TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3147
miRNA Sequence: GGUUGGGCAGUGAGGAGGGUGUGA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr52327 165 185 ----
NM_000020chr1292109 2039 1600 1520 911 696 201 150 141 21981 555 12289 --
NM_000061chrX150 ----1299
NM_000081chr121236 626 ------
NM_000084chrX166445 6305 6069 5283 5190 4665 4396 2649 2618 2192 1778 1648 1409 1097 898 347 --14263 --
NM_000088chr174474 347 53 37 --11101 2520 456
NM_000092chr243222 2866 800 205 12973 ----
NM_000110chr11845 ------
NM_000114chr2041288 1259 1068 819 ------
NM_000115chr1342492 2281 1823 629 11725 ----
NM_000125chr664275 4099 3668 3600 3503 1232 1111 --11302
NM_000138chr1532209 1729 71 11855 --11917
NM_000165chr611262 1108 ----
NM_000168chr783263 3210 2809 2624 2416 2069 380 120 --23278 2921 --
NM_000176chr572961 2798 2553 2394 941 836 321 12539 ----
NM_000183chr21404 ------
NM_000196chr164508 463 447 114 179 2155 23 --
NM_000208chr1964651 3124 1780 1417 443 104 24645 302 ----
NM_000210chr26566 484 349 270 235 195 ------
NM_000217chr1231090 739 44 --13674 11221
NM_000222chr442109 318 194 92 1211 --11513
NM_000252chrX11463 ------
NM_000259chr1564656 4489 2455 2430 1208 43 25747 1074 ----
NM_000267chr1763303 2939 2788 2695 903 171 12760 --13381
NM_000278chr1052183 2093 1995 235 124 --42190 2075 427 299 1706
NM_000280chr111848 ------
NM_000330chrX61995 1452 1436 890 594 261 11458 11516 1695
NM_000332chr666515 6414 6320 5821 1656 537 1614 26529 4682 14600
NM_000335chr382080 1817 1738 1613 1390 633 503 267 --11964 --
NM_000337chr556331 5457 1637 1570 684 45432 4867 1692 326 --25469 1243
NM_000351chrX93839 3752 3647 3026 2945 2879 1437 1426 167 11322 13769 1157
NM_000368chr9114077 3166 1921 1779 1690 1667 1573 1335 1113 1001 212 21800 1304 ----
NM_000376chr1282630 2239 2158 973 817 311 289 142 12010 31249 1244 163 --
NM_000393chr242109 2026 1990 1886 ------
NM_000439chr572500 2169 2090 2020 975 474 167 22409 2063 ----
NM_000461chr3114492 3632 3116 3047 1794 1601 1344 1316 702 385 307 --23197 1303 --
NM_000476chr991417 1366 1327 1224 586 420 256 248 24 ------
NM_000480chr1131303 1220 368 11607 ----
NM_000484chr212439 356 ------
NM_000489chrX2672 85 22921 1369 ----
NM_000518chr112109 21 ------
NM_000523chr231017 929 321 1390 1174 --
NM_000533chrX4637 536 259 242 ------
NM_000555chrX97497 7175 7116 5768 2606 2488 2157 499 71 --15215 27050 81
NM_000575chr22976 777 ------
NM_000595chr63454 249 120 1114 --1613
NM_000599chr284045 3671 3550 2942 1404 462 50 44 1810 33275 403 169 11371
NM_000609chr1062619 1985 1218 1026 820 599 --22177 42 11123
NM_000615chr1121935 1849 22877 70 --12141
NM_000618chr1265908 5877 5174 5134 1549 135 1161 15751 12473
NM_000618chr1265908 5877 5174 5134 1549 135 1161 15751 12473
NM_000633chr1874697 4225 3867 3691 3482 998 829 23565 837 ----
NM_000663chr1662607 2308 871 474 228 68 2315 42 1298 --
NM_000671chr4178 --11273 --
NM_000680chr81142 --1416 --
NM_000684chr1011191 ------
NM_000719chr12116339 6003 5767 4468 4462 4290 2597 793 586 470 255 35784 4486 2271 1670 1979
NM_000720chr31353 ----1461
NM_000723chr17101672 1600 1573 1111 640 498 187 162 129 42 11104 --11085
NM_000793chr1484815 4799 4522 4333 3972 3701 1104 427 14491 1834 --
NM_000806chr551884 1580 677 585 61 ------
NM_000813chr521915 1405 35185 4177 885 --1325
NM_000814chr1553786 3406 3049 1294 1232 23891 892 13583 --
NM_000827chr542253 583 446 47 12405 1877 --
NM_000836chr198861 801 719 681 375 200 189 52 2834 257 ----
NM_000859chr521154 81 ------
NM_000861chr352710 2691 2539 1772 1073 11089 --148
NM_000868chrX32263 1766 844 11636 ----
NM_000875chr15136452 2187 2101 2032 1882 1586 967 961 862 735 583 433 217 15370 1874 16079
NM_000899chr1264341 3936 3223 1660 1562 964 ------
NM_000921chr121188 ------
NM_000933chr2011438 --1238 --
NM_000961chr20133892 3545 3509 3253 2824 1412 845 749 338 253 69 61 51 21278 479 43372 3076 1196 41 --
NM_000984chr171325 --1420 1454
NM_000990chr1193934 3658 3107 3000 1480 655 410 318 105 --1588 --
