TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3136-5p
miRNA Sequence: CUGACUGAAUAGGUAGGGUCAUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000168chr753318 1287 813 610 210 2629 346 22208 751 --
NM_000202chrX52603 2443 1171 249 181 11446 22899 1161 --
NM_000217chr1254764 3813 2154 1569 276 --23717 1061 11258
NM_000242chr1062644 2495 2433 2286 868 196 12187 12755 --
NM_000264chr973327 3036 2660 2152 953 720 330 ------
NM_000267chr1753148 2890 2807 2466 415 --22624 742 --
NM_000314chr1043072 2361 605 110 --12441 1976
NM_000408chr253269 2703 2547 2399 199 --1756 --
NM_000489chrX63282 3126 2431 2355 700 635 --1726 --
NM_000555chrX117132 5938 5572 5552 5029 2195 1393 1195 1172 920 198 12653 ----
NM_000618chr12106189 2468 2323 2215 1749 1490 1274 1057 480 286 --16622 12447
NM_000618chr12106189 2468 2323 2215 1749 1490 1274 1057 480 286 --16622 12447
NM_000793chr1455036 4908 3238 614 558 --24891 1886 13357
NM_000809chr468905 8110 3398 2637 1263 137 26327 811 36877 687 224 18081
NM_000813chr555112 4496 4269 4259 1480 34370 4097 208 1338 --
NM_000875chr1585613 5561 5450 5443 5334 4853 4491 399 11092 ----
NM_000899chr1244177 3319 2957 1192 --34183 3440 3431 --
NM_001001664chr233895 2865 1436 --11237 13037
NM_001002860chr1443447 1273 734 636 ----11409
NM_001003674chr18106884 4954 4833 4587 2436 2171 1470 1183 1165 87 11532 15872 --
NM_001003675chr18106884 4954 4833 4587 2436 2171 1470 1183 1165 87 11532 15872 --
NM_001003679chr131452 604 116 ----1652
NM_001004065chr953975 2866 2443 779 542 ------
NM_001004360chr21600 1680 11591 1490
NM_001004419chr1253496 3017 723 707 643 14145 ----
NM_001007023chr1455036 4908 3238 614 558 --24891 1886 13357
NM_001008239chr1853339 3064 2981 1447 343 13571 1455 1815
NM_001008925chr473220 2528 2358 1375 776 425 93 ------
NM_001009899chr386163 5744 5145 4473 4153 795 518 117 45924 2583 2326 829 1125 --
NM_001009909chr1143849 3607 2631 207 33916 1248 1106 13444 11093
NM_001009959chr251603 927 329 267 170 1795 1627 12013
NM_001009960chr722738 2445 11752 3453 298 110 1365
NM_001010853chr633216 2988 999 --12849 12388
NM_001010888chrX44647 4307 4172 727 14229 23926 1718 --
NM_001011666chr786150 5917 4141 2048 1710 309 253 105 11274 ----
NM_001012393chr1131981 1956 828 13331 11214 13676
NM_001014380chr1365199 4258 3860 1820 1765 1409 25653 2048 --15155
NM_001017368chr1722210 2088 22439 1893 --12588
NM_001017440chr7127769 7195 7052 6314 5971 5243 2881 1390 1088 659 445 378 18049 26914 282 --
NM_001024956chr1165597 5097 4377 1728 1328 1132 194 13923 14270
NM_001025076chr1095713 5211 4783 4627 3985 2063 1719 693 399 24068 3870 ----
NM_001025077chr1087071 6569 6141 5985 5343 5071 2051 1757 25426 5228 25107 1115 --
NM_001025356chr1232073 574 144 ----1553
NM_001029863chr623202 1040 1719 2620 154 1110
NM_001030055chr1464374 4123 3906 3605 1774 445 23948 471 14254 --
NM_001031732chr463635 3492 2909 2694 1073 548 13323 12671 --
NM_001031804chr1654414 4380 3797 854 454 11512 13257 --
NM_001033025chr161412 1159 1054 545 381 194 1613 21473 466 --
NM_001034841chr1655228 4047 3562 1908 750 25443 84 11275 --
NM_001035260chr1021176 208 ----11331
NM_001037132chr731452 579 511 ----1158
NM_001037133chr731452 579 511 ----1158
NM_001039199chr2055033 4899 4149 1679 88 24577 1882 11898 --
NM_001039590chrX43716 3419 1289 815 --21611 1125 --
