TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3140-3p
miRNA Sequence: AGCUUUUGGGAAUUCAGGUAGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX156892 5236 4600 4526 4480 4461 2621 1289 1214 973 476 470 386 337 279 36870 4844 300 14619 --
NM_000092chr2103610 3433 1496 1449 1396 1346 803 601 305 33 41505 756 451 289 ----
NM_000104chr282864 2715 2576 2362 2356 1975 881 811 32096 997 425 ----
NM_000109chrX82063 1709 1688 1681 1674 944 429 290 ------
NM_000112chr595488 4740 4437 3787 3522 716 588 453 343 55277 4789 1297 1224 1096 --11237
NM_000115chr13102619 2437 2387 2295 2284 1073 812 801 625 213 42055 1747 587 228 ----
NM_000125chr684095 2740 1530 1064 823 680 458 199 33509 3480 1254 ----
NM_000151chr1731750 1198 430 ----21180 527
NM_000163chr542025 1900 864 342 1875 22116 23 --
NM_000167chrX61739 1519 1161 583 462 404 ----11708
NM_000176chr5193761 3711 3634 3498 3339 3328 3073 2994 2665 2446 1357 1213 1033 976 923 896 771 714 461 32864 2759 2505 --1179
NM_000208chr1994705 4456 4212 3694 3500 812 418 382 63 63870 3651 3410 3276 1168 317 24683 411 --
NM_000210chr282362 2123 2099 1509 261 206 175 98 1120 ----
NM_000214chr2031661 1361 204 11492 1656 1576
NM_000217chr12104631 4167 4033 3977 3410 1215 838 687 47 27 24542 1184 31726 993 182 14955
NM_000224chr12149 ------
NM_000237chr861619 1325 1172 258 239 182 --1108 --
NM_000248chr372858 2815 2526 2304 1092 566 277 22809 2708 12179 --
NM_000252chrX61466 1446 1163 350 194 40 2243 77 --1490
NM_000286chr172605 144 1732 --134
NM_000314chr1072718 2646 2335 2088 380 306 237 22824 692 13027 --
NM_000321chr133703 632 237 --11236 --
NM_000330chrX31793 1401 424 --2590 257 12224
NM_000332chr6116856 6558 6351 5348 5151 5081 2030 1732 918 595 344 45246 1289 706 632 1956 1305
NM_000333chr32971 357 --1374 1740
NM_000337chr5216573 5916 5208 5148 5093 4755 4542 4536 2394 2310 2042 1959 1753 1566 1518 958 896 862 233 93 39 115545 5331 4344 4046 2468 2304 1820 1437 1159 1064 940 --15068
NM_000340chr31218 31446 1432 156 11333 --
NM_000346chr1741877 1230 751 411 41804 1318 794 167 ----
NM_000351chrX153585 3495 3099 3022 2948 2674 1745 1582 1360 1267 898 739 708 676 323 23334 452 ----
NM_000362chr2253477 3454 2728 611 455 --1786 23278 482
NM_000368chr9114796 4679 4488 4177 1924 1782 1331 1084 988 699 499 54711 3597 3551 3249 849 33560 1213 644 --
NM_000393chr241661 1483 691 332 ----11737
NM_000408chr273304 2925 2362 938 660 614 358 12112 33347 2467 1230 --
NM_000411chr21123294 3267 3209 2976 2940 2615 1279 1161 1113 968 534 225 43098 3021 2437 2185 ----
NM_000437chr121558 387 22032 1667 1684 1740
NM_000439chr582478 2131 2115 1975 1835 949 326 275 52453 2427 2350 1928 334 22378 569 --
NM_000448chr1182931 2722 2602 2478 1139 504 234 112 32637 2200 208 23109 790 --
NM_000461chr374660 4186 3988 1604 1535 630 349 13086 --24037 494
NM_000555chrX147793 7536 7327 6757 6535 6416 5775 5402 5363 2885 2081 2028 1884 288 47107 2241 1563 1073 14773 17524
NM_000597chr21329 ------
NM_000599chr2134540 4518 4467 4430 3747 3693 3181 2883 1815 1654 1035 938 202 2683 531 ----
NM_000600chr7--1106 ----
NM_000610chr11123054 3040 2596 2587 2500 1166 1138 1008 916 764 648 534 53019 2991 2775 2459 1992 12661 --
NM_000612chr1143864 3368 2706 753 2855 443 23359 380 12486
NM_000615chr1153047 2452 1190 315 38 12492 ----
NM_000618chr12176233 6200 4834 4761 4716 4665 4618 4048 2538 2041 1955 1890 1537 1322 1070 755 117 96410 5882 4265 4246 2240 1997 1147 962 561 35023 1089 302 23994 540
NM_000618chr12176233 6200 4834 4761 4716 4665 4618 4048 2538 2041 1955 1890 1537 1322 1070 755 117 96410 5882 4265 4246 2240 1997 1147 962 561 35023 1089 302 23994 540
NM_000633chr18145205 5008 4846 4689 4660 4001 3782 3223 1884 1624 1536 1271 213 35 41427 1127 747 408 11799 11931
NM_000663chr1652340 2311 1114 867 29 31955 840 90 32630 2113 329 --
NM_000702chr161803 1466 779 631 488 378 22117 2034 41983 1843 791 511 21883 357
NM_000719chr1286578 5811 5423 4388 1822 938 326 66 35727 5018 1324 ----
NM_000721chr182432 1938 792 643 591 580 375 325 22584 827 ----
NM_000791chr592600 2533 2524 2511 2427 2404 2104 799 689 52718 2296 611 537 51 1371 12213
NM_000793chr14115153 4874 4592 4554 3571 1708 1610 840 329 220 37 24368 49 13940 14308
NM_000794chr52970 954 21010 869 141 --
NM_000806chr581792 1610 1527 1430 581 412 237 145 2294 222 ----
NM_000809chr4228481 8349 8043 7220 7200 7116 6369 5712 3389 3255 3099 2664 2631 2409 2241 2113 1951 765 492 207 171 28 21032 801 15875 17951
NM_000813chr5125312 4866 4733 4511 4385 4229 3689 3492 1766 1607 1127 521 44851 4416 798 782 199 --
NM_000814chr1573858 3447 3122 3061 2777 2680 1322 33390 1608 899 1546 --
NM_000829chr1171723 1606 1553 1451 862 717 360 31796 1531 809 ----
NM_000831chr1154980 4200 2453 2318 2311 2158 1901 1669 1253 1141 1131 812 508 309 248 65348 5177 4995 4908 859 50 35101 4013 382 15135
NM_000838chr662666 1899 901 890 759 84 42347 2273 741 26 1555 --
NM_000840chr72315 88 1473 149 --
NM_000845chr7------1158
NM_000861chr3102704 2656 2083 1956 1935 806 758 745 734 285 32146 1791 1038 12041 --
NM_000866chr391898 1852 1534 1180 751 549 495 256 162 21729 1573 ----
NM_000875chr15156709 6299 5905 5039 4984 4550 4465 2659 2498 2244 1709 1655 1270 831 540 45927 4487 1543 1087 12105 --
NM_000877chr262911 2618 2379 2047 873 811 42467 943 559 221 23012 2347 --
NM_000891chr1773465 3212 2267 797 761 479 387 13389 43394 2784 2446 534 1361
NM_000899chr12113568 3356 3307 3261 3040 1752 1656 1515 1168 724 469 54142 3528 2728 527 306 11558 --
NM_000901chr4122542 2108 2000 1965 1877 1861 1565 953 359 262 160 60 --12456 12184
NM_000909chr471297 994 825 511 489 331 182 1896 --1471
NM_000912chr843502 3305 627 189 13024 43355 990 347 230 --
NM_000950chrX83251 3172 2813 2619 2388 1412 1277 569 --12650 12584
NM_000953chr1491727 1530 1378 1257 1239 1181 1141 258 103 2679 408 --2146 124
NM_000959chr1103878 3858 3740 3316 3071 1404 1215 1140 919 878 1248 23377 760 --
NM_000961chr2062597 505 424 194 161 137 --1839 13752
NM_000975chr1134 ------
NM_000978chr17--154 ----
NM_000983chr171511 1244 1084 595 385 311 122 11324 11039 --
NM_001001132chr21----11508 --
NM_001001344chrX82618 1934 1817 1604 1025 500 321 289 12237 --11915
NM_001001389chr11123054 3040 2596 2587 2500 1166 1138 1008 916 764 648 534 53019 2991 2775 2459 1992 12661 --
NM_001001390chr11123054 3040 2596 2587 2500 1166 1138 1008 916 764 648 534 53019 2991 2775 2459 1992 12661 --
NM_001001391chr11123054 3040 2596 2587 2500 1166 1138 1008 916 764 648 534 53019 2991 2775 2459 1992 12661 --
NM_001001392chr11123100 3086 2642 2633 2546 1212 1184 1054 962 810 694 580 53065 3037 2821 2505 2038 12707 --
NM_001001395chr1272837 2737 2065 1828 872 716 139 2480 210 22653 971 11925
NM_001001396chr1114418 4398 4149 3644 3185 1428 1215 1179 1008 962 792 --21408 41 1442
NM_001001419chr575183 5098 3580 1883 1483 500 211 44414 2001 566 458 2480 410 --
NM_001001420chr575183 5098 3580 1883 1483 500 211 44414 2001 566 458 2480 410 --
NM_001001436chr161304 ------
NM_001001481chr8103369 3024 2470 2127 1380 1151 491 379 288 29 --11188 --
NM_001001484chr1051802 966 716 504 235 --22438 773 --
NM_001001549chr752718 2079 638 619 56 --12091 --
NM_001001550chr752718 2079 638 619 56 --12091 --
NM_001001555chr752718 2079 638 619 56 --12091 --
NM_001001556chr1591602 1508 1487 1416 1091 638 607 211 152 11195 ----
NM_001001664chr293547 3280 3232 1629 1524 1159 353 86 57 51426 786 708 439 129 1119 11432
NM_001001668chr1993917 3685 3298 2863 2727 2637 1530 1281 388 53566 3261 2651 1626 993 1552 2912 862
NM_001001685chr1762775 2716 2635 2415 1802 1794 42437 2103 2017 1990 --1917
NM_001001701chr442052 2013 601 479 52292 2110 860 577 279 22329 413 1429
NM_001001928chr22248108 7471 7305 7273 7039 6820 6140 5691 5577 5464 5376 3202 3048 3040 2447 2387 2336 2260 1868 1430 999 973 465 59 57722 5918 5174 483 185 15677 12328
NM_001001938chr984029 3776 3557 3393 3032 2781 1151 1024 13414 --12979
NM_001002243chr2------166
NM_001002258chr261958 1798 1537 1387 1314 1250 21520 1367 ----
NM_001002759chr103521 465 51 ------
NM_001002814chr8163140 3071 2991 1531 1524 1458 1402 1355 1299 1272 999 767 729 587 406 135 23187 711 ----
NM_001002860chr1474403 3890 3866 3708 3481 1263 683 43161 3154 1128 817 ----
NM_001003407chr1074920 4595 4427 3760 3207 1302 347 54891 3312 1759 905 192 24539 1686 1684
NM_001003408chr1074920 4595 4427 3760 3207 1302 347 54891 3312 1759 905 192 24539 1686 1684
NM_001003652chr18208704 8538 8061 7963 7599 7112 6718 5872 5461 3478 3261 3151 1947 1307 1182 1055 1027 586 277 104 66881 6660 6087 5933 1993 519 37490 6064 97 18397
NM_001003674chr18166336 6297 5994 5982 5569 5507 5221 5046 4293 2827 2781 2248 2066 1919 766 578 86774 6070 5850 4676 4467 1663 1518 1504 16827 1703
NM_001003675chr18166336 6297 5994 5982 5569 5507 5221 5046 4293 2827 2781 2248 2066 1919 766 578 86774 6070 5850 4676 4467 1663 1518 1504 16827 1703
NM_001003712chr1274089 3578 2868 2741 1518 761 614 31330 1263 557 3979 430 175 --
NM_001003792chr351211 1069 808 384 248 31095 1024 157 --1933
NM_001003793chr351211 1069 808 384 248 31095 1024 157 --1933
NM_001003800chr973335 3117 3031 2780 986 770 363 42942 592 427 290 12766 --
NM_001003810chr42288 185 ----1687
NM_001004065chr9103299 2682 2660 2574 1073 1067 932 533 275 207 43851 3689 1449 72 1133 --
NM_001004127chr1361030 1010 1002 993 840 138 2966 339 1347 1959
NM_001004196chr351249 446 185 92 58 3793 105 65 1125 --
NM_001004304chr1273255 2397 999 665 624 135 36 21292 52 --1400
NM_001004342chr1135778 5747 5725 5614 5378 4667 4402 4394 3996 2448 2306 1087 212 35943 4177 1126 14976 23866 92
NM_001004360chr271819 1516 1448 1437 1233 553 223 11999 ----
NM_001004419chr12153893 3776 3758 3674 3023 3000 1391 1263 1215 1114 960 744 656 374 316 43232 1037 1006 109 23523 1164 23825 1712
NM_001004441chr551304 559 438 216 210 21628 1487 ----
NM_001005375chrY4437 415 146 43 31719 1560 394 11268 1558
NM_001005386chr242448 1597 1532 878 42196 1954 834 731 --1926
NM_001005404chr17144525 4469 4397 4185 3930 3893 3114 3069 1615 1604 877 553 501 261 53577 2765 1664 1174 939 1825 --
NM_001005473chr5126618 6133 5948 5752 5337 4965 2240 1825 986 884 845 40 34197 1713 1220 26162 1391 14473
NM_001005474chr331300 1215 157 1379 ----
NM_001005609chrX103596 3181 3073 2965 2680 2561 1345 1281 1228 1025 43490 2587 492 355 ----
NM_001005612chrX155 2179 103 --1109
NM_001005845chr871745 1617 1449 467 315 104 85 ------
NM_001006118chrY1221 ------
NM_001006120chrY1221 ------
NM_001006610chr1641027 925 321 135 2983 962 1729 --
NM_001007023chr14115153 4874 4592 4554 3571 1708 1610 840 329 220 37 24368 49 13940 14308
NM_001007088chrX21314 883 2162 72 1146 --
NM_001007097chr9144979 4844 4746 4576 4521 4315 3753 1963 1097 989 629 603 552 333 14756 --23411 1799
NM_001007157chr7128 ------
NM_001007214chr131605 1269 679 51363 648 335 271 128 11717 --
NM_001007237chr172417 999 900 736 670 425 127 --1792 1633
NM_001007246chr2171657 1560 1542 1417 375 217 186 11816 ----
NM_001007257chr131390 1275 80 143 --1965
NM_001007466chr6114693 3887 3730 3416 1887 1339 1145 866 608 510 220 54646 3585 3404 1731 504 1199 24085 3522
NM_001007526chrY1221 ------
NM_001007531chr65352 325 232 118 66 --158 --
NM_001008239chr1893410 3162 3149 2583 1123 1111 859 522 167 11236 196 --
NM_001008392chr373555 2675 1434 917 808 281 179 --1958 11189
NM_001008405chr761465 1159 682 521 114 39 31495 573 546 11573 --
NM_001008408chr7125244 4900 4844 4668 4333 4217 4210 1487 1325 1156 547 480 34389 2457 2087 1622 14474
NM_001008410chr262241 1964 1546 699 361 246 42285 2032 1536 308 12167 --
NM_001008541chr10112318 1871 1787 1521 840 807 799 583 562 179 138 22203 411 12345 --
NM_001008541chr10112318 1871 1787 1521 840 807 799 583 562 179 138 22203 411 12345 --
NM_001008564chr1352076 1830 1682 1552 410 ----1772
NM_001008707chr1461818 1423 1326 461 443 268 21737 1455 --11683
NM_001008723chr101453 ------
NM_001008744chr1451614 1114 562 298 125 ----21416 1084
NM_001008801chr1942147 1780 600 394 1122 1191 --
NM_001008895chr1361127 1117 948 493 321 298 11075 1567 --
NM_001008925chr463320 2202 1035 790 382 232 22997 825 ----
NM_001009554chr484266 3678 2879 1100 1076 832 228 134 43788 3524 1592 379 11220 --
NM_001009554chr484266 3678 2879 1100 1076 832 228 134 43788 3524 1592 379 11220 --
NM_001009555chr431344 1128 302 2262 142 --11539
NM_001009899chr3136146 6082 5678 5307 5161 4748 2362 2299 1653 1642 728 720 681 44965 4626 791 535 ----
NM_001009909chr1163933 3430 3424 1509 1125 1024 31388 1166 815 ----
NM_001009960chr762598 2339 2286 2261 2088 355 22780 2672 11804 --
NM_001009993chr2104071 3872 3405 2773 1458 1104 1053 857 374 318 24375 1151 --14521
NM_001010846chr1103809 3729 3508 3461 1755 1604 1342 1050 812 124 14174 12906 --
NM_001010853chr6112862 2787 2714 2577 2555 2489 2216 2122 2116 1986 376 12379 ----
NM_001010861chr152627 2609 2027 842 332 32450 2321 1701 22346 853 --
NM_001010862chrX33073 3057 795 63152 3092 2085 1323 1087 509 1887 --
NM_001010888chrX93617 3606 3597 3392 3066 3048 1682 1463 1364 23241 855 --1781
NM_001010891chr5186225 6169 5902 5874 5800 5482 4780 4683 4381 2194 2024 1406 1315 1237 1042 784 528 118 55813 5394 5030 2156 1800 2986 319 11582
NM_001010895chr982092 1828 1769 1491 1442 1404 1354 360 1755 ----
NM_001010922chr153559 2847 1426 1055 946 194 --13602
NM_001010986chrX82006 1989 1738 1635 1620 1611 365 33 1201 11582 --
NM_001011657chrX4475 423 177 162 11162 --1366
NM_001011666chr7186217 6209 6131 5682 5667 5554 5498 5371 4928 4473 4012 2118 1914 1896 1521 1074 967 33 22196 735 --12183
NM_001011708chr2112967 2862 2117 1834 1098 1025 877 624 592 568 247 143 ----
NM_001011713chr1461569 1521 1179 368 350 186 ------
NM_001012393chr1184984 3485 1676 1542 1328 1283 1231 1085 23744 1869 21790 424 24009 1119
NM_001012420chr1582251 1086 963 638 548 521 164 21 12770 ----
NM_001012423chr1582251 1086 1009 963 638 548 521 164 12770 ----
NM_001012755chrX84476 4307 4034 4014 3800 3553 3309 620 34280 3542 1608 13131 1176
NM_001012761chr582541 1884 1660 721 611 594 577 83 32230 2069 267 11966 --
NM_001013415chr461301 538 491 469 229 201 --11363 --
NM_001013620chr12218453 8391 8211 7258 7234 6890 6456 6428 5776 5406 5231 3277 2721 2067 1916 1744 1495 825 713 499 185 67858 6835 6784 6584 6158 2311 1205 1382
NM_001013699chr121143 ------
NM_001013746chr731926 466 301 32062 2001 1651 --11460
NM_001014286chr132279 55 ----2133 43
NM_001014380chr1355028 4575 4325 1264 306 34481 3825 3807 --11864
NM_001014797chr10188019 7479 6997 6915 6662 6624 6563 5393 5351 3253 3108 2933 2490 2107 2050 1384 1324 1283 67974 6553 3262 1916 1550 1290 12681 --
NM_001015877chrX102904 2871 2864 2755 2623 2187 1074 896 679 363 1369 ----
NM_001015880chr1041228 468 337 124 1217 21454 635 --
NM_001017395chr393103 2576 2442 2420 2265 1424 1258 634 150 33034 1442 620 1613 13040
NM_001017405chr4--1240 ----
NM_001017424chr161842 1394 1338 1256 149 104 31777 1698 706 ----
NM_001017425chr161842 1394 1338 1256 149 104 31777 1698 706 ----
NM_001017440chr7218268 7637 7023 7011 6926 6817 6720 6496 6454 6329 5923 5444 5380 3225 2930 2477 2376 550 477 452 357 67862 7039 6588 6125 3148 777 21832 1542 26350 3119
NM_001017926chr851808 1311 697 538 138 31853 1475 120 ----
NM_001018025chrX3847 782 138 1204 2795 323 1218
NM_001018057chr11--11431 ----
NM_001018065chr983949 3747 2425 1972 1800 1757 1743 1125 22214 1782 11232 14158
NM_001018066chr983949 3747 2425 1972 1800 1757 1743 1125 22214 1782 11232 14158
NM_001018067chr1124924 4741 4427 4246 3970 3628 3295 2022 1544 1343 1048 178 --12084 --
NM_001018068chr1124924 4741 4427 4246 3970 3628 3295 2022 1544 1343 1048 178 --12084 --
NM_001018069chr1124924 4741 4427 4246 3970 3628 3295 2022 1544 1343 1048 178 --12084 --
NM_001018074chr5193761 3711 3634 3498 3339 3328 3073 2994 2665 2446 1357 1213 1033 976 923 896 771 714 461 32864 2759 2505 --1179
NM_001018075chr5193761 3711 3634 3498 3339 3328 3073 2994 2665 2446 1357 1213 1033 976 923 896 771 714 461 32864 2759 2505 --1179
NM_001018076chr5193761 3711 3634 3498 3339 3328 3073 2994 2665 2446 1357 1213 1033 976 923 896 771 714 461 32864 2759 2505 --1179
NM_001018077chr5193761 3711 3634 3498 3339 3328 3073 2994 2665 2446 1357 1213 1033 976 923 896 771 714 461 32864 2759 2505 --1179
NM_001018090chr1572267 1096 797 179 155 136 120 1905 1981 --
NM_001018091chr1582377 1835 907 289 265 246 230 42 11015 11091 --
NM_001018102chr1572267 1096 797 179 155 136 120 1905 1981 --
NM_001018111chr773744 3513 3459 2855 2601 1303 254 23033 1033 21221 1214 --
NM_001020658chr151425 1330 1131 364 165 11303 11343 --
NM_001020658chr151425 1330 1131 364 165 11303 11343 --
NM_001020825chr571236 1186 1109 973 548 469 140 2339 234 ----
NM_001023567chr15102504 2137 2068 971 843 641 551 164 158 21 12162 ----
NM_001024094chr5193761 3711 3634 3498 3339 3328 3073 2994 2665 2446 1357 1213 1033 976 923 896 771 714 461 32864 2759 2505 --1179
NM_001024380chr892469 2146 2089 2070 1000 910 700 204 39 --11684 --
NM_001024381chr892469 2146 2089 2070 1000 910 700 204 39 --11684 --
NM_001024647chr12195882 5839 5573 5495 5398 4714 2794 2722 2475 2141 2031 2018 1722 1608 1446 1337 1301 930 732 76743 5596 3021 1846 1756 1012 888 ----
NM_001024660chr3111566 1227 1100 1072 353 345 250 240 230 201 172 ------
NM_001024855chr381610 1569 1314 1261 1175 643 226 54 11530 --2434 310
NM_001024924chr41520 ------
NM_001024947chr51786 ------
NM_001024956chr1164062 3861 1776 1356 1106 172 85244 5105 5006 4679 4659 4261 1755 1073 25084 4392 --
NM_001025068chr341680 729 43 28 157 2302 88 1577
NM_001025069chr341680 729 43 28 157 2302 88 1577
NM_001025076chr10105438 4511 4495 4409 1996 1591 1099 1071 904 108 12348 14704 --
NM_001025077chr10146796 5869 5853 5767 4655 2949 2457 2429 2262 1466 1340 820 515 116 5942 853 526 361 322 16062 --
NM_001025079chr364181 3636 3565 2906 1347 1322 43520 1152 972 117 12738 --
NM_001025233chr1282550 2506 2316 1950 803 570 492 413 42749 2610 2544 94 1306 12393
NM_001025252chr883149 2739 2709 2300 1955 862 453 281 12522 1840 --
NM_001025253chr883149 2739 2709 2300 1955 862 453 281 12522 1840 --
NM_001025266chr374608 3324 3309 3182 1889 799 337 14194 21504 1046 33630 3621 1184
NM_001025356chr1242660 2146 958 264 42387 2295 2253 22 --1766
NM_001025580chrX124008 3764 3645 3438 3132 3067 2918 2636 1616 973 809 661 1920 23470 1172 --
NM_001025616chr461801 1504 1403 1232 497 103 21414 260 --1242
NM_001029858chr663298 2893 2416 1123 930 642 12346 1138 1274
NM_001029875chr542607 2289 573 224 51869 1032 628 588 171 12095 12990
NM_001029884chr652567 2372 2198 1686 348 2839 412 1420 1381
NM_001029955chr4103468 3177 3085 2913 2898 2535 2452 2268 796 218 63109 2869 2803 2459 2339 374 --11054
NM_001029989chr15--1375 --1123
NM_001030006chr1792300 2085 2078 2026 1833 980 958 755 380 52471 2462 1963 974 461 --21718 346
NM_001030007chr16144038 3828 3749 3702 3570 3524 3277 2829 2724 1525 1313 860 694 43 12616 --11001
NM_001030055chr1484162 3180 3055 2935 1906 775 685 462 142 13062 --
NM_001031679chr1262907 2839 2799 2513 2248 584 43255 3217 1262 1148 1149 2665 317
NM_001031684chr2130 ------
NM_001031695chr2235457 924 446 55165 3705 3519 1591 1542 23978 3898 --
NM_001031716chr211048 31020 208 90 1992 --
NM_001031803chr171304 ------
NM_001031804chr1643933 3360 982 670 73996 3728 3696 3048 1665 1350 618 13576 --
NM_001031812chr54817 710 462 303 62364 2329 2081 606 389 323 21593 720 --
NM_001032280chr661644 1088 510 504 403 303 11120 ----
NM_001032282chr82230 161 1193 21254 115 11140
NM_001032395chr642667 2631 1061 970 1320 1240 11689
NM_001032999chr20115375 5130 5063 4265 4135 3552 3271 2125 1840 1241 1067 35017 3524 598 15116 --
