742 25518 2404 --
NM_000721chr142673 2280 2217 1843 ------
NM_000724chr101261 ------
NM_000726chr22386 113 ------
NM_000793chr1424737 1053 1771 33458 3274 181 14273
NM_000800chr51240 ------
NM_000816chr5------1653
NM_000827chr522463 621 ------
NM_000831chr1126155 5982 5957 5903 5857 5775 5705 4251 1743 1385 958 91 46078 4062 2431 1523 25920 185 21113 125
NM_000842chr112664 227 --1548 --
NM_000844chr31189 ------
NM_000855chr111269 155 ----
NM_000868chrX1867 ------
NM_000870chr53571 397 145 --11317 --
NM_000875chr1566528 2596 1781 1154 900 237 24928 465 ----
NM_000891chr1763546 3532 2856 1064 781 296 1100 ----
NM_000899chr121591 --23101 268 --
NM_000935chr3------1131
NM_000963chr112418 ------
NM_000964chr1751148 273 261 211 178 --11371 --
NM_000966chr122898 288 ------
NM_000983chr131488 367 281 1454 ----
NM_001001132chr211260 ------
NM_001001323chr121345 ------
NM_001001389chr1142447 1945 742 401 12429 ----
NM_001001390chr1142447 1945 742 401 12429 ----
NM_001001391chr1142447 1945 742 401 12429 ----
NM_001001392chr1142493 1991 788 447 12475 ----
NM_001001396chr132759 1320 1251 ------
NM_001001433chr2032615 2088 2042 42896 1163 974 648 ----
NM_001001479chr223815 751 549 ----1831
NM_001001484chr1012403 ------
NM_001001520chr191124 ------
NM_001001521chr2--136 ----
NM_001001560chr221212 --1625 1290
NM_001001664chr212727 33374 1319 820 ----
NM_001001852chr223772 735 88 ------
NM_001001890chr2194160 3983 3946 3114 1513 668 536 105 26 --13294 1725
NM_001001924chr811816 ----11600
NM_001001925chr811816 ----11600
NM_001001931chr811816 ----11600
NM_001002032chr171226 189 180 --
NM_001002838chrX21818 85 ------
NM_001003652chr1868145 6893 1796 1666 1141 255 25715 1214 ----
NM_001003681chr2211303 ------
NM_001003698chr61443 ------
NM_001003699chr61443 ------
NM_001003810chr4----1151 --
NM_001004065chr921366 1006 ----23073 2811
NM_001004304chr1242689 2162 787 500 12393 ----
NM_001004317chr633351 1723 1558 --1733 --
NM_001005266chr151604 --1216 --
NM_001005267chr151604 --1216 --
NM_001005268chr151604 --1216 --
NM_001005269chr151604 --1216 --
NM_001005271chr171707 2794 118 --1107
NM_001005273chr171707 2794 118 --1107
NM_001005366chr121205 ------
NM_001005386chr242122 1844 855 563 ------
NM_001005404chr1754345 4339 1801 802 649 ------
NM_001005473chr544672 2424 1996 514 15436 15144 --
NM_001005505chr331621 505 255 --11669 --
NM_001005609chrX43691 1474 642 421 --12941 1727
NM_001005743chr1411082 ------
NM_001005744chr1411082 ------
NM_001005745chr1411082 ------
NM_001005746chr22386 113 ------
NM_001005747chr22386 113 ------
NM_001006115chr382362 1074 1017 968 867 587 376 273 12257 ----
NM_001006938chrX2606 585 ------
NM_001007023chr1424737 1053 1771 33458 3274 181 14273
NM_001007226chr1711374 --11147 --
NM_001007227chr1711374 --11147 --
NM_001007228chr1711374 --11147 --
NM_001007229chr1711374 --11147 --
NM_001007230chr1711374 --11147 --
NM_001007237chr142121 1844 1028 965 1787 12399 --
NM_001007246chr211169 ------
NM_001007277chr111973 ------
NM_001007553chr11991 ------
NM_001007794chr1------1221
NM_001008220chr573209 2610 2475 1339 752 733 410 ------
NM_001008222chrX21234 233 --1242 --
NM_001008239chr181997 12777 --12521
NM_001008401chr1921149 272 ----1961
NM_001008495chr821616 882 ------
NM_001008541chr1022195 76 2836 46 12139 --
NM_001008541chr1022195 76 2836 46 12139 --
NM_001008564chr1311817 ------
NM_001008660chr1111197 ------
NM_001008701chr1972137 1931 836 829 778 758 134 1104 23003 806 --
NM_001009899chr325902 5595 --14522 --
NM_001009993chr253604 2997 1635 1563 637 24171 1684 13897 13516
NM_001010846chr144075 1280 1171 26 --11556 --
NM_001010861chr112678 ----1383
NM_001010862chrX32138 1118 271 ------
NM_001010867chr186448 6320 5378 5231 4762 2661 2577 249 26373 6135 --11133
NM_001010888chrX34408 1803 1596 ------
NM_001010971chr11924 ------
NM_001011645chrX1159 ------
NM_001012393chr1123575 355 --187 --
NM_001012415chr95844 838 824 572 364 --1112 --
NM_001012420chr152756 174 ------
NM_001012423chr152756 174 ------
NM_001012426chr632283 1344 821 ------
NM_001012427chr632283 1344 821 ------
NM_001013031chr1032829 2642 2293 ----12543
NM_001013398chr721532 1249 ------
NM_001013615chr12453 307 11091 2774 186 --
NM_001013620chr1245960 2228 2195 787 ----15451
NM_001013635chr12142 1119 ----
NM_001013693chr162469 1875 832 424 386 311 ------
NM_001013693chr162469 1875 832 424 386 311 ------
NM_001013839chr1742351 1659 732 80 --12291 --
NM_001013843chr151881 ------
NM_001014797chr1066604 6466 5134 5061 2961 2201 46816 6693 5222 2972 12668 11672
NM_001015048chr1443058 3008 2597 804 --12688 --
NM_001015049chr1443058 3008 2597 804 --12688 --
NM_001015053chr1741150 1054 102 26 1287 ----
NM_001015508chr81212 ------
NM_001015877chrX--12986 ----
NM_001017368chr17157 11908 1297 --
NM_001017395chr342688 859 405 200 --11237 --
NM_001017926chr81551 1382 ----
NM_001017928chr3--151 ----
NM_001017992chr52153 23 ------
NM_001018008chr151471 --125 --
NM_001018050chr2283373 3204 3028 2652 2427 2288 1017 772 22417 539 22721 221 --
NM_001018052chr2283373 3204 3028 2652 2427 2288 1017 772 22417 539 22721 221 --
NM_001018054chr121047 97 ------
NM_001018064chr911525 --12129 --
NM_001018065chr934309 1948 539 --15795 --
NM_001018066chr934309 1948 539 --15795 --
NM_001018074chr513369 ------
NM_001018075chr513369 ------
NM_001018076chr513369 ------
NM_001018077chr513369 ------
NM_001023567chr152759 174 --11882 --
NM_001024094chr513369 ------
NM_001024668chr124878 707 287 135 1800 ----
NM_001024809chr1751148 273 261 211 178 --11371 --
NM_001024858chr1452940 2897 975 634 174 22065 560 ----
NM_001025077chr1057296 7088 4878 1004 930 ----1196
NM_001025079chr321399 457 1507 --14002
NM_001025108chr232952 2811 28 ------
NM_001025233chr121428 12423 --1918
NM_001025366chr6----1188 --
NM_001025366chr6----1188 --
NM_001025367chr6----1188 --
NM_001025367chr6----1188 --
NM_001025368chr6----1188 --
NM_001025368chr6----1188 --
NM_001025369chr6----1204 --
NM_001025369chr6----1204 --
NM_001025370chr6----1188 --
NM_001025370chr6----1188 --
NM_001025579chr175919 336 240 166 39 --11067 --
NM_001025580chrX34242 247 29 11724 1587 --
NM_001025603chr11194 2497 270 ----
NM_001029858chr613150 ------
NM_001029998chr411384 ------
NM_001030006chr171257 --12639 --
NM_001030007chr1623483 299 ----13178
NM_001030055chr1432877 1061 420 ------
NM_001031679chr1222948 1379 ------
NM_001031680chr152238 2063 952 462 66 ----1923
NM_001031690chr753024 1016 276 268 261 ------
NM_001031692chr7----1253 --
NM_001031695chr2225258 1712 ------
NM_001031702chr33661 355 286 --2915 25 --
NM_001031711chr531836 1206 453 ------
NM_001031732chr413416 ------
NM_001031803chr172261 207 ------
NM_001032221chr92385 363 ------
NM_001032279chr111429 ------
NM_001032280chr6----1150 --
NM_001032282chr831210 1047 103 ------
NM_001032296chr1322286 614 ------
NM_001033045chr234001 487 77 ------
NM_001033047chr41813 2115 107 ----
NM_001033087chr202669 651 22784 2134 ----
NM_001033112chr51809 ------
NM_001033117chr344171 3917 3397 1550 ------
NM_001033506chr11133 --1385 --
NM_001033551chr17104080 3607 3456 3388 2949 1487 557 486 422 236 44009 3104 1358 897 33421 2933 1343 --
NM_001033756chr6----1122 --
NM_001033756chr6----1122 --
NM_001034841chr1634110 1383 1143 25505 3483 34482 1775 1255 11877
NM_001034845chr421075 67 ------
NM_001035chr121025 953 ------
NM_001035254chr942494 1906 1016 910 12008 ----
NM_001037132chr721685 902 ------
NM_001037133chr721685 902 ------
NM_001037174chr211410 ------
NM_001037317chr112678 ----1383
NM_001037339chr131387 1179 553 ------
NM_001037340chr131387 1179 553 ------
NM_001037341chr131387 1179 553 ------
NM_001037341chr131387 1179 553 ------
NM_001038640chr151826 ------
NM_001039091chrX1432 ------
NM_001039350chr731677 1511 489 --1675 --
NM_001039459chr73992 334 116 ------
NM_001039465chr141132 --1138 --
NM_001039479chr1412193 --22084 1762 1850
NM_001039538chr243384 2950 1097 62 12816 ----
NM_001039550chr23846 591 186 ------
NM_001039580chr424135 3592 14205 ----
NM_001039585chr132720 847 85 ----13013
NM_001039618chr1155652 4224 2266 2154 2070 --35588 5106 424 --
NM_001039690chr1662150 939 770 729 615 531 --21686 703 --
NM_001039888chr11712 1706 ----
NM_001040144chr1662150 939 770 729 615 531 --21686 703 --
NM_001040146chr1662150 939 770 729 615 531 --21686 703 --
NM_001040159chr41403 ------
NM_001040172chr53571 397 145 --11317 --
NM_001040173chr53571 397 145 --11317 --
NM_001040284chr1635153 4986 898 ------
NM_001040402chr412975 ------
NM_001040429chr13----11132 --
NM_001040446chr52129 94 ----1983
NM_001040458chr51235 1173 ----
NM_001040633chr711030 154 ----
NM_001040708chr8150 ----11057
NM_001040712chr933261 3244 2330 ------
NM_001040876chr41151 ------
NM_001042368chr91674 1339 ----
NM_001042403chr121795 ------
NM_001042404chr111773 ------
NM_001042425chr6----1150 --
NM_001042548chr22114 26 ------
NM_001042595chr19123 172 --1113
NM_001042599chr256958 6661 5287 2838 1047 12703 --11494
NM_001042601chr33815 458 114 1637 ----
NM_001042603chr1253576 3509 3451 3393 3335 --1763 --