NM_001039591chrX43716 3419 1289 815 --21611 1125 --
NM_001039618chr1164915 4846 4301 4075 359 269 22285 717 ----
NM_001040202chr42731 30 --12148 1382
NM_001040402chr412805 22193 2148 --1942
NM_001040441chr184950 4390 3796 3525 3491 1997 1338 490 1443 ----
NM_001040712chr953566 2789 969 779 748 --31200 980 976 --
NM_001042453chrX1330 11084 --21500 1349
NM_001042492chr1753148 2890 2807 2466 415 --22624 742 --
NM_001042555chr1263660 3621 1018 849 717 546 --11647 --
NM_001042599chr286953 5388 5310 4820 3057 2948 2142 1329 ----13088
NM_001042604chr373737 3266 2971 1807 1547 986 980 34338 3763 3248 33370 818 366 --
NM_001042683chr631217 570 396 1663 --11374
NM_001046chr522755 1077 ----1187
NM_001083621chr194202 4171 3477 3036 1786 1064 645 528 393 --13082 --
NM_001099678chr376051 5696 5266 5093 4551 2124 1894 ------
NM_001100108chr178217 7170 5933 5290 2996 1523 1334 15347 1619 --
NM_001106chr3149728 8862 8539 8231 8130 7904 7688 7357 6346 3605 2263 1699 1264 195 26524 2764 28081 1895 --
NM_001173chr1464374 4123 3906 3605 1774 445 23948 471 14254 --
NM_001186chr2152554 2018 1218 1201 723 13284 22937 2872 --
NM_001201chr463364 3351 2781 1244 633 129 13659 52785 1467 1111 1061 689 13853
NM_001204chr2107181 6221 5376 5296 3107 2054 2026 627 339 221 15450 27482 5162 --
NM_001259chr786058 5910 5338 5299 1777 1761 1675 730 26123 5446 --15312
NM_001304chr1743684 2626 2475 405 --11495 11176
NM_001419chr1984814 4716 4389 3216 1364 1032 964 525 ------
NM_001439chr161412 1159 1054 545 381 194 1613 21473 466 --
NM_001527chr654812 3945 3607 1511 557 --23751 3228 11136
NM_001621chr722825 2613 1207 12605 12357
NM_001621chr722825 2613 1207 12605 12357
NM_001650chr1843988 3756 442 132 1375 1547 --
NM_001701chr91561 --1532 11189
NM_001709chr1142497 2177 912 191 ----186
NM_001969chr1443645 3566 1396 275 13401 12706 13650
NM_002006chr4104990 4904 4682 3615 1260 615 532 402 351 100 --15119 1905
NM_002025chrX48865 7173 3504 2548 16093 1204 17405
NM_002040chr2163147 2711 2697 2341 1106 261 --1940 --
NM_002092chr474821 4385 4176 3811 1090 875 775 24774 1330 ----
NM_002126chr1761145 1076 1062 561 468 435 23622 2814 ----
NM_002158chr233699 3678 1372 11470 22777 2345 13006
NM_002210chr232347 1201 842 --21431 317 12551
NM_002211chr1051080 407 399 62 56 1932 ----
NM_002214chr735663 1940 103 --14908 14968
NM_002223chr1243721 2708 999 344 --11374 12587
NM_002270chr564099 3893 2202 297 247 46 --13754 --
NM_002336chr1233885 3802 3479 1118 14280 34563 1751 459
NM_002545chr1131981 1956 828 13331 11214 13676
NM_002577chr343844 3551 2757 657 ----13610
NM_002645chr1152461 2067 308 181 38 12277 ----
NM_002655chr853265 1752 1554 907 831 --24503 3393 1189
NM_002656chr6----2938 66 1742
NM_002657chr2082630 1524 1078 838 687 590 430 26 13673 1556 --
NM_002737chr1776609 6279 4598 4390 2123 608 140 25284 5039 ----
NM_002839chr953566 2789 969 779 748 --31200 980 976 --
NM_002906chr1162254 2082 1524 953 673 326 22277 1651 12110 --
NM_002948chr33909 809 51 ----11197
NM_002977chr252565 1000 334 252 124 --1951 --
NM_003034chr1257537 7521 7327 2112 907 --13227 15710
NM_003108chr276213 5561 5303 4925 4721 939 463 --15258 --
NM_003161chr1711107 12254 --13115
NM_003199chr1844365 3574 1997 1862 15071 --15008
NM_003234chr352329 2128 973 785 310 1503 ----
NM_003236chr243436 3248 3058 1108 ----12961
NM_003247chr661586 1544 1449 1324 616 62 --11351 --