NM_001033025chr161539 941 347 170 128 106 --1420 --
NM_001033057chr352090 1598 496 258 38 51900 544 470 463 175 ----
NM_001033087chr20102836 2740 2683 2487 923 832 773 643 386 195 13050 2889 499 --
NM_001033117chr393505 3423 3193 3003 1932 1896 1645 678 596 14203 1830 1850
NM_001033578chr871988 1897 971 901 859 237 179 51729 1672 1559 894 522 11616 12064
NM_001033723chr892724 1842 981 759 257 251 188 116 76 1775 ----
NM_001033925chr1041938 1433 497 483 2822 371 1667 --
NM_001034841chr1694940 4318 3851 3671 1979 1844 1195 658 101 41317 783 636 323 --15405
NM_001035003chr451330 1257 1247 896 153 21454 1046 --1251
NM_001035004chr451330 1257 1247 896 153 21454 1046 --1251
NM_001037164chr742037 1392 1284 1266 --11956 1782
NM_001037165chr778124 7468 6944 6799 6265 2833 634 38512 7573 763 18281 43380 3073 2926 2920
NM_001037174chr262295 2284 764 311 282 61 32259 687 440 --11734
NM_001037277chr161561 1400 1372 1086 493 154 21698 1257 11266 21116 201
NM_001037278chr161561 1400 1372 1086 493 154 21698 1257 11266 21116 201
NM_001037317chr152627 2609 2027 842 332 32450 2321 1701 22346 853 --
NM_001037332chr552338 1869 786 450 57 3616 227 44 1951 --
NM_001037333chr552338 1869 786 450 57 3616 227 44 1951 --
NM_001037334chr1852248 2080 266 237 124 22109 942 --1136
NM_001037553chr21155201 5068 5052 4746 4528 4401 4072 3758 3513 3157 1998 904 288 158 143 25173 1535 14581 13598
NM_001037954chr11103182 2963 2384 2193 1294 1141 902 799 518 445 33203 2798 784 1120 11249
NM_001039111chr3--1155 ----
NM_001039538chr253421 2784 2531 2254 638 33607 3506 458 12886 --
NM_001039547chr3127563 7247 6702 6601 5972 5908 5796 5477 5327 5274 1607 247 1132 ----
NM_001039570chr22114307 3204 3066 3020 1796 1331 1024 948 935 731 722 13263 13708 --
NM_001039571chr22114307 3204 3066 3020 1796 1331 1024 948 935 731 722 13263 13708 --
NM_001039577chr194479 3324 2934 1431 719 584 417 368 305 21742 1624 32845 2793 1543 --
NM_001039585chr1114135 4115 3997 3573 3328 1661 1472 1397 1176 1135 104 1505 23634 1017 12595
NM_001039590chrX93934 3862 3758 2574 2544 1541 1306 695 237 11143 1327 12786
NM_001039591chrX93934 3862 3758 2574 2544 1541 1306 695 237 11143 1327 12786
NM_001039618chr1185723 5196 4939 3808 3734 2161 1422 1377 55866 2174 1504 148 116 11940 34423 1861 1122
NM_001039693chr2123974 3486 3467 3357 1656 1466 1155 1116 834 602 513 211 34003 1392 766 ----
NM_001039709chr20115375 5130 5063 4265 4135 3552 3271 2125 1840 1241 1067 35017 3524 598 15116 --
NM_001039762chr1042043 1789 1505 142 2505 408 1809 22289 172
NM_001039840chrX85779 4186 1804 1427 1348 1108 1044 1022 34978 4892 3679 15073 11223
NM_001039937chr1363586 3524 3511 3457 799 602 83370 3068 1445 813 491 393 199 123 1978 --
NM_001040020chr731519 1131 28 61277 614 580 280 233 91 1981 --
NM_001040108chr14103236 3091 2666 2479 2195 1249 1076 238 32 23 23039 789 13122 --
NM_001040142chr252419 2197 1560 959 604 31696 1613 246 ----
NM_001040143chr252419 2197 1560 959 604 31696 1613 246 ----
NM_001040152chr794975 4871 4087 3316 3235 1691 1534 1332 723 --13567 --
NM_001040202chr422372 1743 1144 1597 --
NM_001040214chr652283 781 729 540 300 52128 909 264 88 81 11508 --
NM_001040284chr16155957 5441 5379 5318 5303 4263 4060 3928 3795 3661 2358 1522 434 405 226 55405 5016 3726 2367 201 ----
NM_001040402chr493111 2851 2843 2278 2001 1164 727 424 290 23234 2016 ----
NM_001040429chr1383629 3603 3559 3082 1381 1076 833 668 23281 3249 ----
NM_001040441chr155079 3746 1806 991 714 64425 3784 1986 774 651 448 21896 1042 --
NM_001040450chr152659 493 42204 961 855 812 ----
NM_001040453chr152659 493 42204 961 855 812 ----
NM_001040610chr15--147 ----
NM_001040653chr342538 1946 1047 104 22188 1853 12378 11709
NM_001040665chr764733 4432 4344 3446 1057 1044 34977 3224 423 --24200 818
NM_001040712chr9113545 3504 3297 3147 2898 2580 2558 2425 1354 1018 605 12257 ----
NM_001040875chr852588 2064 1709 574 121 12478 ----
NM_001040876chr491850 1814 1746 1394 1234 1216 421 142 38 11642 11585 --
NM_001041chr31128 ------
NM_001042355chr1695111 4732 4417 4388 3548 3476 1588 1282 1229 41438 1325 1222 187 ----
NM_001042404chr111726 21241 217 ----
NM_001042412chr1695111 4732 4417 4388 3548 3476 1588 1282 1229 41438 1325 1222 187 ----
NM_001042413chr963482 2615 1215 788 245 140 23938 3380 11475 13748
NM_001042425chr661644 1088 510 504 403 303 11120 ----
NM_001042453chrX31310 399 133 31620 1614 523 11272 --
NM_001042473chr1082201 1896 1797 1772 705 604 415 350 32072 2042 1639 ----
NM_001042481chr1481817 1807 678 606 246 189 183 56 --1148 22605 579
NM_001042494chr1593370 3249 2831 783 378 305 161 98 40 42421 1011 338 198 --1262
NM_001042495chr1593370 3249 2831 783 378 305 161 98 40 42421 1011 338 198 --1262
NM_001042496chr1593370 3249 2831 783 378 305 161 98 40 42421 1011 338 198 --1262
NM_001042497chr1593370 3249 2831 783 378 305 161 98 40 42421 1011 338 198 --1262
NM_001042533chr3153295 2907 2779 2426 2169 919 883 851 787 777 569 557 533 340 49 33325 262 56 22736 765 --
NM_001042543chr451497 1374 568 139 49 21553 561 --1387
NM_001042555chr1264723 4337 1900 1639 576 520 43813 3405 3184 622 ----
NM_001042599chr2127082 6888 6570 6012 5864 5292 5154 5061 4931 3025 1198 480 56988 6357 2712 2409 1982 11499 12324
NM_001042601chr3103318 2619 2280 2229 2151 1005 987 905 159 82 32655 2404 952 ----
NM_001042603chr12105264 4993 4337 4301 4101 3771 3744 3713 1889 747 45248 4830 4246 782 --14440
NM_001042604chr3104809 4638 4130 4095 3642 3047 1884 1853 1685 165 11250 14524 --
NM_001042669chr461801 1504 1403 1232 497 103 21414 260 --1242
NM_001042681chr152213 957 705 668 263 --1440 189
NM_001042682chr152213 957 705 668 263 --1440 189
NM_001042682chr152213 957 705 668 263 --1440 189
NM_001042749chrX41931 1457 792 667 31749 592 550 1620 11626
NM_001042750chrX41931 1457 792 667 31749 592 550 1620 11626
NM_001042751chrX41931 1457 792 667 31749 592 550 1620 11626
NM_001044385chr2133940 3910 3518 2598 1588 1523 1419 1081 692 601 395 318 214 21621 302 23548 1011 --
NM_001044722chr54817 710 462 303 62364 2329 2081 606 389 323 21593 720 --
NM_001044723chr54817 710 462 303 62364 2329 2081 606 389 323 21593 720 --
NM_001045556chr8141552 1539 1351 1278 663 561 443 255 175 121 115 74 42 33 --1427 --
NM_001045557chr8141552 1539 1351 1278 663 561 443 255 175 121 115 74 42 33 --1427 --
NM_001046chr542459 649 316 277 2594 134 ----
NM_001048183chr163688 1463 1158 1054 498 476 42553 1289 1021 531 ----
NM_001079874chr182045 1309 835 703 683 275 97 58 31360 695 417 1260 --
NM_001083621chr1104744 4693 4455 4060 4020 3687 1683 1428 1190 298 33795 3032 315 43993 3287 1666 819 13140
NM_001100108chr1208032 7743 7386 7314 7106 6903 6380 3075 2842 2803 2619 2295 2025 1802 1619 1059 910 696 459 442 35865 2871 175 27067 2883 --
NM_001106chr3249376 9024 8784 8743 8326 8305 7956 7886 7864 6997 6542 6296 6066 3512 2559 2492 2470 1590 1568 1071 994 467 295 59 49724 9115 3457 1411 39290 8629 787 17239
NM_001117chr1851659 1537 693 413 50 21605 361 12337 --
NM_001121chr1071181 768 669 649 595 516 148 ------
NM_001126chr121074 725 ----1301
NM_001128chr16144038 3828 3749 3702 3570 3524 3277 2829 2724 1525 1313 860 694 43 12616 --11001
NM_001144chr1621168 91 21450 1275 11340 --
NM_001146chr841682 840 181 51 32096 917 31 1554 187
NM_001160chr1262617 2520 2366 2318 2199 2177 --1128 --
NM_001167chrX85094 4758 2341 2088 1241 925 728 578 75275 5183 4591 2707 1300 1294 247 --14284
NM_001173chr1484162 3180 3055 2935 1906 775 685 462 142 13062 --
NM_001174chrX102349 2035 1619 1600 1435 602 410 345 199 171 21776 397 12069 --
NM_001186chr2162632 1315 388 372 172 64 43186 3076 1117 475 ----
NM_001187chr213631 597 467 ------
NM_001196chr2231047 941 906 41122 952 446 329 11366 --
NM_001201chr453955 3600 2671 1416 113 21507 341 12617 1728
NM_001204chr2217751 7610 7361 7012 6985 6750 6720 6495 6363 6010 5954 5616 4717 3052 2681 2661 2266 1680 1456 1101 57 66231 5267 2741 2474 658 312 1280 25761 374
NM_001206chr9103103 2806 2709 2356 2218 2189 1228 988 90 41 42224 851 172 51 --1612
NM_001219chr761985 1782 1486 610 500 117 12050 --132
NM_001233chr762416 2001 1672 1542 807 800 3668 252 67 --1491
NM_001256chr17122740 2576 2558 2472 2287 2029 1919 1881 906 858 809 481 1168 ----
NM_001259chr7196226 6139 5701 5681 5630 5292 5094 4668 4149 3902 2347 2188 1945 1914 889 652 267 258 186 35936 5382 4273 24972 4867 24480 630
NM_001282chr1792300 2085 2078 2026 1833 980 958 755 380 52471 2462 1963 974 461 --21718 346
NM_001284chr5--1574 ----
NM_001289chrX41323 1291 518 24 41515 1032 634 249 ----
NM_001304chr1783854 3767 3731 3029 2867 1167 372 106 12513 21180 755 --
NM_001310chr1262932 2646 1977 1214 164 70 42853 2818 2136 784 ----
NM_001315chr652195 2136 1926 643 615 11410 1296 1872
NM_001329chr1071616 1349 1082 1035 548 351 47 31669 1173 638 1150 --
NM_001351chr351735 1654 1504 1294 58 31692 1534 292 --1460
NM_001387chr5103171 3109 2864 2823 2403 1159 826 361 268 85 ----132
NM_001391chr1841234 948 183 90 2878 867 2797 380 --
NM_001396chr21102246 2215 2047 1881 1058 950 864 183 163 121 31899 767 357 1302 12013
NM_001399chrX103596 3181 3073 2965 2680 2561 1345 1281 1228 1025 43490 2587 492 355 ----
NM_001412chrX83136 2351 1391 1285 1035 949 841 449 32971 2761 2661 ----
NM_001419chr19104670 4517 4496 4378 4023 4017 1930 1893 1832 1416 34471 3324 1014 14285 11331
NM_001420chr1983187 3044 2278 2019 1981 1959 466 89 11995 1930 --
NM_001432chr493669 3440 3199 2689 2581 1163 820 260 206 1506 ----
NM_001438chr1103359 3219 2892 2800 2793 1423 1233 590 547 60 1689 ----
NM_001439chr161539 941 347 170 128 106 --1420 --
NM_001448chrX71514 1502 1190 473 466 36 22 2483 45 11382 1435
NM_001449chrX41242 1086 406 290 2329 194 --11190
NM_001460chr172636 2326 1433 1350 763 698 257 43213 2459 1259 527 13522 --
NM_001465chr541990 1972 328 200 1502 31722 1411 1339 --
NM_001497chr932100 2053 553 11957 31898 1078 630 21937 990
NM_001508chr27938 721 694 607 360 348 312 1128 1895 --
NM_001526chr61153 ------
NM_001527chr634723 1171 1123 24516 3499 --11141
NM_001542chr172417 999 900 736 670 425 127 --1792 1633
NM_001543chr5114612 4290 4145 4101 3341 1650 1337 927 743 532 38 23306 3168 23846 1377 --
NM_001554chr1------1411
NM_001584chr116897 850 824 302 294 269 11168 1235 --
NM_001650chr1894163 3794 3393 2881 2779 1181 1055 456 163 63752 3600 3457 3151 520 22 22770 1447 --
NM_001656chr541627 1473 1404 85 2251 42 12024 --
NM_001660chr3--1214 ----
NM_001684chr1114135 4115 3866 3361 2902 1145 932 896 725 679 509 --11125 1159
NM_001689chr261958 1798 1537 1387 1314 1250 21520 1367 ----
NM_001695chr8104186 4168 4096 3730 3386 1718 1052 991 982 534 --1335 --
NM_001709chr1182619 2114 2069 1139 656 278 212 180 --12823 --
NM_001717chr1541346 1200 216 154 11046 --1111
NM_001729chr4--1301 ----
NM_001730chr1371651 1642 1398 1386 1248 1220 375 11483 --195
NM_001730chr1371651 1642 1398 1386 1248 1220 375 11483 --195
NM_001755chr1641717 823 363 123 21641 1551 ----
NM_001759chr12144651 4491 4333 4279 4099 3686 3672 1865 1705 1283 1233 1146 861 21 52024 970 540 264 187 14441 12108
NM_001766chr1112261 2028 1959 673 582 483 369 308 260 252 184 1131 --11881
NM_001777chr364181 3636 3565 2906 1347 1322 43520 1152 972 117 12738 --
NM_001792chr1831074 944 323 164 173 1226
NM_001796chr16--1174 ----
NM_001806chr1952256 918 401 358 329 42877 2658 2075 478 12822 22184 559
NM_001830chrX103524 2580 2548 1060 940 751 533 401 394 129 13420 23172 115 13317
NM_001858chr6154789 4393 4267 4056 3429 1879 1519 1495 1129 1112 982 965 822 771 295 23815 138 44724 1380 1101 1071 13934
NM_001859chr9103556 3544 3221 2867 2842 2481 1121 775 686 243 --11255 13829
NM_001918chr1279262 8871 8812 8564 8107 7770 7741 7681 7651 7586 7574 6512 5944 3641 3413 3347 3306 3224 3162 2893 2164 2157 1980 1925 1829 786 606 58914 8854 7833 7224 866 17332 17953
NM_001924chr14496 392 386 380 ------
NM_001939chrX113771 3551 3059 3047 2898 2451 1320 514 468 386 316 13386 ----
NM_001941chr1864054 3928 3001 1461 1282 174 73855 3486 3376 2619 1609 1511 1149 23669 2500 --
NM_001949chr673148 2527 2297 663 217 135 103 ----1505
NM_001957chr422321 288 11668 22278 1765 1810
NM_001963chr4------171
NM_001969chr1473863 3298 2645 2638 1297 1129 65 53940 3707 2664 1137 637 187 23842 3572
NM_001977chr431725 1140 564 1657 --11549
NM_001987chr1294311 4004 3938 3828 3320 3224 1448 1108 150 13326 11132 --
NM_001992chr552076 1452 653 43 34 42051 2011 1688 1532 ----
NM_001999chr551448 594 531 252 66 11231 --2201 56
NM_002006chr4165219 5000 4830 4343 4224 4201 1903 1523 1494 1482 1304 1155 1133 1028 924 76 33990 2224 1897 2734 178 14986
NM_002009chr1582732 2667 2478 2065 2030 1715 674 111 1198 --1595
NM_002015chr1312957 52617 2449 2429 66 30 11316 --
NM_002023chr151562 1310 663 222 104 31671 1616 1144 31538 319 199 --
NM_002025chrX149053 8772 8538 8508 6797 6449 3196 2811 2356 1992 1479 1338 554 149 67758 7111 5778 3644 3265 3171 11007 --
NM_002033chr1193119 1586 1220 1102 1092 936 698 557 312 23219 1503 --1888
NM_002037chr6--1389 1404 --
NM_002044chr1591602 1508 1487 1416 1091 638 607 211 152 11195 ----
NM_002074chr151334 1261 309 279 127 11454 21068 660 1170
NM_002099chr451938 1895 1414 632 370 31397 1324 1312 21823 1772 --
NM_002128chr1342452 1681 592 405 1805 1917 --
NM_002137chr762302 2032 794 475 395 148 42381 2330 2016 311 1890 --
NM_002138chr42288 185 ----1687
NM_002139chrX3667 89 49 3538 268 167 ----
NM_002140chr921144 120 1393 ----
NM_002146chr1751416 1248 1185 1032 1011 31304 485 335 ----
NM_002158chr222673 2620 1213 11205 --
NM_002190chr621267 391 1464 --1951
NM_002202chr5--1321 1443 176
NM_002203chr5154084 3991 3533 3132 3075 3024 2670 2528 1394 1363 1275 981 783 480 413 33693 3115 246 ----
NM_002214chr785607 3566 2006 1028 788 554 525 73 45433 3796 1113 292 24330 3516 --
NM_002233chr111370 ------
NM_002242chr251524 1470 1256 657 452 41752 1427 1410 603 ----
NM_002247chr10102123 2100 1653 1612 931 860 605 557 363 357 12212 1217 1253
NM_002264chr3105079 4733 4344 3806 2012 1823 1805 383 332 205 14373 ----
NM_002267chr1352460 2397 2010 1972 86 41954 890 848 542 3912 649 165 --
NM_002270chr5175384 5014 4777 4574 4426 4131 3534 3474 2270 2007 1543 1302 1291 1174 624 558 447 34905 585 274 --14202
NM_002271chr1381903 1891 1746 1550 663 542 436 89 42359 1955 1947 146 1468 12100
NM_002293chr1122463 2290 992 953 813 773 638 534 510 412 191 141 1162 ----
NM_002298chr1371466 1353 1197 1053 636 312 169 21304 124 ----
NM_002310chr5145696 5317 5265 5074 4873 4783 2359 2234 2056 2050 2006 1583 1343 173 65750 5651 4167 2304 1324 275 14862 11411
NM_002312chr132380 25 4665 416 349 119 ----
NM_002313chr1074920 4595 4427 3760 3207 1302 347 54891 3312 1759 905 192 24539 1686 1684
NM_002336chr1293971 3876 3085 1822 1653 314 248 220 163 55098 4727 4434 3063 334 1915 14494
NM_002351chrX81756 1707 1284 1150 1124 1098 335 255 31503 547 206 21689 1446 --
NM_002356chr672436 2338 1988 1887 1099 522 492 --1335 1843
NM_002359chr1783885 2697 1107 1069 1047 791 775 727 --23477 2737 --
NM_002374chr253421 2784 2531 2254 638 33607 3506 458 12886 --
NM_002387chr5124723 4424 3993 3853 3511 3347 3235 3197 1148 586 471 66 24259 1536 24020 849 14124
NM_002389chr181558 1452 1367 1314 728 675 554 41 31655 1330 48 11888 --
NM_002397chr592134 2106 1909 1545 1456 711 568 347 117 2849 141 22128 365 --
NM_002431chr14------151
NM_002451chr983678 2438 2412 1143 1101 918 435 197 21184 204 ----
NM_002465chr121267 ------
NM_002481chr1157502 7460 7181 7089 6966 6477 5766 5544 4838 2452 2022 1127 743 459 86 57797 7061 7044 5272 4828 11472 12753
NM_002486chr952463 2214 2144 571 121 32414 422 173 12041 --
NM_002487chr151586 1790 ----
NM_002501chr194819 685 85 50 2328 148 43776 2539 1453 1181 2775 219
NM_002508chr191420 1413 1401 1307 731 719 448 190 79 11373 ----
NM_002515chr1451912 1877 1463 547 79 3597 529 510 1684 --
NM_002522chr1753630 2992 2975 1025 283 43689 3090 2797 1350 22880 569 13305
NM_002540chr94690 162 145 74 ----1155
NM_002545chr1184984 3485 1676 1542 1328 1283 1231 1085 23744 1869 21790 424 24009 1119
NM_002547chrX104109 3614 3454 3397 2853 1638 1100 713 255 221 63312 3206 2994 1549 957 106 2789 575 --
NM_002577chr3103826 3733 3668 1448 652 547 517 209 151 48 53676 3493 1192 616 122 --13925
NM_002581chr9155199 4764 4714 4606 4526 4208 4181 4161 4100 4000 3570 1355 1343 984 935 --11499 --
NM_002594chr2092459 2015 1974 1794 1704 1681 824 558 353 22176 464 ----
NM_002613chr16105022 4817 3910 3830 1885 949 884 797 204 145 35410 4735 4604 23973 3611 --
NM_002655chr864865 4632 4546 2082 413 265 25177 1106 --22096 1169
NM_002657chr20123383 2985 2850 2710 2686 2393 1202 1115 906 895 391 180 23723 1010 ----
NM_002698chr19112856 2133 2100 2002 1845 952 893 771 687 524 480 12170 ----
NM_002709chr283502 3358 1424 1337 1195 1010 476 459 32726 325 283 ----
NM_002716chr1183666 3182 2471 2274 1212 738 494 22 11125 ----
NM_002718chr372468 1731 1025 925 825 733 221 52223 1795 1676 477 435 ----
NM_002719chr1472453 2086 2054 1648 729 702 384 31939 1609 290 --12210
NM_002737chr17116106 4553 4360 4338 4034 2499 2485 2235 929 542 446 1279 15342 26365 2158
NM_002745chr2273831 3396 2999 2775 1194 861 771 14362 --13044
NM_002760chrY104523 4392 2273 2073 1424 1377 1138 800 158 37 55614 5343 5331 4792 3659 --24798 265
NM_002786chr11----191 --
NM_002809chr171367 ------
NM_002816chr172228 25 1329 ----
NM_002837chr1284581 4059 3444 3319 999 963 926 730 34089 3364 1175 ----
NM_002839chr9113545 3504 3297 3147 2898 2580 2558 2425 1354 1018 605 12257 ----
NM_002843chr1143121 2675 2361 2344 22799 860 23201 1059 --
NM_002844chr651206 983 418 400 384 1138 ----
NM_002855chr1193539 3024 2982 2770 2516 1334 932 546 427 22783 1119 21220 1163 --
NM_002869chr1162253 1628 880 647 467 212 11940 2179 33 --
NM_002886chr3115136 4919 4646 4528 3684 3345 3150 2028 1779 1606 794 44631 3738 3718 1363 33257 326 40 11356
NM_002906chr1151934 1793 1764 819 132 157 12416 --
NM_002940chr491850 1814 1746 1394 1234 1216 421 142 38 11642 11585 --
NM_002941chr371581 1521 1507 1459 1053 298 202 11635 ----
NM_002956chr1211195 ------
NM_002971chr35858 813 474 140 59 ------
NM_002976chr23181 73 55 180 1464 --
NM_002977chr273472 2984 2493 2409 832 820 276 22561 1152 1243 1413
NM_002998chr841995 1771 321 103 11789 --12222
NM_003003chr17--1272 ----
NM_003010chr1762267 2159 1931 865 485 437 12011 11775 --
NM_003022chrX2460 84 11032 --11162
NM_003034chr12197835 7475 7258 6269 5837 5418 5202 4933 2184 2160 1827 1719 1189 1107 929 901 806 365 66 37549 5698 2530 --17641
NM_003043chr394097 3970 3551 3127 1435 1123 876 707 642 33728 3480 723 --31684 745 412
NM_003048chr252737 2438 2319 1865 594 42543 1888 531 415 --12151
NM_003068chr82762 261 1298 --2173 77
NM_003099chr15135808 5290 5247 5056 4431 4137 1793 1453 1066 998 934 685 222 36406 4722 4163 31038 970 748 12341
NM_003106chr35969 359 339 169 71 1770 2730 402 --
NM_003108chr2127308 7277 6839 6446 6271 5914 4765 2089 1732 1414 1146 902 76097 5950 5879 4533 2716 1399 1170 15886 1396
NM_003112chr753227 2977 2955 2012 667 31215 209 182 ----
NM_003144chr631588 1391 81 2855 506 --1512
NM_003151chr2145 ------
NM_003155chr822132 641 42386 1817 1131 683 --11876
NM_003161chr1752629 1364 977 614 466 22497 2320 --13298
NM_003174chr101729 2872 237 ----
NM_003199chr18145690 5365 5047 4892 4146 4118 3600 1941 951 750 430 207 150 39 24745 3873 13519 --
NM_003203chr262424 2374 756 229 176 68 21621 124 ----
NM_003212chr34934 897 219 66 1886 --1972
NM_003217chr1261964 1408 1332 724 689 111 21648 101 --1605
NM_003220chr661644 1088 510 504 403 303 11120 ----
NM_003221chr683951 3152 2939 1150 1143 288 148 43 23808 1385 13746 --
NM_003246chr1541615 1496 1478 1384 31447 627 261 --1360
NM_003253chr2131949 1627 281 1309 11843 --