NM_001042632chr203948 546 400 1327 11944 1199
NM_001042633chr203948 546 400 1327 11944 1199
NM_001042663chr11273 1543 21312 376 --
NM_001042664chr11273 1543 21312 376 --
NM_001042665chr11273 1543 21312 376 --
NM_001042728chr122898 288 ------
NM_001042749chrX----11493 --
NM_001042750chrX----11493 --
NM_001042751chrX----11493 --
NM_001043318chr1433173 2697 490 1259 11299 --
NM_001043351chr121804 1438 1196 ----
NM_001044385chr232792 894 749 ----13296
NM_001049chr142614 249 ----12299
NM_001079874chr111908 21516 798 ----
NM_001099678chr325668 393 23910 1869 --26242 4735
NM_001106chr3159674 9031 7997 7534 7395 6632 3711 3431 3223 3071 3053 2290 1844 874 815 47985 3161 2279 1679 28957 2945 --
NM_001113490chrX23076 937 13327 ----
NM_001116chr1652877 2495 930 636 318 22323 222 ----
NM_001122679chr52298 104 ------
NM_001128chr1623483 299 ----13178
NM_001149chr1011293 ------
NM_001173chr1432877 1061 420 ------
NM_001186chr2113019 1904 ----
NM_001203chr41229 ------
NM_001206chr931111 453 274 ------
NM_001231chr11317 ----1471
NM_001238chr191353 1206 ----
NM_001241chr2--12352 ----
NM_001241chr2--12352 ----
NM_001258chr171186 1481 ----
NM_001265chr133828 708 256 ------
NM_001275chr141397 ------
NM_001282chr171257 --12639 --
NM_001288chr6--1179 ----
NM_001304chr1743205 2653 2457 562 --13249 --
NM_001331chr1121932 27 22615 697 ----
NM_001346chr321880 624 --11947 --
NM_001356chrX------1411
NM_001365chr174667 234 193 49 ------
NM_001380chr103724 212 193 --196 --
NM_001387chr532966 2643 592 1463 ----
NM_001396chr213508 481 460 12301 ----
NM_001397chr162354 1699 1073 525 272 250 1546 ----
NM_001399chrX43691 1474 642 421 --12941 1727
NM_001417chr1231940 1627 353 ------
NM_001418chr111497 ------
NM_001418chr111497 ------
NM_001423chr12--1335 11985 --
NM_001431chr61902 ------
NM_001438chr123464 2384 --12786 --
NM_001460chr122258 145 --1212 --
NM_001465chr521571 77 ------
NM_001495chr841195 881 807 358 ------
NM_001497chr952308 2298 1713 637 75 ------
NM_001541chr111170 ------
NM_001542chr142121 1844 1028 965 1787 12399 --
NM_001543chr5114803 4396 3953 3895 3151 3058 3017 1495 1065 486 193 23974 1357 ----
NM_001563chr6--191 ----
NM_001567chr111501 ------
NM_001620chr11156 ------
NM_001662chr71303 ------
NM_001679chr32510 125 ------
NM_001682chr12159 ------
NM_001693chr831123 487 201 --1313 --
NM_001695chr823007 2968 ----1695
NM_001701chr9--11184 ----
NM_001718chr611324 ------
NM_001731chr122762 60 ------
NM_001740chr161505 ------
NM_001754chr2194160 3983 3946 3114 1513 668 536 105 26 --13294 1725
NM_001777chr321399 457 1507 --14002
NM_001859chr953898 3572 3445 1369 1242 1401 ----
NM_001903chr5----2737 701 --
NM_001904chr32383 41 ------
NM_001924chr11350 ------
NM_001936chr731677 1511 489 --1675 --
NM_001938chr11444 ------
NM_001944chr181154 ----191
NM_001946chr123986 879 73 ------
NM_001962chr5199 ------
NM_001977chr41527 ------
NM_001978chr83718 243 103 --11058 --
NM_001999chr51351 ------
NM_002017chr11--1207 11008 --
NM_002025chrX38888 6177 952 13712 17701 --
NM_002028chr1431202 1094 439 --1446 21299 1161
NM_002056chr22764 652 ------
NM_002061chr111670 ------
NM_002069chr71232 ------
NM_002072chr9--143 --1963
NM_002086chr1731675 632 364 --11908 11580
NM_002092chr435055 3120 130 ------
NM_002114chr61448 ------
NM_002128chr1311673 ----12321
NM_002129chr41318 ------
NM_002130chr511601 ------
NM_002136chr121460 ------
NM_002137chr7124 ------
NM_002138chr4----1151 --
NM_002147chr171741 1787 ----
NM_002181chr2142 ------
NM_002196chr201435 ------
NM_002196chr201435 ------
NM_002204chr1731212 904 480 ------
NM_002205chr122888 874 --1708 1349
NM_002210chr213474 11029 ----
NM_002221chr142580 914 833 34 1252 12361 --
NM_002247chr102531 401 12275 ----
NM_002254chr231877 501 245 --21483 574 --
NM_002265chr171458 ------
NM_002267chr1312434 --12128 --
NM_002270chr535297 5154 738 ------
NM_002283chr121767 1531 ----
NM_002285chr232952 2811 28 ------
NM_002309chr2273038 2977 2628 2298 565 261 161 22206 448 150 --
NM_002336chr1253827 1855 1517 1418 358 ------
NM_002356chr632580 2353 1817 1393 ----
NM_002359chr17124240 3958 2765 1657 1538 1312 1270 671 650 569 482 346 13653 23781 1456 --
NM_002374chr243384 2950 1097 62 12816 ----
NM_002390chr1742020 1985 1550 145 ------
NM_002430chr2251947 1645 1613 958 837 ------
NM_002442chr1241616 1604 1461 594 ------
NM_002480chr121485 ------
NM_002481chr156778 6600 4910 1477 1192 --1953 --
NM_002501chr1923492 1163 13708 11309 1681
NM_002507chr1711308 21338 306 11939 --
NM_002509chr202646 617 ------
NM_002522chr1723818 3428 23831 2408 ----
NM_002538chr51184 ------
NM_002545chr1123575 355 --187 --
NM_002581chr964377 3948 3794 2097 1037 1001 --14867 --
NM_002586chr641555 1116 659 382 1500 ----
NM_002595chr1211764 ------
NM_002599chr1141191 247 146 95 1744 --11037
NM_002600chr131387 1179 553 ------
NM_002612chr7140 ------
NM_002613chr16103900 2086 1836 1775 1712 1408 1191 1178 576 558 ----15284
NM_002646chr14662 578 310 203 ------
NM_002655chr814715 1863 --14460
NM_002670chr31176 ------
NM_002698chr1952468 2208 854 125 93 21158 821 22866 2631 --
NM_002709chr211101 ------
NM_002713chr131168 1089 33 ------
NM_002714chr641051 1032 803 142 --1789 --
NM_002715chr511007 ------
NM_002719chr1411957 ------
NM_002731chr11244 ------
NM_002737chr1745898 1745 645 304 25549 5425 15065 15014
NM_002745chr2224291 2958 24431 3451 13204 --
NM_002750chr101227 ------
NM_002751chr221225 21050 810 2365 45 --
NM_002765chrX1432 ------
NM_002827chr2031643 1602 564 ------
NM_002839chr933261 3244 2330 ------
NM_002843chr1152817 2441 2204 802 374 ----12870
NM_002844chr6----1871 --
NM_002858chr111047 1388 1275 --
NM_002869chr11--12014 ----
NM_002874chr9----181 --
NM_002881chr221419 499 ------
NM_002885chr16848 667 311 251 168 124 ------
NM_002886chr335123 4171 3224 ----13643
NM_002923chr11142 ------
NM_002940chr41151 ------
NM_002945chr171621 ------
NM_002955chr61443 ------
NM_002959chr164435 3098 2874 1297 427 275 --12882 --
NM_002977chr242992 2704 1327 1044 ------
NM_003011chr91551 --1400 --
NM_003012chr831980 907 333 181 ----
NM_003029chr14567 377 248 94 --11227 --
NM_003030chr31251 ------
NM_003031chr161371 ------
NM_003034chr1237343 1416 102 16790 ----
NM_003035chr11687 ------
NM_003047chr161367 1320 1211 1198 916 131 11314 11026 --
NM_003069chrX1597 ----126
NM_003074chr3185 --1182 --
NM_003076chr1221651 1287 --3551 316 49 --
NM_003110chr1721080 59 --194 --
NM_003112chr7170 ------
NM_003118chr52416 298 12035 ----
NM_003128chr242668 2383 1863 995 ------
NM_003131chr641761 857 550 167 21461 449 ----
NM_003137chr671806 1672 1521 1414 579 189 148 --1219 --
NM_003156chr112926 227 1545 21265 161 --
NM_003161chr17------11212
NM_003183chr22582 284 ------
NM_003189chr183112 2412 2241 821 812 611 87 60 ------
NM_003199chr1815462 ------
NM_003200chr1971917 1790 1720 1634 958 311 179 --11479 --
NM_003203chr232152 1746 886 ------
NM_003204chr1741370 1105 679 502 ------
NM_003215chr441455 1128 451 428 ------
NM_003216chr2273295 2893 2478 2353 1057 836 359 ------
NM_003220chr6----1150 --
NM_003221chr623309 2546 --32957 1655 1044 --
NM_003223chr16----1116 --
NM_003234chr342448 1662 1604 522 ------
NM_003236chr263032 2732 1380 1340 1290 145 22941 371 ----
NM_003239chr141715 1367 --1328
NM_003255chr176983 945 251 188 170 117 ------
NM_003270chrX1211 ------
NM_003281chr1114844 3944 3874 3713 3403 1770 1762 1066 890 467 218 ----11819
NM_003291chr131270 ------
NM_003325chr221178 ------
NM_003339chr51600 ------
NM_003340chr4--11247 ----
NM_003341chr31270 ------
NM_003342chr1732085 2017 137 --13053 --
NM_003348chr1221098 398 ------
NM_003367chr191441 ------
NM_003369chr1122198 2058 2595 176 ----
NM_003370chr193775 656 486 ------
NM_003376chr6----1188 --
NM_003376chr6----1188 --
NM_003387chr232149 1074 848 --11897 --
NM_003392chr343493 1689 1100 683 14305 11598 --
NM_003399chrX31013 828 237 ------
NM_003400chr21272 ------
NM_003406chr811352 ------
NM_003407chr192681 489 --1551 --
NM_003410chrX------12523
NM_003427chr61631 ------
NM_003439chr71173 ----12939
NM_003458chr343307 2690 515 431 ------
NM_003463chr622446 171 ------
NM_003468chr223166 474 ------
NM_003470chr1621827 319 ----11593
NM_003482chr1262435 2088 1853 1037 298 271 --12201 --
NM_003483chr1222384 360 12113 ----
NM_003487chr17193 ------
NM_003488chr17----150 --
NM_003489chr2122198 1278 ------
NM_003502chr162528 109 ------
NM_003559chr1732874 758 345 --22633 2511 183
NM_003563chr1711374 --11147 --
NM_003566chr1233255 648 559 --1186 --
NM_003576chr1322286 614 ------
NM_003580chr81438 ------
NM_003583chr1233650 3260 1496 ----13366
NM_003590chr232768 1514 413 --1605 --
NM_003591chr101263 ------
NM_003592chr71466 ------
NM_003607chr153945 3770 3152 1185 390 11090 ----
NM_003618chr21403 ------
NM_003629chr122450 2191 --23123 2247 --
NM_003633chr552316 1814 495 473 366 --32391 2135 1825 --
NM_003635chr10--1504 ----
NM_003644chr1745412 4734 1500 49 1102 1937 22095 1819
NM_003654chr11----1261 --
NM_003663chr311094 --13144 --
NM_003666chr11175 ------
NM_003670chr32397 294 ------
