TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3143
miRNA Sequence: AUAACAUUGUAAAGCGCUUCUUUCG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX116724 6501 5761 5465 4988 4657 4305 2706 2057 211 56 26865 587 22247 526 26752 2384
NM_000112chr594999 4841 4241 4220 3760 3637 2175 2031 1467 24773 4094 1425 11667
NM_000264chr9103041 2928 2842 2787 2326 2266 1353 1186 970 350 --1488 22799 2459
NM_000332chr6127112 6805 6676 6249 5597 5534 5184 5132 4905 1919 1492 94 --21866 876 --
NM_000809chr4168518 8178 8156 7903 7340 6530 6451 6028 3481 2806 2515 2244 2006 1271 591 61 --17136 28469 6899
NM_000868chrX82591 2565 2387 1957 770 729 241 114 11827 32646 2078 592 12364
NM_000875chr15116903 6556 5694 5652 5047 4892 4723 2266 1686 1170 176 ----11797
NM_000950chrX73433 2479 2391 1103 713 552 82 --12470 22795 2615
NM_001001419chr5105091 4970 4814 4705 3969 3533 1099 619 555 204 13452 21945 808 --
NM_001001420chr5105091 4970 4814 4705 3969 3533 1099 619 555 204 13452 21945 808 --
NM_001001664chr283685 3581 3002 1612 1441 1372 970 614 34056 781 629 33393 2849 2702 13044
NM_001003652chr1897835 7650 7337 6810 5307 2764 2565 2482 1234 38657 8102 1475 18096 16169
NM_001003674chr1896993 6634 6513 6057 4567 1308 642 217 79 --35429 5403 4343 1598
NM_001003675chr1896993 6634 6513 6057 4567 1308 642 217 79 --35429 5403 4343 1598
NM_001003712chr12103869 3797 3159 2886 2822 2657 1346 1299 850 60 1211 13638 22620 353
NM_001004317chr684370 4305 4248 3713 3478 1460 1118 869 24498 190 --13606
NM_001005473chr5106199 4948 4354 4294 2608 2573 1919 672 624 299 1811 1228 --
NM_001005502chr1255015 4768 4401 4205 139 --24310 4124 24262 4135
NM_001005845chr871901 1621 1336 734 679 455 185 21488 1203 1743 --
NM_001008925chr483499 3444 3170 2258 2182 588 445 251 13265 --12885
NM_001010891chr5126604 6546 5596 5455 4890 4537 4430 2701 2383 2168 1644 307 35283 4267 1291 16779 --
NM_001011666chr7166163 6089 5455 5356 4222 2540 2506 2367 1785 1748 1586 1541 1237 858 837 713 26435 441 66047 5203 4991 4138 4080 150 26571 6243
NM_001013399chr61203 --3960 833 756 21121 781
NM_001013620chr12218410 8374 8054 7686 7438 7372 7327 7175 7151 6529 6205 5952 5151 3167 3142 3026 2151 2041 1474 455 288 26282 2235 27428 263 25738 5520
NM_001014797chr1037346 6331 5125 37900 6203 3290 36596 6397 3233 1130
NM_001025076chr10116151 5367 5319 4894 4049 3995 3893 1296 1048 830 779 --1441 11466
NM_001025077chr10137509 6725 6677 6252 5407 5353 5251 4591 2654 2406 2188 2137 758 --11799 12824
NM_001025356chr1232344 2108 2058 21838 807 1228 42973 2931 2520 727
NM_001025580chrX43919 3421 2659 1308 33565 3516 2764 --24328 2976
NM_001030055chr14104635 4461 3645 3599 1609 1594 1535 1185 1084 514 --21355 677 --
NM_001031732chr473143 3026 2936 1323 689 470 282 32329 2310 980 --13267
NM_001031804chr1654442 3618 2951 1288 362 11626 43286 3228 1540 691 14204
NM_001037582chr471560 1554 1414 1267 1171 406 137 --21730 1588 1162
NM_001039547chr376833 6553 6254 3230 3063 2814 984 27997 659 26791 2370 --
NM_001039590chrX103711 3638 3271 3105 3004 2921 2775 842 368 196 1478 --1260
NM_001039591chrX103711 3638 3271 3105 3004 2921 2775 842 368 196 1478 --1260
NM_001039618chr1195525 5380 5269 4771 3994 1608 1550 931 136 24143 1916 15826 14677
NM_001039840chrX95648 5540 5389 2414 1990 1211 523 279 28 56097 4869 4845 4215 740 35435 5193 1888 --
NM_001040284chr1685233 4331 2209 2106 1871 1857 779 345 23876 1924 14770 45615 4228 4013 3645
NM_001040402chr462931 2639 2185 2107 561 128 --22972 2702 22512 663
NM_001040441chr154904 4186 4134 575 420 11546 35513 3599 706 13993
