TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3144-5p
miRNA Sequence: AGGGGACCAAAGAGAUAUAUAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000037chr842017 1726 829 181 1536 1920 12346
NM_000084chrX76245 5938 5847 5805 4319 4223 895 26728 1133 14441 --
NM_000092chr253121 3012 155 148 115 13107 12916 --
NM_000208chr1964544 4435 3348 1295 613 285 --24269 1531 21560 37
NM_000271chr181577 ----1534
NM_000278chr1082205 1989 1889 1741 1530 888 768 58 --12222 --
NM_000332chr676287 6210 5907 1162 497 425 361 15998 17047 1509
NM_000337chr586441 5893 5782 5596 5115 4261 1882 1231 25978 2315 25175 4855 --
NM_000368chr964605 3721 1820 1687 453 131 13291 ----
NM_000429chr1051256 659 512 304 26 --21186 124 1456
NM_000461chr374132 1759 1228 1146 1138 300 201 --1523 13162
NM_000555chrX77290 6586 5929 5756 5032 4933 2187 36574 4768 2502 ----
NM_000578chr261790 1307 1277 676 637 175 1185 31546 1329 463 --
NM_000610chr1122544 2200 2819 249 1380 1746
NM_000612chr11103627 3502 3247 2845 2573 559 135 109 101 79 33641 3536 2946 33675 3313 2742 12702
NM_000618chr1285597 5508 5329 5318 5283 1050 289 201 12650 ----
NM_000618chr1285597 5508 5329 5318 5283 1050 289 201 12650 ----
NM_000719chr12156331 6061 5751 5196 5107 4479 4225 4208 2646 1273 1163 1104 560 406 222 25900 4428 ----
NM_000809chr449132 9030 9014 8212 ------
NM_000813chr545274 1074 591 191 25020 1090 11165 --
NM_000831chr1146071 5841 5600 5257 4712 4302 4177 1764 1065 724 705 545 81 74 45946 5305 5232 4398 35860 4100 1155 26059 1806
NM_000872chr1051320 1137 1069 614 544 ------
NM_000899chr1273103 1703 1678 935 667 419 270 ------
NM_000964chr173275 263 256 --21261 460 --
NM_001001342chr1041225 1192 1058 1038 ----1933
NM_001001389chr1122544 2200 2819 249 1380 1746
NM_001001390chr1122544 2200 2819 249 1380 1746
NM_001001391chr1122544 2200 2819 249 1380 1746
NM_001001392chr1122590 2246 2865 295 1426 1792
NM_001001433chr2032646 2027 544 1852 --12456
NM_001001549chr711013 1530 1540 1520
NM_001001550chr711013 1530 1540 1520
NM_001001555chr711013 1530 1540 1520
NM_001001669chr552193 1819 1687 917 609 1987 --1591
NM_001001890chr2153897 3719 3166 1417 1095 12718 ----
NM_001002909chr1751709 860 219 203 54 1594 ----
NM_001003652chr1878409 6434 5836 3020 2532 867 126 36919 6327 760 --174
NM_001003674chr1835132 1942 1854 12345 --1697
NM_001003675chr1835132 1942 1854 12345 --1697
NM_001003794chr372922 2573 2356 1901 670 322 232 32099 473 342 22438 712 --
NM_001004304chr1283059 2547 2285 1225 1110 967 244 76 --12092 12413
NM_001005386chr232163 1970 1554 12331 ----
NM_001007024chr1733924 3751 254 --31720 475 458 --
NM_001007025chr1733924 3751 254 --31720 475 458 --
NM_001008220chr563641 3561 3252 2531 1063 728 1338 23606 636 1927
NM_001008239chr185928 698 619 461 34 ------
NM_001008397chr52600 56 2230 41 ----
NM_001008408chr765307 3925 3913 1087 991 98 1775 --11780
NM_001008701chr1982664 2545 2140 1901 1085 831 502 145 32854 2053 766 22974 632 --
NM_001008925chr432927 654 345 22189 1047 ----
NM_001009993chr284274 4140 4109 3833 3766 3685 3146 938 1169 23658 1566 --
NM_001010867chr1166618 6477 6246 6053 5920 5879 4957 2618 2320 2195 2076 1906 1652 1434 268 136 15483 1388 15741
NM_001011666chr765188 4510 2465 2016 1698 1555 14741 ----
NM_001012420chr1531863 1036 176 ----1845
NM_001012423chr1531863 1036 176 ----1845
NM_001012642chr1552009 1976 1758 1541 319 4739 494 63 23 12022 --
NM_001012751chr1011257 1569 --1578
NM_001012755chrX63098 1725 1397 1374 517 369 23378 138 11439 --
NM_001013620chr1265966 3150 3040 2861 1693 857 ----1114
NM_001013690chr1262189 1905 537 333 44 36 32158 703 515 1552 --
NM_001013693chr152688 2630 2384 2184 306 --21902 87 22195 1953
NM_001013693chr152688 2630 2384 2184 306 --21902 87 22195 1953
NM_001014797chr1047180 2351 1540 1459 26512 6249 12256 --
NM_001017368chr174551 441 406 299 --1675 1112
NM_001017395chr342762 2553 2317 25 ----13355
NM_001017995chr594055 1377 1270 1244 690 589 551 369 36 24306 760 1734 --
NM_001018050chr22103375 3251 3175 2762 2713 1383 1038 1023 1003 774 --1766 --
NM_001018052chr22103375 3251 3175 2762 2713 1383 1038 1023 1003 774 --1766 --
NM_001024809chr173275 263 256 --21261 460 --
NM_001025076chr1035235 5214 88 34762 3925 3837 15553 --
NM_001025077chr1046593 6572 1446 1171 46120 5283 5195 153 16911 --
NM_001025079chr363355 1584 999 736 657 311 ----1601
NM_001025107chr132679 1918 496 22082 581 --1154
NM_001025107chr132679 1918 496 22082 581 --1154
NM_001025108chr253137 3127 2939 2916 1012 ----138
NM_001029858chr622571 732 23184 2601 1940 --
NM_001029859chr1171804 1531 873 642 562 444 173 21654 436 11662 11684
NM_001029871chr204336 112 35 28 31397 1363 580 ----
NM_001029883chr252509 2381 1986 746 739 22137 653 --12581
NM_001030006chr1782641 2132 1979 1870 1796 1041 1032 855 12522 ----
NM_001030007chr1653499 3485 1304 182 81 1808 1544 --
NM_001031680chr1132254 2036 944 938 886 839 675 617 513 343 132 121 115 41912 1894 1778 309 2821 542 12068
NM_001031695chr2295139 5092 4846 4174 4068 1769 1294 1138 1123 --24378 2042 --
NM_001031732chr433343 2995 2912 33496 3283 3068 ----
NM_001033117chr364606 4500 4435 4085 3899 3478 34763 1603 674 14299 --
NM_001033507chr131773 1612 1466 11740 --11569
NM_001033551chr1783133 2544 1408 1374 1210 821 574 493 22993 1197 43560 1104 667 38 2989 561