NM_003671chr942888 2869 2250 177 --12810 --
NM_003679chr142583 2441 1294 745 ------
NM_003707chr3281 54 ------
NM_003714chr531920 647 378 2794 360 12647 --
NM_003722chr342684 2358 370 261 ------
NM_003725chr121403 ------
NM_003728chr4----1261 --
NM_003744chr1411082 ------
NM_003749chr1332225 925 756 --12135 --
NM_003763chr2032615 2088 2042 42896 1163 974 648 ----
NM_003913chr61309 --13960 --
NM_003916chrX11158 ------
NM_003930chr731874 1861 694 ------
NM_003947chr31182 1176 11074 --
NM_003951chrX------1327
NM_003955chr17128 --11355 --
NM_003958chr632466 492 368 23780 704 ----
NM_003994chr121591 --23101 268 --
NM_004006chrX31842 363 32 ------
NM_004007chrX31842 363 32 ------
NM_004009chrX31842 363 32 ------
NM_004010chrX31842 363 32 ------
NM_004011chrX31842 363 32 ------
NM_004012chrX31842 363 32 ------
NM_004013chrX31842 363 32 ------
NM_004014chrX31842 363 32 ------
NM_004015chrX31842 363 32 ------
NM_004016chrX21756 277 ------
NM_004017chrX31842 363 32 ------
NM_004018chrX21756 277 ------
NM_004020chrX31842 363 32 ------
NM_004021chrX21756 277 ------
NM_004022chrX21756 277 ------
NM_004023chrX21756 277 ------
NM_004024chr11542 ------
NM_004055chr1141933 1570 1473 61 32023 1487 835 1640 --
NM_004067chr7----1216 --
NM_004080chr7------147
NM_004100chr621889 874 ------
NM_004103chr8182 1202 --1683
NM_004114chrX11084 ------
NM_004117chr62426 54 ------
NM_004161chr211441 ------
NM_004171chr1169497 9265 8373 6215 5823 3803 --18523 --
NM_004180chr2148 ------
NM_004187chrX31028 961 271 1302 ----
NM_004200chr11103262 2826 2575 2552 2408 755 743 526 488 152 --12335 --
NM_004202chrY------1278
NM_004210chr1051966 1912 1632 824 725 21465 1359 12141 --
NM_004225chr8------11219
NM_004229chrX2765 333 ------
NM_004232chr1843646 936 552 174 ------
NM_004247chr17141 --1243 --
NM_004263chr251677 1318 589 165 77 --1293 --
NM_004274chr1432878 2540 91 ------
NM_004281chr101124 ------
NM_004286chr224941 835 597 262 --1908 --
NM_004293chr923618 706 ------
NM_004298chr5158 ------
NM_004302chr122983 171 --11873 22321 925
NM_004311chr1032602 1186 329 ------
NM_004326chr12486 246 --1394 --
NM_004331chr811059 ------
NM_004342chr71101 ------
NM_004349chr8----1951 --
NM_004350chr152238 2063 952 462 66 ----1923
NM_004376chr1011270 --1149 11291
NM_004386chr1922254 927 --12216 --
NM_004393chr352253 2123 1944 1603 539 1909 --1780
NM_004395chr51708 ------
NM_004397chr1133178 972 768 12950 12762 --
NM_004405chr22423 342 ------
NM_004409chr191112 ------
NM_004420chr1122350 1762 --21865 637 --
NM_004422chr17289 24 ----1449
NM_004432chr91539 ------
NM_004433chr12674 589 --2719 445 --
NM_004438chr222586 753 --1680 --
NM_004440chr621631 104 --11446 --
NM_004449chr2111088 ------
NM_004451chr111623 ------
NM_004459chr1711934 ----1661
NM_004463chrX3176 144 138 ------
NM_004474chr13798 709 666 1819 1112 --
NM_004481chr132275 855 45 1535 1958 --
NM_004494chr11425 --11247 --
NM_004501chr123688 1525 ------
NM_004502chr171401 ------
NM_004503chr121816 ------
NM_004514chr173462 330 237 ------
NM_004515chr1166 ------
NM_004535chr2021572 1487 ----1694
NM_004560chr92718 118 ------
NM_004566chr1052409 2202 2097 536 199 ------
NM_004576chr51296 --174 --
NM_004586chrX11283 ----13368
NM_004612chr934572 3552 186 ----14627
NM_004630chr1121136 145 1151 1209 --
NM_004631chr121047 97 ------
NM_004637chr311319 ------
NM_004650chrX31286 569 281 ------
NM_004656chr381200 1054 797 494 487 480 418 340 --1808 --
NM_004685chr1311020 12168 ----
NM_004687chr1711969 ------
NM_004703chr1732106 750 36 ------
NM_004705chr111316 ------
NM_004719chr1212161 ------
NM_004726chrX2751 648 11756 --13739
NM_004730chr521830 1433 --11743 1678
NM_004734chr131748 ------
NM_004737chr2221278 1069 ------
NM_004742chr3------11381
NM_004756chr1921371 399 ----1552
NM_004758chr175921 812 299 195 79 ------
NM_004774chr1732827 2226 2088 ------
NM_004796chr141608 ------
NM_004798chr2063494 3351 3093 2657 891 855 ------
NM_004822chr1773981 2523 2517 1502 821 685 309 23607 1315 21303 1113 13819
NM_004859chr1712583 13052 22912 241 --
NM_004860chr171130 ------
NM_004866chr544955 4525 4064 1259 1134 ----
NM_004873chr1443058 3008 2597 804 --12688 --
NM_004879chr111851 ------
NM_004884chr1541729 383 232 135 ------
NM_004902chr201762 ------
NM_004921chr11250 ------
NM_004922chr101152 --1867 --
NM_004956chr734187 4084 433 ------
NM_004968chr71570 2539 291 ----
NM_004976chr11124796 4286 4031 4005 3480 3447 3226 1681 1653 1632 1323 712 24900 1799 14481 --
NM_004979chrX61065 929 911 891 231 94 --2840 319 --
NM_004985chr1221739 460 ----1957
NM_004992chrX107587 7026 6929 6474 5391 2749 1939 1786 1599 1136 16522 27949 1430 --
NM_004992chrX107587 7026 6929 6474 5391 2749 1939 1786 1599 1136 16522 27949 1430 --
NM_004993chr14--11280 ----
NM_004998chr152654 631 ------
NM_005004chr10----124 --
NM_005010chr721685 902 ------
NM_005022chr17------190
NM_005034chr81477 ------
NM_005056chr1253820 3753 3695 3637 3579 --11007 --
NM_005063chr1053749 3266 3204 3094 879 ------
NM_005065chr1425101 5033 14517 ----
NM_005068chr621456 1289 ------
NM_005077chr9------140
NM_005078chr1541748 1420 180 101 --1359 --
NM_005096chrX3865 342 291 ------
NM_005102chr22114 26 ------
NM_005116chr2013226 11199 ----
NM_005119chr121077 984 --1240 --
NM_005120chrX1167 177 ----
NM_005133chr111429 ------
NM_005148chr173452 419 42 ------
NM_005154chr15----1581 --
NM_005156chr923499 1123 --1327 --
NM_005180chr10------1323
NM_005197chr1444141 1933 1924 460 12359 14271 --
NM_005207chr221909 ------
NM_005219chr51360 21619 1137 11432 1453
NM_005235chr256958 6661 5287 2838 1047 12703 --11494
NM_005241chr31283 ------
NM_005270chr221514 385 ------
NM_005277chr411688 ------
NM_005279chr2145 ------
NM_005281chr11132 ------
NM_005302chr7------122
NM_005312chr941929 1799 733 205 1989 12106 --
NM_005324chr1741941 1599 409 276 11347 ----
NM_005329chr1672173 2101 854 737 537 442 282 ------
NM_005339chr424194 3092 ------
NM_005347chr931527 523 184 1283 ----
NM_005359chr1846282 5241 5218 1428 ----15161
NM_005374chr1732018 763 119 --1465 --
NM_005381chr21296 ------
NM_005388chr9139 ------
NM_005392chr911163 ------
NM_005399chr153409 3128 636 417 374 --13761 --
NM_005407chr141445 ----11161
NM_005417chr20101926 1776 1436 1413 1390 1277 1254 438 278 44 ------
NM_005429chr4193 ------
NM_005430chr122755 304 1639 ----
NM_005436chr101177 --12793 --
NM_005437chr10193 --1316 --
NM_005474chr1741150 1054 102 26 1287 ----
NM_005475chr12------12934
NM_005487chr2211303 ------
NM_005494chr71599 ------
NM_005497chr1755723 4923 1846 1414 158 ------
NM_005506chr442618 632 278 206 ------
NM_005522chr731250 235 210 21377 1168 144 --
NM_005529chr14393 353 272 134 ------
NM_005539chr1011012 ------
NM_005578chr323566 209 --13737 --
NM_005595chr1----1202 --
NM_005596chr946266 4795 2136 2130 26213 6059 ----
NM_005603chr1831922 1280 145 --11635 --
NM_005610chr11865 ------
NM_005627chr62842 330 ------
NM_005634chrX1653 ------
NM_005639chr12179 ------
NM_005644chr11307 ------
NM_005647chrX22572 557 --1625 --
NM_005655chr831210 1047 103 ------
NM_005676chrX134 --1172 --
NM_005688chr311010 ------
NM_005704chr11968 2198 135 --1792
NM_005722chr242122 1844 855 563 ------
NM_005730chr1252886 1186 1057 848 473 13513 33412 2753 814 --
NM_005734chr111115 ------
NM_005736chr1031204 376 160 21464 1258 ----
NM_005737chr222197 607 ----1631
NM_005742chr2----1627 --
NM_005748chr1213421 --12714 --
NM_005779chr553330 3044 2596 1455 414 ------
NM_005822chr612136 11861 ----
NM_005826chr1----2205 126 --
NM_005828chr17104463 3809 3794 3545 1962 1652 1181 1061 754 609 54216 4092 4076 3535 3521 ----
NM_005840chrX12839 12412 12120 --
NM_005852chr171707 2794 118 --1107
NM_005868chr722380 1979 ------
NM_005880chr161471 ------
NM_005883chr1942227 366 360 68 --12312 --
NM_005898chr1123012 533 ------
NM_005901chr1868145 6893 1796 1666 1141 255 25715 1214 ----
NM_005911chr211259 --1177 --
NM_005920chr153712 3010 2765 1110 472 13652 1680 --
NM_005933chr1122596 2237 23031 403 21049 331 --
NM_005934chr1952280 2221 2172 1062 239 1208 ----
NM_005941chr81899 24204 3442 --13124
NM_005955chr144816 3922 1028 408 177 --14806
NM_005962chr1022195 76 2836 46 12139 --
NM_005962chr1022195 76 2836 46 12139 --
NM_005964chr1721329 567 ------
NM_005986chr1342408 626 507 217 ------
NM_005990chr531059 401 37 --12307 --
NM_006007chr973808 3058 1514 1081 1067 1044 155 ------
NM_006010chr3193 ------
NM_006011chr1562944 2627 1448 1055 850 719 --1363 --
NM_006016chr622110 1405 ------
NM_006030chr331621 505 255 --11669 --
NM_006032chr141193 ------
NM_006034chr1142332 1565 1009 183 3713 340 39 1271 --
NM_006036chr221768 1567 ------
NM_006038chr2031528 682 134 ------
NM_006048chr13925 846 319 ------
NM_006051chr5137 --1218 --
NM_006085chr11398 ------
NM_006090chr1------1221
NM_006095chr411002 ------
NM_006106chr1132727 2180 719 ------
NM_006108chr1131914 1524 558 ----12323
NM_006113chr111908 21516 798 ----
NM_006133chr1172142 1951 1725 931 714 563 540 1270 12071 --
NM_006136chr721199 96 --11358 --
NM_006148chr1782880 2416 2046 2000 1148 492 293 244 --12674 1702