NM_001001342chr1031064 935 136 --11289 11479
NM_001001344chrX32572 2269 286 --11623 --
NM_001001396chr194265 3884 3076 2869 1769 1730 1577 990 959 13038 ----
NM_001001419chr544552 4344 1460 1058 33560 1328 294 ----
NM_001001420chr544552 4344 1460 1058 33560 1328 294 ----
NM_001001433chr2083053 2411 2236 2032 1092 879 866 166 ------
NM_001001481chr82926 501 1479 ----
NM_001001484chr1042381 1773 943 194 ------
NM_001001486chr32292 113 ------
NM_001001487chr32292 113 ------
NM_001001563chr194780 732 653 81 21015 955 1868 --
NM_001001664chr2------23431 639
NM_001001684chr1752485 2110 1714 241 150 --174 --
NM_001001890chr2133047 1198 185 32806 1457 274 24196 137 11087
NM_001001924chr81194 --11381 1786
NM_001001925chr81194 --11381 1786
NM_001001931chr81194 --11381 1786
NM_001001995chrX21646 1462 11768 --1377
NM_001002295chr104871 179 91 31 ----11044
NM_001002762chr10112835 2762 2139 2076 1875 904 870 709 440 153 30 12663 12733 --
NM_001003398chr122631 182 --122 --
NM_001003406chr22103315 3036 2980 2834 2722 2659 2141 1270 806 432 --11195 1132
NM_001003652chr1897486 6644 6566 6363 5683 3491 2659 2230 882 15888 13359 --
NM_001003674chr1865612 5030 4355 2261 1389 674 26215 1201 12057 1737
NM_001003675chr1865612 5030 4355 2261 1389 674 26215 1201 12057 1737
NM_001003679chr14664 524 483 33 150 ----
NM_001003696chr211118 ------
NM_001003697chr211118 ------
NM_001003701chr211118 ------
NM_001003703chr211118 ------
NM_001003712chr1243988 2564 1535 529 ------
NM_001003800chr941410 738 583 48 42748 1427 842 58 1970 --
NM_001003894chrY3248 217 90 ------
NM_001003895chrY177 ------
NM_001003940chr1583552 3056 2988 2577 2531 1505 1411 591 31218 902 477 33540 3130 3099 --
NM_001003942chr1583552 3056 2988 2577 2531 1505 1411 591 31218 902 477 33540 3130 3099 --
NM_001003943chr1583556 3060 2992 2581 2535 1509 1415 595 31222 906 481 33544 3134 3103 --
NM_001003945chr931839 1661 21 31925 1686 1568 11640 1138
NM_001004065chr963695 3647 3176 2482 530 390 11490 ----
NM_001004106chr53938 742 655 --31055 749 405 1831
NM_001004303chr13730 694 637 1167 ----
NM_001004303chr13730 694 637 1167 ----
NM_001004304chr123989 763 458 22918 1158 22700 2693 --
NM_001004317chr624467 2938 ----11133
NM_001004360chr231879 166 43 ------
NM_001004419chr1284264 4043 3587 2792 1587 795 188 94 13982 ----
NM_001004441chr51263 21394 1177 ----
NM_001005473chr566645 5665 4337 4099 4068 1417 46241 4990 4840 1659 15768 1432
NM_001005609chrX83504 3467 3245 1507 1392 809 703 466 11426 33723 3204 872 --
NM_001005782chr21819 ------
NM_001005920chr1631063 324 265 1845 1101 2192 153
NM_001006636chr23823 199 33 1855 ----
NM_001006657chr222386 1169 12023 --13125
NM_001006932chr692968 2738 2578 2344 1278 796 650 544 22 21031 378 --13394
NM_001007023chr1484815 4799 4522 4333 3972 3701 1104 427 14491 1834 --
NM_001007097chr9114704 4587 4486 3669 3595 3315 3212 3099 1868 1835 634 43606 3517 3468 1114 --11554
NM_001007102chr611150 --1550 --
NM_001007214chr11699 11778 --1285
NM_001007246chr21131 ------
NM_001007257chr11955 21419 136 2195 56 --
NM_001007267chr21120 ------
NM_001007271chr1041080 839 346 95 --2943 126 --
NM_001007466chr655114 4383 3883 1836 233 1484 --14288
NM_001007471chr93550 58 31 ------
NM_001007559chr1851777 1658 1393 1354 186 11502 ----
NM_001007794chr12569 148 ------
NM_001008220chr5113510 3404 3145 2809 2743 2714 596 573 488 340 268 23495 238 1756 1377
NM_001008223chr122161 138 ------
NM_001008225chr71657 ------
NM_001008392chr362858 2661 1325 1300 371 352 1592 12275 1724
NM_001008407chr73657 244 102 126 --2363 150
NM_001008529chr1711334 ------
NM_001008701chr19102955 2912 2706 2669 2656 2143 734 677 255 33 22857 2417 32487 2399 2172 --
NM_001008925chr452481 1411 916 756 145 12793 ----
NM_001009183chr14--1427 182 --
NM_001009554chr421662 698 11429 ----
NM_001009554chr421662 698 11429 ----
NM_001009958chr71106 1641 ----
NM_001009993chr253195 1700 326 155 85 11039 13853 1146
NM_001010853chr633150 1154 548 --22564 667 --
NM_001010854chr14----1203 --
