TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3140-5p
miRNA Sequence: ACCUGAAUUACCAAAAGCUUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX86370 5764 5435 1723 945 646 551 515 1183 15686 15978
NM_000112chr585541 4673 4648 4189 3536 1000 310 213 25324 694 14142 14315
NM_000217chr1254464 4294 2125 1109 274 --14608 14783
NM_000259chr1575710 5614 4634 2180 1662 1434 1108 --21376 825 1874
NM_000332chr6106468 5895 5180 4686 2704 2409 2380 543 485 110 --12207 --
NM_000411chr2193252 1047 762 656 323 219 213 141 62 ------
NM_000448chr1152686 1064 850 835 721 1682 33175 3143 1277 --
NM_000489chrX53249 2992 2749 993 760 161 --1355
NM_000555chrX87421 5888 3049 2193 2183 2143 993 903 47235 2361 1879 979 ----
NM_000618chr1296187 4102 2443 2421 2202 1355 843 716 381 1173 ----
NM_000618chr1296187 4102 2443 2421 2202 1355 843 716 381 1173 ----
NM_000726chr221254 261 --1283 11169
NM_000899chr12104180 4151 3708 3317 2970 2893 1117 984 276 161 ------
NM_001001323chr1262499 2062 1209 1142 1135 89 2841 77 ----
NM_001001481chr843482 2730 178 67 --11181 12412
NM_001001664chr263893 3708 3052 1368 563 147 13181 --11623
NM_001001928chr22108325 7601 6929 6378 5853 5842 5167 2379 1913 1456 ----25876 5188
NM_001003800chr952672 2362 1052 1039 874 43680 3170 2535 436 12923 1552
NM_001004065chr923762 807 31406 1175 720 --11551
NM_001005502chr12105212 4230 4032 3939 3567 3486 3325 1870 1255 190 1577 ----
NM_001005746chr221254 261 --1283 11169
NM_001005747chr221254 261 --1283 11169
NM_001007278chr1374746 4665 4364 2091 1803 172 66 23649 899 ----
NM_001009960chr782486 2471 2355 2313 1113 626 450 47 12818 137 --
NM_001010846chr1124437 4352 3845 3726 3280 3265 3182 1736 1706 1519 823 535 21660 611 ----
NM_001010853chr652050 1197 1050 887 404 ----12374
NM_001010861chr182526 2309 1956 1907 1890 790 480 415 --1767 --
NM_001011666chr785770 5636 4635 4487 4371 4183 4049 1071 ----14359
NM_001012393chr1174839 4448 4440 4176 3672 1972 1759 11598 23384 791 15155
NM_001012968chrX42760 2376 1124 89 --12657 1105
NM_001014380chr1365197 5172 4262 3668 1239 312 21799 297 14865 --
NM_001014797chr1097992 7954 7378 7274 6770 5449 5378 2920 1225 36834 6127 1029 12019 --
NM_001015045chr4--31830 650 637 --12114
NM_001017440chr787995 7585 6563 5160 2295 1875 464 129 22740 1204 --16948
NM_001018065chr976041 5917 5768 5025 4978 4464 3809 35047 4867 1563 12078 --
NM_001018066chr976041 5917 5768 5025 4978 4464 3809 35047 4867 1563 12078 --
NM_001018067chr1135204 5058 4987 4669 4482 3851 3763 3565 3280 1761 1514 382 209 35219 3640 1621 ----
NM_001018068chr1135204 5058 4987 4669 4482 3851 3763 3565 3280 1761 1514 382 209 35219 3640 1621 ----
NM_001018069chr1135204 5058 4987 4669 4482 3851 3763 3565 3280 1761 1514 382 209 35219 3640 1621 ----
NM_001024948chr163047 2523 948 791 784 488 ------
NM_001025077chr10105143 5094 4912 2392 2376 1925 1892 1112 697 591 ------
NM_001025233chr1262476 2259 2183 2068 435 31 ----1558
NM_001025252chr872159 2141 926 831 796 668 109 ----1221
NM_001025253chr872159 2141 926 831 796 668 109 ----1221