NM_006159chr12183 ------
NM_006161chr51467 ------
NM_006180chr911525 --12129 --
NM_006195chr9----11083 --
NM_006197chr812244 --2486 232 --
NM_006206chr411972 ----1612
NM_006237chr1342259 1476 1398 329 22284 1886 ----
NM_006245chr611048 --11005 --
NM_006251chr51423 ------
NM_006257chr102274 72 ------
NM_006258chr101389 1422 ----
NM_006266chr91674 1339 ----
NM_006279chr13833 340 199 ------
NM_006301chr121443 ------
NM_006317chr51698 ------
NM_006325chr121149 ------
NM_006336chr931404 1215 530 1564 11055 --
NM_006351chr19--137 ----
NM_006352chr11720 ------
NM_006369chr13457 368 64 ------
NM_006372chr61468 ------
NM_006373chr173494 472 209 11217 1548 --
NM_006393chr1021410 166 ------
NM_006401chr9----1386 --
NM_006416chr6----1733 --
NM_006420chr2012529 ------
NM_006421chr81935 ------
NM_006449chr221607 103 1886 --11764
NM_006454chr473062 2948 2595 923 788 586 135 --12743 --
NM_006459chr1031541 1528 765 ------
NM_006464chr233791 648 193 --34360 765 220 11485
NM_006469chr141378 389 264 163 11327 ----
NM_006471chr18146 ------
NM_006472chr131271 164 107 ------
NM_006482chr1233650 3260 1496 ----13366
NM_006526chr2021335 352 --11875 --
NM_006544chr1414391 ------
NM_006570chr9197 ------
NM_006575chr141993 ------
NM_006584chr17----1125 --
NM_006599chr1637713 7056 1361 36370 2260 1880 ----
NM_006603chrX----11493 --
NM_006614chr323392 1083 ------
NM_006620chr624432 408 ------
NM_006621chr1------11456
NM_006625chr11359 ------
NM_006625chr11359 ------
NM_006625chr11359 ------
NM_006646chr1342005 886 296 149 ------
NM_006650chr573209 2610 2475 1339 752 733 410 ------
NM_006651chr41423 ------
NM_006693chr73815 593 204 ------
NM_006694chr1127 ------
NM_006696chr5--2194 116 164 --
NM_006703chr61209 ------
NM_006704chr131369 ------
NM_006708chr611277 --1879 --
NM_006717chr91606 --22957 2370 12075
NM_006734chr621185 1098 --1211 --
NM_006736chr241856 1601 1516 1196 --1300 --
NM_006756chr81115 11061 ----
NM_006759chr2--136 ----
NM_006766chr832256 1957 174 22608 1990 ----
NM_006769chr1--1214 ----
NM_006775chr632985 2925 212 --12944 --
NM_006802chr131009 913 834 --1819 131
NM_006805chr521321 1235 --11736 --
NM_006815chr1221237 504 --1964 1902
NM_006852chr1732488 990 187 1391 ----
NM_006868chr1863063 2851 2185 1130 938 699 --11962 --
NM_006884chr31251 ------
NM_006885chr1633891 3244 2883 ------
NM_006888chr1432770 2485 992 --1300 --
NM_006896chr71217 ------
NM_006908chr7----11313 --
NM_006912chr11244 ----1553
NM_006920chr231857 658 26 ------
NM_006924chr1723013 2970 1106 13955 --
NM_006925chr141132 --1138 --
NM_006948chr21--12106 ----
NM_006981chr911193 ------
NM_006990chr152538 2034 1950 866 530 --12123 --
NM_006999chr5------1621
NM_007006chr1643081 2202 1232 401 ------
NM_007011chr1596590 5927 4973 1731 1690 1607 926 913 670 16176 16195 12743
NM_007017chr5--1318 ----
NM_007027chr3179 ------
NM_007050chr20117814 7202 6612 6019 5373 2777 2588 2053 1825 629 81 25497 2327 26590 799 16702
NM_007078chr102833 781 --1488 --
NM_007124chr621508 1436 ------
NM_007126chr9------1547
NM_007158chr11991 ------
NM_007166chr1111197 ------
NM_007174chr1231979 1934 888 --11550 --
NM_007203chr921366 1006 ----23073 2811
NM_007222chr81551 1382 ----
NM_007249chr1338746 7528 6341 11282 18794 --
NM_007275chr31170 ------
NM_007276chr7----153 --
NM_007280chr15----1354 --
NM_007350chr1234165 4136 1392 ------
NM_007358chr11744 ------
NM_007359chr1711178 ------
NM_007363chrX1824 ------
NM_007375chr122030 1729 ------
NM_012069chrX12419 ----11007
NM_012074chr145880 763 741 399 180 ------
NM_012081chr532937 2399 975 ------
NM_012090chr1158 ------
NM_012095chr1012966 ------
NM_012097chr211410 ------
NM_012104chr1122412 989 12749 12971 11491
NM_012104chr1122412 989 12749 12971 11491
NM_012111chr141138 ------
NM_012120chr61584 ------
NM_012127chr9135 ------
NM_012164chr966242 2169 796 273 56 34 ------
NM_012166chr931419 1066 111 ------
NM_012175chr111170 ------
NM_012191chr31200 ------
NM_012193chr1124962 424 --35199 4890 3516 --
NM_012197chr931160 1101 593 --11114 --
NM_012199chr144159 3354 3155 392 --12888 --
NM_012207chr102925 285 ------
NM_012215chr1031436 268 222 ------
NM_012218chr1933011 2343 722 32455 628 478 ----
NM_012248chr161224 ------
NM_012249chr213354 1505 --1791
NM_012262chr155140 4984 3221 1252 409 ------
NM_012264chr225859 788 662 437 184 --31636 1402 768 --
NM_012264chr225859 788 662 437 184 --31636 1402 768 --
NM_012281chr71614 ------
NM_012287chr321326 756 ------
NM_012290chr211172 ------
NM_012296chr1153441 3347 2515 1408 794 53874 3700 2902 1328 412 ----
NM_012298chr33650 582 23 --1211 --
NM_012300chr531700 870 422 ------
NM_012307chr181806 ------
NM_012309chr1184739 3873 1465 1346 557 202 166 53 23969 3193 ----
NM_012316chr175367 5251 4867 1670 440 234 206 24426 4304 ----
NM_012323chr2231136 201 139 --1465 --
NM_012329chr1711332 ------
NM_012333chr121200 630 --1182 --
NM_012334chr544492 4018 3066 1793 ----11281
NM_012428chr15----1215 --
NM_012432chr1155 194 ----
NM_012465chr1042546 2328 825 407 --13176 --
NM_012473chr222625 538 1291 ----
NM_012479chr71405 --1665 --
NM_012482chr12576 511 ------
NM_013231chr141932 13122 12807 --
NM_013233chr211225 ------
NM_013247chr23410 383 139 ------
NM_013261chr411018 13130 13295 13355
NM_013262chr631131 1050 325 ------
NM_013279chr1121692 462 32089 1956 764 1224 --
NM_013281chr20135 ------
NM_013286chr323122 124 21398 437 1528 --
NM_013312chr19277 29 ------
NM_013352chr61340 ------
NM_013365chr221212 --1625 1290
NM_013372chr1512832 ----11241
NM_013382chr1472246 2165 2064 1813 1502 784 28 11668 1233 --
NM_013386chr1------1156
NM_013400chr72151 68 --11014 --
NM_013433chr1931670 1305 262 1458 --1297
NM_013438chr91265 ------
NM_013444chrX1399 ------
NM_013952chr241632 855 676 669 --12595 --
NM_013953chr241632 855 676 669 --12595 --
NM_013989chr1424737 1053 1771 33458 3274 181 14273
NM_013992chr241632 855 676 669 --12595 --
NM_014001chr17--1376 11037 --
NM_014010chr94570 493 107 85 ------
NM_014021chr113183 ------
NM_014023chr1032559 1947 874 --2943 218 --
NM_014060chrX------126
NM_014079chr33414 342 211 1358 ----
NM_014089chr1311817 ------
NM_014110chr131168 1089 33 ------
NM_014112chr824414 2062 ------
NM_014117chr161840 11685 1366 --
NM_014155chr1146675 1842 1340 163 ------
NM_014157chr1643401 1429 977 331 1143 1968 --
NM_014181chr212334 ----12593
NM_014190chr441529 1507 1469 267 ------
NM_014216chr1451490 1449 1029 663 614 157 ----
NM_014232chr1711385 ------
NM_014232chr1711385 ------
NM_014233chr1711627 ------
NM_014238chr1731427 1084 338 ------
NM_014240chr343489 3351 3011 1635 ------
NM_014243chr4----12064 --
NM_014250chr2211303 ------
NM_014253chrX11987 ------
NM_014298chr161208 165 ----
NM_014299chr1941994 1436 881 135 11738 1821 --
NM_014309chr2225248 1702 ------
NM_014319chr1211401 --1520 --
NM_014333chr111600 ------
NM_014335chr15166 ------
NM_014352chr1141357 1145 1032 359 11417 ----
NM_014360chr143638 539 123 --2353 246 --
NM_014372chr112019 ----1424
NM_014374chr72151 68 --11014 --
NM_014390chr7----1106 --
NM_014405chr1762349 2181 2174 2157 447 142 ------
NM_014415chr31115 ------
NM_014417chr191205 ------
NM_014423chr533867 2175 1624 ------
NM_014426chr201712 ------
NM_014445chr322428 2347 ----11515
NM_014456chr1031685 1254 107 ------
NM_014494chr16----1369 --
NM_014554chr1211454 --12139 --
NM_014591chr1011042 --21318 490 --
NM_014612chr911476 ------
NM_014613chr52988 637 ------
NM_014614chr2--1448 21057 477 --
NM_014615chr1641454 939 729 483 --12595 --
NM_014636chr994129 3758 3627 1507 1438 816 311 266 54 ------
NM_014648chr321346 1063 1546 ----
NM_014655chr132105 897 225 2117 48 1381 --
NM_014661chr1073233 3057 1305 703 312 98 71 --11369 --
NM_014665chr84495 356 221 120 13039 ----
NM_014666chr51882 --1411 --
NM_014670chr21168 ------
NM_014671chr711225 ------
NM_014682chr811504 --12198 --
NM_014690chr753024 1016 276 268 261 ------
NM_014701chr15--1573 1406 13148
NM_014711chr1621770 177 1546 ----
NM_014712chr163567 553 83 ------
NM_014713chr21409 ------
NM_014729chr811571 1142 ----
NM_014730chr1245198 5138 3696 2072 12060 54972 3942 1832 1739 1597 --
NM_014730chr1245198 5138 3696 2072 12060 54972 3942 1832 1739 1597 --
NM_014739chr613988 ------
NM_014743chr412290 ------
NM_014747chr1165804 5486 5279 5011 4876 4853 4482 4323 2019 1989 1525 1365 1148 850 254 129 --24656 4472 --
NM_014751chr811971 ------
NM_014752chr1111361 ----1324
NM_014755chr223260 2607 --14213 --
NM_014761chr163857 819 143 ------
NM_014766chr743141 2543 1116 607 --11452 --
NM_014770chr121255 --11172 --
NM_014772chr1823395 425 11230 --1393
NM_014774chr123055 2926 ------
NM_014779chr3------1752
NM_014786chr114841 296 248 125 11205 ----
NM_014797chr631301 1125 579 12416 132 --
NM_014800chr73992 334 116 ------
NM_014810chr131195 704 48 ------
NM_014812chr111773 ------
NM_014820chr311927 ------
NM_014826chr153945 3770 3152 1185 390 11090 ----
NM_014828chr1442413 2169 1709 81 1496 12211 --
NM_014839chr111892 ------
NM_014840chr1252755 1316 1040 390 176 --3377 216 62 --
NM_014841chr611193 ------
