TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3145-3p
miRNA Sequence: AGAUAUUUUGAGUGUUUGGAAUUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000051chr11103473 3448 3351 3320 3072 2604 2357 1254 167 98 12291 22421 929 12887
NM_000052chrX113451 3427 3230 3124 2883 2789 2671 2259 776 688 381 23066 3050 42930 405 155 82 12104
NM_000081chr151680 1346 1222 738 555 11715 1544 1311
NM_000084chrX156384 6002 5908 5637 5329 5139 4722 2705 2487 2245 1168 1106 957 548 524 --14497 1228
NM_000091chr2132857 2841 2806 2797 2786 2763 2732 2672 2552 997 866 799 100 32540 2312 2002 42093 1897 893 328 22881 245
NM_000092chr2134444 4437 3560 3383 3374 3350 3139 1793 1753 1625 685 355 270 24178 819 54549 4415 4091 1773 778 14233
NM_000104chr282772 2605 2235 2067 982 901 716 426 12014 134 12169
NM_000109chrX102625 2432 2342 1631 957 767 696 538 128 90 22523 56 ----
NM_000110chr191146 986 960 882 850 477 413 126 105 11207 1163 11219
NM_000112chr5155278 3782 3712 3625 2208 1758 1664 1424 1354 1104 255 235 228 119 25 15222 21286 939 --
NM_000138chr1572527 2053 1976 1041 704 493 42 1876 32440 2311 2093 1885
NM_000163chr581831 1480 806 775 265 194 153 145 12270 1217 12145
NM_000167chrX51801 1695 1281 1222 1186 11359 31414 1351 194 11638
NM_000176chr593920 3894 3815 3671 3562 2865 2411 1548 1504 11497 23469 3188 13789
NM_000202chrX153215 3081 3047 2963 2936 1352 1121 1053 869 860 681 615 154 95 27 11007 53962 1286 1211 1062 925 21205 490
NM_000214chr2011497 --11267 21097 570
NM_000232chr4103163 3111 2917 2908 2876 2707 2026 1209 1006 379 13043 21976 559 22014 1105
NM_000242chr1062302 1046 860 609 509 214 --22150 1672 22609 1905
NM_000248chr3132833 2322 1108 983 808 772 746 664 552 468 369 234 211 --2790 299 --
NM_000259chr15196404 6347 5772 5580 5489 5156 4956 4938 3997 2319 2085 2045 1780 1770 1364 660 562 358 295 36292 3918 2214 66002 5565 5435 5206 4214 1420 16259
NM_000264chr982903 2786 2720 2682 2607 741 544 486 --62537 446 400 366 178 166 --
NM_000314chr1073051 2801 2574 2406 1068 888 825 1783 22148 1076 11242
NM_000329chr12754 748 --2943 250 1857
NM_000332chr6126302 6061 5577 5194 5164 5063 4835 4824 4504 1629 1295 652 26685 2544 26924 2060 26956 1986
NM_000337chr5226566 6545 6286 6183 6172 5694 5614 5500 5287 4516 4409 4370 4325 4035 2077 1948 1398 388 258 195 181 171 35482 5340 4378 14811 36614 4347 1038
NM_000340chr371311 1043 426 260 177 157 100 1379 3959 582 362 2145 135
NM_000390chrX123379 3359 3238 2818 2741 2607 2511 2500 2281 2151 706 86 22201 600 12666 32552 1130 471
NM_000393chr262068 1912 825 763 502 168 --2734 212 11779
NM_000408chr292785 2733 2624 2171 1314 907 561 337 213 12860 33355 3315 1151 --
NM_000411chr21103246 3201 3183 2416 2338 1020 942 905 382 327 --32444 776 689 13275
NM_000430chr17103688 3645 2761 1226 1112 1102 1070 427 155 141 13106 193 --
NM_000439chr5102191 2184 2140 1929 1910 1732 1006 785 461 109 1349 32416 2070 31 12246
NM_000448chr11143299 3250 3220 3200 3005 2877 2460 2340 920 895 797 601 531 420 13267 ----
NM_000452chr1342094 1708 679 240 12080 4552 270 257 186 --
NM_000461chr3124612 4592 4521 4120 4042 3971 3787 3512 1813 1723 1445 554 2729 591 41491 1135 951 684 13700
NM_000489chrX133472 3031 2761 2703 2637 2543 2445 2220 1245 810 665 592 231 12615 12114 --
NM_000492chr72589 549 --21227 1129 31525 1263 324
NM_000536chr113576 570 564 --1202 --
NM_000538chr1391765 1141 654 507 432 325 251 153 125 11129 11627 --
NM_000544chr6_cox_hap163421 3334 3212 3145 2511 2469 --42919 2303 464 274 --
NM_000555chrX157396 7095 6953 6736 6693 5778 2815 2436 1552 1516 1300 1255 946 380 260 17879 27033 6570 16469
NM_000584chr491234 1218 1206 772 325 287 272 254 210 21101 1043 1185 --
NM_000610chr1132830 2781 2113 --1675 23036 585
NM_000618chr12216560 6504 5759 5740 5197 4930 4842 4708 4595 4553 4300 4290 4098 2454 2397 1968 1879 1792 1574 610 265 16481 26140 4976 46171 6154 5056 1869
NM_000618chr12216560 6504 5759 5740 5197 4930 4842 4708 4595 4553 4300 4290 4098 2454 2397 1968 1879 1792 1574 610 265 16481 26140 4976 46171 6154 5056 1869
NM_000633chr18125246 4519 4369 4302 4044 3875 3665 3542 1552 1084 714 28 1770 --1222
NM_000668chr471279 1214 1107 1099 1007 971 461 --1290 181
NM_000793chr14124989 4955 4467 3954 3767 3481 3176 3155 1655 1588 1527 1202 13332 44699 4384 1541 936 21917 448
NM_000806chr561952 1855 1654 1416 427 342 21941 1465 31600 389 357 --
NM_000809chr4399255 9223 8717 8692 8536 8466 8378 8224 7920 7862 7774 7614 7508 7368 7290 7134 6979 6568 6414 6316 6174 6123 5656 3641 3596 3566 3382 2792 2015 1694 1496 1316 1199 1003 934 127 70 60 49 58872 7939 7685 790 354 139318 9027 8960 8608 7753 6493 5605 3243 3188 901 574 534 81 27303 1753
NM_000813chr5165630 5587 5267 4909 4571 3909 3873 1878 1813 1787 1498 1466 1418 1013 984 308 35436 2048 668 34898 4747 3985 25032 3965
NM_000814chr1593608 3333 3294 3280 1516 1006 887 851 400 1389 13103 3355 344 52
NM_000826chr4142508 2366 2260 2223 1734 1624 1041 1020 1013 990 754 699 285 248 1148 1557 --
NM_000860chr471648 270 262 188 156 92 74 21479 1326 21150 440 21630 315
NM_000866chr381778 1518 1482 541 425 272 230 157 1685 21663 1340 --
NM_000868chrX92644 2386 2328 2154 1770 1018 614 446 240 --2942 96 --
NM_000891chr17103083 2915 2620 2551 2509 2487 2397 1483 507 411 --22837 1447 13354
NM_000899chr12204285 4216 4167 4143 4041 3894 3572 3536 2993 2947 2773 2755 2729 1731 1711 1304 1207 988 853 485 13675 64061 3246 3219 3045 2916 351 --
NM_000908chr55789 727 239 220 208 --1667 1623
NM_000933chr2051513 1421 1238 135 110 11540 21684 1100 21781 1159
NM_000935chr36478 394 383 337 180 94 --31152 308 237 --
NM_000945chr261824 1661 1600 640 342 103 --52097 1838 818 329 307 --
NM_000950chrX153543 3429 3388 3190 2612 2564 2554 2468 2448 2399 2278 984 732 199 81 22782 2245 22339 1355 13358
NM_000959chr1154013 3528 3301 3214 2907 2777 2762 2675 2583 2562 1546 1490 1293 869 61 ------
NM_000963chr1102454 2155 2066 2020 1964 1662 841 828 479 67 11887 32495 2126 695 12249
NM_001001389chr1132830 2781 2113 --1675 23036 585
NM_001001390chr1132830 2781 2113 --1675 23036 585
NM_001001391chr1132830 2781 2113 --1675 23036 585
NM_001001392chr1132876 2827 2159 --1721 23082 631
NM_001001395chr1272041 1901 1005 764 323 309 108 --12783 11717
NM_001001419chr5165151 5005 4895 4837 4270 4027 3893 3887 3719 3203 1943 1911 1614 708 226 99 24800 3831 43932 3728 3376 1733 13184
NM_001001420chr5165151 5005 4895 4837 4270 4027 3893 3887 3719 3203 1943 1911 1614 708 226 99 24800 3831 43932 3728 3376 1733 13184
NM_001001481chr8103395 3179 3169 2944 2600 2588 2540 2354 2216 457 33108 2579 1080 12345 1240
NM_001001484chr10112253 2240 2150 2019 1864 824 799 725 614 388 79 --1549 11622
NM_001001664chr2153463 3442 3381 3368 3160 3134 3079 3041 2912 2700 1031 573 489 466 325 --44098 3726 3528 3067 13214
NM_001001668chr1994296 3104 2874 2838 2624 1662 1490 1103 229 23085 2675 21216 1163 --
NM_001001709chr9102831 2614 2519 2492 2355 2300 1087 922 390 123 1902 12140 --
NM_001001890chr21124070 3891 2808 2682 1590 1064 954 890 822 764 618 569 --23549 3177 1844
NM_001001928chr22108260 6663 5990 5943 5846 2955 2907 1588 1257 473 16464 97652 7191 7177 5552 5449 5356 5272 493 93 17095
NM_001001971chr1081412 1282 1253 1142 986 344 287 267 --1280 --
NM_001001974chr10122314 2262 2218 2145 2116 1961 1784 502 402 314 283 175 21722 227 2441 218 12057
NM_001001995chrX71781 1715 1429 1423 1364 594 318 --21836 193 1752
NM_001002257chr2113535 3390 2971 2829 2708 2642 1340 1130 130 98 48 1250 31166 884 159 --
NM_001002258chr262001 1985 1850 1454 1356 382 --41568 1406 355 264 21861 687
NM_001003652chr18198359 8352 6980 6825 6809 6581 6427 5980 5934 5826 5645 5306 3194 3004 1393 1230 1208 1153 1069 2333 173 48511 7253 2394 1751 16098
NM_001003674chr18186708 6313 5742 5427 5007 4876 4800 4681 4662 4510 4341 2126 1577 1106 1030 718 681 483 25210 955 31596 1562 605 26191 5204
NM_001003675chr18186708 6313 5742 5427 5007 4876 4800 4681 4662 4510 4341 2126 1577 1106 1030 718 681 483 25210 955 31596 1562 605 26191 5204
NM_001003679chr192251 1943 1686 1480 613 556 443 360 195 --31675 1403 461 1352
NM_001003712chr12293928 3865 3796 3778 3636 3612 3394 3262 3134 3108 2774 2637 2617 2553 2521 1345 1310 1295 1219 1070 956 946 671 652 558 393 345 127 96 23678 1084 32802 1557 1246 13279
NM_001003760chr6103623 3303 3108 2417 1474 1464 1180 438 310 124 12312 32538 563 90 13434
NM_001004317chr6114471 4024 3768 3726 3712 3503 3256 3025 1519 1243 60 1844 11798 13473
NM_001004346chr451086 1075 853 375 294 --4489 480 472 343 2499 317
NM_001004360chr2102000 1975 1900 1405 790 699 617 567 71 33 21988 91 21442 483 11575
NM_001004419chr12184606 3939 3877 3765 3603 3216 3145 3139 3112 2891 1713 1642 1552 1495 1309 994 182 63 2261 193 33042 826 462 1237
NM_001004441chr581253 1039 519 462 241 133 76 33 21531 1060 61719 1618 1548 1049 595 345 11214
NM_001005386chr252417 2155 2016 1901 536 11631 12428 22439 952
NM_001005404chr1794113 4083 3257 3153 3135 1517 1256 917 575 23943 1327 23423 817 14538
NM_001005473chr5266574 6532 5512 5496 5356 5250 5221 4513 4505 4474 2557 2517 2483 2398 2359 2275 2229 2172 2090 1980 1742 1567 768 671 658 579 25166 2137 45604 1277 1130 188 --
NM_001005502chr12105254 4259 4132 4122 4072 3547 847 750 351 272 --45227 4415 4394 1591 1534
NM_001006600chr5122399 2257 2123 2110 1903 1726 1521 988 659 651 180 71 --11741 12028
NM_001006623chr2102430 2293 1775 1026 973 879 586 574 481 55 1773 1815 --
NM_001006657chr2102719 2561 2519 2243 2133 765 494 210 143 33 --33073 699 289 --
NM_001007023chr14124989 4955 4467 3954 3767 3481 3176 3155 1655 1588 1527 1202 13332 44699 4384 1541 936 21917 448
NM_001007278chr13235259 5199 5076 4966 4669 4473 4180 4063 3742 3697 3398 2064 2023 1934 1583 1184 972 845 732 308 292 238 109 --35040 3592 3457 13917
NM_001007466chr6145066 4377 4193 4076 4045 4025 4000 3931 3474 1732 1468 1254 1240 32 13371 24389 3965 --
NM_001008239chr18103653 3530 3266 3037 1289 852 525 386 314 229 11085 23453 695 --
NM_001008401chr1971491 1357 1288 508 246 164 82 31175 1125 175 --1586
NM_001008405chr741182 1174 1133 387 21231 186 51858 1713 1645 716 537 31149 691 620
NM_001008539chr8105374 5277 4518 4379 4357 4296 3309 2145 1298 895 1473 --34283 3476 3375
NM_001008564chr1392204 2107 2011 1970 1843 811 457 445 234 --11423 --
NM_001008707chr1441856 1484 1394 625 --21471 387 11195
NM_001008726chr1481090 576 547 475 469 255 191 130 --51262 1211 1136 667 561 --
NM_001008738chr5112903 2703 2192 2149 972 794 717 637 543 493 470 1293 12660 2815 678
NM_001008756chr372608 2343 2337 1631 895 865 854 32516 2056 883 32236 1840 907 --
NM_001008925chr4122751 2597 2553 1362 1289 1256 1140 990 961 670 627 115 2770 36 12725 --
NM_001009554chr4164648 4479 4431 4021 3507 3286 1794 1551 1363 970 919 841 765 589 380 322 --24604 4068 24619 4300
NM_001009554chr4164648 4479 4431 4021 3507 3286 1794 1551 1363 970 919 841 765 589 380 322 --24604 4068 24619 4300
NM_001009894chr1291395 1388 1089 1075 645 581 445 341 45 1291 21591 66 --
NM_001009899chr3266514 6508 6470 6421 6323 6205 6040 4782 4382 4318 4233 2606 2460 2452 1990 1957 1224 1192 1157 1105 1053 713 496 387 361 46 1438 24674 989 1926
NM_001009960chr7112786 2665 2516 2506 2483 2421 2142 567 419 248 23 22363 388 ----
NM_001010000chr18143515 3474 3310 3203 3084 2729 2596 2417 2330 2162 1269 810 519 264 12253 23160 2945 --
NM_001010853chr6113266 3197 3054 2501 2392 2329 1030 883 859 358 327 --32828 2471 910 --
NM_001010861chr172425 2018 1930 1749 954 541 255 1137 12712 12413
NM_001010888chrX104483 4261 3950 3624 1539 1162 982 881 749 33 141 1837 --
NM_001010891chr5226874 6819 6796 6643 6041 5914 5592 4902 4838 4734 4456 4323 2218 2091 2073 1856 1810 1801 1640 1206 1074 719 26918 6599 36281 4275 1428 1605
NM_001010895chr992035 2013 1918 1894 1472 346 339 217 29 21584 622 21545 509 22059 1785
NM_001010986chrX92345 2275 2119 1993 862 689 540 528 101 42406 1946 827 474 12169 --
NM_001011513chr4104090 4009 3962 3954 3727 3519 2949 995 889 83 --43298 3216 2831 160 13688
NM_001011666chr7196568 6200 6181 6088 5705 5652 5378 4989 4825 4221 4078 4064 3975 2505 2366 2080 2007 200 148 36576 2638 1757 26188 5391 1522
NM_001011885chr1561829 1664 1454 1286 1234 299 --1720 11403
NM_001012751chr1061699 521 483 293 138 93 1371 1269 11553
NM_001012755chrX105021 4848 4081 3979 3862 3760 3223 903 844 177 --34329 3953 3514 13851
NM_001012968chrX82483 2477 1895 1878 1872 841 482 417 ----22055 770
NM_001013620chr12318510 8373 8317 8263 8197 7827 7754 7625 7468 7437 7306 7134 7016 5841 5688 5635 5628 3236 2426 2395 2219 1977 1944 1690 1435 1413 1332 965 906 669 521 22678 2347 86915 6237 5333 3349 2761 1380 464 241 16062
NM_001013659chr19185117 4984 4880 4871 4864 4229 4062 4004 3992 3465 1544 1476 1342 1253 1217 976 958 840 24547 984 54913 4557 3927 1400 873 21760 1043
NM_001013746chr7152253 2218 2162 2092 1754 1731 1661 1615 882 729 644 560 237 228 59 --11816 21794 893
NM_001014380chr13165806 5609 4932 4728 4670 4462 4443 4291 4142 4047 3884 958 607 586 237 152 34873 3571 714 55360 5302 5098 4861 4522 --
NM_001014797chr10127557 6594 6395 6371 5187 4993 2058 1917 1649 1587 406 292 35663 3075 1020 35900 1628 432 25489 3004
NM_001015877chrX102836 2774 2574 2561 2366 2276 2097 1946 961 531 --22852 145 --
NM_001017440chr798210 8124 8072 6796 6145 5861 5708 1758 811 12041 25639 5578 --
NM_001017923chr1491481 1290 629 535 415 382 243 178 150 --21090 559 11499
NM_001017926chr871787 1671 1320 1300 1280 1165 568 ----21644 1263
NM_001017992chr561223 1133 952 541 529 496 11233 41279 1142 440 358 21113 300
NM_001018065chr9115835 5177 4932 4809 4248 4135 1991 1841 1414 780 693 34071 1955 1720 14496 11982
NM_001018066chr9115835 5177 4932 4809 4248 4135 1991 1841 1414 780 693 34071 1955 1720 14496 11982
NM_001018067chr1195346 4915 4416 3932 3893 3697 3654 3593 1980 1710 1466 1444 1154 916 546 316 295 215 188 25099 3404 31844 1482 416 1629
NM_001018068chr1195346 4915 4416 3932 3893 3697 3654 3593 1980 1710 1466 1444 1154 916 546 316 295 215 188 25099 3404 31844 1482 416 1629
NM_001018069chr1195346 4915 4416 3932 3893 3697 3654 3593 1980 1710 1466 1444 1154 916 546 316 295 215 188 25099 3404 31844 1482 416 1629
NM_001018074chr593920 3894 3815 3671 3562 2865 2411 1548 1504 11497 23469 3188 13789
NM_001018075chr593920 3894 3815 3671 3562 2865 2411 1548 1504 11497 23469 3188 13789
NM_001018076chr593920 3894 3815 3671 3562 2865 2411 1548 1504 11497 23469 3188 13789
NM_001018077chr593920 3894 3815 3671 3562 2865 2411 1548 1504 11497 23469 3188 13789
NM_001018090chr1582611 2564 2349 2187 2065 194 187 84 22468 67 12215 11116
NM_001018091chr1582721 2674 2459 2297 2175 304 297 194 22578 177 12325 --
NM_001018102chr1582611 2564 2349 2187 2065 194 187 84 22468 67 12215 11116
NM_001024094chr593920 3894 3815 3671 3562 2865 2411 1548 1504 11497 23469 3188 13789
NM_001024647chr12297702 7492 7343 7256 7150 7006 6464 6262 5895 5540 4977 4688 3022 2376 2036 1943 1919 1587 1266 1248 1175 1050 974 943 879 776 594 270 56 35878 5063 2410 --47683 7325 5790 5569
NM_001024934chr64550 244 178 71 --143 2156 23
NM_001024935chr64550 244 178 71 --143 2156 23
NM_001024936chr64550 244 178 71 --143 2156 23
NM_001024956chr11195838 5742 5245 4983 4839 4776 4400 4083 2305 2008 1890 1791 1408 1343 1156 1046 1030 769 83 31539 1394 682 35262 1364 675 55376 4276 3710 1440 46
NM_001025068chr321492 116 1348 1129 21832 624
NM_001025069chr321492 116 1348 1129 21832 624
NM_001025076chr10146239 6001 4594 4499 4086 3767 1973 1918 1828 1192 1079 1042 591 370 35956 3931 2178 1634 --
NM_001025077chr10117597 7359 5952 5857 5444 5125 2550 2437 2400 1949 1728 27314 5289 24642 1992 1628
NM_001025079chr333889 1530 1017 23961 2964 43673 3003 1423 397 24117 3948
NM_001025233chr1292750 2648 2334 2254 2074 2002 1983 698 514 12060 4760 657 580 111 --
NM_001025356chr12122993 2951 2847 2267 2261 2204 2152 2107 511 174 101 51 1863 ----
NM_001025366chr691872 1824 1783 1724 1455 1317 1242 647 420 --1397 --
NM_001025366chr691872 1824 1783 1724 1455 1317 1242 647 420 --1397 --
NM_001025367chr691872 1824 1783 1724 1455 1317 1242 647 420 --1397 --
NM_001025367chr691872 1824 1783 1724 1455 1317 1242 647 420 --1397 --
NM_001025368chr691872 1824 1783 1724 1455 1317 1242 647 420 --1397 --
NM_001025368chr691872 1824 1783 1724 1455 1317 1242 647 420 --1397 --
NM_001025369chr691888 1840 1799 1740 1471 1333 1258 663 436 --1413 --
NM_001025369chr691888 1840 1799 1740 1471 1333 1258 663 436 --1413 --
NM_001025370chr691872 1824 1783 1724 1455 1317 1242 647 420 --1397 --
NM_001025370chr691872 1824 1783 1724 1455 1317 1242 647 420 --1397 --
NM_001025580chrX204325 4268 4223 3730 3511 3368 2973 2883 2857 2769 1593 1581 1529 1379 1346 1197 1144 1001 884 603 44199 1628 1219 268 23889 935 1841
NM_001025616chr4101834 1708 1606 1265 558 476 464 458 413 302 21199 125 ----
NM_001029858chr673095 2401 2160 1166 637 571 279 21110 795 --12072
NM_001029875chr531918 788 322 2491 476 3905 590 343 1802
NM_001029998chr4111371 1223 1104 1079 1033 1023 513 215 180 151 123 ----11171
NM_001030055chr1484656 4442 3546 3273 2916 1705 819 475 13538 44765 3499 1471 1019 13131
NM_001031679chr1253263 3218 2998 1160 80 13029 23382 1179 23444 1309
NM_001031700chr462515 1567 950 787 765 32 1802 2970 210 11549
NM_001031732chr483699 3654 3220 2547 1314 996 445 281 31342 570 161 22386 438 --
NM_001031804chr16134033 3886 3835 3633 3376 3072 2976 1753 1697 1517 1448 689 682 ------
NM_001031812chr592330 2297 2139 2082 1939 867 662 333 278 --32072 746 456 1122
NM_001032282chr861298 1155 992 841 388 248 --1461 11171
NM_001032380chr1061909 1868 1322 704 671 620 1681 2687 347 --
NM_001032394chr6152840 2752 2743 2129 2018 1881 1143 835 793 755 554 390 213 169 137 12213 12191 2710 95
NM_001032395chr6142707 2619 2610 1996 1885 1748 1010 702 660 622 421 257 80 36 12080 12058 1577
NM_001033045chr2124467 4308 4229 3789 3690 2934 2705 1001 941 267 245 129 --13814 14392
NM_001033047chr4102618 2421 2316 2028 2017 2008 1678 675 657 438 --21929 693 1758
NM_001033057chr351657 1328 207 176 163 11775 1695 11948
NM_001033059chr672038 1937 1795 1736 1341 770 332 --21509 186 1345
NM_001033087chr2093135 3094 3069 2947 2124 2034 1215 928 597 1884 22229 545 12385
NM_001033578chr8102342 2190 2143 2095 1646 1587 515 137 84 74 --22205 491 --
NM_001033756chr691806 1758 1717 1658 1389 1251 1176 581 354 --1331 --
NM_001033756chr691806 1758 1717 1658 1389 1251 1176 581 354 --1331 --
NM_001033925chr1082126 1914 1887 1777 1563 723 625 116 --3797 534 96 --