NM_001010862chrX42940 2866 837 603 21140 1040 2557 181 --
NM_001010867chr1116424 5356 5221 5178 4934 4530 1702 1585 1037 976 271 25976 4396 22224 1490 --
NM_001010891chr555204 4551 2538 1372 911 --25240 2657 --
NM_001010922chr184027 3919 3871 3287 3235 1393 1017 781 --13278 --
NM_001010942chr1231025 407 74 11116 152 --
NM_001011657chrX3479 318 181 ------
NM_001011663chr101933 ------
NM_001011666chr7136194 6135 5959 5592 4461 1617 1546 1370 1129 972 758 601 542 12322 1313 --
NM_001012393chr1184535 4469 4294 4154 3978 3775 1353 241 44094 1777 673 312 ----
NM_001012420chr1522894 2797 ------
NM_001012423chr1532894 2797 28 ------
NM_001012426chr6123348 2924 2770 2581 2398 2189 831 646 502 445 284 71 32469 2405 1064 11259 --
NM_001012427chr6123348 2924 2770 2581 2398 2189 831 646 502 445 284 71 32469 2405 1064 11259 --
NM_001012751chr1021195 264 ------
NM_001012755chrX115032 4428 4109 3442 1657 1408 1222 1146 171 140 88 --21479 1104 --
NM_001013415chr4126 ------
NM_001013693chr1142558 2197 2121 2009 1983 1818 973 896 840 778 753 651 602 116 --22304 931 --
NM_001013693chr1142558 2197 2121 2009 1983 1818 973 896 840 778 753 651 602 116 --22304 931 --
NM_001013839chr17102451 2418 2236 1997 983 944 679 659 396 193 --21828 1704 --
NM_001014797chr1068144 7865 7748 5992 2748 1939 22358 2046 16291 --
NM_001015877chrX31087 1078 138 --1111 --
NM_001015887chr341640 1220 446 303 1500 1327 --
NM_001017396chr262035 1502 843 769 640 447 ------
NM_001017424chr151804 639 374 257 101 ------
NM_001017425chr151804 639 374 257 101 ------
NM_001017440chr7157571 7526 6500 6400 6078 2972 2951 2840 2497 2176 2028 2014 1097 980 739 27841 5586 13062 11882
NM_001017535chr1282630 2239 2158 973 817 311 289 142 12010 31249 1244 163 --
NM_001017926chr8----173 --
NM_001017999chr181904 1862 1680 1673 1503 934 595 481 --11736 --
NM_001017999chr181904 1862 1680 1673 1503 934 595 481 --11736 --
NM_001018000chr181904 1862 1680 1673 1503 934 595 481 --11736 --
NM_001018000chr181904 1862 1680 1673 1503 934 595 481 --11736 --
NM_001018001chr181904 1862 1680 1673 1503 934 595 481 --11736 --
NM_001018025chrX1128 1663 ----
NM_001018050chr22123359 3274 3117 2470 2378 2339 2148 1260 1096 1089 995 953 ------
NM_001018052chr22123359 3274 3117 2470 2378 2339 2148 1260 1096 1089 995 953 ------
NM_001018065chr975761 4597 3889 2181 667 397 315 45888 2222 1658 1081 35843 3685 2270 11528
NM_001018066chr975761 4597 3889 2181 667 397 315 45888 2222 1658 1081 35843 3685 2270 11528
NM_001018067chr175372 5319 5013 3476 3299 2102 395 14283 --13906
NM_001018068chr175372 5319 5013 3476 3299 2102 395 14283 --13906
NM_001018069chr175372 5319 5013 3476 3299 2102 395 14283 --13906
NM_001018074chr572961 2798 2553 2394 941 836 321 12539 ----
NM_001018075chr572961 2798 2553 2394 941 836 321 12539 ----
NM_001018076chr572961 2798 2553 2394 941 836 321 12539 ----
NM_001018077chr572961 2798 2553 2394 941 836 321 12539 ----
NM_001018111chr763878 3338 1197 567 344 125 33695 3240 1489 ----
NM_001020825chr53436 273 28 ------
NM_001023567chr1552286 2189 1600 467 28 ------
NM_001024024chr141665 --197 --
NM_001024070chr141661 --193 --
NM_001024094chr572961 2798 2553 2394 941 836 321 12539 ----
NM_001024455chrX72587 1846 847 603 437 416 339 1593 1187 1812
NM_001024647chr12157278 6903 6483 5299 4938 4721 2929 2890 2791 2736 2290 2166 1496 832 98 57600 7242 6051 5166 2119 12305 --
NM_001024858chr1492638 2588 2582 2050 1037 876 350 233 56 22663 944 12960 --
NM_001024912chr1931731 427 348 194 --157
NM_001024948chr142428 2373 2184 1378 ------
NM_001025076chr1045078 5054 4608 2014 34963 2195 1776 25701 4379 --
NM_001025077chr1046436 6412 5966 537 26321 74 27059 5737 --
NM_001025079chr313074 14148 1224 --
NM_001025108chr283779 2955 2930 2814 2758 712 520 84 --151 --
NM_001025252chr852945 2846 2777 2470 53 11201 ----
NM_001025253chr852945 2846 2777 2470 53 11201 ----
NM_001025266chr351620 1493 1449 669 115 24518 896 14879 --
NM_001025389chr1131303 1220 368 11607 ----