NM_003262chr394195 4083 3727 1965 1329 896 257 147 138 1282 11280 --
NM_003342chr1783165 2830 2385 971 861 769 417 157 ------
NM_003392chr364191 3761 3484 3318 3307 2882 ------
NM_003409chr182180 77 ----11380
NM_003410chrX73043 2725 2176 1945 464 191 71 12232 --12816
NM_003411chrY1180 21401 1277 21755 262 --
NM_003566chr1231324 817 527 --12353 12358
NM_003677chr1211916 11438 --1385
NM_003885chr1752629 2354 1862 803 66 12383 ----
NM_003887chr262316 2181 1714 935 464 30 ------
NM_003909chr862831 2595 2330 1993 1069 625 1196 11011 --
NM_003983chr1684368 4070 3952 3008 2878 2870 1627 514 13888 13374 13013
NM_003994chr1244177 3319 2957 1192 --34183 3440 3431 --
NM_004028chr1843988 3756 442 132 1375 1547 --
NM_004094chr1432452 1033 499 21182 452 12360 --
NM_004124chr1443512 3434 2809 646 22635 990 21329 570 --
NM_004171chr11148544 7880 7189 6286 6187 5995 3540 3430 3424 3025 1621 1175 1134 260 37557 3757 787 27884 962 --
NM_004232chr182135 111 22640 2547 13536 1923
NM_004338chr18106884 4954 4833 4587 2436 2171 1470 1183 1165 87 11532 15872 --
NM_004370chr66864 779 699 665 288 204 11675 ----
NM_004586chrX63694 3445 1361 1263 812 241 --11811 --
NM_004685chr1321001 204 ----22746 2516
NM_004726chrX95381 4749 4358 2295 2242 1505 730 471 290 --14538 --
NM_004734chr1323020 711 12546 13207 1393
NM_004736chr131621 735 432 --11433 11695
NM_004745chr855004 4860 2612 1060 809 26644 2288 12715 --
NM_004748chr1513403 --33602 687 454 23093 213
NM_004815chr194604 4507 4260 3513 3437 1487 1300 640 274 --23151 692 1550
NM_004834chr221293 583 --23019 694 1854
NM_004859chr1782891 2308 2240 2178 1935 858 67 24 12551 ----
NM_004866chr544509 3537 838 53 11188 1484 --
NM_004896chr1021091 123 ----11246
NM_004904chr786150 5917 4141 2048 1710 309 253 105 11274 ----
NM_004956chr7--43640 3137 1179 388 14384 1793
NM_004985chr1263973 3831 1066 961 405 376 --1569 11095
NM_004992chrX98277 6118 2913 2745 1965 1649 1059 939 207 16861 23119 2219 12772
NM_004992chrX98277 6118 2913 2745 1965 1649 1059 939 207 16861 23119 2219 12772
NM_005010chr731452 579 511 ----1158
NM_005121chr1751383 1161 1043 307 268 --1897 23214 2927
NM_005156chr985309 4966 4618 4397 3316 2149 1421 1367 1184 24231 3602 --
NM_005188chr11128291 7874 7282 6587 5953 5468 2406 2077 1746 1134 956 231 23322 1469 21589 1548 --
NM_005233chr322526 2429 ----11806
NM_005235chr286953 5388 5310 4820 3057 2948 2142 1329 ----13088
NM_005339chr453786 3437 2691 1178 947 23315 27 ----
NM_005385chr332757 2047 1745 ----12703
NM_005388chr941608 1588 1285 440 1272 --11486
NM_005493chr61580 145 --1744
NM_005596chr956165 5988 5717 1670 1001 26395 5151 15992 --
NM_005668chr513705 12944 34175 1589 476 12960
NM_005739chr1541913 1541 545 517 --22047 183 11973
NM_005748chr1223365 2214 1214 23258 27 1988
NM_005813chr231808 962 390 12159 1909 1951
NM_005840chrX46225 5763 5489 208 13080 12481 27279 7069
NM_005843chr251679 1503 771 183 50 11901 2755 239 --
NM_005845chr1351651 1533 1496 1198 494 1241 ----
NM_005909chr5104299 4178 4119 3288 2790 837 696 578 546 165 --23600 2684 11159
NM_005941chr893849 3751 3461 1392 1104 1058 969 242 217 --23205 2729 --
NM_005966chr231813 537 488 11927 1615 --
NM_006036chr252485 2009 590 300 149 ------
NM_006095chr463353 3202 1282 1224 568 336 --13045 --
NM_006141chr1682745 2708 1841 1730 812 783 361 96 ------