NM_001034841chr1685371 5274 5179 5121 4931 1798 1248 767 21372 560 35163 3464 261 1150
NM_001034850chr551624 1429 1284 1042 564 --21407 327 2389 261
NM_001035005chr187663 613 518 168 154 146 121 ------
NM_001035260chr1071487 1297 1219 585 364 256 83 --31594 1557 508 --
NM_001037132chr7122213 2178 2121 2001 1928 1558 1527 1412 1387 846 461 23 --11677 --
NM_001037133chr7122213 2178 2121 2001 1928 1558 1527 1412 1387 846 461 23 --11677 --
NM_001037174chr2122260 1710 1614 1564 1390 567 538 441 420 411 393 85 31971 1641 1508 --22242 1862
NM_001037317chr172425 2018 1930 1749 954 541 255 1137 12712 12413
NM_001037535chrX71382 1336 1269 983 966 270 121 11327 1110 11569
NM_001037536chrX71382 1336 1269 983 966 270 121 11327 1110 11569
NM_001037540chrX71382 1336 1269 983 966 270 121 11327 1110 11569
NM_001039199chr20105061 5004 4489 4040 3137 829 610 483 443 135 --21977 204 1875
NM_001039538chr2123663 3507 2970 2458 2420 2275 1315 894 855 781 775 33 2834 698 22555 1441 13451
NM_001039547chr3247904 7333 7116 6936 6805 6659 6552 6539 6152 5196 4972 3021 2953 2476 2462 2389 1565 1538 1434 782 703 536 494 472 21969 525 77922 6581 6460 6021 2513 1494 863 11576
NM_001039577chr183636 1752 1127 1096 1065 1029 907 802 21154 545 23181 460 14528
NM_001039580chr4155114 4911 4555 4181 4059 4052 3961 3895 1922 1128 1071 909 897 319 94 95083 4953 4853 3418 1804 1559 1372 721 49 13123 13838
NM_001039585chr1134270 3785 3558 3471 3164 3034 3019 2932 2840 2819 1550 1126 318 ----12604
NM_001039590chrX123899 3390 3270 3076 3023 2920 2485 1241 920 797 778 81 1772 11404 --
NM_001039591chrX123899 3390 3270 3076 3023 2920 2485 1241 920 797 778 81 1772 11404 --
NM_001039618chr11305958 5897 5824 5734 5435 5417 5234 5117 4681 4674 4255 4199 3930 3825 3729 2025 1920 1911 1607 1549 1505 1315 1123 1062 1045 849 814 740 721 121 22339 1457 55308 5289 4905 4868 4066 1783
NM_001039693chr273699 2600 1269 964 794 745 248 1322 --13101
NM_001039840chrX225732 5706 5657 5539 5433 5424 5272 5191 5009 4979 4968 4699 4285 3972 3680 1816 1448 1378 1224 811 587 120 35443 5357 4710 75767 4395 3694 1955 1828 563 537 25468 1751
NM_001039937chr1393283 3265 2924 2661 1348 1330 1171 479 465 11542 2942 241 1202
NM_001040020chr771559 1282 1150 1067 627 619 316 1137 31336 1169 82 1350
NM_001040142chr2122426 2408 2313 2090 1986 1544 1518 849 773 716 199 119 --21615 937 --
NM_001040143chr2122426 2408 2313 2090 1986 1544 1518 849 773 716 199 119 --21615 937 --
NM_001040152chr785110 3926 3731 3609 2037 849 718 167 24703 390 14716 13416
NM_001040157chr472258 2245 2235 2172 2052 652 168 11122 22266 1824 11956
NM_001040202chr4102567 2309 2109 2026 1719 864 762 575 528 145 --22224 2034 --
NM_001040284chr16185724 5622 5513 5130 4540 4375 4208 3790 3740 3642 2348 2183 1851 1796 1465 808 297 80 32204 2051 376 54296 3860 3757 3635 470 --
NM_001040402chr4113235 3218 2970 2943 2270 2113 2072 1277 683 600 327 1556 --1534
NM_001040429chr13143543 3526 3099 2414 2332 2188 1431 1299 983 975 809 676 350 150 --32547 1126 940 13046
NM_001040441chr1165511 5357 4407 4346 4185 3597 1577 1541 1508 1449 1412 1372 680 537 305 187 24195 3661 12019 --
NM_001040450chr15112584 2549 2481 2447 2278 2264 2016 1989 1969 936 838 22078 694 11958 1396
NM_001040453chr15112584 2549 2481 2447 2278 2264 2016 1989 1969 936 838 22078 694 11958 1396
NM_001040665chr7145010 4845 4825 4065 3741 3638 3460 3236 3225 3121 1253 618 313 81 --74906 4245 3652 3595 3478 3216 3075 43631 1265 821 173
NM_001040712chr9103487 2889 2236 1223 872 759 677 575 374 46 1745 12259 23618 694
NM_001040875chr872685 2545 2494 2077 1984 846 774 22125 2115 --12239
NM_001040876chr4101914 1713 1672 1563 1466 1347 1269 388 222 116 1728 11924 --
NM_001042355chr16175383 3891 3465 3431 3424 3378 3342 1951 1648 1415 1365 1011 998 766 360 207 174 --34971 1266 654 --
NM_001042357chr1061469 1375 1248 1228 1189 318 31257 213 162 11572 --
NM_001042358chr1061469 1375 1248 1228 1189 318 31257 213 162 11572 --
NM_001042360chr1061469 1375 1248 1228 1189 318 31257 213 162 11572 --
NM_001042361chr1061500 1406 1279 1259 1220 349 31288 244 193 11603 --
NM_001042363chr1061469 1375 1248 1228 1189 318 31257 213 162 11572 --
NM_001042364chr1061500 1406 1279 1259 1220 349 31288 244 193 11603 --
NM_001042365chr1061500 1406 1279 1259 1220 349 31288 244 193 11603 --
NM_001042383chr3113484 3461 3439 3131 3100 2379 661 644 379 293 252 --23384 3035 13478
NM_001042387chr1061500 1406 1279 1259 1220 349 31288 244 193 11603 --
NM_001042389chr1061469 1375 1248 1228 1189 318 31257 213 162 11572 --
NM_001042390chr1061469 1375 1248 1228 1189 318 31257 213 162 11572 --
NM_001042392chr1061469 1375 1248 1228 1189 318 31257 213 162 11572 --
NM_001042393chr1061500 1406 1279 1259 1220 349 31288 244 193 11603 --
NM_001042395chr1061469 1375 1248 1228 1189 318 31257 213 162 11572 --
NM_001042396chr1061500 1406 1279 1259 1220 349 31288 244 193 11603 --
NM_001042397chr1061500 1406 1279 1259 1220 349 31288 244 193 11603 --
NM_001042406chr611203 3866 422 176 21249 848 21136 319
NM_001042412chr16175383 3891 3465 3431 3424 3378 3342 1951 1648 1415 1365 1011 998 766 360 207 174 --34971 1266 654 --
NM_001042413chr9104056 4026 3206 1619 1459 1436 1068 902 667 336 --33439 2956 2734 32946 2910 1295
NM_001042440chr562008 1929 1732 1650 538 282 --42056 1864 1757 154 --
NM_001042441chr562008 1929 1732 1650 538 282 --42056 1864 1757 154 --
NM_001042442chr562008 1929 1732 1650 538 282 --42056 1864 1757 154 --
NM_001042443chr562008 1929 1732 1650 538 282 --42056 1864 1757 154 --
NM_001042444chr562008 1929 1732 1650 538 282 --42056 1864 1757 154 --
NM_001042445chr562008 1929 1732 1650 538 282 --42056 1864 1757 154 --
NM_001042446chr562008 1929 1732 1650 538 282 --42056 1864 1757 154 --
NM_001042481chr14102651 2606 2425 1938 1890 1009 283 204 173 127 --21909 789 --
NM_001042493chr691488 1399 724 684 640 490 483 400 213 31306 476 80 1330 --
NM_001042533chr383193 3064 2705 2327 1314 798 415 157 22254 295 13272 1706
NM_001042550chr9122043 1818 1654 1531 1485 1432 1378 781 708 336 232 43 51479 1402 639 585 382 ----
NM_001042555chr12164587 4213 4067 3921 3820 3793 3755 3696 3438 3230 3070 1611 1573 911 290 123 24599 1799 34651 1553 687 11343
NM_001042599chr2257886 7849 7260 7203 6628 6591 6585 6322 6230 6222 5712 5434 5225 2799 2785 2590 2410 2349 2267 1730 1512 1076 833 799 274 33116 2238 2021 87074 5950 5115 2157 1856 1803 1786 766 36403 4901 3083
NM_001042601chr3122762 2692 2570 1243 1228 1156 1113 1105 1030 892 555 528 12601 21282 217 13234
NM_001042603chr12165397 5186 5131 4948 4903 4877 4247 4157 3953 1942 1844 1232 1224 988 906 225 34308 3655 663 23551 1161 --
NM_001042604chr3104821 4619 3794 1937 1740 1413 805 647 305 195 2284 276 24684 1464 34407 3980 814
NM_001042669chr4101834 1708 1606 1265 558 476 464 458 413 302 21199 125 ----
NM_001042683chr671554 1516 1135 454 440 416 254 --31868 1853 619 --
NM_001042749chrX81785 1627 1433 738 603 593 338 112 --41610 644 531 233 11329
NM_001042750chrX81785 1627 1433 738 603 593 338 112 --41610 644 531 233 11329
NM_001042751chrX81785 1627 1433 738 603 593 338 112 --41610 644 531 233 11329
NM_001044385chr2143618 3270 3133 2786 1536 1502 1459 1411 1002 435 377 345 147 61 2477 137 ----
NM_001044722chr592330 2297 2139 2082 1939 867 662 333 278 --32072 746 456 1122
NM_001044723chr592330 2297 2139 2082 1939 867 662 333 278 --32072 746 456 1122
NM_001046chr5103055 2926 2920 2402 2273 1139 1037 931 631 531 42079 1116 918 392 22770 1187 22366 2199
NM_001083620chr4142506 2364 2258 2221 1733 1623 1040 1019 1012 989 753 698 284 247 1148 1556 --
NM_001099678chr3226462 6304 6204 5659 5462 5365 5108 4666 2300 2266 2156 1982 1944 1937 1445 1238 1209 1027 858 819 716 610 26417 6038 25550 780 15744
NM_001100108chr1128377 7290 6367 6175 5204 3300 3097 3064 1389 1274 571 189 32988 2313 1626 15353 11869
NM_001106chr3119321 9207 9084 8652 8522 8381 7846 7703 2580 2285 1526 1175 12481 29305 8827
NM_001117chr18122463 2445 853 631 519 448 277 242 229 192 153 138 1384 ----
NM_001146chr8102366 2176 922 892 852 814 537 379 333 96 1569 22140 1499 --
NM_001159chr23244 178 156 --1585 2787 772
NM_001167chrX256644 6614 6433 6377 5469 5250 4868 4716 4348 4314 2360 1496 1427 1159 1152 1128 1028 908 873 761 742 699 640 379 125 --44527 1571 1539 1070 --
NM_001173chr1484656 4442 3546 3273 2916 1705 819 475 13538 44765 3499 1471 1019 13131
NM_001177chr12112486 2435 2392 2135 1723 1694 1659 1596 532 156 131 11615 2367 214 1822
NM_001186chr21143256 3238 2975 2827 2738 2546 2464 2450 2129 2106 1039 497 416 224 1203 12967 12037
NM_001200chr2081119 906 843 286 239 165 104 26 --2381 203 11146
NM_001201chr4153675 3640 3412 3295 3276 3243 3054 2517 2508 1479 1264 1172 999 708 223 21412 1050 33333 1383 1042 --
NM_001204chr2146958 6466 6403 5406 5289 3014 2957 2491 2337 1947 1742 1641 1129 791 26473 2766 56763 2163 2127 1817 294 35729 2702 881
NM_001233chr7102167 1820 1793 859 717 642 559 537 458 140 --22104 575 --
NM_001241chr2112418 2208 2156 1924 1669 941 643 605 579 392 217 ----11688
NM_001241chr2112418 2208 2156 1924 1669 941 643 605 579 392 217 ----11688
NM_001256chr17102792 2547 2268 1948 1800 644 559 543 334 178 --1598 1290
NM_001259chr7165710 5666 5420 5198 4757 4657 4438 4375 4349 4138 4074 3886 2134 2072 1427 1143 --33859 1707 1110 --
NM_001304chr1773457 3365 1352 1215 1190 957 861 13263 21007 948 12396
NM_001310chr12112877 2586 2511 2114 2050 2013 647 580 566 144 39 12557 13103 12308
NM_001349chr24582 569 385 140 ----2512 175
NM_001356chrX52316 2207 2102 1795 798 11912 21818 552 1374
NM_001364chr1184774 4296 3904 804 790 729 720 54 --34590 4169 773 14782
NM_001390chr1863654 3527 3469 2481 2389 1090 1457 1796 1817
NM_001412chrX153768 3624 3606 3548 3342 2977 2511 2376 2295 2289 1076 892 790 411 136 1529 --32750 2570 1063
NM_001427chr731834 1524 1482 11996 52002 194 179 136 109 --
NM_001432chr4153861 3830 3608 3413 3323 3172 2741 2499 1174 950 858 511 388 134 77 43802 3051 202 52 23579 194 --
NM_001438chr193593 3548 3223 2830 2737 2226 1294 1218 1023 13669 23533 2902 --
NM_001527chr6114874 4700 4558 3828 3552 1537 1428 1203 1142 921 60 1563 31275 1181 47 11167
NM_001609chr10104485 4369 4313 4070 3616 1359 994 819 497 114 21276 643 21032 702 33141 3095 878
NM_001616chr2133501 3426 3326 3262 2201 1314 1236 1193 922 891 336 147 117 --13486 --
NM_001621chr7153080 3032 3019 2977 2675 2641 2590 1882 1223 944 919 791 626 601 280 --32331 833 328 2869 645
NM_001621chr7153080 3032 3019 2977 2675 2641 2590 1882 1223 944 919 791 626 601 280 --32331 833 328 2869 645
NM_001634chr672038 1937 1795 1736 1341 770 332 --21509 186 1345
NM_001650chr18114080 4059 4005 3722 667 465 390 363 237 223 98 --32910 213 147 11429
NM_001656chr5112071 2054 1538 1448 1442 830 812 655 405 252 233 --11786 11945
NM_001663chr1492364 2212 2103 2095 2058 952 799 645 581 22119 1730 12398 1710
NM_001689chr262001 1985 1850 1454 1356 382 --41568 1406 355 264 21861 687
NM_001695chr8133938 3841 3699 3570 3551 3537 3496 3390 2815 436 218 178 92 23723 293 --11136
NM_001709chr1192909 2885 2749 2719 2677 2321 2026 1126 691 1493 32688 929 421 22279 2063
NM_001742chr761850 1650 1253 562 372 72 --11672 3355 274 252
NM_001750chr562008 1929 1732 1650 538 282 --42056 1864 1757 154 --
NM_001754chr21124070 3891 2808 2682 1590 1064 954 890 822 764 618 569 --23549 3177 1844
NM_001777chr333889 1530 1017 23961 2964 43673 3003 1423 397 24117 3948
NM_001806chr1982966 2942 2665 2210 1035 234 184 164 2909 582 32049 863 262 --
NM_001854chr181515 1430 1333 498 322 305 193 38 1963 11496 11096
NM_001855chr9173 ----2558 92
NM_001874chr12105254 4259 4132 4122 4072 3547 847 750 351 272 --45227 4415 4394 1591 1534
NM_001918chr1269276 9147 9080 8777 8762 8740 8491 8456 8425 8359 8049 8011 7922 6430 6266 6137 5882 3568 3036 2796 1423 1347 1031 867 848 137 1815 78916 8503 8445 2979 2659 780 712 --
NM_001920chr125562 294 281 263 245 2492 51 --1786
NM_001938chr181837 1789 1759 1541 1299 516 472 37 1215 11521 --
NM_001977chr471733 1489 1464 1284 1155 658 237 2475 426 --31528 1521 289
NM_001980chr1292260 2215 2129 2059 1823 1597 1408 813 315 21384 290 52174 1488 798 298 274 --
NM_001981chr1132428 2112 2038 2002 1983 1949 1890 1805 811 765 450 324 125 11977 32154 1852 541 21846 631
NM_001987chr1263565 3530 2687 1527 1003 405 22901 306 32949 2822 1050 12654
NM_001999chr561511 1205 1047 382 264 244 ----1275
NM_002006chr4245781 5685 5665 5508 5387 5234 5214 5106 4485 4262 3896 3689 3547 1471 1279 1143 1046 690 427 293 188 142 87 46 45058 4901 4423 985 65597 4391 2327 2307 1002 375 --
NM_002024chrX92145 2068 2009 1883 1680 1510 857 625 493 1578 --11490
NM_002025chrX179117 9036 7950 7771 7362 6458 6327 5931 5817 5608 3669 3299 2657 2393 1722 1617 288 48463 6744 3699 559 88118 7664 7593 7499 6628 5780 3485 3414 37170 6532 1453
NM_002035chr18123536 3036 3008 2968 2861 2503 2495 952 805 707 360 199 1577 23679 2440 22820 2641
NM_002040chr21153188 2977 2936 2890 2773 2530 2375 1141 496 383 319 218 190 55 42 1544 83174 2963 2803 2618 2319 1251 345 137 --
NM_002069chr7101732 1697 1658 1531 610 534 379 276 268 182 1479 ----
NM_002092chr494493 3889 3460 1832 1557 1404 1085 628 260 11037 11059 --
NM_002158chr2103823 3773 3515 3484 3272 3010 2733 2625 1031 232 21270 54 23330 1221 --
NM_002182chr392701 2492 2025 1873 1779 1084 1032 565 354 12116 1657 1192
NM_002199chr441015 835 804 368 ----2724 713
NM_002203chr5144128 4069 3936 3910 3808 3694 3576 3100 3031 1217 1084 755 465 342 --22964 388 --
NM_002210chr2103073 2816 2739 2646 2377 2322 1385 926 655 591 32890 1166 777 43452 3382 3254 2407 22558 2229
NM_002214chr7245747 5523 5513 5410 5385 5301 5183 5143 5118 5082 5029 4990 4583 4233 4170 3937 3866 3809 3777 1781 1644 1137 433 197 21603 762 45403 2023 1630 147 54515 4145 3799 1008 821
NM_002264chr3185037 4715 4706 4610 4236 3986 3861 3849 3730 3620 3501 3262 1288 952 690 592 288 98 24826 4811 24003 3754 14025
NM_002270chr5135612 5334 5066 4529 4357 3912 1891 1518 1440 1315 1070 236 86 34461 2253 328 35592 3763 1108 --
NM_002310chr5226616 6506 6137 6072 5938 5751 5522 5510 4908 4698 4598 2564 1951 1773 1756 1442 1106 925 773 581 182 100 44316 2245 2170 869 56007 5276 4981 4003 413 --
NM_002336chr12194718 4696 4635 4591 4567 4181 4136 3732 3713 1406 1333 1291 1176 844 582 351 152 48 42 --33822 3265 968 13570
NM_002374chr2123663 3507 2970 2458 2420 2275 1315 894 855 781 775 33 2834 698 22555 1441 13451
NM_002395chr681510 1454 1404 1251 1004 598 485 142 11026 21055 1034 --
NM_002397chr5142007 1913 1834 1553 1484 1439 801 769 678 670 595 465 419 285 12021 --11701
NM_002514chr881146 1134 1021 874 419 286 173 68 ----21171 364
NM_002519chr1151212 1204 1014 590 221 --21536 514 21474 1247
NM_002526chr661477 1428 1219 1111 575 388 ----21570 1456
NM_002577chr363375 1404 644 617 577 173 --21584 1087 23417 3403
NM_002581chr9165685 5415 5038 5001 4995 4927 4914 4548 4167 3921 3755 2276 1291 1102 785 537 45623 5446 4628 740 25637 4897 --
NM_002594chr20122335 2307 2238 2121 2039 1979 1902 1835 898 678 269 195 11992 22263 2101 --
NM_002610chr2112864 2782 2744 2652 2559 2335 2224 2199 2053 1936 31 12426 32440 2280 2066 --
NM_002645chr11103097 3077 3005 2830 2765 2560 2016 1990 1905 142 --33151 2873 2211 --
NM_002649chr791380 1374 1364 1090 1082 654 251 190 117 --51296 1234 1217 1201 1101 --
NM_002655chr8195308 5290 5072 5038 4994 4890 4654 4048 4001 3625 3572 3405 1861 1812 1457 1322 1243 518 32 14427 31832 1696 585 15214
NM_002656chr63892 817 766 --1239 2801 62
NM_002667chr681311 1280 1015 1002 988 421 380 81 ----21038 445
NM_002670chr391500 1433 1352 1044 1031 353 216 138 69 1525 --11295
NM_002709chr2163317 3055 3038 2939 2903 2890 2815 2694 2445 2283 2190 1234 1119 679 467 191 --32481 2299 528 --
NM_002719chr1452406 2359 2286 2100 785 --32432 1864 1701 22307 1947
NM_002731chr173047 2451 2335 2324 2276 1250 409 12767 22131 1938 --
NM_002740chr372840 2492 2017 1895 1739 978 121 --1314 22219 1812
NM_002745chr22104335 4287 3660 3411 3281 3073 1645 1249 1028 953 14497 23270 1160 --
NM_002760chrY134371 4352 4230 4191 4050 2314 2292 2182 2059 1817 1655 762 580 25033 3784 43775 1461 732 272 12304
NM_002837chr12164546 4492 4474 4394 4329 4317 3867 3713 2931 1631 1468 1257 1207 509 207 166 43606 3471 970 232 14116 11138
NM_002838chr161154 1134 1127 948 846 117 --2890 155 1813
NM_002839chr9103487 2889 2236 1223 872 759 677 575 374 46 1745 12259 23618 694
NM_002843chr1173460 2637 1353 606 597 381 96 ----33472 824 394
NM_002886chr3154632 4548 4307 3904 3790 3563 3530 2049 1221 1008 850 679 298 216 65 25111 1538 15220 11465
NM_002940chr4101914 1713 1672 1563 1466 1347 1269 388 222 116 1728 11924 --
NM_002941chr3131663 1375 1219 1099 1045 667 650 539 432 392 381 337 88 21337 143 1592 11403
NM_002956chr1281345 1307 1205 1186 1175 473 438 369 --3497 191 134 --
NM_002977chr2153389 3146 2777 2512 2420 2396 2362 2265 2214 2100 1295 1128 641 614 414 13330 23248 105 --
NM_002994chr491684 1532 1439 782 746 647 596 503 379 --31475 482 368 --
NM_002998chr842122 1831 1825 527 11383 32183 2157 1516 1226
NM_003034chr12308134 7949 7887 7459 7132 7123 6026 5714 5635 5570 5563 5010 4996 2889 2865 2625 2228 2196 2155 2077 1915 1651 1637 1578 1467 1249 1102 1024 541 354 58005 7608 6237 2776 404 67200 5926 5912 4903 2912 2053 47506 2417 2279 1689
NM_003042chr372159 2093 2067 1988 1946 1475 1430 21912 1446 22194 2167 --
NM_003046chr8105374 5277 4518 4379 4357 4296 3309 2145 1298 895 1473 --34283 3476 3375
NM_003048chr252761 2005 1821 1040 373 11083 52573 2268 2251 1739 417 11069
NM_003051chr132041 1478 48 11391 61576 1555 1374 529 487 58 --
NM_003071chr392092 1919 1654 786 757 706 679 568 267 --22004 1828 --
NM_003099chr15126332 6126 5981 4538 2513 2121 2029 1560 1476 1420 289 275 55019 2545 2379 2333 1806 26283 377 13999
NM_003108chr2137264 6437 5973 5897 5130 4939 4713 4703 1212 1081 814 538 343 27164 5300 14562 --
NM_003112chr7133202 3196 3054 2544 2398 2274 1181 921 859 521 247 210 127 1290 22594 876 --
NM_003133chr17993 947 437 414 373 314 172 --2740 46 11096
NM_003144chr6122212 2113 2010 1908 1750 1687 1663 1412 370 307 150 49 --22120 2101 --
NM_003161chr17123380 3299 3235 3171 3107 2829 2729 2560 2440 1257 1034 525 1109 42188 1401 1235 948 --
NM_003184chr871103 1020 1007 851 776 749 189 --3948 762 435 --
NM_003199chr18305681 5581 5535 5487 5437 5336 5267 5224 5055 4850 4569 4079 4005 3799 3772 3613 3502 2238 2182 2091 1834 1681 1406 1361 970 770 655 643 631 359 25076 4053 1390 --