NM_001025390chr1131303 1220 368 11607 ----
NM_001025580chrX23454 3445 24319 3211 11365 13324
NM_001025596chr112104 70 ------
NM_001029858chr633186 1232 564 11033 11351 1161
NM_001029863chr622290 546 ------
NM_001029883chr2123175 3102 3006 2849 2664 2607 2143 1990 1208 828 573 143 ------
NM_001030001chr142363 49 ----1184
NM_001030007chr1634049 549 87 ----13061
NM_001030055chr1444645 4438 1483 467 13898 ----
NM_001031680chr1102215 1784 1591 663 645 622 424 320 232 135 2572 43 2767 627 12078
NM_001031690chr763027 2939 789 465 438 337 177 ----
NM_001031702chr33706 248 225 ----1786
NM_001031732chr443484 3352 1218 248 13000 ----
NM_001032363chr192168 1972 1904 1897 1721 878 716 655 22 12036 ----
NM_001032363chr192168 1972 1904 1897 1721 878 716 655 22 12036 ----
NM_001032999chr20145281 5094 4924 4692 4647 3425 3337 3291 1691 1402 672 532 344 133 11963 11521 --
NM_001033025chr111487 ------
NM_001033047chr422641 172 ------
NM_001033057chr35802 722 672 255 21 ------
NM_001033117chr3114594 4387 4351 4062 3082 1883 1666 1651 1228 246 52 1263 ----
NM_001033503chr5130 ----164
NM_001033551chr1763728 3303 3268 1454 617 86 --43425 1606 1347 283 --
NM_001033557chr211444 --11381 --
NM_001033576chr1772507 2458 2175 2128 2015 1960 1082 22566 863 ----
NM_001033910chr112111 ----11898
NM_001034954chr1071224 998 546 526 416 395 346 ------
NM_001034955chr1071224 998 546 526 416 395 346 ------
NM_001034956chr1071224 998 546 526 416 395 346 ------
NM_001034957chr1071224 998 546 526 416 395 346 ------
NM_001035003chr4--2885 27 --11107
NM_001035004chr4--2885 27 --11107
NM_001035005chr18------1492
NM_001037126chr7151 ------
NM_001037164chr711982 --2467 144 --
NM_001037494chr12158 ------
NM_001037495chr12158 ------
NM_001037553chr2195036 4643 4217 3945 3911 3508 3173 1566 1063 1205 21337 1142 --
NM_001037738chr52302 34 ------
NM_001038493chr26466 438 216 170 118 67 ----1336
NM_001039468chr111275 ------
NM_001039538chr222806 569 33539 2286 1470 ----
NM_001039547chr3157540 7318 7279 6699 6515 5644 5150 3142 2709 2653 2217 1907 1819 886 265 67407 5510 5368 2088 2021 1219 22772 2135 --
NM_001039577chr163396 3315 2822 1253 1024 25 11450 11312 --
NM_001039590chrX53681 3562 3224 2884 2861 --22579 57 --
NM_001039591chrX53681 3562 3224 2884 2861 --22579 57 --
NM_001039618chr1155557 5008 2073 1520 582 14839 ----
NM_001039690chr16152236 2212 1689 1533 1507 942 732 693 632 618 593 548 414 372 366 --2707 470 --
NM_001039709chr20145281 5094 4924 4692 4647 3425 3337 3291 1691 1402 672 532 344 133 11963 11521 --
NM_001039762chr1011973 21940 1569 ----
NM_001039840chrX45366 4919 2093 1571 14444 ----
NM_001039916chr122279 62 ------
NM_001039917chr122279 62 ------
NM_001039918chr122279 62 ------
NM_001039919chr122279 62 ------
NM_001039920chr122279 62 ------
NM_001040002chr1751472 1156 91 63 48 11254 --1145
NM_001040101chr41203 ------
NM_001040108chr1472888 1172 830 405 399 202 106 11039 ----
NM_001040144chr16152236 2212 1689 1533 1507 942 732 693 632 618 593 548 414 372 366 --2707 470 --
NM_001040146chr16152236 2212 1689 1533 1507 942 732 693 632 618 593 548 414 372 366 --2707 470 --
NM_001040152chr774043 1918 961 764 742 255 176 23876 387 ----
NM_001040181chr34969 921 831 807 ------
NM_001040182chr34969 921 831 807 ------
NM_001040183chr34969 921 831 807 ------
NM_001040199chr34969 921 831 807 ------
NM_001040200chr34969 921 831 807 ------
NM_001040429chr131511 ----1786
NM_001040431chr171138 --127 --
NM_001040439chr1691226 1075 590 531 515 491 264 112 44 1351 51207 1130 962 296 24 --
NM_001040446chr51267 ------
NM_001040619chr151631 1461 1142 311 191 2561 422 1345 --
NM_001040665chr753736 3175 1781 1667 1633 ----14081
NM_001042357chr1011006 ----1303
NM_001042358chr1011006 ----1303
NM_001042360chr1011006 ----1303
NM_001042363chr1011006 ----1303
NM_001042388chr181853 1151 ----
NM_001042389chr1011006 ----1303
NM_001042390chr1011006 ----1303
NM_001042392chr1011006 ----1303
NM_001042395chr1011006 ----1303
NM_001042406chr62839 446 ------