NM_003262chr365293 4245 3646 2016 355 38 1950 25170 3757 --
NM_003269chr641295 957 926 480 --2493 330 1856
NM_003274chr2172920 2669 2649 2150 2141 2041 634 12280 ----
NM_003298chr3146250 5988 5872 5765 5354 5217 4896 4325 4306 1458 937 373 269 161 35857 5421 67 24376 700 --
NM_003304chr331052 114 49 11102 --1213
NM_003314chr54465 115 109 69 196 1322 --
NM_003319chr2--3848 676 102 ----
NM_003337chr571624 1230 1107 519 429 122 65 1363 21380 147 --
NM_003339chr531537 357 271 31275 1084 424 11599 11304
NM_003342chr172467 423 21305 453 23335 174 --
NM_003348chr122606 109 2442 238 11676 --
NM_003359chr41867 --1967 11339
NM_003385chr23949 906 695 3979 917 201 2741 32 --
NM_003392chr373742 3464 3004 2679 2654 474 331 34239 2985 2851 11575 --
NM_003404chr2052044 1336 796 662 560 11419 12060 --
NM_003406chr841546 532 372 295 1698 --11895
NM_003409chr181504 41372 1087 439 418 ----
NM_003410chrX42651 2378 2104 1247 31204 962 582 --13127
NM_003411chrY1268 11304 11664 --
NM_003412chr353152 2469 2161 1092 836 --32557 528 222 --
NM_003413chrX41401 1322 97 53 11602 11437 1165
NM_003423chr1971753 1741 885 313 294 212 47 11036 ----
NM_003432chr51453 ------
NM_003439chr7113525 3393 3242 2553 1343 982 637 603 368 249 209 43236 2232 1110 256 22993 113 11426
NM_003463chr683212 3201 2889 933 860 698 396 203 22706 121 --1668
NM_003468chr274093 3983 3363 3334 2699 1409 1324 22684 942 13651 11287
NM_003469chr21314 ------
NM_003471chr342384 1532 761 352 21839 508 32032 526 23 --
NM_003478chr1152953 1188 714 264 244 12909 22188 2033 11090
NM_003489chr21113231 2983 2894 2827 2647 2342 2224 876 800 767 372 4698 127 92 75 --1833
NM_003505chr731351 412 177 11659 2342 157 --
NM_003574chr18105355 5228 4759 4651 4569 4312 1596 1362 687 428 34034 1718 1038 11587 14449
NM_003583chr1273453 1577 1326 1168 1112 713 618 23534 230 12434 --
NM_003589chr1361127 1117 948 493 321 298 11075 1567 --
NM_003590chr273722 3027 2780 2557 1418 430 289 22881 911 ----
NM_003603chr4102053 1995 1844 1717 1706 871 739 709 591 324 ------
NM_003607chr1114323 3568 3341 1465 881 685 601 578 406 284 98 22730 1533 23198 2849 11255
NM_003615chr3114029 2992 2853 2839 2721 1542 1449 1414 1220 932 715 21096 124 11587 13066
NM_003617chr174569 4239 3881 3571 1399 478 398 54629 3950 3772 3722 1104 34741 3460 1177 --
NM_003637chr181383 985 600 568 560 194 94 48 21254 63 ----
NM_003644chr1786314 6105 5894 4753 2425 1285 189 137 25610 1419 21740 853 14764
NM_003659chr23953 845 374 21035 448 11143 1865
NM_003663chr393462 3174 2822 2371 1400 1393 794 639 600 13474 23011 670 --
NM_003664chr5--1209 143 1460
NM_003671chr9113440 3349 2564 2431 1411 1387 1355 1176 899 658 351 53631 3034 1440 1429 439 22541 95 23050 2955
NM_003672chr161983 1928 640 351 152 23 51618 1534 1378 131 79 ----
NM_003676chr17820 796 660 615 288 277 123 --195 --
NM_003679chr172577 2526 2283 952 329 244 183 11168 33390 2518 2230 22134 1101
NM_003692chr9--11010 --1947
NM_003713chr151774 1439 1309 671 503 31542 512 350 ----
NM_003722chr392617 2587 2412 2324 2088 1741 1714 1694 802 22450 56 12701 --
NM_003743chr272285 1812 1592 1543 1409 547 207 31977 1435 775 1445 --
NM_003758chr1531108 299 103 2537 404 --11452
NM_003758chr1531108 299 103 2537 404 --11452
NM_003759chr4143911 3736 3679 3242 3062 2883 2670 2662 1347 1115 1056 668 613 59 33839 3032 2997 --11649
NM_003760chr15668 618 317 57 29 2686 183 ----
NM_003774chr12103380 3059 2715 2537 2330 535 257 131 64 55 --198 --
NM_003783chr12449 351 2893 50 --1879
NM_003795chr6------1559
NM_003800chr652300 2140 939 594 273 31970 1865 603 --11890
NM_003816chr861359 1231 1063 612 551 81 ------
NM_003825chr1551449 1313 1174 447 397 ------
NM_003861chr1482292 2257 2230 2120 1159 967 700 25 2565 100 --135
NM_003872chr2122439 2313 2296 2283 2257 1947 1092 748 505 375 145 44 42507 2198 2135 457 ----
NM_003884chr341873 1296 1157 459 21701 582 ----
NM_003895chr2142027 575 401 320 72018 1523 1475 857 457 436 252 ----
NM_003909chr863059 2860 2783 1954 1901 267 32306 614 593 ----
NM_003913chr693899 3826 2864 2734 1311 1082 981 913 451 23392 1362 13283 1279
NM_003924chr451678 1641 580 509 477 41719 1266 1100 458 ----
NM_003930chr752457 1684 640 627 57 31984 1816 69 21821 1757 --
NM_003939chr10103846 3639 3229 3035 2999 1414 914 392 331 230 34164 3586 1084 --12752
NM_003941chr772299 2145 2084 1634 1558 986 334 11576 11812 --
NM_003958chr642578 2408 1453 265 33672 2774 1405 12556 --
NM_003966chr5137561 7014 6277 6056 5550 5206 5159 4975 2314 2278 1497 832 594 67642 6596 6204 5610 970 167 26793 6566 26659 5436
NM_003980chr671245 1205 483 348 309 293 286 2950 499 ----
NM_003983chr16134429 3746 3668 3529 3364 3266 3162 3150 2863 1333 1271 831 431 13036 13581 --
NM_003994chr12113568 3356 3307 3261 3040 1752 1656 1515 1168 724 469 54142 3528 2728 527 306 11558 --
NM_004004chr1331179 354 346 11328 21105 205 --
NM_004006chrX82063 1709 1688 1681 1674 944 429 290 ------
NM_004007chrX82063 1709 1688 1681 1674 944 429 290 ------
NM_004009chrX82063 1709 1688 1681 1674 944 429 290 ------
NM_004010chrX82063 1709 1688 1681 1674 944 429 290 ------
NM_004011chrX82063 1709 1688 1681 1674 944 429 290 ------
NM_004012chrX82063 1709 1688 1681 1674 944 429 290 ------
NM_004013chrX82063 1709 1688 1681 1674 944 429 290 ------
NM_004014chrX82063 1709 1688 1681 1674 944 429 290 ------
NM_004015chrX82063 1709 1688 1681 1674 944 429 290 ------
NM_004016chrX91977 1623 1602 1595 1588 1038 858 343 204 ------
NM_004017chrX82063 1709 1688 1681 1674 944 429 290 ------
NM_004018chrX91977 1623 1602 1595 1588 1038 858 343 204 ------
NM_004020chrX82063 1709 1688 1681 1674 944 429 290 ------
NM_004021chrX91977 1623 1602 1595 1588 1038 858 343 204 ------
NM_004022chrX91977 1623 1602 1595 1588 1038 858 343 204 ------
NM_004023chrX91977 1623 1602 1595 1588 1038 858 343 204 ------
NM_004028chr1894163 3794 3393 2881 2779 1181 1055 456 163 63752 3600 3457 3151 520 22 22770 1447 --
NM_004035chr1784431 4126 3467 3326 814 376 225 37 2459 169 11377 --
NM_004067chr741309 969 539 328 ----11080
NM_004079chr162144 2103 1181 824 349 79 1224 11043 32626 2510 2466
NM_004081chrY4437 415 146 43 31719 1560 394 11268 1558
NM_004087chr352019 1245 773 367 325 --41927 1802 1375 692 --
NM_004090chr17113486 3405 2625 2473 2444 2322 1222 1032 957 182 54 23116 2219 ----
NM_004093chr13123017 2586 2561 2419 2398 1278 1219 1213 1204 943 228 140 21166 811 1310 --
NM_004096chr1041629 748 488 90 32103 841 28 --11752
NM_004114chrX41211 1201 1021 352 --21156 85 1297
NM_004226chr2--1229 ----
NM_004227chr762302 572 486 453 335 29 22835 2166 --1293
NM_004232chr18143574 3439 3143 3061 2731 2550 2419 1544 1084 1005 642 429 124 46 1338 12812 --
NM_004261chr13741 706 695 ------
NM_004273chr10104047 3972 3798 3474 1661 1198 1136 484 351 38 21083 674 44444 3525 3103 986 24408 1057
NM_004274chr1472325 2050 777 739 726 570 498 22014 1071 12289 --
NM_004279chr782393 2267 2134 2125 1846 1712 1586 122 22204 1565 1787 --
NM_004293chr983626 3582 3393 2725 2628 700 352 260 43699 3203 3053 1083 23686 437 22569 2519
NM_004311chr10113073 3032 2283 2209 2185 2011 1167 1027 807 633 296 42197 716 550 379 12042 --
NM_004319chr1103173 3149 3097 2662 2317 1268 806 769 592 345 --1321 --
NM_004331chr832341 1872 427 32376 1973 531 --22440 471
NM_004338chr18166336 6297 5994 5982 5569 5507 5221 5046 4293 2827 2781 2248 2066 1919 766 578 86774 6070 5850 4676 4467 1663 1518 1504 16827 1703
NM_004342chr772003 1783 1766 1757 1641 396 315 32098 1720 194 11953 --
NM_004361chr18--139 ----
NM_004370chr642188 722 258 150 --11597 22083 192
NM_004380chr1642640 2583 2536 719 2763 399 11864 --
NM_004384chr54817 710 462 303 62364 2329 2081 606 389 323 21593 720 --
NM_004392chr13102498 2162 2132 1991 1759 588 506 380 163 134 2651 293 1670 --
NM_004396chr17------1229
NM_004397chr11144325 3883 3802 3394 3163 3083 1655 1366 1335 800 434 164 121 27 1808 ----
NM_004412chr1045622 5355 1300 1227 75859 4889 4234 4101 1309 1238 983 ----
NM_004430chr852358 2300 1926 1793 73 62351 2125 1959 1009 852 63 ----
NM_004432chr931749 628 213 2655 473 --151
NM_004434chr1461818 1423 1326 461 443 268 21737 1455 --11683
NM_004437chr173488 2359 2332 196 162 71 47 --1850 1769
NM_004440chr641689 545 461 42 31908 751 136 1681 --
NM_004441chr34939 832 286 251 11322 --31328 370 183
NM_004449chr2151247 469 248 105 92 1266 182 --
NM_004457chr23674 495 349 21425 1068 --11312
NM_004458chrX72629 2367 1048 824 795 390 210 --31907 444 140 1809
NM_004464chr463627 3157 3117 3023 1466 1437 53488 1426 838 766 437 1674 --
NM_004472chr51517 ------
NM_004482chr21923 ----194
NM_004500chr1411390 1412 --21605 381
NM_004501chr1103473 2902 2765 1424 1121 753 300 187 129 99 24139 3721 13330 --
NM_004503chr121727 ------
NM_004504chr26955 746 718 509 122 107 12860 ----
NM_004505chr1731660 657 238 1466 173 21936 1237
NM_004520chr5--1802 ----
NM_004524chr171276 ------
NM_004529chr941372 1351 1249 123 31437 1357 918 ----
NM_004569chr142693 223 --1664 1264
NM_004586chrX125449 5001 4890 3905 3502 3356 3300 2135 1895 1442 1421 1070 13569 45174 3494 1861 1077 --
NM_004598chr572728 2587 2391 2144 1131 895 716 11307 33061 1210 947 --
NM_004612chr9144862 4672 4443 4249 4163 3875 3696 3562 3084 1059 1029 733 339 99 11503 13339 --
NM_004615chrX1887 ----1900
NM_004647chr191345 ------
NM_004670chr1041228 468 337 124 1217 21454 635 --
NM_004681chrY2233 158 2782 113 1716 --
NM_004685chr1372897 2544 2373 2172 890 485 79 12931 12098 42637 2328 1850 1166
NM_004686chr841218 1142 336 142 31494 1367 712 ----
NM_004687chr1721617 1295 31722 797 346 --1407
NM_004696chr1139 --2755 72 --
NM_004703chr1782575 2096 2090 1836 1004 443 271 109 1698 ----
NM_004717chr751536 1313 1280 318 82 11012 11227 21054 1048
NM_004719chr1242768 2243 2229 1069 --12667 12785
NM_004726chrX135698 5485 5371 5051 4710 4687 4351 3935 1549 1234 1050 884 756 24666 512 44904 1189 499 106 15363
NM_004736chr152226 1791 1652 690 500 ----1477
NM_004744chr443411 1094 1027 294 43855 3305 1432 916 23834 174 13398
NM_004745chr8176071 5948 5783 5646 5494 5417 2648 2334 2185 1435 1376 1370 1021 779 707 600 478 36821 2270 2137 22406 985 --
NM_004748chr15134247 4204 3779 3584 3443 3182 2697 2660 951 846 766 721 373 34222 3667 3107 13741 33432 3158 3152
NM_004755chr1411206 31111 765 253 11153 1164
NM_004768chr141081 775 271 165 ----11118
NM_004774chr1742585 2408 1100 917 43189 684 418 156 32929 2738 1050 --
NM_004779chr551226 980 179 155 79 ----11105
NM_004789chr91430 ------
NM_004795chr131390 ----31728 549 268
NM_004796chr1482154 1956 972 828 646 488 354 239 21767 1488 2702 670 --
NM_004798chr20103635 3306 2644 1332 1205 1093 1014 465 116 67 22794 261 ----
NM_004801chr25583 377 316 282 102 21328 616 ----
NM_004804chr262757 2728 2450 2389 628 196 12465 11934 --
NM_004817chr9--1322 --2774 742
NM_004834chr273313 2899 2399 2332 2298 920 430 22312 295 1894 --
NM_004837chr161561 1400 1372 1086 493 154 21698 1257 11266 21116 201
NM_004849chr661614 1526 1223 480 436 419 21545 1494 ----
NM_004857chr14114683 4610 4444 3645 3556 1356 1349 1206 1080 136 116 33802 1898 1428 1985 --
NM_004866chr5104569 3761 1993 1912 1503 957 773 721 620 496 44992 3197 1149 385 ----
NM_004869chr1861721 1630 1464 591 487 191 1327 ----
NM_004884chr1531764 1377 361 3653 616 301 --160
NM_004898chr472432 2380 2088 1826 615 578 289 2589 326 ----
NM_004904chr7186217 6209 6131 5682 5667 5554 5498 5371 4928 4473 4012 2118 1914 1896 1521 1074 967 33 22196 735 --12183
NM_004921chr172512 2090 1636 877 350 324 175 --22104 850 125
NM_004926chr1461805 1586 1554 1535 1159 336 1344 --1363
NM_004932chr531604 705 418 21383 606 21237 111 21279 631
NM_004937chr1722641 79 12280 12726 12656
NM_004938chr941222 909 390 247 31116 1016 214 --145
NM_004956chr794622 4089 3780 3612 2969 2961 2807 1663 1612 31750 1697 1536 13843 --
NM_004976chr11115115 4730 4342 4104 3845 3271 3213 1694 1150 807 767 34360 4245 4064 1153 1474
NM_004985chr1294148 4068 3410 3302 1754 1595 1309 944 540 13782 11244 11178
NM_004992chrX168252 8152 8041 7919 7566 6755 6394 5247 5241 3228 2678 2633 2592 1702 910 234 98425 8400 7507 2470 1622 1531 1524 1465 46 27332 6348 27255 3105
NM_004992chrX168252 8152 8041 7919 7566 6755 6394 5247 5241 3228 2678 2633 2592 1702 910 234 98425 8400 7507 2470 1622 1531 1524 1465 46 27332 6348 27255 3105
NM_004999chr6154450 3782 3750 3739 3624 3262 3228 3155 3123 2811 1561 747 591 461 283 24212 3334 14094 --
NM_005025chr3--1230 ----
NM_005036chr22248108 7471 7305 7273 7039 6820 6140 5691 5577 5464 5376 3202 3048 3040 2447 2387 2336 2260 1868 1430 999 973 465 59 57722 5918 5174 483 185 15677 12328
NM_005044chrX43042 1761 1155 662 44170 3865 3311 3125 --23853 82
NM_005056chr12105508 5237 4581 4545 4345 4015 3988 3957 2133 991 55492 5074 4490 1026 156 --14684
NM_005057chr171741 1416 1400 1247 617 520 446 --21685 100 --
NM_005058chrY1221 ------
NM_005063chr10123879 3660 3473 3318 3210 2880 2359 1260 787 697 595 156 33510 2500 502 --1148
NM_005065chr14205078 5057 4716 4610 4481 3847 3654 3568 3440 1932 1705 1687 1483 1158 1083 655 581 488 445 103 --24142 810 14590
NM_005079chr883149 2739 2709 2300 1955 862 453 281 12522 1840 --
NM_005093chr20115375 5130 5063 4265 4135 3552 3271 2125 1840 1241 1067 35017 3524 598 15116 --
NM_005119chr11421 ----1524
NM_005121chr1743147 2817 2442 581 2329 286 ----
NM_005135chr1593370 3249 2831 783 378 305 161 98 40 42421 1011 338 198 --1262
NM_005151chr1852248 2080 266 237 124 22109 942 --1136
NM_005156chr9134991 4168 3917 3301 2042 2011 1734 1665 1110 936 878 458 187 22066 1938 --13687
NM_005160chr22136185 5931 5870 5552 5028 4625 2367 2202 1718 1468 518 489 202 16209 45902 4338 2120 763 45573 1711 925 751
NM_005164chr1252620 1834 163 42 23 31868 561 103 11958 --
NM_005180chr1051240 1123 607 574 144 21474 224 ----
NM_005187chr164816 729 483 170 2831 744 1274 11480
NM_005188chr11158305 8150 7474 7175 7017 6321 6125 6087 5964 5315 3223 2645 1065 459 294 47398 3294 2132 765 37827 7786 6522 11655
NM_005197chr14155805 5797 5780 4505 3851 2224 1989 1901 1814 1725 1404 1038 568 438 285 31873 1111 925 45898 5361 783 253 11322
NM_005235chr2127082 6888 6570 6012 5864 5292 5154 5061 4931 3025 1198 480 56988 6357 2712 2409 1982 11499 12324
NM_005238chr1163327 2210 1186 1079 329 181 53365 3344 1273 923 732 22671 257 --
NM_005277chr451216 654 606 437 91 21233 1203 --11678
NM_005311chr752718 2079 638 619 56 --12091 --
NM_005339chr463884 2627 1547 1417 1049 313 23082 1540 11221 --
NM_005359chr18136567 6560 6403 6247 5447 5403 2504 1903 1727 1226 910 805 493 3873 519 385 36392 6124 5488 --
NM_005385chr372406 1954 1809 1726 1713 714 408 ----11019
NM_005392chr921299 237 21886 438 --11284
NM_005397chr773744 3513 3459 2855 2601 1303 254 23033 1033 21221 1214 --
NM_005398chr104541 382 339 308 21352 372 ----
NM_005399chr194324 3654 3150 3049 3036 1762 860 696 653 64445 1386 1274 1238 788 38 ----
NM_005400chr273055 2809 2550 2535 1146 738 187 31167 867 358 1913 --
NM_005406chr1861638 1412 1255 554 268 242 31495 1357 509 ----
NM_005433chr18122661 2332 2275 2158 1852 1012 857 803 606 559 384 77 --21755 480 --
NM_005436chr1083865 3801 3349 3217 2596 1558 827 344 33166 1611 1372 23389 68 --
NM_005458chr972481 2255 1997 1723 1570 998 98 ----12094
NM_005494chr7--1581 ----
NM_005497chr17185450 5420 5112 5074 4215 3900 3838 3826 3802 2334 2266 1438 1361 1058 963 682 495 398 44134 2002 860 574 1778 12418
NM_005502chr973191 2841 2617 559 401 91 85 32716 2285 1198 13151 --
NM_005504chr12126638 6382 6363 5355 4774 4727 2487 2075 1942 1741 385 138 36455 4912 4163 --12266
NM_005542chr761759 1640 1328 688 444 379 31656 679 496 ----
NM_005578chr394721 4424 3887 1914 1784 1100 1090 158 73 34281 4273 747 ----
NM_005593chr122170 71 ------
NM_005596chr9166102 5892 5601 5508 5293 5223 4905 4862 4530 4302 4257 4241 3934 1168 856 595 45396 4216 2308 1022 24375 771 1204
NM_005604chr671726 1698 1687 1670 1585 789 158 1165 12142 --
NM_005638chrX3515 383 232 2586 54 --1375
NM_005647chrX123438 3190 2994 2314 2130 2120 1323 1109 989 715 468 343 42885 1314 361 186 22379 1379 1202
NM_005655chr82230 161 1193 21254 115 11140
NM_005662chr8----197 --
NM_005665chr194028 3834 3807 3488 3213 3060 1667 1190 1160 34843 1774 1684 ----
NM_005668chr543418 1508 968 647 24286 3176 21734 410 24405 3601
NM_005690chr121141 ------
NM_005711chr56857 687 405 333 324 116 2356 46 ----
NM_005715chr642748 2698 2454 1071 22862 752 --32344 2085 729
NM_005722chr242448 1597 1532 878 42196 1954 834 731 --1926
NM_005725chr191960 1644 1494 914 854 712 663 370 332 --11904 --
NM_005730chr12103650 3141 2517 2389 1303 529 362 305 136 84 23054 3037 32767 1015 604 --
NM_005738chr742037 1392 1284 1266 --11956 1782
NM_005739chr1592433 2163 1947 826 573 196 147 122 115 ----2444 255
NM_005746chr752137 1991 1689 733 191 --1871 12346
NM_005748chr1293307 3238 2847 2824 2767 2512 854 810 67 11095 ----
NM_005759chr294455 4257 4088 4003 3363 3099 1646 1595 255 24512 1531 ----
NM_005779chr573372 2858 2245 1441 1026 829 541 33383 1142 1076 --12254
NM_005795chr251125 552 402 120 78 31935 592 280 12388 --
NM_005808chr373555 2675 1434 917 808 281 179 --1958 11189
NM_005813chr272652 2562 2523 2327 1937 739 563 12242 ----
NM_005822chr652376 2030 1999 1966 144 1229 1791 --
NM_005840chrX227460 7415 7234 7050 6353 6166 6133 5847 5575 5507 5281 2965 2391 1806 1765 1554 1544 1523 1379 1137 1086 1058 77400 7247 6089 5826 5307 4848 1724 1696 36958 5130 1024
NM_005843chr261673 1455 526 157 103 27 1477 --3675 669 390
NM_005859chr561249 1242 438 392 110 102 21184 276 --11363
NM_005868chr732364 1989 1860 11765 12488 2953 875
NM_005882chr4--1240 ----
NM_005895chr1264045 3285 2842 420 216 39 44116 3318 2615 866 ----
NM_005898chr1193197 3133 2834 2675 2429 1138 979 966 70 21038 333 ----
NM_005901chr18208704 8538 8061 7963 7599 7112 6718 5872 5461 3478 3261 3151 1947 1307 1182 1055 1027 586 277 104 66881 6660 6087 5933 1993 519 37490 6064 97 18397
NM_005902chr1594635 4335 3980 3802 3544 1172 901 724 420 64530 4478 4302 3784 3388 3099 --11159
NM_005903chr575183 5098 3580 1883 1483 500 211 44414 2001 566 458 2480 410 --
NM_005906chr6----1118 11519
NM_005909chr551616 1360 1079 415 80 34075 3862 3785 24328 4319 13756
NM_005935chr4125177 3862 3838 3424 3377 3246 1828 1688 1446 834 412 251 34522 3367 110 --1194
NM_005937chr1764170 3816 3001 552 485 323 --34049 2657 1186 13566
NM_005941chr8104026 3887 3528 3348 3227 1656 1546 1491 463 333 32646 936 394 167 13169
NM_005944chr351249 446 185 92 58 3793 105 65 1125 --
NM_005955chr1165489 5359 4670 4427 4278 4154 3688 2221 2184 1373 1347 1210 940 917 218 32 65520 5287 5182 3714 3582 3382 45197 5187 1481 500 --
NM_005962chr10112318 1871 1787 1521 840 807 799 583 562 179 138 22203 411 12345 --
NM_005962chr10112318 1871 1787 1521 840 807 799 583 562 179 138 22203 411 12345 --
NM_005966chr2101961 1704 1644 812 525 472 263 194 181 128 --1910 --
NM_005986chr1362437 1984 725 318 289 122 32592 1029 903 11829 --
NM_006007chr983339 2992 1778 1628 1478 919 843 695 64445 4365 3481 1640 1122 69 14382 13521
NM_006011chr1563852 3617 3285 520 433 307 11615 23562 702 11325
NM_006015chr131135 1042 140 ------
NM_006037chr294416 4391 4314 4186 3942 3793 1858 1688 935 21235 1090 34568 3136 650 13458
NM_006048chr121280 982 21183 475 1221 2487 60
NM_006055chr2103161 2785 2629 2536 2526 2454 2376 2269 528 348 23037 2262 1650 --
NM_006106chr1142698 2228 1136 217 33379 3267 2441 13118 --
NM_006113chr182045 1309 835 703 683 275 97 58 31360 695 417 1260 --
NM_006136chr72961 278 31367 1322 510 --162
NM_006141chr1662401 2100 1069 1043 633 443 32676 1890 565 12239 --
NM_006154chr1542574 2032 1977 419 52110 2005 1998 731 135 ----
NM_006158chr831160 533 107 11745 ----