NM_001035534chr941360 1092 1046 43 --31243 1229 386 21423 911
NM_001038493chr24568 561 207 196 1624 1222 1607
NM_001039547chr375835 5641 2828 2718 2392 1263 553 12165 1290 --
NM_001039577chr153957 3155 1445 1284 237 2929 715 13723 --
NM_001039590chrX43694 3572 1203 23 12647 ----
NM_001039591chrX43694 3572 1203 23 12647 ----
NM_001039690chr1671940 1922 953 524 503 461 104 --4588 489 447 84 --
NM_001040144chr1671940 1922 953 524 503 461 104 --4588 489 447 84 --
NM_001040146chr1671940 1922 953 524 503 461 104 --4588 489 447 84 --
NM_001040202chr411869 --11021 1884
NM_001040402chr41362 22809 240 1399 --
NM_001042355chr1644581 3711 3437 167 1648 14749 --
NM_001042412chr1644581 3711 3437 167 1648 14749 --
NM_001042413chr964059 2966 2592 1593 1583 494 ------
NM_001042486chr2041551 572 519 407 11431 1169 11124
NM_001042599chr276732 6715 5936 5542 2980 2336 1487 11688 ----
NM_001042601chr312614 --12922 1698
NM_001042603chr1273885 2059 1541 1474 1452 235 128 --14369 --
NM_001043318chr1463710 3391 1338 1301 1004 694 --21506 727 13356
NM_001044385chr263930 3804 3332 1462 896 786 ------
NM_001083621chr173816 3731 2874 1569 1407 1136 530 --33503 3369 557 22983 775
NM_001095chr1241827 783 518 160 1505 --11476
NM_001106chr398133 8071 7144 6924 6608 2855 2197 1166 1139 28060 7280 17398 29678 3661
NM_001111chr132679 1918 496 22082 581 --1154
NM_001113490chrX13229 --33572 1321 653 1941
NM_001128chr1653499 3485 1304 182 81 1808 1544 --
NM_001175chr122347 71 1406 196 1162
NM_001204chr257034 5214 2772 2669 286 21240 1145 ----
NM_001256chr17162 --1798 12594
NM_001282chr1782641 2132 1979 1870 1796 1041 1032 855 12522 ----
NM_001396chr2131099 493 417 22647 1791 1744 --
NM_001406chr1741378 304 232 140 21639 147 ----
NM_001412chrX13046 1342 --11017
NM_001417chr1221793 1347 1501 --1302
NM_001419chr1973699 3576 3134 3050 547 500 277 33707 1686 350 23301 1939 --
NM_001432chr472436 1408 1294 625 585 571 518 11537 ----
NM_001478chr126817 374 341 241 106 51 1924 --1663
NM_001543chr5154376 4023 3869 3470 3127 1869 1862 1785 1679 605 558 396 390 326 302 53083 1465 1169 782 241 1489 1801
NM_001650chr1811536 148 --12740
NM_001654chrX1394 --1383 2354 140
NM_001668chr152122 625 499 267 147 21535 411 ----
NM_001695chr843089 3066 767 277 ----12614
NM_001754chr2153897 3719 3166 1417 1095 12718 ----
NM_001759chr12104363 3700 3547 3449 1643 1337 988 604 163 48 ------
NM_001777chr363355 1584 999 736 657 311 ----1601
NM_001927chr24653 496 488 105 247 35 --1154
NM_001987chr1273307 2952 2877 1590 1513 648 499 --1639 11223
NM_002025chrX38299 7516 6074 38768 1432 281 13054 --
NM_002092chr464800 4630 3313 2008 878 728 ------
NM_002126chr1753706 3390 2931 2575 986 --23801 312 --
NM_002196chr204737 380 220 138 ----1994
NM_002196chr204737 380 220 138 ----1994
NM_002241chr152860 2340 649 185 34 23071 419 ----
NM_002247chr1051959 1744 799 662 101 ------
NM_002285chr253137 3127 2939 2916 1012 ----138
NM_002309chr2282921 2761 2752 2668 2112 1011 482 285 12744 --21140 975
NM_002359chr17173980 3849 3736 3711 3311 3300 3004 2946 2786 1666 1601 1078 673 383 374 358 71 --22681 1491 --
NM_002375chr3112139 2056 2049 1613 633 212 165 62 53 42 31 31751 849 724 11701 --
NM_002430chr2242155 1761 705 653 ----11594
NM_002501chr1994052 3884 3609 3494 3093 1558 253 78 30 1399 33918 3049 2971 --
NM_002522chr1742731 1339 1096 187 32703 1551 152 ----
NM_002523chr74768 432 389 175 --1217 1107
NM_002577chr333511 2881 334 11613 --12704
NM_002594chr2042270 901 392 55 1205 ----
NM_002599chr1141184 911 97 90 ----1394
NM_002657chr2083238 2902 2859 2490 1288 1158 406 72 33596 2531 1047 13040 --
NM_002698chr1982598 2320 2034 1932 1194 1008 177 132 1996 2345 333 1396
NM_002716chr1163558 3531 3520 3273 3220 252 13685 12557 --
NM_002745chr2274010 3916 3481 3206 570 317 80 21146 87 --12848
NM_002787chr71586 1600 --1540
NM_002833chr1551327 1307 1159 355 120 11381 31287 348 286 --
NM_002886chr384924 4185 4173 3361 3310 579 189 153 ------
NM_002996chr1651491 1301 746 428 357 11255 41851 1458 1386 268 --
NM_003045chr1374863 4852 3839 3591 1219 800 251 21967 483 13201 --
NM_003074chr331738 1689 299 --11966 1186
NM_003076chr1231602 1535 146 2576 222 11654 --
NM_003099chr1575858 4256 2388 2291 1290 586 57 65751 4556 921 733 143 127 ----
NM_003108chr272272 2018 1975 1636 853 269 50 25403 5388 35101 2567 2452 --
NM_003150chr1741879 1824 309 112 ----12166
NM_003221chr663882 3281 3221 594 492 465 --13110 --
NM_003234chr352047 1884 688 558 346 --11694 --
NM_003255chr1742090 1013 788 291 --2834 430 1199
NM_003262chr354107 3692 1460 240 149 1642 ----
NM_003342chr1723329 2019 12467 --23088 44
NM_003470chr1641532 1361 363 313 1326 21705 300 --
NM_003489chr2112847 12415 --1584
NM_003528chr141736 1352 581 439 ----1206
NM_003559chr17113601 3493 3461 2885 2854 2787 2513 1127 840 483 441 13071 22636 278 --
NM_003569chr61151 ----1113
NM_003590chr223594 1149 23147 1567 1951 --
NM_003633chr552437 2196 1927 1888 1882 ------
NM_003637chr151439 428 288 255 28 ----11336
NM_003644chr17106323 6068 5564 4718 4490 2024 1086 711 292 28 1376 ----
NM_003763chr2032646 2027 544 1852 --12456
NM_003939chr1072947 2922 1006 734 554 478 322 12658 ----
NM_003987chr1082205 1989 1889 1741 1530 888 768 58 --12222 --
NM_003994chr1273103 1703 1678 935 667 419 270 ------
NM_004028chr1811536 148 --12740