NM_001025580chrX82896 2845 1684 1342 1160 926 866 432 --1521 --
NM_001030055chr1494457 4372 4359 3769 3657 852 489 71 65 --24769 2960 --
NM_001031695chr2234272 3582 1676 14351 --2907 899
NM_001031732chr463093 2668 2648 2265 626 404 2871 862 11051 --
NM_001037317chr182526 2309 1956 1907 1890 790 480 415 --1767 --
NM_001039580chr454925 3511 1266 1157 870 --2824 409 24026 1819
NM_001039590chrX104022 3923 3915 3827 3714 3417 3394 3259 2872 653 ----23518 1602
NM_001039591chrX104022 3923 3915 3827 3714 3417 3394 3259 2872 653 ----23518 1602
NM_001039618chr11115264 4558 4525 4325 4299 3611 1327 1017 691 517 222 --13849 --
NM_001040020chr761468 1319 1292 1191 1139 371 ----1642
NM_001040152chr795147 4824 4685 4640 4186 1250 1234 1200 873 11170 ----
NM_001040284chr1685534 5210 5048 3863 3805 1514 341 102 11626 --186
NM_001040429chr13113127 3028 2880 2821 2785 2728 2508 2467 1042 869 769 ------
NM_001040450chr1582656 2462 865 614 579 536 367 126 ----1565
NM_001040453chr1582656 2462 865 614 579 536 367 126 ----1565
NM_001040665chr754074 3170 1809 734 71 --1221 23891 3661
NM_001042555chr1244506 1669 1628 417 ----11410
NM_001042599chr2127407 7318 6019 3055 2791 2537 2473 1770 1327 995 439 21 1975 12497 --
NM_001046chr582802 2204 2072 1044 923 904 841 479 ----12327
NM_001099678chr376358 4549 4460 4114 2380 398 160 --11610 16389
NM_001100108chr1137630 7586 7383 7023 5803 3174 2699 2678 2383 2330 1342 855 473 --35880 2742 2477 --
NM_001106chr3128111 7097 6948 6808 6536 6210 5941 2950 2169 1903 1028 697 18363 16422 --
NM_001173chr1494457 4372 4359 3769 3657 852 489 71 65 --24769 2960 --
NM_001204chr267740 5871 5312 2005 1903 165 12146 16566 --
NM_001259chr795880 5570 5308 2006 1839 1790 1472 848 728 1978 ----
NM_001271chr1543054 2408 1230 1040 12149 1185 22904 2310
NM_001412chrX63694 3288 3214 2962 2585 1196 ----12462
NM_001609chr1074192 4102 3164 1168 1149 790 173 13707 ----
NM_001616chr232394 1328 901 23170 1089 --11412
NM_001650chr1833436 2807 671 13853 1799 13943
NM_001656chr541467 534 453 148 ----22002 99
NM_001858chr674657 4551 3799 3426 3341 1669 582 --24978 4930 --
NM_001874chr12105212 4230 4032 3939 3567 3486 3325 1870 1255 190 1577 ----
NM_002006chr485243 5110 4405 3941 3655 3637 3529 699 15503 --11477
NM_002015chr1322640 1031 --12699 11090
NM_002025chrX88828 7416 5844 3718 3256 3068 711 492 ----12200
NM_002158chr253002 2800 1370 1297 83 ----1987
NM_002203chr532619 1172 1155 21063 835 23620 3049 --
NM_002310chr5106432 6277 5681 4575 4548 4132 2541 1760 1654 561 --11613 15515
NM_002545chr1174839 4448 4440 4176 3672 1972 1759 11598 23384 791 15155
NM_002577chr384058 3231 2977 955 949 815 586 200 11045 ----
NM_002613chr1695352 5175 5120 4938 4877 4197 4036 3953 1935 11923 1212 --
NM_002641chrX31501 399 106 ----1212
NM_002745chr2284546 4392 3637 3085 2767 1728 1680 992 ----11504
NM_002886chr395093 5044 4830 4525 3980 3611 1520 1293 1286 13381 11016 --
NM_003099chr1585813 5154 5089 4911 4831 2014 615 169 2314 302 ----
NM_003161chr1733566 3111 553 12861 --11294
NM_003262chr375229 5011 3303 1340 1013 780 145 14234 ----