NM_006187chr1293148 2956 2842 2816 2778 2750 1195 1181 697 22741 1131 12038 --
NM_006197chr822137 1522 2720 390 ----
NM_006201chrX11217 ------
NM_006203chr5125279 5185 5111 4622 4372 4338 4039 2038 1460 830 371 289 44576 4071 2101 378 35005 3640 317 --
NM_006206chr482453 1187 1130 1095 995 621 522 274 2867 726 --12029
NM_006252chr1137620 7600 7544 6653 6486 6341 2707 2483 2021 1779 688 575 439 57553 2777 1513 1331 453 1522 11491
NM_006264chr4--1432 ----
NM_006275chr2081960 1933 1870 1714 1638 700 477 91 22006 956 --1775
NM_006282chr20114470 3721 3687 1705 1498 1205 872 866 697 657 215 23804 1635 ----
NM_006283chr8114922 4021 3840 3775 3456 3427 1654 1167 1026 1006 589 63947 3472 3387 1800 1115 122 --13137
NM_006290chr661962 1902 1593 777 487 402 31864 1838 203 11456 --
NM_006306chrX145677 5611 5518 5484 5409 5301 5213 4591 2310 2107 1420 1080 474 438 14066 25376 4211 15291
NM_006313chr1261584 1481 1425 1056 585 24 11362 189 --
NM_006315chr474006 3230 1529 1453 1286 1280 530 54524 3996 2796 1520 521 23124 1125 23711 1611
NM_006317chr51754 ------
NM_006352chr141746 1347 177 107 2781 82 --11474
NM_006353chr64960 567 482 81 ----11300
NM_006366chr641247 916 539 72 160 ----
NM_006369chr11432 ------
NM_006371chr3125278 4745 4059 4016 3697 3568 3240 2022 2008 1719 1617 1012 34267 3447 1413 --14895
NM_006375chrX31811 1389 1296 3684 659 420 2589 260 --
NM_006379chr742054 1753 464 430 11862 --1735
NM_006380chr17104132 3835 3725 3076 2928 1583 498 477 347 298 ------
NM_006393chr10154014 3945 3913 3845 3412 3356 2926 2799 1769 1721 1224 857 716 498 61 21582 1566 31690 1323 1072 12770
NM_006420chr2093260 3158 2955 2174 1249 1014 928 730 716 13494 ----
NM_006431chr121202 ------
NM_006464chr2124241 3941 3739 3601 3335 3264 3124 941 567 531 342 126 23723 143 ----
NM_006482chr1273453 1577 1326 1168 1112 713 618 23534 230 12434 --
NM_006489chr1451912 1877 1463 547 79 3597 529 510 1684 --
NM_006529chr471665 1488 1365 641 559 130 40 21544 552 --1378
NM_006538chr2103919 3678 1614 1550 1274 825 610 581 464 138 23857 2906 ----
NM_006544chr14176088 5881 5239 5179 5042 4887 4641 4230 2328 1981 1644 1174 840 685 516 316 309 184 11019 --
NM_006546chr17216680 6369 6329 6267 6030 5738 5656 5546 5025 4821 4548 4324 2539 2070 1905 1775 1769 1531 683 292 272 36142 2167 1760 21389 1004 --
NM_006547chr751719 1347 1327 1321 263 1593 ----
NM_006557chr961573 1520 1504 1383 1352 529 11746 1668 --
NM_006561chr10105438 4511 4495 4409 1996 1591 1099 1071 904 108 12348 14704 --
NM_006587chr461472 1147 686 609 68 41 21257 1087 --2226 94
NM_006591chr1191696 1589 1560 1458 678 534 196 166 114 21703 225 1637 --
NM_006599chr16117581 6597 5836 5534 5526 5215 5171 5033 2908 1959 1452 95374 2734 2266 1307 1123 574 477 430 149 16483 36933 2553 596
NM_006603chrX41931 1457 792 667 31749 592 550 1620 11626
NM_006609chr262771 2737 1995 786 779 116 12541 11131 12811
NM_006614chr3113683 3502 3030 2835 2297 1213 743 611 428 119 63 13138 23062 541 --
NM_006620chr674254 4217 3462 3244 1953 592 81 54191 4044 3694 502 396 13895 --
NM_006624chr1031937 1369 70 31537 1382 195 --1480
NM_006628chr1574547 3352 3015 1455 1126 812 420 23909 784 --23889 806
NM_006629chr1852807 2565 823 784 664 22777 2427 1778 22801 1940
NM_006633chr5--1557 ----
NM_006646chr1362825 2271 2238 1018 893 692 21170 1126 12080 12467
NM_006654chr1264723 4337 1900 1639 576 520 43813 3405 3184 622 ----
NM_006667chrX1853 11066 --2978 352
NM_006675chr12----12222 23443 2974
NM_006682chr732847 2749 2658 2930 919 22191 1867 --
NM_006699chr142626 2589 2014 496 42339 1980 843 328 --12374
NM_006717chr972823 1313 774 657 252 207 91 32625 957 596 --12474
NM_006720chr1074920 4595 4427 3760 3207 1302 347 54891 3312 1759 905 192 24539 1686 1684
NM_006722chr372858 2815 2526 2304 1092 566 277 22809 2708 12179 --
NM_006729chrX115415 5193 4626 3756 2187 1633 1278 578 528 507 374 25477 4527 24751 1790 1870
NM_006738chr15144084 4037 3968 3947 3404 3388 1822 1393 1156 903 783 693 465 322 14001 11032 --
NM_006748chr8141552 1539 1351 1278 663 561 443 255 175 121 115 74 42 33 --1427 --
NM_006750chr16178117 7955 6214 6126 5949 5864 5392 3213 3147 2457 1526 1029 737 552 205 158 23 47795 2556 707 68 11900 --
NM_006751chr22997 129 --21029 955 --
NM_006763chr172066 1660 1473 1410 1403 556 100 11898 21801 151 --
NM_006766chr8112676 2467 2452 2321 2171 2151 2006 1999 816 337 294 ------
NM_006775chr672368 1093 1085 844 562 555 155 42491 924 651 510 ----
NM_006777chrX82531 2231 879 750 647 253 237 57 1154 12328 --
NM_006808chr9------167
NM_006823chr831244 941 424 1440 --11104
NM_006826chr21952 31005 511 214 ----
NM_006827chr1473404 3148 3088 2151 1240 717 564 33125 2669 2280 12890 13163
NM_006838chr1231791 1336 185 ----1153
NM_006846chr5--1280 ----
NM_006851chr12112458 2347 2233 2176 2161 974 899 798 735 500 140 52740 2387 1815 991 482 ----
NM_006854chr74666 458 163 157 11866 1290 21327 69
NM_006857chr21172 3776 614 565 --1603
NM_006873chr2103541 2945 2888 2526 2199 1151 1090 980 657 414 --22377 2335 2822 261
NM_006885chr16103182 1671 1654 1464 906 716 471 287 231 141 53904 3783 3154 1269 404 ----
NM_006888chr1472313 2274 2206 2149 1366 1276 92 11327 --1140
NM_006901chr152493 177 2553 409 1414 1171
NM_006912chr142065 974 912 754 22355 1708 11640 1673
NM_006914chr931191 1043 324 11486 --157
NM_006915chrX81972 1570 896 823 761 290 280 209 ------
NM_006916chr221143 293 ----1395
NM_006918chr1164062 3861 1776 1356 1106 172 85244 5105 5006 4679 4659 4261 1755 1073 25084 4392 --
NM_006920chr221438 603 ----11941
NM_006922chr262223 2121 1987 499 200 81 22195 773 11875 12184
NM_006924chr1794444 4310 3917 3623 3483 2771 1687 1029 445 43847 3218 922 546 13739 --
NM_006948chr2152150 1802 1515 255 78 11641 ----
NM_006962chrX21314 883 2162 72 1146 --
NM_006981chr962756 2574 2311 1908 467 62 2128 112 1952 --
NM_006996chr141615 767 706 180 21519 1409 1247 1277
NM_007006chr1673471 2265 1243 1038 441 86 26 12508 ----
NM_007007chr1294664 4504 4413 3988 3464 1896 1868 310 237 23690 1251 ----
NM_007011chr15116651 6135 5645 5306 5125 2133 1633 898 523 427 348 35213 4769 4306 11275 11797
NM_007030chr585005 4786 3793 1622 1486 1168 829 307 33967 1829 1702 21546 663 --
NM_007034chr15354 259 185 160 51 ------
NM_007038chr21105975 4778 4541 1694 1187 853 816 522 466 159 45624 1963 1293 658 --15810
NM_007042chr392564 2460 2370 2072 1022 676 514 505 89 --2727 611 --
NM_007050chr20257875 6965 6448 6224 6166 6120 6097 5443 5336 5201 5032 2987 2689 2659 2605 2200 2095 1690 1478 1235 1192 1029 553 256 203 67930 6998 6436 5686 2145 2133 36707 2568 1921 47586 7464 7458 2681
NM_007064chr3111566 1227 1100 1072 353 345 250 240 230 201 172 ------
NM_007073chr6104105 3501 3127 2820 2771 2708 1700 1662 1322 938 42801 2612 2598 450 13011 --
NM_007078chr1083083 2980 2314 2176 2138 826 738 60 22162 288 1280 --
NM_007111chr131296 ------
NM_007114chr332726 2681 2038 53048 2147 1057 1037 547 ----
NM_007145chr1961439 1158 945 424 248 32 --1575 --
NM_007146chr1742412 2013 1761 768 32622 80 34 ----
NM_007174chr1242136 2053 1608 313 1851 12272 12310
NM_007200chr15144084 4037 3968 3947 3404 3388 1822 1393 1156 903 783 693 465 322 14001 11032 --
NM_007203chr9103299 2682 2660 2574 1073 1067 932 533 275 207 43851 3689 1449 72 1133 --
NM_007222chr851808 1311 697 538 138 31853 1475 120 ----
NM_007249chr13219474 7934 7828 7440 7241 6290 5957 5830 3581 3490 3294 3163 2882 2411 1965 1726 1332 1020 784 95 32 97849 6128 2997 2953 2926 2814 1240 1006 509 15919 13425
NM_007292chr1784431 4126 3467 3326 814 376 225 37 2459 169 11377 --
NM_007345chr1872374 2145 1961 1930 1620 456 183 4845 405 367 57 --1757
NM_007347chr1583201 2951 2713 2606 1968 1269 1014 222 22014 742 ----
NM_007350chr12174272 4227 4173 4004 3752 3668 3653 3163 3056 3004 1705 1355 1272 1072 674 623 617 54502 4290 3377 2836 1023 --189
NM_007353chr782799 2231 1206 994 608 564 452 171 12565 --12185
NM_007361chr143530 428 161 --1481 174
NM_007375chr161900 985 821 762 282 171 32726 2134 571 --1508
NM_012063chr121141 ------
NM_012081chr563673 2474 2411 1103 809 356 --23239 2523 1934
NM_012082chr8--2802 359 --1382
NM_012089chr141145 570 364 138 31433 1283 348 ----
NM_012095chr10102821 2517 2474 957 847 770 742 461 326 300 1294 32907 541 353 12418
NM_012096chr3123721 2922 2876 2686 2289 1444 1403 1127 894 772 639 64 33302 2796 1334 --11053
NM_012097chr262295 2284 764 311 282 61 32259 687 440 --11734
NM_012102chr152213 957 705 668 263 --1440 189
NM_012104chr11173652 3632 3575 3182 3139 3105 2984 2874 2766 2494 2406 1291 1062 795 711 355 156 31102 645 215 33720 1401 764 12947
NM_012104chr11173652 3632 3575 3182 3139 3105 2984 2874 2766 2494 2406 1291 1062 795 711 355 156 31102 645 215 33720 1401 764 12947
NM_012120chr652696 2628 2464 2247 719 32868 2027 141 12255 145
NM_012129chr772529 2499 2334 2316 1956 814 64 31772 575 402 1324 --
NM_012137chr182468 2437 2116 1033 822 805 794 754 ----11920
NM_012141chr1363586 3524 3511 3457 799 602 83370 3068 1445 813 491 393 199 123 1978 --
NM_012156chr2042961 2471 520 494 31228 831 146 12527 13294
NM_012157chr34756 707 300 127 1113 1938 1670
NM_012158chr1371875 1623 1557 1480 1266 643 624 11224 11514 --
NM_012164chr9197223 6634 6579 5860 5655 4899 4690 4564 2977 2705 2645 2632 2601 2026 1080 1008 883 474 418 65573 5214 5039 2983 1384 736 25446 2152 27182 6644
NM_012193chr1185324 4883 2075 965 487 477 214 74 11046 34865 1364 1281 25358 632
NM_012199chr173606 3433 3112 960 905 266 37 23869 3188 1377 --
NM_012214chr2176414 6141 5669 5507 5150 5119 4798 4486 4209 4109 4097 4090 4012 2116 1927 1886 1133 55607 4845 4283 4062 1232 ----
NM_012234chr373693 3642 3222 2804 2394 1346 1217 22863 2843 13064 1831
NM_012238chr1031587 1203 361 1629 11250 --
NM_012249chr263290 1219 1190 1036 477 267 2178 48 22474 628 12602
NM_012252chr794930 4632 3873 3666 1585 1460 1409 1271 146 85014 1922 1529 668 547 302 139 35 --14458
NM_012262chr1115077 3523 3501 1963 1905 1874 1695 1495 1470 992 291 65059 4605 3869 3661 1369 755 24460 1015 --
NM_012281chr762392 1896 1652 1571 1506 825 12023 ----
NM_012287chr374185 3840 2953 963 691 244 213 63936 3920 3494 3145 2883 800 24232 302 --
NM_012294chr753538 2606 365 221 134 23106 830 2892 528 1235
NM_012297chr432236 653 274 32225 2054 125 --12192
NM_012301chr731898 1643 1512 31676 1484 383 --11715
NM_012309chr1174872 3921 3492 3348 1739 1442 1280 55007 1846 1329 1307 566 --1860
NM_012316chr185338 5214 4216 3615 1212 1155 691 303 156 1611 11499
NM_012320chr16--11386 ----
NM_012322chr7----1357 --
NM_012329chr1741476 1409 336 148 ----11644
NM_012330chr1081769 1205 644 619 611 250 163 146 21721 723 ----
NM_012334chr5114128 3846 3808 3303 3141 1379 1364 1264 1220 1112 971 44630 3821 1890 652 14541 --
NM_012343chr52861 258 1132 --2247 167
NM_012347chr682594 2504 2379 1898 1041 933 768 461 52771 2547 2255 1993 61 --12303
NM_012383chr9175 ------
NM_012408chr203719 690 646 21003 351 --2891 78
NM_012416chr951111 937 848 841 358 141 ----
NM_012420chr1072335 2064 1929 1797 539 524 428 12211 ----
NM_012425chr10122584 2500 2097 1931 1866 1809 1696 1094 735 512 414 319 22536 1786 --1231
NM_012431chr743128 2969 751 96 42367 1354 846 57 ----
NM_012465chr1073059 2301 2100 1285 1262 378 329 1542 12685 12494
NM_013229chr1262617 2520 2366 2318 2199 2177 --1128 --
NM_013231chr14114422 3887 3576 3033 2997 2917 2893 2852 796 247 171 64021 3714 3323 2674 1361 560 ----
NM_013233chr271459 1448 1442 1323 1096 367 124 11297 2386 276 --
NM_013253chr11--11431 ----
NM_013255chr7288576 8543 8308 8261 7857 7663 7422 7310 6999 6957 6784 6638 6283 6237 5751 5677 5392 3105 2983 2961 2812 2259 1888 1836 884 807 796 295 33239 1441 1275 38255 8061 7264 --
NM_013257chr871988 1897 971 901 859 237 179 51729 1672 1559 894 522 11616 12064
NM_013261chr463366 3219 2834 1262 488 211 22659 2453 1934 11338
NM_013269chr12153820 3703 3685 3601 2950 2927 1318 1190 1142 1041 887 671 583 301 243 43159 964 933 36 23450 1091 23752 1639
NM_013286chr373765 3750 3133 2872 754 570 364 12508 11520 144
NM_013302chr1663705 3656 3441 3041 3021 1736 43432 3030 1754 240 --11713
NM_013309chr1562267 2156 2131 2017 787 175 22650 868 1504 --
NM_013322chr751552 1330 1289 1269 63 11239 ----
NM_013341chr2112967 2862 2117 1834 1098 1025 877 624 592 568 247 143 ----
NM_013372chr15103110 2843 2733 2599 2075 1193 726 438 404 103 23395 2328 2717 696 --
NM_013381chr1232377 798 37 1656 --1450
NM_013382chr1442371 1997 1944 1717 --12386 21557 524
NM_013423chrX41311 997 397 125 --21031 115 --
NM_013427chrX41311 997 397 125 --21031 115 --
NM_013438chr941628 1245 689 563 2361 348 1650 --
NM_013444chrX----1323 --
NM_013448chr14--1670 ----
NM_013449chr1292879 2696 2646 2586 2450 2311 2237 665 235 12329 ----
NM_013943chr183230 2603 2567 2065 1074 840 680 674 22376 630 22312 573 12002
NM_013989chr14115153 4874 4592 4554 3571 1708 1610 840 329 220 37 24368 49 13940 14308
NM_013995chrX42251 630 222 32 141 1640 --
NM_014011chr272411 2174 1054 792 666 580 470 12254 1415 11836
NM_014016chr341286 689 462 409 ----1117
NM_014021chr172770 1264 1225 789 537 181 171 33384 2541 1156 13357 3831 264 212
NM_014028chr643372 3204 2574 349 33021 2840 570 ----
NM_014033chr1272207 2060 2012 1490 858 772 21 12304 --11549
NM_014034chr631507 1345 1098 41542 1445 1060 279 ----
NM_014035chr5--21108 25 --21376 31
NM_014043chr31242 1386 ----
NM_014048chr16155316 5088 4671 4296 4278 4233 3864 3680 3617 1850 1562 968 698 674 58 31377 391 281 11622 54650 4595 3269 1685 504
NM_014089chr1352076 1830 1682 1552 410 ----1772
NM_014112chr8104544 4502 4229 4173 4148 3998 3489 3389 1218 179 44919 4644 4452 3660 14984 1917
NM_014117chr1692308 1908 1678 1064 310 282 142 74 39 22681 2097 12503 --
NM_014141chr7145161 4567 4534 4421 4016 3442 1877 1806 1756 1484 1424 811 395 359 55241 3274 2041 1978 1341 11983 23248 68
NM_014155chr1185496 2943 2701 2657 2556 1262 627 365 86389 6029 2574 2143 563 204 135 75 16226 24797 896
NM_014157chr1673876 3630 3216 1515 999 992 465 23363 48 13339 --
NM_014181chr292751 2602 2007 1931 1817 978 330 309 153 12498 --11022
NM_014191chr125828 675 392 296 185 1380 --1373
NM_014217chr161842 1394 1338 1256 149 104 31777 1698 706 ----
NM_014231chr1221643 551 31655 701 217 --22208 2167
NM_014240chr383644 2813 1619 1527 1519 926 819 291 33969 1534 691 ----
NM_014243chr451612 1308 633 336 235 --21461 728 --
NM_014255chr12----1119 --
NM_014283chr141419 1400 310 26 2144 109 --1269
NM_014309chr2235447 914 436 55155 3695 3509 1581 1532 23968 3888 --
NM_014319chr1261743 1710 1479 341 149 132 ----1329
NM_014325chr1252192 720 277 228 207 12032 --1432
NM_014331chr4156789 5822 5514 5500 2959 2562 2538 2445 1309 1248 1137 782 572 413 110 107343 6554 6018 5421 3074 2878 2433 1920 1112 436 34774 4724 2479 15003
NM_014333chr1162273 2115 2019 1949 1839 516 11042 ----
NM_014350chr54912 799 745 201 2834 176 ----
NM_014372chr171985 1450 1428 1421 1363 439 76 3474 186 154 1109 --
NM_014376chr552338 1869 786 450 57 3616 227 44 1951 --
NM_014379chr82824 301 --127 --
NM_014381chr14103236 3091 2666 2479 2195 1249 1076 238 32 23 23039 789 13122 --
NM_014388chr1116102 5909 5476 5217 5012 4052 1742 1261 212 171 88 25936 1608 --14913
NM_014395chr441785 1291 1231 585 11942 --1125
NM_014396chr742150 1984 1681 366 ----21623 67
NM_014418chr1451852 1779 1682 1295 575 31253 568 257 21720 424 --
NM_014423chr595129 4775 4580 1763 1586 1301 1233 816 762 54908 4257 2253 2164 790 15330 --
NM_014445chr34816 733 558 550 32116 952 450 11898 --
NM_014456chr1051843 1693 1378 562 542 1216 --11562
NM_014469chr111708 2583 232 1524 1667
NM_014521chr22542 329 --11804 --
NM_014554chr1251915 1795 407 331 288 1703 --22270 2092
NM_014572chr1331794 1429 555 31290 1256 265 ----
NM_014573chr1741845 1187 726 540 1615 --21510 130
NM_014584chr1441477 282 252 47 1203 --169
NM_014607chr241919 1799 1706 232 31977 1494 167 ----
NM_014613chr5133074 2985 2422 2188 1023 930 664 602 547 380 142 91 42 32513 481 466 1820 --
NM_014615chr1693020 2708 1381 1113 853 767 761 598 131 11038 33126 1100 582 12469
NM_014616chr342991 1028 943 480 43224 2173 1380 157 22998 2780 --
NM_014630chr1553919 3667 3407 1314 80 24026 3698 --1679
NM_014647chr163839 503 307 1316 32134 625 60 --
NM_014666chr551094 893 261 149 136 1514 --1186
NM_014667chr362273 1979 1943 1670 1655 563 12453 ----
NM_014670chr241621 1417 1296 646 2430 411 11403 --
NM_014674chr3104026 3940 3923 3193 2733 2428 1583 682 559 92 23794 1256 ----
NM_014676chr151425 1330 1131 364 165 11303 11343 --
NM_014682chr821995 27 22217 195 11530 1652
NM_014689chr21405 1567 1499 --
NM_014701chr1582876 2684 2168 2108 771 534 453 298 22770 340 ----
NM_014702chr673345 3328 3036 1122 1083 428 31 --11392 --
NM_014705chr74737 727 383 161 11504 --1809
NM_014711chr1671915 1795 1651 533 417 401 94 12111 --1564
NM_014721chr6157446 7351 7110 5499 5274 4648 2692 2458 2160 2008 1705 1249 323 293 192 86982 5180 4773 4633 4522 2367 1733 1580 31131 678 268 --
NM_014729chr892294 1842 1738 1675 1580 1497 1480 1468 316 22192 607 11620 --
NM_014730chr12124685 4208 4117 4095 4048 3852 3454 3395 3252 1688 1084 1055 75252 5011 4588 4419 4380 1108 517 ----
NM_014730chr12124685 4208 4117 4095 4048 3852 3454 3395 3252 1688 1084 1055 75252 5011 4588 4419 4380 1108 517 ----
NM_014735chrX41331 662 346 71 11842 --2700 692
NM_014739chr683956 1595 1328 1051 847 624 575 505 94218 4101 3366 3193 1670 1481 1284 654 596 ----
NM_014743chr483174 3151 2935 2210 2075 1997 903 665 22488 2198 ----
NM_014746chr294300 4242 3888 3879 1694 1308 1268 1018 611 2949 430 13574 12674
NM_014747chr1135528 5453 4948 4260 4143 3948 3897 2147 2092 1855 1775 1486 302 55622 4581 4181 3747 1549 24815 3537 --
NM_014751chr821825 91 52005 1744 1371 524 439 --21791 1632
NM_014755chr2144302 3972 3557 3416 3380 3329 3279 3182 3019 1314 1243 729 375 321 23322 1172 ----
NM_014766chr783313 2801 2460 2371 1409 618 429 310 41166 1094 371 339 22929 2365 --
NM_014774chr192692 2635 1184 1159 1102 813 422 152 142 22739 464 21062 599 12299
NM_014779chr331137 864 378 2902 38 1148 186
NM_014787chr182781 2592 2555 2240 1855 770 543 194 12366 1370 12681
NM_014803chr1062076 1092 709 224 151 122 131 22530 195 --
NM_014810chr183090 3043 2965 2912 2854 1055 710 90 13204 ----
NM_014812chr111726 21241 217 ----
NM_014819chr522142 1994 --22415 585 --
NM_014824chr1151998 1838 1791 1643 472 ----11460
NM_014826chr1114323 3568 3341 1465 881 685 601 578 406 284 98 22730 1533 23198 2849 11255
NM_014835chr2051604 536 501 397 386 1634 22151 1702 1709
NM_014838chr2272864 2766 2565 2371 1150 1049 914 ------
NM_014839chr172513 2260 1996 1612 278 253 37 2937 185 12083 --
NM_014850chr393505 3423 3193 3003 1932 1896 1645 678 596 14203 1830 1850
NM_014859chr171903 ----11442
NM_014864chr193882 3191 2727 1727 1529 1522 1018 793 285 33820 2667 729 14219 1871
NM_014870chr1104744 4693 4455 4060 4020 3687 1683 1428 1190 298 33795 3032 315 43993 3287 1666 819 13140
NM_014873chr154714 3681 1877 1034 754 54842 4361 3548 575 103 43521 3027 1615 622 24059 3189
NM_014877chr17116789 6673 6263 5772 1944 1634 1538 1260 780 325 284 37540 6718 628 --12121
NM_014888chr731519 1131 28 61277 614 580 280 233 91 1981 --
NM_014893chrY82368 2181 1637 860 760 666 130 55 21981 218 ----
NM_014898chr1972309 2123 962 819 401 245 161 32486 2129 631 1722 11598
NM_014900chr241080 447 155 149 11172 1744 1338
NM_014904chr1093668 3531 3084 2661 1521 879 666 310 167 23877 3323 1760 13967
NM_014906chr1794077 3552 3484 2901 2816 642 569 519 511 22599 1272 --2942 901
NM_014912chr1083365 2778 2480 1376 1066 989 834 444 43010 2436 2418 2161 ----
NM_014920chr682796 1218 1117 904 815 797 596 531 31278 101 40 --13328
NM_014923chr1322180 568 3761 687 448 --12154