NM_004037chr14350 141 123 81 4757 627 93 56 ----
NM_004050chr1442539 1722 1013 591 ----12372
NM_004055chr1151984 1888 474 230 96 42157 655 54 34 2746 662 12060
NM_004093chr1362706 2643 2568 1308 592 266 ------
NM_004112chr1741239 238 120 67 21713 310 21222 27 11752
NM_004171chr1198856 8653 8502 3854 3701 2775 2156 1767 921 37744 2332 1005 --16184
NM_004185chr12545 163 ----1722
NM_004200chr1182288 2102 1158 935 830 779 528 136 --21222 339 144
NM_004338chr1835132 1942 1854 12345 --1697
NM_004350chr1132254 2036 944 938 886 839 675 617 513 343 132 121 115 41912 1894 1778 309 2821 542 12068
NM_004380chr1662208 1854 1693 912 517 193 --21656 1635 --
NM_004420chr1182197 2087 2001 1896 1641 1616 1610 293 11626 22319 182 --
NM_004430chr81390 --1219 2637 157
NM_004481chr172467 2288 2224 763 638 497 32 22481 874 ----
NM_004485chr193773 3206 2724 1708 1201 933 918 769 47 --11029 11511
NM_004491chr1953794 2967 2905 881 271 11678 137 --
NM_004501chr143544 3457 3097 117 11361 --1441
NM_004514chr17102879 2574 2318 2022 1157 1022 991 888 853 269 22586 219 1333 --
NM_004586chrX54682 4276 4016 3896 345 11365 14053 --
NM_004588chr1153464 1620 1597 259 38 13140 --1293
NM_004598chr542985 2579 1319 94 33189 2316 153 --1396
NM_004612chr944645 1696 1314 188 ----14702
NM_004661chr521267 297 ----21227 1202
NM_004726chrX1235 14470 --11058
NM_004730chr52607 537 11525 --1766
NM_004741chr1061433 1155 264 158 125 82 1287 ----
NM_004815chr134523 4354 1283 24888 1491 ----
NM_004822chr17113827 3649 3527 3473 3211 3185 2564 2525 1222 687 550 1664 --11416
NM_004845chrX93319 3178 1380 1100 833 399 366 320 278 --13370 --
NM_004871chr1733924 3751 254 --31720 475 458 --
NM_004887chr52969 444 ----1768
NM_004904chr765188 4510 2465 2016 1698 1555 14741 ----
NM_004956chr763280 3253 3013 875 814 291 ------
NM_004976chr11134825 4579 4453 4333 3644 3285 3205 2045 1888 1479 563 396 209 54715 3701 3670 3472 512 34153 1552 464 --
NM_004979chrX--21138 1126 21118 30 1471
NM_004985chr1242749 1160 850 550 23492 1060 ----
NM_004992chrX146163 5920 5796 5433 5378 5208 3417 2839 2607 2227 1377 1062 760 674 21353 1002 27087 6130 21790 1154
NM_004992chrX146163 5920 5796 5433 5378 5208 3417 2839 2607 2227 1377 1062 760 674 21353 1002 27087 6130 21790 1154
NM_005056chr1264129 1785 1718 1696 479 372 --14613 --
NM_005116chr2084065 3914 3228 1684 1621 989 316 266 22865 1629 12919 --
NM_005156chr943589 3484 3348 1523 33653 1425 686 ----
NM_005157chr931954 669 224 11727 31743 1711 1398 --
NM_005161chr1172085 1977 1444 737 460 139 116 12033 ----
NM_005173chr1771282 440 242 220 174 113 25 21203 182 ----
NM_005188chr11137927 7466 7427 7361 6277 5711 5624 3312 3093 2736 1964 1397 141 27795 235 15658 --
NM_005225chr2051210 1013 417 81 71 1129 1925 --
NM_005235chr276732 6715 5936 5542 2980 2336 1487 11688 ----
NM_005311chr711013 1530 1540 1520
NM_005399chr144241 4099 4009 1207 --1702 --
NM_005461chr2031517 272 89 21664 61 11266 --
NM_005497chr1774910 4800 4525 1834 1811 1163 851 34683 800 189 11638 --
NM_005512chr1131477 799 719 ----21952 108
NM_005596chr934941 2499 2006 36052 4477 2530 12188 --
NM_005722chr232163 1970 1554 12331 ----
NM_005730chr1263243 2784 2279 1291 653 342 1919 23251 2889 13216
NM_005779chr523600 768 1454 --1870
NM_005828chr1784550 3871 3641 1964 1600 1540 558 258 --14223 1818
NM_005840chrX77355 5543 5093 4898 2841 2037 673 26670 45 15199 --
NM_005895chr1253744 1666 1354 1082 763 34055 3572 2542 11030 13725
NM_005901chr1878409 6434 5836 3020 2532 867 126 36919 6327 760 --174
NM_005920chr173826 3714 2911 2414 1550 1122 530 12615 13013 --
NM_005933chr1152598 2461 1051 844 195 11970 --1273
NM_005937chr17103175 2728 2714 2651 1408 1330 1271 1066 407 63 22916 2865 33128 942 294 13150
NM_005955chr185085 4264 3970 3924 2096 2057 1013 1006 15113 ----
NM_005994chr17----1321 1633
NM_006034chr1141957 1612 732 273 1756 194 11582
NM_006036chr231575 844 466 ----12175
NM_006037chr264193 3766 3102 3077 284 173 11467 21276 886 --
NM_006040chr1641241 968 885 544 --1507 1979
NM_006095chr424500 2847 21129 1025 13842 --
NM_006158chr811653 ----11502
NM_006202chr1961819 564 227 102 94 25 11987 21686 341 --
NM_006206chr422588 21 32822 2449 123 1914 --
NM_006224chr1782428 2395 2066 1910 1630 938 856 307 --21582 932 --
NM_006245chr641050 920 869 264 11021 1170 1764
NM_006306chrX44973 4452 841 46 ----24709 3650
NM_006315chr484375 3630 3051 2824 1425 811 222 205 11365 13562 --
NM_006379chr721887 547 ----1200
NM_006386chr2242204 1942 1777 1685 ----12333
NM_006454chr462963 2752 2112 2007 550 205 --32794 2599 926 12281
NM_006465chr1552267 2176 830 535 161 1578 2551 280 --
NM_006516chr161575 1430 1027 639 316 280 ----11587
NM_006532chr1961667 819 602 547 464 202 ----11484
NM_006540chr831372 1078 376 1632 --1145
NM_006546chr17166216 6196 5994 5451 5158 4746 4152 4117 2626 2503 1681 1548 1054 977 867 784 11236 12140 26247 5106
NM_006561chr1035235 5214 88 34762 3925 3837 15553 --
NM_006599chr1646704 5905 5106 61 ----11232
NM_006646chr1372634 2576 2537 1995 1139 366 57 --1646 --
NM_006650chr563641 3561 3252 2531 1063 728 1338 23606 636 1927
NM_006690chr2081955 1640 1526 1469 928 591 485 463 31910 1451 955 22001 432 --
NM_006717chr953297 3125 2439 1199 103 --12164 --
NM_006729chrX55053 3971 3549 2215 936 ----13655
NM_006764chr31182 ----180