NM_003566chr1243246 783 525 217 1935 --11314
NM_003574chr1894242 3843 2252 2196 1920 1873 1427 393 316 ----1417
NM_003590chr283897 3236 3115 1138 896 829 299 184 ------
NM_003607chr154074 3390 3049 2917 1623 12741 --1138
NM_003672chr121624 414 ----21481 669
NM_003774chr1253279 3177 2950 2224 1357 32897 2626 2126 12741 --
NM_003913chr684219 3932 3177 3044 2983 2852 1718 521 --13848 11543
NM_003948chr452585 2114 1993 1968 1081 ----1450
NM_003994chr12104180 4151 3708 3317 2970 2893 1117 984 276 161 ------
NM_004028chr1833436 2807 671 13853 1799 13943
NM_004124chr1443383 2418 2260 476 12750 --13409
NM_004229chrX82077 1963 1890 1829 889 730 141 62 11587 ----
NM_004232chr1883699 2950 2822 2590 1274 742 526 143 12624 ----
NM_004440chr6------21735 191
NM_004464chr453608 1407 827 262 220 ----12862
NM_004612chr994501 4077 3178 1877 1407 1347 604 450 300 1483 14791 --
NM_004726chrX75157 4796 3767 1771 1439 1130 522 2401 376 ----
NM_004866chr555027 3817 3700 3394 259 13874 24847 666 --
NM_004904chr785770 5636 4635 4487 4371 4183 4049 1071 ----14359
NM_004985chr1254045 3855 3727 3543 3123 43188 2891 1792 1547 24056 3217 --
NM_005036chr22108325 7601 6929 6378 5853 5842 5167 2379 1913 1456 ----25876 5188
NM_005065chr1474900 4431 4205 4138 1758 561 168 11235 11117 175
NM_005079chr872159 2141 926 831 796 668 109 ----1221
NM_005121chr1762661 1486 1296 1120 938 918 21097 199 11063 --
NM_005188chr11106585 5664 5599 5564 2814 2075 1808 1586 1448 1132 47229 5883 1073 467 ----
NM_005197chr14115604 5527 5090 4893 2114 1588 1535 1355 1214 414 376 14486 ----
NM_005235chr2127407 7318 6019 3055 2791 2537 2473 1770 1327 995 439 21 1975 12497 --
NM_005359chr18116369 5951 5913 4938 4573 4193 2561 1971 1105 594 294 ------
NM_005665chr184826 4446 4270 3116 1809 1692 1499 523 13624 24493 3797 --
NM_005668chr574101 3651 3458 3378 2956 2877 1586 --12971 --
NM_005798chr1374746 4665 4364 2091 1803 172 66 23649 899 ----
NM_005840chrX117078 6223 5861 5791 5214 4894 3045 2557 1865 1309 319 11405 1256 --
NM_006016chr662245 1545 1440 460 369 355 ------
NM_006047chr2043144 3067 3054 2870 --1790 11226
NM_006095chr493821 3448 3088 848 818 562 542 390 139 1428 ----
NM_006106chr1183134 3076 1339 1279 1042 989 390 90 1605 12363 --
NM_006197chr872072 1987 1712 1679 1672 1656 373 ------
NM_006251chr573357 2218 1252 1246 1114 901 281 ------
NM_006252chr146867 6759 6586 612 57024 4932 2802 2297 2203 ----
NM_006380chr1773690 2702 1424 1044 819 192 182 13740 ----
NM_006544chr14115605 5498 4638 4340 4169 4110 2380 1168 482 366 24 11535 14292 --
NM_006572chr17113533 3358 3105 3027 3012 2706 2507 2436 2290 385 288 ------
NM_006599chr16117154 6568 6559 6445 6060 5891 5425 5237 2616 2371 1622 36358 5357 4984 --11977
NM_006624chr1061944 1309 458 357 276 184 11970 1522 --
NM_006628chr1531663 961 628 21537 1321 14073 14125
NM_006654chr1244506 1669 1628 417 ----11410
NM_006729chrX104397 3853 3640 3555 2149 2100 1795 1471 858 557 --13867 --
NM_006731chr955744 4460 4203 1934 589 ----11450
NM_006750chr1697436 7071 6477 6285 3225 3051 2859 752 413 ------