NM_001042413chr973814 2890 2737 1302 716 497 478 11648 1102 --
NM_001042453chrX31164 1142 566 ------
NM_001042486chr2081521 1207 975 545 419 378 175 80 --21169 300 --
NM_001042492chr1763303 2939 2788 2695 903 171 12760 --13381
NM_001042494chr1593747 3674 3473 3041 2741 2665 2546 229 91 43656 1524 1389 213 12809 --
NM_001042495chr1593747 3674 3473 3041 2741 2665 2546 229 91 43656 1524 1389 213 12809 --
NM_001042496chr1593747 3674 3473 3041 2741 2665 2546 229 91 43656 1524 1389 213 12809 --
NM_001042497chr1593747 3674 3473 3041 2741 2665 2546 229 91 43656 1524 1389 213 12809 --
NM_001042550chr921397 195 ------
NM_001042555chr1273493 3226 3213 3193 1661 1239 708 34810 3131 1217 --13886
NM_001042599chr297795 7595 6312 6277 5337 5219 2029 579 158 47527 2095 1549 543 11006 --
NM_001042601chr331308 452 22 --23307 3249 --
NM_001042603chr1244865 4390 1379 985 11002 15204 --
NM_001042604chr354569 4431 4038 3973 1597 11554 ----
NM_001042632chr2062371 2333 1947 1043 372 35 --2351 103 --
NM_001042633chr2062371 2333 1947 1043 372 35 --2351 103 --
NM_001042646chr31148 --21426 550 --
NM_001042681chr111746 --12372 --
NM_001042682chr111746 --12372 --
NM_001042682chr111746 --12372 --
NM_001042784chr4----141 --
NM_001043318chr14103525 2764 2645 1632 1510 1450 1410 1236 1172 481 13285 13659 --
NM_001044305chr611263 --1263 --
NM_001044385chr253614 2986 2884 2465 969 13444 13622 13601
NM_001045556chr851528 1204 558 49 30 ----1261
NM_001045557chr851528 1204 558 49 30 ----1261
NM_001048183chr193162 3137 3031 2816 2631 2406 1334 698 463 31197 757 90 23225 3091 --
NM_001077628chr11149 ------
NM_001083621chr174631 3842 3314 3012 1694 1546 1494 1194 --1583
NM_001092chr1782216 1991 1779 1676 708 497 381 191 22182 102 2185 60 22314 2295
NM_001094chr172237 49 ----1169
NM_001095chr1261702 1228 493 470 288 65 --31509 1305 771 --
NM_001099678chr355254 4900 4554 2049 1926 15690 12231 --
NM_001100108chr1116300 6214 5640 5576 5386 5334 2893 2692 2033 1586 1238 26083 5443 11121 12500
NM_001106chr3109491 9165 8998 8311 8151 7699 7307 7282 6673 2638 19738 16909 --
NM_001112808chr13281 81 60 ------
NM_001117chr1841000 690 582 325 31674 1558 72 1587 --
NM_001122679chr52327 165 185 ----
NM_001128chr1634049 549 87 ----13061
NM_001148chr441966 257 249 181 2850 276 ----
NM_001156chr101479 ------
NM_001167chrX96176 5634 5548 4864 4183 2648 1791 1225 404 16044 12011 --
NM_001173chr1444645 4438 1483 467 13898 ----
NM_001200chr201111 1276 --11012
NM_001204chr2116536 6502 6015 5985 4987 3068 2788 1962 1811 1800 1790 35287 4855 561 --12325
NM_001206chr933151 2030 185 ------
NM_001227chr1031300 906 376 ----11031
NM_001241chr22875 85 11849 ----
NM_001241chr22875 85 11849 ----
NM_001249chr14----1156 --
NM_001253chr61276 ------
NM_001259chr746204 4676 4545 4238 11280 25981 2439 --
NM_001271chr1552969 2815 2492 2260 2046 ----12977
NM_001304chr1772763 2597 2498 2418 1029 915 867 33306 2959 27 --13659
NM_001329chr10--11563 11463 --
NM_001343chr511587 ------
NM_001346chr31864 32865 2139 204 12133 --
NM_001356chrX31835 367 149 ------
NM_001364chr1194348 3890 3683 3462 3073 2940 1654 273 229 23627 304 11424 --
NM_001386chr852446 937 573 387 302 1273 ----
NM_001391chr183993 793 760 ------
NM_001396chr212748 195 ------
NM_001397chr182408 2294 2262 2053 1984 1629 1006 163 12157 21999 689 22487 740
NM_001399chrX83504 3467 3245 1507 1392 809 703 466 11426 33723 3204 872 --
NM_001419chr1974789 4281 3293 3229 1953 658 436 ----11276
NM_001420chr1972264 1219 1114 748 502 402 86 23069 414 12799 --
NM_001421chrX31605 1276 1135 --1167 --
NM_001427chr751661 1634 710 663 372 --2851 609 --
NM_001429chr2221003 95 ------
NM_001439chr111487 ------
NM_001448chrX31573 477 339 ------
NM_001530chr142937 763 ------
NM_001543chr5144352 4183 3781 3463 3425 3392 1925 1584 824 813 673 542 243 203 33220 3131 3086 13062 --
NM_001553chr4171 ------
NM_001584chr112884 479 ------
NM_001604chr111848 ------
NM_001616chr223296 2633 22911 583 ----
NM_001650chr1862934 2669 1539 1066 650 627 24015 1265 ----