NM_006852chr1772778 2248 1994 931 872 297 231 --2705 340 --
NM_006856chr123871 735 361 ----126
NM_006902chr132473 1338 605 33154 707 568 --13064
NM_006922chr21659 ----1396
NM_006996chr1------1630
NM_007011chr1595971 4645 2558 1832 1240 1162 821 564 53 15661 34228 642 75 1839
NM_007050chr2078047 6657 6485 6160 2490 1473 540 27758 5113 37687 1092 174 --
NM_007106chr1352627 2519 2355 1853 752 ------
NM_007153chr1911702 23504 33 --1117
NM_007174chr123948 890 821 21857 157 11553 12304
NM_007187chr131171 ----1842
NM_007238chr20103625 3452 1639 1355 1293 688 673 312 219 119 34413 1453 1078 13671 11170
NM_007249chr13128833 8796 8146 7296 6860 6306 2733 2056 1121 733 523 266 11621 --11733
NM_007283chr372922 2573 2356 1901 670 322 232 32099 473 342 22438 712 --
NM_007286chr53527 471 459 11984 41836 1392 731 662 11423
NM_007313chr931954 669 224 11727 31743 1711 1398 --
NM_007365chr151657 812 585 210 175 31976 1955 1633 --11400
NM_012095chr1021327 340 12902 --13350
NM_012098chr92551 187 1226 --1635
NM_012104chr1163387 3033 2815 1389 394 172 ----13359
NM_012104chr1163387 3033 2815 1389 394 172 ----13359
NM_012156chr2072965 2507 2241 1327 1051 776 405 23363 1246 11370 --
NM_012164chr9116783 6690 6081 2398 1664 1544 1523 1327 860 798 686 --14569 --
NM_012193chr1164761 4369 4342 4140 3617 293 24779 2157 --15203
NM_012199chr174302 3129 2898 2890 1761 1540 214 ------
NM_012214chr256338 2561 2165 1700 1206 54300 2364 2343 1573 190 12159 --
NM_012249chr223097 2457 23272 130 --11180
NM_012288chr685439 4986 4965 4188 3964 3558 1347 687 34798 4235 249 21069 439 2963 490
NM_012306chr12123538 3518 3430 2933 2601 1238 1226 1006 965 433 59 26 21149 1065 32920 2495 52 12253
NM_012308chr113802 685 126 2888 418 11672 21844 366
NM_012316chr144182 1308 1207 971 25039 88 33803 696 409 --
NM_012334chr553078 3000 1691 1323 143 34352 4188 1852 13967 --
NM_012346chr1921116 319 21128 1091 21139 997 132
NM_013313chr22103545 3519 3377 3362 2371 2300 2263 855 179 166 12617 ----
NM_013449chr1262902 2169 2097 624 528 222 2703 316 1689 --
NM_014155chr1132282 1442 153 36913 6073 4774 21030 113 16039
NM_014157chr1652449 1456 694 683 88 23108 107 22996 980 --
NM_014190chr471835 698 622 556 408 282 75 --1477 1271
NM_014216chr1431428 1350 657 11673 11032 2504 356
NM_014231chr1281842 1793 1760 500 266 165 97 51 ----11693
NM_014232chr1771619 1455 1376 555 340 311 133 --1250 --
NM_014232chr1771619 1455 1376 555 340 311 133 --1250 --
NM_014309chr2295129 5082 4836 4164 4058 1759 1284 1128 1113 --24368 2032 --
NM_014331chr457535 7464 5796 2387 2071 15905 --17226
NM_014388chr185844 4149 3925 2130 1165 1107 991 164 24682 4501 ----
NM_014423chr533869 1847 1653 34783 4349 328 ----
NM_014571chr152738 2608 2193 230 216 53000 2710 2289 1225 763 3865 689 514 --
NM_014613chr531933 704 21 2716 38 22265 2132 --
NM_014646chr1852218 2123 840 707 127 21095 690 32115 428 36 --
NM_014665chr893514 3347 3314 2703 2284 877 465 296 290 22325 439 12755 --
NM_014723chr2053202 2736 1107 288 61 12753 12295 11071
NM_014730chr12123836 3739 3714 3705 2027 1961 1834 626 590 209 203 185 15205 24445 1482 1688
NM_014730chr12123836 3739 3714 3705 2027 1961 1834 626 590 209 203 185 15205 24445 1482 1688
NM_014731chr2071555 1421 1144 700 635 141 64 156 --11546
NM_014747chr1155140 5004 4997 4706 3699 2103 1464 1458 1023 900 759 751 440 387 62 35259 340 266 45692 4693 3646 1121 --
NM_014752chr1161808 1752 1519 1476 207 114 11854 ----
NM_014762chr142217 284 261 220 12555 1807 1527
NM_014766chr743514 3128 3028 172 --23398 191 --
NM_014767chr1092831 2645 2332 2325 1217 961 947 668 405 23313 533 32533 1081 582 --
NM_014772chr1863355 2802 1320 1001 604 448 --1905 1531
NM_014774chr152890 2822 2590 92 84 1580 23024 2796 --
NM_014810chr142944 1483 1414 272 11047 ----
NM_014830chr1263201 3175 2523 1391 506 497 13335 2926 74 --
NM_014850chr364606 4500 4435 4085 3899 3478 34763 1603 674 14299 --
NM_014869chr371225 1184 1159 1091 914 470 368 1105 11292 --
NM_014870chr173816 3731 2874 1569 1407 1136 530 --33503 3369 557 22983 775
NM_014877chr1787659 7240 7022 6835 5832 4960 1760 95 ----26121 5545
NM_014897chr1742677 2310 2291 922 141 --1808
NM_014901chr561468 712 699 393 248 158 --3565 283 260 --
NM_014902chr2041551 572 519 407 11431 1169 11124
NM_014903chr1231932 520 361 ----1129
NM_014909chr1493961 3592 3517 3194 3160 3071 2549 2412 915 21105 710 13729 --
NM_014921chr1982664 2545 2140 1901 1085 831 502 145 32854 2053 766 22974 632 --
NM_014939chr1821264 1052 ----1523
NM_015008chr342762 2553 2317 25 ----13355
NM_015009chr3------1601
NM_015020chr1642865 2796 193 170 23444 2748 ----
NM_015033chr9113234 2960 2688 2097 1298 1171 1051 818 798 537 130 42135 529 240 62 1394 --
NM_015035chr2096362 6188 5762 5742 4517 4243 4064 1887 1213 45838 4468 1251 97 26569 5934 --
NM_015039chr164044 3129 1679 1574 281 204 --23343 1008 11449
NM_015044chr1642989 2809 2580 325 2600 527 12910 --
NM_015074chr174588 4491 3739 1986 1668 1450 156 --13796 1375
NM_015076chr623181 1797 1715 --23914 3134
NM_015090chr175709 5198 4277 2132 1357 434 271 55921 5694 4676 1488 1367 --11375
NM_015094chr2284551 3309 3193 3076 968 740 289 203 12983 43933 3145 823 306 13250
NM_015107chrX42388 1537 520 171 22173 1650 --11800
NM_015115chr41362 22809 240 1399 --
NM_015163chr14--11273 1132 1267