NM_003221chr674020 3681 1620 810 439 195 29 --33299 2625 82 23925 3811
NM_003234chr362379 1933 1524 934 875 225 --1212 22395 299
NM_003262chr3113811 3450 2004 1761 1550 1478 1400 926 784 165 118 35204 4006 1261 44891 3235 2079 1896 21921 1082
NM_003274chr2182982 2693 2259 1968 960 884 751 688 22101 730 22532 2308 --
NM_003292chr182243 1778 1633 1595 1514 1433 130 113 21817 614 22288 2265 --
NM_003298chr3116096 5694 5619 5517 5121 4717 4408 1654 1508 1242 194 2414 302 45941 5423 3860 93 15444
NM_003304chr391434 1180 1132 549 394 359 280 145 87 11262 2415 131 --
NM_003338chr1071885 1715 1652 1553 1543 445 132 1767 11845 --
NM_003376chr691872 1824 1783 1724 1455 1317 1242 647 420 --1397 --
NM_003376chr691872 1824 1783 1724 1455 1317 1242 647 420 --1397 --
NM_003392chr3114205 3918 3684 3095 2893 1468 1462 1456 1405 1384 363 2585 173 63901 1699 854 635 219 89 --
NM_003409chr1881396 1373 1327 1303 1204 1187 495 84 1952 --21415 1167
NM_003410chrX153093 3019 2820 2679 2509 2471 1214 1097 963 848 613 513 376 152 31 --52892 2880 2135 1112 300 --
NM_003412chr3103017 2448 2424 2262 2180 925 804 708 581 569 1630 13049 12960
NM_003414chr167786 759 662 258 181 147 90 2728 719 --3595 281 174
NM_003423chr19112626 2429 1848 1669 1652 1619 923 697 627 499 29 --42505 1868 782 759 1365
NM_003430chr1991628 1446 1400 1159 1083 1048 627 294 210 1517 ----
NM_003439chr763258 2722 1203 1098 1009 651 43423 3230 1166 574 --1275
NM_003463chr6123115 3013 2979 2872 2317 2085 1079 1046 827 796 683 229 12826 32845 2300 850 --
NM_003468chr2104277 3618 3418 3293 1360 1277 1005 943 430 397 --24312 771 --
NM_003471chr3102259 2195 1936 1802 1583 713 513 483 339 275 11545 2950 663 22203 1632
NM_003472chr641365 1355 1045 480 1321 31498 1332 417 --
NM_003478chr11173368 2910 2888 2844 2821 2645 2578 2145 1133 984 888 703 630 534 389 361 23 22689 546 23296 614 22681 112
NM_003483chr1231996 1952 1928 1715 32872 1974 689 12748
NM_003489chr21123259 3235 2934 2875 2353 2178 1209 807 502 301 152 128 --23024 2540 1284
NM_003506chr871257 1135 452 367 351 224 208 1924 --21268 1101
NM_003566chr12113380 3053 2916 2782 1306 1087 1057 587 383 265 56 41292 631 152 29 21113 450 13476
NM_003574chr18205717 5682 5539 5032 4780 4774 4665 4454 4023 4017 3860 3777 2129 1476 1421 1189 1156 1020 382 330 33932 1801 494 35092 5009 2021 --
NM_003590chr2143682 3213 3169 1543 1342 1292 1108 1037 966 856 714 510 368 238 --21494 1212 22857 80
NM_003607chr194152 4137 4091 2950 2827 976 644 550 313 44363 4353 4052 466 24292 1535 24317 1284
NM_003615chr3113915 3523 3331 3257 3169 2756 2643 1361 764 79 33 --53341 2914 2596 1050 219 33496 1462 1076
NM_003617chr1145026 4988 3965 3220 1975 1559 1441 931 787 757 746 609 528 297 34384 373 317 64731 4577 3907 3764 543 235 1901
NM_003622chr1241941 1833 1650 506 22043 1979 42545 1845 1771 707 12627
NM_003663chr393504 3400 3212 2597 2531 2136 1078 281 36 --12578 12875
NM_003675chr102473 404 --1417 2519 374
NM_003679chr1123477 3438 3431 3332 3120 2981 2748 1183 549 543 137 66 43203 3069 2569 963 22861 1009 --
NM_003713chr151758 1694 1456 1318 137 ----31578 1566 1412
NM_003749chr1392259 2100 2092 2053 1871 1568 1558 799 363 22246 48 22175 1491 --
NM_003759chr4144273 4031 3787 3416 3132 2617 1681 1578 1473 1241 807 740 488 456 22602 184 23034 1281 12649
NM_003762chr1131350 1334 1214 1198 571 531 522 453 442 323 310 185 155 ----1129
NM_003787chr1831594 1569 482 --11222 2345 253
NM_003800chr672201 1995 1926 1744 1486 645 589 3977 893 689 2695 267 12386
NM_003816chr871532 1401 1128 1000 604 464 457 --2540 28 1988
NM_003822chr1113002 2934 2437 2054 1943 1241 1149 846 731 675 135 1762 13186 12671
NM_003873chr1082306 2207 2149 1599 1556 997 424 256 --32133 1959 1737 --
NM_003895chr21102220 2122 1872 1853 1709 1544 1458 630 458 110 21431 603 11998 --
NM_003899chr1352549 2099 1997 409 315 --1350 22538 325
NM_003913chr6164353 4231 4120 4062 4046 3990 3970 3914 3707 3592 3198 2910 1402 877 823 305 23290 2883 43666 2980 1488 91 --
NM_003931chr64550 244 178 71 --143 2156 23
NM_003948chr4112494 2391 2357 2014 1927 1732 602 591 434 177 76 11671 11786 12081
NM_003994chr12204285 4216 4167 4143 4041 3894 3572 3536 2993 2947 2773 2755 2729 1731 1711 1304 1207 988 853 485 13675 64061 3246 3219 3045 2916 351 --
NM_004006chrX102625 2432 2342 1631 957 767 696 538 128 90 22523 56 ----
NM_004007chrX102625 2432 2342 1631 957 767 696 538 128 90 22523 56 ----
NM_004009chrX102625 2432 2342 1631 957 767 696 538 128 90 22523 56 ----
NM_004010chrX102625 2432 2342 1631 957 767 696 538 128 90 22523 56 ----
NM_004011chrX102625 2432 2342 1631 957 767 696 538 128 90 22523 56 ----
NM_004012chrX102625 2432 2342 1631 957 767 696 538 128 90 22523 56 ----
NM_004013chrX102625 2432 2342 1631 957 767 696 538 128 90 22523 56 ----
NM_004014chrX102625 2432 2342 1631 957 767 696 538 128 90 22523 56 ----
NM_004015chrX102625 2432 2342 1631 957 767 696 538 128 90 22523 56 ----
NM_004017chrX102625 2432 2342 1631 957 767 696 538 128 90 22523 56 ----
NM_004020chrX102625 2432 2342 1631 957 767 696 538 128 90 22523 56 ----
NM_004028chr18114080 4059 4005 3722 667 465 390 363 237 223 98 --32910 213 147 11429
NM_004056chr861151 1114 914 792 353 335 --1850 21033 195
NM_004061chr51663 ----2673 70
NM_004079chr1102841 2430 2305 2138 2088 1992 521 442 130 35 22316 727 22278 792 1779
NM_004087chr361974 1734 1573 1535 1471 795 1187 11864 12005
NM_004094chr1493064 2950 2202 2196 775 382 131 123 106 21207 825 1859 1170
NM_004100chr692685 2653 2218 2111 1899 1821 977 603 597 --12162 11683
NM_004109chr114333 285 166 21 --2588 529 2212 201
NM_004113chr391996 1894 1641 1626 1538 1426 1398 746 568 --11912 1274
NM_004124chr14173590 3339 3325 3208 3023 2953 2888 2863 2759 2707 2588 1321 1123 979 781 755 26 22919 2383 12491 11115
NM_004133chr852674 2590 2297 1798 36 22424 1686 32497 556 61 1961
NM_004136chr15113223 3210 2704 2328 1155 827 685 474 406 250 203 12429 11296 12598
NM_004171chr11269676 9628 9207 9176 8267 8136 7343 7059 6936 6774 5974 3613 3007 2696 2645 2543 2261 2021 1551 1435 936 761 737 694 578 315 39122 6970 1048 46045 3514 814 486 17588
NM_004232chr1893633 3466 3175 3100 2963 2796 1472 894 727 --33203 2890 2782 1832
NM_004241chr104684 555 520 513 ----1661
NM_004261chr15982 868 850 730 161 --2205 123 153
NM_004277chr621439 52 11451 11521 11578
NM_004293chr9143799 3761 3570 3536 3350 2944 2904 2732 2393 1308 1186 1174 361 328 31444 737 640 42546 2521 1049 217 11001
NM_004338chr18186708 6313 5742 5427 5007 4876 4800 4681 4662 4510 4341 2126 1577 1106 1030 718 681 483 25210 955 31596 1562 605 26191 5204
NM_004384chr592330 2297 2139 2082 1939 867 662 333 278 --32072 746 456 1122
NM_004392chr1382315 2226 1783 892 712 659 222 143 --1958 32359 2211 232
NM_004397chr1184286 4078 3107 2848 1573 1378 257 180 42895 2817 1496 487 1566 --
NM_004412chr10225885 5841 5691 5469 5190 5092 4585 4405 4388 4235 3646 2239 2223 2124 1930 1704 1255 562 538 326 260 247 --45486 4718 1868 457 --
NM_004432chr962352 2287 1516 474 204 141 --61708 1597 714 346 188 84 --
NM_004434chr1441856 1484 1394 625 --21471 387 11195
NM_004458chrX102455 2107 2056 1873 1842 963 872 572 418 274 --42520 2004 649 299 1401
NM_004464chr4114110 3316 2857 2705 1413 804 778 646 526 376 156 --21115 396 12794
NM_004504chr2113085 2781 2270 2031 1212 819 795 682 628 546 360 1244 52693 2122 1983 1234 933 1620
NM_004505chr17111937 1919 1528 1457 1434 1304 1238 780 304 294 97 --1769 21246 345
NM_004525chr261541 1353 1306 1050 246 103 1493 11453 1960
NM_004580chr1561473 1440 554 510 488 475 --2217 181 21591 1385
NM_004586chrX155406 4783 4573 4535 4184 3827 2118 2100 2084 2035 1144 1061 1035 658 236 12077 55111 4503 1916 353 335 15290
NM_004600chr17989 978 597 451 406 374 58 --31548 1210 1037 11340
NM_004612chr9154242 4110 3963 3918 3658 3642 3472 3194 1785 1145 1000 950 907 840 230 34488 3750 1156 24124 1496 13844
NM_004660chrY52027 1725 1513 707 475 11843 11748 1882
NM_004673chr151277 259 157 67 61 --31415 381 266 --
NM_004685chr13102963 2932 2841 2345 2146 1950 1119 989 770 420 12199 32561 2316 474 12855
NM_004686chr8101755 1542 1469 1462 1304 1296 1255 1247 300 201 ------
NM_004717chr73544 508 496 --31564 1544 1436 21532 424
NM_004719chr12172890 2871 2814 2448 2390 2176 2081 1993 1797 1105 464 401 394 361 289 157 36 22016 475 21861 1788 --
NM_004725chr1051195 1150 1046 472 309 1112 --1100
NM_004726chrX145780 5740 5556 5500 5447 3998 3952 3785 3746 3521 1196 1019 877 123 24985 633 12319 14103
NM_004736chr172014 1886 1548 1479 1464 595 270 --2364 221 12176
NM_004745chr8186396 6390 6378 6370 5652 4778 4731 2799 2341 2170 2051 1848 1581 1145 1081 1051 1032 791 --46949 6438 5539 1919 --
NM_004748chr15154231 4032 4013 3823 3505 3377 3204 3074 2981 2973 2567 642 594 399 219 --13123 13400
NM_004760chr7112516 2341 2332 2301 2071 1933 1719 518 406 295 45 3635 107 53 21786 531 --
NM_004775chr1862248 2216 2165 1798 1707 860 11503 61932 1896 1637 1598 956 812 --
NM_004788chr1182405 2333 2079 1975 1005 991 839 399 22456 813 --1794
NM_004796chr1472444 2019 1915 1829 1648 1501 928 --21934 1790 12084
NM_004815chr1134487 3750 3599 3315 3113 3070 1938 1892 1808 1504 1209 899 561 23625 2997 24792 3205 14843
NM_004827chr481902 1466 1438 576 454 440 418 62 --11877 --
NM_004857chr14114813 4653 4031 3812 3408 3159 3068 2927 1799 1442 570 34741 4016 1120 23103 1303 11388
NM_004859chr1762656 2165 1161 546 348 282 --1844 22454 1974
NM_004866chr5114771 4739 3850 3799 3782 3555 3398 1916 1176 1117 187 14646 53235 3103 1693 231 71 1214
NM_004896chr1071402 1212 1134 634 500 279 171 --31509 1472 423 --
NM_004898chr482384 2253 2204 1833 1768 1759 559 269 12185 2983 871 22106 283
NM_004904chr7196568 6200 6181 6088 5705 5652 5378 4989 4825 4221 4078 4064 3975 2505 2366 2080 2007 200 148 36576 2638 1757 26188 5391 1522
NM_004936chr9122968 2647 2560 2372 2319 2178 1972 1887 1869 1037 1011 437 --21182 1173 22212 1945
NM_004956chr7124595 4347 4122 4107 3831 3764 3456 1657 1452 1378 1131 835 --63527 1529 986 868 773 408 24362 1090
NM_004969chr101190 1507 1217 2148 132
NM_004985chr12134490 4446 4081 3454 3351 2983 2952 2944 2926 1775 1446 843 817 ----31498 1234 592
NM_004999chr6134287 4179 3504 3267 3201 3042 2859 1482 1328 1113 1057 690 637 --32926 1406 830 11093
NM_005010chr7122213 2178 2121 2001 1928 1558 1527 1412 1387 846 461 23 --11677 --
NM_005036chr22108260 6663 5990 5943 5846 2955 2907 1588 1257 473 16464 97652 7191 7177 5552 5449 5356 5272 493 93 17095
NM_005056chr12165641 5430 5375 5192 5147 5121 4491 4401 4197 2186 2088 1476 1468 1232 1150 469 34552 3899 907 23795 1405 --
NM_005065chr14184924 4828 4575 4440 4281 4259 4225 3900 3825 3546 3504 3492 3417 986 789 702 502 289 24344 358 13466 24472 995
NM_005104chr62771 613 ----2678 587
NM_005121chr17103294 3124 2697 2521 2355 933 691 557 464 409 23096 323 32989 2878 133 22556 1076
NM_005156chr9105363 5338 4815 4257 4148 3999 3896 3661 1746 128 14125 55008 4503 3257 1102 900 35394 5229 3329
NM_005164chr12112651 2543 2271 1819 1717 726 715 573 332 143 74 --1660 12137
NM_005171chr1251165 1090 483 474 143 --1129 21127 851
NM_005188chr11128078 7182 5867 5837 5829 5683 3300 3272 3036 2178 1254 308 46603 2008 1197 128 48338 8159 5199 2097 --
NM_005197chr1485677 5664 5321 4834 4467 2229 1386 774 55940 2394 1175 359 83 11635 --
NM_005233chr372468 2178 1946 1796 594 391 125 --22617 612 32519 2448 230
NM_005235chr2257886 7849 7260 7203 6628 6591 6585 6322 6230 6222 5712 5434 5225 2799 2785 2590 2410 2349 2267 1730 1512 1076 833 799 274 33116 2238 2021 87074 5950 5115 2157 1856 1803 1786 766 36403 4901 3083
NM_005256chr115983 807 762 178 135 1279 2939 600 1119
NM_005261chr821004 392 --31049 969 747 1789
NM_005295chr73316 101 81 1233 2251 93 --
NM_005339chr4153975 3631 3497 3343 2847 2778 2709 1563 1466 1361 739 683 646 520 351 13434 22971 2728 13961
NM_005359chr18126545 6203 4852 4629 2514 2433 2097 948 893 736 126 79 14527 32459 2445 556 --
NM_005385chr382747 2680 2636 2217 1791 956 174 62 31735 287 93 3419 190 39 --
NM_005388chr981621 1580 1478 1386 1362 1209 1100 276 --21090 1069 11405
NM_005399chr1114446 4411 4300 4231 3159 3110 1387 1294 765 259 209 13843 --11277
NM_005400chr263041 2910 2731 1191 770 706 --11099 22035 2028
NM_005406chr1851597 1175 1144 991 254 1518 31054 602 417 1104
NM_005433chr18172767 2634 2625 2613 2487 2055 1003 981 937 811 641 622 593 565 166 132 41 21711 419 ----
NM_005436chr10104153 4073 3807 3196 1487 1479 1101 763 357 147 --33224 994 912 --
NM_005461chr2011560 --11777 21923 643
NM_005497chr17126095 5958 5814 5589 4602 4574 4173 4139 3745 2128 1483 1477 15991 --1719
NM_005502chr9113238 3124 2739 2603 2152 2106 2046 2034 1029 781 683 1593 32937 2830 1287 --
NM_005504chr12176399 6120 5972 5781 5587 5470 5449 5171 5005 4671 4589 4048 2626 1871 1369 1306 962 46147 5272 1342 124 56409 6247 4562 1898 537 --
NM_005509chr591881 1524 1480 1453 1378 1348 1327 1178 56 --31808 1758 1148 --
NM_005539chr1011169 1954 31102 932 219 11028
NM_005578chr3154942 4623 4258 4207 4091 4015 3625 3553 1988 1574 1565 1465 1260 922 707 22036 791 44383 3919 1617 902 --
NM_005584chr136736 691 680 669 137 82 --1638 1553
NM_005596chr9205725 5652 5547 5491 5273 4685 4328 4101 3896 2455 1810 1749 1642 1474 1468 1298 843 608 435 52 --45252 2402 2390 1617 --
NM_005639chr1261694 443 437 404 160 54 11915 --21860 467
NM_005655chr861298 1155 992 841 388 248 --1461 11171
NM_005665chr1114911 4512 4489 4415 3681 1748 1591 1503 1354 1343 378 1268 23279 3036 --
NM_005668chr5144421 3976 3951 3526 3233 3213 2873 1813 1535 1412 1366 1281 1201 303 21597 1052 33298 1240 187 11346
NM_005715chr642823 2011 1818 300 --12030 2869 351
NM_005722chr252417 2155 2016 1901 536 11631 12428 22439 952
NM_005725chr1102273 2216 2169 2072 1771 1743 1540 890 604 234 --52442 2398 2249 792 762 150
NM_005746chr7142641 2512 2498 2426 2288 1964 1799 1771 980 854 842 664 615 394 12687 ----
NM_005748chr12112852 2830 2793 2729 2505 2147 1096 1078 919 375 229 12286 22200 1135 11342
NM_005749chr177677 614 561 533 239 215 203 --1464 1628
NM_005759chr2134816 4411 4193 4035 3983 3436 3266 3237 1923 1654 1215 1187 649 12936 ----
NM_005795chr2162999 2802 2791 2723 2654 2511 2406 2372 2224 2177 1936 1209 1169 1029 999 802 32248 109 90 22624 1095 12872
NM_005798chr13235259 5199 5076 4966 4669 4473 4180 4063 3742 3697 3398 2064 2023 1934 1583 1184 972 845 732 308 292 238 109 --35040 3592 3457 13917
NM_005807chr17643 636 572 279 204 118 84 ----1714
NM_005813chr2112453 2429 2398 1989 981 806 657 340 334 113 103 --32512 1639 1023 --
NM_005832chr361464 1399 970 926 898 373 41308 1243 1237 1025 1415 --
NM_005840chrX167594 7257 7240 6436 6110 5827 5777 4865 3041 2956 2603 2465 2194 2063 1286 188 --25021 4796 --
NM_005843chr231740 1580 696 --2496 392 3469 434 76
NM_005857chr131510 1315 940 ----21094 1016
NM_005859chr561364 510 487 421 319 73 ----11550
NM_005863chr1081360 1256 1170 336 327 207 164 50 --21014 264 --
NM_005868chr752328 2206 1694 971 298 32411 1941 1830 42448 1915 913 903 1897
NM_005901chr18198359 8352 6980 6825 6809 6581 6427 5980 5934 5826 5645 5306 3194 3004 1393 1230 1208 1153 1069 2333 173 48511 7253 2394 1751 16098
NM_005903chr5165151 5005 4895 4837 4270 4027 3893 3887 3719 3203 1943 1911 1614 708 226 99 24800 3831 43932 3728 3376 1733 13184
NM_005906chr691723 1657 1589 586 329 260 253 229 110 11287 282 72 --
NM_005935chr465252 5126 4114 3811 3435 595 --21095 493 14618
NM_005941chr8113733 3635 3479 3006 2602 1638 1446 1188 911 808 202 11151 43695 3496 1140 672 23106 2584
NM_005955chr195463 5392 4926 4498 4408 4188 4145 1659 1219 15526 15478 --
NM_005966chr281989 1667 1520 702 569 429 278 219 11823 21533 555 11481
NM_005989chr751626 1384 1067 1038 243 11570 11601 1187
NM_006007chr9144512 4395 4346 4313 3995 3592 2763 2755 1632 1560 1272 724 275 198 --23585 2814 --
NM_006016chr6122214 2089 1759 1739 1487 908 794 692 642 310 284 194 --1204 1781
NM_006037chr2104818 3638 3628 3622 3614 1632 1515 1236 1133 1105 --11211 1374
NM_006047chr2073296 3064 2975 2816 2716 2486 640 2911 693 12186 1342
NM_006055chr2103196 2927 2425 849 793 495 417 375 341 314 --2959 187 1558
NM_006080chr7122957 2893 2667 2598 2540 2342 1986 1125 670 656 517 416 12586 22126 2046 2532 312
NM_006089chrX71728 1651 1221 714 494 310 67 --21683 113 31915 479 401
NM_006095chr4124083 3639 3177 2781 2740 1592 1272 971 666 641 583 525 24421 3251 13101 --
NM_006139chr252742 2652 2183 2072 774 32767 667 55 11898 1155
NM_006154chr15102865 2160 1863 940 908 860 732 645 344 89 11012 22274 393 22798 2346
NM_006166chr1282642 2512 1990 1889 1838 742 574 400 12580 3880 607 224 1909
NM_006197chr882271 2019 1551 638 585 417 278 93 --3693 555 315 --
NM_006203chr5155596 5586 5542 4859 3782 3485 3418 1343 1119 1061 1000 609 416 363 159 11494 35339 4001 1777 --
NM_006212chr1155388 5343 5016 4987 4859 4632 4552 4116 1456 1448 1375 1191 1004 712 358 --23969 824 --
NM_006226chr2121434 1349 1299 1238 1217 1166 1026 964 898 532 127 77 3980 186 140 ----
NM_006241chr372145 1742 1632 656 358 319 282 22246 227 2760 443 --
NM_006251chr593363 3333 3293 2801 2778 2633 2174 960 449 --42479 2471 934 376 2840 305
NM_006252chr1267144 7061 7009 6882 6827 6809 6747 6606 6356 5845 5369 5297 4746 4715 2624 2568 2066 1919 1849 1332 1182 710 485 474 229 82 21677 247 66939 6864 6723 1579 773 160 26837 870
NM_006256chr1112668 2409 2373 2260 2164 2113 1954 765 579 434 200 1496 ----
NM_006282chr2084504 4478 4195 4109 1435 982 368 362 33734 1090 1041 --13673
NM_006287chr282687 2455 2057 1977 991 801 332 52 12131 32175 829 39 --
NM_006298chr673004 2871 2303 2133 1140 555 520 33438 2609 1259 1207 12100
NM_006315chr484255 4036 3925 3914 2913 1272 462 117 13977 23661 439 11773
NM_006379chr7122281 2145 2015 1799 1695 1571 1499 870 778 666 557 216 11565 --11427
NM_006380chr1794411 4341 3987 3857 1609 1054 1010 979 159 --34221 3875 949 14060
NM_006393chr10164576 4408 3957 3592 3537 3448 3438 3416 3369 3130 2862 2849 1609 1063 329 285 54194 1293 732 683 456 13014 --
NM_006420chr20143317 3231 2997 2914 2748 2682 2371 773 673 602 587 568 436 393 --23450 3217 13428
NM_006457chr4104090 4009 3962 3954 3727 3519 2949 995 889 83 --43298 3216 2831 160 13688
NM_006496chr131881 535 145 11942 21490 485 11481
NM_006504chr106606 301 217 206 163 89 1235 2244 21 --
NM_006520chrX121713 1612 1404 1384 1197 1159 1146 478 404 375 297 245 41486 1394 158 142 --11724
NM_006534chr20143253 3241 2930 2755 2742 2146 1329 1005 988 974 749 399 239 183 --11068 12895