NM_006186chr231225 303 291 ----11102
NM_006203chr574055 2198 1249 1091 1033 143 84 --11027 --
NM_006241chr342363 2203 233 113 12140 12430 --
NM_006242chr2032072 873 751 --2865 639 --
NM_006252chr187377 6538 6249 6052 5221 2382 2051 998 --145 --
NM_006275chr2042167 878 619 55 1645 12197 1715
NM_006283chr894601 4174 3934 3253 1890 1804 1306 929 792 1568 ----
NM_006371chr344328 2096 1826 765 13502 12034 14446
NM_006375chrX61755 1687 1474 1416 767 114 ------
NM_006380chr1724016 1267 34150 3905 1003 1185 1908
NM_006544chr1475187 5132 4190 1474 963 437 32 14613 ----
NM_006559chr111239 --2859 29 11021
NM_006561chr1095713 5211 4783 4627 3985 2063 1719 693 399 24068 3870 ----
NM_006599chr1678144 6541 5602 2656 2373 2235 514 28280 7207 1333 36563 5508 409
NM_006628chr1553283 1292 1105 630 93 14623 ----
NM_006654chr1263660 3621 1018 849 717 546 --11647 --
NM_006667chrX31115 942 894 2986 902 1371 11191
NM_006717chr942894 2741 1196 272 1727 1562 --
NM_006718chr6----2938 66 1742
NM_006729chrX43886 1904 623 198 13710 1702 1327
NM_006750chr1688127 7362 6075 3227 2800 2750 1740 957 16292 1889 --
NM_006775chr632103 2023 378 --31244 537 477 21185 71
NM_006885chr1623196 564 ----12713
NM_006918chr1165597 5097 4377 1728 1328 1132 194 13923 14270
NM_007038chr2134477 682 58 14612 15541 1612
NM_007054chr553885 3586 3006 1029 160 1883 1779 --
NM_007106chr1311825 1252 1783 12077
NM_007137chrX83919 3761 1727 1473 1381 1093 447 251 ------
NM_007203chr953975 2866 2443 779 542 ------
NM_007249chr13128702 7606 6955 6721 5886 3705 3333 3029 2388 2270 1285 1221 --28534 2873 17522
NM_007373chr1031244 1188 486 1651 --21804 543
NM_012095chr1041337 1098 990 984 1914 12867 11262
NM_012096chr332560 1380 655 1538 --13454
NM_012158chr1331714 254 206 11656 2397 120 --
NM_012193chr1185169 4648 4243 3858 1210 614 220 96 14302 ----
NM_012234chr3103550 3123 3031 2976 2455 1159 631 577 461 443 ------
NM_012287chr374316 3711 2895 1696 1180 659 251 ----1373
NM_012290chr221164 1105 31607 1485 475 ----
NM_012327chr1861498 1387 1292 1245 469 317 ----1590
NM_012330chr10----31172 1168 418 1641
NM_012420chr1021859 494 11829 --11890
NM_013255chr767458 6133 6075 6066 1999 1334 31705 1592 236 16629 --
NM_013269chr1253423 2944 650 634 570 14072 ----
NM_013374chr372711 2587 2434 2360 2325 2044 545 ------
NM_013943chr12515 112 13114 --12281
NM_013989chr1455036 4908 3238 614 558 --24891 1886 13357
NM_014016chr33414 387 198 --11410 11193
NM_014028chr623093 504 13108 23304 383 --
NM_014048chr1653348 1889 1322 1248 65 ----14040
NM_014155chr1177469 6937 6756 5017 4862 1068 293 21640 921 25808 4941 12005
NM_014157chr1683730 3687 3619 3009 567 427 415 67 23595 1590 13641 --
NM_014319chr1251577 1372 1312 398 204 ----1220
NM_014331chr456834 5756 4732 745 210 25301 4901 21831 120 --
NM_014423chr574949 4611 4481 3422 1611 579 167 --11685 --
NM_014445chr341983 1566 377 321 22460 1560 32288 759 715 21670 270
NM_014585chr231084 367 223 --2321 307 --
NM_014616chr333088 2571 288 12987 --11102
NM_014636chr974278 4080 3555 2741 1555 1123 187 --22770 1229 --
NM_014701chr1531273 683 344 --21277 530 12873
NM_014730chr12104166 3629 1889 1790 1516 1382 1345 763 643 200 11608 --12079
NM_014730chr12104166 3629 1889 1790 1516 1382 1345 763 643 200 11608 --12079
NM_014765chr121727 326 ----134
NM_014776chr1232878 1041 825 ----1388
NM_014820chr31456 11716 --1444