NM_001040665chr784630 4404 4066 4054 1891 907 684 469 --15012 43813 3306 1396 321
NM_001042493chr651989 1700 740 401 321 3787 777 748 41349 807 796 726 1758
NM_001042550chr951655 682 353 233 105 --197 11381
NM_001042555chr12113794 3725 3439 3384 3231 3084 3024 1482 1275 912 421 --22998 567 12976
NM_001042599chr277502 7123 6111 2959 2835 726 211 36744 6096 2212 37549 7481 7267 11797
NM_001042604chr384757 4711 4497 3855 3546 3366 1741 1539 24860 824 21706 1415 --
NM_001099678chr344268 4118 1945 106 --34537 2302 1447 11427
NM_001126chr15958 683 666 285 262 1709 --11022
NM_001167chrX116615 6527 6453 6335 5680 4869 2055 1702 1497 138 24 21345 645 14350 22346 1430
NM_001173chr14104635 4461 3645 3599 1609 1594 1535 1185 1084 514 --21355 677 --
NM_001186chr2183264 3225 2976 2831 2615 2547 2451 1209 12644 33258 2905 944 --
NM_001204chr2127155 6553 6436 6413 6317 6036 5554 5492 1881 1317 792 62 1450 36046 1643 1029 --
NM_001432chr453550 975 755 135 84 23604 525 23760 96 --
NM_001616chr2112881 2695 2398 2334 2202 2141 1262 750 685 496 307 --1149 21344 120
NM_001621chr752931 2921 2544 2389 901 3811 475 450 32979 967 793 11191
NM_001621chr752931 2921 2544 2389 901 3811 475 450 32979 967 793 11191
NM_001650chr1854156 4113 3479 1354 224 13291 24007 3724 14031
NM_001806chr1941906 1842 819 277 --1166 32213 237 44
NM_001874chr1255015 4768 4401 4205 139 --24310 4124 24262 4135
NM_001918chr197265 7102 6853 6667 6431 6029 1336 599 249 25635 3580 27532 5802 18362
NM_002009chr1592779 2134 2018 964 864 680 399 317 268 ------
NM_002024chrX32189 1869 858 21804 1721 1782 21529 628
NM_002025chrX138624 8008 7342 7218 6982 6722 3082 2943 2936 1835 1464 731 530 --39038 7280 6198 12251
NM_002137chr732251 2102 2041 ----2332 99
NM_002158chr273774 3491 2999 961 831 688 556 33312 3045 1484 13363 --
NM_002214chr7105634 4171 4120 1832 1645 1588 1425 1363 1066 978 25712 3857 --1799
NM_002264chr3125057 4919 4867 4237 4130 4087 3862 3532 1722 953 440 99 --11471 --
NM_002270chr5115424 5400 5235 5049 4344 2011 1495 1373 972 842 194 35697 5289 521 21317 88 25677 1894
NM_002310chr5176543 5976 5806 5593 5475 5349 4815 4720 4570 4028 1803 1757 1572 1041 565 147 56 46002 5756 4794 130 16139 14694
NM_002430chr2252421 2252 818 805 242 --32516 2379 559 1252
NM_002610chr252783 2731 2336 2263 2200 22749 2124 12055 12194
NM_002645chr1182974 2641 2604 2301 746 604 438 402 ----32768 1924 1900
NM_002655chr8124891 4868 4754 4397 4305 4265 4002 3804 3336 1772 1201 519 23423 2115 25267 4656 13511
NM_002745chr22104351 4336 4053 3849 3811 3692 3239 1684 793 542 33171 3121 1673 --13663
NM_002837chr12104475 4395 4252 4226 4047 3244 1359 269 224 133 13576 ----
NM_002886chr354810 4223 3459 3336 1951 14939 1852 24520 3159
NM_002977chr283390 3265 2846 2811 2177 2144 642 473 155 --13149
NM_003108chr296980 6739 6585 5935 4665 4572 2198 1735 1085 ----27231 4680
NM_003112chr7103203 3008 2558 2346 2234 1131 1122 860 796 158 42918 2549 933 298 22839 523 --
NM_003199chr18115652 5398 5168 4911 4681 4167 4151 1835 1103 886 487 --65537 5489 5248 1166 1083 1025 --
NM_003262chr3105254 5245 5141 4715 3965 3226 1551 1360 981 56 44864 3413 1494 1377 11875 --
NM_003274chr21102694 2170 2130 2061 1969 1861 1171 1084 794 689 12239 --1720
NM_003298chr3115887 5741 5557 5518 5122 2375 2228 1885 600 195 104 14746 21862 1283 --
NM_003463chr663226 2425 2202 1213 717 77 23330 3111 21140 798 22519 2088
NM_003478chr1143153 3142 873 191 --22846 632 22824 2581
NM_003566chr1232783 848 541 --32411 1249 143 12662
NM_003574chr1875237 3937 2192 1538 1291 1079 638 --1332 11159
NM_003590chr2113683 3356 3282 3069 2892 2765 2746 2483 1284 381 357 --11344 33172 3104 2930