NM_006538chr273328 3252 2907 2889 2591 931 833 --42860 2797 2691 665 --
NM_006544chr14215001 4962 4861 4833 4702 4681 4585 4314 4153 4037 3902 3780 2350 2229 1920 1855 1508 1293 322 297 50 21386 820 45647 5518 4166 3983 44081 3854 1155 600
NM_006546chr1776420 2299 2260 2207 2049 1791 574 --12218 15668
NM_006561chr10146239 6001 4594 4499 4086 3767 1973 1918 1828 1192 1079 1042 591 370 35956 3931 2178 1634 --
NM_006572chr17103213 2792 2743 2671 2571 2204 1283 1187 381 28 1869 1402 53454 2829 2639 2157 340
NM_006575chr1481485 1341 1165 1088 914 462 151 39 11080 21306 1047 --
NM_006599chr16248219 8136 7935 7312 7253 7094 6972 6625 6387 6244 5987 5937 5790 5003 3148 2995 2976 2665 2554 2518 2397 2029 769 96 26222 6216 27604 2186 28210 1146
NM_006603chrX81785 1627 1433 738 603 593 338 112 --41610 644 531 233 11329
NM_006609chr292947 2866 2097 807 586 501 437 168 125 ----22605 1818
NM_006614chr3203565 3350 3329 3275 3214 3174 3103 2938 2522 1151 1077 994 930 913 814 614 502 469 457 168 12580 23647 1140 11130
NM_006624chr1062152 1782 1525 1422 1383 708 --21748 573 11446
NM_006628chr15164227 4165 4153 4100 3783 3176 3102 2990 1615 1434 1078 949 677 625 563 148 14470 24279 756 --
NM_006654chr12164587 4213 4067 3921 3820 3793 3755 3696 3438 3230 3070 1611 1573 911 290 123 24599 1799 34651 1553 687 11343
NM_006682chr7132666 2473 2414 2405 1897 1844 1803 1750 892 859 820 230 71 32764 907 371 42892 2523 2184 1852 12886
NM_006716chr741230 1068 116 64 1308 2459 136 1124
NM_006717chr973319 2809 2700 1175 1029 706 43 2576 266 33116 2060 100 22847 2477
NM_006718chr63892 817 766 --1239 2801 62
NM_006722chr3132833 2322 1108 983 808 772 746 664 552 468 369 234 211 --2790 299 --
NM_006729chrX125672 5540 5074 2258 1928 1677 1467 1314 1112 458 347 215 1488 3876 758 29 --
NM_006731chr9155463 4976 4685 4633 4268 4220 3814 1527 1371 1204 960 866 729 483 109 35787 4540 526 25510 3837 1942
NM_006746chrX71382 1336 1269 983 966 270 121 11327 1110 11569
NM_006750chr16238047 7977 7796 7748 7295 7286 6763 6730 6512 6368 6325 5541 5046 2871 2845 2781 2637 2542 1887 1455 854 247 189 25108 1402 37323 7174 45 21414 1284
NM_006756chr851053 499 457 294 271 1563 21362 23 1415
NM_006766chr852233 2194 410 361 33 22373 561 2748 101 --
NM_006775chr6123071 2566 2410 2394 1128 984 966 795 741 602 511 296 1486 1697 --
NM_006777chrX82609 2535 2142 1868 1826 982 889 415 11126 32493 839 203 1478
NM_006827chr1493364 3130 2952 2802 2620 2382 986 510 488 1680 1623 22930 603
NM_006851chr1282874 2861 2064 1126 1055 1037 779 112 --32900 517 371 --
NM_006857chr22717 558 --1788 2212 187
NM_006873chr2173464 3402 3200 3125 3085 2910 2242 2187 1384 1275 853 784 626 505 464 214 41 11392 43161 2672 2447 520 --
NM_006885chr1694271 4234 4206 2607 838 630 491 485 309 22708 215 24223 1390 --
NM_006914chr981239 480 366 309 226 218 162 110 1499 --188
NM_006918chr11195838 5742 5245 4983 4839 4776 4400 4083 2305 2008 1890 1791 1408 1343 1156 1046 1030 769 83 31539 1394 682 35262 1364 675 55376 4276 3710 1440 46
NM_006922chr2122581 2384 2072 1778 995 956 812 801 694 668 605 58 ------
NM_006924chr17104472 4015 3788 3639 3426 3064 1362 1004 928 134 1845 24069 261 --
NM_006947chr491817 1725 1647 1457 1173 664 587 173 57 --41803 1673 541 448 21150 463
NM_006948chr21122297 2256 2083 1878 1649 1642 1617 1532 918 654 561 512 1794 21723 1662 32401 2274 96
NM_006981chr992598 2246 2218 2007 1921 1872 1057 713 450 ----22304 2294
NM_006999chr541814 1762 1311 514 11471 41733 1724 1579 481 11995
NM_007006chr16103464 3322 2783 2366 2324 2317 1227 1076 187 75 13180 33569 890 818 11029
NM_007007chr12164686 4456 4036 4009 3870 3710 3624 3313 3244 1846 1815 1020 671 500 371 356 14500 63720 3635 3491 1910 1650 1634 11862
NM_007038chr21156118 6032 6013 5777 5605 5420 4941 4546 2163 2093 1589 1459 1254 932 327 34508 4021 1198 65877 5638 1440 1275 636 442 --
NM_007039chr1462325 2260 1904 1795 746 460 12248 21972 408 11603
NM_007050chr2088043 7738 6788 2445 2124 1806 1655 1021 47962 7947 6686 2398 15959 16439
NM_007054chr5123688 3599 3261 3132 3061 2967 2953 2638 730 623 570 533 11597 32592 1558 930 1995
NM_007073chr663087 3049 2649 941 270 244 --44223 3746 3140 3119 --
NM_007106chr1372692 2443 1921 1869 1756 624 524 22243 854 11893 1816
NM_007114chr3203258 3064 3049 2918 2909 2886 2705 2618 2554 2050 1078 932 796 661 471 333 290 185 158 48 --32256 2080 1128 --
NM_007125chrY51357 1200 1025 429 315 21440 208 21167 1057 1530
NM_007137chrX175302 4619 4505 1567 1459 1205 1196 707 669 645 579 563 550 536 286 243 217 1495 --11470
NM_007146chr17132924 2298 2275 1904 1892 1833 1143 1114 879 694 536 515 23 --2666 40 --
NM_007159chr361688 1248 620 454 178 157 21304 268 21614 1354 11260
NM_007172chr22113333 2823 2626 2375 2131 2114 2105 1109 1032 765 161 --22502 1041 12355
NM_007195chr18143526 2427 2401 2317 1108 1037 1002 863 445 383 376 267 173 95 23647 250 23035 1013 --
NM_007212chr1102025 1906 1672 894 859 756 743 550 462 225 157 21511 1402 1394
NM_007220chrX103152 3119 3009 1980 818 786 714 567 388 101 --74952 4038 2987 1861 1729 1536 1214 --
NM_007222chr871787 1671 1320 1300 1280 1165 568 ----21644 1263
NM_007231chrX92176 849 837 814 552 490 412 159 95 --12008 1366
NM_007236chr1562318 2230 1805 667 217 136 ----22261 247
NM_007249chr13149087 8879 7997 7909 7855 6786 6249 5978 5803 5765 2865 2815 2030 1721 49039 7353 7055 1808 36889 6744 1828 28574 588
NM_007345chr1882177 1808 1537 1501 942 629 600 368 21687 1566 21833 1798 22058 1910
NM_007347chr1583033 2989 2868 2695 2155 954 928 469 --42999 1111 796 292 --
NM_007351chr461136 846 389 186 179 168 21097 304 ----
NM_012072chr20114361 4351 3896 2860 1712 1570 1501 804 688 554 333 --23656 1324 14313
NM_012081chr5113762 3620 2948 1421 1309 1163 1093 1076 1042 473 329 23509 2709 12627 13683
NM_012095chr1063492 2975 1387 1150 968 427 12767 12348 22761 393
NM_012096chr382722 2467 2395 1335 1103 959 756 21 1486 1474 187
NM_012097chr2122260 1710 1614 1564 1390 567 538 441 420 411 393 85 31971 1641 1508 --22242 1862
NM_012120chr6172712 2614 2570 2150 1981 1187 1158 1101 858 765 736 686 374 341 269 129 108 12330 1912 --
NM_012129chr7102372 2094 2068 2033 1655 443 413 239 181 167 --1751 1622
NM_012141chr1393283 3265 2924 2661 1348 1330 1171 479 465 11542 2942 241 1202
NM_012156chr2063441 993 692 177 171 161 ----1970
NM_012164chr9157334 7024 6994 6746 5363 4864 4850 4836 2035 1994 1591 1025 1016 942 876 12851 17346 11986
NM_012177chr65585 537 432 115 50 --4557 486 230 170 1410
NM_012214chr2136257 6195 5716 5161 4973 3948 1061 1044 982 728 437 425 417 11198 36221 5891 678 11560
NM_012234chr3113593 3495 3380 3179 3011 2794 921 859 710 644 488 --13728 --
NM_012243chr15900 844 656 365 198 2797 228 1288 3601 324 97
NM_012249chr293582 3486 3305 3263 2785 2240 1013 671 547 --42707 2680 584 380 --
NM_012252chr7255402 5360 5351 4994 4919 4869 4569 4270 4034 3879 3810 3590 2087 1898 1883 1788 1357 1337 911 738 723 586 563 512 361 23842 1828 74733 3771 3436 3404 1607 1020 919 --
NM_012262chr1115209 4736 4651 4510 3405 1573 1400 701 672 522 251 1747 41767 1529 965 809 11959
NM_012281chr782405 2308 2243 1976 915 901 352 210 22101 1580 21534 85 11924
NM_012287chr3154521 4497 4047 3996 3487 3207 3100 1644 1211 1004 801 736 423 107 24 33312 2815 825 33820 3190 1202 11143
NM_012297chr492579 2429 2203 1708 1025 1008 989 643 473 --12375 --
NM_012343chr541138 444 328 248 --3877 386 210 2897 70
NM_012345chr1371797 1650 1602 1472 1275 490 440 148 31660 555 497 1572
NM_012347chr6122517 2334 2096 2082 1183 546 529 386 378 193 77 45 --22939 2599 --
NM_012382chr5264472 4135 4100 4037 3824 3624 3428 3223 3142 3134 3034 3026 2959 1523 1449 750 678 668 551 468 416 401 299 260 172 110 --13698 --
NM_012388chr1593104 3046 3038 2565 2554 2542 2417 945 335 ----13029
NM_012420chr10102279 2216 1718 817 793 641 612 327 236 106 --1505 --
NM_012425chr1061911 1831 1787 1775 915 436 --11840 32758 352 297
NM_012463chr12101323 1228 1216 1170 1158 487 397 227 191 140 --1165 --
NM_012464chr492582 2546 2040 1940 1885 1807 1167 88 76 --12605 12754
NM_013231chr1483830 3501 3347 3287 3095 1114 846 97 23367 1089 21702 1256 12986
NM_013238chr1371798 1639 1500 495 483 321 152 --51907 1301 726 446 70 --
NM_013250chr1191373 1031 1003 598 445 325 272 249 88 31509 237 131 --1158
NM_013255chr7258889 8766 8050 7769 7707 7637 7375 7188 6495 5778 5577 5478 5423 2069 2009 1780 1527 1379 1122 842 723 694 556 389 240 11788 78504 8334 7682 7057 6086 3043 2660 16773
NM_013257chr8102342 2190 2143 2095 1646 1587 515 137 84 74 --22205 491 --
NM_013261chr4133746 3048 3000 2620 1217 1209 1079 907 738 495 470 358 224 --32898 1405 899 12852
NM_013269chr12174533 3866 3804 3692 3530 3143 3072 3066 3039 2818 1640 1569 1479 1422 1236 921 109 2188 120 32969 753 389 1164
NM_013309chr1582551 2511 2378 2205 938 884 540 332 22242 722 32577 2472 2141 --
NM_013322chr731163 583 458 21688 655 31441 1139 531 11720
NM_013357chr85876 581 567 270 251 1574 ----
NM_013381chr12112398 2369 1943 1902 1547 1477 744 416 343 289 77 --11766 11919
NM_013386chr191814 1788 1639 1423 500 470 407 283 178 11543 31648 1458 1225 --
NM_013396chr2171571 1447 1114 1026 965 577 386 --11562 11329
NM_013447chr1973818 3779 3610 3291 3085 642 269 13172 2768 497 13572
NM_013943chr183318 3135 2959 2942 2653 2188 458 163 1543 32123 501 430 11002
NM_013989chr14124989 4955 4467 3954 3767 3481 3176 3155 1655 1588 1527 1202 13332 44699 4384 1541 936 21917 448
NM_013995chrX62587 2551 2337 2243 2057 525 --31923 1796 1605 11663
NM_014005chr5132598 2557 2162 1233 1076 1065 630 527 487 450 366 275 71 21245 885 21192 815 --
NM_014011chr292372 2315 1925 1810 1676 1596 986 340 125 12440 --12480
NM_014016chr381489 1438 1231 1209 1066 668 495 234 31631 1564 1253 11278 31728 1522 1142
NM_014021chr1143317 2945 2921 2871 2465 1189 1157 1023 945 887 870 557 349 330 1776 32372 897 669 12425
NM_014023chr1082938 2698 2503 2089 722 329 170 158 1795 12800 1712
NM_014028chr6123243 3022 2745 2682 2647 2470 2419 1275 870 854 809 409 --23141 335 13300
NM_014048chr16165281 5273 4774 4661 4584 4403 4209 3848 3827 3740 1940 1476 1404 1343 873 107 --23607 984 24419 2070
NM_014089chr1392204 2107 2011 1970 1843 811 457 445 234 --11423 --
NM_014106chr15112934 2674 2510 2477 2261 2110 1913 1026 359 272 239 --12785 12384
NM_014109chr831144 798 130 --1197 2806 173
NM_014112chr8185248 4938 4836 4532 4514 4505 4489 3985 3962 3443 1634 1577 1403 1160 1115 1022 768 69 34853 4207 3641 65265 4218 3662 2167 1782 1679 65127 5031 3767 1500 936 296
NM_014141chr7115307 5294 5042 4887 4429 3756 938 736 188 148 138 11931 15174 34800 1941 106
NM_014155chr11227348 7095 7057 6954 6830 6697 6558 6270 6263 5165 5137 4914 2846 2730 2051 1881 1792 1374 1143 959 740 712 57233 7068 6531 4625 1773 27566 1894 --
NM_014243chr462166 2155 1734 1715 737 243 21672 1362 21349 448 1747
NM_014253chrX82187 1728 919 865 411 309 161 104 12226 32327 2310 495 12220
NM_014313chr1101364 1181 1090 1033 1013 413 401 380 313 206 --21592 439 11435
NM_014331chr4157412 7396 7316 7208 6636 6510 6401 6297 5684 5422 4964 3075 2838 2644 203 16274 77819 6919 3037 3024 2154 1144 1073 12436
NM_014372chr172000 1870 1855 1804 1607 1485 231 1756 --1836
NM_014423chr5115392 4138 3743 3569 1977 1374 661 623 449 386 181 35114 4513 3661 45528 5231 4457 2166 25644 4701
NM_014426chr203654 558 83 --3583 565 124 1173
NM_014574chr1431345 1121 567 1158 21172 544 11513
NM_014575chr34557 223 130 116 1190 1209 195
NM_014584chr145648 529 516 354 243 --11672 21589 1541
NM_014615chr1633612 74 66 13577 11003 32872 1186 44
NM_014616chr393446 3346 3009 2660 2421 971 811 741 322 --23356 963 --
NM_014637chr841229 1139 1131 1114 1956 1509 11249
NM_014660chr7111143 1032 1023 861 790 770 748 387 360 187 74 1700 1294 --
NM_014666chr581346 1211 1110 1038 930 924 486 330 --2861 158 11243
NM_014674chr393976 3964 3950 3909 3795 3696 3377 850 648 --13201 23630 607
NM_014682chr892285 2096 1482 932 770 720 703 294 279 --11958 --
NM_014701chr15193420 3394 3362 3075 2977 2919 2912 2761 2722 2615 2374 2341 2300 1258 1166 925 908 523 174 --1124 12333
NM_014702chr6152762 2754 2470 1381 1332 1240 1233 1168 1072 767 724 714 440 353 248 1789 43200 2531 2344 334 42877 2592 673 509
NM_014705chr781638 1582 1447 1439 822 743 197 57 1157 11664 22139 142
NM_014707chr7142242 1992 1822 1601 1521 1503 1485 882 765 718 587 507 224 105 42030 1980 817 807 42170 1869 1588 1447 2621 159
NM_014711chr1661480 1467 1293 603 471 315 11329 --21691 285
NM_014720chr10101808 1787 1766 1652 1462 1425 1211 498 474 342 --11469 --
NM_014721chr6227075 6883 6775 6521 6472 6459 6273 5994 5834 5775 5114 4504 2808 2507 2128 2098 2012 1677 1605 1004 462 355 37013 4815 2927 47324 6874 769 419 25139 4967
NM_014729chr872285 2070 2044 1803 1766 608 450 --1592 1761
NM_014733chr591946 1765 1601 1503 769 699 168 96 90 11454 3380 300 176 --
NM_014735chrX102032 2004 1939 1927 1719 1521 1320 550 305 154 --32119 1561 265 11911
NM_014739chr6134021 3964 3589 3495 3448 3194 1632 1601 1182 761 637 489 293 12591 1151 11041
NM_014746chr264333 4110 1486 1046 725 562 11523 11374 14205
NM_014765chr182489 2324 2085 628 568 503 355 90 12707 141 1240
NM_014781chr861234 1009 898 441 363 334 1403 41223 1193 965 842 --
NM_014787chr1112823 2643 2379 2205 2190 1818 1072 926 573 556 428 --32253 2222 530 --
NM_014802chr1281122 1038 944 932 915 861 825 418 ----21013 750
NM_014803chr10122793 2771 2583 2426 2368 2361 2309 1861 1810 1794 684 501 --12818 --
NM_014810chr193668 3332 3319 2682 1474 1038 958 485 386 --33301 2662 2580 --
NM_014819chr5102501 2429 2176 942 831 435 370 229 173 88 22184 137 11809 12110
NM_014826chr194152 4137 4091 2950 2827 976 644 550 313 44363 4353 4052 466 24292 1535 24317 1284
NM_014828chr1452240 1857 1808 1538 428 ----21576 338
NM_014829chr562365 1932 1602 750 268 125 --41946 813 294 257 21782 243
NM_014836chr1061909 1868 1322 704 671 620 1681 2687 347 --
NM_014839chr192490 2442 2405 2353 1812 970 917 765 299 21638 274 22049 697 1825
NM_014873chr1114395 4338 4291 3852 3629 3190 3150 746 550 131 88 23245 1961 ----
NM_014877chr17207781 7757 7174 6742 6202 4841 2992 2935 2871 2619 2309 2112 1090 1072 1001 884 671 441 338 168 55239 4897 1900 392 110 36378 1213 1028 12232
NM_014888chr771559 1282 1150 1067 627 619 316 1137 31336 1169 82 1350
NM_014893chrY72000 1498 834 614 368 219 210 11459 12238 12011
NM_014897chr17103198 3142 2985 2908 2870 2201 2143 1307 706 623 13163 22925 1290 --
NM_014898chr1982362 2354 2237 2147 1730 676 335 141 11687 22317 697 --
NM_014900chr261134 934 393 339 216 77 --1429 1118
NM_014904chr10133968 3586 3428 3278 3067 2922 2561 1389 980 604 509 477 200 --42806 1326 398 302 2946 150
NM_014906chr1792825 2728 2612 2592 1353 1203 1058 183 129 23184 3178 43637 2601 672 448 12583
NM_014912chr1083533 3416 3091 2748 2255 2209 1405 913 43313 3305 2369 746 ----
NM_014915chr1081440 1434 1369 1290 1256 904 227 196 1964 --281 58
NM_014918chr1591568 1436 1166 1049 471 362 328 266 234 ----11340
NM_014920chr683750 3447 3066 2720 459 377 355 148 1387 1176 23523 892
NM_014923chr1372259 1843 1827 892 604 583 425 --22156 666 21921 196
NM_014934chr13103978 3801 3713 3439 3250 2463 1545 1353 806 665 149 43487 2957 853 382 --
NM_014936chr692845 2696 2413 2185 2090 1943 1156 563 349 --21924 581 12148
NM_014942chr642316 2084 1031 888 11824 42607 1952 953 562 12010
NM_014946chr2112841 2312 2084 2016 1180 1151 890 687 335 184 171 12821 22773 1248 11207
NM_014950chr1471626 1244 548 457 403 367 226 31504 1092 78 --21399 449
NM_014951chr1052592 2176 2132 1666 72 12073 32316 1064 452 22634 353
NM_014953chr13154352 4196 3458 2805 2758 1706 1695 1683 1635 1105 918 907 830 347 225 --24361 703 --
NM_014982chr14235380 5221 5144 5078 4499 4301 4281 3898 3765 3536 3455 3413 3394 3347 3326 2156 1950 1524 1280 966 780 765 444 14271 75332 4404 3339 1620 1204 1078 208 13441
NM_014988chr4112831 2750 2482 2426 2177 2053 1869 1850 363 301 230 2830 703 21902 761 --
NM_014991chr4143186 3123 2914 2510 2210 1224 1204 1178 984 933 657 558 433 212 22711 1139 22884 755 --
NM_015000chr1292822 2697 2551 1960 1241 1208 1088 510 201 --12926 1921
NM_015026chr12194191 4066 3668 3521 3443 3239 3218 2932 1681 1595 1514 1110 1103 1067 792 699 558 351 45 --24114 1865 --
NM_015032chr1372712 2520 2193 2059 1928 891 741 12821 32546 968 260 12073
NM_015040chr2103193 2753 2742 2624 2443 2410 2333 1056 868 690 12859 12422 --
NM_015055chr11122923 2788 2588 2519 2258 2203 2099 2072 1838 1055 912 461 --22827 1891 --
NM_015071chr5126423 5786 5453 5264 5014 4374 4253 4245 2192 1787 985 931 36220 4309 1490 16153 35626 5398 2118
NM_015074chr174866 3808 3168 1538 1421 994 241 23753 470 11960 24828 4306
NM_015092chr1664592 4107 3884 3325 1076 830 34383 4033 3896 --33687 3455 1473
NM_015110chr962533 2448 1776 1575 265 57 21641 276 21562 453 --
NM_015115chr4113235 3218 2970 2943 2270 2113 2072 1277 683 600 327 1556 --1534
NM_015137chr8132627 2541 2364 2224 1884 1853 814 727 649 603 437 306 133 ------
NM_015144chr1663879 3857 3541 2658 1446 813 12969 43872 3845 2923 433 13910
NM_015156chr14114058 4011 3861 3853 3824 3762 2821 2707 2651 2632 1536 22592 54 --23235 1006
NM_015200chr492586 2061 1836 1801 1668 815 743 630 188 --31809 502 81 21851 1598
NM_015206chr15163916 3890 3766 3580 3459 3230 3084 1365 983 671 366 283 232 155 128 43 --23046 2939 33217 2912 1131
NM_015208chr18183668 3578 3289 2957 2709 2651 1570 1478 1397 1217 1196 1188 1159 1144 1028 1003 498 371 --63479 3416 2978 2574 1388 991 12513
NM_015215chr1103156 3147 3126 2751 2405 2262 1200 1156 638 393 --52432 2002 1082 1052 379 --
NM_015216chr581492 1429 1386 1259 515 476 156 91 --11563 1597
NM_015230chr461702 1500 713 667 156 41 --31730 1661 552 --
NM_015235chr1072152 1856 1833 1812 1730 444 284 --1323 11778
NM_015247chr16175383 3891 3465 3431 3424 3378 3342 1951 1648 1415 1365 1011 998 766 360 207 174 --34971 1266 654 --
NM_015263chr1571182 1159 1040 1025 1002 338 122 --1935 1951
NM_015271chr4104141 3980 3779 3581 3546 3182 1494 1474 929 510 --23237 2882 2904 596
NM_015278chr683489 3233 3122 2924 2718 2517 1210 918 --22579 2568 1843
NM_015310chr8248400 8379 8258 8248 8077 7603 7421 6984 6946 6389 6064 5996 5800 5326 5193 5138 3199 2164 2032 1795 1357 1096 875 78 22302 1495 25441 1728 28144 5311
NM_015313chr11114674 4555 4315 4275 4191 3575 1499 1217 274 208 47 --23873 3709 13937
NM_015317chr242824 1893 1010 514 12286 2685 663 1506
NM_015323chr671304 1217 1085 424 388 309 156 --31419 1169 1110 11481