NM_001655chr1121893 558 --1646 11492
NM_001656chr52663 375 ------
NM_001664chr311035 --1173 --
NM_001677chr11426 ------
NM_001684chr193982 3601 2793 2586 1486 1447 1294 707 676 12755 ----
NM_001685chr211118 ------
NM_001695chr843532 3105 2971 2746 1154 ----
NM_001699chr1951672 1481 1334 706 274 ------
NM_001709chr1111801 12481 ----
NM_001714chr122515 66 ------
NM_001716chr1161562 1244 1038 318 229 210 169 ----
NM_001723chr61147 ------
NM_001730chr1321648 58 1268 ----
NM_001730chr1321648 58 1268 ----
NM_001731chr122638 218 ------
NM_001753chr741786 1256 574 363 ------
NM_001754chr2133047 1198 185 32806 1457 274 24196 137 11087
NM_001762chr7178 ------
NM_001777chr313074 14148 1224 --
NM_001789chr351673 1622 1478 167 30 ------
NM_001802chr16188 ------
NM_001830chrX93555 2925 2769 959 945 897 391 345 79 11464 ----
NM_001845chr132521 102 ------
NM_001854chr12248 241 ----11089
NM_001859chr953728 2417 1247 1105 676 33319 2440 541 1463 1151
NM_001880chr21250 ------
NM_001904chr31861 ------
NM_001914chr181310 ------
NM_001918chr1178636 8600 7841 7698 7017 6939 6509 3108 3060 2561 1996 1957 1826 1787 890 460 341 69066 7570 5976 1645 1307 326 ----
NM_001939chrX133555 3089 2758 2612 2511 1492 1364 1139 1014 390 276 111 77 1948 ----
NM_001942chr1831723 1525 1428 ------
NM_001968chr43891 800 216 ------
NM_001969chr1433625 3609 3555 1445 1161 --
NM_001977chr421202 68 ------
NM_001987chr12104031 3874 3554 3138 3093 2939 1703 1198 937 38 2792 184 21292 459 11026
NM_001995chr4----11368 --
NM_002009chr151652 --11047 --
NM_002025chrX37193 2909 989 69206 8902 8003 7959 3540 1877 --1892
NM_002031chr61327 ------
NM_002040chr2122606 810 ------
NM_002045chr31407 ------
NM_002051chr104871 179 91 31 ----11044
NM_002061chr141865 1583 1572 1552 21732 1258 ----
NM_002069chr711318 ------
NM_002074chr13441 82 46 ----11627
NM_002082chr53901 705 618 --31018 712 368 1794
NM_002089chr41113 ------
NM_002092chr464564 4444 4217 4084 3331 1225 13200 ----
NM_002126chr1714131 1261 ----
NM_002128chr1322437 1955 ------
NM_002129chr4187 ------
NM_002146chr1721026 506 ------
NM_002147chr174757 239 48 28 --121 --
NM_002158chr241003 659 272 238 12568 ----
NM_002199chr4----1146 --
NM_002202chr51761 ------
NM_002203chr553313 2795 1015 268 42 13494 --11438
NM_002214chr785346 4388 4157 3827 3598 1899 1087 1059 14276 24287 1321 --
NM_002221chr182786 2687 2413 931 446 236 165 72 --12333 --
NM_002223chr1253973 2774 934 258 189 --13810 --
NM_002227chr131188 110 63 ------
NM_002239chr2150 ------
NM_002241chr172746 1910 1037 979 800 687 201 23080 214 ----
NM_002247chr10--168 --12189
NM_002264chr344400 4330 3373 3244 23928 1164 ----
NM_002267chr1322015 239 ------
NM_002285chr283779 2955 2930 2814 2758 712 520 84 --151 --
NM_002309chr2252790 2450 372 88 71 42171 1170 1147 394 ----
NM_002310chr554834 2469 1925 671 416 15503 --14101
NM_002336chr1264631 4489 4449 3958 1819 32 34104 1404 559 ----
NM_002350chr831266 487 309 1376 ----
NM_002356chr622568 929 1225 ----
NM_002359chr1774114 3961 3811 3068 1348 572 244 23118 3086 --1468
NM_002373chr1561361 1337 507 464 360 40 3929 910 895 ----
NM_002374chr222806 569 33539 2286 1470 ----
NM_002381chr21943 ------
NM_002387chr563641 3310 3206 1821 527 145 ------
NM_002398chr241487 1027 118 82 2285 201 ----
NM_002399chr153288 200 164 11079 --1323
NM_002401chr1782371 2198 1937 1780 956 511 334 203 --2869 120 --
NM_002408chr144856 214 131 49 ------
NM_002429chr12111531 1291 1265 1212 300 265 247 233 181 89 82 ------
NM_002444chrX51995 1337 748 73 64 ------
NM_002449chr511305 ------
NM_002469chr122188 64 ------
NM_002480chr1211064 1416 ----
NM_002500chr211056 ------
NM_002501chr19133637 3624 3613 3328 3254 1399 1208 947 848 633 623 225 124 --43748 1489 134 129 12998
NM_002508chr161767 1417 740 235 116 109 2308 134 1121 --
NM_002519chr1131349 1306 499 ------
NM_002522chr1763650 3035 1541 1480 1077 913 21132 967 1792 13636
NM_002526chr651298 1215 542 456 249 11760 ----
NM_002545chr1184535 4469 4294 4154 3978 3775 1353 241 44094 1777 673 312 ----