NM_006924chr17124072 3893 3794 3680 2782 1743 1261 1074 603 220 97 57 1435 12922 --
NM_007007chr1274075 3785 3737 3572 1090 592 493 --34745 3748 3724 13590
NM_007011chr1586121 5949 4325 2494 2222 1624 628 70 ----12232
NM_007038chr21106102 4475 4458 4237 4167 3872 2420 1069 741 44 --15969 --
NM_007050chr2087018 6305 5718 4934 3038 1741 1605 485 15922 ----
NM_007175chr863581 3193 2817 2734 1102 197 ----22979 1243
NM_007203chr923762 807 31406 1175 720 --11551
NM_007249chr13149011 7861 7101 6396 5915 3600 3027 2529 2386 2224 2007 1891 1109 59 28918 1875 16150 --
NM_012137chr172877 2540 2506 1992 470 317 286 11117 ----
NM_012249chr252918 2640 1358 821 730 --12847 13210
NM_012252chr755084 4059 1221 1194 942 1704 1797 --
NM_012262chr1105090 4564 4321 3968 3898 3847 1804 1727 1215 188 11624 ----
NM_012287chr363154 1825 1106 657 463 249 1194 23442 261 --
NM_012297chr452569 2243 1762 1618 732 --1295 12149
NM_012316chr195617 4295 4203 4163 3957 3754 3675 2103 2013 ----14012
NM_014005chr572206 753 717 661 571 352 166 1428 ----
NM_014048chr1694838 4110 3759 2035 1772 934 564 527 178 ----14570
NM_014309chr2234262 3572 1666 14341 --2897 889
NM_014331chr487131 6972 6218 5700 1990 1306 519 170 26247 2599 ----
NM_014333chr1182667 2130 684 556 549 505 268 45 ------
NM_014388chr195311 3730 1877 1731 1703 1646 1135 528 152 ----14358
NM_014393chr811491 --2712 463 1126
NM_014421chr42321 82 31293 635 623 --12100
NM_014423chr564096 2057 1682 1555 1251 390 14507 15235 --
NM_014721chr687459 7000 5412 5380 4972 2408 2331 483 ----26566 512
NM_014739chr654130 3328 1643 1308 1163 ----13585
NM_014774chr183272 3198 2435 2372 1133 794 650 195 --13209 --
NM_014810chr163450 3021 2822 2709 1178 1052 ----1926
NM_014826chr154074 3390 3049 2917 1623 12741 --1138
NM_014883chr4--31830 650 637 --12114
NM_014888chr761468 1319 1292 1191 1139 371 ----1642
NM_014904chr1073854 3041 2793 2515 1055 551 401 2802 409 ----
NM_014906chr1784040 3331 2847 2683 1316 1206 930 744 1754 24089 3018 13130
NM_014982chr1465244 4791 4105 1816 1324 1042 --11273 11426
NM_015000chr1263108 3053 2573 2420 1162 698 ----1351
NM_015026chr1284050 3547 3209 3014 1847 1164 361 146 ------
NM_015068chr793999 3676 3537 3492 3038 1151 102 86 52 122 ----
NM_015076chr664088 3961 3908 743 568 431 --11134 --
NM_015092chr1694699 4200 4016 3672 3231 1384 1339 1283 462 11229 ----
NM_015093chr631826 1614 1382 ----11278
NM_015208chr1852828 2457 1403 883 355 --13420 11393
NM_015365chrX82896 2845 1684 1342 1160 926 866 432 --1521 --
NM_015455chr563757 3651 3010 2738 1460 443 --24017 3132 14044
NM_015640chr1135204 5058 4987 4669 4482 3851 3763 3565 3280 1761 1514 382 209 35219 3640 1621 ----
NM_015879chr18127794 7109 5765 5309 2277 1879 1609 1432 1009 895 720 170 22820 1636 15405 15440
NM_015886chr8105333 4723 4635 4106 4080 3977 1092 951 697 433 13686 34199 1967 1608 1812
NM_015888chr163031 2864 2632 1019 882 354 ----23324 2472
NM_016075chr1372570 2263 2015 351 315 190 169 ----1703
NM_016206chr3107100 6980 2926 2335 2222 2213 2045 1706 1631 82 38960 5843 366 11269 --