NM_003663chr372598 2519 2478 2304 2171 2137 282 22512 791 12397 12973
NM_003701chr134791 200 183 38 --31018 672 21 11058
NM_003722chr322609 666 11975 --32584 2530 1101
NM_003822chr163088 3057 2686 2498 2189 657 32442 1025 713 --22850 753
NM_003913chr6134121 4063 3713 3593 3347 2955 1556 1155 1025 985 605 571 162 12788 13326 23883 880
NM_003941chr722521 92 --11619 21848 482
NM_003966chr5187572 7249 6844 5991 5928 5678 5428 5217 5007 4948 2505 2373 2237 2125 1841 983 542 362 25143 4815 36779 5895 1684 36856 6377 5278
NM_004028chr1854156 4113 3479 1354 224 13291 24007 3724 14031
NM_004035chr17145041 4844 4707 4605 4139 3804 3710 3406 3195 2045 1532 424 364 175 43512 1443 1419 1370 ----
NM_004133chr852475 1873 660 361 220 22653 646 --1309
NM_004136chr1593265 3017 2950 2456 2393 1172 1156 1058 974 --1879 13206
NM_004171chr11149640 9394 8144 7449 7344 6955 6804 6616 6279 6222 2142 579 414 400 38181 2758 1092 36991 3009 2263 --
NM_004293chr983335 2466 1132 970 809 691 605 344 11194 23241 1322 --
NM_004338chr1896993 6634 6513 6057 4567 1308 642 217 79 --35429 5403 4343 1598
NM_004719chr1292757 2608 2391 2005 1072 580 465 267 140 22479 2426 11799 --
NM_004726chrX105346 5232 4727 3747 2030 1830 1565 1496 90 62 25770 5552 12292 --
NM_004745chr8146857 6826 6776 6087 5653 4759 4385 2711 2586 2342 1953 1456 1162 721 12042 36622 6331 2573 15590
NM_004748chr1584232 4002 3633 3506 3338 2994 2862 2568 24089 3641 1596 14051
NM_004804chr221897 1733 ----32712 2571 256
NM_004815chr1144756 3366 3163 1714 1669 1655 1227 1210 900 562 412 173 76 40 --13072 --
NM_004866chr563556 3294 3183 3115 1968 630 23256 3149 --14471
NM_004898chr462244 1029 717 337 232 121 --31770 518 376 12042
NM_004904chr7166163 6089 5455 5356 4222 2540 2506 2367 1785 1748 1586 1541 1237 858 837 713 26435 441 66047 5203 4991 4138 4080 150 26571 6243
NM_004985chr1264447 4137 3812 3488 1713 1075 64182 4086 3870 3632 3134 1592 44390 3353 1448 318 --
NM_005065chr1455389 4576 4124 503 203 13634 34261 3664 1751 25292 3796
NM_005105chr14661 465 302 143 21874 596 1171 12204
NM_005121chr1773295 3125 3109 3043 1013 389 50 23083 313 23228 1021 --
NM_005164chr1232573 1972 947 179 --22274 937
NM_005188chr1198233 7484 7183 6193 5771 5684 1608 863 710 1433 18257 18023
NM_005190chr61203 --3960 833 756 21121 781
NM_005235chr277502 7123 6111 2959 2835 726 211 36744 6096 2212 37549 7481 7267 11797
NM_005339chr493279 3149 2779 1467 1130 1105 839 287 117 14298 33626 3345 1438 11576
NM_005436chr1083965 1577 807 591 432 213 170 148 14094 1765 1722
NM_005497chr17145815 5032 4896 4701 4655 4174 4143 3994 2284 2129 1820 1562 1298 185 15306 45889 4604 3807 1883 25046 3748
NM_005504chr12125973 5516 5347 5100 4847 4788 4334 2314 1370 629 447 132 36527 6360 527 11308 34433 4051 1386
NM_005596chr995653 4878 4181 4073 2424 2417 1086 807 385 15280 16221 --
NM_005665chr1104912 4274 3714 3685 1726 1182 1106 962 697 273 23485 1596 13763 --
NM_005667chr22339 71 1170 2100 60 1137
NM_005668chr594413 4085 3876 2874 1282 1075 1000 859 257 --14023 13400
NM_005746chr772499 1772 981 808 544 149 45 22712 2462 11757 12797
NM_005779chr553137 2917 2224 2217 896 --33064 2685 2335 12473
NM_005795chr242829 2643 372 203 22103 1025 12374 12180
NM_005901chr1897835 7650 7337 6810 5307 2764 2565 2482 1234 38657 8102 1475 18096 16169
NM_005903chr5105091 4970 4814 4705 3969 3533 1099 619 555 204 13452 21945 808 --
NM_006007chr9133848 3793 3186 1786 1772 1308 1234 1167 1060 903 883 150 96 13410 21562 374 --
NM_006095chr4104379 3769 3640 3178 2892 2799 2768 699 550 526 1768 34437 2957 1064 --
NM_006106chr11103392 3287 3209 3096 2825 2546 2202 1125 1108 327 12995 33347 2986 470 --