NM_014924chr1472983 2845 2349 2342 878 451 416 23071 1077 ----
NM_014926chr351162 1054 815 58 42 1979 ----
NM_014932chr332023 1784 704 21965 1443 1493 1754
NM_014934chr13114030 3917 2916 2459 1432 1381 1312 1054 973 477 264 1647 22718 30 1936
NM_014936chr642473 693 628 455 32184 1866 610 ----
NM_014946chr2123068 3009 2857 2786 2641 2327 2318 2164 2069 904 556 41 22873 682 11107 --
NM_014953chr1364124 3647 2824 1046 515 45 54014 3018 585 578 402 ----
NM_014961chr462193 2132 297 228 115 54 1636 11930 --
NM_014962chr2081970 1935 1827 959 861 752 383 201 21956 1877 ----
NM_014965chr3102210 1684 1421 668 574 483 372 317 170 142 11855 ----
NM_014977chr141142 ------
NM_014982chr14115359 5051 4817 4496 4309 3379 1648 1640 471 282 77 25072 1076 --11921
NM_014989chr661477 772 753 725 716 349 ----2580 81
NM_015000chr12122560 2510 2327 2193 2144 961 813 792 451 247 122 30 12298 --12273
NM_015008chr393103 2576 2442 2420 2265 1424 1258 634 150 33034 1442 620 1613 13040
NM_015020chr1673174 2894 2733 2640 1054 675 458 23613 564 13320 12443
NM_015025chr231834 982 736 11083 32399 2366 1952 --
NM_015026chr12124164 4036 3956 3570 3371 3190 3044 1913 1885 1240 1136 481 53731 3313 3035 557 24 1181 13442
NM_015032chr1372963 2102 1794 1100 1053 597 33 ----11983
NM_015033chr993282 3017 2993 2956 2870 2785 2768 2540 2045 12864 ----
NM_015035chr2076356 5967 5673 5582 4391 4181 62 55910 4837 2478 2401 1598 26103 2589 --
NM_015039chr154353 3839 3298 1453 460 63777 3648 3188 1751 1348 1257 --12700
NM_015045chr1032048 770 61 --12189 1400
NM_015046chr942437 2378 941 297 32732 1045 557 1184 --
NM_015051chr9103156 3069 3015 2948 2712 2600 2567 2074 1215 258 1644 13181 --
NM_015055chr1162777 2698 2061 1098 523 72 22098 1137 12447 1172
NM_015059chr15103907 3592 3322 2672 2442 1299 861 672 460 291 33504 3480 1344 23735 3192 --
NM_015068chr7113827 3723 2939 1404 1378 1358 1284 937 543 386 184 21369 1028 12419 --
NM_015071chr5156120 5931 5424 5306 5220 5198 4871 4845 4609 4541 4479 4141 4039 2565 2344 35715 1984 1228 25525 5464 36111 4676 4572
NM_015074chr184439 4386 4339 4159 3913 1846 231 47 23972 3065 ----
NM_015076chr664023 3676 1400 1035 923 895 34143 3829 1068 21633 807 --
NM_015082chr572588 2573 2441 1958 1702 886 450 12132 11745 2795 95
NM_015087chr1382572 2204 2018 1002 894 798 342 162 32713 753 559 ----
NM_015090chr1156269 6188 5440 5013 4539 4524 4422 3965 3921 1834 1585 1465 939 881 571 --24382 1088 12282
NM_015091chr143856 265 67 --134 --
NM_015092chr16124708 4560 4513 4185 4162 4080 4052 3601 3406 1202 535 528 34445 3643 233 --1906
NM_015094chr2294708 4648 4476 3867 3209 3022 1531 565 63 14616 33861 810 793 --
NM_015097chr3102273 2179 2109 1791 1637 1504 1442 707 370 35 22084 216 ----
NM_015100chr121638 588 ------
NM_015107chrX52462 1736 1617 642 605 32244 2010 887 1426 31843 1611 140
NM_015110chr972367 2344 690 554 287 186 75 4924 819 611 98 22199 1882 --
NM_015115chr493111 2851 2843 2278 2001 1164 727 424 290 23234 2016 ----
NM_015141chr362769 2672 2641 2074 2063 1948 ----11960
NM_015144chr16154032 3853 3578 3488 3454 3333 2986 2490 1503 1276 1232 1061 573 505 109 43510 2872 1552 293 12464 --
NM_015149chr172238 1561 1381 871 864 594 491 31745 1612 1414 --136
NM_015176chr11702 41537 1237 1098 485 11190 --
NM_015185chrX63048 2791 2665 972 330 287 178 1201 1754
NM_015199chr3123009 2814 2783 2333 2237 1053 1040 612 437 396 332 176 81934 1207 1109 886 646 389 163 64 ----
NM_015200chr4102445 2276 2202 2121 1963 1696 1625 605 480 264 1222 12337 143
NM_015206chr1593638 3382 3361 1499 1260 1019 794 362 247 53531 3306 3037 2901 1059 --12429
NM_015208chr1883787 3754 3452 2908 1559 1182 389 276 33691 3596 3029 ----
NM_015215chr152388 1095 1041 470 323 1704 --11237
NM_015225chr973128 2749 2478 2443 2012 864 568 ----12697
NM_015226chr16133490 3479 3173 3109 2617 2478 2235 2104 998 542 497 371 156 1413 12412 --
NM_015235chr1041847 429 362 70 21761 1446 --1443
NM_015239chr9--1116 ----
NM_015247chr1695111 4732 4417 4388 3548 3476 1588 1282 1229 41438 1325 1222 187 ----
NM_015252chr22838 63 1968 ----
NM_015270chr1261987 1612 651 641 561 119 1807 --21747 293
NM_015271chr463769 3512 3476 1444 878 101 63850 1648 1051 1019 735 530 21235 884 3986 748 377
NM_015272chr1622044 665 31400 807 476 --1354
NM_015275chr1272097 1344 1337 472 423 267 186 21426 136 2590 172 --
NM_015278chr6173335 2793 2634 2395 2311 1165 1089 1016 821 552 526 446 261 254 177 112 106 33466 2808 2787 42286 708 485 33 --
NM_015282chr292132 2061 1052 1042 805 713 474 239 219 32383 1151 35 ----
NM_015285chr1872412 2125 1786 1006 889 813 271 --11638 2827 316
NM_015286chr1532455 2293 464 1197 159 12154
NM_015288chr573525 3009 2854 2768 1502 1339 581 33553 2873 536 1311 --
NM_015310chr8138214 7687 7660 7545 6381 6278 6142 5485 5404 2656 2543 600 95 45959 5097 3256 1858 26623 3355 --
NM_015313chr1194480 4018 3781 3064 2987 1187 1172 620 495 43519 1866 841 370 11871 11254
NM_015314chr7102451 2387 2187 2102 2087 2041 1771 466 87 76 1533 11698 12061
NM_015315chr5113505 3319 3064 2966 2570 2286 1076 984 912 800 601 ----12802
NM_015317chr251928 1085 942 769 288 1352 --12547
NM_015322chr15--143 ----
NM_015335chr12132595 2566 2399 2142 2053 2003 1016 890 835 733 574 339 315 21742 778 ----
NM_015336chr1252124 1077 1015 1009 726 1863 --3542 165 100
NM_015349chr673008 2656 2215 1241 1175 614 420 3886 232 175 --21038 86
NM_015355chr1751960 1858 1821 1752 1725 1237 ----
NM_015365chrX124008 3764 3645 3438 3132 3067 2918 2636 1616 973 809 661 1920 23470 1172 --
NM_015375chr1114809 4795 4766 4557 4107 1476 1170 656 537 250 232 11465 --1772
NM_015378chr182777 2358 1901 1103 923 882 628 471 2461 153 --11146
NM_015394chr1272386 2168 1604 1540 765 392 219 128 1858 12424
NM_015396chr351442 1259 1166 898 195 31471 1296 1041 1950 1128
NM_015409chr1262541 1989 1960 311 225 94 42764 2404 680 540 1360 --
NM_015423chr1161601 1560 1108 288 100 21 1144 1692 --
NM_015435chr841144 1073 424 199 31202 947 233 197 --
NM_015455chr583897 2766 2733 1603 585 572 472 152 13446 11538 --
NM_015458chr894987 4372 4165 2090 2084 1979 1968 1453 1291 25070 688 11532 --
NM_015520chr392788 2296 956 736 631 562 285 268 87 42598 873 337 114 ----
NM_015532chr1572267 1096 797 179 155 136 120 1905 1981 --
NM_015535chr263997 3344 1356 1245 820 76 24021 3297 ----
NM_015550chr783578 3438 2697 1045 934 310 288 87 23153 3038 --12267
NM_015553chr6155139 4830 4639 4564 4377 4318 2026 1708 1312 1060 944 623 386 229 84 34855 1964 1784 165 11394
NM_015554chr1552656 2548 728 405 87 --12497 12580
NM_015564chr5123558 3429 2969 2607 2488 2180 1336 1133 1073 1022 428 343 53143 2655 2200 1344 941 13306 12476
NM_015565chr2151926 1861 1552 573 214 ----147
NM_015568chr2084259 4118 3971 3744 3558 3173 453 304 13809 44015 3864 3845 3814 1806
NM_015569chr1134651 4260 4076 3777 3656 2970 1763 1607 1411 673 613 590 584 31099 737 653 11316 2566 49
NM_015570chr771786 1513 1258 650 452 438 106 --1634 --
NM_015576chr331813 952 280 1512 21136 840 12475
NM_015577chr541814 1769 655 134 ----1640
NM_015601chr101912 ----137
NM_015640chr1124924 4741 4427 4246 3970 3628 3295 2022 1544 1343 1048 178 --12084 --
NM_015713chr8103395 3144 2979 1392 1335 1084 843 217 178 116 1240 ----
NM_015852chr793601 2988 2485 2407 2246 614 530 326 194 23610 2550 ----
NM_015866chr131390 1275 80 143 --1965
NM_015879chr18238415 8314 8291 8078 7950 6466 6306 5607 5583 5397 3348 3275 3156 2600 2171 2003 1291 1272 1265 988 796 116 40 78089 7927 7539 6365 6002 2633 1745 37562 7546 5817 --
NM_015881chr11--11431 ----
NM_015886chr8105765 4775 4702 2117 1677 1201 1110 794 633 285 --24894 4393 1805
NM_015897chr19--1188 ----
NM_015906chr184860 4815 4585 4451 4413 3156 1570 130 44696 3873 802 232 1237 11174
NM_015932chr131244 5797 668 532 178 86 ----
NM_015967chr15699 397 339 215 140 2661 147 ----
NM_015976chr11359 ------
NM_015984chr1--1564 --1525
NM_016009chr154580 4134 1684 1509 436 31570 647 467 --11406
NM_016018chr862492 2149 1866 1020 699 89 22555 1926 --11117
NM_016021chr662847 2374 2281 2020 770 330 1442 12978 --
NM_016023chr851938 1598 1501 634 555 22055 1973 ----
NM_016027chr8--191 ----
NM_016045chr2051341 1144 601 438 177 11457 --1584
NM_016072chr1232436 2367 625 42154 1700 770 165 --11958
NM_016076chr133052 2914 197 3977 74 62 12484 --
NM_016097chr184422 284 192 30 2437 210 --1773
NM_016120chrX61139 918 372 300 188 173 ----1867
NM_016127chr81168 2304 74 2692 113 1710
NM_016129chr41268 1370 ----
NM_016131chr262288 1929 1448 667 655 440 11861 1454 --
NM_016132chr1553288 2881 2459 888 57 1895 21012 94 --
NM_016133chr22415 261 31674 438 34 ----
NM_016206chr3208703 8644 8602 8486 7981 7707 7485 7162 6826 6646 3558 3294 3092 2907 2772 2376 1540 1016 732 417 78297 6177 3582 515 190 161 101 15738 32096 1491 622
NM_016220chr731926 466 301 32062 2001 1651 --11460
NM_016227chr141419 1400 310 26 2144 109 --1269
NM_016248chr1373387 2857 2830 2684 1505 1217 983 23708 2429 --13750
NM_016255chr692955 2896 2383 2377 2145 1119 719 526 176 4874 677 305 223 12625 --
NM_016257chr1103553 3351 3224 2421 1236 1223 706 634 185 33 33243 1109 722 23213 3143 --
NM_016260chr2207664 7592 7453 6933 6827 6396 6340 5818 5682 5575 5325 5213 5205 4841 2714 1823 1403 1335 1137 192 76997 6859 6620 4653 929 820 258 22976 2888 --
NM_016269chr441176 972 261 129 21095 275 1223 --
NM_016270chr191483 ------
NM_016271chr1872361 2285 2190 1609 600 594 473 1106 ----
NM_016275chr322404 760 32169 1086 335 --154
NM_016279chr5--1197 ----
NM_016297chr273483 3026 2690 2671 1435 1006 977 2773 122 11499 32785 1453 356
NM_016301chr126515 506 375 86 69 31 2464 110 ----
NM_016338chr521026 195 2250 238 --11096
NM_016353chr811973 2233 37 ----
NM_016374chr131523 1509 613 21391 170 11595 --
NM_016374chr131523 1509 613 21391 170 11595 --
NM_016376chr17104086 3925 3437 3354 3280 1758 1690 1627 958 632 44291 4052 3185 1329 ----
NM_016424chr1752009 1684 1622 665 296 21643 1320 1146 --
NM_016441chr262373 2282 2099 1958 474 30 2378 62 ----
NM_016507chr1743043 2187 2165 670 32857 2475 285 12644 --
NM_016513chr682796 1218 1117 904 815 797 596 531 31278 101 40 --13328
NM_016522chr1161658 1234 1146 571 178 31 1503 ----
NM_016530chr1573990 3409 3150 2873 1169 598 174 43090 1139 404 61 51532 1311 990 567 269 --
NM_016531chr454135 2959 2824 742 343 --22969 1344 11464
NM_016542chrX31310 399 133 31620 1614 523 11272 --
NM_016559chr33216 107 86 21148 381 --2571 178
NM_016577chr394455 3682 3057 1780 1251 1125 796 785 717 13119 --12872
NM_016592chr2041381 1308 1276 1141 166 11317 --
NM_016603chr582249 2043 1719 1699 650 459 450 286 11627 ----
NM_016613chr412055 --22464 1873 1513
NM_016621chr1184443 4203 3918 1661 1277 1080 527 21 173 11350 --
NM_016626chr1861767 1333 1286 1179 320 151 150 ----
NM_016824chr1071181 768 669 649 595 516 148 ------
NM_016929chr6124395 4375 3321 1834 1803 1792 1563 1386 1162 973 927 34 54180 3833 3625 3025 1692 13385 12912
NM_016952chr1183972 3474 2837 1643 1125 830 815 323 13368 23176 309 12736
NM_017420chr1483387 3224 2351 1536 1411 1027 238 125 33129 1528 1386 --23030 1041
NM_017426chr42234 216 ----1498
NM_017447chr2184080 4003 3424 1351 1247 1100 785 648 54309 2734 1107 1039 941 --1718
NM_017540chr5103102 3006 2286 914 817 651 470 412 212 99 63260 2527 1985 1218 265 199 2585 347 --
NM_017551chr1082394 2041 1029 939 790 679 301 173 32074 1899 269 ----
NM_017563chr3116164 6113 5989 5678 5501 4438 4337 2485 2406 1789 695 66017 4206 1911 1487 415 219 36043 5957 550 25514 1047
NM_017580chr1062129 1835 588 452 318 23 21862 379 ----
NM_017592chr1972851 2385 1056 841 827 63 52 --12506 12342
NM_017594chr941319 1153 1041 532 --2949 403 22850 968
NM_017628chr471857 1424 1390 928 644 122 30 11140 --24007 1489
NM_017633chr693949 3491 3424 3287 2626 396 363 292 191 33502 1262 269 ----
NM_017634chr841936 1739 688 31 31533 378 204 --11312
NM_017637chr9289141 8807 8772 7901 7888 6924 6916 6838 6616 6117 5900 5879 5864 3751 3204 2988 2981 2854 2777 2399 2350 2085 1975 1523 1517 1290 1171 419 58032 7611 7335 1603 1441 28968 1249 27370 2335
NM_017644chr375160 4111 3455 1642 1010 788 25 34872 4797 2000 --14981
NM_017650chr7135914 5673 5131 4632 4446 4212 2117 2079 1949 1413 1290 1169 38 54480 4267 3855 667 590 1672 1336
NM_017657chr2------166
NM_017658chr1454283 3882 3044 1660 493 33081 3004 227 1132 --
NM_017660chr1963098 2211 1191 877 774 293 31268 808 543 42976 2309 1273 822 1119
NM_017676chr561822 1778 1664 1330 1189 193 41715 1436 1390 1367 ----
NM_017694chr241801 795 570 544 2510 496 21897 658 --
NM_017709chr154141 3798 1662 1391 192 21705 1489 --13362
NM_017712chr1976146 5762 5562 4716 1452 1222 416 56345 5453 4968 4064 2524 2663 164 --
NM_017737chr151535 835 811 235 228 21972 104 1850 --
NM_017752chrX31945 1347 483 21823 213 --2662 133
NM_017754chr644911 4792 4201 454 13420 --1380
NM_017769chr1473250 2682 1317 1223 434 36 25 31239 616 313 ----
NM_017770chr642300 1898 911 515 22980 1174 22955 273 21196 1186
NM_017776chrX91545 1093 431 361 320 277 180 127 96 1196 31592 1304 264 1111
NM_017779chr172365 2173 2086 698 666 334 79 22671 2293 ----
NM_017787chr1072907 2729 2096 861 839 744 319 22522 68 22375 2119 --
NM_017799chr1481463 1454 1380 752 599 546 243 232 21990 765 ----
NM_017813chr8145861 5712 5009 4600 4397 4245 3876 3810 1777 1196 681 549 475 71 24694 467 ----
NM_017824chr1032383 2246 2016 42390 2367 2099 1090 12554 --
NM_017826chr134188 116 90 66 1318 ----
NM_017831chr1864664 4336 4050 3675 3159 727 44023 3449 1121 898 --11245
NM_017832chr951269 1181 925 372 319 123 1943 11069
NM_017847chr162150 2117 1993 1550 1407 269 21942 1912 ----
NM_017848chrX73595 2885 1713 1171 829 818 346 54170 3960 1262 687 586 14505 14357
NM_017890chr861747 1629 741 646 283 209 11560 1561 --
NM_017919chr9105744 5417 5244 4565 4331 4166 1449 1310 760 570 14294 1428 14575
NM_017922chr14--140 --1574
NM_017933chr221382 1333 1137 --21293 28
NM_017944chr1192842 2458 2447 2254 2188 1960 458 381 260 32640 1203 490 32577 393 146 --
NM_017998chr961318 514 499 353 244 79 ------
NM_018010chr341654 1018 610 214 11258 --11483
NM_018017chr1062787 1128 852 551 533 187 22255 1872 133 --
NM_018018chr1231669 153 58 51653 1370 756 492 367 --11701
NM_018027chr10102837 2814 2346 2340 2087 1261 1128 913 743 83 11192 11097 --
NM_018043chr1181460 1187 1095 1025 942 511 485 331 --21208 419 1277
NM_018046chr551207 763 389 377 74 41924 1891 1871 1486 ----
NM_018056chr11171 ------
NM_018084chr283342 3231 3117 2967 2898 2633 599 45 22303 1080 ----
NM_018121chr1092847 2726 836 821 473 383 242 49 34 3507 417 260 2630 224 --
NM_018137chr121205 198 1938 --1256
NM_018155chr352383 1286 845 88 42 22233 231 33338 2653 70 --
NM_018156chr182777 2358 1901 1103 923 882 628 471 2461 153 --11146
NM_018157chr1263299 2422 2007 580 416 329 33055 408 226 ----
NM_018191chr133704 258 97 21916 1757 ----
NM_018225chr9124738 4730 3951 3920 2078 1400 1190 1138 1119 889 847 623 35141 4856 4842 15319 35116 4778 33
NM_018227chr442530 2036 832 368 22614 345 2252 66 1975
NM_018234chr262241 1964 1546 699 361 246 42285 2032 1536 308 12167 --
NM_018243chr473723 3621 3589 2992 2483 1132 401 13226 ----
NM_018246chr872882 2815 2786 1132 963 836 497 42607 2112 322 270 ----
NM_018254chr162231 1774 605 264 252 197 22342 611 ----
NM_018261chr41520 ------
NM_018293chr372717 2314 1914 1843 1127 362 188 31825 869 51 ----
NM_018299chr8103369 3024 2470 2127 1380 1151 491 379 288 29 --11188 --
NM_018302chr452279 858 603 586 272 21580 453 --1369
NM_018313chr362417 2103 1963 418 385 91 41038 942 716 32 1541 --
NM_018315chr461301 538 491 469 229 201 --11363 --
NM_018319chr1451614 1114 562 298 125 ----21416 1084
NM_018323chr441715 369 257 120 11737 2477 146 11160
NM_018327chr2041477 1344 1184 562 51874 1146 731 591 454 ----
NM_018354chr20----1266 --
NM_018361chr893776 3251 2581 977 839 536 519 505 221 13632 21309 148 --
NM_018362chr1183840 2843 2683 1504 1386 968 717 350 53017 1212 940 380 200 ----
NM_018364chr194133 3272 3199 3060 2832 2812 1644 746 566 43625 2806 1559 574 ----
NM_018371chr861477 1034 1007 446 130 99 2374 342 --2232 196
NM_018373chr14176297 5964 5814 5336 4578 4527 4116 3905 2138 2130 1646 1600 1135 1127 604 573 346 55799 2254 1575 497 475 ----
NM_018374chr784621 4500 3876 3789 2036 637 301 261 24349 136 ----
NM_018394chr341173 582 257 42 ----1460
NM_018403chr383946 3053 1087 1004 869 721 575 374 22732 25 22779 2630 --
NM_018425chr10122665 2098 2017 1965 1864 1786 1008 799 748 109 83 74 1163 1547 12491
NM_018429chr562922 2649 2611 1907 1055 1023 22889 2848 12801 --
NM_018440chr8188719 8062 7465 6942 6595 5372 5336 3410 2844 2612 2459 2406 1687 1605 1457 327 309 268 118678 8638 7853 7455 7443 5877 3084 3042 2655 2344 384 37180 2823 1108 18137
NM_018444chr832305 1711 743 12058 1848 1326
NM_018452chr6_random93781 3493 3083 2733 1436 770 622 313 72 73707 3588 3235 2750 1425 653 327 1406 13398
NM_018482chr841921 945 810 532 1347 22021 726 --
NM_018489chr151532 738 662 402 365 21647 1574 31811 884 457 22255 1927
NM_018555chr1942001 1914 1797 389 --11439 11818
NM_018566chr1115151 4374 3817 3524 3404 2043 1786 1379 804 93 48 54899 4450 987 440 333 ----
NM_018638chr1295096 5034 4037 3748 3480 3458 2143 232 71 24781 4421 13538 --
NM_018640chr1272837 2737 2065 1828 872 716 139 2480 210 22653 971 11925
NM_018650chr151851 1614 786 709 435 1202 1515 11802
NM_018660chr882713 2050 720 693 580 335 91 55 32958 2775 1052 1928 --
NM_018683chr2061710 1542 1400 1383 1142 1050 11274 31468 1227 500 --
NM_018697chr792395 2364 2200 2159 2027 1886 746 729 616 2877 99 143 --
NM_018698chrX31800 1369 176 2660 79 --1791
NM_018704chr15850 839 385 342 268 32146 2073 215 21817 53 --
NM_018717chr4112798 2556 2203 2088 1822 1108 590 457 418 359 50 11945 21046 659 --
NM_018841chr183972 3598 2894 2425 1366 1231 1211 548 43898 3845 1489 620 ----
NM_018844chr751707 1401 763 356 281 31737 815 788 11815 --
NM_018898chr571982 1568 821 583 369 274 177 22011 241 11689 2852 744
NM_018899chr571982 1568 821 583 369 274 177 22011 241 11689 2852 744
NM_018900chr571982 1568 821 583 369 274 177 22011 241 11689 2852 744
NM_018901chr571982 1568 821 583 369 274 177 22011 241 11689 2852 744
NM_018902chr571982 1568 821 583 369 274 177 22011 241 11689 2852 744
NM_018903chr571982 1568 821 583 369 274 177 22011 241 11689 2852 744
NM_018904chr571982 1568 821 583 369 274 177 22011 241 11689 2852 744
NM_018905chr571982 1568 821 583 369 274 177 22011 241 11689 2852 744
NM_018906chr571982 1568 821 583 369 274 177 22011 241 11689 2852 744
NM_018907chr571982 1568 821 583 369 274 177 22011 241 11689 2852 744
NM_018908chr571982 1568 821 583 369 274 177 22011 241 11689 2852 744
NM_018909chr571982 1568 821 583 369 274 177 22011 241 11689 2852 744
NM_018910chr571982 1568 821 583 369 274 177 22011 241 11689 2852 744
NM_018911chr571982 1568 821 583 369 274 177 22011 241 11689 2852 744
NM_018945chr673409 3192 2845 2524 994 961 902 12360 1178 2451 58
NM_018959chr191211 ------
NM_018972chr852588 2064 1709 574 121 12478 ----
NM_018976chr1221991 720 11824 --32524 517 470
NM_018979chr1282293 2182 2047 1808 1029 758 746 580 11044 ----
NM_018999chr10104975 3733 3328 3066 1828 1218 942 830 428 49 54911 4811 514 96 77 31232 975 188 --
NM_019001chr3104809 4638 4130 4095 3642 3047 1884 1853 1685 165 11250 14524 --
NM_019004chr792275 1779 1613 1587 1524 700 573 401 353 1238 ----
NM_019016chr17----123 --
NM_019027chr462550 2483 1594 691 615 214 22056 407 ----
NM_019044chr2164508 4356 4325 3979 3549 3392 3359 3213 2896 1823 1692 1653 1041 643 512 85 1912 24247 1338 13718
NM_019050chr452117 1672 1517 817 662 2529 473 ----
NM_019071chr7--1622 ----
NM_019072chr5104065 3986 3618 3295 3113 3023 2963 2688 588 412 32818 2662 1004 ----