NM_002547chrX53947 3275 2807 1623 1199 22721 505 --12979
NM_002553chr71114 ----1132
NM_002556chr1152025 1953 1331 824 372 ------
NM_002572chr111312 ------
NM_002576chr115918 433 426 230 70 ------
NM_002581chr954674 693 661 121 33 21928 1396 182 --
NM_002586chr61135 184 1450 --
NM_002588chr571318 1224 649 563 550 156 43 21131 377 152 --
NM_002594chr2052347 792 786 753 40 1208 --12486
NM_002595chr12134 --127 11567
NM_002609chr571735 1574 1544 673 656 616 588 21225 55 11666 --
NM_002613chr16124532 4050 4020 1504 1425 1242 806 380 308 279 169 49 14597 14771 23979 1822
NM_002628chr311259 1830 1133 --
NM_002657chr2082982 2970 2798 1497 483 409 386 197 --13072 --
NM_002670chr33457 440 105 ------
NM_002693chr151105 ------
NM_002697chr11211 ------
NM_002698chr19102871 2754 1201 1027 812 805 743 672 285 273 11079 --1983
NM_002706chr21727 --1664 --
NM_002709chr243086 2609 798 621 ------
NM_002717chr81259 ------
NM_002738chr163437 343 282 --147 --
NM_002742chr141616 ------
NM_002745chr2243055 1775 1415 392 1708 1655 11789
NM_002755chr151824 ------
NM_002763chr12224 58 ------
NM_002788chr14184 ------
NM_002823chr21167 ----1651
NM_002828chr18------1155
NM_002830chr21320 ------
NM_002834chr1242685 1082 863 206 1190 11266 --
NM_002845chr182597 135 --1169 --
NM_002849chr121258 1879 ----
NM_002855chr11123559 3346 3089 1457 1440 867 713 543 406 155 117 42 22874 478 33407 2359 110 23625 2533
NM_002858chr11262 ------
NM_002886chr354605 4572 1992 1642 173 11026 ----
NM_002890chr5----1891 144
NM_002902chr151638 ------
NM_002924chr1159 ------
NM_002942chr331341 1226 945 ------
NM_002959chr183674 3236 3111 2808 1437 877 107 71 125 ----
NM_002976chr2159 ------
NM_002977chr253384 2816 2707 2696 881 12548 --1863
NM_002996chr1681951 1592 1494 477 291 285 228 218 --21743 317 --
NM_003011chr931436 1127 23 11235 ----
NM_003012chr822207 527 21175 295 ----
NM_003016chr1721379 262 ------
NM_003027chr15------1431
NM_003042chr351873 727 679 92 41 126 1869 --
NM_003068chr8172 ------
NM_003079chr1741048 758 225 151 ------
NM_003106chr32830 113 ------
NM_003108chr235753 5327 4877 15368 ----
NM_003110chr173984 874 226 1368 1251 --
NM_003112chr731167 825 639 ------
NM_003118chr542022 1775 616 61 ------
NM_003128chr241843 1054 452 92 12008 ----
NM_003131chr651696 809 681 309 30 --11869 --
NM_003139chr117935 671 371 360 223 186 141 1312 ----
NM_003155chr862189 2172 1864 1104 1050 1040 21894 170 1594 --
NM_003156chr1161385 1069 509 394 289 219 ------
NM_003161chr1733238 735 253 11162 ----
NM_003173chrX71395 1257 1107 481 317 302 197 ----1463
NM_003174chr10------140
NM_003178chr352189 1843 1768 442 399 ------
NM_003189chr163314 2621 2533 2415 1075 679 1459 --23209 2234
NM_003199chr1864489 4444 3515 335 285 167 23627 3492 ----
NM_003203chr21889 --2952 234 --
NM_003204chr1721467 529 21143 685 11679 11261
NM_003214chr681395 1216 1207 926 903 568 491 117 1148 21385 265 --
NM_003217chr1241710 1237 492 24 11872 ----
NM_003221chr673750 3409 2812 2568 1147 824 496 11217 21641 614 --
NM_003234chr332375 1540 391 ------
NM_003253chr2141181 774 156 50 ------
NM_003255chr1772265 1796 763 679 343 191 120 1540 ----
NM_003262chr334567 4242 4110 2793 374 14132 --
NM_003286chr201929 ------
NM_003305chr41395 ------
NM_003319chr21907 1358 --1333
NM_003330chr1241661 436 130 58 ------
NM_003342chr1712088 ----1180
NM_003344chr72183 43 11167 ----
NM_003347chr222505 277 ----11599
NM_003352chr21819 ------
NM_003369chr1122699 44 --22651 517 --
NM_003387chr262244 2070 524 482 291 31 1892 ----
NM_003392chr353496 2885 1734 938 299 23421 521 ----
NM_003404chr20--21375 49 11887 --
NM_003406chr811948 ------
NM_003411chrY1433 1707 ----
NM_003412chr322567 621 1627 ----
NM_003413chrX----11820 --
NM_003418chr31549 ------
NM_003432chr5------187
NM_003452chr9124 1628 --171
NM_003458chr393518 3263 3188 1228 1124 819 799 726 134 43497 3215 2736 654 ----
NM_003463chr663256 2928 2780 2716 988 49 1363 ----
NM_003466chr262492 2124 2066 1684 365 288 1971 11731 --