NM_014827chr141363 475 333 97 ----11635
NM_014829chr532234 2199 1716 ----1181
NM_014870chr194202 4171 3477 3036 1786 1064 645 528 393 --13082 --
NM_014872chr982092 2084 1758 1731 1578 1495 554 244 167 ----
NM_014873chr184584 4532 4164 3017 1845 997 632 325 ------
NM_014877chr1767424 7106 5693 2376 2235 2166 12470 27326 4774 --
NM_014903chr1211865 1923 11709 1737
NM_014920chr653309 2790 1196 1071 951 3977 844 297 13633 --
NM_014934chr1363401 3385 3043 2991 2439 483 --12983 13236
NM_014946chr233042 747 226 ----12132
NM_014951chr1042571 1694 614 587 11609 1577 --
NM_015020chr1643561 3440 769 581 13624 43662 3658 2464 141 --
NM_015026chr1243378 1920 677 376 23391 1156 1364 --
NM_015090chr1115456 5299 5263 5102 4347 3888 2219 1871 1671 1495 632 --25771 5698 --
NM_015110chr962264 1616 488 250 203 102 ------
NM_015115chr412805 22193 2148 --1942
NM_015208chr1843587 3568 3223 452 31205 1170 589 2892 724 --
NM_015263chr15153 1866 --136
NM_015271chr434237 3065 1582 --31736 1359 824 11512
NM_015278chr673483 3021 2882 2734 1340 988 618 --12948 1997
NM_015282chr272675 2167 2023 1132 1024 960 90 ----2979 364
NM_015310chr8147806 7520 6996 6219 5181 2568 1321 1304 1259 1191 1114 808 458 308 1738 ----
NM_015336chr1222005 352 12040 --12141
NM_015436chr463039 2347 2177 1194 595 244 ------
NM_015446chr13412 268 170 --11274 1653
NM_015458chr874277 3336 3261 2032 1599 237 73 1350 13274 --
NM_015571chr612337 12250 --12460
NM_015578chr192172 68 --12029 1547
NM_015906chr153082 1496 894 787 407 13654 ----
NM_015975chrX21483 322 1199 --1132
NM_016009chr174414 3987 3883 3806 1702 742 425 ------
NM_016021chr631140 994 176 ----21913 561
NM_016040chr152445 919 610 411 385 2855 67 ----
NM_016073chr151310 --1951 1360
NM_016083chr642905 1198 863 145 --23808 1449 --
NM_016206chr337114 2224 1466 1638 17091 18270
NM_016260chr246863 6007 4694 977 25527 825 --12292
NM_016271chr184861 808 688 420 --21697 115 11561
NM_016322chr942886 2542 2175 1152 ----12308
NM_016396chr1542824 2285 660 313 21136 565 11041 --
NM_016424chr1711455 --11656 1692
NM_016507chr1763177 3050 2891 2253 2063 1983 --12552 --
NM_016513chr653309 2790 1196 1071 951 3977 844 297 13633 --
NM_016530chr1542715 1287 1281 1210 11646 12803 --
NM_016531chr453882 2791 824 511 323 --12607 --
NM_016542chrX1330 11084 --21500 1349
NM_016953chr274692 4302 4192 4089 3883 305 57 ------
NM_017412chr831165 1104 570 193 --2381 108
NM_017420chr1443434 2642 1327 648 1159 ----
NM_017447chr2144121 3087 2720 1481 22954 2941 ----
NM_017563chr375522 5264 5067 1724 1039 576 261 1973 14363 --
NM_017629chr131486 437 382 --11802 11423
NM_017635chr112624 495 160 --11243
NM_017637chr9157153 5907 5836 3678 3142 2973 2898 2829 2788 1969 1777 1399 1359 606 67 --59482 7175 6221 3399 1033 --
NM_017643chr1772786 2122 835 743 447 158 121 ------
NM_017650chr745224 1815 1072 518 --24883 1027 11090
NM_017658chr1473755 3113 1522 1461 1240 771 550 ------
NM_017741chr421823 446 --164 21828 95
NM_017754chr644870 4591 4233 1580 15014 33158 706 396 --
NM_017769chr1433106 1289 1041 1197 22856 653 --
NM_017787chr1032725 2461 422 --12782 12412
NM_017811chr953033 2701 2643 2354 154 ----12753
NM_017902chr1095638 5290 4730 4065 2307 1945 1357 518 309 33545 1854 546 11687 --
NM_018000chr222087 1743 153 1536 1354
NM_018027chr1063005 2647 2313 949 685 572 12572 --12621