NM_015335chr1282510 2394 2211 2166 2154 1810 1073 961 --11686 12614
NM_015336chr1262581 2111 1660 570 389 346 11769 --32687 2669 1883
NM_015355chr1761984 1353 639 280 251 242 ----1272
NM_015358chr2171325 1051 1007 409 141 86 63 --41305 247 154 27 --
NM_015365chrX204325 4268 4223 3730 3511 3368 2973 2883 2857 2769 1593 1581 1529 1379 1346 1197 1144 1001 884 603 44199 1628 1219 268 23889 935 1841
NM_015387chr282111 1894 1798 1373 1294 594 380 21 --21689 412 --
NM_015393chr483135 2722 2689 2633 2537 2499 1025 408 12858 32604 1312 931 11432
NM_015394chr12132475 2461 2373 2328 2312 2253 2114 1745 976 964 736 617 407 12205 22278 723 11706
NM_015429chr351125 922 723 716 707 ------
NM_015431chr1113505 3283 2816 2275 1299 1280 1047 780 323 154 129 3689 407 64 21194 162 --
NM_015446chr191534 1389 1140 584 469 391 303 254 224 --21672 68 --
NM_015455chr5113828 3761 3299 3149 3096 2966 2858 2658 2551 305 279 33560 2682 1100 33774 3448 2722 --
NM_015458chr8175336 5248 5116 5104 4953 4879 4794 4243 3321 1406 1265 1203 1094 1063 958 689 431 13309 11706 --
NM_015507chrX4470 343 162 153 ----2176 124
NM_015520chr362355 2026 905 874 861 695 12473 --12646
NM_015532chr1582611 2564 2349 2187 2065 194 187 84 22468 67 12215 11116
NM_015550chr783221 2858 2283 1241 1070 878 529 178 11383 23372 459 1734
NM_015553chr6145147 5111 4961 4581 4437 4431 3804 3155 1509 1026 897 860 787 770 23916 1409 23948 294 --
NM_015554chr1592737 2316 2167 849 693 572 445 380 189 --11887 1969
NM_015565chr2172287 2201 1819 883 432 284 191 1221 52193 1509 1417 542 241 --
NM_015569chr1164831 4644 4426 4167 3766 3560 3493 3258 3150 3136 3064 3030 1529 1364 772 358 --23283 1439 1745
NM_015571chr6112468 2108 1865 1813 783 565 469 444 406 385 176 1457 62185 749 595 575 394 303 2929 127
NM_015576chr372750 2275 1932 1060 513 459 87 1344 12305 12185
NM_015577chr561587 1377 1298 620 590 513 11233 31762 1267 487 --
NM_015601chr1041022 711 627 237 1183 2957 322 1155
NM_015605chr1061500 1406 1279 1259 1220 349 31288 244 193 11603 --
NM_015626chr1751181 975 255 199 180 1800 11028 1160
NM_015635chr972247 2116 686 515 509 279 269 --31937 675 312 --
NM_015640chr1195346 4915 4416 3932 3893 3697 3654 3593 1980 1710 1466 1444 1154 916 546 316 295 215 188 25099 3404 31844 1482 416 1629
NM_015713chr8113302 3238 2869 2818 2579 2556 2513 862 834 579 84 22934 468 23348 586 22404 1388
NM_015852chr7263615 3539 3374 3309 2934 2741 2707 2612 2580 2446 2241 2218 1395 1230 1149 1065 981 897 813 738 729 645 393 309 225 141 --53632 3243 2763 2420 2303 12281
NM_015878chr8112198 2121 2089 1633 1582 1416 819 491 405 396 256 --11979 11945
NM_015879chr18208554 8134 7965 7650 7154 6813 6502 6074 5673 3148 3086 2135 1811 1779 1669 1597 1005 947 265 89 25782 2072 58452 6032 5941 5346 3102 --
NM_015886chr8285722 5575 5556 5526 5462 5185 4953 4884 4744 4621 4471 4324 4271 4218 4012 3994 3646 3631 2195 2030 1848 1648 806 607 558 318 227 25 44483 4429 2263 1871 45519 5330 1923 179 24286 4114
NM_015888chr1113318 3298 3223 3099 3065 2628 2408 1274 1120 703 309 1117 42663 2075 816 62 22897 2107
NM_015902chr85866 817 596 305 299 2588 33 1912 1959
NM_015906chr1144337 4266 3973 3797 3401 1917 1789 1683 1560 1524 1445 942 925 98 1502 31200 1192 302 --
NM_015912chr8112562 2397 2387 2372 2364 2351 1632 505 484 361 261 --12358 --
NM_015975chrX71533 1356 1293 612 166 107 72 --31573 1472 1463 1644
NM_015986chr1751320 1140 268 259 144 21100 340 11194 1224
NM_016009chr194835 4752 4716 4355 3703 3478 1892 1870 1407 44514 4342 554 357 53832 3651 3145 163 80 --
NM_016018chr872026 1965 1777 655 338 255 101 1964 1752 22532 1805
NM_016021chr652873 897 887 819 145 11077 1905 22453 473
NM_016023chr872076 2056 1739 1721 1697 405 150 --21382 586 21915 1670
NM_016040chr1112407 2253 2196 1936 842 827 796 718 219 207 104 12532 51075 967 932 286 95 --
NM_016061chr251677 1258 1231 1225 355 21219 209 11402 --
NM_016063chr65747 707 595 275 141 ----2269 253
NM_016072chr12132412 2403 2213 1906 1845 1809 1705 756 618 603 572 476 64 12058 4727 411 390 34 --
NM_016081chr481416 905 773 730 580 549 394 340 1781 22269 2227 --
NM_016083chr6173848 3797 3737 3683 3352 2975 2667 1431 1298 1156 1087 1081 607 476 429 417 362 32697 1129 379 32540 704 619 12552
NM_016087chr791621 1590 1421 1346 1174 664 606 355 251 11732 21717 1533 11188
NM_016131chr272187 1899 605 484 235 198 96 22241 929 12386 12168
NM_016132chr15112773 2671 2417 2214 2120 1280 909 723 638 152 78 32739 1194 559 --12167
NM_016156chr1151559 1488 843 754 454 2325 238 21904 226 --
NM_016206chr3198850 8610 8530 8509 8201 7945 7552 6178 5791 3616 3583 2935 2836 2404 2101 1069 595 528 352 28992 5684 48899 6493 3144 1741 27025 6044
NM_016217chr6193664 3477 3454 3189 2810 2649 2559 2549 2483 1452 1440 1261 1044 669 639 624 598 412 360 ------
NM_016220chr7152253 2218 2162 2092 1754 1731 1661 1615 882 729 644 560 237 228 59 --11816 21794 893
NM_016248chr13113665 3652 2986 2966 2934 2871 2735 2558 1603 1394 126 193 13193 --
NM_016255chr6173279 3093 3042 2943 2805 2345 2117 2042 1314 1193 1032 906 875 826 199 140 63 12713 1377 21079 680
NM_016257chr173492 3407 2965 2693 1295 845 246 --23425 3391 1899
NM_016260chr2207631 7317 7112 7092 6910 6573 6490 6105 6039 5983 5200 5112 4968 4907 2836 2059 989 930 211 88 22070 117 46685 5876 3054 2012 --
NM_016275chr3102553 2478 2455 2240 2162 1958 1829 744 527 406 11747 12286 --
NM_016277chr641631 592 509 323 --1135 21476 1086
NM_016315chr281728 1391 1287 593 509 118 109 36 1410 21160 657 1470
NM_016353chr8132442 2416 2193 2106 1938 1830 1609 920 726 395 315 166 128 --11534 2227 40
NM_016356chr672613 2327 2109 796 620 490 88 22039 1002 22199 1011 1228
NM_016374chr161585 1534 1496 1198 999 412 ----2558 87
NM_016374chr161585 1534 1496 1198 999 412 ----2558 87
NM_016422chr11133043 2759 2738 2723 2682 2536 2529 2341 2089 2047 856 429 361 1381 23183 44 --
NM_016485chr6112292 1928 1419 735 587 548 475 425 398 294 113 21989 838 21454 248 --
NM_016507chr17113145 2848 2793 2684 2205 2094 1227 992 544 290 259 --43215 2504 2310 2169 --
NM_016513chr683750 3447 3066 2720 459 377 355 148 1387 1176 23523 892
NM_016530chr1583778 3633 3470 3091 2686 1620 850 783 ----23043 470
NM_016531chr4133433 3332 3169 2715 1565 1292 1240 1056 960 912 430 377 360 23777 350 --24177 1522
NM_016599chr471384 1354 1051 433 374 253 37 11095 31443 1159 956 --
NM_016607chrX41191 1182 1099 452 2181 113 41447 1259 1040 239 --
NM_016617chr13122195 2154 2117 2037 1879 1631 1587 1577 1469 1398 452 370 1567 144 --
NM_016953chr2156127 5700 5684 5659 5328 5316 5113 4601 4326 3746 2393 2068 1889 977 628 76052 5632 5478 4865 4855 4668 68 11961 --
NM_017420chr14163749 3391 3318 3138 2406 1264 961 897 731 641 635 562 335 252 163 112 1862 22730 1392 13542
NM_017447chr21234434 4098 3881 3379 3203 2958 2946 2935 2710 1765 1706 1572 1545 1458 1384 1082 887 881 596 511 463 398 259 22908 1717 21724 1340 --
NM_017563chr3106401 6365 6296 6175 4985 2342 1052 569 301 171 25245 921 --35219 4359 1465
NM_017610chr1552143 1685 1368 674 465 21413 682 --1797
NM_017628chr4145321 4897 4168 3680 3548 3464 3410 3214 1605 1101 704 557 533 339 24722 595 35330 1686 318 --
NM_017633chr6143924 3802 3530 3410 3254 2895 2853 1346 1129 1114 766 677 458 301 --33385 3191 2665 --
NM_017637chr9199019 7728 7683 7662 7622 7169 6942 6112 3693 3279 3255 2931 2675 2336 1887 1234 971 732 624 12846 68990 6596 3100 1986 788 531 13669
NM_017641chr1281033 872 861 748 422 206 117 66 11053 31141 1110 414 --
NM_017643chr17113142 2902 2708 2667 2439 1946 770 729 573 477 248 --1588 --
NM_017644chr3165131 4982 4798 4775 4364 4003 3396 3362 3151 2081 2001 1590 835 541 487 255 14789 45179 4732 4720 287 1146
NM_017645chr9153163 3039 2855 2746 2728 2533 2467 2363 1958 789 402 221 214 171 153 12633 23192 3131 12791
NM_017650chr7145779 5549 5137 4980 4853 4651 3708 2369 2268 2168 1898 1529 1043 721 24801 2027 55079 3956 2310 2258 2197 15968
NM_017651chr661356 1029 1011 427 329 236 1383 41647 1341 1195 435 --
NM_017658chr14244681 4488 4434 4129 3728 3680 3609 3447 3417 3385 3269 3005 2975 1843 1822 1781 1276 1223 1210 1182 1056 989 917 660 33700 3281 1829 33068 1453 816 13595
NM_017752chrX102166 2126 1840 1780 1444 710 313 304 262 120 22062 295 --1530
NM_017754chr6125064 5007 4723 4578 4529 4511 4091 3892 3406 3284 1501 977 --24027 3509 11755
NM_017762chr1551922 1762 687 424 132 --11538 21862 674
NM_017769chr14113288 2580 2408 2370 2155 1274 1065 938 603 537 135 32221 1128 147 32593 2392 2140 --
NM_017770chr6112877 2870 2841 2821 2484 2211 1942 1197 888 389 375 22924 983 12728 2639 494
NM_017779chr1152621 2470 2238 2165 1992 1068 743 702 672 539 471 433 416 369 353 11842 22634 1940 1578
NM_017813chr8124621 4468 4120 4070 1566 1071 887 864 524 503 200 121 34152 3994 1711 35671 4861 3617 14663
NM_017824chr1082624 1699 1091 904 587 507 471 126 1633 12584 1313
NM_017831chr18164757 4732 4480 4437 4308 3839 3412 3365 3133 1358 1080 1035 947 899 388 102 23179 1333 2979 958 --
NM_017919chr995563 5495 4961 4938 4522 4090 900 272 92 65455 4537 4327 3723 2296 1646 15402 11667
NM_017938chrX82046 1961 1751 1516 1505 826 791 640 ----22108 1689
NM_017952chr2104064 3984 2941 1652 1266 1065 731 565 78 69 11091 --14051
NM_017987chr10102215 1820 1781 1567 1556 1514 807 525 420 188 --22240 1679 --
NM_018017chr10182702 2620 2489 2269 2256 2202 2160 2136 2099 2070 1873 1830 1762 958 688 501 449 335 1344 21807 109 --
NM_018018chr1291654 1371 1191 680 665 643 581 436 62 1136 --11563
NM_018036chr14174418 4096 4066 3781 3534 3528 3462 3388 2824 1740 1396 1329 1034 993 910 683 202 21280 1129 34486 4405 2947 24035 459
NM_018046chr5121931 1860 1819 1787 1703 1683 1610 1499 1487 656 455 130 --11373 --
NM_018121chr10122797 2721 2520 2285 2201 370 185 178 130 117 106 24 22367 2305 ----
NM_018155chr393489 3078 3050 1237 1172 993 684 571 481 12748 32881 2412 545 21012 826
NM_018184chr362059 1947 1419 540 380 153 31468 866 643 42196 1505 651 367 --
NM_018191chr1372136 2070 2042 1880 1701 737 223 --31812 694 632 --
NM_018227chr4133043 2984 2978 2934 2722 2550 2196 2188 871 737 492 325 306 --32873 2742 2349 --
NM_018247chr692763 2620 2448 2389 2048 1226 963 174 78 13140 13163 12137
NM_018279chr12102761 2718 2266 2237 1898 1049 1039 696 485 426 1310 32666 2509 614 --
NM_018293chr392822 2507 2441 2025 1979 1923 1826 1134 410 1395 11890 --
NM_018299chr8103395 3179 3169 2944 2600 2588 2540 2354 2216 457 33108 2579 1080 12345 1240
NM_018323chr4101866 1848 1758 1707 1534 1513 1288 714 589 329 11196 1663 1170
NM_018325chr941678 1479 1280 269 --21241 599 1249
NM_018342chr4101458 1445 1185 698 668 563 506 458 186 152 --21668 252 11714
NM_018351chr12133220 3132 3126 3079 3052 3035 1602 1028 830 805 780 579 498 24398 618 54611 3785 3552 3494 910 14511
NM_018361chr8204103 3940 3919 3910 3837 3807 3600 3265 3232 3095 3079 3039 3031 1483 966 673 618 436 418 410 1835 43488 3460 3218 3114 --
NM_018362chr11113740 3675 3471 2937 1586 1351 1326 1155 1062 699 312 23631 306 23045 1173 33706 3488 2584
NM_018364chr1134115 3889 3721 3567 3320 2853 2758 2728 2698 1528 1496 734 714 13107 43631 1451 1334 949 53646 3254 1482 1427 140
NM_018373chr14155179 5152 4886 4612 4404 4197 2329 2272 2255 1967 1862 1688 900 857 654 36339 6219 2286 --1530
NM_018374chr7205027 5019 4953 4801 4543 4461 4441 4411 4383 3656 3486 3386 1992 1566 1352 1314 1207 1139 489 137 44630 3895 1253 1072 2915 34 23339 773
NM_018403chr384109 3841 1374 1207 1161 1077 1011 541 13760 --14049
NM_018409chr493183 2869 2739 2678 2242 2207 1239 1046 258 --53190 3147 923 809 284 23200 2492
NM_018429chr572640 1960 1859 1175 1151 887 608 22854 2364 12494 22762 90
NM_018439chr18122638 2509 2333 2276 752 717 557 494 401 352 88 69 --22669 339 1617
NM_018440chr8248639 8591 8559 7866 7764 7715 7668 6469 5925 3209 3172 3116 3066 2881 2559 2509 2497 1847 1420 1386 1378 1337 1123 1042 27565 693 46852 5434 3271 454 25287 2472
NM_018452chr6_random113865 3737 3516 2401 2376 1524 948 840 795 528 328 1681 2989 342 11053
NM_018482chr842585 2296 917 546 11604 31689 572 155 1781
NM_018490chr1191866 1821 1618 1440 1330 382 358 236 204 1616 1408 11718
NM_018555chr1992034 1932 1580 1541 754 647 634 614 495 12045 --22296 90
NM_018557chr291420 1411 1075 668 590 497 301 41 32 --11302 --
NM_018566chr1144973 4885 4791 4754 4688 4488 4389 3746 3725 3510 3387 1990 1577 631 14020 35119 4929 1508 --
NM_018569chr481373 1365 1289 1227 1211 1043 994 42 --21446 551 1371
NM_018638chr12205577 5259 5189 5020 5004 4093 3869 3796 1705 1644 1631 1523 1456 1170 761 709 677 609 216 180 3801 601 79 75323 4435 3515 2197 934 684 366 --
NM_018640chr1272041 1901 1005 764 323 309 108 --12783 11717
NM_018650chr182068 1803 1637 885 876 615 350 225 --22144 186 12251
NM_018695chr5122399 2257 2123 2110 1903 1726 1521 988 659 651 180 71 --11741 12028
NM_018700chr551640 571 405 339 275 --21263 1150 11454
NM_018841chr1103822 3758 3691 3659 3551 2756 2397 1319 629 111 --23064 2790 12857
NM_018844chr771424 1416 1375 1362 629 211 174 31473 428 250 52100 1955 1887 779 156 11391
NM_018846chr78951 656 631 612 332 252 233 41 1841 1907 --
NM_018847chr991974 1851 1207 458 378 275 222 174 96 --1757 2497 332
NM_018947chr7164920 4885 4716 4708 4555 4253 3192 3170 1728 1436 807 477 356 244 172 118 1583 24443 40 2971 950
NM_018958chr1573716 3618 3532 3419 3099 2755 539 13212 23651 3172 13067
NM_018970chr773169 2318 2127 1929 839 740 386 1523 1465 33100 2236 290
NM_018972chr872685 2545 2494 2077 1984 846 774 22125 2115 --12239
NM_018976chr1262732 2707 2545 2359 854 813 32425 570 547 22799 406 --
NM_018981chr251394 1210 954 877 852 --31169 443 200 1302
NM_018999chr10194936 4822 4250 4187 4117 3964 3881 3426 3364 3233 3139 1844 1732 1673 1646 1155 1131 1023 853 13401 34028 3114 1785 24095 3978
NM_019000chr551624 1429 1284 1042 564 --21407 327 2389 261
NM_019001chr3104821 4619 3794 1937 1740 1413 805 647 305 195 2284 276 24684 1464 34407 3980 814
NM_019004chr752103 1722 1714 1599 775 41855 1825 1775 837 11670 11943
NM_019022chr1893066 2661 2560 2137 2002 1175 568 319 283 22294 123 22783 22 --
NM_019027chr472472 2428 2013 1838 941 452 442 ----12340
NM_019035chr462096 1823 1786 1606 725 114 31710 741 135 1588 --
NM_019036chr611203 3866 422 176 21249 848 21136 319
NM_019041chr622112 620 --1528 22241 561
NM_019042chr761272 1215 1148 448 212 165 --11225 1260
NM_019050chr4111869 1464 1417 883 742 419 338 277 269 141 68 --22194 1967 11955
NM_019053chr103917 322 64 --11118 21110 154
NM_019072chr5124256 4004 3959 3764 3696 3381 2635 1106 876 870 524 56 43264 1390 732 484 24106 1126 14130
NM_019084chr10102552 2516 2428 2112 2057 2002 1913 374 232 142 11644 31661 271 260 11812
NM_019094chr1253001 1010 863 696 673 13417 23087 183 2711 430
NM_019117chrX113344 2590 2435 2291 1354 1302 1038 747 495 424 257 13497 63363 3099 1172 953 856 287 33451 3283 703
NM_019593chr20102666 2588 2537 1084 1068 897 701 252 156 125 --32434 1008 239 1687
NM_019610chr172111 1967 1957 1932 748 232 225 --41924 1916 1907 1898 --
NM_019885chr262887 2799 2732 2685 2618 2082 12586 12714 12769
NM_019891chr161213 510 397 193 178 141 --1856 21240 924
NM_020116chr471560 1491 1428 1111 460 246 210 1482 2739 434 --
NM_020122chr2155809 5583 4656 4359 2400 2278 2192 2033 1539 1152 822 522 198 147 26 32266 976 330 --15909
NM_020130chr861442 1390 1168 1162 1155 1012 11403 21123 515 1928
NM_020147chr1541066 396 367 305 2270 114 --31106 958 826
NM_020159chr471694 1593 1467 1406 343 290 208 1526 11747 31259 311 39
NM_020199chr581342 1306 1056 994 458 281 207 69 ----1143
NM_020228chr1162567 2489 2464 1587 865 814 --52409 2384 1900 1667 1602 1320
NM_020245chr6134972 4283 4099 3982 3951 3931 3906 3837 3380 1638 1374 1160 1146 13277 24295 3871 --
NM_020336chr2053842 3725 1509 1480 849 53595 3389 2879 2376 337 33685 1463 813 1836
NM_020337chr4153183 3018 2926 2860 2834 2798 2463 2444 2258 2134 1085 1078 1065 352 331 --22818 606 22579 561
NM_020341chr2062063 1972 1778 1731 1659 1489 --1788 11713
NM_020342chr282459 2252 2036 1976 1872 925 222 194 --32496 1843 372 22555 850
NM_020346chr1171696 1570 1445 1071 574 550 469 ----11489
NM_020390chr3184888 4843 4812 4722 4495 3823 3751 3721 3666 3338 3243 3143 2997 1751 1407 883 223 208 23403 1380 11855 --
NM_020425chr691488 1399 724 684 640 490 483 400 213 31306 476 80 1330 --
NM_020432chr771842 1833 1614 713 628 395 251 --11936 22220 2108
NM_020455chr6152840 2752 2743 2129 2018 1881 1143 835 793 755 554 390 213 169 137 12213 12191 2710 95
NM_020456chr1362191 2164 791 103 89 46 1551 1384 11597
NM_020466chr6164920 4451 4321 3895 3666 3560 3485 3440 3424 3399 3136 1915 1169 1103 1070 187 24665 4191 31993 1028 927 13530
NM_020640chr3122299 2158 1833 1794 1647 1553 1426 1412 898 642 569 421 1588 22283 752 --
NM_020647chr862291 2103 2042 1828 761 366 --41932 1510 1447 894 --
NM_020648chr18112872 2715 2196 2072 1970 1964 1760 1139 1090 476 141 --22219 1915 1513
NM_020654chr361372 1170 1136 263 219 140 31635 1185 495 21037 241 11556
NM_020673chr2087704 7688 7306 6774 6129 4705 2457 838 57271 5721 5394 1745 1400 22539 861 26866 4981
NM_020714chr19124630 4368 4359 3634 3505 3355 3300 3290 3224 1571 298 206 --24338 159 --
NM_020718chr16116600 5989 5956 4462 4359 4293 4160 2116 1648 1313 551 15224 22626 2285 42474 2403 1483 1394
NM_020727chr21194015 3813 3672 3043 2953 2845 2798 2780 2640 2593 2566 2535 2523 1599 1335 1204 356 164 62 13622 42759 536 196 82 --
NM_020728chr751181 660 611 584 413 1168 --2595 536
NM_020734chr12143381 3279 2860 2713 2627 2543 2425 2371 2326 1023 724 668 592 270 --2986 366 1232
NM_020739chr15154231 4032 4013 3823 3505 3377 3204 3074 2981 2973 2567 642 594 399 219 --13123 13400
NM_020742chrX82704 2526 2468 2068 1782 758 628 228 ----22762 2079
NM_020748chr17112155 2068 2061 2049 2041 1958 1917 1886 1688 839 98 11673 11762 --
NM_020752chr1072635 2034 1068 888 513 274 60 --32878 475 74 --
NM_020766chrX104573 3643 3627 1796 1556 1491 1334 807 272 124 13141 33704 3089 2830 --
NM_020771chr651468 1253 1242 535 200 21437 1077 --21559 71
NM_020772chr17218574 8409 8025 7926 7466 7083 6837 6374 5891 5629 5523 3168 2694 1922 1737 1176 946 888 823 582 138 --77971 6957 5931 5246 2310 1577 841 11474
NM_020774chr18176237 5924 5383 5358 4537 4196 3978 2472 2084 1513 1337 1325 1153 948 746 276 139 45504 4023 2115 102 46111 4513 3797 1221 13861
NM_020779chr2102719 2561 2519 2243 2133 765 494 210 143 33 --33073 699 289 --
NM_020782chr1294554 4442 4214 4147 3408 3362 520 281 53 1800 34850 1022 619 23091 1745