NM_015200chr441862 298 176 84 --1592 --
NM_015205chr13174593 3971 3720 1895 1468 1405 1281 1273 1257 1249 1220 1162 1141 979 209 178 37 115056 4346 3564 1872 1319 1311 1295 1242 1213 1184 1134 1763 1134
NM_015247chr1644581 3711 3437 167 1648 14749 --
NM_015282chr242202 2170 973 651 22117 2076 22540 138 22863 691
NM_015284chr172098 1932 1584 832 509 462 389 11657 11533 11943
NM_015288chr572799 2685 2667 1171 1075 441 239 43783 2644 2589 2524 139 1697
NM_015299chr1473685 3591 1318 900 745 536 75 1754 23242 3094 --
NM_015310chr897835 6256 6222 5457 3206 3187 1604 1329 1194 23308 2960 ----
NM_015315chr523263 1181 21318 560 13140 1381
NM_015326chr1102676 2334 1949 1153 1007 934 862 605 331 140 11100 ----
NM_015332chr753415 3394 2867 2505 783 22220 289 11381 22783 1172
NM_015335chr122996 507 1519 --1273
NM_015375chr153531 3365 1761 1587 495 23599 3203 --11836
NM_015443chr1741051 1015 993 262 --1477 11007
NM_015455chr524031 1131 ----11357
NM_015465chr5----1203 195
NM_015488chr251682 1428 1134 663 253 --1290 11235
NM_015493chr1951518 70 59 53 46 --11450 --
NM_015520chr331831 1007 429 12150 2553 460 1278
NM_015526chr1951474 1026 482 464 400 41451 1004 240 36 ----
NM_015527chr165694 585 249 227 101 1718 2260 126 --
NM_015553chr664650 4569 3838 3617 3604 1690 ------
NM_015557chr183121 2788 2756 2659 1076 741 518 428 --12457 13345
NM_015564chr51687 ----1303
NM_015569chr133902 1442 1061 21347 1139 ----
NM_015575chr243356 2946 2490 309 22653 55 --1983
NM_015576chr332223 2064 868 11960 --1943
NM_015840chr132679 1918 496 22082 581 --1154
NM_015841chr132679 1918 496 22082 581 --1154
NM_015850chr831820 93 87 21909 420 21689 875 --
NM_015898chr1982117 1742 1649 1594 1572 880 651 528 --32249 716 576 --
NM_015981chr582967 2557 2199 2103 2084 1052 436 406 12228 ----
NM_015995chr15135181 5127 4747 4639 4428 4269 3879 3806 3525 3467 1382 606 47 25419 1205 22219 2066 --
NM_016169chr1043180 2761 1009 849 --23060 2607 21206 972
NM_016206chr368557 7608 7179 6293 2113 172 18152 17602 --
NM_016257chr173048 2887 2542 621 433 364 125 12472 32880 197 24 13362
NM_016260chr256785 5636 5579 1986 663 ----16127
NM_016376chr1762962 2903 1724 1542 1107 1041 34270 2951 742 12974 --
NM_016553chr1921116 319 21128 1091 21139 997 132
NM_016577chr344299 2962 2806 2769 24095 3357 12733 11247
NM_016605chr522603 1783 31689 1036 71 --1990
NM_016621chr11164102 4041 3865 3727 3627 3550 3408 3317 3262 3035 1583 1499 1161 765 713 120 ----14369
NM_016946chr172514 2307 2211 1302 1222 564 493 ----11290
NM_017413chrX42042 1833 309 50 12187 2939 294 11556
NM_017575chr1731472 513 424 2568 507 21514 1021 --
NM_017590chr2282537 2436 2175 876 851 754 406 386 --2974 829 2666 361
NM_017596chr1144546 4314 4117 3388 3043 1761 1422 1140 868 839 742 508 169 24 23510 1042 23435 1150 --
NM_017637chr939025 7911 6192 28923 8140 12596 --
NM_017772chr641496 1322 460 304 21704 321 11635 --
NM_017813chr845378 4727 4221 2157 --14653 --
NM_017873chr992444 2301 2160 1080 1028 907 789 719 232 22963 1935 ----
NM_017902chr10135193 5110 4686 4637 4489 3619 2087 2059 1603 1542 1115 659 368 13848 24191 1510 --
NM_018032chr163929 776 214 156 --1616
NM_018071chr144740 716 567 176 --1656 1852
NM_018085chr1117995 7482 7278 6655 2942 2803 2449 2428 2299 1492 213 48151 7439 5057 1980 26731 2376 --
NM_018182chr1742064 764 684 173 22140 1599 1165 --
NM_018205chr1041956 1446 1435 743 --1547 12211
NM_018239chr1041956 1446 1435 743 --1547 12211
NM_018243chr483630 3608 3543 3056 1498 1110 609 25 31580 1537 863 ----
NM_018327chr20--1161 1656 1112
NM_018351chr1234172 3359 3102 44007 3852 3643 1747 ----
NM_018362chr1153780 3496 2706 2449 164 ------
NM_018375chr14--1775 --1437
NM_018416chr1272598 2508 989 574 555 277 81 31925 445 285 ----
NM_018440chr896893 6682 5992 5962 5553 2024 646 576 289 16721 28153 972 --
NM_018566chr134831 4029 1492 33254 920 504 ----
NM_018689chr1552589 2486 2254 1897 1775 --184 --
NM_018953chr125820 755 727 50 43 --1181 --
NM_018999chr1064788 4332 1870 1618 821 306 ------
NM_019041chr642493 1928 1833 277 --2781 199 --
NM_019096chr63903 830 353 2317 36 --11008
NM_019106chr2253408 2681 2458 285 244 23208 1066 --12115
NM_019114chr962182 2116 2099 986 892 179 ----1120
NM_019594chr951349 1331 1259 322 207 149 31441 1343 272 11425
NM_019859chr1051351 1168 1100 645 575 ------
NM_019885chr262272 2166 890 639 603 418 --22343 2232 1543
NM_020039chr1241827 783 518 160 1505 --11476
NM_020182chr2083518 3415 3357 2977 2602 2499 2210 798 53190 3177 2638 2469 2305 11034 --
NM_020184chr262073 1745 1482 1453 841 439 1413 11650 --
NM_020228chr1111975 --11636 1653
NM_020310chr1782516 2411 2193 2045 2039 1714 795 53 52226 1122 857 850 843 ----
NM_020443chr176974 6845 5325 4440 2788 2314 1110 26308 5050 16216 12760
NM_020465chr163656 186 69 2745 162 21634 737 11959
NM_020475chr841954 1663 766 118 1473 1857 12283
NM_020476chr841954 1663 766 118 1473 1857 12283
NM_020477chr841954 1663 766 118 1473 1857 12283
NM_020478chr842017 1726 829 181 1536 1920 12346
NM_020480chr841954 1663 766 118 1473 1857 12283
NM_020530chr225902 775 352 221 100 --1825 189
NM_020638chr1251519 716 384 288 151 1766 2136 70 --
NM_020673chr2066181 5666 5251 5123 3109 44 11958 172 12895
NM_020699chr1104962 4906 4628 3974 3839 1802 827 524 380 294 --14385 --