NM_018036chr1421673 814 --14053 11684
NM_018121chr1063218 2989 2118 2058 323 272 23084 295 ----
NM_018128chr1751010 981 186 105 37 ----1159
NM_018178chr142001 1793 1315 1309 ----11693
NM_018254chr12206 166 21791 354 --11929
NM_018263chr242584 2549 538 107 12537 22205 847 --
NM_018351chr1234201 4134 4010 13226 --13216
NM_018374chr774240 1943 1671 1460 995 874 316 1131 15202 --
NM_018429chr562893 1950 1066 967 724 465 ------
NM_018440chr878725 8216 7646 5546 3121 725 158 36933 6794 755 28414 107 13037
NM_018452chr6_random53672 1463 1056 753 475 1203 11095 13080
NM_018489chr132185 821 53 --12079 11807
NM_018638chr12155570 5089 4084 3916 3850 3677 1381 1354 1190 1102 986 870 781 494 249 --23670 1404 --
NM_019001chr373737 3266 2971 1807 1547 986 980 34338 3763 3248 33370 818 366 --
NM_019116chr1673694 3413 2423 1089 702 602 214 11509 --13777
NM_020122chr265702 5172 4466 3854 1764 1219 --35355 4137 644 14564
NM_020336chr2032471 656 491 --12883 33864 1365 316
NM_020390chr364912 1957 1445 779 610 247 13433 23812 515 --
NM_020466chr644181 1037 889 742 13914 --13129
NM_020666chr51732 1114 --165
NM_020711chr251603 927 329 267 170 1795 1627 12013
NM_020718chr1686347 6227 6073 6000 5169 2436 1132 801 22243 875 ----
NM_020727chr2153783 3749 3309 722 259 ----23760 649
NM_020739chr1513403 --33602 687 454 23093 213
NM_020772chr1788437 8344 8236 7653 6668 1956 1830 1704 38403 8109 8089 ----
NM_020774chr1844058 2352 1482 42 15721 34723 1716 357 11011
NM_020782chr1294873 4643 4457 4001 3864 1570 1499 651 593 --11349 11293
NM_020868chr21600 1680 11591 1490
NM_020871chrX3752 555 245 --22219 1940 11952
NM_020935chr234212 1283 458 14239 --13176
NM_021629chr361666 1591 1576 1377 758 609 ------
NM_021911chr555112 4496 4269 4259 1480 34370 4097 208 1338 --
NM_021961chr1177376 5386 4850 2596 1275 1082 901 17331 24676 1800 16085
NM_021964chr396466 6102 5727 5514 4521 2435 733 699 387 --1170 1914
NM_022048chr1576151 5788 5277 5209 4608 2302 1891 ------
NM_022162chr162989 28 --1782 1794
NM_022459chr1375866 5758 5153 4752 4609 2543 90 11588 11763 --
NM_022497chr363604 3363 3173 2558 640 469 --13679 --
NM_022726chr651602 1278 525 337 323 ------
NM_022781chr92178 168 --1893 13145
NM_022832chr442076 1986 912 189 1875 --12117
NM_023929chr81913 --2239 235 12390
NM_024422chr1821624 1218 1395 --11378
NM_024548chr351600 1560 1300 641 55 ----1626
NM_024638chr332339 1838 852 12043 --1273
NM_024665chr354498 3932 1601 644 527 14422 ----
NM_024740chr1152550 1120 1078 1067 717 31565 997 144 ----
NM_024817chr15115544 5321 5288 5025 4948 4142 3973 2055 894 747 198 21502 872 1123 --
NM_024947chr3109605 7976 7079 6234 6188 6059 5923 3168 681 637 23031 2046 11641 13564
NM_024989chr2118129 7346 6755 6388 6175 5947 5933 1577 1544 1497 790 ----15034
NM_025160chr183432 3199 2975 1232 1162 979 422 45 ------
NM_030627chr531460 1329 419 11186 --13863
NM_030648chr464552 4439 2077 1584 1461 956 --31040 348 338 --
NM_030650chr233717 2743 850 2626 563 155 --
NM_030786chr111242 --11246 1699
NM_030817chr121212 13729 13155 13146
NM_030925chr1331308 553 27 --31648 464 31 1194
NM_031427chr1485778 4722 3949 1201 676 339 303 247 --34691 693 254 --
NM_031461chr831742 274 250 1263 ----
NM_031468chr7127769 7195 7052 6314 5971 5243 2881 1390 1088 659 445 378 18049 26914 282 --
NM_031483chr2041244 661 495 202 --11018 13155