NM_006158chr841555 1223 715 284 --1155 2335 329
NM_006252chr1107507 6956 6284 2412 2036 1829 1547 1394 927 920 26380 1647 36884 2626 1526 37408 5621 488
NM_006330chr831646 110 92 21465 1356 --1104
NM_006420chr2073174 3095 2915 2511 481 465 41 43005 1190 790 398 11388 --
NM_006544chr1476035 4052 2351 2277 1240 884 332 35144 4218 4102 31482 324 299 23881 1987
NM_006561chr10116151 5367 5319 4894 4049 3995 3893 1296 1048 830 779 --1441 11466
NM_006572chr1783279 2744 2587 2162 2137 1188 600 47 --13421 13461
NM_006599chr1697927 6639 5481 5367 3149 2112 1508 1292 809 15390 35939 5898 2309 23174 190
NM_006614chr353424 3065 1262 1152 340 2909 142 13277 13370
NM_006628chr15104426 3962 3635 1624 1616 987 349 307 203 57 ------
NM_006654chr12113794 3725 3439 3384 3231 3084 3024 1482 1275 912 421 --22998 567 12976
NM_006873chr252991 2402 1323 235 215 21251 487 13416 12463
NM_006948chr2182331 2012 1888 1879 1806 1650 655 148 1789 22246 1524 --
NM_007007chr12124714 4687 4037 3766 3245 1672 1500 1077 465 410 357 194 --1514 11479
NM_007038chr21105609 5271 4562 4550 4455 2434 1681 1315 1085 469 --12048 --
NM_007054chr583770 3065 2846 2418 624 557 439 419 33305 2561 1063 2824 572 13080
NM_007114chr373099 2976 2896 2862 2659 916 365 --21080 709 2485 402
NM_007137chrX84431 3681 3667 3356 1350 537 366 261 14041 35304 3503 245 --
NM_007212chr141441 824 603 102 --12207 21636 388
NM_007249chr13109049 9007 7655 7479 7367 7173 3549 1505 824 283 --29226 6222 187
NM_007292chr17145041 4844 4707 4605 4139 3804 3710 3406 3195 2045 1532 424 364 175 43512 1443 1419 1370 ----
NM_007375chr141735 970 558 456 11058 --32643 2018 1820
NM_012081chr553660 3172 2490 1458 1422 23615 3219 43554 3427 972 859 23765 1331
NM_012129chr742520 2186 716 595 2523 303 --22005 1904
NM_012158chr134725 655 499 302 11846 2510 341 11256
NM_012164chr996797 6723 6278 5073 4718 4710 2407 430 246 36247 5243 2002 31593 581 256 1483
NM_012214chr2146117 5999 5868 5246 5185 4991 4974 4760 4602 4001 1954 1851 1792 983 16422 35642 439 323 --
NM_012249chr2103542 2802 2321 1439 1316 1020 970 548 285 158 1940 --23489 1150
NM_012252chr795403 5139 4407 4399 4365 4128 4014 293 81 14263 14349 2348 176
NM_012382chr554412 3495 1700 1629 164 34397 1528 1314 1332 13910
NM_012431chr783339 3244 3231 1415 1329 1252 493 133 23347 918 11223 1513
NM_013255chr7118833 7716 7407 7005 5620 5424 3149 2355 2070 1280 584 28771 547 68891 8052 5383 3406 2011 400 37677 5883 1783
NM_013381chr1252214 1478 718 422 404 1307 --22319 111
NM_014011chr252290 2263 2034 424 371 22352 901 2120 87 12594
NM_014021chr193458 2894 2853 2689 2466 1161 1127 331 246 1517 --13320
NM_014155chr11107267 6090 5395 5166 5112 4906 4875 2661 1184 702 1487 22715 2431 15586
NM_014331chr4116206 4965 2839 2189 1314 1297 1172 923 687 416 312 46880 6419 5946 5641 36512 6132 969 --
NM_014372chr161946 1616 1454 1319 222 141 --11280 22067 287
NM_014445chr352031 1753 779 64 21 1924 12361 12242
NM_014494chr1692401 2362 2275 789 605 585 509 458 408 --22190 2162 11992
NM_014701chr1593143 2780 2693 2172 1259 562 524 479 352 2785 488 12302 --
NM_014721chr6137414 6971 6355 5107 4847 2132 2018 1898 1718 1539 648 609 580 1431 --11680
NM_014783chr1571632 1575 1521 1433 433 129 76 --11158 11710
NM_014877chr17166989 6337 6203 6165 5091 5068 2704 2113 2032 1589 1268 1078 988 885 447 31 22314 1805 16356 24741 739
NM_014915chr10----41292 1094 1044 145 11372
NM_014934chr1353185 2891 1138 741 56 --13715 2683 294
NM_015026chr1254151 4039 3834 1383 46 54266 1858 1769 1092 319 13424 22960 570
NM_015032chr13102506 2194 2060 1929 1797 1061 763 539 410 281 --1877 --