NM_020718chr1676635 5487 5361 4982 2168 1017 765 25383 4990 21342 276 --
NM_020742chrX22645 2331 1101 --11058
NM_020772chr1748361 8199 2297 1991 13437 --12866
NM_020774chr1834612 2332 1314 ----11969
NM_020778chr1554758 4295 3317 1414 323 31835 452 248 33845 1339 1019 11163
NM_020792chr342240 1951 734 312 ----1213
NM_020795chr1761739 1411 1274 1258 587 409 31715 1613 1293 ----
NM_020804chr6172580 2274 2125 1996 1923 1724 1627 1071 1004 948 857 843 544 311 286 272 68 22450 2227 32259 1847 610 12235
NM_020845chr1252473 2464 1935 929 171 12447 1382 129
NM_020897chr161286 1236 987 540 331 155 2272 165 ----
NM_020956chr1984410 3730 1372 960 952 739 606 193 34456 372 164 44254 1084 649 365 --
NM_020967chr2021147 30 --21106 293 11191
NM_021012chr1773038 2800 2461 2052 1194 836 608 1999 1561 13025
NM_021033chr1333203 910 211 1205 ----
NM_021079chr1793012 2877 2869 2559 2498 2344 2071 993 843 --1211 --
NM_021090chr2281515 1197 1112 1052 951 702 557 175 44187 3906 3175 969 1901 1883
NM_021116chr7108722 7821 7231 7175 6988 5957 3379 2358 2157 1069 16758 12409 33290 2082 1908
NM_021120chrX62757 1229 1217 1103 111 48 22846 79 ----
NM_021202chr2062605 2265 576 442 358 314 ----2276 210
NM_021242chrX1854 1700 --1970
NM_021638chr463155 1750 724 539 354 150 14337 21648 1271 24025 218
NM_021813chr641854 1654 1456 551 24093 3589 --14232
NM_021911chr545274 1074 591 191 25020 1090 11165 --
NM_021949chrX62343 1830 1147 625 291 168 12590 ----
NM_021961chr1166990 6929 4646 2907 2706 2035 11915 25158 1994 11817
NM_022048chr1565962 5080 1687 649 579 217 45171 4257 1029 23 14841 --
NM_022058chr231291 846 186 11472 ----
NM_022060chr1441111 503 494 403 21174 130 --11140
NM_022114chr1114346 4129 3616 3496 3227 1627 1606 1094 1024 986 89 64541 3457 3185 1908 668 175 23595 1058 1884
NM_022131chr35585 394 376 260 35 21455 361 11032 11516
NM_022166chr1675812 4303 2483 1387 267 215 115 --2462 432 --
NM_022459chr1355900 5711 5568 4974 3858 ------
NM_022462chr1962547 2458 1520 1455 1098 198 --33545 689 227 12725
NM_022465chr1232215 1873 809 31051 444 68 1774 --
NM_022572chr251682 1428 1134 663 253 --1290 11235
NM_022574chr752120 2095 1654 807 67 ----21638 120
NM_022648chr264128 3345 3102 1574 546 389 34596 4147 324 33782 1826 1194 --
NM_022716chr132317 1182 449 32998 551 412 --12908
NM_022719chr2273314 3020 2946 2559 2393 1357 1087 33092 2867 2470 1537 --
NM_022745chr142848 2832 2220 1881 32077 2070 811 ----
NM_022833chr941360 1092 1046 43 --31243 1229 386 21423 911
NM_022842chr393160 2943 2907 2365 2256 1052 987 585 454 ----2405 387
NM_022910chr163656 186 69 2745 162 21634 737 11959
NM_023105chr831820 93 87 21909 420 21689 875 --
NM_023106chr831820 93 87 21909 420 21689 875 --
NM_023110chr831820 93 87 21909 420 21689 875 --
NM_023111chr831820 93 87 21909 420 21689 875 --
NM_023929chr832724 1049 291 1223 ----
NM_024494chr12545 163 ----1722
NM_024511chr452996 2304 693 531 36 2785 354 --13529
NM_024525chr12490 459 --192 1253
NM_024646chr163133 3087 718 683 337 203 11052 ----
NM_024665chr334665 3016 62 24608 3059 ----
NM_024701chr1021573 124 ----21799 712
NM_024770chr245110 1639 1197 805 31209 922 379 ----
NM_024811chr1181911 1905 1626 1557 1508 1345 443 179 11516 --1283
NM_024834chr1031882 1756 1639 ----1610
NM_024881chr1973674 3150 2436 2391 1045 271 139 11352 11515 1972
NM_024915chr862721 2481 1895 1825 866 338 1874 --1552
NM_024947chr369134 8964 8682 5832 3545 3106 12481 17904 --
NM_024963chr7155826 5751 5410 5176 4754 4542 4093 2188 2122 1455 1426 490 443 378 27 21391 150 42362 1941 1873 639 --
NM_025179chr173517 3219 1902 1064 559 455 110 14537 23314 1132 --
NM_025224chr2042028 1812 1530 260 1269 22148 722 169
NM_025248chr1772759 2637 2305 2181 1992 1263 32 --22887 1167 12997
NM_030576chr1772661 2349 1910 1784 878 396 351 12454 ----
NM_030621chr1443339 1105 931 543 2948 389 ----
NM_030623chr211190 ----11340
NM_030629chr1651731 1606 613 88 80 21277 491 11385 --
NM_030647chr73903 251 77 35026 1744 1495 ----
NM_030661chr7135 --11393 21503 1139
NM_030674chr12135244 5195 4289 3978 3888 3866 1710 1566 1385 1290 1272 307 180 151 ----
NM_030761chr131031 603 69 ----21772 131
NM_030881chr2242204 1942 1777 1685 ----12333
NM_030884chr3112139 2056 2049 1613 633 212 165 62 53 42 31 31751 849 724 11701 --
NM_030940chr931122 214 30 ----11060
NM_030981chr1161096 1037 970 914 315 53 --31135 1019 389 1187
NM_031309chr861773 1518 691 300 187 134 --12210 11729
NM_031426chr962527 2514 2475 2277 702 310 32700 2186 356 21898 202 --
NM_031439chr81269 21439 1270 1350 21426 1344
NM_031469chr633181 3026 2767 21278 516 ----
NM_031844chr143544 3457 3097 117 11361 --1441
NM_031890chr2242754 2592 2247 2078 32871 2240 43 ----
NM_032017chr181763 1710 1287 832 733 714 708 479 11427 11833 --
NM_032109chr541187 1178 227 133 1373 2433 220 1278
NM_032153chr3----12278 12405
NM_032242chr382825 2525 2191 940 809 465 384 160 32578 2391 750 --12595
NM_032268chr1673243 2870 2714 2494 2198 669 466 12795 12071 11150
NM_032287chr2261548 1287 1250 823 625 133 22883 990 13265 11060
NM_032329chr294320 3289 2890 2819 1626 1234 680 619 45 24174 1190 23408 1097 --
NM_032440chr1042822 2254 1893 771 --12948 --
NM_032486chr1642567 2556 1734 305 32034 1946 284 ----
NM_032557chr4------1269
NM_032595chr1731539 1292 560 31578 1333 67 11179 --