NM_020783chr18122180 2143 1853 1810 1559 706 656 371 308 228 220 164 22170 1474 2517 456 --
NM_020792chr3102731 2577 2528 2427 2226 2176 883 753 689 667 1921 --11112
NM_020794chr1111521 1459 1075 1061 522 486 470 401 173 158 118 21486 1345 21558 428 --
NM_020800chr381454 1351 1343 1195 945 547 446 348 1573 --2313 220
NM_020801chr582566 2466 2334 2290 2273 2244 2071 2045 12489 32368 2015 73 --
NM_020810chr1493461 3454 3038 2339 2252 2215 1312 245 221 --33630 2918 256 --
NM_020813chr1972811 2605 2461 2373 2362 99 90 12655 21929 1824 --
NM_020841chr12293928 3865 3796 3778 3636 3612 3394 3262 3134 3108 2774 2637 2617 2553 2521 1345 1310 1295 1219 1070 956 946 671 652 558 393 345 127 96 23678 1084 32802 1557 1246 13279
NM_020844chr8167404 7120 6997 6981 6936 6919 6369 5617 5072 2766 1521 1324 1131 1062 465 216 26389 5193 57329 4978 2785 2670 1788 17465
NM_020858chr1542425 887 445 378 12060 --21972 426
NM_020868chr2102000 1975 1900 1405 790 699 617 567 71 33 21988 91 21442 483 11575
NM_020871chrX82559 2489 2189 899 861 640 296 81 --62321 2291 1623 671 548 59 --
NM_020872chr371746 1720 699 628 246 137 131 41409 1350 412 189 11481 --
NM_020918chr10133652 3526 3254 3040 2952 2567 2486 1467 1350 797 664 609 347 22444 641 23481 2655 11298
NM_020921chr1492996 2847 2673 2458 2444 2335 1050 963 354 ----12503
NM_020935chr2154144 4088 3860 3233 3197 3131 3125 1413 1162 1070 920 720 437 361 266 --13462 11389
NM_020940chr10122836 2348 2212 1998 1824 1817 644 546 475 344 301 169 1311 11037 --
NM_020948chr1163642 3526 3208 3195 3133 2866 2793 2739 2634 2619 1219 1182 1082 491 261 237 33445 2386 1064 32754 2278 451 23709 1478
NM_020951chr1982140 2112 1813 1517 898 367 334 89 1324 32435 977 201 --
NM_020964chr18154725 4717 4247 3678 3365 3281 1701 1319 1264 871 507 481 370 297 148 24062 1852 64286 3006 1664 1514 1352 1279 --
NM_021007chr2122426 2408 2313 2090 1986 1544 1518 849 773 716 199 119 --21615 937 --
NM_021032chr391996 1894 1641 1626 1538 1426 1398 746 568 --11912 1274
NM_021033chr13143357 3093 3016 2859 2489 2451 2233 1369 1308 1043 943 661 155 41 13435 42872 2159 418 381 12653
NM_021038chr3183235 3186 3122 2940 2795 2253 2234 2194 2137 2067 2057 1205 1190 944 908 893 529 405 12273 12243 --
NM_021072chr592632 2506 2076 1695 660 173 151 143 112 2887 606 22172 267 --
NM_021111chr9111297 1262 1201 1086 1035 487 390 226 194 186 87 1156 11351 --
NM_021148chr792384 2147 2041 1946 1912 1849 531 505 164 --31662 591 457 22269 569
NM_021163chr7203628 3513 3480 3139 2844 2824 2760 2505 1547 1329 1095 1071 951 651 616 498 334 253 45 36 12430 33769 888 246 --
NM_021167chr7112776 2358 2259 2237 1851 1807 1035 948 938 170 152 ----11106
NM_021176chr251817 1796 1232 208 193 31717 1670 1501 11624 --
NM_021252chr10112044 1938 1836 1799 1762 1698 1679 1485 1380 824 167 --1130 --
NM_021255chr14104007 3833 3280 3147 1344 1101 1062 643 588 235 24131 1559 22709 1493 --
NM_021622chr10122314 2262 2218 2145 2116 1961 1784 502 402 314 283 175 21722 227 2441 218 12057
NM_021629chr3155084 4631 4507 4429 3964 3944 3875 3773 3561 3496 3124 3095 1651 1633 478 14927 44706 4385 3981 1049 24154 372
NM_021645chr1342428 1992 1977 248 ----22336 2272
NM_021647chr4164648 4479 4431 4021 3507 3286 1794 1551 1363 970 919 841 765 589 380 322 --24604 4068 24619 4300
NM_021813chr674712 3920 2114 2106 1065 922 453 24697 1993 1152 12095
NM_021815chr2143048 2643 2503 2494 2352 1892 1164 1045 868 809 570 533 97 86 22961 2414 ----
NM_021818chr1461531 1485 1406 1398 1186 452 --3487 405 45 31459 432 275
NM_021911chr5165630 5587 5267 4909 4571 3909 3873 1878 1813 1787 1498 1466 1418 1013 984 308 35436 2048 668 34898 4747 3985 25032 3965
NM_021912chr1593608 3333 3294 3280 1516 1006 887 851 400 1389 13103 3355 344 52
NM_021914chr1482419 2409 2364 2045 893 730 531 352 1741 42352 2111 1783 1673 1143
NM_021935chr35864 834 198 82 25 11052 --2848 277
NM_021956chr661137 583 544 519 388 79 1347 21340 395 --
NM_021961chr11167277 7163 6001 5950 5893 4870 4735 2567 1606 1488 1023 772 600 469 463 395 --56258 5075 947 348 27 16583
NM_021964chr3286606 6238 6197 6181 6060 6036 6009 5961 5932 5909 5620 5493 5117 4880 4505 4475 4403 4176 2628 1816 1790 1677 1129 1057 858 758 716 651 1451 45561 5196 1947 1610 --
NM_021980chr101560 21144 873 2892 95 141
NM_021998chrX91488 1397 1261 1187 1082 587 425 325 38 21385 1142 2235 143 --
NM_022041chr1662572 2486 2020 824 507 225 12276 32733 2474 2074 32467 306 265
NM_022048chr15146115 6102 5976 5602 5326 5290 5167 4762 3977 3914 2232 2161 1025 109 35936 2203 2098 26356 6182 --
NM_022079chr1041022 711 627 237 1183 2957 322 1155
NM_022091chr6142780 2667 2489 1997 1791 1778 576 494 425 413 352 284 208 47 42773 310 142 134 22166 1068 --
NM_022130chr511002 --2532 428 31299 1059 1017
NM_022166chr1696025 5989 5981 5300 5123 4949 4366 3939 1581 --35904 5561 5283 15747
NM_022351chr8153870 3777 3720 3699 3236 1268 1122 934 885 742 710 470 309 211 202 --43142 2735 1287 1056 12762
NM_022444chr771790 1671 1644 1221 624 404 67 ----21233 1203
NM_022456chr12297702 7492 7343 7256 7150 7006 6464 6262 5895 5540 4977 4688 3022 2376 2036 1943 1919 1587 1266 1248 1175 1050 974 943 879 776 594 270 56 35878 5063 2410 --47683 7325 5790 5569
NM_022459chr13176352 6243 5375 5345 5115 5087 5071 4820 4525 4447 3956 3907 3898 3891 488 368 283 34766 2290 1759 24838 4649 14577
NM_022461chr3111273 1205 1143 924 918 531 473 464 345 221 121 --31014 361 353 --
NM_022469chr183273 3106 2410 1323 1272 1168 849 552 1775 22916 1228 --
NM_022474chr1492703 2616 2338 1845 1036 1011 956 704 424 22574 2467 32241 2176 366 11113
NM_022483chr571619 1392 784 607 477 423 320 1217 --21609 1457
NM_022716chr193155 3117 2787 2682 2666 2156 1001 783 190 12693 31238 835 133 12923
NM_022763chr3113207 2992 2865 2579 2409 2171 2121 591 572 490 231 ----23143 138
NM_022781chr993335 3162 2974 2898 2861 2680 2443 2329 1029 2902 879 13178 --
NM_022787chr121943 1875 12553 --22716 1853
NM_022841chr15142775 2715 2404 2241 2154 2069 1725 1001 749 685 678 455 395 209 12183 2938 473 32096 1890 594
NM_022893chr2102873 2261 2172 1963 1957 1119 1103 721 632 160 12527 1611 --
NM_022898chr1454653 4335 3788 3757 1887 24752 3729 34696 4503 1338 13283
NM_022900chr791169 1141 1002 836 337 170 100 88 82 --1895 --
NM_022912chr2112758 2486 2435 2337 2304 2007 1993 1950 1116 758 595 --1606 --
NM_022977chrX102455 2107 2056 1873 1842 963 872 572 418 274 --42520 2004 649 299 1401
NM_023012chr123638 258 227 ----2724 145
NM_023016chr2132912 2788 2687 2427 2307 2035 2001 1988 1981 1110 989 801 263 ------
NM_023929chr8132833 2459 2399 2126 2017 1997 1912 1904 1891 1875 1826 1076 89 --22331 254 11030
NM_024052chr17123121 3101 3036 3002 2982 2849 2843 2818 2481 1145 918 891 --13043 --
NM_024345chr9145884 5695 5667 5263 4890 4871 4482 4222 4143 3837 2248 2228 850 71 23869 1103 56145 4974 4836 4506 599 25757 679
NM_024511chr473217 3178 3021 2572 1184 781 630 --51337 1055 1013 621 266 --
NM_024524chr372503 2338 2119 760 469 168 48 --22842 2386 1238
NM_024539chrX91259 1252 1221 858 831 786 358 322 198 1132 31271 485 159 --
NM_024548chr3101506 1182 1147 708 494 446 433 353 320 156 1631 31678 1281 24 --
NM_024573chr68952 742 707 684 678 390 264 218 ----1753
NM_024594chr581891 1730 770 695 555 476 357 162 11677 21942 318 134
NM_024613chr8101821 1605 1582 1461 1397 1316 1142 748 215 63 11684 31881 1574 682 11474
NM_024636chr7112956 2941 1941 927 870 732 577 465 349 327 28 22196 1849 3917 841 635 22220 521
NM_024646chr1113245 3195 3050 2853 1105 1010 841 750 548 490 64 22965 1368 13772 13369
NM_024665chr3144732 3960 3183 3002 1466 1460 1363 1291 1196 1097 1039 956 289 131 23929 1441 24394 577 13319
NM_024692chr261685 1535 1227 166 104 30 --41474 1318 1296 731 11861
NM_024744chr2162690 2672 2522 2509 2349 2322 2055 1829 1754 1714 1634 1075 1002 526 493 67 --1319 --
NM_024749chr182259 2221 1979 1694 1671 1647 472 334 12012 --1741
NM_024751chr4112107 2012 1974 1967 1908 1707 1699 1498 639 554 384 --11988 --
NM_024761chr9105210 5002 4834 4811 4116 3739 1965 1776 1281 804 --44234 3801 3565 1381 25354 3408
NM_024770chr2155980 5919 5885 5811 5780 5059 4958 4381 4312 4101 2430 2312 1894 627 314 12634 25744 4129 --
NM_024817chr15105810 5349 5256 5096 3793 3644 1557 1511 759 558 13616 36009 5902 3772 15425
NM_024854chr12111322 1144 1134 1097 447 432 368 325 266 192 141 --21344 1195 21069 362
NM_024884chr14124536 3823 3559 3548 3445 3360 3252 3000 1830 1555 1460 339 --23568 2970 --
NM_024899chr181471 --1635 2595 287
NM_024913chr771325 1251 611 470 396 319 234 11768 21780 619 11429
NM_024920chr491611 1489 1312 606 586 478 436 213 189 1639 1330 --
NM_024921chrX71901 1423 1406 1360 1347 609 529 11431 --1325
NM_024930chr5102696 2649 2275 1063 1011 935 914 821 296 61 2986 864 22664 2380 1346
NM_024941chr531511 1289 95 --31428 353 142 1136
NM_024942chr1091374 1044 1018 364 324 241 95 87 31 1551 2977 71 --
NM_024947chr3329503 9399 9215 8570 8552 8002 7808 7767 7749 6978 6910 6776 6758 6482 6301 5984 3776 3623 3526 3470 3412 2975 2502 2401 1899 1589 1559 1396 992 971 273 85 16101 88376 8016 7855 7733 5797 3569 909 860 11999
NM_024949chr4125016 4961 4866 4770 4498 3431 2013 1794 1304 1140 614 246 --44590 1985 1873 1614 --
NM_024953chr12102754 2547 2208 2144 2066 1824 1030 847 156 43 1984 11981 --
NM_024989chr2218117 7578 7359 7105 6723 6684 6617 6492 6218 6097 6040 5634 5298 5266 3067 2563 1388 738 675 593 125 46210 5249 999 980 67612 7042 6295 5685 3266 2526 26027 2074
NM_025054chr8133156 3101 3091 2777 2761 2681 1558 1352 1338 1239 507 51 43 33958 3878 3265 54186 3594 2954 1463 554 12894
NM_025073chr1144368 4362 4314 3593 3493 3416 3008 2970 1576 1470 1224 795 755 150 1492 11351 13200
NM_025107chr6102280 2227 2021 1804 1582 1466 795 333 205 199 11962 12210 --
NM_025134chr16142449 2334 2326 2247 2197 2054 1806 1721 851 693 531 355 164 25 1430 1991 1727
NM_025146chr392297 2158 2003 1694 778 764 635 387 312 --12550 22068 1896
NM_025154chr761323 1163 1034 627 614 547 21417 445 31484 1407 1073 --
NM_025160chr1184323 4127 4107 3843 3520 3496 3393 3148 3044 3021 2867 2816 2777 2670 1243 1220 1186 691 1600 33529 3422 2829 --
NM_025180chr3113483 3460 3438 3131 3100 2379 661 644 379 293 252 --23383 3035 13477
NM_025191chr1133548 3483 3437 3427 2849 2684 2672 2570 2553 2287 1154 611 107 --33557 3281 3209 --
NM_025214chr1892723 2544 2511 1919 1725 1065 921 844 783 --22450 796 --
NM_025238chr1561626 1461 1251 1083 1031 96 --2577 517 11200
NM_030621chr14103872 3797 3736 3139 3094 2962 2938 1035 961 863 --24100 3451 --
NM_030625chr10132404 2385 2375 1944 1899 1788 1716 1665 1062 813 609 526 245 12394 42204 1742 1679 544 12132
NM_030627chr563854 3709 3665 2827 911 903 22687 1035 14132 23474 306
NM_030634chr162507 2491 1939 1649 1560 777 159 1792 11981
NM_030647chr7186292 6286 5214 5207 5118 4805 4741 4592 2270 1769 1710 1579 1539 1490 1263 1113 949 895 14126 76209 5663 4637 4585 4188 1343 417 35064 1757 1650
NM_030648chr4145618 5606 5522 5386 4116 3982 3840 3519 3496 1987 937 890 857 459 24379 731 45548 4097 3753 755 14847
NM_030664chr10112253 2240 2150 2019 1864 824 799 725 614 388 79 --1549 11622
NM_030674chr12185908 5895 5838 5300 5265 5058 4803 4600 4544 4439 4117 2252 1904 1544 923 754 571 108 15473 15180 14968
NM_030755chr14103043 2077 2019 1174 1036 453 412 315 179 96 127 1360 --
NM_030763chrX4733 671 609 222 --3664 624 71 --
NM_030777chr2062466 2328 2312 1926 777 278 2387 362 12268 22258 1900
NM_030799chr551836 1606 1445 797 213 --31844 1823 719 21931 1513
NM_030806chr189206 9060 8780 8304 8269 7779 7360 176 29301 1496 33681 2531 1281 18820
NM_030816chr1172456 2399 2366 1420 1317 1302 1214 1067 1038 931 826 487 409 340 324 224 209 --63451 3350 2803 1117 460 398 11259
NM_030885chr382147 2100 1893 839 635 592 395 293 --1361 11574
NM_030945chr5102488 2326 2270 2229 1993 1985 1958 845 737 729 22425 1074 42383 965 702 290 32654 2415 694
NM_031216chr1892028 1761 1740 1467 731 553 376 275 221 12168 1456 1565
NM_031217chr112485 75 --2538 228 1514
NM_031271chr871731 1325 533 420 140 114 102 21718 1417 41678 1570 470 51 --
NM_031296chr4102682 2421 2307 2264 1940 1800 1780 1109 330 55 --32431 2325 2144 12584
NM_031305chr4101834 1708 1606 1265 558 476 464 458 413 302 21199 125 ----
NM_031362chr2132783 2767 2732 2723 2712 2689 2658 2598 2478 923 792 725 26 32466 2238 1928 42019 1823 819 254 22807 171
NM_031365chr2132919 2903 2868 2859 2848 2825 2794 2734 2614 1059 928 861 162 32602 2374 2064 42155 1959 955 390 22943 307
NM_031366chr2132919 2903 2868 2859 2848 2825 2794 2734 2614 1059 928 861 162 32602 2374 2064 42155 1959 955 390 22943 307
NM_031371chr161585 1534 1496 1198 999 412 ----2558 87
NM_031371chr161585 1534 1496 1198 999 412 ----2558 87
NM_031418chr11102430 2310 2194 2127 1101 671 423 353 265 130 1890 22211 160 1382
NM_031427chr14175941 4874 4430 4255 4120 4042 3865 2396 2259 2107 1186 1000 960 609 560 535 328 23695 2307 15372 140
NM_031435chr1293495 3316 3259 2826 2562 1257 1242 738 681 23342 2509 43406 3130 597 586 --
NM_031438chr561767 1688 1621 1371 325 187 --21427 131 11776
NM_031442chrX133043 2980 2772 2748 2624 2618 2402 2393 2280 2061 1191 987 897 12214 42589 1254 1246 1201 --
NM_031461chr8102309 2244 2065 790 688 634 600 579 199 49 1530 2885 229 --
NM_031468chr798210 8124 8072 6796 6145 5861 5708 1758 811 12041 25639 5578 --
NM_031469chr6193923 3890 3884 3718 3703 3674 3547 2529 1594 1512 980 945 803 778 748 684 552 405 321 --11380 --
NM_031483chr2083201 2559 2440 2290 2184 1298 1183 287 --22495 2172 23497 2194
NM_031845chr2123663 3507 2970 2458 2420 2275 1315 894 855 781 775 33 2834 698 22555 1441 13451
NM_031847chr2123663 3507 2970 2458 2420 2275 1315 894 855 781 775 33 2834 698 22555 1441 13451
NM_031911chr482666 1899 1845 1017 475 338 313 206 --22760 238 --
NM_032012chr9115172 5119 4895 4487 4102 3743 1955 1770 826 554 407 24703 3611 35273 1222 974 34936 1788 984
NM_032047chr3102354 2130 2048 934 883 834 709 530 385 68 21657 165 32362 827 110 12217
NM_032116chr13165806 5609 4932 4728 4670 4462 4443 4291 4142 4047 3884 958 607 586 237 152 34873 3571 714 55360 5302 5098 4861 4522 --
NM_032121chrX52621 2150 1068 940 268 --32810 2254 1827 12744
NM_032145chr661859 1625 1608 1211 732 192 1452 1422 187
NM_032160chr18113970 3432 3325 2978 1696 1685 1398 1133 858 659 598 1520 13406 33929 3459 3211
NM_032189chr1384757 4694 4645 4193 3789 1900 1801 1249 15004 24715 1506 14456
NM_032199chr10123901 3888 3860 3526 3080 3048 2953 2892 2397 1118 963 288 --43595 3277 2712 982 --
NM_032208chr2123477 3267 3117 2923 2597 2565 2440 1467 1456 1121 589 172 23282 974 ----
NM_032228chr11133512 3391 3098 3045 2632 2382 2296 1008 431 238 66 59 50 2746 537 13372 --
NM_032291chr1131911 1763 1658 1365 1356 1230 753 551 416 410 223 204 97 11958 11989 --
NM_032321chr2113095 2658 2436 2175 2150 2136 850 531 396 109 52 53058 2971 2392 261 125 13282 --
NM_032373chr10265917 5891 5795 5726 5708 5673 5525 5488 5278 5103 4995 4795 4785 4585 4490 2228 2133 1556 1504 1482 1422 1317 719 673 460 293 --65773 5533 5188 3843 1412 1202 45480 4763 4667 951
NM_032435chr182378 1999 1866 1787 691 556 151 130 --11511 21474 931
NM_032436chr1361005 918 783 380 249 60 --1994 1370
NM_032439chr1091528 1403 1312 1175 1149 1131 602 544 355 --41041 584 558 385 --
NM_032445chr1582215 1806 1741 1652 1013 993 283 41 --21780 512 11749
NM_032446chr5103635 2993 1379 1285 827 694 671 636 575 355 33376 3354 2577 43800 3323 2568 1008 11192
NM_032457chr4123934 3823 3561 3489 2533 2460 1528 1043 985 597 571 457 21102 584 32848 1338 714 13225
NM_032458chrX113166 3104 2904 2891 2696 2606 2427 2276 1291 861 250 1236 23182 475 --
NM_032521chr2043032 2826 2257 457 1135 12568 43129 2960 2923 2867
NM_032582chr1791551 1480 1457 1442 1323 1257 316 306 97 ----21265 356
NM_032622chr441417 985 164 126 1978 2439 386 1116
NM_032778chr383193 3064 2705 2327 1314 798 415 157 22254 295 13272 1706
NM_032804chr1082391 2369 2335 2255 1901 1777 1722 975 --1298 11002
NM_032828chr19124953 4564 4500 4356 3978 3933 3721 3567 3440 1624 455 115 13858 --14424
NM_032842chr791606 1559 1346 1340 1074 1051 171 157 141 --21415 1086 11592
NM_032859chr13134019 3956 3775 3620 3589 3448 2585 2497 1447 1439 687 336 262 23883 1416 1378 11006
NM_032869chr8141995 1973 1766 1712 1699 1674 1268 531 484 398 247 144 103 39 --32053 1838 325 --
NM_032961chr481308 1218 1180 1170 1145 1050 492 194 21394 373 --2519 290
NM_032968chrX174125 4054 3931 3863 3737 3374 3303 3144 3105 2710 1698 1563 1433 1310 1165 980 648 34099 1142 316 43813 3045 933 380 14037
NM_032969chrX174125 4054 3931 3863 3737 3374 3303 3144 3105 2710 1698 1563 1433 1310 1165 980 648 34099 1142 316 43813 3045 933 380 14037
NM_032973chrY174117 4046 3923 3855 3729 3369 3298 3139 3100 2705 1692 1562 1433 1310 1165 980 648 34091 1142 316 43805 3040 933 380 14029
NM_032975chr1863654 3527 3469 2481 2389 1090 1457 1796 1817
NM_032980chr1863654 3527 3469 2481 2389 1090 1457 1796 1817
NM_033020chr1144337 4266 3973 3797 3401 1917 1789 1683 1560 1524 1445 942 925 98 1502 31200 1192 302 --
NM_033055chr161117 829 811 432 296 116 --31145 1124 307 1801
NM_033117chr9------2350 324
NM_033132chr13102284 2199 1966 1915 1836 1732 702 675 622 184 --12096 --
NM_033143chr4124441 3647 3188 3036 1744 1135 1109 977 857 707 487 335 --21446 727 13125
NM_033181chr6173848 3797 3737 3683 3352 2975 2667 1431 1298 1156 1087 1081 607 476 429 417 362 32697 1129 379 32540 704 619 12552
NM_033224chr7198098 7994 7617 7403 7234 7041 6525 6131 6080 6007 5774 5708 5457 5379 5051 2167 1919 1366 925 12859 47568 6304 6267 690 33050 2749 1570
NM_033225chr893124 3044 3001 2954 2919 2386 816 806 162 13097 23216 2760 --
NM_033285chr8103765 3746 3325 3258 1772 1655 1617 1082 274 79 --13878 12991
NM_033290chrX43587 2379 1088 411 12807 33559 2910 1447 33635 3389 1299
NM_033360chr12124611 4567 4202 3575 3472 3104 3073 3065 3047 1567 964 938 ----31619 1355 713
NM_033389chr17164849 4831 4811 4730 4480 3677 3536 3192 3152 1524 1503 1193 909 821 100 37 13671 ----
NM_033430chr4163904 3862 3804 3709 3534 3008 2962 2952 2790 1518 1430 1346 1287 1249 1212 810 12652 22974 1608 23195 3061
NM_033437chr4163904 3862 3804 3709 3534 3008 2962 2952 2790 1518 1430 1346 1287 1249 1212 810 12652 22974 1608 23195 3061
NM_033480chr6122517 2334 2096 2082 1183 546 529 386 378 193 77 45 --22939 2599 --
NM_033481chr6122517 2334 2096 2082 1183 546 529 386 378 193 77 45 --22939 2599 --