NM_014850chr344171 3917 3397 1550 ------
NM_014851chr182280 2196 2143 780 635 595 249 119 --193 --
NM_014859chr171585 ----11087
NM_014872chr932235 586 78 12122 ----
NM_014876chr2251918 1596 408 393 74 --11955 --
NM_014892chr61622 ------
NM_014893chrY11967 1409 ----
NM_014900chr2----1459 --
NM_014901chr511905 1384 --1672
NM_014904chr1023774 1539 23491 219 11092 --
NM_014912chr1013548 --1130 --
NM_014921chr1972137 1931 836 829 778 758 134 1104 23003 806 --
NM_014924chr1453027 2676 2228 315 303 1344 ----
NM_014934chr1311065 --13070 --
NM_014939chr1821376 1262 ------
NM_014947chr142554 2289 1121 752 --12650 --
NM_014949chr1--1696 ----
NM_014969chr11156 ------
NM_014970chr12105 57 ------
NM_014978chr102683 321 ------
NM_014982chr1455210 4938 3681 1303 745 ------
NM_014989chr621986 1640 ------
NM_014996chr3----1122 --
NM_014999chr1221226 1151 ------
NM_015000chr121434 ------
NM_015008chr342688 859 405 200 --11237 --
NM_015020chr1633760 3259 1516 ------
NM_015023chr151740 1633 1608 496 185 ------
NM_015033chr932883 2152 314 12310 ----
NM_015035chr2066685 6433 5892 4874 1590 1538 2640 463 --14329
NM_015037chr101220 ------
NM_015042chr1533235 3197 3170 24166 1171 ----
NM_015044chr163767 753 498 12401 23024 2907 --
NM_015045chr1022241 640 ------
NM_015075chrX42113 882 398 104 --1497 --
NM_015080chr111315 ------
NM_015086chr12----147 --
NM_015090chr135531 4737 645 46132 5324 1768 556 25081 3980 11979
NM_015091chr142804 551 ------
NM_015092chr1623889 506 ------
NM_015100chr131710 1525 432 ------
NM_015101chr142760 2601 2195 2086 --1603 --
NM_015115chr412975 ------
NM_015116chr1311743 ----1399
NM_015125chr191477 ------
NM_015138chr1551962 673 457 232 226 --32592 242 88 --
NM_015144chr1612950 1422 ----
NM_015173chr421752 395 11602 --1525
NM_015176chr1----11422 --
NM_015185chrX42856 2290 1120 866 ------
NM_015186chr91380 ------
NM_015194chr1731809 243 51 --11844 1815
NM_015199chr352877 2224 1123 815 580 --12218 --
NM_015200chr422493 1026 ------
NM_015215chr1----1531 --
NM_015219chr1742351 1659 732 80 --12291 --
NM_015230chr41251 ------
NM_015238chr5--1606 1153 --
NM_015239chr91481 ----1126
NM_015245chr6102715 2338 2217 2020 1783 999 807 454 439 149 --12442 --
NM_015246chr1662012 1464 1369 1342 647 275 11412 ----
NM_015252chr2----1786 --
NM_015254chr862941 2667 2349 1140 574 156 12204 12047 11078
NM_015263chr151351 ------
NM_015265chr21103 ------
NM_015270chr1232288 2139 1932 22229 1959 ----
NM_015275chr121855 199 ----
NM_015282chr222900 2879 1894 ----
NM_015284chr131511 94 48 11962 21340 257 --
NM_015285chr1821810 1624 12064 ----
NM_015288chr52360 279 21287 383 ----
NM_015291chr123448 1154 ------
NM_015299chr1453887 3632 3600 1541 743 23075 480 1577 --
NM_015313chr1174497 4427 4137 827 679 501 288 ------
NM_015315chr521012 494 ----1159
NM_015317chr222672 2586 12145 ----
NM_015326chr131937 1005 316 1639 12138 --
NM_015328chr742534 2251 472 227 ------
NM_015332chr763245 2827 2430 1412 790 657 13408 ----
NM_015336chr121269 ------
NM_015346chr14--11679 --11548
NM_015349chr642854 2168 2016 467 12490 ----
NM_015365chrX34242 247 29 11724 1587 --
NM_015378chr152856 2723 2591 2091 1207 12344 32140 2028 587 --
NM_015393chr452799 2657 2525 2473 326 1233 --13567
NM_015401chr123270 175 84 ------
NM_015416chr124878 707 287 135 1800 ----
NM_015435chr811316 ------
NM_015441chr11333 --1150 --
NM_015446chr111131 ------
NM_015477chr153233 109 54 1170 ----
NM_015503chr161240 --1560 --
NM_015509chr1221297 540 --11389 --
NM_015528chr171165 ----1181
NM_015541chr3177 ------
NM_015567chr1321027 436 ----1997
NM_015568chr2054222 2946 408 272 108 --24229 1431 --
NM_015575chr253369 2503 1443 1331 1143 12736 1850 --
NM_015576chr3--1687 --12437
NM_015609chr182840 2832 2736 2167 2118 960 764 51 22474 783 ----
NM_015635chr9----1185 --
NM_015642chr31200 ------
NM_015652chr101228 ------
NM_015678chr13----1634 --
NM_015686chrX21717 856 --21963 1854 --
NM_015702chr2148 ------
NM_015726chr111488 11813 1349 --
NM_015872chr141614 1368 558 317 ------
NM_015878chr81303 ------
NM_015902chr81222 ------
NM_015906chr111746 --1561 --
NM_015913chr11538 ------
NM_015949chr73776 743 299 ------
NM_015964chr162143 60 ------
NM_015995chr15115164 4927 4225 1987 1717 1708 1387 1380 864 548 421 --12118 --
NM_016022chr12755 418 ----1718
NM_016025chr1611440 ------
NM_016032chrX21234 233 --1242 --
NM_016061chr221466 308 --1382 --
NM_016073chr151959 ------
NM_016076chr11576 ----13190
NM_016083chr6----13405 --
NM_016107chr5--1914 ----
NM_016132chr1543094 2278 1047 183 ------
NM_016140chr162143 60 ------
NM_016169chr1093223 3057 2698 2010 1014 968 847 739 649 --12367 --
NM_016203chr711030 154 ----
NM_016206chr336847 2746 170 27125 439 --11354
NM_016247chr31438 ------
NM_016250chr14----1694 183
NM_016257chr131172 1083 254 --1393 13096
NM_016260chr215880 12640 15289 --
NM_016264chr191371 ------
NM_016272chr2251708 942 904 762 237 21847 585 12102 --
NM_016281chr12----1776 --
NM_016287chr1------1607
NM_016338chr511135 ------
NM_016374chr1--1318 ----
NM_016374chr1--1318 ----
NM_016376chr1753692 2971 1232 677 379 --22795 243 --
NM_016396chr1511013 ------
NM_016441chr21144 ------
NM_016451chr11149 ------
NM_016456chr12776 551 --1218 122
NM_016480chr51809 ------
NM_016507chr1743122 2077 724 446 1207 12115 --
NM_016522chr1111203 ------
NM_016575chr1284596 4011 3903 3357 1949 452 72 42 14075 14508 --
NM_016577chr364449 1666 1555 947 651 612 1916 14068 --
NM_016587chr7----153 --
NM_016596chr123270 175 84 ------
NM_016603chr51898 ------
NM_016605chr51544 12440 12392 --
NM_016621chr1174365 3434 3406 3246 2866 452 351 11493 13797 --
NM_016626chr181351 ------
NM_016631chr21----1712 --
NM_016936chr162281 218 --2663 32 11589
NM_016950chr41403 ------
NM_017415chr511311 11661 1255 --
NM_017455chr15----1215 --
NM_017522chr121047 97 ------
NM_017558chr161362 ------
NM_017575chr1731494 584 217 ------
NM_017593chr41356 1397 ----
NM_017596chr154208 3984 3712 1770 1077 23395 1660 13474 --
NM_017610chr151283 ------
NM_017629chr11464 ------
NM_017633chr6------13788
NM_017637chr938623 7357 1355 --18607 --
NM_017643chr1712455 ------
NM_017644chr321203 1088 ------
NM_017650chr744543 4063 1021 292 ------
NM_017658chr141142 ------
NM_017660chr1963271 3023 2572 1367 1300 243 --11085 --
NM_017666chrX1724 --11906 --
NM_017676chr511632 ------
NM_017684chr151137 1229 ----
NM_017694chr21717 ------
NM_017709chr143091 1533 340 162 13919 ----
NM_017719chr3----1614 --
NM_017724chr3----1681 --
NM_017749chr112306 239 1368 ----
NM_017752chrX3687 423 167 ------
NM_017763chr1741021 907 452 275 --151 --
NM_017769chr1422670 2015 ------
NM_017778chr82605 232 ------
NM_017801chr332579 1813 945 11972 22001 1852 --
NM_017813chr825376 2333 15213 11614 --
NM_017848chrX73285 1821 1691 1387 1303 1240 318 ------
NM_017864chr8--143 ----
NM_017893chr1031438 512 385 159 ----
NM_017910chr2------1255
NM_017919chr945662 3911 326 203 ----1926
NM_017938chrX----1847 --
NM_017944chr1122008 1986 1164 ----
NM_017953chr12375 67 ------
NM_018010chr321600 35 ------
NM_018028chr192981 94 ------
NM_018032chr162197 98 ------
NM_018061chr131727 1324 1174 ------
NM_018063chr102341 64 ------
NM_018067chr12120 106 ----1485
NM_018085chr148118 8064 7452 4958 137 ----
NM_018086chr221697 1381 ------
NM_018120chr81268 ------
NM_018131chr10--1900 ----
NM_018133chr3--11589 11538 --
NM_018155chr342800 2705 1165 285 ------
NM_018156chr152856 2723 2591 2091 1207 12344 32140 2028 587 --
NM_018157chr1242520 2359 1109 436 11310 ----
NM_018181chr1831517 473 283 ------
NM_018184chr311584 22166 338 ----
NM_018206chr161662 ------
NM_018243chr453492 870 799 593 162 ------
NM_018263chr242553 2055 912 59 ------
NM_018266chr3--1784 ----
NM_018293chr3----12563 --
NM_018313chr321755 362 11955 ----
NM_018320chr1151170 1157 1046 1035 370 ----1114
NM_018330chr101689 --1643 --
NM_018362chr1112447 ------
NM_018364chr12741 218 ------
NM_018371chr8--1117 1153 --
NM_018373chr1436104 2045 1016 22457 1541 24679 4310 --
NM_018374chr735035 4725 3824 ------
NM_018387chr9----1462 --
NM_018403chr323406 3064 --2568 431 --
NM_018413chr122193 79 ------
NM_018424chr911876 ------
NM_018425chr1052204 2004 970 606 565 --11976 --
NM_018440chr835599 5248 2799 11721 ----
NM_018448chr1211120 ------
NM_018475chr41576 ------
NM_018553chr1751863 1832 1363 617 212 1737 ----
NM_018557chr21146 ------
NM_018584chr11198 ------
NM_018660chr852499 1200 1133 960 631 --1120 --
NM_018667chr1651983 1866 782 547 169 159 ----
NM_018710chr81868 ------
NM_018715chr132029 1878 542 ------
NM_018717chr422247 994 1815 ----
NM_018718chr7----1343 174
NM_018841chr143411 1312 270 242 --11263 --
NM_018890chr7----11313 --
NM_018947chr744989 3946 3252 128 14965 ----
NM_018953chr123818 316 116 ------
NM_018976chr1232441 964 907 --22435 1868 1977
NM_018979chr1222249 440 ------
NM_018999chr1024460 4047 ------
NM_019004chr721576 373 ------
NM_019024chr2--1348 ----
NM_019030chr5--174 ----
NM_019044chr214477 2840 485 1559 11569
NM_019050chr411795 --1919 --
NM_019058chr102727 335 ------
NM_019071chr71567 ------
NM_019074chr155828 785 656 610 189 ------