NM_032116chr1365199 4258 3860 1820 1765 1409 25653 2048 --15155
NM_032189chr1355081 4854 4459 695 562 14065 --11842
NM_032208chr252389 877 697 213 68 23292 2523 23590 2372 --
NM_032228chr1122367 615 ----13508
NM_032321chr272878 2803 1239 892 799 777 195 --22757 209 --
NM_032373chr1065661 5447 5245 2272 1250 149 25212 72 1261 --
NM_032435chr141921 1824 948 746 ----12087
NM_032440chr1031156 906 837 --12752 1707
NM_032632chr1461806 1767 1643 539 464 434 ------
NM_032682chr362802 2781 2771 2720 2414 2294 ------
NM_032859chr1333546 863 239 11234 13332 --
NM_032968chrX43364 3272 2619 498 21246 47 --1152
NM_032969chrX43364 3272 2619 498 21246 47 --1152
NM_032973chrY43359 3267 2618 498 21246 47 --1152
NM_033020chr153082 1496 894 787 407 13654 ----
NM_033181chr642905 1198 863 145 --23808 1449 --
NM_033224chr7107905 5806 5572 5559 5149 3214 3146 3093 3002 1163 31434 193 142 12702 --
NM_033360chr1264094 3952 1187 1082 526 497 --1690 11216
NM_033656chr2175560 4791 4648 4396 2154 731 344 15195 ----
NM_052832chr832940 1982 1901 1907 ----
NM_052885chr1251695 1552 1538 871 450 14325 1808 --
NM_053016chr9107489 7062 6898 6699 6537 6045 2277 1745 511 382 ------
NM_057169chr1232878 1041 825 ----1388
NM_057170chr1232878 1041 825 ----1388
NM_057178chr1722210 2088 22439 1893 --12588
NM_080645chr66864 779 699 665 288 204 11675 ----
NM_080867chr1454397 4127 3476 1703 1138 --24965 3191 13288
NM_130385chr11103147 2993 2634 2203 2126 1208 1127 1071 1015 803 1966 ----
NM_130391chr953566 2789 969 779 748 --31200 980 976 --
NM_130392chr953566 2789 969 779 748 --31200 980 976 --
NM_130393chr953566 2789 969 779 748 --31200 980 976 --
NM_130809chr573120 2605 2273 1036 489 425 199 ------
NM_133334chr485865 5510 5364 5230 4749 2079 1401 686 1860 ----
NM_133370chr463635 3492 2909 2694 1073 548 13323 12671 --
NM_133646chr253613 3506 1986 1744 68 14627 25463 609 --
NM_138270chrX63282 3126 2431 2355 700 635 --1726 --
NM_138494chr722738 2445 11752 3453 298 110 1365
NM_138713chr1678144 6541 5602 2656 2373 2235 514 28280 7207 1333 36563 5508 409
NM_138714chr1678144 6541 5602 2656 2373 2235 514 28280 7207 1333 36563 5508 409
NM_144571chr456469 5388 1642 1152 522 26682 909 ----
NM_144578chr1444735 1968 1854 1191 --23628 624 23812 1905
NM_144590chr1022909 419 --1244 1180
NM_144599chr1565444 4583 4091 3481 801 786 11152 ----
NM_145055chr1853339 3064 2981 1447 343 13571 1455 1815
NM_145165chr1432355 2195 242 --12541 11127
NM_145686chr221293 583 --23019 694 1854
NM_145687chr221293 583 --23019 694 1854
NM_147150chr953975 2866 2443 779 542 ------
NM_152624chr597291 6607 5551 5104 5096 5041 794 687 181 14530 14602 --
NM_152699chr363536 3302 3236 1300 1032 191 --13199 --
NM_152756chr553330 3229 1414 1402 130 --1248 --
NM_152835chr132556 790 764 11911 22212 756 --
NM_153184chr321598 381 11505 --11925
NM_153188chr564099 3893 2202 297 247 46 --13754 --
NM_153262chr162112 1106 1076 570 308 23 --1506 --
NM_153619chr1553257 3095 439 250 134 ----12898
NM_153810chr1053601 1425 1174 975 576 13748 13909 --
NM_170731chr1142497 2177 912 191 ----186
NM_170732chr1142497 2177 912 191 ----186
NM_170733chr1142497 2177 912 191 ----186
NM_170734chr1142497 2177 912 191 ----186
NM_170735chr1142497 2177 912 191 ----186
NM_172071chr1116437 6415 6200 4707 4547 2572 2550 1485 1333 102 42 11629 ----
NM_173082chr62307 133 1400 --11111
NM_173171chr231225 303 291 ----11102