NM_032711chr17173980 3849 3736 3711 3311 3300 3004 2946 2786 1666 1601 1078 673 383 374 358 71 --22681 1491 --
NM_033133chr1793732 3609 3147 1358 1352 1097 713 705 534 --12647 --
NM_033136chr541288 1282 462 257 --21220 122 1233
NM_033137chr541288 1282 462 257 --21220 122 1233
NM_033224chr747941 6809 5542 910 16313 17544 --
NM_033274chr563420 3110 2910 910 583 435 12665 13342 --
NM_033315chr1771867 1734 1380 728 614 450 106 --22071 1457 --
NM_033360chr1242870 1281 971 671 23613 1181 ----
NM_033389chr1744741 837 537 407 34368 3741 1018 14155 --
NM_033551chr523263 1181 21318 560 13140 1381
NM_033631chr183711 2943 2779 1192 623 409 248 231 22612 304 13364 --
NM_033637chr1072947 2922 1006 734 554 478 322 12658 ----
NM_052845chr1262325 2085 1284 196 84 78 13127 ----
NM_052847chr1923612 714 32365 176 121 43295 3000 2553 729 --
NM_052876chr1962118 1019 719 680 121 88 1467 42420 1688 698 656 11030
NM_052885chr1234520 3117 794 23098 1650 ----
NM_052906chr22114844 4655 4256 4236 3994 3761 3541 1524 833 584 497 34810 1096 1081 3985 687 438 --
NM_052971chr5------1155
NM_053016chr937695 7044 5819 ----17278
NM_053023chr1142239 2155 647 283 11264 12168 11051
NM_053043chr765307 3925 3913 1087 991 98 1775 --11780
NM_053279chr852483 1957 804 708 457 1700 2111 94 1276
NM_057178chr174551 441 406 299 --1675 1112
NM_078476chr6101531 1506 1475 653 610 564 531 465 219 169 ------
NM_080621chr2051120 1072 1021 436 319 --1378 11391
NM_130436chr2131099 493 417 22647 1791 1744 --
NM_130438chr2141070 994 531 469 33224 2368 105 11321 --
NM_130830chr343403 2840 489 304 12651 32900 1139 889 --
NM_133170chr2078047 6657 6485 6160 2490 1473 540 27758 5113 37687 1092 174 --
NM_133264chr1783942 3738 3574 2967 2925 2710 1344 141 --163 11373
NM_133265chrX13229 --33572 1321 653 1941
NM_133334chr4116237 5868 5634 5600 4927 4631 3966 2291 1706 1208 270 24709 433 11094 --
NM_133370chr433343 2995 2912 33496 3283 3068 ----
NM_133445chr912783 13764 11139 1191
NM_133635chr2141372 171 126 115 11195 --11093
NM_134268chr1741155 1094 921 309 --1155 1362
NM_138338chr22103375 3251 3175 2762 2713 1383 1038 1023 1003 774 --1766 --
NM_138479chr1--21826 402 21345 717 11926
NM_138713chr1646704 5905 5106 61 ----11232
NM_138714chr1646704 5905 5106 61 ----11232
NM_138967chr1582427 2362 1949 1874 978 599 286 258 11558 191 --
NM_138971chr1163387 3033 2815 1389 394 172 ----13359
NM_138971chr1163387 3033 2815 1389 394 172 ----13359
NM_138972chr1163387 3033 2815 1389 394 172 ----13359
NM_138972chr1163387 3033 2815 1389 394 172 ----13359
NM_138973chr1163387 3033 2815 1389 394 172 ----13359
NM_138973chr1163387 3033 2815 1389 394 172 ----13359
NM_139071chr1231602 1535 146 2576 222 11654 --
NM_139156chr14350 141 123 81 4757 627 93 56 ----
NM_139276chr1741879 1824 309 112 ----12166
NM_144588chr1031179 969 503 1596 --11034
NM_144599chr1523828 3576 21650 200 186 13716
NM_145055chr185928 698 619 461 34 ------
NM_145166chr3112719 2625 2460 2345 1092 1086 1067 1051 745 443 369 32816 1861 765 21984 1869 --
NM_145176chr631359 517 202 12728 13386 --
NM_145259chr234402 1961 621 --1572 11040
NM_145799chrX62353 1142 482 451 264 40 --21987 460 --
NM_148955chr1575858 4256 2388 2291 1290 586 57 65751 4556 921 733 143 127 ----
NM_152280chr142608 2396 2272 440 --23397 3249 --
NM_152388chr263930 3804 3332 1462 896 786 ------
NM_152407chr532352 328 173 ----1914
NM_152424chrX54003 3681 3010 2879 1563 23100 2867 ----
NM_152470chr1893196 2865 2594 1450 1377 1335 1249 396 344 33490 1232 209 146 --
NM_152624chr585980 4499 2908 1745 1719 1407 927 64 ----15548
NM_152629chr964059 2966 2592 1593 1583 494 ------
NM_152704chr132228 117 ----1994
NM_152744chr773490 3439 2788 2382 1361 1062 596 2934 824 11420 23481 669
NM_152753chr671950 1703 534 487 446 257 205 11997 ----
NM_152787chrX43334 3292 3099 1394 ------
NM_152826chr1575858 4256 2388 2291 1290 586 57 65751 4556 921 733 143 127 ----
NM_152924chr1595971 4645 2558 1832 1240 1162 821 564 53 15661 34228 642 75 1839
NM_153029chr1663936 3930 3397 3382 1307 1085 43811 3319 2716 925 13537 --
NM_153035chr122155 411 ----22205 580
NM_153050chr2281515 1197 1112 1052 951 702 557 175 44187 3906 3175 969 1901 1883
NM_153051chr2281515 1197 1112 1052 951 702 557 175 44187 3906 3175 969 1901 1883
NM_153207chr1253028 2987 2639 1607 1590 ------
NM_153234chr512442 --12227 176
NM_153262chr13539 423 246 12378 1716 --
NM_153367chr1063900 1483 1417 1162 542 248 1304 23717 1250 --
NM_153487chr694762 4066 4020 3162 1179 1135 1060 831 397 14745 13587 14460
NM_153631chr7135 --11393 21503 1139
NM_153632chr7135 --11393 21503 1139
NM_153718chr1921116 319 21128 1091 21139 997 132
NM_153719chr1921116 319 21128 1091 21139 997 132
NM_153756chr141959 1479 1414 154 ----31704 1437 607
NM_153836chr211870 11617 21840 727 12041
NM_170706chr164044 3129 1679 1574 281 204 --23343 1008 11449
NM_171825chr582967 2557 2199 2103 2084 1052 436 406 12228 ----
NM_172071chr136418 6210 2816 27203 724 15824 --
NM_173065chr153126 2644 2220 706 261 21249 976 31180 520 345 --
NM_173214chr1646704 5905 5106 61 ----11232
NM_173468chr423682 130 1361 --12347
NM_173511chr242844 1488 509 238 ----12877
NM_173595chr1284634 4473 4293 2018 1561 1444 500 358 --85236 4689 1836 1602 1369 1221 436 303 --
NM_173602chr1263296 3225 3211 2554 1076 375 --13124 --
NM_173681chr741760 1431 567 364 51883 1845 1668 154 89 12042 --
