TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3145-5p
miRNA Sequence: AACUCCAAACACUCAAAACUCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000555chrX76892 6198 5110 4954 2826 2457 236 11816 17205 1758
NM_000611chr1186693 6078 5656 5381 4617 2614 1658 377 --25877 1912 17010
NM_001017440chr7157897 7676 6959 6634 5662 5627 1871 1651 1284 1212 990 911 649 563 160 --27600 1074 15960
NM_001034841chr1685512 4588 4420 4065 3909 3604 1827 961 14807 13967 25478 3808
NM_001039618chr1141371 912 727 620 1836 11739 23701 2216
NM_001106chr3158158 6505 6363 6148 3900 3586 3491 3437 2215 1962 1853 1088 1020 798 630 --39647 6396 2112 --
NM_002271chr1342419 2146 1498 168 --11971 22327 1544
NM_002657chr2073683 914 758 739 341 321 152 ----13777
NM_002687chr14------21334 1028
NM_003034chr12108119 7658 7174 6544 6404 2588 1986 1237 486 168 16481 --1361
NM_005359chr18126426 6321 6314 6182 6055 6030 4681 4116 4039 2468 2102 1121 ----15278
NM_006047chr2053216 2890 2308 1097 745 --12457 12550
NM_014423chr5115622 5533 5321 5100 5088 4934 4854 3941 2271 1960 336 ------
NM_015020chr1671427 1092 986 753 438 167 154 ----33587 1073 48
NM_030939chr6------31147 1118 936
NM_031468chr7157897 7676 6959 6634 5662 5627 1871 1651 1284 1212 990 911 649 563 160 --27600 1074 15960
NM_152838chr2053216 2890 2308 1097 745 --12457 12550
NM_178151chrX76892 6198 5110 4954 2826 2457 236 11816 17205 1758
NM_178152chrX76892 6198 5110 4954 2826 2457 236 11816 17205 1758
NM_178153chrX76892 6198 5110 4954 2826 2457 236 11816 17205 1758
NM_182757chr632767 2368 390 --33318 3079 237 12240
NM_203329chr1186693 6078 5656 5381 4617 2614 1658 377 --25877 1912 17010
NM_203330chr1186693 6078 5656 5381 4617 2614 1658 377 --25877 1912 17010
NM_203331chr1186693 6078 5656 5381 4617 2614 1658 377 --25877 1912 17010
NM_207406chr496545 5380 4716 4441 2100 1704 1371 650 386 1349 26494 6216 14574