NM_016255chr663307 2443 2168 2055 2033 90 --22517 648 --
NM_016308chr142055 2027 753 640 1347 2353 191 --
NM_016521chrX2133 23 2242 31 142 --
NM_016530chr1583786 3301 3120 2989 2922 2592 1405 1381 13051 1860 --
NM_016953chr265807 5463 5457 4701 4087 3972 ----11955
NM_017420chr1462954 2568 2450 939 711 276 ----13354
NM_017563chr395571 5421 4487 4161 2307 1839 1831 1267 340 15563 12032 --
NM_017610chr1562048 1647 847 755 734 691 11307 ----
NM_017643chr172322 135 ----32071 1116 735
NM_017644chr384966 4844 4723 1956 1842 1776 1688 628 1307 31491 558 412 --
NM_017769chr1432853 2785 806 13076 1288 12109
NM_017831chr1874377 4007 3492 1583 1552 1507 972 34362 3898 1183 1531 --
NM_018155chr383032 2888 2856 2545 2467 2200 2160 2098 12606 ----
NM_018263chr242045 502 318 293 --1525 22468 1627
NM_018299chr843482 2730 178 67 --11181 12412
NM_018313chr311841 12266 1587 12170
NM_018373chr1476392 5996 5043 4270 1265 694 265 11675 12365 --
NM_018374chr7105199 4830 4132 4030 3224 2011 1964 1106 843 568 ------
NM_018429chr582164 1064 660 415 382 199 110 78 ------
NM_018440chr8118389 8102 7760 7620 6976 6878 6134 3062 2789 377 156 36740 2991 529 17116 --
NM_018566chr124734 1524 14475 14142 14665
NM_018638chr1285591 5087 3887 3675 1321 1081 941 430 1545 --24963 518
NM_018947chr794781 4698 3035 1206 729 330 209 178 95 --11587 1707
NM_019080chr132422 381 11103 11467 1561
NM_020122chr275889 4080 2245 2101 2086 2064 97 14775 1834 11306
NM_020336chr2063860 2656 2469 2384 2364 985 3959 907 389 13184 --
NM_020466chr684651 4471 4275 3670 1896 1572 1235 1014 24915 336 14874 157
NM_020473chrX31501 399 106 ----1212
NM_020718chr16105796 4775 4526 2567 2447 1999 1910 1797 1789 49 15607 ----
NM_020766chrX124302 4103 3275 3108 3042 1722 1373 1088 948 469 259 189 ----11652
NM_020771chr641322 558 457 42 11046 --11281
NM_020772chr17118560 8234 7651 6144 5298 3210 2972 2547 2023 1954 1839 27887 7738 ----
NM_020774chr1875856 5672 5258 2487 1663 926 805 25784 4668 ----
NM_020918chr1073238 2499 2405 1403 803 648 603 ------
NM_021061chr874122 4104 3718 3250 1406 1249 116 --13556 12986
NM_021183chrX4823 808 720 700 ----12347
NM_021190chr151344 1086 402 367 66 1935 --11121
NM_021215chr2072402 2296 1933 1605 1593 657 178 ----12394
NM_021813chr675209 4947 4932 1149 1129 668 540 14188 --13725
NM_021998chrX51239 1156 1057 574 553 ----133
NM_022459chr13155756 5638 5402 5225 5186 4888 4693 3887 2372 2329 1819 1319 973 640 26 14726 ----
NM_022474chr1442718 2579 2514 488 12156 --12093
NM_024345chr995853 5404 5094 4728 4523 3995 1417 1322 62 15965 ----
NM_024511chr442958 2795 768 165 --12787 12685
NM_024524chr353173 2080 2018 224 97 160 --144
NM_024646chr153312 1404 1388 1161 911 53955 3756 3721 644 227 11543 --
NM_024761chr934028 1372 491 --1343 25318 3322
NM_024770chr295759 5146 4467 2394 2346 613 528 360 170 --15875 --
NM_024947chr3119374 9345 6804 6281 5855 3596 3560 978 748 654 447 12748 --27113 2407
NM_024989chr286386 6317 5931 3101 3000 788 324 42 15198 --12952
NM_030621chr1443193 1307 1249 284 13674 11237 --