NM_019106chr22--33249 2715 959 ----
NM_019114chr922414 2382 --12097 --
NM_019116chr1653203 2954 891 708 641 12401 21068 794 --
NM_019557chr12870 592 2787 573 1781 --
NM_019592chr91201 ------
NM_019593chr20----195 --
NM_019594chr931620 566 444 ------
NM_019606chr71512 ------
NM_019610chr122150 1860 ----11505
NM_019613chr1721053 335 187 ----
NM_019885chr272530 2270 2124 955 400 183 164 ------
NM_020116chr411437 ------
NM_020122chr255007 4835 1168 1066 73 ------
NM_020135chr61412 ------
NM_020159chr411702 --11734 --
NM_020179chr11--1361 ----
NM_020205chr11286 ------
NM_020226chr41274 ------
NM_020246chr71147 1295 ----
NM_020310chr1772187 996 975 867 833 808 726 ------
NM_020336chr2032487 1050 188 11375 12713 1172
NM_020346chr1131386 1201 604 ------
NM_020357chr31640 ------
NM_020362chr1----2240 233 --
NM_020390chr333967 3654 649 ------
NM_020432chr71678 ------
NM_020440chr123130 2329 12823 11086 --
NM_020443chr1116951 6667 6177 5494 5200 4333 2384 1631 941 315 275 ----16105
NM_020474chr181771 146 ----
NM_020478chr832152 460 143 ------
NM_020526chr131721 1687 683 ------
NM_020631chr11273 1543 21312 376 --
NM_020640chr31207 --1189 1434
NM_020651chr221584 55 ------
NM_020672chr12568 48 1483 --1225
NM_020673chr2036479 2255 1977 --17523 --
NM_020689chr2031151 620 571 --11653 1190
NM_020699chr1105028 4994 4155 3723 2083 2003 1947 1060 792 667 --24546 694 --
NM_020708chr2031990 1932 226 ------
NM_020742chrX32651 2035 1054 ------
NM_020749chr811816 ----11600
NM_020755chr61592 --1250 --
NM_020766chrX23309 1136 13785 ----
NM_020769chrX------1614
NM_020772chr1737745 1371 369 27309 6339 12456 --
NM_020774chr1845948 4901 2244 871 11878 22482 131 --
NM_020791chr172384 89 ------
NM_020795chr1731849 1486 200 --11544 --
NM_020796chr542517 628 172 132 ------
NM_020801chr5----11967 --
NM_020804chr622052 1882 ------
NM_020807chr164644 624 611 50 1452 11152 --
NM_020808chr1----2390 302 --
NM_020821chr151137 1229 ----
NM_020824chr10----1111 --
NM_020839chr3----1575 --
NM_020844chr834764 1715 1483 ----17232
NM_020845chr1272145 1839 967 936 927 328 96 12428 12486 --
NM_020850chr1673125 2851 2479 2352 2155 1241 521 1675 11156 --
NM_020854chr1811497 ------
NM_020856chr191128 ------
NM_020858chr1522391 723 ------
NM_020859chr433374 3192 1160 12899 33145 1472 1303 1936
NM_020860chr41357 ------
NM_020871chrX42374 2033 1701 980 ------
NM_020899chr172546 523 1850 ----
NM_020922chrX21818 85 ------
NM_020940chr1042895 2817 1072 699 ------
NM_020946chr931471 513 268 31506 1441 295 1645 --
NM_020948chr122954 634 ------
NM_020949chr31191 163 ----
NM_020956chr1944217 3933 2891 293 126 53408 1398 1029 921 362 --
NM_020962chr1532078 474 370 11555 12187 --
NM_020983chr1232288 2139 1932 22229 1959 ----
NM_020987chr1011293 ------
NM_021005chr15----1855 --
NM_021020chr862839 2619 2208 1283 796 243 23290 3152 ----
NM_021033chr1332773 2319 173 --11109 --
NM_021038chr311227 --13312 --
NM_021061chr813862 13972 ----
NM_021079chr1732530 2307 176 12065 33272 2099 1347 --
NM_021090chr2234733 3977 879 23168 778 21807 744 --
NM_021120chrX52733 2536 2228 1183 593 ------
NM_021132chr10------1196
NM_021136chr141606 ------
NM_021140chrX1316 ------
NM_021144chr9----125 --
NM_021145chr7----1975 --
NM_021148chr71818 ------
NM_021159chr421645 1372 ------
NM_021183chrX--11667 ----
NM_021188chr142527 222 ------
NM_021189chr12246 152 ------
NM_021198chr2196 1917 21309 317 --
NM_021202chr2042923 1917 528 112 13011 ----
NM_021215chr203835 424 398 ------
NM_021222chr111433 ------
NM_021224chr9----170 --
NM_021229chr121132 ------
NM_021255chr1453110 1390 604 377 285 ------
NM_021643chr211507 ----1274
NM_021644chr102925 285 ------
NM_021648chr63560 460 193 --1402 --
NM_021728chr14148 ------
NM_021729chr11----1305 --
NM_021814chr61204 ------
NM_021905chr671757 1736 258 176 132 126 21 1145 ----
NM_021945chr673235 2721 2430 1393 1257 1057 46 11082 ----
NM_021961chr1176998 6960 6895 5905 2641 2608 2395 17515 11991 --
NM_021964chr356423 6114 5356 5161 1455 ------
NM_022041chr161103 ------
NM_022048chr1554574 2313 2062 883 475 1178 11401 --
NM_022062chr1121391 702 1776 21499 110 --
NM_022114chr153240 3215 1339 1055 780 ------
NM_022123chr141587 ------
NM_022130chr51264 ------
NM_022143chr72351 117 ------
NM_022152chr24220 81 61 34 ------
NM_022153chr1093474 2506 2312 1374 1029 703 121 36 22 1380 ----
NM_022166chr1685772 5403 5338 4614 807 703 642 113 22419 23 --12075
NM_022169chr1151371 451 421 168 88 ------
NM_022170chr721422 180 --1338 --
NM_022307chr71570 2539 291 ----
NM_022340chr311197 --3367 332 28 --
NM_022353chr2----1174 --
NM_022459chr131628 --1501 11664
NM_022474chr1421733 547 ------
NM_022497chr32383 21 21220 575 1294 --
NM_022552chr24984 504 467 333 ------
NM_022648chr264195 3419 3173 2947 1336 1078 ----21462 103
NM_022652chr123986 879 73 ------
NM_022659chr8----1125 --
NM_022719chr2293696 3471 3002 2907 2897 1321 964 578 552 22851 101 ----
NM_022728chr72619 73 ------
NM_022730chr21679 139 ----
NM_022739chr17--1908 ----
NM_022748chr772484 1122 954 722 591 234 62 ------
NM_022750chr72504 179 --158 --
NM_022751chr18163 ------
NM_022755chr931660 1609 78 12241 1928 --
NM_022758chr643101 2253 2247 248 12234 ----
NM_022780chr21704 ------
NM_022781chr922613 31 1764 22997 2926 --
NM_022810chrX------1327
NM_022831chr121135 430 ------
NM_022843chr1321547 1426 --11012 --
NM_022893chr22990 800 ------
NM_022898chr1453808 3311 952 319 239 --24732 2964 --
NM_022913chr51219 ------
NM_023079chr1731684 1585 1540 ------
NM_023929chr821850 849 --1289 --
NM_024019chr41176 ------
NM_024046chr341253 827 491 400 1841 ----
NM_024085chr23744 717 159 --2903 391 --
NM_024293chr21227 1583 ----
NM_024294chr643101 2253 2247 248 12234 ----
NM_024306chr163424 372 110 ------
NM_024345chr91125 --11863 1104
NM_024429chr711030 154 ----
NM_024496chr14------1257
NM_024523chr711031 ------
NM_024524chr31295 ------
NM_024536chr25320 306 157 149 22 ------
NM_024539chrX--1912 --1392
NM_024541chr103258 154 55 11800 1444 --
NM_024567chr81574 ------
NM_024615chr51245 ------
NM_024617chr91823 ------
NM_024624chr21328 --11224 --
NM_024631chr11--1237 127 2164 128
NM_024639chr622458 573 1932 ----
NM_024665chr31991 --14354 --
NM_024700chr1183 ------
NM_024740chr1143892 3654 3544 432 23570 139 ----
NM_024755chr151881 ------
NM_024811chr111776 11473 ----
NM_024824chr1421501 194 ------
NM_024887chr132140 1793 470 --1167 --
NM_024900chr442208 500 447 129 ------
NM_024900chr442208 500 447 129 ------
NM_024917chrX1834 ------
NM_024922chr1651640 1476 1399 1304 311 11368 ----
NM_024923chr3129 31312 1196 1034 ----
NM_024947chr379550 9529 8393 7894 6993 6449 6315 ----16655
NM_024969chr2170 ------
NM_024989chr225751 2767 --12646 --
NM_025054chr821568 977 165 ----
NM_025061chr192160 93 ------
NM_025073chr124731 3552 ------
NM_025079chr1158 1213 --166
NM_025090chr175610 452 286 152 126 ------
NM_025145chr10160 ------
NM_025146chr33972 670 436 --1739 --
NM_025160chr123585 3103 --12732 --
NM_025164chr111163 ------
NM_025176chr20--180 ----
NM_025182chr93969 216 143 ------
NM_025187chr1651170 898 878 163 63 --1138 --
NM_025222chr35663 638 461 417 101 1885 12578 --
NM_025224chr2051674 868 573 334 65 --1774 --
NM_025238chr151343 1431 ----
NM_025250chr743032 2484 1867 188 176 ----
NM_030627chr531142 769 338 ------
NM_030637chr141268 ------
NM_030647chr733983 2068 901 ------
NM_030650chr211555 1670 23431 1529 --
NM_030660chr14--11280 ----
NM_030664chr1012403 ------
NM_030674chr1224874 735 --12221 --
NM_030761chr152084 1838 1658 601 201 --1127 --
NM_030766chr122280 116 1101 ----
NM_030784chr6127 ------
NM_030786chr1--1680 ----
NM_030790chr161203 ------
NM_030796chr732241 1713 96 ------
NM_030801chrX1172 ------
NM_030802chr171147 ------
NM_030806chr1119283 9181 8872 8645 7937 7734 7479 7228 6278 3191 2390 27266 3100 ----
NM_030808chr174833 250 154 80 --1981 --
NM_030918chr185227 4703 4600 4006 1916 1616 1104 524 --24393 466 14382
NM_030923chr21673 ------
NM_030962chr11----1320 --
NM_030963chr61193 ------
NM_030981chr1131101 477 126 ------
NM_031157chr121460 ------
NM_031216chr181294 ------
NM_031243chr7124 ------
NM_031268chr16103900 2086 1836 1775 1712 1408 1191 1178 576 558 ----15284
NM_031309chr862251 2197 1852 1791 1687 555 11693 1298 --
NM_031369chr4----1151 --
NM_031370chr4----1151 --
NM_031371chr1--1318 ----
NM_031371chr1--1318 ----
NM_031372chr4--11426 ----
NM_031438chr51119 ----1214
NM_031445chr232440 2356 614 --32798 2325 928 --
NM_031844chr123688 1525 ------
NM_031845chr243384 2950 1097 62 12816 ----
NM_031847chr243384 2950 1097 62 12816 ----
NM_031890chr22102803 2386 2206 1076 1017 1006 765 630 327 31 12563 11065 --
NM_031891chr181157 ------
NM_031936chr11725 1143 ----
NM_031992chr721422 180 --1338 --
NM_032017chr161920 1564 1538 1418 1305 77 21985 1787 ----
NM_032051chr221220 ----1594
NM_032052chr2241075 468 302 242 ------
NM_032102chr111247 12938 ----
NM_032105chr156911 6733 5043 1610 1325 --11086 --
NM_032109chr51953 ------
NM_032121chrX21084 869 ------
NM_032144chr2----11154 --
NM_032147chr121795 ------