NM_015040chr263360 3084 2595 618 576 383 13217 1450 33042 2439 1059
NM_015115chr462931 2639 2185 2107 561 128 --22972 2702 22512 663
NM_015144chr1643985 3269 2844 2736 --13021 22813 1374
NM_015206chr1531034 447 334 --13768 23418 131
NM_015263chr1531144 1078 1041 31068 1007 800 41184 961 846 340 --
NM_015271chr464188 3896 3809 1708 1071 1040 --23548 1026 24144 1497
NM_015310chr8108249 8067 6437 6342 5997 2897 2670 2238 2033 1659 --26948 6909 --
NM_015336chr12102633 2603 2541 1674 812 582 557 529 376 347 --22080 391 --
NM_015365chrX43919 3421 2659 1308 33565 3516 2764 --24328 2976
NM_015436chr473318 3263 2989 2077 407 264 70 13084 --12704
NM_015458chr884450 3876 3364 1678 1204 1138 1054 432 23292 1000 14796 15302
NM_015525chr641023 956 934 152 ----2981 779
NM_015553chr6125216 5179 4582 4219 3766 1553 1162 1155 1054 674 455 57 11454 13806 14365
NM_015879chr18137956 7733 7479 6687 5971 5674 3177 2361 2007 1815 1056 804 586 11459 1226 --
NM_015886chr895648 5014 4544 4472 4204 4038 3829 3681 145 14131 24822 4085 13649
NM_015888chr183229 2966 2590 2248 1356 1057 937 310 33052 2795 1116 12957 22718 706
NM_015906chr163879 3295 1105 1059 809 88 13560 --13236
NM_016009chr142981 1638 205 183 51538 1505 1058 99 91 --11432
NM_016083chr673699 3614 3442 2915 2564 459 155 1902 11388 13355
NM_016087chr751622 1201 1178 1161 633 1514 --21397 213
NM_016132chr1533047 1284 856 12219 12485 2726 146
NM_016206chr3128812 7992 7946 7863 7647 7587 6564 6520 6396 596 529 353 19015 28736 2406 23241 2203
NM_016217chr693392 3379 3116 2742 2438 2321 1377 631 479 ----33600 363 178
NM_016248chr1393634 3047 2967 2903 2837 2453 1604 149 65 22794 939 11396 23703 960
NM_016260chr287403 6174 6019 5858 5660 4858 4773 2666 26354 6033 --2970 91
NM_016315chr251732 1575 629 449 100 132 11431 11357
NM_016485chr652064 1929 1650 355 228 --21641 1602 1635
NM_016530chr1534122 3336 1123 12621 1305 21387 397
NM_017437chr1432191 865 78 21855 774 11639 21590 812
NM_017447chr2194221 4056 3141 3064 3039 2919 2782 1153 560 24248 1518 13381 --
NM_017563chr3146402 6366 5541 4847 3994 2063 2016 1794 1629 1053 809 603 486 470 32051 1327 530 14887 16299
NM_017628chr475322 4402 3549 2040 1716 1701 1354 14466 33412 1522 472 11321
NM_017637chr9138397 7416 6626 3522 2932 2824 2501 2386 1698 1687 1562 1555 668 57736 7281 3622 2483 2374 26944 1121 26478 980
NM_017643chr1762957 2606 2231 2204 899 574 --1777 23145 707
NM_017658chr14154682 4641 4489 4478 3740 3247 3190 2976 1640 1417 1311 1108 976 910 827 12960 11058 11077
NM_017736chr1632910 250 53 --33114 2313 1249 23060 2483
NM_017813chr8145510 5338 4918 4754 4706 3984 2330 2143 1886 1567 1507 1217 516 391 24524 3907 1505 14289
NM_017938chrX92189 2135 1942 1590 1545 1506 757 715 338 22164 522 1828 11819
NM_018018chr1231693 1349 773 --187 2668 646
NM_018036chr14103979 3924 3766 3535 2997 2734 1567 1397 496 203 24260 1665 1570 --
NM_018155chr353427 2816 2781 1241 572 ----23343 687
NM_018293chr352730 2140 2017 1202 900 ----22870 2444
NM_018351chr1253151 1220 689 207 187 --23134 894 14736
NM_018364chr143954 3796 3774 3568 14047 --21172 758
NM_018440chr8128666 8274 7990 6470 6089 5959 3173 1901 1240 1079 888 776 38420 2183 1980 25927 3319 --
NM_018566chr1114974 4955 4095 4046 3979 3535 3229 1850 1790 1578 1071 14121 23727 700 --
NM_018569chr441160 448 236 115 11481 --2596 45
NM_018638chr1255587 4799 1706 745 278 35143 1094 221 41807 1698 1666 721 --
NM_018691chr561211 909 877 398 312 155 --2322 293 1839
NM_018999chr1084522 4272 4251 4168 1544 1359 1203 988 --24938 1319 33429 3236 3142