NM_019084chr1052165 2127 1906 954 83 ------
NM_019555chr371704 1632 1322 1231 659 569 525 31362 397 85 1674 11623
NM_019593chr201875 31131 700 290 1626 --
NM_019605chr1--1238 ----
NM_019610chr171619 842 824 780 707 676 94 2547 171 ----
NM_019903chr1071181 768 669 649 595 516 148 ------
NM_020122chr2105794 5709 5326 5288 4520 3828 2126 2038 249 132 11086 --15482
NM_020132chr21155201 5068 5052 4746 4528 4401 4072 3758 3513 3157 1998 904 288 158 143 25173 1535 14581 13598
NM_020148chr18103022 2749 2380 2265 1139 1011 793 782 604 338 22628 502 12902 --
NM_020150chr10142263 2226 2089 1506 1464 1456 873 543 350 323 126 120 92 23 22207 1634 1854 --
NM_020193chr1171361 1188 1148 987 411 366 225 186 ----
NM_020228chr1182107 730 706 487 411 347 107 61 12424 2671 528 --
NM_020245chr6114599 3793 3636 3322 1793 1245 1051 772 514 416 126 54552 3491 3310 1637 410 1105 23991 3428
NM_020336chr2093827 3357 740 649 613 580 567 297 256 13713 1107 --
NM_020337chr493198 2950 2778 2169 2124 2037 406 283 26 22425 365 --12253
NM_020338chr1043352 3122 1125 667 2650 551 --21379 874
NM_020341chr2052008 1379 269 85 64 21594 396 21992 1425 --
NM_020342chr262543 1795 562 522 144 87 11963 --1977
NM_020346chr1151727 1420 568 411 341 --1333 --
NM_020357chr34581 236 123 45 31374 1235 1067 --11253
NM_020390chr394176 3298 1916 1811 1721 1499 767 691 631 44137 3548 3142 1891 ----
NM_020420chrY4437 415 146 43 31719 1560 394 11268 1558
NM_020429chr752750 2591 2374 1938 927 41047 986 873 796 11246 33009 1199 51
NM_020440chr172687 2664 2619 2095 1035 978 897 11157 11327 11021
NM_020443chr1166771 6634 6312 6065 5683 5293 5027 4628 4289 2601 2100 1876 1787 1752 1083 557 46791 5396 5313 521 24447 2127 --
NM_020457chr16--1687 ----
NM_020463chr271018 950 932 452 275 122 80 11043 1537 --
NM_020466chr6124981 4087 3875 3042 1657 1585 1334 895 883 754 215 127 34992 3836 3135 13638 11954
NM_020474chr1851909 1395 715 454 95 --11588 --
NM_020482chr62783 123 2249 170 --1833
NM_020529chr142389 52 ------
NM_020546chr562117 1187 1042 775 646 214 72871 2601 2556 2179 1277 861 246 1786 --
NM_020640chr392176 2004 1829 1736 1688 1623 1516 671 294 ------
NM_020647chr832337 1901 822 11412 --11677
NM_020648chr18122789 2749 2412 2399 2245 2226 2147 1782 557 524 331 52 42871 2619 815 253 --1361
NM_020651chr241519 1394 1231 184 11734 --21270 1223
NM_020665chrX1603 1147 1443 179
NM_020673chr20197581 7340 7228 7173 7160 6647 5584 5003 4870 4725 2961 2795 2708 2074 1851 1779 1203 719 219 47327 2526 2166 855 --12594
NM_020686chr1652340 2311 1114 867 29 31955 840 90 32630 2113 329 --
NM_020699chr1135384 4347 4293 3659 3585 3532 3378 3281 1782 1110 715 566 132 45294 4941 2163 115 11576 --
NM_020715chr1442074 2053 1936 1398 42282 2225 1924 1660 2723 617 12180
NM_020717chrX104347 4098 3827 3714 3357 1268 955 944 550 374 54014 3430 1467 962 511 ----
NM_020718chr16166591 6398 6261 5970 5479 5047 4699 4663 4476 2595 2210 1662 1398 1273 795 361 66508 5183 4387 4315 4242 4016 11063 16069
NM_020727chr2173830 3398 2573 1491 1358 1319 485 13247 ----
NM_020728chr752986 999 526 482 393 53134 2910 2597 1227 832 ----
NM_020731chr553274 2708 2394 1202 1017 13186 12153 11055
NM_020738chr261160 350 312 214 158 135 21566 173 --1423
NM_020739chr15134247 4204 3779 3584 3443 3182 2697 2660 951 846 766 721 373 34222 3667 3107 13741 33432 3158 3152
NM_020742chrX72250 1983 915 821 710 681 533 22576 152 12442 22626 975
NM_020747chr53967 366 352 1601 ----
NM_020748chr1741908 1495 721 25 41916 1760 1751 576 ----
NM_020752chr1062406 1806 1050 1043 342 56 --1876 2165 134
NM_020766chrX124617 3649 3265 3237 3136 2805 1698 640 629 494 383 370 54633 3932 364 271 51 24142 3801 --
NM_020772chr17248378 8119 8002 7401 7089 6773 6704 6239 6202 5796 3287 3264 2589 2553 2499 2200 2158 2117 1663 1048 1034 796 407 226 98153 6932 2472 2043 1736 1514 1256 393 180 47227 5504 5412 2009 --
NM_020774chr18126064 5916 5873 5446 4806 3967 2403 2036 836 635 430 334 86133 5751 5462 4993 4602 3997 2471 1585 ----
NM_020781chr7112832 2525 2456 2438 2406 2147 1989 798 660 382 60 1293 12617 2989 257
NM_020783chr1872089 2035 1872 1830 626 590 339 41715 1636 515 370 ----
NM_020792chr362320 1926 1796 1740 564 535 2342 281 121 1873
NM_020796chr5103015 2238 2061 2030 1928 1060 927 776 551 267 23034 3005 12318 1302
NM_020800chr351524 1475 1445 1239 503 2140 91 1401 --
NM_020805chr1881881 1638 1538 1314 1237 312 291 146 11814 11736 --
NM_020810chr14113432 2821 2806 2773 2653 2531 2220 1387 1079 988 521 33344 2485 385 13160 --
NM_020819chr6--1913 ----
NM_020825chr1683784 3755 3385 2596 2465 2450 1524 72 23417 3242 12510 1549
NM_020830chr232317 2149 323 12324 11113 2958 695
NM_020841chr1274089 3578 2868 2741 1518 761 614 31330 1263 557 3979 430 175 --
NM_020844chr8187672 7482 6245 5976 5695 4844 2938 2921 2875 2832 2538 1678 1620 967 836 723 198 30 97310 7068 5771 2887 1552 1055 659 240 187 27502 7237 --
NM_020861chr651248 1215 959 360 160 ----21175 274
NM_020868chr271819 1516 1448 1437 1233 553 223 11999 ----
NM_020870chr4102228 1850 1664 1648 1515 1413 439 412 113 21 174 --1816
NM_020917chr19123958 3263 3193 3085 3009 2900 1328 1016 826 808 690 130 22544 1255 ----
NM_020918chr1042502 2276 619 74 22720 1413 --22549 2234
NM_020921chr1482729 2597 2422 1471 1424 1066 702 661 22544 777 ----
NM_020935chr2104072 3678 3102 1702 1525 1203 1055 590 544 134 34128 3402 3192 ----
NM_020940chr1072766 2132 1953 292 253 93 83 12272 ----
NM_020948chr153314 2990 2373 1385 81 --21055 734 --
NM_020980chr1571591 1517 1206 1156 637 562 155 1143 --21609 1109
NM_020983chr1261987 1612 651 641 561 119 1807 --21747 293
NM_021007chr252419 2197 1560 959 604 31696 1613 246 ----
NM_021025chr52524 344 ------
NM_021033chr1362560 1115 795 430 350 273 1845 11154 32858 2729 306
NM_021038chr393145 2469 1311 1063 980 764 455 255 157 11156 32581 1057 114 13104
NM_021045chr1061967 739 648 324 120 67 1697 ----
NM_021061chr8114107 3357 3257 3016 2927 1334 1107 897 594 457 72 34550 3737 144 14002 --
NM_021069chr4102053 1995 1844 1717 1706 871 739 709 591 324 ------
NM_021072chr572439 2025 1061 768 642 203 192 21668 383 --11794
NM_021079chr1772465 2033 1166 975 799 406 108 23366 322 32930 2855 2205 1720
NM_021090chr22105053 3677 3571 3260 3233 1783 1737 1589 1408 411 35006 3741 3342 --1510
NM_021097chr272783 2615 2482 2233 2223 2184 618 42628 901 612 535 --2989 127
NM_021109chrX1405 ------
NM_021109chrX1405 ------
NM_021116chr7158997 8671 8362 7935 7868 7721 7454 2986 2737 2684 2167 1893 1510 683 621 16159 2504 373 --
NM_021120chrX83026 2852 2836 2385 1164 1091 316 35 32438 1172 838 --12694
NM_021136chr142254 213 2634 499 ----
NM_021140chrX1456 11074 ----
NM_021145chr771171 1005 961 947 911 294 87 --21124 310 --
NM_021148chr762133 1569 758 232 154 87 52450 2220 300 207 116 1662 11911
NM_021183chrX1393 22498 1918 12247 --
NM_021204chr42798 338 2956 79 1363 --
NM_021205chr192746 2290 1996 1805 1094 928 511 53 24 2726 351 ----
NM_021213chr1711239 2862 114 --21086 829
NM_021215chr2072282 1876 1533 842 694 482 342 2649 380 22001 1497 --
NM_021238chr1241463 1346 466 339 31526 1332 613 11810 --
NM_021249chr142247 117 41059 566 432 106 ----
NM_021255chr1474051 3090 2943 2680 2674 1323 964 12527 1370 --
NM_021614chr51303 ------
NM_021629chr374607 3665 1165 848 741 200 156 84767 4457 4192 3472 1622 704 521 177 1182 14805
NM_021638chr4144724 4555 4521 4362 3748 3666 3573 3559 1665 1641 1007 644 395 242 34313 3912 561 ----
NM_021647chr484266 3678 2879 1100 1076 832 228 134 43788 3524 1592 379 11220 --
NM_021728chr142956 83 1820 --1263
NM_021738chr101729 2872 237 ----
NM_021813chr6145785 5664 5270 4993 4639 4571 4207 4066 3966 3890 3806 2182 2039 2009 45719 4902 980 955 33766 1553 487 11192
NM_021815chr292650 2533 2467 1206 767 600 332 313 278 51993 1175 1144 667 182 ----
NM_021911chr5125312 4866 4733 4511 4385 4229 3689 3492 1766 1607 1127 521 44851 4416 798 782 199 --
NM_021912chr1573858 3447 3122 3061 2777 2680 1322 33390 1608 899 1546 --
NM_021945chr673038 2930 934 821 681 571 94 43354 1209 595 261 1152 --
NM_021960chr162538 2281 2017 1964 428 135 42228 400 210 124 11838 --
NM_021961chr11126214 5707 5649 5033 4887 4545 2744 2720 2521 2187 1071 721 47078 6692 5603 4918 15506 15145
NM_021964chr3106173 4869 2541 2016 1043 810 631 455 441 54 3593 214 99 11224 --
NM_021977chr6123379 3327 3311 3279 2874 1213 979 960 842 526 316 235 11238 1902 --
NM_021998chrX31146 519 24 31520 282 200 1500 --
NM_022041chr1651773 920 857 269 61 31967 977 907 11697 141
NM_022048chr15145148 4935 4044 2475 2385 1802 1497 936 930 727 427 416 402 144 --15254 --
NM_022054chr14------1262
NM_022058chr271423 1413 541 525 457 53 36 1554 ----
NM_022079chr101912 ----137
NM_022091chr6102362 2273 2002 1909 1886 1696 698 436 179 25 71757 1690 910 795 564 371 191 --1997
NM_022114chr184697 4686 4527 4445 1799 1237 715 391 23969 546 44010 3792 324 170 --
NM_022130chr551138 420 403 391 204 ----11390
NM_022133chr871627 1344 1155 637 592 574 71 1107 ----
NM_022143chr781570 1544 1480 1262 1042 367 270 160 1502 ----
NM_022166chr16125589 5435 4985 4258 4175 3830 2271 1923 1813 1684 1261 741 147 15098 --
NM_022351chr883837 3539 3532 3088 2655 2367 944 531 33102 2444 288 1615 --
NM_022455chr51288 ------
NM_022456chr12195882 5839 5573 5495 5398 4714 2794 2722 2475 2141 2031 2018 1722 1608 1446 1337 1301 930 732 76743 5596 3021 1846 1756 1012 888 ----
NM_022458chr773195 3182 2798 1995 555 401 32 52968 549 415 338 78 ----
NM_022459chr13156337 6094 5602 5564 5447 5432 5313 4704 4485 3981 2312 1983 1771 1349 1045 22095 447 1549 15983
NM_022469chr1123231 3047 2665 2503 2401 2072 1319 1240 1150 934 836 788 43338 2286 848 355 ----
NM_022473chr1594455 4236 3560 3465 3110 3018 1771 1407 710 --12852 --
NM_022474chr1452860 2348 2333 1138 867 22836 626 11973 --
NM_022491chr1263528 3237 2411 1043 770 605 23474 380 22328 482 12283
NM_022648chr2123788 3608 3363 3317 3160 3151 2988 1466 1446 380 328 88 33471 2812 1015 1893 --
NM_022725chr1142146 1930 675 434 1304 12012 11965
NM_022726chr621413 1266 21452 714 11736 21594 78
NM_022753chr172823 1900 1078 913 728 325 289 11048 --11920
NM_022756chr131245 1220 1146 --31484 959 21 --
NM_022758chr6103159 3042 1289 1133 558 484 326 305 40 33 22844 146 ----
NM_022780chr25746 515 453 402 59 1299 --11373
NM_022781chr993076 3012 2575 2021 780 704 339 155 107 12868 12124 --
NM_022784chr154426 412 218 68 41021 913 722 400 ----
NM_022802chr1071616 1349 1082 1035 548 351 47 31669 1173 638 1150 --
NM_022824chr551760 694 517 414 221 --31934 252 158 --
NM_022825chrX--1320 ----
NM_022826chr21381 --11154 --
NM_022841chr1542656 1739 126 111 1608 --2855 277
NM_022845chr1641671 777 317 77 21595 1505 ----
NM_022893chr2133054 2909 2830 2699 2489 2468 2333 1262 1144 981 952 658 142 --11053 --
NM_022898chr1453914 3289 1267 554 483 54343 3228 1698 1684 1246 13831 --
NM_022912chr2113033 3007 2868 2492 2243 2078 1985 965 809 724 118 22411 32 11884 --
NM_022918chr1171795 1335 768 409 336 313 69 --1160 --
NM_022977chrX72629 2367 1048 824 795 390 210 --31907 444 140 1809
NM_023016chr272272 847 652 399 166 83 28 52572 2250 2133 2058 625 ----
NM_023034chr81477 141 --2375 151
NM_023039chr51404 ------
NM_023923chr163688 1463 1158 1054 498 476 42553 1289 1021 531 ----
NM_024007chr562841 2728 2429 2362 2237 471 32231 1019 433 22827 1008 1258
NM_024045chr10--1140 ----
NM_024090chr481795 1452 1429 1389 1346 1275 672 59 11531 1324 3315 295 284
NM_024294chr6103159 3042 1289 1133 558 484 326 305 40 33 22844 146 ----
NM_024345chr9115608 5112 4801 4453 4193 4082 3854 3814 1728 1378 966 32227 2181 1923 45683 5339 4250 1266 --
NM_024408chr183068 2914 2537 2425 1288 1161 973 780 43433 3215 562 157 1995 --
NM_024411chr2071553 1344 1084 1006 575 529 475 ----11063
NM_024423chr1884268 4142 3215 2620 2607 1675 1496 388 64069 3700 3590 2833 1363 135 23883 2714 1199
NM_024511chr453174 3101 2764 972 958 33287 1005 245 1862 --
NM_024524chr363012 2065 1980 1214 478 393 43150 2819 2094 1966 12646 12745
NM_024551chr1272061 1848 1743 831 677 609 193 22524 1915 21989 1950 --
NM_024551chr1272061 1848 1743 831 677 609 193 22524 1915 21989 1950 --
NM_024570chr13--1225 ----
NM_024580chr15--147 ----
NM_024590chr461800 1745 1709 1603 777 588 21977 1337 1476 --
NM_024607chr8124406 4372 3891 3213 3042 2997 2757 1566 787 537 204 130 23836 633 2889 370 14510
NM_024626chr131656 574 161 21471 23 --2169 145
NM_024638chr341847 999 684 179 12414 1283 11883
NM_024639chr672353 920 728 503 468 447 260 32484 1881 1826 1904 1549
NM_024640chr12616 243 1313 1230 --
NM_024646chr131527 988 104 33734 3025 2724 1675 11393
NM_024665chr394442 3796 3329 3323 1233 1089 730 277 125 33264 2971 303 ----
NM_024692chr21266 11349 --11578
NM_024721chr862431 2343 2306 2291 2161 462 3511 453 294 12031 --
NM_024744chr242450 2226 2005 120 --1249 12439
NM_024749chr172091 1569 1493 811 752 193 24 61621 1549 805 623 416 181 11582 --
NM_024761chr9115015 4858 3709 1958 1771 1513 1209 837 824 501 33 45367 5293 4810 960 11814 14790
NM_024792chr1721208 1035 --1280 2418 179
NM_024814chr71379 ----1317
NM_024817chr15125033 4918 4495 4270 3817 2361 2120 1240 994 814 728 190 15223 11068 11834
NM_024824chr1491596 1435 1245 1184 1169 1155 474 239 23 21452 540 11301 --
NM_024828chr931352 1154 278 21469 345 ----
NM_024835chr17--1285 ----
NM_024837chr1561767 1629 681 622 362 91 21516 399 1580 --
NM_024857chr17--186 ----
NM_024941chr541389 1377 1234 1188 2463 439 21215 266 1419
NM_024947chr3229632 9276 9011 8726 8618 8478 7792 7635 7249 7231 6255 6153 6081 3148 2421 2374 2007 1599 1474 924 783 66 89312 9255 7777 6300 5901 3164 2877 338 38694 6511 3219 --
NM_024949chr4134666 4079 3964 3384 3339 1996 1806 1457 1164 1103 688 663 57 35015 4753 1519 1818 23741 3200
NM_024953chr1252507 1865 1024 538 257 32242 1835 730 1193 168
NM_024963chr775976 5144 4889 3590 1475 87 43 25313 4723 15471 14437
NM_024989chr2137459 7330 6898 6885 6287 5756 5517 3289 1763 1214 1185 503 484 38034 6089 5210 25336 841 1396
NM_025027chr195911 885 369 174 72 --1310 --
NM_025054chr883927 3899 3634 1693 1103 767 423 346 43100 2726 1070 24 ----
NM_025057chr1431237 989 262 --1119 2289 196
NM_025073chr174383 3544 2947 1834 1811 1608 1535 63426 3365 3279 1371 956 740 13827 --
NM_025133chr251130 735 286 238 22 ----1786
NM_025146chr3102633 2579 2248 1843 1821 1765 1020 956 363 48 1376 ----
NM_025160chr174331 3897 1698 1547 1051 651 615 22685 1340 11382 24162 588
NM_025179chr1144639 4431 3862 3599 3586 3138 3104 3021 1821 1769 1714 1568 1542 406 43608 3343 1192 520 41915 1531 1206 736 13803
NM_025191chr193469 3316 3303 3147 3050 2768 2270 809 631 32214 2189 1213 --12420
NM_025208chr1192262 2252 1801 1778 1548 936 783 574 503 31555 605 480 --1847
NM_025221chr451330 1257 1247 896 153 21454 1046 --1251
NM_025237chr1751611 1380 1350 1204 420 1977 11505 11364
NM_030621chr1473997 3725 3585 1577 1489 669 263 22732 1077 ----
NM_030625chr1082558 2212 1042 1012 705 321 215 65 2642 623 --11608
NM_030627chr5124039 3843 3836 3588 3343 1521 1398 1254 1193 667 310 258 1570 ----
NM_030647chr765372 4550 4216 4078 2091 1675 36013 1188 948 15426 15470
NM_030648chr4115508 5273 4851 3828 3480 1996 1851 1786 1560 1474 598 21879 1180 65310 5193 4480 4236 1616 988 --
NM_030650chr284271 3605 3595 3577 3570 3391 2955 1046 2274 182 13162 23518 676
NM_030664chr1051802 966 716 504 235 --22438 773 --
NM_030674chr1275450 4355 4245 4196 1214 1062 684 25907 3553 35383 3793 1734 197
NM_030755chr1482164 1242 1197 1130 987 975 941 48 52800 2750 2014 1012 156 ----
NM_030758chr2231306 1239 1052 --2491 477 --
NM_030780chr871671 1432 1351 1335 407 129 71 11502 ----
NM_030806chr1207869 7858 7250 7013 6849 6071 2988 2877 2321 1664 1518 1306 1261 1161 828 558 546 171 110 75 68779 7528 7413 6928 3758 576 59127 7198 3136 1168 1100 --
NM_030918chr1114836 4307 3966 3582 1531 1420 1080 1029 917 617 84 11376 1939 --
NM_031243chr762302 2032 794 475 395 148 42381 2330 2016 311 1890 --
NM_031262chr921087 63 1336 ----
NM_031263chr921144 120 1393 ----
NM_031268chr16105022 4817 3910 3830 1885 949 884 797 204 145 35410 4735 4604 23973 3611 --
NM_031305chr461801 1504 1403 1232 497 103 21414 260 --1242
NM_031314chr1411390 1412 --21605 381
NM_031369chr42288 185 ----1687
NM_031370chr42288 185 ----1687
NM_031371chr131523 1509 613 21391 170 11595 --
NM_031371chr131523 1509 613 21391 170 11595 --
NM_031411chr571982 1568 821 583 369 274 177 22011 241 11689 2852 744
NM_031419chr331300 1215 157 1379 ----
NM_031427chr14115715 5569 4036 1519 1478 1419 1389 908 453 372 319 65740 4881 4663 4621 2090 555 23822 102 1434
NM_031435chr12103117 2849 2727 2592 2308 1310 530 285 143 48 --12481 --
NM_031442chrX33226 2362 46 22974 2323 --1986
NM_031445chr263324 3164 2983 2380 497 285 --1896 11356
NM_031453chr1082179 2115 2033 1781 993 890 615 384 12047 177 1858
NM_031468chr7218268 7637 7023 7011 6926 6817 6720 6496 6454 6329 5923 5444 5380 3225 2930 2477 2376 550 477 452 357 67862 7039 6588 6125 3148 777 21832 1542 26350 3119
NM_031469chr683786 3496 3356 2565 1586 545 467 439 63413 3116 2782 2636 1454 450 193 --
NM_031483chr2063069 2202 1202 888 612 426 --1304 --
NM_031844chr1103473 2902 2765 1424 1121 753 300 187 129 99 24139 3721 13330 --
NM_031845chr253421 2784 2531 2254 638 33607 3506 458 12886 --
NM_031847chr253421 2784 2531 2254 638 33607 3506 458 12886 --
NM_031849chr571982 1568 821 583 369 274 177 22011 241 11689 2852 744
NM_031857chr571982 1568 821 583 369 274 177 22011 241 11689 2852 744
NM_031860chr571982 1568 821 583 369 274 177 22011 241 11689 2852 744
NM_031940chr892469 2146 2089 2070 1000 910 700 204 39 --11684 --
NM_031942chr241309 413 167 53 1310 21211 495 --
NM_032012chr9124746 4342 4278 4154 4128 1888 1722 1125 1109 370 255 157 34894 4482 117 1122 15161
NM_032047chr372224 2142 1978 655 153 118 101 1427 --11771
NM_032105chr1157635 7593 7314 7222 7099 6610 5899 5677 4971 2585 2155 1260 876 592 219 57930 7194 7177 5405 4961 11605 12886
NM_032109chr5--21071 480 21318 1076 --
NM_032116chr1355028 4575 4325 1264 306 34481 3825 3807 --11864
NM_032136chr4122 ----150
NM_032144chr261484 732 498 316 62 29 21796 632 --11547
NM_032153chr362668 2622 469 381 176 78 --42738 2514 1105 635 --
NM_032160chr18114374 3579 3107 3041 2781 1361 630 539 372 240 69 34382 3545 1073 32964 1065 428 --
NM_032199chr1093856 3742 3155 3118 1403 1397 1238 921 370 ----12614
NM_032221chr2062012 1624 1453 723 533 336 1446 11463 --
NM_032229chr1341031 305 270 170 1996 --11127
NM_032281chr1983187 3044 2278 2019 1981 1959 466 89 11995 1930 --
NM_032290chr5--1140 --1216
NM_032312chr23865 762 754 --1366 2303 251
NM_032321chr263321 3032 2613 2478 656 388 2742 82 --23187 62
NM_032373chr10104656 4467 4283 3761 3607 2249 1670 1618 524 472 65697 3880 3747 2266 1790 753 25553 998 --
NM_032435chr17868 860 678 535 483 472 236 --2224 100 --
NM_032440chr10102818 2790 2684 2513 2336 2312 1823 1175 441 235 12116 11035 --
NM_032441chrX4475 423 177 162 11162 --1366
NM_032445chr1582317 2073 2045 2032 1728 933 881 141 32258 2150 992 --1191
NM_032446chr573519 3280 2634 679 585 142 135 1276 13331 --
NM_032457chr453543 3389 2914 1485 1017 33405 1493 570 1842 3920 682 502
NM_032458chrX93234 3201 3194 3085 2953 2517 1226 1009 693 2699 119 ----
NM_032505chr372279 1926 1899 696 571 90 66 42375 2295 444 319 --12168
NM_032509chr892403 1947 1881 1827 967 743 410 198 181 1432 12111 --
NM_032547chr421438 344 1475 175 --
NM_032560chr1431133 365 269 ----2896 863
NM_032582chr1741668 1201 672 250 2477 87 173 11256
NM_032622chr471444 1333 1013 512 448 261 143 1125 ----
NM_032663chr1271350 675 611 530 520 453 276 4434 225 129 60 ----
NM_032711chr1783885 2697 1107 1069 1047 791 775 727 --23477 2737 --