NM_030627chr583266 2715 1425 1314 1156 753 627 27 ------
NM_030647chr776177 4848 3862 3849 2462 1802 429 --1538 11122
NM_030674chr12165269 5167 4841 4729 4616 4515 4412 4380 3944 2275 2179 2099 1900 1048 884 390 --1203 --
NM_030755chr14103039 2781 2680 2419 2299 2253 2060 518 144 108 11991 --1602
NM_030806chr1117724 7699 7019 6817 5964 2882 1869 1809 1377 1205 89 37785 3732 960 26997 3058 28453 2924
NM_031268chr1695352 5175 5120 4938 4877 4197 4036 3953 1935 11923 1212 --
NM_031427chr1475935 4889 2302 429 392 356 160 11180 1633 --
NM_031468chr787995 7585 6563 5160 2295 1875 464 129 22740 1204 --16948
NM_032116chr1365197 5172 4262 3668 1239 312 21799 297 14865 --
NM_032160chr1874170 3378 3192 3126 3050 512 122 ----13538
NM_032859chr1383781 2705 2518 1597 1462 1262 1227 742 11132 13364 --
NM_032873chr1163045 3019 1759 1239 179 112 14532 24370 3820 --
NM_032968chrX84234 3643 3541 3362 3163 1021 424 187 ------
NM_032969chrX84234 3643 3541 3362 3163 1021 424 187 ------
NM_033030chr211181 11463 1207 1407
NM_033143chr453939 1738 1158 593 551 ----13193
NM_033224chr7107767 7382 6366 6171 5152 4927 1627 1007 732 546 --26275 391 --
NM_033290chrX42596 1498 217 46 1274 2794 59 11280
NM_033360chr1254166 3976 3848 3664 3244 33309 3012 1668 24177 3338 --
NM_033656chr2185356 5145 4816 4775 2069 1323 886 190 --194 15961
NM_052811chr1374746 4665 4364 2091 1803 172 66 23649 899 ----
NM_052832chr832821 2730 1139 ----1608
NM_052879chr1283571 2512 1469 1407 1038 636 327 321 --23898 3381 --
NM_052885chr12114859 4596 4291 4150 3979 3945 3463 1773 762 599 23 ------
NM_053042chr42338 72 32973 2459 2095 --12780
NM_080764chr2233244 709 87 13093 --1146
NM_133170chr2087018 6305 5718 4934 3038 1741 1605 485 15922 ----
NM_133370chr463093 2668 2648 2265 626 404 2871 862 11051 --
NM_138270chrX53249 2992 2749 993 760 161 --1355
NM_138468chr286302 5895 5649 4347 4223 1726 270 75 ------
NM_138494chr782486 2471 2355 2313 1113 626 450 47 12818 137 --
NM_138713chr16117154 6568 6559 6445 6060 5891 5425 5237 2616 2371 1622 36358 5357 4984 --11977
NM_138714chr16117154 6568 6559 6445 6060 5891 5425 5237 2616 2371 1622 36358 5357 4984 --11977
NM_138782chr581964 1935 938 855 422 363 235 29 ----1220
NM_138959chr1116351 6342 5842 5252 5096 4480 4350 4199 4117 2208 867 31386 491 405 --15698
NM_139169chr1052196 2080 2004 388 264 1225 1410 --
NM_144571chr4116391 5749 5494 5460 5293 5216 2726 1885 1211 520 107 1805 ----
NM_144578chr14135290 4948 4182 4052 4019 3965 3509 2016 1664 1548 1189 1039 213 ------
NM_144664chr1182257 2175 2125 2087 1797 1729 844 404 ----1491
NM_147150chr923762 807 31406 1175 720 --11551
NM_148955chr1585813 5154 5089 4911 4831 2014 615 169 2314 302 ----
NM_152407chr5103264 2603 2481 2450 2434 2422 2155 746 438 116 2477 248 ----
NM_152409chr563601 2709 2272 2249 1306 554 --23383 3275 --
NM_152455chr1522308 346 1117 --22681 1920
NM_152556chr732227 2166 240 ----11719
NM_152624chr5107392 6310 5987 5793 5207 2325 2271 2151 1593 217 22763 1120 ----
NM_152754chr763441 3257 2989 2857 2531 582 ------