NM_033505chr2226494 6265 5899 5879 5764 5698 5499 4901 4844 4776 4620 4469 4339 4258 4204 2380 2302 1773 847 708 576 246 15392 21897 52 --
NM_033656chr21175685 5617 5199 5119 4966 4639 4322 4005 3957 2369 2056 2009 1138 1108 272 207 100 35799 3798 1467 25986 4178 11034
NM_052811chr13235259 5199 5076 4966 4669 4473 4180 4063 3742 3697 3398 2064 2023 1934 1583 1184 972 845 732 308 292 238 109 --35040 3592 3457 13917
NM_052832chr8103039 2831 2745 2645 2469 2241 787 684 602 433 ----2494 478
NM_052851chr1342318 2109 781 332 22381 874 --22338 959
NM_052864chr452138 1726 847 746 27 12086 41674 879 625 254 22222 891
NM_052867chr133571 254 55 1231 41504 1363 541 431 1273
NM_052879chr1284040 3921 3801 3004 1014 662 250 215 13126 33865 3323 392 11425
NM_052885chr12254877 4837 4789 4770 4741 4652 4301 4235 4166 3782 3707 3367 3359 3314 3280 1941 1851 1673 1514 1382 659 603 276 240 191 11910 54581 4561 3048 1636 203 33623 3208 1126
NM_052907chr12134276 4032 3952 3939 3569 2893 2770 1549 1486 1449 1393 777 270 12761 44237 4056 2873 2787 --
NM_052917chr2133398 3333 3205 2520 2269 2188 2077 1116 1010 506 274 202 151 --23376 3179 42967 2213 384 73
NM_052918chr1093726 3574 3509 2382 1466 1000 253 195 141 12727 21291 531 --
NM_052932chr11101875 1864 1694 1672 1609 919 889 831 145 84 --12210 --
NM_052937chr8122611 2348 2227 2211 2093 1817 983 809 769 533 214 53 --21047 634 12388
NM_053016chr9137704 7590 7008 6714 6496 6035 5004 2636 2147 1435 1298 844 649 --21945 928 11223
NM_053023chr1183302 3198 3093 2975 2772 2337 2274 2059 --33114 2909 2501 --
NM_053064chr1493021 2890 2741 2269 768 587 382 358 232 12628 1781 11181
NM_057168chr791621 1590 1421 1346 1174 664 606 355 251 11732 21717 1533 11188
NM_057175chr472094 1666 1050 493 160 111 55 12328 1172 1344
NM_058170chr171480 1442 1150 1089 633 454 340 1486 21623 395 11597
NM_058241chr2112318 2108 2056 1824 1569 841 543 505 479 292 117 ----11588
NM_058241chr2112318 2108 2056 1824 1569 841 543 505 479 292 117 ----11588
NM_078487chr9123271 2950 2863 2675 2622 2481 2275 2190 2172 1340 1314 740 ----22515 2248
NM_080629chr181515 1430 1333 498 322 305 193 38 1963 11496 11096
NM_080630chr181515 1430 1333 498 322 305 193 38 1963 11496 11096
NM_080666chr1481090 576 547 475 469 255 191 130 --51262 1211 1136 667 561 --
NM_080676chr2093135 3094 3069 2947 2124 2034 1215 928 597 1884 22229 545 12385
NM_080759chr1382315 2226 1783 892 712 659 222 143 --1958 32359 2211 232
NM_080760chr1382315 2226 1783 892 712 659 222 143 --1958 32359 2211 232
NM_080832chrX101707 1651 1477 1404 1292 1152 588 501 494 216 --21724 1587 21845 344
NM_080867chr14144931 4909 4429 4302 4247 3364 3326 1761 1413 1350 450 350 198 51 21783 1769 74555 3891 2028 1922 1794 1513 410 1612
NM_080874chr491647 1574 1558 674 509 432 426 211 79 --11318 21777 135
NM_080921chr161154 1134 1127 948 846 117 --2890 155 1813
NM_080927chr3102859 2789 2614 2539 2398 1250 1133 778 708 122 --22195 216 --
NM_130387chr341280 780 321 205 ----1920
NM_130391chr9103487 2889 2236 1223 872 759 677 575 374 46 1745 12259 23618 694
NM_130392chr9103487 2889 2236 1223 872 759 677 575 374 46 1745 12259 23618 694
NM_130393chr9103487 2889 2236 1223 872 759 677 575 374 46 1745 12259 23618 694
NM_130435chr106606 301 217 206 163 89 1235 2244 21 --
NM_130446chr394385 4364 4308 3932 3474 2973 2891 972 231 ----23910 2997
NM_130809chr5103138 3130 3048 3004 2546 2259 1200 756 738 238 12596 12836 --
NM_130847chr11125939 5844 5395 5366 5098 4318 4252 4214 531 352 291 151 --45782 4752 4360 2198 --
NM_133170chr2088043 7738 6788 2445 2124 1806 1655 1021 47962 7947 6686 2398 15959 16439
NM_133334chr496302 5739 4563 2195 1230 1063 917 730 461 15619 35376 4195 2424 1381
NM_133370chr483699 3654 3220 2547 1314 996 445 281 31342 570 161 22386 438 --
NM_133372chr5112903 2703 2192 2149 972 794 717 637 543 493 470 1293 12660 2815 678
NM_133474chr4161398 1273 1262 1194 1083 1061 679 497 466 413 331 256 172 163 92 72 --11094 --
NM_133477chr4153286 3249 3149 3019 2954 2849 2454 2202 996 890 519 442 404 362 177 22729 2307 33091 2876 501 11167
NM_133496chr1164281 4246 4010 3828 3801 3463 3308 2863 2775 1757 1663 1535 639 619 405 193 1509 22792 1023 --
NM_133503chr125562 294 281 263 245 2492 51 --1786
NM_133504chr125562 294 281 263 245 2492 51 --1786
NM_133505chr125562 294 281 263 245 2492 51 --1786
NM_133506chr125562 294 281 263 245 2492 51 --1786
NM_133631chr3131663 1375 1219 1099 1045 667 650 539 432 392 381 337 88 21337 143 1592 11403
NM_133638chr521199 1103 ----21062 87
NM_133646chr2105043 4549 4204 3473 3439 1998 1499 228 208 33 25214 467 45402 5281 3544 1448 24798 1136
NM_134265chr1751181 975 255 199 180 1800 11028 1160
NM_138270chrX133472 3031 2761 2703 2637 2543 2445 2220 1245 810 665 592 231 12615 12114 --
NM_138292chr11103473 3448 3351 3320 3072 2604 2357 1254 167 98 12291 22421 929 12887
NM_138333chr982512 2378 2297 860 616 348 342 200 --22412 944 --
NM_138357chr1051819 1261 418 212 188 --2646 229 1456
NM_138426chr772466 2335 2280 2152 2030 1797 942 22128 2122 3571 346 126 12229
NM_138444chr13114751 4693 4368 4254 4193 4094 3943 3849 3784 1554 1148 33639 3160 959 13446 11121
NM_138459chr6103703 3571 3073 2929 2861 2790 2242 1274 680 609 12537 31123 957 573 21165 302
NM_138468chr2105376 5011 4305 4156 4059 3842 1160 869 607 114 25452 1962 --44341 4123 244 220
NM_138473chr1283932 3879 3778 3464 3445 3246 443 367 11769 --14395
NM_138494chr7112786 2665 2516 2506 2483 2421 2142 567 419 248 23 22363 388 ----
NM_138576chr1454653 4335 3788 3757 1887 24752 3729 34696 4503 1338 13283
NM_138621chr273328 3252 2907 2889 2591 931 833 --42860 2797 2691 665 --
NM_138638chr1482419 2409 2364 2045 893 730 531 352 1741 42352 2111 1783 1673 1143
NM_138713chr16248219 8136 7935 7312 7253 7094 6972 6625 6387 6244 5987 5937 5790 5003 3148 2995 2976 2665 2554 2518 2397 2029 769 96 26222 6216 27604 2186 28210 1146
NM_138714chr16248219 8136 7935 7312 7253 7094 6972 6625 6387 6244 5987 5937 5790 5003 3148 2995 2976 2665 2554 2518 2397 2029 769 96 26222 6216 27604 2186 28210 1146
NM_138731chr14224244 4235 4143 4076 4051 3721 3295 3289 3128 2850 1565 1351 924 899 827 719 567 547 540 275 200 159 13268 33777 3141 387 --
NM_138771chr7111579 1392 1376 1323 1099 1055 1013 988 506 454 358 --11402 --
NM_138782chr5102382 2279 2188 2077 2013 1947 1541 889 577 215 1324 32360 1487 909 12002
NM_138959chr1116787 6406 5223 4464 2691 1876 559 451 134 55 43 1459 24626 1892 16840
NM_138970chr1472444 2019 1915 1829 1648 1501 928 --21934 1790 12084
NM_139014chr682121 1792 1657 1467 931 679 420 396 --11689 1155
NM_139136chr1251083 991 955 842 820 2798 780 --1720
NM_139169chr106722 587 344 252 246 218 1738 22282 125 11478
NM_139182chr461702 1500 713 667 156 41 --31730 1661 552 --
NM_139319chr1251633 1451 1347 1180 738 --299 50 1145
NM_144563chr25755 704 600 197 164 --3275 225 178 --
NM_144563chr25755 704 600 197 164 --3275 225 178 --
NM_144571chr4256957 5948 5891 5648 5586 5543 5127 5000 4281 4258 2545 2372 2267 2241 1922 1720 1590 1554 1462 986 913 710 193 81 66 11874 46902 4816 2017 1910 --
NM_144578chr14175509 5497 5070 4903 4788 4685 4049 3846 3733 3611 2171 2036 1746 1480 1096 373 260 23807 1892 11545 31900 1578 1334
NM_144590chr10122936 2573 2348 2305 2299 2238 2193 2186 2125 2085 1115 862 11052 43018 2032 1059 647 1956
NM_144599chr15185502 5288 5169 5153 4885 4381 4360 3958 3525 3333 1849 1508 774 760 752 478 364 279 35102 2200 1283 --15321
NM_144632chr2122380 2341 2179 1933 900 890 878 767 756 454 99 21 11626 12258 1967
NM_144664chr11102583 2474 2440 2314 828 763 634 621 529 221 22059 2053 193 --
NM_144778chr13132731 2483 2291 2241 2196 2168 1810 1757 980 763 383 315 190 --22601 2024 22501 2391
NM_144949chr292372 2315 1925 1810 1676 1596 986 340 125 12440 --12480
NM_144963chr862502 2367 2041 1825 1047 259 22654 122 --22427 2344
NM_144973chr12195331 5122 5039 4856 4622 4429 4221 4055 3737 3628 1442 1290 987 694 375 317 284 226 152 --34381 4338 2045 --
NM_145010chr1081470 919 822 792 655 570 372 34 --31525 515 172 1589
NM_145055chr18103653 3530 3266 3037 1289 852 525 386 314 229 11085 23453 695 --
NM_145176chr672720 2626 2484 1284 1214 641 561 42997 1380 932 232 22465 616 22316 652
NM_145206chr10112424 2136 1326 1096 968 956 908 819 625 552 501 1266 2690 157 --
NM_145259chr2367050 7018 6943 6911 6815 6734 6701 6644 6586 6224 6176 6137 6019 5486 5456 5343 5242 5178 4913 2808 2772 2662 2646 2463 2375 2168 1926 1775 1311 1292 1196 1114 810 297 275 262 16967 66347 1104 1014 997 689 485 36478 6239 926
NM_145263chr4122310 2279 2002 1686 1566 1552 775 744 703 414 179 148 3664 451 106 ----
NM_145307chr10124103 4078 3807 3711 3560 3166 3016 2856 364 355 238 95 1570 24366 3376 54688 2931 1231 955 843
NM_145320chr783221 2858 2283 1241 1070 878 529 178 11383 23372 459 1734
NM_145321chr783221 2858 2283 1241 1070 878 529 178 11383 23372 459 1734
NM_145322chr783221 2858 2283 1241 1070 878 529 178 11383 23372 459 1734
NM_147128chr7101635 1406 1344 1250 1210 1155 644 635 532 517 21360 667 21368 1278 --
NM_147147chr663087 3049 2649 941 270 244 --44223 3746 3140 3119 --
NM_147175chrX82188 2076 1902 1419 433 328 277 229 --2592 409 --
NM_148174chr8112198 2121 2089 1633 1582 1416 819 491 405 396 256 --11979 11945
NM_148955chr15126332 6126 5981 4538 2513 2121 2029 1560 1476 1420 289 275 55019 2545 2379 2333 1806 26283 377 13999
NM_148957chr1362642 2511 2466 2275 2197 1710 --11775 1443
NM_152227chr203654 558 83 --3583 565 124 1173
NM_152261chr12102212 1643 956 635 570 299 266 251 222 125 ----22504 1831
NM_152265chr171464 1376 1353 1015 452 214 207 --31451 554 114 --
NM_152270chr1771909 1900 1883 1807 1751 1683 1508 1658 21467 34 11454
NM_152292chr471775 1533 1441 871 410 209 64 --21760 179 32225 1555 517
NM_152330chr14102651 2606 2425 1938 1890 1009 283 204 173 127 --21909 789 --
NM_152332chr14132752 2644 2571 2191 2167 2008 1867 1767 685 348 243 200 163 2756 286 3933 717 183 12884
NM_152388chr2143618 3270 3133 2786 1536 1502 1459 1411 1002 435 377 345 147 61 2477 137 ----
NM_152389chr231304 1176 1149 11166 11070 11383
NM_152400chr4132114 2088 2018 1966 1619 1525 1502 649 633 545 389 199 186 --22072 476 11747
NM_152402chr42530 26 1223 --3718 664 643
NM_152409chr5133560 3473 3379 3360 3324 3251 2880 1444 1314 1019 879 767 527 ----11398
NM_152422chr981873 1839 563 503 276 174 47 21 1255 21574 1443 --
NM_152437chr1232372 1931 524 --2550 90 22445 2160
NM_152450chr1591452 1346 701 685 665 432 185 146 126 ----1353
NM_152487chr121396 879 --11155 21286 936
NM_152519chr282236 2206 609 546 435 427 249 32 --32151 1841 802 --
NM_152529chr2124467 4308 4229 3789 3690 2934 2705 1001 941 267 245 129 --13814 14392
NM_152551chr6102792 2717 2614 2480 1890 858 493 300 162 59 11864 32773 1002 467 --
NM_152556chr7102523 2246 2238 2004 1714 1656 788 731 533 410 12460 21884 1642 --
NM_152613chr2241262 1183 983 866 --21173 1126 1830
NM_152622chr5113430 3291 3284 3275 3087 3004 2872 2358 1049 1000 180 13389 33199 3021 1199 12218
NM_152624chr5207193 6744 6705 6693 6625 5847 5130 4805 2961 2550 2425 2189 2114 2068 1989 1788 1358 848 717 572 17234 22247 25 26129 2984
NM_152629chr9104056 4026 3206 1619 1459 1436 1068 902 667 336 --33439 2956 2734 32946 2910 1295
NM_152630chrX101451 1407 1159 1103 475 320 250 209 186 68 11199 11589 1400
NM_152636chr1193128 2915 1102 995 951 919 856 689 549 12462 --1985
NM_152641chr1262390 2240 1895 500 336 325 12013 31905 621 379 --
NM_152695chrX102309 2061 2043 1886 1726 1689 1578 788 777 487 --11468 --
NM_152707chr1081078 1068 1033 1026 950 898 828 745 1942 2919 220 1790
NM_152723chr1151121 1062 717 254 82 --2295 45 1699
NM_152724chr1061911 1831 1787 1775 915 436 --11840 32758 352 297
NM_152754chr7213831 3793 3696 3648 3468 3314 2651 2632 2548 2493 2484 2392 2341 1523 1496 754 408 355 256 215 151 33383 3252 1456 33632 1127 765 12405
NM_152756chr5134368 4195 4172 3815 3799 3459 3298 3131 2946 2899 2788 1430 107 13090 23738 762 --
NM_152758chr8122463 2385 2319 2061 1200 1034 1005 776 711 628 492 246 --12265 --
NM_152774chr792291 2279 2273 2133 1994 744 711 501 139 1633 --2957 371
NM_152785chr372608 2343 2337 1631 895 865 854 32516 2056 883 32236 1840 907 --
NM_152787chrX143744 3453 3365 3270 2988 2907 1534 1521 1331 1196 823 605 595 500 11059 13614 13303
NM_152793chr7104611 4507 4435 3509 1972 923 731 713 642 484 --24408 161 14794
NM_152826chr15126332 6126 5981 4538 2513 2121 2029 1560 1476 1420 289 275 55019 2545 2379 2333 1806 26283 377 13999
NM_152835chr1102873 2541 1853 1135 710 432 310 298 189 82 --22502 1979 --
NM_152838chr2073296 3064 2975 2816 2716 2486 640 2911 693 12186 1342
NM_152890chr151302 1254 1162 267 195 ----21210 1185
NM_152903chr1362574 2517 2483 2310 1910 458 --31927 83 74 12349
NM_152919chr1973818 3779 3610 3291 3085 642 269 13172 2768 497 13572
NM_152995chr43710 563 74 --1227 2829 66
NM_152999chr7145010 4845 4825 4065 3741 3638 3460 3236 3225 3121 1253 618 313 81 --74906 4245 3652 3595 3478 3216 3075 43631 1265 821 173
NM_153013chr592489 2330 2200 1840 1537 904 691 505 41 --3853 842 310 --
NM_153042chr6131783 1645 1636 1546 1507 1477 1215 1160 742 634 475 436 117 --11240 11494
NM_153182chr383193 3064 2705 2327 1314 798 415 157 22254 295 13272 1706
NM_153184chr3101945 1843 1823 1726 1652 1494 1301 615 326 257 11775 21544 762 --
NM_153188chr5135612 5334 5066 4529 4357 3912 1891 1518 1440 1315 1070 236 86 34461 2253 328 35592 3763 1108 --
NM_153207chr12204029 3741 3725 3619 3610 3521 3442 2880 2492 1569 1446 1304 1193 1169 1132 1059 1026 737 196 145 --31265 909 472 11558
NM_153235chr682334 2242 2038 1574 708 613 511 360 --22090 1944 11862
NM_153262chr1103091 3054 2946 2623 2567 2452 2337 1271 607 178 1379 --12294
NM_153332chr8123247 2975 2910 2665 2460 2435 2384 1009 973 835 350 275 42220 655 453 328 ----
NM_153354chr56900 850 275 176 137 124 --3884 763 51 --
NM_153365chr4112787 2725 2564 2503 2216 2160 2087 2041 704 496 138 12263 22274 94 --
NM_153367chr1083979 3625 3193 2955 2833 2727 2557 2483 23002 2812 22985 2869 23563 3103
NM_153456chr13176184 4991 4685 4351 4344 4210 3983 3878 2200 1781 1518 1474 1356 1274 1168 1051 910 24029 425 24475 2238 26341 845
NM_153605chr371650 1381 617 553 481 374 223 --1179 21183 216
NM_153607chr5132936 2766 2278 2144 1264 770 764 705 675 637 524 318 248 --2565 32 11114
NM_153616chr1542425 887 445 378 12060 --21972 426
NM_153617chr1542425 887 445 378 12060 --21972 426
NM_153618chr1542425 887 445 378 12060 --21972 426
NM_153634chr1281678 1435 1310 1293 1028 497 227 175 21461 24 31594 332 151 --
NM_153645chr22113333 2823 2626 2375 2131 2114 2105 1109 1032 765 161 --22502 1041 12355
NM_153689chr262177 1607 1511 931 259 139 --42160 1573 568 405 --
NM_153705chr11112585 2520 2496 2436 1982 1779 911 628 335 221 156 1533 52605 2038 1929 1801 742 1523
NM_153712chr283569 3324 3111 3078 2749 1127 751 732 23665 2562 --12523
NM_153748chr1251083 991 955 842 820 2798 780 --1720
NM_153810chr1094777 4532 4379 4227 3476 2045 1904 1885 331 34743 3973 1735 14610 --
NM_170665chr1254410 4343 4192 3991 3864 1438 34465 748 240 24500 4176
NM_170709chr8102342 2190 2143 2095 1646 1587 515 137 84 74 --22205 491 --
NM_170710chr4213111 3092 2970 2805 2766 2732 2601 2555 2487 2368 2229 2179 1250 1204 1190 701 597 430 422 412 163 12171 32659 2008 331 43222 2418 552 316
NM_170731chr1192909 2885 2749 2719 2677 2321 2026 1126 691 1493 32688 929 421 22279 2063
NM_170732chr1192909 2885 2749 2719 2677 2321 2026 1126 691 1493 32688 929 421 22279 2063
NM_170733chr1192909 2885 2749 2719 2677 2321 2026 1126 691 1493 32688 929 421 22279 2063
NM_170734chr1192909 2885 2749 2719 2677 2321 2026 1126 691 1493 32688 929 421 22279 2063
NM_170735chr1192909 2885 2749 2719 2677 2321 2026 1126 691 1493 32688 929 421 22279 2063
NM_172069chr2132335 2283 1815 1785 1722 1620 1555 1502 779 719 620 399 332 --22194 159 1172
NM_172070chr272242 2136 2122 1461 1432 474 189 ----21886 1548
NM_172071chr1137437 7095 5987 5608 5594 4541 2731 1962 1158 800 544 322 223 12547 27448 1175 1480
NM_172103chr692685 2653 2218 2111 1899 1821 977 603 597 --12162 11683
NM_172105chr692685 2653 2218 2111 1899 1821 977 603 597 --12162 11683
NM_172159chr3102259 2195 1936 1802 1583 713 513 483 339 275 11545 2950 663 22203 1632
NM_172160chr3102259 2195 1936 1802 1583 713 513 483 339 275 11545 2950 663 22203 1632
NM_172193chr1451230 1169 1140 356 164 11109 31285 514 223 1479
NM_173060chr562008 1929 1732 1650 538 282 --42056 1864 1757 154 --
NM_173061chr562008 1929 1732 1650 538 282 --42056 1864 1757 154 --
NM_173063chr562008 1929 1732 1650 538 282 --42056 1864 1757 154 --
NM_173082chr661291 1253 560 191 177 153 --41605 1590 520 356 --
NM_173083chr171311 1076 1045 996 978 899 523 11031 2266 250 --
NM_173198chr992598 2246 2218 2007 1921 1872 1057 713 450 ----22304 2294
NM_173200chr992598 2246 2218 2007 1921 1872 1057 713 450 ----22304 2294
NM_173214chr16248219 8136 7935 7312 7253 7094 6972 6625 6387 6244 5987 5937 5790 5003 3148 2995 2976 2665 2554 2518 2397 2029 769 96 26222 6216 27604 2186 28210 1146
NM_173468chr4225743 5690 5212 5097 4959 4917 4690 4554 4435 4416 4388 4226 4169 4028 2377 2017 1512 1277 717 685 421 273 45286 5239 4626 450 56025 4345 2422 1778 596 24607 1416
NM_173510chr22132597 2203 1991 1958 1882 1168 1132 607 423 338 265 114 32 --12700 --
NM_173511chr253398 3005 2894 675 647 21340 266 1733 12802
NM_173531chr19173913 3892 3809 2981 2921 2716 2643 2485 1271 1181 1115 980 844 519 407 244 91 21237 660 42625 928 506 397 1823
NM_173552chr382438 2300 2239 1579 858 800 277 199 1397 22362 2262 3910 767 621
NM_173576chr1072098 1843 1767 1677 1645 443 130 11474 11570 1195
NM_173582chr11166092 5393 5081 4891 4638 3872 2216 2185 2128 1792 1088 860 389 247 167 113 25888 1303 ----
NM_173602chr12113726 3646 3593 3351 2888 2737 2373 1364 876 661 192 --33809 1495 1401 --
NM_173607chr14132149 1963 1886 1781 1545 1399 1352 1300 825 706 566 188 135 1657 1119 11760
NM_173642chr1127450 6837 5907 3619 3289 2015 1869 1818 1754 1747 1241 187 29165 9154 39244 3315 623 --
NM_173644chr2051747 1682 1638 1614 1587 2702 484 11358 1472
NM_173654chr332297 1837 1496 22398 818 52002 1764 1732 1712 804 --
NM_173694chrX92411 2341 2185 2059 928 755 606 594 167 42472 2012 893 540 12235 --
NM_173698chrX91765 1652 1418 724 390 341 290 239 219 21404 740 21311 821 1320
NM_173797chr571145 957 386 260 229 206 192 1883 11112 --
NM_173808chr1214479 4410 3782 3714 3689 3662 3583 3549 3543 3516 3284 1400 1210 888 856 661 630 498 472 361 349 11043 34492 4040 1707 24418 1158
