TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3144-3p
miRNA Sequence: AUAUACCUGUUCGGUCUCUUUA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_004171chr1198113 8085 7905 7809 7417 2877 1360 880 852 --12579 18095
NM_013374chr312178 22993 2368 --22847 217
NM_015886chr834610 4202 3590 14971 --24684 1105
NM_019593chr2041222 765 493 51 ----22547 184
NM_022459chr1355792 4884 4224 4122 1822 ----24681 2204
NM_030647chr735174 1838 1362 ----35493 5332 2087
NM_130847chr1175426 5135 4700 4574 4304 3797 2362 --1762 24616 1762
NM_213589chr271304 1145 1011 983 497 381 79 21373 98 --13829