NM_019001chr384757 4711 4497 3855 3546 3366 1741 1539 24860 824 21706 1415 --
NM_019117chrX53345 2607 2240 919 818 2839 594 22676 1040 23510 931
NM_019593chr2053177 2700 2589 1224 971 21142 768 32944 2399 1956 42553 1167 645 270
NM_019610chr152182 2112 1611 256 108 21991 237 --1228
NM_020193chr1161013 850 453 327 141 128 1862 --11248
NM_020245chr6104828 4143 3608 3548 3255 2049 1514 1445 629 503 13887 11891 11163
NM_020347chr352313 1910 1856 1573 357 11694 1778 1341
NM_020390chr374723 4072 4031 3667 3108 1121 498 1868 --14815
NM_020403chr1351809 690 576 150 128 --31153 1136 591 21356 520
NM_020425chr651989 1700 740 401 321 3787 777 748 41349 807 796 726 1758
NM_020718chr1685957 5290 4806 4760 4549 565 38 21 35773 4494 1080 11102 14296
NM_020727chr2183402 3337 2901 2871 2641 2444 1461 777 ----34018 3965 246
NM_020739chr1584232 4002 3633 3506 3338 2994 2862 2568 24089 3641 1596 14051
NM_020766chrX114519 4391 3656 3609 3526 2856 1748 1157 1092 287 237 13397 13155 --
NM_020794chr161451 617 449 179 134 46 ----1161
NM_020841chr12103869 3797 3159 2886 2822 2657 1346 1299 850 60 1211 13638 22620 353
NM_020871chrX62490 2380 2190 1875 1827 788 --22129 901 1807
NM_020940chr1072700 1835 959 762 737 676 645 22865 1052 32911 181 171 --
NM_021116chr759060 7899 7715 2221 1109 16910 37651 7347 3480 19016
NM_021629chr384962 4872 4508 4097 3777 3128 2037 1533 34627 4518 1465 25086 940 --
NM_021956chr641138 595 472 65 --1421 21098 255
NM_021961chr11117173 7164 5635 5534 4712 4643 4521 2091 1557 1534 879 15556 14938 1603
NM_021964chr365744 4506 1681 1340 1227 197 --46183 6157 4935 1716 15462
NM_022459chr13106313 6162 6050 5955 5346 4382 1634 1577 979 394 1519 45394 4527 4449 194 25286 2284
NM_022473chr1574370 3578 3483 3318 3005 2927 284 --33234 3073 859 1218
NM_022841chr1552776 2673 2543 2439 794 12223 12253 22333 688
NM_022893chr262741 2262 2045 426 380 337 12195 12274 11966
NM_023016chr262913 2731 2649 2315 1111 1100 --1803 1727
NM_024594chr531809 696 649 1690 21563 126 2479 205
NM_024665chr3114536 4193 4147 4085 3986 1197 1138 1040 924 655 607 24560 4479 ----
NM_024921chrX31542 1295 1279 ----21426 1363
NM_024947chr3209400 8556 8518 8252 7501 6836 6446 6266 3777 3530 3052 2847 1954 1869 1854 1520 1424 793 306 277 29085 5976 17707 36111 1758 712
NM_024949chr4104969 4867 4822 4566 3834 3784 3552 1548 842 811 14650 24987 248 --
NM_024989chr2148204 8071 7743 6594 6351 6070 5734 5635 5299 5283 4987 4977 2378 153 ----36239 6057 2905
NM_024993chr271447 1344 1280 1114 1032 522 52 1243 --11196
NM_025054chr8134235 3940 3759 3714 3250 3072 2593 1365 1109 698 508 298 31 11246 12779 1384
NM_025160chr184324 4214 3724 3338 3248 3025 2778 1390 1223 34109 3234 2869 --
NM_030625chr1052571 2405 527 246 77 ----22321 385
NM_030627chr573134 2669 1334 1212 1052 924 575 24150 2702 34077 2785 913 --
NM_030674chr12125565 5399 5059 4394 4257 4092 2290 1965 924 670 387 341 14265 ----
NM_030806chr1108038 7780 2224 2174 1536 1202 1103 804 492 151 13661 16801 11193
NM_031243chr732251 2102 2041 ----2332 99
NM_031427chr1495996 5391 5334 4794 4761 1986 1035 329 164 22067 25 25958 747 15944
NM_031438chr56730 566 315 305 142 115 1204 --21749 601
NM_031483chr2072687 2419 2307 1235 323 131 48 --13203 1696
NM_032047chr371877 1573 592 321 302 136 69 --32283 666 541 12357
NM_032329chr264399 4170 2969 2960 1340 136 24060 1770 24343 4284 --
NM_032373chr10115820 5505 4891 4833 4808 2021 1946 1444 653 326 161 25906 5108 1721 13684
NM_032435chr162392 2266 2218 2162 1965 734 --11789 1289
NM_032446chr593792 3576 3494 3050 2997 2524 2508 1168 265 12766 195 13090
NM_032682chr323547 288 33434 460 146 13534 21431 714