NM_173172chr231533 611 599 ----11410
NM_173173chr231225 303 291 ----11102
NM_173214chr1678144 6541 5602 2656 2373 2235 514 28280 7207 1333 36563 5508 409
NM_173582chr1155766 5692 5533 5008 423 16116 14195 1771
NM_173602chr1253611 3368 3222 2662 861 ----22925 463
NM_173648chr241095 989 913 864 --1871 --
NM_173797chr52504 448 --1457 1491
NM_173808chr153699 1773 1165 816 396 14325 1307 --
NM_175056chr372132 2084 2049 698 295 90 63 ------
NM_175767chr531389 1249 416 175 --11449
NM_175876chr132726 893 579 ----1762
NM_176787chr1861498 1387 1292 1245 469 317 ----1590
NM_178011chr1043087 2703 460 404 1908 11056 --
NM_178140chr551945 1932 1858 881 27 --32451 917 913 --
NM_178151chrX117132 5938 5572 5552 5029 2195 1393 1195 1172 920 198 12653 ----
NM_178152chrX117132 5938 5572 5552 5029 2195 1393 1195 1172 920 198 12653 ----
NM_178153chrX117132 5938 5572 5552 5029 2195 1393 1195 1172 920 198 12653 ----
NM_180989chr131404 1534 1899 1365
NM_181481chr18106884 4954 4833 4587 2436 2171 1470 1183 1165 87 11532 15872 --
NM_181482chr18106884 4954 4833 4587 2436 2171 1470 1183 1165 87 11532 15872 --
NM_181483chr18106884 4954 4833 4587 2436 2171 1470 1183 1165 87 11532 15872 --
NM_181521chr1646184 2576 383 95 --45230 5031 759 387 152
NM_181705chr574682 3624 1353 1171 618 585 411 --14259 --
NM_181780chr341377 484 452 369 1682 1806 --
NM_181782chr622180 419 ----1839
NM_182314chrX61755 1687 1474 1416 767 114 ------
NM_182488chr132768 277 --1941 1833
NM_182620chr171264 --32021 1971 381 22300 1424
NM_182663chr122088 811 --1718 11433
NM_182664chr122218 941 --1848 11563
NM_182665chr122088 811 --1718 11433
NM_182762chr744795 4563 538 503 14701 --11320
NM_182765chr1022374 738 --42378 2266 2262 870 --
NM_182898chr786150 5917 4141 2048 1710 309 253 105 11274 ----
NM_182899chr786150 5917 4141 2048 1710 309 253 105 11274 ----
NM_183004chr1443645 3566 1396 275 13401 12706 13650
NM_194071chr765246 4701 3979 3869 1694 1229 --13960 1375
NM_194286chr1265474 5254 5221 4214 2382 1927 --14959 14058
NM_194291chr812423 1238 1506 1426
NM_194314chr185586 5413 4319 1856 1848 1411 1185 336 23772 1653 ----
NM_194328chr92178 168 --1893 13145
NM_194329chr92178 168 --1893 13145
NM_194330chr92178 168 --1893 13145
NM_194332chr92178 168 --1893 13145
NM_198128chr184861 808 688 420 --21697 115 11561
NM_198465chrX52878 2761 2306 2002 89 1594 --1456
NM_198468chr664095 3513 3388 3153 1675 1075 24053 3617 ----
NM_198581chr277329 7251 7040 6139 5791 1343 48 1971 ----
NM_198715chr146168 3981 2374 1677 26152 481 13828 --
NM_198859chr334093 264 168 24435 3306 --11531
NM_198968chr1363401 3385 3043 2991 2439 483 --12983 13236
NM_198990chr762450 2419 1152 1136 658 176 ----13305
NM_199421chr1454397 4127 3476 1703 1138 --24965 3191 13288
NM_199436chr233042 747 226 ----12132
NM_206853chr643351 165 100 60 --23469 1123 11086
NM_206854chr654612 3741 1426 1361 1321 152 14730 --
NM_206855chr6115577 4706 2391 2326 2286 942 737 714 477 197 58 11017 15695 --
NM_206866chr2152554 2018 1218 1201 723 13284 22937 2872 --
NM_206909chr8147806 7520 6996 6219 5181 2568 1321 1304 1259 1191 1114 808 458 308 1738 ----
NM_207012chr1041337 1098 990 984 1914 12867 11262
NM_207303chr1052588 1152 738 554 209 12536 --13378
NM_207406chr465363 5202 4825 4568 725 666 --14535 1684
NM_213589chr295539 5493 5081 4255 2180 2102 1628 952 908 13769 ----