NM_032153chr321850 447 ----11828
NM_032160chr1823859 1737 13950 ----
NM_032195chr211105 ------
NM_032199chr1041108 968 771 266 ----11475
NM_032228chr1123013 2673 ------
NM_032229chr1321140 836 ------
NM_032239chr421381 1365 --11328 --
NM_032312chr21682 ----1197
NM_032320chr11----1529 --
NM_032325chr114362 331 267 57 ------
NM_032329chr263405 3355 1641 797 719 538 23370 1528 13066 --
NM_032373chr1014613 24338 4259 --15854
NM_032413chr15----1135 --
NM_032420chr54907 611 315 275 ------
NM_032434chr211385 ------
NM_032440chr1021992 1884 ----1578
NM_032446chr523654 2585 ------
NM_032457chr432887 2708 1451 12733 ----
NM_032458chrX--13316 ----
NM_032491chr12--1113 ----
NM_032505chr322033 337 1952 ----
NM_032511chr6149 ------
NM_032538chr641979 1864 826 790 12254 ----
NM_032547chr4--1987 11274 --
NM_032552chr921375 1205 21318 630 21845 312 --
NM_032581chr7177 ------
NM_032590chr121377 ------
NM_032595chr1731396 606 431 ----11467
NM_032631chr191124 ------
NM_032632chr142297 113 1140 ----
NM_032701chr191515 ------
NM_032711chr17124240 3958 2765 1657 1538 1312 1270 671 650 569 482 346 13653 23781 1456 --
NM_032737chr1972592 1993 1875 1748 1718 581 134 1529 1295 --
NM_032777chr821351 1217 ------
NM_032786chr122497 469 --1455 --
NM_032801chr1141991 722 335 251 ------
NM_032808chr154888 729 687 318 ------
NM_032840chr1241136 292 284 204 151 ----
NM_032859chr1323346 357 11503 ----
NM_032900chr1073626 3459 2576 639 442 416 283 12979 1501 --
NM_032918chr1221146 115 ------
NM_032932chr1786317 6154 6120 5967 2304 1462 1382 389 --11713 --
NM_033020chr111746 --1561 --
NM_033036chr1141615 499 172 28 1223 ----
NM_033044chr1158 ------
NM_033055chr1------1448
NM_033102chr121026 44 ------
NM_033102chr121026 44 ------
NM_033105chr81125 ------
NM_033132chr131485 --1191 --
NM_033133chr1773250 2997 2324 1395 974 599 485 1259 13670 --
NM_033136chr51421 ------
NM_033137chr51421 ------
NM_033138chr71101 ------
NM_033139chr71101 ------
NM_033140chr71101 ------
NM_033157chr71101 ------
NM_033181chr6----13405 --
NM_033211chr5--11399 11590 1144
NM_033260chr61549 ----1655
NM_033290chrX32850 2693 353 11466 ----
NM_033300chr121047 97 ------
NM_033326chr1112503 ------
NM_033331chr942888 2869 2250 177 --12810 --
NM_033360chr1221860 581 ----11078
NM_033386chr222359 52 2417 174 ----
NM_033389chr1733421 1305 140 1459 1956 --
NM_033429chr1541221 827 315 31 ------
NM_033449chr531808 1484 498 --21450 377 --
NM_033495chrX1297 ------
NM_033512chr882671 1980 1077 971 688 507 393 36 ------
NM_033549chr53898 404 233 --1877 --
NM_033551chr521012 494 ----1159
NM_033631chr183823 3361 3114 2671 1408 1050 859 448 13308 ----
NM_033642chrX11084 ------
NM_033644chr531700 870 422 ------
NM_033645chr531700 870 422 ------
NM_052834chr1821810 1624 12064 ----
NM_052845chr1242971 2840 1282 225 11119 ----
NM_052879chr1233810 3580 2759 ------
NM_052900chr8--1110 ----
NM_052905chr221821 378 ------
NM_052906chr22114870 4857 4828 4681 3607 3407 3347 3177 1802 1562 1183 --34842 3325 1419 --
NM_052925chr19185 ------
NM_052937chr832400 2234 481 ------
NM_052948chr191140 ------
NM_052968chr112562 97 ------
NM_053001chr81300 ------
NM_053016chr9--37871 6337 1805 25150 2958 --
NM_053053chr1----169 --
NM_053067chr91265 ------
NM_053279chr852497 2226 2146 678 91 --146 --
NM_054035chr175779 746 609 204 29 --1620 --
NM_057178chr17157 11908 1297 --
NM_057182chr191353 1206 ----
NM_057749chr8144 ------
NM_058241chr2--12252 ----
NM_058241chr2--12252 ----
NM_080491chr1153441 3347 2515 1408 794 53874 3700 2902 1328 412 ----
NM_080546chr9--1463 2924 565 --
NM_080664chr141124 ------
NM_080670chr54674 642 312 44 ------
NM_080676chr202669 651 22784 2134 ----
NM_080678chr2----1216 1675
NM_080743chr652318 2052 1745 587 117 ----1463
NM_080832chrX----155 --
NM_080836chr2084666 4149 1430 1301 899 583 165 24 1538 1605 --
NM_080881chr51708 ------
NM_080927chr333031 2682 2084 ------
NM_130391chr933261 3244 2330 ------
NM_130392chr933261 3244 2330 ------
NM_130393chr933261 3244 2330 ------
NM_130395chr61412 ------
NM_130436chr213508 481 460 12301 ----
NM_130438chr2141085 1058 1037 160 12878 ----
NM_130439chr1022195 76 2836 46 12139 --
NM_130439chr1022195 76 2836 46 12139 --
NM_130442chr73992 334 116 ------
NM_130459chr931057 510 34 --11627 --
NM_130797chr731677 1511 489 --1675 --
NM_130809chr5--1555 --13026
NM_133170chr20117814 7202 6612 6019 5373 2777 2588 2053 1825 629 81 25497 2327 26590 799 16702
NM_133171chr201419 --146 1244
NM_133172chr5137 --1218 --
NM_133173chr5137 --1218 --
NM_133174chr5137 --1218 --
NM_133177chr11968 2198 135 --1792
NM_133178chr11968 2198 135 --1792
NM_133264chr1752919 2831 2625 918 912 --21440 538 --
NM_133265chrX23076 937 13327 ----
NM_133370chr413416 ------
NM_133450chr162253 26 ------
NM_133452chr1941092 1050 857 51 11114 --1750
NM_133457chr741359 1215 256 99 ------
NM_133486chrX1455 ------
NM_133489chr121288 ------
NM_133642chr2221278 1069 ------
NM_134428chr9----153 --
NM_138300chr131209 1161 484 --11108 --
NM_138335chr42672 176 ------
NM_138338chr2283373 3204 3028 2652 2427 2288 1017 772 22417 539 22721 221 --
NM_138444chr1323026 191 1908 --13034
NM_138457chr632283 1344 821 ------
NM_138473chr1244545 1386 1188 70 134 ----
NM_138477chr153293 111 26 ------
NM_138558chr131168 1089 33 ------
NM_138576chr1453808 3311 952 319 239 --24732 2964 --
NM_138619chr17--1376 11037 --
NM_138693chr71135 ------
NM_138713chr1637713 7056 1361 36370 2260 1880 ----
NM_138714chr1637713 7056 1361 36370 2260 1880 ----
NM_138732chr111315 ------
NM_138734chr111315 ------
NM_138771chr711168 ------
NM_138782chr522082 458 ------
NM_138927chr21193 ----1716
NM_138970chr141608 ------
NM_138971chr1122412 989 12749 12971 11491
NM_138971chr1122412 989 12749 12971 11491
NM_138972chr1122412 989 12749 12971 11491
NM_138972chr1122412 989 12749 12971 11491
NM_138973chr1122412 989 12749 12971 11491
NM_138973chr1122412 989 12749 12971 11491
NM_139035chrX1597 ----126
NM_139046chr101227 ------
NM_139047chr10193 ------
NM_139048chr31268 --166 --
NM_139049chr10193 ------
NM_139071chr1221651 1287 --3551 316 49 --
NM_139168chr511879 ------
NM_139182chr41251 ------
NM_139215chr17193 ------
NM_139280chr1791356 1307 1246 911 573 497 294 281 202 ------
NM_144567chr11679 ----1471
NM_144571chr465592 4925 4487 2590 2472 2155 ----11095
NM_144578chr1424962 4356 ----1632
NM_144582chr252518 2330 1763 1041 55 2782 284 1591 --
NM_144599chr1532214 1775 329 1950 ----
NM_144608chr17168 ------
NM_144635chr33347 182 76 ------
NM_144664chr1112162 ------
NM_144668chr12138 ------
NM_144703chr2021121 796 1987 ----
NM_145005chr9----11070 --
NM_145008chr113725 655 257 ------
NM_145025chr61151 ------
NM_145055chr181997 12777 --12521
NM_145074chr23410 383 139 ------
NM_145113chr1411057 ------
NM_145166chr362683 1969 1100 869 811 102 1416 11846 12374
NM_145206chr1042965 2706 2681 1079 --1132 --
NM_145244chr431640 1293 37 ----11532
NM_145251chr141391 ------
NM_145260chr22583 135 ------
NM_145296chr197601 272 208 141 106 38 32 ------
NM_145307chr1023680 1734 13786 ----
NM_145313chr1041300 1277 1065 507 11221 1459 --
NM_145341chr1031685 1254 107 ------
NM_145351chr1741678 734 705 625 1948 2828 308 --
NM_145690chr811352 ------
NM_145799chrX42763 2551 1140 88 --149 --
NM_145808chr713063 ------
NM_145891chr161194 ------
NM_145892chr161194 ------
NM_145893chr162316 57 ------
NM_145913chr124802 744 670 335 ------
NM_147150chr921366 1006 ----23073 2811
NM_147156chr101544 --1408 --
NM_147202chr94921 689 665 203 ------
NM_148174chr81303 ------
NM_152227chr201712 ------
NM_152271chr81339 ------
NM_152280chr1----22830 744 --
NM_152287chr1632009 438 333 ------
NM_152341chr16----11016 --
NM_152344chr1711102 ------
NM_152388chr232792 894 749 ----13296
NM_152407chr563118 1305 1085 796 401 195 ------
NM_152409chr523571 99 ------
NM_152424chrX43161 1321 778 64 --14356 1116
NM_152437chr1232234 937 832 11890 ----
NM_152440chr1231145 1021 745 1211 1297 --
NM_152450chr1532043 2002 139 ------
NM_152470chr1873372 3288 2856 2824 2656 2604 1369 ------
NM_152482chr1961155 708 582 533 485 25 11326 ----
NM_152529chr234001 487 77 ------
NM_152554chr61247 ------
NM_152557chr721303 479 --2518 470 --
NM_152608chr142024 1772 442 178 ------
NM_152609chr111054 ----1375
NM_152624chr567467 7139 5186 5175 4743 1404 --11717 25432 761
NM_152699chr333638 2658 2348 13418 --1115
NM_152713chr111155 1161 ----
NM_152721chr181110 --1276 --
NM_152748chr7----1212 --
NM_152758chr812966 ------
NM_152793chr735058 4927 4033 ------
NM_152835chr11506 ------
NM_152856chrX134 --1172 --
NM_152860chr121146 --1306 --
NM_152878chr2231136 201 139 --1465 --
NM_152924chr1596590 5927 4973 1731 1690 1607 926 913 670 16176 16195 12743
NM_152995chr4----1276 --
NM_153029chr1633852 3607 143 --11543 --
NM_153035chr132393 83 47 127 ----
NM_153050chr2234733 3977 879 23168 778 21807 744 --
NM_153051chr2234733 3977 879 23168 778 21807 744 --
NM_153188chr535297 5154 738 ------
NM_153211chr18189 ------
NM_153234chr512440 22839 1072 ----
NM_153273chr382362 1074 1017 968 867 587 376 273 12257 ----