NM_032731chr1751400 1308 302 226 219 31322 497 415 ----
NM_032778chr3153295 2907 2779 2426 2169 919 883 851 787 777 569 557 533 340 49 33325 262 56 22736 765 --
NM_032784chr65997 954 236 178 172 1358 ----
NM_032801chr1172556 1701 1558 853 550 512 450 22340 1598 21825 117 21843 1739
NM_032804chr1062519 2213 2019 1938 887 844 21669 989 ----
NM_032826chr785347 4735 4547 4203 1542 1175 312 120 34983 4511 2125 42133 2045 1130 651 --
NM_032828chr1984978 4705 4578 3576 3552 3518 1116 77 14339 24845 1452 --
NM_032842chr741518 1504 1486 50 11712 11644 --
NM_032857chr151222 ------
NM_032859chr1393665 3210 2787 2441 1301 1156 1120 1032 433 23133 1277 1273 22421 998
NM_032873chr11143841 3801 3750 3495 3477 3445 3202 3126 2783 1595 1257 357 268 28 23502 2792 13876 --
NM_032900chr1063802 3673 2906 2381 1213 482 32795 1093 373 --13582
NM_032918chr123846 421 378 11308 --1329
NM_032961chr431224 448 327 --11359 160
NM_032968chrX104276 3725 3426 3280 1513 1013 894 717 437 369 13877 --14207
NM_032969chrX104276 3725 3426 3280 1513 1013 894 717 437 369 13877 --14207
NM_032973chrY94268 3717 3275 1513 1013 894 717 437 369 13869 --14199
NM_032978chr1841234 948 183 90 2878 867 2797 380 --
NM_032979chr1841234 948 183 90 2878 867 2797 380 --
NM_032981chr1841234 948 183 90 2878 867 2797 380 --
NM_033018chrX11217 ------
NM_033020chr184860 4815 4585 4451 4413 3156 1570 130 44696 3873 802 232 1237 11174
NM_033083chr373441 3420 3329 773 717 234 83 22544 2392 2781 314 --
NM_033128chr74874 725 677 77 ----1579
NM_033132chr1362194 1989 1879 810 799 385 21444 401 1784 --
NM_033133chr1773636 3269 3084 3004 2923 2508 1461 43806 1434 770 412 31502 1166 1006 --
NM_033135chr1192262 2252 1801 1778 1548 936 783 574 503 31555 605 480 --1847
NM_033138chr772003 1783 1766 1757 1641 396 315 32098 1720 194 11953 --
NM_033139chr772003 1783 1766 1757 1641 396 315 32098 1720 194 11953 --
NM_033140chr772003 1783 1766 1757 1641 396 315 32098 1720 194 11953 --
NM_033143chr493958 3488 3448 3354 1797 1768 239 117 108 53819 1757 1169 1097 768 11005 --
NM_033157chr772003 1783 1766 1757 1641 396 315 32098 1720 194 11953 --
NM_033222chr9----1511 --
NM_033224chr7198108 7637 7514 6931 6910 6446 6198 5471 2958 2452 2256 1949 1941 1552 1459 1123 847 610 418 77890 6157 6048 6006 5940 806 188 27910 6577 37799 2809 1070
NM_033225chr852899 2781 2119 833 475 21275 805 2932 212 --
NM_033272chr2------1121
NM_033290chrX82879 2724 2599 2495 2305 543 146 108 33596 3159 73 11153 --
NM_033331chr9113440 3349 2564 2431 1411 1387 1355 1176 899 658 351 53631 3034 1440 1429 439 22541 95 23050 2955
NM_033360chr1284269 4189 3531 3423 1716 1430 1065 661 13903 11365 11299
NM_033389chr17164611 4171 4096 4026 3579 3472 3446 3019 1925 1456 1427 883 552 474 247 46 53993 3566 872 708 336 --1277
NM_033425chr11103182 2963 2384 2193 1294 1141 902 799 518 445 33203 2798 784 1120 11249
NM_033426chr1472951 2686 2609 2268 2257 747 88 32814 2306 1032 12461 --
NM_033429chr15133293 3098 2981 2703 2587 2545 1128 735 708 525 427 193 66 1509 11207 --
NM_033430chr483746 2658 2609 988 965 870 667 530 33784 1665 254 --1405
NM_033437chr483746 2658 2609 988 965 870 667 530 33784 1665 254 --1405
NM_033480chr682594 2504 2379 1898 1041 933 768 461 52771 2547 2255 1993 61 --12303
NM_033481chr682594 2504 2379 1898 1041 933 768 461 52771 2547 2255 1993 61 --12303
NM_033505chr2116315 6254 5821 4909 4581 4425 4353 2620 2018 1795 466 56756 5588 5511 2156 830 14481 --
NM_033515chr671384 1160 1080 975 144 74 62 --11241 --
NM_033550chr2041804 1768 928 586 1619 1155 1874
NM_033551chr5113505 3319 3064 2966 2570 2286 1076 984 912 800 601 ----12802
NM_033632chr461301 538 491 469 229 201 --11363 --
NM_033637chr10103846 3639 3229 3035 2999 1414 914 392 331 230 34164 3586 1084 --12752
NM_033642chrX41211 1201 1021 352 --21156 85 1297
NM_033646chr18--139 ----
NM_033656chr21106030 5707 4840 4590 4056 2183 922 262 123 57 35181 3999 2255 --24107 2225
NM_052834chr1872412 2125 1786 1006 889 813 271 --11638 2827 316
NM_052845chr12102715 2362 2352 2285 2195 969 476 327 317 92 1949 22273 2261 --
NM_052851chr1361591 901 582 308 297 81 11495 1819 --
NM_052879chr1293787 3744 3453 3258 3176 3010 2805 1171 107 74140 3416 2733 1594 912 405 249 1545 --
NM_052885chr1294981 4941 4600 4153 3719 3393 3226 3068 429 33244 1936 1171 --14836
NM_052907chr12124136 3926 3377 2672 1561 1351 933 847 761 695 164 142 54275 4008 3240 1293 1236 11082 --
NM_052918chr10103607 3373 3241 3126 2939 2314 1449 1332 570 173 22381 1387 ----
NM_052927chr571987 1922 1646 1440 828 799 450 31505 480 358 ----
NM_052937chr852687 2654 618 168 75 52327 2303 829 768 662 ----
NM_052966chr1133607 3019 2583 2557 1305 1297 1010 906 769 564 490 44 38 1740 53633 3530 2443 1097 1056 --
NM_053016chr9147257 7204 6654 6206 5671 4980 4857 2449 2265 2200 1637 1387 1364 244 45916 5276 1290 730 1496 --
NM_053023chr1173322 3237 3128 2148 1042 780 50 32974 995 241 --12296
NM_053043chr7125244 4900 4844 4668 4333 4217 4210 1487 1325 1156 547 480 34389 2457 2087 1622 14474
NM_053056chr1183144 2749 799 371 213 182 112 105 1424 12996 --
NM_053064chr1492695 2645 2476 2374 2183 1185 1125 804 24 1712 12956 --
NM_054016chr151827 1498 1345 674 165 --21461 396 --
NM_054016chr151827 1498 1345 674 165 --21461 396 --
NM_054016chr151827 1498 1345 674 165 --21461 396 --
NM_058170chr131282 1274 280 31441 423 232 11187 --
NM_058172chr461714 1663 1606 1350 742 603 2320 108 21502 95 --
NM_078473chr892469 2146 2089 2070 1000 910 700 204 39 --11684 --
NM_080546chr992053 1823 1752 1668 1584 1558 667 617 529 11445 12027 --
NM_080645chr642188 722 258 150 --11597 22083 192
NM_080676chr20102836 2740 2683 2487 923 832 773 643 386 195 13050 2889 499 --
NM_080683chr4--1432 ----
NM_080684chr4--1432 ----
NM_080685chr4--1432 ----
NM_080725chr2092076 1912 1640 1352 652 400 268 79 42 --21757 35 --
NM_080759chr13102498 2162 2132 1991 1759 588 506 380 163 134 2651 293 1670 --
NM_080760chr13102498 2162 2132 1991 1759 588 506 380 163 134 2651 293 1670 --
NM_080764chr22102990 2982 2105 1282 972 858 833 785 634 231 12913 ----
NM_080867chr14124996 4751 4605 4477 4215 4167 4122 4076 1886 1836 1215 1165 44161 4028 569 379 1759 194
NM_080872chr883429 3151 2905 2739 2471 378 282 270 11547 24081 3985 12987
NM_080874chr43632 580 98 1448 --11269
NM_080927chr383149 2941 2828 2241 972 893 821 261 2999 954 ----
NM_130385chr1192800 2760 2682 2673 2380 1994 1045 565 555 53227 2829 2088 589 213 22620 724 --
NM_130391chr9113545 3504 3297 3147 2898 2580 2558 2425 1354 1018 605 12257 ----
NM_130392chr9113545 3504 3297 3147 2898 2580 2558 2425 1354 1018 605 12257 ----
NM_130393chr9113545 3504 3297 3147 2898 2580 2558 2425 1354 1018 605 12257 ----
NM_130436chr21102246 2215 2047 1881 1058 950 864 183 163 121 31899 767 357 1302 12013
NM_130438chr2182823 2792 2624 2458 760 740 698 418 42476 2208 1344 934 22149 879 12590
NM_130439chr10112318 1871 1787 1521 840 807 799 583 562 179 138 22203 411 12345 --
NM_130439chr10112318 1871 1787 1521 840 807 799 583 562 179 138 22203 411 12345 --
NM_130798chr1551449 1313 1174 447 397 ------
NM_133170chr20257875 6965 6448 6224 6166 6120 6097 5443 5336 5201 5032 2987 2689 2659 2605 2200 2095 1690 1478 1235 1192 1029 553 256 203 67930 6998 6436 5686 2145 2133 36707 2568 1921 47586 7464 7458 2681
NM_133264chr1783020 2976 2806 2618 1200 1077 828 719 23475 1352 --12844
NM_133334chr4146399 6171 5767 5630 5516 4188 2202 1929 1430 1309 1302 1290 1087 789 41608 1572 816 264 14972 11062
NM_133367chr6123149 2787 2120 1335 993 935 490 335 178 148 142 69 13243 31349 1232 764 --
NM_133378chr2--3848 676 102 ----
NM_133432chr2--3848 676 102 ----
NM_133437chr2--3848 676 102 ----
NM_133445chr963230 2320 2296 689 349 90 51491 850 756 636 494 43203 2863 739 579 --
NM_133474chr421466 236 41368 1295 1245 456 21203 421 11314
NM_133496chr164448 4196 2782 1143 650 86 34348 3632 1361 14513 --
NM_133631chr371581 1521 1507 1459 1053 298 202 11635 ----
NM_133646chr2124515 3780 3457 2182 2027 1978 1853 1538 1382 1142 659 97 24467 803 14141 21181 51
NM_133647chr1593370 3249 2831 783 378 305 161 98 40 42421 1011 338 198 --1262
NM_134428chr9--1290 ----
NM_138286chr193800 187 32 54132 3459 861 244 143 14207 --
NM_138328chr1783191 3026 2972 2876 2163 1286 1270 112 53237 2402 2365 179 39 ----
NM_138335chr43838 814 284 2882 568 ----
NM_138348chr596227 5882 4830 2494 2457 2066 1770 1489 267 22161 603 45563 5456 1149 959 --
NM_138375chr1851204 966 423 402 179 2136 84 --1932
NM_138444chr13104523 1844 1783 1638 1585 1338 936 814 689 623 34703 3848 1046 1771 --
NM_138459chr663503 2785 2450 1417 831 138 11455 --53275 2241 1028 679 608
NM_138468chr2116198 6031 5876 5365 5077 4503 4000 2490 2373 2011 1034 15489 24865 4459 198
NM_138473chr1295192 4418 3654 1773 1522 1092 993 146 76 33412 1814 1620 13299 1929
NM_138494chr762598 2339 2286 2261 2088 355 22780 2672 11804 --
NM_138576chr1453914 3289 1267 554 483 54343 3228 1698 1684 1246 13831 --
NM_138621chr2103919 3678 1614 1550 1274 825 610 581 464 138 23857 2906 ----
NM_138713chr16117581 6597 5836 5534 5526 5215 5171 5033 2908 1959 1452 95374 2734 2266 1307 1123 574 477 430 149 16483 36933 2553 596
NM_138714chr16117581 6597 5836 5534 5526 5215 5171 5033 2908 1959 1452 95374 2734 2266 1307 1123 574 477 430 149 16483 36933 2553 596
NM_138731chr1494173 4101 3999 2719 1378 1109 1101 804 536 23839 943 ----
NM_138735chr25583 377 316 282 102 21310 616 ----
NM_138799chr23759 692 681 51732 1636 1338 795 93 ----
NM_138966chr182488 79 1574 ----
NM_138970chr1482154 1956 972 828 646 488 354 239 21767 1488 2702 670 --
NM_138971chr11173652 3632 3575 3182 3139 3105 2984 2874 2766 2494 2406 1291 1062 795 711 355 156 31102 645 215 33720 1401 764 12947
NM_138971chr11173652 3632 3575 3182 3139 3105 2984 2874 2766 2494 2406 1291 1062 795 711 355 156 31102 645 215 33720 1401 764 12947
NM_138972chr11173652 3632 3575 3182 3139 3105 2984 2874 2766 2494 2406 1291 1062 795 711 355 156 31102 645 215 33720 1401 764 12947
NM_138972chr11173652 3632 3575 3182 3139 3105 2984 2874 2766 2494 2406 1291 1062 795 711 355 156 31102 645 215 33720 1401 764 12947
NM_138973chr11173652 3632 3575 3182 3139 3105 2984 2874 2766 2494 2406 1291 1062 795 711 355 156 31102 645 215 33720 1401 764 12947
NM_138973chr11173652 3632 3575 3182 3139 3105 2984 2874 2766 2494 2406 1291 1062 795 711 355 156 31102 645 215 33720 1401 764 12947
NM_139012chr652195 2136 1926 643 615 11410 1296 1872
NM_139014chr652275 2216 2006 723 695 11490 1376 1952
NM_139135chr131135 1042 140 ------
NM_139168chr531561 1469 661 21443 669 ----
NM_139244chr64705 340 45 36 ----1666
NM_139246chr962387 2176 2018 1636 867 375 31595 68 40 --21963 1547
NM_139283chr1221989 439 22144 1969 1586 11902
NM_139321chr20104159 3755 3230 3216 3138 2941 1677 1010 467 358 74258 3845 3301 3202 1407 1143 988 21576 1278 14221
NM_139323chr2052044 1336 796 662 560 11419 12060 --
NM_144498chr2051604 536 501 397 386 1634 22151 1702 1709
NM_144571chr4196856 6769 6427 5856 5363 4943 4656 2807 2801 2695 1825 1793 1514 1269 1177 1046 947 930 919 66822 4771 4740 4677 754 377 14426 14605
NM_144583chr2111826 1759 1721 1623 1548 1475 1236 1143 636 496 318 11440 1128 --
NM_144599chr15145480 5344 5258 5144 5129 4912 4854 4687 4398 3688 3389 1590 1498 1330 24785 4470 --14459
NM_144600chr1661369 1358 1130 644 536 154 1202 11037 --
NM_144609chr1781291 1165 1017 453 322 287 131 43 --2929 919 --
NM_144628chr20132961 2914 2885 1887 1197 1114 832 724 553 482 474 427 89 22775 2201 12994 --
NM_144664chr1142044 1997 803 329 11690 22608 791 --
NM_144669chr1251645 1283 1140 602 528 21418 417 11714 1423
NM_144767chr15144084 4037 3968 3947 3404 3388 1822 1393 1156 903 783 693 465 322 14001 11032 --
NM_144775chr17104763 4622 4279 3906 3825 1587 561 293 190 166 44579 4054 4026 3900 13273 --
NM_144778chr1362782 2420 1997 1738 494 156 32774 1809 1059 22403 1108 --
NM_144949chr272411 2174 1054 792 666 580 470 12254 1415 11836
NM_145011chr1092135 1404 653 484 451 390 266 227 65 22016 695 21497 375 --
NM_145049chr53846 803 693 3834 788 778 ----
NM_145055chr1893410 3162 3149 2583 1123 1111 859 522 167 11236 196 --
NM_145113chr144424 252 234 63 11534 --11269
NM_145176chr6103551 3467 3210 2748 2668 1316 856 249 181 169 11249 ----
NM_145206chr1093181 2918 2234 1336 1230 1066 1038 854 397 33043 921 437 12815 22602 835
NM_145247chr103521 465 51 ------
NM_145259chr2126622 5849 5575 5535 4709 4375 2652 2216 2186 1937 1234 655 36942 5779 222 11441 2336 274
NM_145263chr482358 2217 2172 1702 811 726 373 285 42082 1665 351 113 ----
NM_145307chr1084460 3895 3843 3689 1514 850 415 219 23806 1628 --23543 1128
NM_145320chr783578 3438 2697 1045 934 310 288 87 23153 3038 --12267
NM_145321chr783578 3438 2697 1045 934 310 288 87 23153 3038 --12267
NM_145322chr783578 3438 2697 1045 934 310 288 87 23153 3038 --12267
NM_145341chr1051843 1693 1378 562 542 1216 --11562
NM_145349chr1721732 754 42275 2247 2100 1513 2829 747 --
NM_145350chr1741084 430 407 106 31627 1599 1452 3532 181 99 --
NM_145351chr1712224 52767 2739 2592 2005 1831 --11813
NM_145686chr273313 2899 2399 2332 2298 920 430 22312 295 1894 --
NM_145687chr273313 2899 2399 2332 2298 920 430 22312 295 1894 --
NM_145690chr841546 532 372 295 1698 --11895
NM_145698chr1082201 1896 1797 1772 705 604 415 350 32072 2042 1639 ----
NM_145728chr1532455 2293 464 1197 159 12154
NM_145735chr1352687 2226 1893 959 488 12184 1821 1677
NM_145799chrX113142 2810 2729 2421 2184 1998 1068 935 745 542 220 --12375 12203
NM_145810chr241309 413 167 53 1310 21211 495 --
NM_147147chr6104105 3501 3127 2820 2771 2708 1700 1662 1322 938 42801 2612 2598 450 13011 --
NM_147150chr9103299 2682 2660 2574 1073 1067 932 533 275 207 43851 3689 1449 72 1133 --
NM_147156chr1051411 1171 1097 579 169 ----1565
NM_147181chr451330 1257 1247 896 153 21454 1046 --1251
NM_147182chr451330 1257 1247 896 153 21454 1046 --1251
NM_147183chr451330 1257 1247 896 153 21454 1046 --1251
NM_147189chr852301 2140 811 395 343 12210 21483 213 11510
NM_147223chr282468 1995 1775 1726 1592 730 390 153 32160 1618 958 2628 115 --
NM_147233chr272285 1812 1592 1543 1409 547 207 31977 1435 775 1445 --
NM_148170chr11155428 4652 4501 4417 4384 4351 4285 4212 4197 3570 2034 1193 941 332 163 13919 3793 517 109 24161 4146
NM_148955chr15135808 5290 5247 5056 4431 4137 1793 1453 1066 998 934 685 222 36406 4722 4163 31038 970 748 12341
NM_148976chr11----191 --
NM_152233chr142247 117 41059 566 432 106 ----
NM_152238chr11359 ------
NM_152253chr2294203 3540 2781 1552 1443 1275 981 562 448 13554 23311 674 13516
NM_152261chr1292113 1740 1703 1660 1638 966 875 607 467 ------
NM_152262chr196879 771 687 569 271 139 1355 1603 --
NM_152263chr164903 4784 4534 4384 538 275 25062 135 15235 --
NM_152277chr571951 1881 1749 1364 1336 760 191 31437 505 236 ----
NM_152330chr1481817 1807 678 606 246 189 183 56 --1148 22605 579
NM_152380chr161660 1573 1105 1038 341 157 11400 --11155
NM_152388chr2133940 3910 3518 2598 1588 1523 1419 1081 692 601 395 318 214 21621 302 23548 1011 --
NM_152400chr441579 618 380 89 31524 406 388 ----
NM_152414chr871382 1289 1215 1131 265 54 47 ------
NM_152423chrX61468 1425 1300 573 235 85 31114 424 156 11571 --
NM_152424chrX114747 4131 4017 3944 3707 1887 1485 1332 1181 840 69 11039 13457 11300
NM_152436chr123310 184 43 1343 --1336
NM_152437chr1252126 1864 632 347 293 1788 11552 11575
NM_152446chr14----2384 140 --
NM_152519chr252012 1772 667 620 588 22057 94 11426 --
NM_152527chr252226 1962 620 412 350 21613 93 1725 21639 508
NM_152556chr761956 1776 589 374 179 106 21893 1797 ----
NM_152564chr861747 1629 741 646 283 209 11560 1561 --
NM_152594chr156884 411 374 282 255 222 21691 480 ----
NM_152624chr5177345 7311 7153 7113 6515 5913 5269 5011 4960 2923 2697 2342 2195 1986 1967 1433 609 15907 1433 --
NM_152629chr963482 2615 1215 788 245 140 23938 3380 11475 13748
NM_152630chrX51416 1215 635 523 357 155 --1510
NM_152699chr372412 1430 1386 1354 1185 741 301 1662 --13650
NM_152724chr10122584 2500 2097 1931 1866 1809 1696 1094 735 512 414 319 22536 1786 --1231
NM_152733chr6166362 6096 6010 5357 5110 4814 4754 4335 2430 1871 1561 1383 1316 1080 1056 369 --46332 6214 6165 5036 1136
NM_152754chr733787 2905 847 33280 2972 2631 13003 --
NM_152756chr5114347 4320 3997 3524 2929 1700 1020 959 582 576 64 64171 3835 3556 883 432 316 1265 1353
NM_152763chr12256 30 ----1200
NM_152787chrX93900 3769 3698 3519 2857 2575 272 156 53 43978 2800 654 490 1280 13891
NM_152793chr7155203 4661 4440 4311 4220 3957 3870 3811 3366 1988 1764 1615 972 910 183 64904 4584 4125 3530 895 392 1573 14910
NM_152826chr15135808 5290 5247 5056 4431 4137 1793 1453 1066 998 934 685 222 36406 4722 4163 31038 970 748 12341
NM_152835chr152896 744 272 263 89 32839 2378 1891 12299 --
NM_152836chr871627 1344 1155 637 592 574 71 1107 ----
NM_152837chr871627 1344 1155 637 592 574 71 1107 ----
NM_152903chr1362877 2508 2298 2099 1023 111 32726 393 143 ----
NM_152924chr15116651 6135 5645 5306 5125 2133 1633 898 523 427 348 35213 4769 4306 11275 11797
NM_152999chr764733 4432 4344 3446 1057 1044 34977 3224 423 --24200 818
NM_153018chr1763227 2917 2647 2600 375 33 1709 --1886
NM_153029chr1652963 1228 896 696 376 1397 1994 23960 1653
NM_153035chr172747 2638 2444 1979 1014 877 854 52811 2136 1069 818 734 ----
NM_153047chr6--1389 1404 --
NM_153048chr6--1389 1404 --
NM_153050chr22105053 3677 3571 3260 3233 1783 1737 1589 1408 411 35006 3741 3342 --1510
NM_153051chr22105053 3677 3571 3260 3233 1783 1737 1589 1408 411 35006 3741 3342 --1510
NM_153181chr182488 79 1574 ----
NM_153182chr3153295 2907 2779 2426 2169 919 883 851 787 777 569 557 533 340 49 33325 262 56 22736 765 --
NM_153188chr5175384 5014 4777 4574 4426 4131 3534 3474 2270 2007 1543 1302 1291 1174 624 558 447 34905 585 274 --14202
NM_153207chr1294042 3371 3163 3071 3040 989 575 495 295 21244 25 --1414
NM_153223chr551072 1018 521 416 355 --2595 69 11413
NM_153235chr662327 2124 2048 1851 1815 235 2793 76 --12076
NM_153260chr1561359 1325 1215 574 208 182 11235 ----
NM_153262chr163024 2790 2674 652 299 87 32479 772 456 13109 2583 35
NM_153343chr4132392 2222 1970 1937 1899 1860 1718 1522 712 480 376 201 158 21770 498 2852 503 1904
NM_153346chrX51836 1718 1709 1251 665 41358 1258 822 677 ----
NM_153365chr471879 1780 1742 855 753 549 27 ----1285
NM_153367chr1054003 2977 2805 1429 451 34017 3381 210 1276 1267
NM_153377chr124151 105 60 24 ------
NM_153456chr13176040 5885 5196 5165 5102 4481 4056 3994 2185 2174 1982 1898 1502 1379 1006 357 77 12486 25934 5695 12004
NM_153487chr674580 4196 3812 3458 3390 449 438 34648 1040 895 44081 3854 3431 1767 --
NM_153619chr15103481 3052 2354 1444 1322 573 400 386 365 258 13525 ----
NM_153634chr1211258 2362 306 140 1492
NM_153689chr221476 301 32311 1967 1932 --1429
NM_153693chr121727 ------
NM_153695chr9--156 --133
NM_153702chr4--1277 ----
NM_153756chr131308 1253 763 41694 1353 788 342 31763 1722 397 1205
NM_153810chr10134848 4131 3873 3562 3521 3315 3286 1956 1243 1218 1185 1052 494 63890 3777 3116 1975 338 265 14929 --
NM_153812chr131630 631 134 --1457 22212 760
NM_170606chr741308 711 369 122 ----21191 189
NM_170665chr1244101 4066 2976 1710 33950 1728 260 23412 1583 14435
NM_170686chr7112832 2525 2456 2438 2406 2147 1989 798 660 382 60 1293 12617 2989 257
NM_170706chr154353 3839 3298 1453 460 63777 3648 3188 1751 1348 1257 --12700
NM_170709chr871988 1897 971 901 859 237 179 51729 1672 1559 894 522 11616 12064
NM_170710chr4112978 2957 2672 2243 2164 1278 1260 1118 524 302 284 22486 276 ----
NM_170731chr1182619 2114 2069 1139 656 278 212 180 --12823 --
NM_170732chr1182619 2114 2069 1139 656 278 212 180 --12823 --
NM_170733chr1182619 2114 2069 1139 656 278 212 180 --12823 --
NM_170734chr1182619 2114 2069 1139 656 278 212 180 --12823 --