NM_173812chr1261551 1455 1101 1094 271 244 1182 31539 1485 1303 --
NM_173825chr393124 2645 2373 2345 2039 2031 1229 622 247 1887 32774 2360 855 12353
NM_173826chr391684 1644 1575 1467 1418 1255 666 625 533 --158 --
NM_173829chr5175784 5549 5489 5262 4563 4273 4254 4224 3988 2316 1447 943 791 469 463 224 185 24841 1332 65831 5005 2478 2151 1782 610 36018 4986 1924
NM_173851chr893995 3624 3492 3004 2961 2926 803 544 534 11167 1669 23795 3383
NM_175056chr3102222 2122 2112 1729 1455 415 351 279 224 103 --21385 247 11946
NM_175623chr12297702 7492 7343 7256 7150 7006 6464 6262 5895 5540 4977 4688 3022 2376 2036 1943 1919 1587 1266 1248 1175 1050 974 943 879 776 594 270 56 35878 5063 2410 --47683 7325 5790 5569
NM_175624chr12297797 7587 7438 7351 7245 7101 6559 6357 5990 5635 5072 4783 3117 2471 2131 2038 2014 1682 1361 1343 1270 1145 1069 1038 974 871 689 365 151 35973 5158 2505 --47778 7420 5885 5664
NM_175625chr12297797 7587 7438 7351 7245 7101 6559 6357 5990 5635 5072 4783 3117 2471 2131 2038 2014 1682 1361 1343 1270 1145 1069 1038 974 871 689 365 151 35973 5158 2505 --47778 7420 5885 5664
NM_175736chr1297726 7528 7191 6915 6553 6519 5934 5568 2721 17356 27272 1164 16832
NM_175854chr1362579 2469 1965 1921 1711 521 22726 1725 22628 2261 --
NM_175861chr12236010 5995 5910 5858 5529 4955 4900 4859 4678 4589 3851 1980 1859 1320 1146 931 856 800 727 641 572 529 499 44967 1635 1293 1093 65978 5705 5032 1238 873 408 24886 4811
NM_175876chr1132777 2676 2486 2441 2424 2233 2123 2032 2022 1900 1109 636 586 --21812 861 11823
NM_176081chr10225885 5841 5691 5469 5190 5092 4585 4405 4388 4235 3646 2239 2223 2124 1930 1704 1255 562 538 326 260 247 --45486 4718 1868 457 --
NM_176083chr10225885 5841 5691 5469 5190 5092 4585 4405 4388 4235 3646 2239 2223 2124 1930 1704 1255 562 538 326 260 247 --45486 4718 1868 457 --
NM_176814chr7121503 1467 1417 1380 1335 1256 1173 1116 1097 973 449 298 1498 3530 514 129 1360
NM_176824chr491277 1083 921 484 373 317 307 129 52 --1121 --
NM_177414chr151758 1694 1456 1318 137 ----31578 1566 1412
NM_177438chr14103872 3797 3736 3139 3094 2962 2938 1035 961 863 --24100 3451 --
NM_177531chr881142 804 366 255 172 129 98 36 --21175 110 --
NM_177538chr2118136 7227 7017 5471 3184 2402 2293 2145 1836 1322 360 192 28861 1195 15690
NM_177553chr115983 807 762 178 135 1279 2939 600 1119
NM_177947chrX41191 1182 1099 452 2181 113 41447 1259 1040 239 --
NM_177948chrX41191 1182 1099 452 2181 113 41447 1259 1040 239 --
NM_177985chr2122260 1710 1614 1564 1390 567 538 441 420 411 393 85 31971 1641 1508 --22242 1862
NM_177990chr2062063 1972 1778 1731 1659 1489 --1788 11713
NM_177995chr981873 1839 563 503 276 174 47 21 1255 21574 1443 --
NM_177996chr2063441 993 692 177 171 161 ----1970
NM_178006chr1342318 2109 781 332 22381 874 --22338 959
NM_178007chr1342318 2109 781 332 22381 874 --22338 959
NM_178011chr1063166 2831 2345 1223 1067 752 --12417 23237 2184
NM_178140chr572710 2517 2482 1912 1799 1109 694 --1988 2902 411
NM_178151chrX157396 7095 6953 6736 6693 5778 2815 2436 1552 1516 1300 1255 946 380 260 17879 27033 6570 16469
NM_178152chrX157396 7095 6953 6736 6693 5778 2815 2436 1552 1516 1300 1255 946 380 260 17879 27033 6570 16469
NM_178153chrX157396 7095 6953 6736 6693 5778 2815 2436 1552 1516 1300 1255 946 380 260 17879 27033 6570 16469
NM_178498chr11114062 3913 3238 3007 2812 2763 1242 813 485 399 91 13724 43734 1356 863 364 13353
NM_178509chr1784038 3991 3706 3289 3016 1390 1270 368 33904 3045 2584 22947 2563 12961
NM_178566chr951735 1230 1194 670 495 11610 21556 743 11882
NM_178585chr4143186 3123 2914 2510 2210 1224 1204 1178 984 933 657 558 433 212 22711 1139 22884 755 --
NM_178586chr1452406 2359 2286 2100 785 --32432 1864 1701 22307 1947
NM_178815chr1072742 2476 950 912 844 446 284 1770 52407 2187 739 707 315 --
NM_180989chr1371948 887 515 465 264 192 182 --2388 296 --
NM_180991chr5102832 2823 2714 2204 1906 1860 614 436 384 134 31801 960 762 ----
NM_181077chr15102111 2069 1963 1874 1794 1703 1660 1542 1418 770 ----12061
NM_181265chr4213111 3092 2970 2805 2766 2732 2601 2555 2487 2368 2229 2179 1250 1204 1190 701 597 430 422 412 163 12171 32659 2008 331 43222 2418 552 316
NM_181332chrX82704 2526 2468 2068 1782 758 628 228 ----22762 2079
NM_181358chr1114246 4113 3926 2592 1335 1318 1286 1263 1247 766 62 1587 31214 1183 327 --
NM_181361chr361464 1399 970 926 898 373 41308 1243 1237 1025 1415 --
NM_181481chr18186708 6313 5742 5427 5007 4876 4800 4681 4662 4510 4341 2126 1577 1106 1030 718 681 483 25210 955 31596 1562 605 26191 5204
NM_181482chr18186708 6313 5742 5427 5007 4876 4800 4681 4662 4510 4341 2126 1577 1106 1030 718 681 483 25210 955 31596 1562 605 26191 5204
NM_181483chr18186708 6313 5742 5427 5007 4876 4800 4681 4662 4510 4341 2126 1577 1106 1030 718 681 483 25210 955 31596 1562 605 26191 5204
NM_181504chr5133570 3340 3024 2787 2769 1175 1165 1157 957 925 851 720 708 1572 21011 900 --
NM_181521chr16146760 5947 5757 4641 4501 2889 2852 2495 2436 2286 2248 1426 671 351 12573 25205 4446 14400
NM_181523chr5133570 3340 3024 2787 2769 1175 1165 1157 957 925 851 720 708 1572 21011 900 --
NM_181524chr5133570 3340 3024 2787 2769 1175 1165 1157 957 925 851 720 708 1572 21011 900 --
NM_181645chr117677 606 549 459 288 273 155 --2452 68 --
NM_181659chr20143253 3241 2930 2755 2742 2146 1329 1005 988 974 749 399 239 183 --11068 12895
NM_181659chr20143253 3241 2930 2755 2742 2146 1329 1005 988 974 749 399 239 183 --11068 12895
NM_181702chr821004 392 --31049 969 747 1789
NM_181705chr5225681 5052 4839 4717 4674 4474 4415 4352 4155 4139 3747 2154 1780 1758 1423 1260 1156 899 746 552 271 187 35606 1128 840 25428 5343 35438 612 424
NM_181714chr631900 1692 224 21615 642 395 45 37 21964 1644
NM_181723chr8101936 1922 1762 1555 1514 1435 670 450 274 198 31916 1490 318 22335 2030 --
NM_181780chr372054 1723 661 579 572 117 85 --41835 1815 1564 397 --
NM_181782chr6102311 2256 2070 1760 718 527 462 387 282 22 22081 1633 --32062 1440 572
NM_181783chr1251988 1953 1389 617 210 11878 --1223
NM_181787chr8153878 3847 3050 1082 956 884 562 495 482 326 308 275 215 198 192 --1104 --
NM_181789chr1583195 2324 2300 2206 2163 2155 1247 96 --32881 2683 1196 1499
NM_181836chr592538 2209 1954 868 510 425 367 83 41 11912 21778 226 3704 679 556
NM_182485chr4133737 3472 3291 2892 2731 2444 1309 1209 1017 809 427 284 232 23366 3267 53728 3604 2710 2383 1403 --
NM_182503chr6155513 5485 5323 5125 5016 4759 4658 4006 3963 3755 3604 2019 1399 1259 946 13441 15297 24034 2241
NM_182515chr19236564 6222 6190 6012 5986 5447 4965 4946 2480 2170 2135 2099 1693 1552 1442 1334 1269 1135 1107 1086 673 265 256 11235 26168 5964 56525 6034 5832 1575 1398
NM_182551chr2113535 3390 2971 2829 2708 2642 1340 1130 130 98 48 1250 31166 884 159 --
NM_182607chrX31713 1327 1301 41561 1542 1335 692 --1309
NM_182646chr4133737 3472 3291 2892 2731 2444 1309 1209 1017 809 427 284 232 23366 3267 53728 3604 2710 2383 1403 --
NM_182700chr7101977 1956 1837 1796 1613 1604 1565 1418 1320 1259 1670 11409 11463
NM_182758chr15173947 3891 3466 2979 2967 2486 2426 1481 1193 1007 1000 820 757 664 601 540 276 12714 43935 968 229 201 13113
NM_182762chr7125886 5862 5773 4870 4460 4415 1814 1507 1055 807 294 263 34064 4022 3979 66196 5805 5046 4861 4646 410 16155
NM_182765chr1081986 1791 887 862 822 786 150 143 1465 --22360 122
NM_182767chr12132127 2107 2064 1934 1871 1861 1607 1599 1575 1563 1523 661 452 --2531 278 --
NM_182797chr2051533 1441 1258 155 130 11560 21704 1120 21801 1179
NM_182830chr14122280 2115 2077 2047 1956 1795 1763 1715 1668 1662 505 180 11599 --11693
NM_182898chr7196568 6200 6181 6088 5705 5652 5378 4989 4825 4221 4078 4064 3975 2505 2366 2080 2007 200 148 36576 2638 1757 26188 5391 1522
NM_182899chr7196568 6200 6181 6088 5705 5652 5378 4989 4825 4221 4078 4064 3975 2505 2366 2080 2007 200 148 36576 2638 1757 26188 5391 1522
NM_182920chr3101443 572 540 490 453 371 264 231 198 132 1503 --1478
NM_182943chr36478 394 383 337 180 94 --31152 308 237 --
NM_182948chr173047 2451 2335 2324 2276 1250 409 12767 22131 1938 --
NM_182972chr162634 2449 2170 1950 1134 101 12430 --32782 2479 2399
NM_182977chr541138 444 328 248 --3877 386 210 2897 70
NM_183050chr662197 2113 1996 1835 1738 1498 --22379 2206 12427
NM_183079chr2091573 1565 1492 1297 1280 1218 1127 427 243 --21103 636 --
NM_183227chr641631 592 509 323 --1135 21476 1086
NM_183234chr1561473 1440 554 510 488 475 --2217 181 21591 1385
NM_183235chr1561473 1440 554 510 488 475 --2217 181 21591 1385
NM_183236chr1561473 1440 554 510 488 475 --2217 181 21591 1385
NM_194247chr2164521 4464 4421 4347 4235 4153 4138 2937 1748 1667 1624 1458 1246 982 772 390 44256 4092 3324 1813 24453 4322 --
NM_194282chr493111 2927 2734 2561 1966 840 529 406 299 1552 --22104 621
NM_194283chr5153905 3731 3525 3428 3329 3243 3227 2844 2711 1628 1394 948 727 287 221 23517 933 13188 --
NM_194285chr11123383 3190 3148 3109 2405 2095 1275 1163 893 680 506 171 --43451 3233 797 162 1971
NM_194291chr8103016 2839 2092 1916 1124 1116 568 559 100 56 32695 421 194 12560 --
NM_194301chr1481111 1082 1022 961 906 832 404 386 1166 11172 --
NM_194314chr1215659 5560 5351 5040 4490 4100 3569 2253 2184 2164 1965 1795 1771 1113 961 825 756 740 295 194 168 21919 460 35567 5514 1635 25481 3841
NM_194328chr993335 3162 2974 2898 2861 2680 2443 2329 1029 2902 879 13178 --
NM_194329chr993335 3162 2974 2898 2861 2680 2443 2329 1029 2902 879 13178 --
NM_194330chr993335 3162 2974 2898 2861 2680 2443 2329 1029 2902 879 13178 --
NM_194332chr993335 3162 2974 2898 2861 2680 2443 2329 1029 2902 879 13178 --
NM_194356chr1292383 2338 2252 2182 1946 1720 1531 936 438 21507 413 52297 1611 921 421 397 --
NM_194434chr18205717 5682 5539 5032 4780 4774 4665 4454 4023 4017 3860 3777 2129 1476 1421 1189 1156 1020 382 330 33932 1801 494 35092 5009 2021 --
NM_194463chrX91259 1252 1221 858 831 786 358 322 198 1132 31271 485 159 --
NM_198076chr191879 1851 1702 1662 607 585 562 307 224 1412 --1717
NM_198150chr551494 1348 1187 597 43 --31378 1042 605 21526 542
NM_198158chr3132833 2322 1108 983 808 772 746 664 552 468 369 234 211 --2790 299 --
NM_198159chr3132833 2322 1108 983 808 772 746 664 552 468 369 234 211 --2790 299 --
NM_198177chr3132833 2322 1108 983 808 772 746 664 552 468 369 234 211 --2790 299 --
NM_198178chr3132833 2322 1108 983 808 772 746 664 552 468 369 234 211 --2790 299 --
NM_198181chr15102495 2448 2374 2366 2271 2197 2099 1935 694 53 11918 ----
NM_198212chr7112129 1782 1755 942 821 679 604 521 499 420 102 --22066 537 --
NM_198215chr1081412 1282 1253 1142 986 344 287 267 --31470 1444 280 --
NM_198225chr1061909 1868 1322 704 671 620 1681 2687 347 --
NM_198240chr1281345 1307 1205 1186 1175 473 438 369 --3497 191 134 --
NM_198261chr123638 258 227 ----2724 145
NM_198262chr123638 258 227 ----2724 145
NM_198268chr1114246 4113 3926 2592 1335 1318 1286 1263 1247 766 62 1587 31214 1183 327 --
NM_198269chr1114246 4113 3926 2592 1335 1318 1286 1263 1247 766 62 1587 31214 1183 327 --
NM_198270chrX83464 3296 3287 2800 705 653 563 476 --22166 617 32508 2141 1394
NM_198273chr5113071 2939 2803 2590 2134 2063 2045 1972 785 233 22 --53004 2774 1150 583 409 12832
NM_198281chr4183502 3341 3330 3124 2928 2890 2582 2266 1339 1211 1146 1070 650 582 575 566 281 111 --43233 2969 2942 2518 33039 2508 180
NM_198320chr12105254 4259 4132 4122 4072 3547 847 750 351 272 --45227 4415 4394 1591 1534
NM_198399chr321492 116 1348 1129 21832 624
NM_198400chr15102865 2160 1863 940 908 860 732 645 344 89 11012 22274 393 22798 2346
NM_198465chrX122893 2820 2746 2485 2214 2156 1893 1184 1112 996 290 219 --32558 2188 905 --
NM_198503chr1132322 2279 2178 1994 1942 1816 1511 842 833 395 191 138 90 --51615 735 700 583 452 --
NM_198569chr6142707 2619 2610 1996 1885 1748 1010 702 660 622 421 257 80 36 12080 12058 1577
NM_198578chr1241243 174 148 71 11108 41044 986 496 57 1423
NM_198581chr2217575 7562 7274 7174 6820 6320 6264 6092 2175 2005 1981 1690 1665 1389 1213 1067 1059 598 465 287 177 3582 554 126 36854 1402 914 17326
NM_198715chr1276306 6223 6073 5895 5570 5424 5349 5304 5177 4889 4628 4480 4402 3899 3884 2507 1926 1762 1021 808 687 640 506 487 317 244 193 25051 2046 95952 5926 5360 4006 1129 1007 893 530 47 --
NM_198793chr333885 1526 1013 23957 2960 43669 2999 1419 393 24113 3944
NM_198794chr1481485 1341 1165 1088 914 462 151 39 11080 21306 1047 --
NM_198859chr374531 4456 1376 1327 785 543 75 31742 466 192 34645 3983 447 --
NM_198900chr1297726 7528 7191 6915 6553 6519 5934 5568 2721 17356 27272 1164 16832
NM_198904chr592036 1968 1903 1854 1437 830 795 460 265 1147 1547 --
NM_198956chr7101977 1956 1837 1796 1613 1604 1565 1418 1320 1259 1670 11409 11463
NM_198968chr13103978 3801 3713 3439 3250 2463 1545 1353 806 665 149 43487 2957 853 382 --
NM_198990chr793314 3124 2907 2856 2075 1004 919 834 321 --33001 904 136 1240
NM_199000chr7102272 2154 1792 1757 1743 1598 803 335 306 126 1846 1929 --
NM_199040chr1253001 1010 863 696 673 13417 23087 183 2711 430
NM_199072chr7142736 2678 2665 2621 2415 2366 2218 2150 1987 1289 1061 1038 338 266 12315 32997 2756 2263 12452
NM_199188chr1284040 3921 3801 3004 1014 662 250 215 13126 33865 3323 392 11425
NM_199190chr1284040 3921 3801 3004 1014 662 250 215 13126 33865 3323 392 11425
NM_199320chr482859 2789 2550 2193 557 381 367 277 12588 12517 12247
NM_199320chr482859 2789 2550 2193 557 381 367 277 12588 12517 12247
NM_199324chr4173631 3550 3215 3068 3020 2495 2364 909 795 659 600 586 566 455 402 365 271 13266 1893 1772
NM_199421chr14144931 4909 4429 4302 4247 3364 3326 1761 1413 1350 450 350 198 51 21783 1769 74555 3891 2028 1922 1794 1513 410 1612
NM_199436chr2112841 2312 2084 2016 1180 1151 890 687 335 184 171 12821 22773 1248 11207
NM_199437chr1162567 2489 2464 1587 865 814 --52409 2384 1900 1667 1602 1320
NM_199438chr1162567 2489 2464 1587 865 814 --52409 2384 1900 1667 1602 1320
NM_199439chr1162567 2489 2464 1587 865 814 --52409 2384 1900 1667 1602 1320
NM_199482chr282111 1894 1798 1373 1294 594 380 21 --21689 412 --
NM_201278chr1151559 1488 843 754 454 2325 238 21904 226 --
NM_201281chr1151559 1488 843 754 454 2325 238 21904 226 --
NM_201437chr851053 499 457 294 271 1563 21362 23 1415
NM_201548chr26937 597 502 337 56 26 --11496 41405 1077 426 401
NM_203282chr19131532 1194 1159 713 704 681 611 500 445 432 309 154 45 --31858 1691 318 1744
NM_203341chr151055 941 923 803 234 --2278 196 1126
NM_203391chrX51801 1695 1281 1222 1186 11359 31414 1351 194 11638
NM_203394chr1272712 2124 1799 1718 890 794 633 --21875 868 12727
NM_203406chr5112849 2702 2681 2617 2370 2332 1172 980 780 688 623 21926 826 22176 717 22949 2669
NM_203446chr21103030 2932 2682 2663 2519 2354 2268 1867 920 254 22241 2061 22808 672 --
NM_203451chr1362171 1914 1866 1739 521 194 --2842 533 --
NM_203458chr1113851 3304 2964 2893 2623 2502 1493 1263 1147 1031 839 22997 1049 53332 2369 1188 1171 597 --
NM_203459chr1112208 2120 2061 2032 1815 720 635 604 483 324 213 11881 ----
NM_203463chr2104352 4036 3709 3593 3544 1991 1924 1478 89 53 31675 1266 254 24021 968 --
NM_203504chr492579 2429 2203 1708 1025 1008 989 643 473 --12375 --
NM_203505chr492579 2429 2203 1708 1025 1008 989 643 473 --12375 --
NM_205852chr12102186 2005 1935 1560 831 823 714 644 241 197 11582 1120 1302
NM_205860chr1113002 2934 2437 2054 1943 1241 1149 846 731 675 135 1762 13186 12671
NM_206594chr193593 3548 3223 2830 2737 2226 1294 1218 1023 13669 23533 2902 --
NM_206595chr193593 3548 3223 2830 2737 2226 1294 1218 1023 13669 23533 2902 --
NM_206853chr6134088 3761 3753 3511 3438 2794 1555 1491 1236 909 467 445 132 2569 175 33178 2678 1303 13787
NM_206854chr6125349 5022 5014 4772 4699 4055 3504 1728 1706 1393 894 207 21830 1436 24439 3939 15048
NM_206855chr6146314 5987 5979 5737 5664 5020 4469 4223 2358 1859 1172 668 581 443 23968 2401 35404 4904 22 36013 4057 463
NM_206866chr21143256 3238 2975 2827 2738 2546 2464 2450 2129 2106 1039 497 416 224 1203 12967 12037
NM_206876chr2163317 3055 3038 2939 2903 2890 2815 2694 2445 2283 2190 1234 1119 679 467 191 --32481 2299 528 --
NM_206907chr593363 3333 3293 2801 2778 2633 2174 960 449 --42479 2471 934 376 2840 305
NM_206909chr8248400 8379 8258 8248 8077 7603 7421 6984 6946 6389 6064 5996 5800 5326 5193 5138 3199 2164 2032 1795 1357 1096 875 78 22302 1495 25441 1728 28144 5311
NM_207012chr1063492 2975 1387 1150 968 427 12767 12348 22761 393
NM_207015chr3102368 2245 589 464 275 207 181 153 147 115 11728 2959 774 --
NM_207292chr3183235 3186 3122 2940 2795 2253 2234 2194 2137 2067 2057 1205 1190 944 908 893 529 405 12273 12243 --
NM_207293chr3183235 3186 3122 2940 2795 2253 2234 2194 2137 2067 2057 1205 1190 944 908 893 529 405 12273 12243 --
NM_207294chr3183235 3186 3122 2940 2795 2253 2234 2194 2137 2067 2057 1205 1190 944 908 893 529 405 12273 12243 --
NM_207295chr3183235 3186 3122 2940 2795 2253 2234 2194 2137 2067 2057 1205 1190 944 908 893 529 405 12273 12243 --
NM_207296chr3183235 3186 3122 2940 2795 2253 2234 2194 2137 2067 2057 1205 1190 944 908 893 529 405 12273 12243 --
NM_207297chr3183260 3211 3147 2965 2820 2278 2259 2219 2162 2092 2082 1230 1215 969 933 918 554 430 12298 12268 --
NM_207303chr10103342 2644 1387 1329 1287 1131 966 956 296 182 11605 23653 523 --
NM_207304chr13132618 2370 2178 2128 2083 2055 1697 1644 867 650 270 202 77 --22488 1911 22388 2278
NM_207322chr1572156 2061 1929 1534 1515 552 155 --11508 11836
NM_207361chr13226304 5911 5544 5214 5147 4897 4880 4645 4572 4481 2515 2461 2447 2410 2395 2133 2055 1763 1280 1271 683 124 14522 12297 35074 1792 1633
NM_207366chr751511 718 551 534 454 21658 910 21928 1428 --
NM_207406chr4206435 6407 5484 5174 4913 4762 4755 4741 4469 4341 4252 2525 2495 2072 2003 1689 1620 1459 523 59 21331 200 --36568 4211 2092
NM_207491chr441474 1279 1219 1086 --11238 21309 322
NM_207647chr982603 2537 2479 2183 1897 1719 1592 921 1181 22565 597 --
NM_212558chr9163791 3288 3268 3239 3221 3196 2876 2678 1553 1476 1335 1285 1202 1193 275 36 --24284 1705 11582
NM_213589chr2185549 5410 5397 5313 5162 4449 4021 3973 2202 2111 2091 1856 1815 1201 1019 966 647 29 --13548 --
NM_213590chr13235259 5199 5076 4966 4669 4473 4180 4063 3742 3697 3398 2064 2023 1934 1583 1184 972 845 732 308 292 238 109 --35040 3592 3457 13917
NM_213606chr10102722 2417 2275 2266 2174 1685 1097 947 264 142 --42710 2578 2191 1764 42136 2084 1085 860
NM_213609chr341078 861 329 305 --3900 724 159 1340
NM_213651chr191814 1788 1639 1423 500 470 407 283 178 11543 31648 1458 1225 --