NM_153321chr171956 ------
NM_153322chr171956 ------
NM_153367chr1063862 2904 1481 918 807 128 ------
NM_153485chr5158 ------
NM_153607chr523039 2712 1479 11074 --
NM_153616chr1522391 723 ------
NM_153617chr1522391 723 ------
NM_153618chr1522391 723 ------
NM_153619chr1513629 ------
NM_153620chr731641 626 601 31768 1559 66 1435 --
NM_153649chr121804 1438 1196 ----
NM_153689chr21835 ------
NM_153693chr121816 ------
NM_153759chr24984 504 467 333 ------
NM_153809chr91520 ------
NM_170675chr152741 184 ----1455
NM_170676chr152741 184 ----1455
NM_171998chrX--1208 --1933
NM_172070chr211908 ------
NM_172071chr167183 6454 5880 2842 2411 1811 ------
NM_172103chr621889 874 ------
NM_172105chr621889 874 ------
NM_172337chr14148 ------
NM_172373chr13------11019
NM_173078chrX1373 ------
NM_173084chr33835 629 30 11682 ----
NM_173156chr131735 760 53 ------
NM_173165chr162156 67 ------
NM_173174chr8182 1202 --1683
NM_173175chr8182 1202 --1683
NM_173176chr8182 1202 --1683
NM_173191chr1011042 --21318 490 --
NM_173192chr1011042 --21318 490 --
NM_173193chr1011042 --21318 490 --
NM_173194chr1011042 --21318 490 --
NM_173195chr1011042 --21318 490 --
NM_173198chr911193 ------
NM_173200chr911193 ------
NM_173214chr1637713 7056 1361 36370 2260 1880 ----
NM_173468chr41127 14965 ----
NM_173476chr1671770 1550 1502 889 627 592 369 ------
NM_173500chr1511291 --11168 --
NM_173510chr2222648 152 ------
NM_173511chr222873 725 ----11084
NM_173519chr811717 1829 ----
NM_173595chr1253836 3720 1717 1310 642 15151 ----
NM_173602chr12--128 --13560
NM_173609chr151604 --1216 --
NM_173642chr146539 3594 2404 641 28997 5789 ----
NM_173644chr2021912 1261 ----1110
NM_173667chr51223 --2531 474 --
NM_173794chrX1328 ------
NM_173822chr231506 1466 271 ------
NM_173825chr31340 --12721 --
NM_173832chr843725 2442 871 487 1663 --1345
NM_174911chr83393 121 101 12489 ----
NM_174963chr13833 340 199 ------
NM_174964chr13833 340 199 ------
NM_174965chr14852 359 218 26 ------
NM_174966chr13833 340 199 ------
NM_174967chr14852 359 218 26 ------
NM_174968chr13833 340 199 ------
NM_174969chr13833 340 199 ------
NM_174970chr14852 359 218 26 ------
NM_174971chr13833 340 199 ------
NM_175624chr1287215 6549 6406 6209 3077 2406 1159 567 23129 2613 --12824
NM_175625chr1287215 6549 6406 6209 3077 2406 1159 567 23129 2613 --12824
NM_175629chr24984 504 467 333 ------
NM_175634chr8----1951 --
NM_175635chr8----1951 --
NM_175636chr8----1951 --
NM_175709chr2272399 2361 2321 2164 1877 740 449 --2411 41 --
NM_175733chr111158 ------
NM_175736chr1245712 2276 1041 484 1949 --11625
NM_175748chr14------1466
NM_175767chr51249 ------
NM_175852chr173021 2670 2431 2208 1096 625 221 22371 152 ----
NM_175866chr1149 11057 ----
NM_176801chr441529 1507 1469 267 ------
NM_176871chr893342 3257 3048 2911 2705 994 798 485 393 12769 146 12714
NM_177402chr11111 ----1852
NM_177424chr121945 738 ------
NM_177535chrX1172 ------
NM_177967chr133752 717 226 --1875 --
NM_177985chr211410 ------
NM_177999chr932679 2437 1049 23467 3055 ----
NM_178151chrX45679 3119 2833 154 1184 12280 17691
NM_178152chrX45679 3119 2833 154 1184 12280 17691
NM_178153chrX45679 3119 2833 154 1184 12280 17691
NM_178313chr2----11506 1599
NM_178424chr5--155 ----
NM_178450chr51108 ------
NM_178460chr201171 ------
NM_178496chr311465 ------
NM_178565chr8------11110
NM_178582chr202423 359 1118 1293 --
NM_178586chr1411957 ------
NM_178832chr10134 --11337 --
NM_180976chr611048 --11005 --
NM_180977chr611048 --11005 --
NM_181050chr162528 109 ------
NM_181077chr152759 174 --11880 --
NM_181332chrX32651 2035 1054 ------
NM_181354chr83658 252 236 ------
NM_181356chr63822 193 114 ------
NM_181491chr993097 3005 2774 1215 971 613 399 187 43 1386 --12198
NM_181521chr16127038 6957 6934 6367 6280 4801 4608 2814 2697 2004 1582 1069 --26330 1817 --
NM_181532chrX1235 ------
NM_181656chr172400 293 143 ----
NM_181672chrX1376 ------
NM_181673chrX1376 ------
NM_181674chr51296 --174 --
NM_181675chr51296 --174 --
NM_181676chr51296 --174 --
NM_181677chr51296 --174 --
NM_181678chr51296 --174 --
NM_181704chr2111164 ------
NM_181838chr51600 ------
NM_181886chr4--11247 ----
NM_181887chr4--11247 ----
NM_181888chr4--11247 ----
NM_181889chr4--11247 ----
NM_181890chr4--11247 ----
NM_181891chr4--11247 ----
NM_181892chr4--11294 ----
NM_181893chr4--11247 ----
NM_182484chr2111164 ------
NM_182485chr413202 ------
NM_182503chr655599 5079 4591 4452 3977 15029 ----
NM_182507chr1261492 796 702 667 475 157 --1548 --
NM_182509chr1431663 1389 1296 --11118 --
NM_182527chr2241678 503 349 97 1615 1551 --
NM_182540chrX1168 ------
NM_182565chr175701 279 181 147 26 1173 ----
NM_182580chr162405 2034 842 398 352 256 1169 ----
NM_182641chr1711934 ----1661
NM_182646chr413202 ------
NM_182666chr31270 ------
NM_182764chr201419 --146 1244
NM_182830chr141699 ------
NM_182918chr2111088 ------
NM_182920chr3175 ------
NM_182943chr3------1131
NM_182948chr11244 ------
NM_182970chr2094252 4145 4010 3189 3183 3151 3133 2825 1466 12642 23267 149 --
NM_183078chr632372 398 274 23686 610 ----
NM_183419chr811316 ------
NM_183425chr201372 1193 ----
NM_184234chr201762 ------
NM_194247chr22881 669 --13273 --
NM_194278chr1433173 2697 490 1259 11299 --
NM_194285chr1122378 103 ------
NM_194286chr1255605 5241 1522 1388 305 12313 21188 562 --
NM_194313chr9153 21653 232 1313 --
NM_194328chr922613 31 1764 22997 2926 --
NM_194329chr922613 31 1764 22997 2926 --
NM_194330chr922613 31 1764 22997 2926 --
NM_194332chr922613 31 1764 22997 2926 --
NM_194452chr1151170 1157 1046 1035 370 ----1114
NM_194453chr1151170 1157 1046 1035 370 ----1114
NM_194463chrX--1912 --1392
NM_197955chr15----1135 --
NM_198123chr8--1110 ----
NM_198124chr8--1110 ----
NM_198181chr151273 ------
NM_198186chr94570 493 107 85 ------
NM_198187chr94570 493 107 85 ------
NM_198243chr151131 ------
NM_198270chrX12448 ------
NM_198277chr11----187 --
NM_198291chr20101926 1776 1436 1413 1390 1277 1254 438 278 44 ------
NM_198391chr20135 ------
NM_198401chr811214 ------
NM_198404chr131309 ------
NM_198463chr3194 ------
NM_198560chr363586 3447 2782 2610 1395 445 12632 23077 267 --
NM_198563chr31379 ------
NM_198597chr101152 --1867 --
NM_198679chr941929 1799 733 205 1989 12106 --
NM_198681chr11273 1543 21312 376 --
NM_198793chr321395 453 1503 --13998
NM_198794chr141993 ------
NM_198829chr7----11313 --
NM_198859chr355066 4163 3441 1776 1449 ------
NM_198896chr11--12014 ----
NM_198900chr1245712 2276 1041 484 1949 --11625
NM_198903chr5------1653
NM_198904chr51689 ----1653
NM_198968chr1311065 --13070 --
NM_198993chr1741702 1208 298 177 --1419 --
NM_199000chr7--12091 ----
NM_199188chr1233810 3580 2759 ------
NM_199190chr1233810 3580 2759 ------
NM_199229chr231724 1525 456 ------
NM_199320chr42963 44 --133 --
NM_199320chr42963 44 --133 --
NM_199324chr41493 ------
NM_199342chr11238 ------
NM_199454chr153240 3215 1339 1055 780 ------
NM_199478chrX11521 ------
NM_201280chr621336 623 ------
NM_201413chr211928 --1676 --
NM_201414chr211928 --1676 --
NM_201432chr1745412 4734 1500 49 1102 1937 22095 1819
NM_201433chr1745412 4734 1500 49 1102 1937 22095 1819
NM_201437chr81115 11061 ----
NM_201535chr14----1694 183
NM_201536chr14----1694 183
NM_201537chr14----1694 183
NM_201538chr14----1694 183
NM_201539chr14----1694 183
NM_201540chr14----1694 183
NM_201541chr14----1694 183
NM_201568chr131735 760 53 ------
NM_201569chr131735 760 53 ------
NM_201570chr101261 ------
NM_201571chr101261 ------
NM_201572chr101261 ------
NM_201590chr101261 ------
NM_201591chr411688 ------
NM_201592chr411688 ------
NM_201593chr101261 ------
NM_201596chr101261 ------
NM_201597chr101261 ------
NM_201599chrX3865 342 291 ------
NM_201627chr51294 --1273 --
NM_203305chr942494 1906 1016 910 12008 ----
NM_203327chr2013226 11199 ----
NM_203382chr541408 1083 1075 599 ------
NM_203394chr1222247 718 ------
NM_203403chr9--1312 ----
NM_203434chr91494 ------
NM_203458chr123545 1196 1168 ----
NM_203488chr14131 ------
NM_203506chr1731675 632 364 --11908 11580
NM_205768chr11720 ------
NM_205848chr121878 360 22354 2049 ----
NM_205858chr15--145 ----
NM_205861chr132140 1793 470 --1167 --
NM_206594chr123464 2384 --12786 --
NM_206595chr123464 2384 --12786 --
NM_206819chr12136 ------
NM_206820chr12136 ------
NM_206821chr12136 ------
NM_206852chr141606 ------
NM_206853chr633395 984 869 --12586 --
NM_206854chr624656 2130 --13847 --
NM_206855chr625621 206 --14812 --
NM_206857chr141606 ------
NM_206866chr2113019 1904 ----
NM_206876chr211101 ------
NM_206907chr51423 ------
NM_207012chr1012966 ------
NM_207113chr721142 77 1466 ----
NM_207171chr131710 1525 432 ------
NM_207291chr191441 ------
NM_207292chr311227 --13312 --
NM_207293chr311227 --13312 --
NM_207294chr311227 --13312 --
NM_207295chr311227 --13312 --
NM_207296chr311227 --13312 --
NM_207297chr311252 --13337 --
NM_207380chr1543026 1104 432 285 23405 1131 ----
NM_207660chr1421501 194 ------
NM_207661chr1421501 194 ------
NM_207662chr1421501 194 ------
NM_213589chr221970 287 11541 --23837 945
NM_213594chr12--1113 ----
NM_213606chr102967 453 --12671 --
NM_213651chr1------1156