NM_032869chr831941 824 309 11850 --21803 401
NM_032873chr11113828 3598 3539 3413 3030 1444 925 902 812 559 276 21585 887 12843 --
NM_033012chr134791 200 183 38 --31018 672 21 11058
NM_033020chr163879 3295 1105 1059 809 88 13560 --13236
NM_033181chr673699 3614 3442 2915 2564 459 155 1902 11388 13355
NM_033222chr9--31092 291 107 31071 922 474 1237
NM_033360chr1264568 4258 3933 3609 1834 1196 64303 4207 3991 3753 3255 1713 44511 3474 1569 439 --
NM_033389chr17114863 4777 4481 3537 3476 3193 3000 1301 1222 404 38 11333 ----
NM_033430chr463304 2885 1357 811 380 160 --13775 23995 2763
NM_033437chr463304 2885 1357 811 380 160 --13775 23995 2763
NM_033505chr256574 5980 5809 4183 247 --1282 21776 1084
NM_033656chr2195571 4753 4076 3686 1676 1596 1586 1341 647 21784 277 45619 5473 1577 1477 23960 3765
NM_052832chr862242 2067 2004 1071 613 326 12700 12584 12428
NM_052879chr1232624 1542 573 11443 43923 3232 3193 2756 34043 1137 1103
NM_052900chr831697 539 142 ----21662 1363
NM_052917chr292915 2270 2133 1346 1286 782 507 275 152 23212 979 12759 --
NM_052927chr532064 766 507 --22230 1389 22221 108
NM_053016chr966692 6251 5117 5087 2585 1102 36682 5445 892 17706 11198
NM_057168chr751622 1201 1178 1161 633 1514 --21397 213
NM_130847chr11115940 5179 5168 4671 4351 4319 4215 2173 1526 1377 1293 ----1154
NM_133370chr473143 3026 2936 1323 689 470 282 32329 2310 980 --13267
NM_133646chr275414 3659 3404 3382 889 834 34 --45375 1913 1318 1250 24949 4552
NM_138713chr1697927 6639 5481 5367 3149 2112 1508 1292 809 15390 35939 5898 2309 23174 190
NM_138714chr1697927 6639 5481 5367 3149 2112 1508 1292 809 15390 35939 5898 2309 23174 190
NM_138771chr72524 390 ----2991 514
NM_138959chr156788 5703 4427 2661 1467 24496 447 12199 24689 2609
NM_144571chr4106731 6546 6539 6253 5910 5722 2580 2279 1218 875 34959 2221 1324 12547 21925 916
NM_144578chr1485488 4934 4428 4410 4318 1805 1668 572 11687 24790 1766 --
NM_144599chr15135454 4652 4510 4385 4208 3412 1907 1730 1646 1266 616 446 99 15139 23527 1066 15329
NM_144949chr252290 2263 2034 424 371 22352 901 2120 87 12594
NM_145259chr2136912 6866 6788 5960 4914 2514 2366 1779 1480 1444 959 199 69 15595 37020 2774 299 22649 1153
NM_145263chr471976 1944 1868 1534 801 516 149 --12312 1747
NM_147128chr731191 449 440 31270 1255 640 21408 1212 --
NM_152263chr175760 5247 5070 3807 2336 1328 488 22440 2112 25314 2014 24498 179
NM_152409chr593490 3405 2630 2330 2269 1448 1232 632 549 12968 --1530
NM_152622chr5113395 2873 2739 2263 1348 1157 928 739 590 455 382 ----33007 2631 996
NM_152624chr5187425 7194 7067 7005 6844 6694 6003 5996 5535 5425 4935 2861 2322 1216 1069 915 214 115 26644 6558 32552 2070 1360 37107 6027 2192
NM_152793chr7104975 4612 4531 4468 4175 2015 1991 1688 584 298 33828 3609 2030 1644 --
NM_152996chr131758 753 203 ----22073 2007
NM_152999chr784630 4404 4066 4054 1891 907 684 469 --15012 43813 3306 1396 321
NM_153042chr651799 1582 1508 635 118 161 --11549
NM_153184chr331293 1273 472 --21845 572 21981 276
NM_153188chr5115424 5400 5235 5049 4344 2011 1495 1373 972 842 194 35697 5289 521 21317 88 25677 1894
NM_153207chr1283710 3611 3464 2584 1144 671 578 442 1733 23444 1061 13124
NM_153365chr452460 2253 2161 945 497 1868 --2789 333
NM_153607chr552540 2320 1265 706 490 1759 22028 250 12603
NM_153689chr252204 2144 1717 1608 350 12080 159 22267 1514
NM_170710chr422556 1191 21233 823 21252 599 1425
NM_172071chr1107357 7342 7161 6884 5653 4826 4754 1159 1019 783 14796 11151 25294 803
NM_173214chr1697927 6639 5481 5367 3149 2112 1508 1292 809 15390 35939 5898 2309 23174 190
NM_173468chr4126070 5536 5142 4691 4227 3884 2273 1278 1179 921 485 229 31684 747 712 ----