NM_152787chrX73939 3650 2443 1314 1272 1044 555 ----11155
NM_152826chr1585813 5154 5089 4911 4831 2014 615 169 2314 302 ----
NM_152838chr2043144 3067 3054 2870 --1790 11226
NM_152924chr1586121 5949 4325 2494 2222 1624 628 70 ----12232
NM_152999chr754074 3170 1809 734 71 --1221 23891 3661
NM_153013chr52637 279 1993 1788 1315
NM_153207chr1242540 1098 475 72 1701 --1138
NM_153235chr672324 2282 2042 1933 617 154 48 --1713 --
NM_153371chr1331570 1557 239 22356 89 --12395
NM_172071chr1117165 6403 6030 5776 5616 5126 4545 2462 866 779 237 36805 4717 2962 ----
NM_173214chr16117154 6568 6559 6445 6060 5891 5425 5237 2616 2371 1622 36358 5357 4984 --11977
NM_173468chr495435 4656 4348 3992 1888 1855 1320 1162 1093 11050 1773 15132
NM_173582chr1175690 5587 4441 4176 1585 590 532 ----12269
NM_173602chr1273543 3175 3039 2311 1502 971 832 ----1994
NM_173642chr1138636 8506 7388 6991 6574 6290 6127 3434 3374 3111 2066 1490 539 12745 11712 --
NM_173808chr154165 3990 602 394 304 1545 23269 537 --
NM_173829chr5105440 5221 4249 4183 4005 2382 1743 1654 889 713 ----25779 846
NM_175056chr352164 2063 763 715 386 21462 453 --1252
NM_175061chr771826 1808 806 708 502 86 74 ------
NM_177438chr1443193 1307 1249 284 13674 11237 --
NM_178123chr251003 900 791 388 379 1973 ----
NM_178151chrX87421 5888 3049 2193 2183 2143 993 903 47235 2361 1879 979 ----
NM_178152chrX87421 5888 3049 2193 2183 2143 993 903 47235 2361 1879 979 ----
NM_178153chrX87421 5888 3049 2193 2183 2143 993 903 47235 2361 1879 979 ----
NM_181521chr1676541 5890 4791 4472 1193 926 93 25718 5001 35052 4877 1998 --
NM_182493chr1685172 3987 3799 3671 3632 2032 369 280 ----1477
NM_182515chr1976105 5901 5439 4521 2407 2210 2161 ------
NM_182898chr785770 5636 4635 4487 4371 4183 4049 1071 ----14359
NM_182899chr785770 5636 4635 4487 4371 4183 4049 1071 ----14359
NM_182975chr131033 1017 73 2727 191 --1469
NM_194291chr821070 117 --22332 2155 175
NM_194314chr1105326 5015 4990 4945 4463 4050 3609 2144 557 232 ------
NM_194434chr1894242 3843 2252 2196 1920 1873 1427 393 316 ----1417
NM_197970chr211181 11463 1207 1407
NM_198273chr562714 1158 1113 493 412 94 32200 686 243 --1815
NM_198320chr12105212 4230 4032 3939 3567 3486 3325 1870 1255 190 1577 ----
NM_198465chrX52807 2171 1052 299 87 11971 12509 --
NM_198485chr351990 1658 349 130 122 ----12224
NM_198549chr142857 2829 2807 486 12925 1109 12238
NM_198859chr334148 3767 1851 23721 344 23466 3114 23744 1825
NM_199188chr1283571 2512 1469 1407 1038 636 327 321 --23898 3381 --
NM_199190chr1283571 2512 1469 1407 1038 636 327 321 --23898 3381 --
NM_203394chr1282613 2293 2120 1897 1811 871 549 505 12719 ----
NM_203504chr452569 2243 1762 1618 732 --1295 12149
NM_203505chr452569 2243 1762 1618 732 --1295 12149
NM_206855chr664296 2201 815 275 195 170 34632 4547 1132 15473 --
NM_206907chr573357 2218 1252 1246 1114 901 281 ------
NM_207406chr496479 5361 5132 4823 4270 4116 4087 1462 153 14239 26072 1378 --
NM_213589chr295416 4596 4304 3553 1874 1292 976 374 83 --2109 76 1755
NM_213590chr1374746 4665 4364 2091 1803 172 66 23649 899 ----