NM_170735chr1182619 2114 2069 1139 656 278 212 180 --12823 --
NM_170740chr693045 2976 2831 2804 2774 2599 1155 479 31 21125 912 31281 951 329 33153 1131 743
NM_170775chr51303 ------
NM_171998chrX92351 1947 1000 858 557 504 481 402 283 22029 49 21901 1594 --
NM_172070chr262179 1478 1391 792 566 510 41967 1709 1440 260 ----
NM_172071chr196267 6173 5401 5169 5154 2701 1418 771 97 86025 4665 2851 2527 2440 2159 1882 1368 ----
NM_172159chr342384 1532 761 352 21839 508 32032 526 23 --
NM_172160chr342384 1532 761 352 21839 508 32032 526 23 --
NM_172240chr122965 130 31032 162 153 11307 --
NM_172337chr142956 83 1820 --1263
NM_172349chr51288 ------
NM_172354chr181558 1452 1367 1314 728 675 554 41 31655 1330 48 11888 --
NM_173065chr1103640 3478 3323 2486 2397 2369 461 452 140 22 43500 3334 2828 569 2778 301 22423 195
NM_173198chr962756 2574 2311 1908 467 62 2128 112 1952 --
NM_173200chr962756 2574 2311 1908 467 62 2128 112 1952 --
NM_173201chr161258 ------
NM_173214chr16117581 6597 5836 5534 5526 5215 5171 5033 2908 1959 1452 95374 2734 2266 1307 1123 574 477 430 149 16483 36933 2553 596
NM_173463chr4134152 3133 1156 1130 1057 1042 991 888 868 747 679 589 60 14204 ----
NM_173468chr4145978 4978 4885 4727 4398 4261 4157 3914 3878 3846 2327 1760 505 365 ----15681
NM_173469chr151274 11088 21164 70 11127
NM_173473chr1042429 1680 707 426 22570 211 12323 --
NM_173495chrX42154 1929 313 195 ----31625 904 559
NM_173497chr1051444 1254 964 540 237 11059 1932 134
NM_173511chr2103545 3469 3055 2977 2753 868 853 793 558 479 1670 1712 --
NM_173515chr65893 759 719 215 131 11001 ----
NM_173531chr1942478 2460 1017 424 63912 3705 2408 1087 948 378 ----
NM_173536chr4155125 4886 4825 4623 4539 4358 4207 4181 4156 3810 3219 2069 2021 150 28 --24500 4016 --
NM_173545chr252009 1964 1900 1670 1654 61955 1738 1506 1483 666 296 ----
NM_173552chr382207 2190 1953 1745 866 786 612 329 12253 ----
NM_173562chr6103022 2961 2868 2319 1342 1129 871 570 555 405 33068 2814 446 --22440 283
NM_173582chr1195449 5358 4977 4706 2499 1527 1224 472 365 35645 883 246 46007 2166 297 230 --
NM_173602chr1263480 2979 2823 846 699 53 33459 1419 70 11428 --
NM_173607chr1462001 1924 1447 759 484 252 11299 1168 --
NM_173642chr1228217 8102 8086 8029 7959 7734 7723 7264 6408 6255 6082 6046 3455 2980 2699 2339 2256 2190 2051 1397 1302 879 29039 6269 28363 855 37214 1696 356
NM_173667chr551915 1814 654 607 323 11824 --1413
NM_173683chr851241 583 545 361 348 ----2680 674
NM_173694chrX82072 2055 1804 1701 1686 1677 431 99 2267 77 11648 --
NM_173797chr551295 1184 1071 994 292 11153 ----
NM_173808chr1104104 3920 3610 3128 1563 1548 1049 944 232 21 53084 2839 1461 463 83 13426 1299
NM_173822chr232133 1937 1517 21644 529 11668 --
NM_173825chr342012 839 370 233 22372 2059 --12806
NM_173829chr5126183 5795 5431 5362 4923 3952 2367 1674 1152 1130 1079 1071 34913 2106 1312 12111 24771 1953
NM_173851chr893253 2709 1204 1198 1058 733 661 447 93 43781 3277 3174 1390 ----
NM_174890chr104725 300 94 54 1196 1186 1115
NM_174916chr1581792 1681 1488 936 681 638 608 49 ----1753
NM_175056chr372189 1599 1581 1378 562 325 318 ------
NM_175061chr752168 1711 1483 634 243 12111 ----
NM_175623chr12195882 5839 5573 5495 5398 4714 2794 2722 2475 2141 2031 2018 1722 1608 1446 1337 1301 930 732 76743 5596 3021 1846 1756 1012 888 ----
NM_175624chr12195977 5934 5668 5590 5493 4809 2889 2817 2570 2236 2126 2113 1817 1703 1541 1432 1396 1025 827 76838 5691 3116 1941 1851 1107 983 ----
NM_175625chr12195977 5934 5668 5590 5493 4809 2889 2817 2570 2236 2126 2113 1817 1703 1541 1432 1396 1025 827 76838 5691 3116 1941 1851 1107 983 ----
NM_175736chr12117479 6302 5859 5774 5563 5285 4916 2691 2340 1522 1056 47307 5695 5665 602 22646 871 31732 1467 22
NM_175854chr1392475 2438 2227 2060 1804 1729 1706 989 819 32702 2531 1839 21025 183 --
NM_175907chr1852779 1991 1868 993 789 22574 1141 1443 1118
NM_175921chr583573 3524 3459 2702 1356 790 639 528 13953 11585 --
NM_175931chr164816 729 483 170 2831 744 1274 11480
NM_176081chr1045622 5355 1300 1227 75859 4889 4234 4101 1309 1238 983 ----
NM_176083chr1045622 5355 1300 1227 75859 4889 4234 4101 1309 1238 983 ----
NM_177414chr151774 1439 1309 671 503 31542 512 350 ----
NM_177438chr1473997 3725 3585 1577 1489 669 263 22732 1077 ----
NM_177452chr1472416 2225 2051 1800 1730 1695 145 32262 413 59 ----
NM_177538chr298082 6716 5630 2952 1919 1506 1164 1110 335 38848 3405 3204 15451 16641
NM_177925chr1272634 2399 2359 2160 1121 544 371 23118 2031 142 --
NM_177985chr262295 2284 764 311 282 61 32259 687 440 --11734
NM_177990chr2052008 1379 269 85 64 21594 396 21992 1425 --
NM_177996chr2042961 2471 520 494 31228 831 146 12527 13294
NM_178006chr1361591 901 582 308 297 81 11495 1819 --
NM_178007chr1361591 901 582 308 297 81 11495 1819 --
NM_178011chr1073299 3131 3105 2552 1133 911 248 32455 1045 845 1873 --
NM_178140chr542312 2230 1792 389 32273 822 601 32278 717 189 1889
NM_178151chrX147793 7536 7327 6757 6535 6416 5775 5402 5363 2885 2081 2028 1884 288 47107 2241 1563 1073 14773 17524
NM_178152chrX147793 7536 7327 6757 6535 6416 5775 5402 5363 2885 2081 2028 1884 288 47107 2241 1563 1073 14773 17524
NM_178153chrX147793 7536 7327 6757 6535 6416 5775 5402 5363 2885 2081 2028 1884 288 47107 2241 1563 1073 14773 17524
NM_178483chr20--187 ----
NM_178539chr1261826 1413 1316 533 244 172 21673 1631 11596 --
NM_178554chr373295 3276 3046 2966 1335 1302 31 33160 717 343 1585 12833
NM_178586chr1472453 2086 2054 1648 729 702 384 31939 1609 290 --12210
NM_178587chr14--1112 ----
NM_178812chr871585 1518 1449 1297 582 526 157 ------
NM_178815chr1062383 2276 2083 801 718 157 32652 1947 1788 ----
NM_180989chr1361911 1741 694 629 41 27 22200 356 --2873 113
NM_181077chr1572130 843 641 551 164 158 21 12155 ----
NM_181265chr4112978 2957 2672 2243 2164 1278 1260 1118 524 302 284 22486 276 ----
NM_181332chrX72250 1983 915 821 710 681 533 22576 152 12442 22626 975
NM_181349chr752750 2591 2374 1938 927 41047 986 873 796 11246 33009 1199 51
NM_181351chr1153047 2452 1190 315 38 12492 ----
NM_181358chr174103 3366 1038 860 816 516 143 1704 13036 --
NM_181443chr2081970 1935 1827 959 861 752 383 201 21956 1877 ----
NM_181457chr251340 1270 1013 957 104 1942 --172
NM_181458chr261473 1403 1146 1090 237 139 11075 --1205
NM_181481chr18166336 6297 5994 5982 5569 5507 5221 5046 4293 2827 2781 2248 2066 1919 766 578 86774 6070 5850 4676 4467 1663 1518 1504 16827 1703
NM_181482chr18166336 6297 5994 5982 5569 5507 5221 5046 4293 2827 2781 2248 2066 1919 766 578 86774 6070 5850 4676 4467 1663 1518 1504 16827 1703
NM_181483chr18166336 6297 5994 5982 5569 5507 5221 5046 4293 2827 2781 2248 2066 1919 766 578 86774 6070 5850 4676 4467 1663 1518 1504 16827 1703
NM_181504chr563619 3263 3199 1063 591 408 62981 2974 1638 952 537 59 12882 --
NM_181521chr16146245 5528 5417 4787 4532 2483 2402 1958 1496 1261 1048 780 532 119 11360 34939 1860 514 --
NM_181523chr563619 3263 3199 1063 591 408 62981 2974 1638 952 537 59 12882 --
NM_181524chr563619 3263 3199 1063 591 408 62981 2974 1638 952 537 59 12882 --
NM_181723chr84927 733 271 93 52194 1414 754 593 57 ----
NM_181787chr843736 3512 1125 772 53474 3298 2962 2656 1359 ----
NM_181789chr1573141 2979 2911 2508 2382 2262 1002 11170 2601 117 --
NM_181832chr224462 219 149 70 13214 33569 3271 724 12619
NM_181838chr531537 357 271 31275 1084 424 11599 11304
NM_181839chr831244 941 424 1440 --11104
NM_181861chr1262617 2520 2366 2318 2199 2177 --1128 --
NM_181868chr1262617 2520 2366 2318 2199 2177 --1128 --
NM_181869chr1262702 2605 2451 2403 2284 2262 --1213 --
NM_181897chr372468 1731 1025 925 825 733 221 52223 1795 1676 477 435 ----
NM_182314chrX31811 1389 1296 3684 659 420 2589 260 --
NM_182485chr483159 2683 2289 1097 1085 819 399 82 1871 --12730
NM_182487chr9104458 3788 3588 3504 3244 3209 1728 1522 1464 1134 ----23574 872
NM_182503chr6125471 5353 5113 4720 4221 1816 1761 1732 1385 1065 668 64 24092 810 65287 4509 4051 3462 1090 209 13824
NM_182515chr19154906 4870 4848 4542 4187 2385 2013 1971 1592 1520 1356 967 766 688 476 52064 1663 1069 741 644 --14807
NM_182646chr483159 2683 2289 1097 1085 819 399 82 1871 --12730
NM_182648chr14--1670 ----
NM_182663chr1112281 1983 1666 1618 866 828 800 627 501 438 335 52274 2130 2007 875 483 1139 21721 689
NM_182664chr1112411 2113 1796 1748 958 930 757 631 568 465 64 42404 2260 2137 613 1269 21851 819
NM_182665chr1112281 1983 1666 1618 866 828 800 627 501 438 335 52274 2130 2007 875 483 1139 21721 689
NM_182680chrX--1116 ----
NM_182703chr1521471 1336 ----11324
NM_182758chr1563585 3431 2804 2707 789 52 63754 3009 2938 2821 2794 82 13492 --
NM_182762chr7115817 5634 4678 4624 3861 1858 1752 1716 799 593 335 52396 1886 1880 222 169 ----
NM_182763chr162527 2270 2006 1953 417 124 42217 389 199 113 11827 --
NM_182765chr1062113 1747 1606 882 686 210 31624 544 307 --1164
NM_182830chr1452098 454 327 206 26 22023 1704 1860 --
NM_182898chr7186217 6209 6131 5682 5667 5554 5498 5371 4928 4473 4012 2118 1914 1896 1521 1074 967 33 22196 735 --12183
NM_182899chr7186217 6209 6131 5682 5667 5554 5498 5371 4928 4473 4012 2118 1914 1896 1521 1074 967 33 22196 735 --12183
NM_182915chr262241 1964 1546 699 361 246 42285 2032 1536 308 12167 --
NM_182918chr2151247 469 248 105 92 1266 182 --
NM_182972chr162642 2320 2187 924 366 179 --1589 --
NM_182977chr52861 258 1132 --2247 167
NM_183004chr1473863 3298 2645 2638 1297 1129 65 53940 3707 2664 1137 637 187 23842 3572
NM_183047chr203719 690 646 21003 351 --2891 78
NM_183048chr203719 690 646 21003 351 --2891 78
NM_183050chr672299 2176 2105 2080 1945 141 31 21845 130 --11527
NM_183078chr632484 1359 171 33578 2680 1311 12462 --
NM_183238chr1282508 1278 1131 274 204 191 134 114 63108 1190 975 965 519 174 1288 --
NM_183353chrX61139 918 372 300 188 173 ----1867
NM_183376chr1552533 2184 1615 873 667 22065 532 ----
NM_183419chr841144 1073 424 199 31202 947 233 197 --
NM_194071chr785393 4526 4478 4321 4065 2157 1783 202 11320 24308 3476 --
NM_194247chr2144374 4106 4019 3992 3643 3399 3126 3115 1112 1052 216 152 126 61 23750 1790 ----
NM_194282chr462213 887 674 556 357 115 22599 499 --13042
NM_194283chr5114235 3930 3881 3713 3606 3154 2890 942 864 821 321 53959 3461 2770 2706 428 24061 3979 13820
NM_194285chr1153378 2545 2239 2144 73 33085 2693 2123 ----
NM_194286chr12126078 5142 5075 4674 4265 4206 3985 2368 2302 1820 1702 1336 45421 4317 4035 298 21948 545 24308 4178
NM_194291chr832790 2540 182 32558 633 349 12936 --
NM_194298chr1061855 1394 472 383 294 277 ----11910
NM_194314chr185112 4339 3664 1999 1628 1396 1221 602 55457 5077 2018 872 700 21155 1105 --
NM_194317chr252637 2184 988 629 608 31797 619 399 ----
NM_194328chr993076 3012 2575 2021 780 704 339 155 107 12868 12124 --
NM_194329chr993076 3012 2575 2021 780 704 339 155 107 12868 12124 --
NM_194330chr993076 3012 2575 2021 780 704 339 155 107 12868 12124 --
NM_194332chr993076 3012 2575 2021 780 704 339 155 107 12868 12124 --
NM_194434chr18105355 5228 4759 4651 4569 4312 1596 1362 687 428 34034 1718 1038 11587 14449
NM_197941chr552226 2110 1934 1007 852 ----22613 556
NM_197966chr2231047 941 906 41122 952 446 329 11366 --
NM_197967chr2231047 941 906 41122 952 446 329 11366 --
NM_198066chr1463015 2028 305 277 229 26 52983 710 654 595 361 ----
NM_198081chr642266 1905 1851 345 22440 1967 2228 21 1835
NM_198128chr1872361 2285 2190 1609 600 594 473 1106 ----
NM_198158chr372858 2815 2526 2304 1092 566 277 22809 2708 12179 --
NM_198159chr372858 2815 2526 2304 1092 566 277 22809 2708 12179 --
NM_198177chr372858 2815 2526 2304 1092 566 277 22809 2708 12179 --
NM_198178chr372858 2815 2526 2304 1092 566 277 22809 2708 12179 --
NM_198181chr15122959 2946 2917 2885 2867 1996 1105 1026 980 853 651 257 22974 2539 ----
NM_198212chr762378 1963 1634 1504 769 762 3630 214 29 --1453
NM_198240chr1211195 ------
NM_198268chr174103 3366 1038 860 816 516 143 1704 13036 --
NM_198269chr174103 3366 1038 860 816 516 143 1704 13036 --
NM_198270chrX63475 3113 2455 2157 1363 85 42774 2382 2283 827 130 --
NM_198273chr562664 2586 2502 1212 322 127 42441 2259 757 512 11206 186
NM_198321chr5103102 3006 2286 914 817 651 470 412 212 99 63260 2527 1985 1218 265 199 2585 347 --
NM_198336chr761671 1552 1240 600 356 291 31568 591 408 ----
NM_198399chr341680 729 43 28 157 2302 88 1577
NM_198400chr1542574 2032 1977 419 52110 2005 1998 731 135 ----
NM_198404chr132719 257 4739 677 667 330 1571 124
NM_198465chrX102962 2585 2388 2326 697 662 547 538 447 359 12544 22025 936 --
NM_198468chr6124323 4169 4103 3779 3652 3454 1800 1576 1562 1502 989 653 24632 776 14199 --
NM_198485chr352191 2108 1718 1668 150 2977 953 11831 --
NM_198503chr152263 1934 944 223 73 2717 292 157 --
NM_198521chr12----1152 --
NM_198549chr193316 3025 2895 2794 2150 2094 1248 1175 163 12164 1327 --
NM_198567chr53513 478 81 2530 73 163 --
NM_198569chr642667 2631 1061 970 1320 1240 11689
NM_198570chr7------1256
NM_198581chr2117368 6934 6888 6086 5984 2785 2598 2428 2037 1999 1316 44799 2404 1357 239 15098 --
NM_198584chr832721 2548 2276 1768 22238 70 --
NM_198595chr4144724 4555 4521 4362 3748 3666 3573 3559 1665 1641 1007 644 395 242 34313 3912 561 ----
NM_198793chr364177 3632 3561 2902 1343 1318 43516 1148 968 113 12734 --
NM_198859chr394973 4274 4070 1274 1174 1095 901 621 470 11897 21747 1456 --
NM_198892chr4145 ------
NM_198896chr1162253 1628 880 647 467 212 11940 2179 33 --
NM_198900chr12117479 6302 5859 5774 5563 5285 4916 2691 2340 1522 1056 47307 5695 5665 602 22646 871 31732 1467 22
NM_198935chr2022768 1172 42672 2398 1060 680 12799 11162
NM_198947chr1161088 842 313 289 280 134 1764 188 --
NM_198968chr13114030 3917 2916 2459 1432 1381 1312 1054 973 477 264 1647 22718 30 1936
NM_199000chr762034 1913 1678 812 459 390 21657 422 12240 --
NM_199044chr192951 2815 2683 2425 2010 1997 1070 275 33 32677 2511 317 --13034
NM_199050chr2141324 749 198 30 23143 1256 11338 32639 2633 823
NM_199072chr783263 2744 2590 1262 1204 776 549 141 22612 69 ----
NM_199132chr1942147 1780 600 394 1122 1191 --
NM_199187chr12149 ------
NM_199188chr1293787 3744 3453 3258 3176 3010 2805 1171 107 74140 3416 2733 1594 912 405 249 1545 --
NM_199190chr1293787 3744 3453 3258 3176 3010 2805 1171 107 74140 3416 2733 1594 912 405 249 1545 --
NM_199229chr231586 1143 293 1681 --1395
NM_199245chr1222049 957 22061 623 --22614 2573
NM_199320chr452289 2183 1055 603 207 21090 79 ----
NM_199320chr452289 2183 1055 603 207 21090 79 ----
NM_199324chr453578 3306 2282 844 789 33549 3505 249 1550 12494
NM_199421chr14124996 4751 4605 4477 4215 4167 4122 4076 1886 1836 1215 1165 44161 4028 569 379 1759 194
NM_199436chr2123068 3009 2857 2786 2641 2327 2318 2164 2069 904 556 41 22873 682 11107 --
NM_199437chr1182107 730 706 487 411 347 107 61 12424 2671 528 --
NM_199438chr1182107 730 706 487 411 347 107 61 12424 2671 528 --
NM_199439chr1182107 730 706 487 411 347 107 61 12424 2671 528 --
NM_199454chr184697 4686 4527 4445 1799 1237 715 391 23969 546 44010 3792 324 170 --
NM_199461chr1073075 2836 1442 1001 931 748 410 43162 2649 2531 143 23377 1266 13509
NM_199462chr1114809 4795 4766 4557 4107 1476 1170 656 537 250 232 11465 --1772
NM_201266chr2122439 2313 2296 2283 2257 1947 1092 748 505 375 145 44 42507 2198 2135 457 ----
NM_201279chr2122439 2313 2296 2283 2257 1947 1092 748 505 375 145 44 42507 2198 2135 457 ----
NM_201432chr1786314 6105 5894 4753 2425 1285 189 137 25610 1419 21740 853 14764
NM_201433chr1786314 6105 5894 4753 2425 1285 189 137 25610 1419 21740 853 14764
NM_201591chr451216 654 606 437 91 21233 1203 --11678
NM_201592chr451216 654 606 437 91 21233 1203 --11678
NM_201613chr122359 168 --1819 1140
NM_201629chr9--1322 --2774 742
NM_203282chr1931437 416 171 41221 454 391 288 ----
NM_203341chr14814 779 768 59 ------
NM_203342chr173488 2359 2332 196 162 71 47 --1850 1769
NM_203343chr173488 2359 2332 196 162 71 47 --1850 1769
NM_203349chr15102113 2100 1969 1724 1476 848 733 646 448 223 1288 1595 --
NM_203372chr23674 495 349 21425 1068 --11312
NM_203391chrX61739 1519 1161 583 462 404 ----11708
NM_203394chr1282417 2299 1065 1027 515 419 395 224 22259 2042 ----
NM_203406chr5122798 2605 2407 2208 2076 1158 1122 1097 753 650 294 189 2588 355 12088 --
NM_203437chr2------166
NM_203446chr2162837 1211 1130 526 391 35 52828 2333 2285 1835 1062 1101 1445
NM_203451chr1382331 2292 2088 1971 1959 1622 778 438 1771 ----
NM_203454chr151281 943 921 531 472 21133 122 1330 --
NM_203458chr193767 3340 3253 3205 2492 2424 2388 1312 616 --13450 --
NM_203463chr2194649 4387 4381 4169 3872 3702 3629 3620 3451 3411 3194 1974 1884 1639 1036 975 932 438 290 14757 ----
NM_203473chrX--1320 ----
NM_203474chrX--1320 ----
NM_203475chrX--1320 ----
NM_203476chrX--1320 ----
NM_203504chr432236 653 274 32225 2054 125 --12192
NM_203505chr432236 653 274 32225 2054 125 --12192
NM_205768chr141746 1347 177 107 2781 82 --11474
NM_206594chr1103359 3219 2892 2800 2793 1423 1233 590 547 60 1689 ----
NM_206595chr1103359 3219 2892 2800 2793 1423 1233 590 547 60 1689 ----
NM_206819chr121277 ------
NM_206820chr121277 ------
NM_206821chr121277 ------
NM_206852chr142254 213 2634 499 ----
NM_206853chr674028 3837 3718 3599 1163 805 85 34149 2813 432 ----
NM_206854chr695289 5098 4979 4860 2066 1346 1256 782 291 35410 4074 1693 ----
NM_206855chr6106254 6063 5944 5825 4071 2311 2221 1747 1256 879 26375 5039 ----
NM_206857chr142254 213 2634 499 ----
NM_206866chr2162632 1315 388 372 172 64 43186 3076 1117 475 ----
NM_206876chr283502 3358 1424 1337 1195 1010 476 459 32726 325 283 ----
NM_206909chr8138214 7687 7660 7545 6381 6278 6142 5485 5404 2656 2543 600 95 45959 5097 3256 1858 26623 3355 --
NM_206937chr132380 25 4665 416 349 119 ----
NM_207009chr108849 764 748 719 649 379 311 39 1290 ----
NM_207012chr10102821 2517 2474 957 847 770 742 461 326 300 1294 32907 541 353 12418
NM_207015chr362231 1930 1912 604 397 24 31986 1520 837 21904 51 --
NM_207033chr2051255 1187 590 575 289 --11505 1409
NM_207034chr2051255 1187 590 575 289 --11505 1409
NM_207171chr121638 588 ------
NM_207292chr393145 2469 1311 1063 980 764 455 255 157 11156 32581 1057 114 13104
NM_207293chr393145 2469 1311 1063 980 764 455 255 157 11156 32581 1057 114 13104
NM_207294chr393145 2469 1311 1063 980 764 455 255 157 11156 32581 1057 114 13104
NM_207295chr393145 2469 1311 1063 980 764 455 255 157 11156 32581 1057 114 13104
NM_207296chr393145 2469 1311 1063 980 764 455 255 157 11156 32581 1057 114 13104
NM_207297chr393170 2494 1336 1088 1005 789 480 280 182 11181 32606 1082 139 13129
NM_207303chr1074140 4119 4107 3151 1113 787 721 21047 181 --13461
NM_207304chr1362669 2307 1884 1625 381 43 32661 1696 946 22290 995 --
NM_207359chr341991 1521 587 198 22034 1981 4793 770 608 449 1678
NM_207361chr1395937 5458 5365 4938 4849 4109 3852 313 179 65485 5421 5387 5380 4052 1583 21808 1433 24948 215
NM_207366chr782356 1771 1531 803 682 596 573 467 1453 21814 877 1416
NM_207406chr476415 4767 1732 1558 1293 535 42 55685 5604 5020 4094 407 --15962
NM_207411chr883483 2942 2728 1374 882 629 521 324 33641 3417 707 21025 344 13305
NM_207517chr1561866 1711 758 449 98 52 141 ----
NM_207577chr1152374 2037 1837 541 83 11082 22627 448 12616
NM_207660chr1491596 1435 1245 1184 1169 1155 474 239 23 21452 540 11301 --
NM_207661chr1491596 1435 1245 1184 1169 1155 474 239 23 21452 540 11301 --
NM_207662chr1491596 1435 1245 1184 1169 1155 474 239 23 21452 540 11301 --
NM_212460chr742037 1392 1284 1266 --11956 1782
NM_212558chr9114294 3891 2746 2703 1400 1332 1137 660 515 465 297 --12862 24079 4010
NM_213589chr295235 5097 4547 4535 4289 4026 1652 1526 1190 13631 23703 1706 --
NM_213606chr1062632 1050 902 554 174 91 --1738 12739