NM_173809chr1041225 1192 1058 1038 ----1933
NM_173825chr393013 2875 2727 2677 1182 858 557 213 183 1511 ----
NM_173832chr8153711 3384 3177 3136 3087 3062 3037 3012 2963 2853 742 651 631 562 275 32915 2492 1465 2597 490 33741 2365 1401
NM_173854chr142044 799 72 64 1581 1758 12054
NM_174934chr1131096 667 309 23342 2533 2299 274 --
NM_174953chr1771282 440 242 220 174 113 25 21203 182 ----
NM_174957chr1771282 440 242 220 174 113 25 21203 182 ----
NM_175077chr203357 235 51 --141 11365
NM_175736chr12106764 6669 5453 5201 3077 2781 2528 2456 1208 899 36344 5332 1113 1179 15347
NM_175748chr1471790 857 822 791 507 186 99 --1436 --
NM_175907chr1852844 2533 486 259 139 --1372 --
NM_176801chr471835 698 622 556 408 282 75 --1477 1271
NM_177398chr131773 1612 1466 11740 --11569
NM_177399chr131773 1612 1466 11740 --11569
NM_177438chr1443339 1105 931 543 2948 389 ----
NM_177996chr2072965 2507 2241 1327 1051 776 405 23363 1246 11370 --
NM_178014chr62188 36 1830 --2717 315
NM_178120chr24494 390 383 29 1446 144 1429
NM_178151chrX77290 6586 5929 5756 5032 4933 2187 36574 4768 2502 ----
NM_178152chrX77290 6586 5929 5756 5032 4933 2187 36574 4768 2502 ----
NM_178153chrX77290 6586 5929 5756 5032 4933 2187 36574 4768 2502 ----
NM_178426chr152222 725 599 367 247 21635 511 ----
NM_178427chr152122 625 499 267 147 21535 411 ----
NM_178818chr1652319 2236 1878 623 22 1763 1876 --
NM_180976chr641050 920 869 264 11021 1170 1764
NM_180977chr641050 920 869 264 11021 1170 1764
NM_181332chrX22645 2331 1101 --11058
NM_181481chr1835132 1942 1854 12345 --1697
NM_181482chr1835132 1942 1854 12345 --1697
NM_181483chr1835132 1942 1854 12345 --1697
NM_181491chr962776 2533 1185 1164 1106 615 11943 13018 22707 1040
NM_181521chr16117100 7017 6659 6227 5404 4803 4610 2232 1721 108 33 35544 2785 1203 15657 --
NM_181706chr1152249 838 815 710 313 --11860 --
NM_181714chr6------21435 490
NM_181809chr1103725 3617 3300 3099 2894 1477 1259 1200 954 148 --11406 --
NM_181832chr2283419 3058 2817 2391 1163 1137 803 495 123 1636 --
NM_182526chr1473086 3020 2694 2266 2240 2036 417 12760 33096 2802 2784 --
NM_182538chr17284 69 ----2244 48
NM_182557chr1172211 2033 1750 1582 1503 409 217 21661 799 1384 1772
NM_182894chr1451634 662 341 256 118 1462 1129 --
NM_182898chr765188 4510 2465 2016 1698 1555 14741 ----
NM_182899chr765188 4510 2465 2016 1698 1555 14741 ----
NM_182970chr20124147 3908 3895 3612 3583 3415 1724 1707 1534 1451 1304 597 --12828 22613 1658
NM_183006chr2041551 572 519 407 11431 1169 11124
NM_183397chr20133849 3676 1863 1579 1517 912 897 536 443 343 216 139 55 34637 1677 1302 13895 11394
NM_194278chr1463710 3391 1338 1301 1004 694 --21506 727 13356
NM_194286chr12136113 6090 5820 5243 4407 4210 2446 1930 1899 1616 1502 1261 564 16237 --26159 837
NM_194318chr131322 21624 775 --1978
NM_198277chr1121040 78 2742 315 --191
NM_198390chr1651731 1606 613 88 80 21277 491 11385 --
NM_198560chr3133770 3730 3422 3238 3120 3107 2664 2464 2420 1323 1087 534 495 13535 2401 302 --
NM_198568chr61270 --1861 1763
NM_198581chr267254 7056 5681 4704 2088 51 24619 1071 ----
NM_198595chr463155 1750 724 539 354 150 14337 21648 1271 24025 218
NM_198715chr165977 5971 4059 1657 1132 842 16202 ----
NM_198793chr363351 1580 995 732 653 307 ----1597
NM_198844chr171935 ----1430
NM_198859chr324838 4316 34373 4303 1055 ----
NM_198900chr12106764 6669 5453 5201 3077 2781 2528 2456 1208 899 36344 5332 1113 1179 15347
NM_198993chr1741603 537 488 112 --1654 1558
NM_199000chr7------1746
NM_199054chr1941728 443 277 39 1633 1289 11535
NM_199138chr132228 117 ----1994
NM_199141chr195691 660 349 249 48 3897 362 168 2709 335 --
NM_199169chr2083518 3415 3357 2977 2602 2499 2210 798 53190 3177 2638 2469 2305 11034 --
NM_199170chr2083518 3415 3357 2977 2602 2499 2210 798 53190 3177 2638 2469 2305 11034 --
NM_199171chr2083518 3415 3357 2977 2602 2499 2210 798 53190 3177 2638 2469 2305 11034 --
NM_199245chr1292248 2199 2166 906 672 571 503 457 34 ----12099
NM_199262chr1752271 1642 1460 747 344 1929 2542 462 --
NM_199321chr171935 ----1430
NM_199437chr1111975 --11636 1653
NM_199438chr1111975 --11636 1653
NM_199439chr1111975 --11636 1653
NM_199454chr1114346 4129 3616 3496 3227 1627 1606 1094 1024 986 89 64541 3457 3185 1908 668 175 23595 1058 1884
NM_199462chr153531 3365 1761 1587 495 23599 3203 --11836
NM_201432chr17106323 6068 5564 4718 4490 2024 1086 711 292 28 1376 ----
NM_201433chr17106323 6068 5564 4718 4490 2024 1086 711 292 28 1376 ----
NM_203327chr2084065 3914 3228 1684 1621 989 316 266 22865 1629 12919 --
NM_203404chr14350 141 123 81 4757 627 93 56 ----
NM_203458chr123662 2722 13694 --1793
NM_203463chr243531 3028 1723 1309 54534 4047 3491 1900 1649 ----
NM_206855chr631567 1512 279 --1138 16277
NM_206909chr897835 6256 6222 5457 3206 3187 1604 1329 1194 23308 2960 ----
NM_207012chr1021327 340 12902 --13350
NM_207043chr122183 446 12107 --11823
NM_207044chr122183 446 12107 --11823
NM_207047chr122183 446 12107 --11823
NM_207119chr1041956 1446 1435 743 --1547 12211
NM_207306chr1104008 3944 3841 3530 2961 2833 1481 1475 1414 89 13938 14248 --
NM_207380chr1563433 3193 1406 1301 628 29 22663 2435 11279 --
NM_207406chr465983 5656 4611 2564 2465 2301 24111 334 135 --
NM_207645chr1131216 29 22 ------
NM_213662chr1751973 1918 403 206 45 ----12260