NM_173510chr2292964 2926 2880 2794 2303 2045 1891 1018 703 --2238 34 11135
NM_173552chr342287 1892 1624 757 1825 197 2871 141
NM_173582chr11105734 5605 4615 3808 2511 1947 742 640 558 80 14327 46309 4240 2303 391 11053
NM_173602chr1273761 3565 3429 2738 548 417 262 13801 1673 3952 879 195
NM_173808chr154480 3666 1717 1186 662 --1890 11438
NM_173851chr852987 2782 2695 1511 1240 23885 3000 33592 3006 2963 23998 2760
NM_176814chr761504 1381 585 474 231 66 --1300 11259
NM_178815chr1092759 2746 2558 2389 2220 2087 1022 598 285 1734 ----
NM_181265chr422556 1191 21233 823 21252 599 1425
NM_181481chr1896993 6634 6513 6057 4567 1308 642 217 79 --35429 5403 4343 1598
NM_181482chr1896993 6634 6513 6057 4567 1308 642 217 79 --35429 5403 4343 1598
NM_181483chr1896993 6634 6513 6057 4567 1308 642 217 79 --35429 5403 4343 1598
NM_181521chr1697196 4540 2624 2287 2097 1939 1560 1307 436 25699 868 --26869 1429
NM_181723chr862122 1937 1737 1658 1462 611 --31437 1420 200 1383
NM_181787chr863573 3321 3256 2543 929 647 1610 3979 779 484 --
NM_182485chr493428 3146 2958 2497 2275 810 615 293 233 33511 3333 2348 ----
NM_182620chr1751832 779 430 364 341 1885 12035 2606 464
NM_182646chr493428 3146 2958 2497 2275 810 615 293 233 33511 3333 2348 ----
NM_182758chr1533551 3439 3181 --33468 2988 542 23894 373
NM_182762chr7136205 5971 5887 5838 5410 4871 4842 4425 1275 1131 1064 850 450 25590 717 1358 15954
NM_182898chr7166163 6089 5455 5356 4222 2540 2506 2367 1785 1748 1586 1541 1237 858 837 713 26435 441 66047 5203 4991 4138 4080 150 26571 6243
NM_182899chr7166163 6089 5455 5356 4222 2540 2506 2367 1785 1748 1586 1541 1237 858 837 713 26435 441 66047 5203 4991 4138 4080 150 26571 6243
NM_194285chr1132204 1098 718 --22425 455 22386 2098
NM_194314chr175637 5550 5352 4008 1299 776 744 --34529 4090 1797 1828
NM_194434chr1875237 3937 2192 1538 1291 1079 638 --1332 11159
NM_198123chr831697 539 142 ----21662 1363
NM_198124chr831697 539 142 ----21662 1363
NM_198273chr51209 32647 2595 174 32941 2857 24 1335
NM_198320chr1255015 4768 4401 4205 139 --24310 4124 24262 4135
NM_198581chr2187563 6821 6611 5667 5339 5101 2858 2754 2681 2176 2062 1257 905 764 748 736 315 224 15040 17276 --
NM_198715chr1106224 6198 6123 5605 5310 5064 4890 1022 839 213 15420 --14532
NM_198859chr345129 4004 3382 1909 1186 14558 3877 861 78
NM_198935chr2042483 414 281 92 12455 12378 32997 2578 2198
NM_198968chr1353185 2891 1138 741 56 --13715 2683 294
NM_199072chr773041 2868 2666 2471 820 225 38 124 --22493 269
NM_199188chr1232624 1542 573 11443 43923 3232 3193 2756 34043 1137 1103
NM_199190chr1232624 1542 573 11443 43923 3232 3193 2756 34043 1137 1103
NM_199324chr4133679 3625 3532 3433 3232 3069 2607 1261 1200 380 357 314 48 22460 1337 1639 23575 912
NM_203463chr253819 3710 3507 1645 926 23039 1058 11324 13547
NM_203487chr1351809 690 576 150 128 --31153 1136 591 21356 520
NM_205860chr163088 3057 2686 2498 2189 657 32442 1025 713 --22850 753
NM_206853chr6104122 4058 4014 3976 3949 1113 714 693 550 149 13173 ----
NM_206854chr6115383 5319 5275 5237 5210 3391 1975 1954 1811 1410 310 14434 ----
NM_206866chr2183264 3225 2976 2831 2615 2547 2451 1209 12644 33258 2905 944 --
NM_206909chr8108249 8067 6437 6342 5997 2897 2670 2238 2033 1659 --26948 6909 --
NM_207325chr1982065 1715 1419 319 265 215 145 133 1547 3761 686 495 1233
NM_207361chr1375816 5286 5195 4462 888 864 365 24362 688 15216 55150 5142 4900 4274 378
NM_207406chr476497 5733 4660 2496 1566 892 354 26289 394 26409 6378 12376
NM_213589chr2125550 5446 5432 5010 4920 1976 985 921 648 490 422 102 ------