NM_003468chr274332 3521 3367 3325 2644 1226 790 21048 709 1186 --
NM_003470chr1621625 307 1735 ----
NM_003471chr32775 53 12011 1109 --
NM_003478chr1112950 --11342 --
NM_003482chr1241999 992 747 237 --2621 399 --
NM_003483chr1222018 476 12302 ----
NM_003489chr2132417 1196 586 23056 1177 --11309
NM_003583chr123595 555 97 --13618 13506
NM_003590chr233960 3288 608 1164 ----
NM_003597chr21405 ------
NM_003601chr4186 ------
NM_003607chr123681 175 33927 3660 3277 13799 21352 181
NM_003616chr14--1396 151 --
NM_003617chr134392 4291 284 24249 3976 24596 4062 --
NM_003620chr1721073 696 1843 ----
NM_003629chr143260 3143 2667 917 22852 291 ----
NM_003632chr174899 719 681 197 ------
NM_003644chr1796139 4626 4436 2401 2086 1663 849 742 186 --11335 --
NM_003670chr31455 --21008 956 --
NM_003684chr11952 ------
NM_003735chr571318 1224 649 563 550 156 43 21131 377 152 --
NM_003736chr571318 1224 649 563 550 156 43 21131 377 152 --
NM_003743chr252265 2016 485 400 391 ------
NM_003746chr12158 ------
NM_003758chr1521173 577 ------
NM_003758chr1521173 577 ------
NM_003759chr443793 3618 3150 1440 --1848 --
NM_003763chr2083053 2411 2236 2032 1092 879 866 166 ------
NM_003768chr131267 460 118 --11451 --
NM_003774chr1232365 896 329 12615 12958 --
NM_003822chr152528 2503 2280 2203 597 33149 1996 510 13198 --
NM_003861chr1452564 2539 2514 1931 1010 22349 154 ----
NM_003884chr331476 1178 48 11238 ----
NM_003885chr175732 667 451 358 26 12378 --11051
NM_003895chr2131540 714 329 1583 11890 --
NM_003908chr2041372 1316 1270 159 --11114 --
NM_003913chr633040 2921 887 13626 ----
NM_003919chr71275 ------
NM_003924chr45418 386 204 131 85 1637 ----
NM_003939chr10133923 3814 3717 2951 2709 2698 2555 1533 471 464 183 111 31 1530 23377 523 13973
NM_003947chr32916 337 1895 2295 287 --
NM_003949chr1781773 1497 1405 582 461 313 281 44 11603 21848 1567 --
NM_003958chr663172 1058 1014 939 619 220 23565 2957 11191 --
NM_003983chr1684197 3818 1664 1438 1091 1019 463 110 23867 3784 21787 78 --
NM_003987chr1052183 2093 1995 235 124 --42190 2075 427 299 1706
NM_003988chr1052260 2170 2072 312 201 --42267 2152 504 376 1783
NM_003989chr1052119 2029 1931 171 60 --42126 2011 363 235 1642
NM_003990chr1052119 2029 1931 171 60 --42126 2011 363 235 1642
NM_003994chr1264341 3936 3223 1660 1562 964 ------
NM_004004chr131209 198 --1896
NM_004024chr151540 1370 1051 574 220 2470 331 1254 --
NM_004028chr1862934 2669 1539 1066 650 627 24015 1265 ----
NM_004034chr101479 ------
NM_004035chr1775050 3922 3794 3293 1878 1599 604 ------
NM_004050chr1462772 2478 2374 955 895 600 ------
NM_004076chr221117 ------
NM_004077chr12147 ------
NM_004079chr152359 1895 1047 910 308 1871 21939 1804 --
NM_004085chrX2769 704 ------
NM_004086chr141321 ------
NM_004090chr1741164 906 373 334 3406 137 103 22640 836 --
NM_004094chr1472989 2572 2286 1169 831 365 22 1196 ----
NM_004100chr641911 922 416 270 ------
NM_004111chr111222 ------
NM_004119chr131609 148 ----
NM_004124chr1453392 2851 956 885 81 ------
NM_004157chr33883 314 244 2641 288 ----
NM_004171chr1167728 6869 6207 6029 3821 40 ----12841
NM_004180chr21201 ------
NM_004200chr11102343 2296 2182 2136 1114 960 945 146 37 21 --11245 --
NM_004205chr11----1552 --
NM_004229chrX42160 1570 1472 708 ------
NM_004274chr1463089 3051 3036 2965 2786 2427 ------
NM_004279chr731841 1743 808 12240 12412 --
NM_004293chr953678 3522 253 180 64 13416 ----
NM_004302chr1262932 2747 2311 2174 1017 895 22180 843 22566 98 --
NM_004316chr1211034 ------
NM_004321chr273565 3482 3049 2798 2584 2440 446 33595 3185 180 281 35 --
NM_004331chr822414 98 22225 226 ----
NM_004338chr1865612 5030 4355 2261 1389 674 26215 1201 12057 1737
NM_004349chr831116 147 74 ------
NM_004350chr1102215 1784 1591 663 645 622 424 320 232 135 2572 43 2767 627 12078
NM_004393chr332152 2055 887 --11842 1226
NM_004397chr1153799 2909 1217 624 506 33879 3138 372 ----
NM_004423chr3112415 2342 2335 2183 2090 852 791 719 615 192 41 32564 1732 335 32428 983 867 --
NM_004437chr173495 2926 2262 1340 1150 326 24 21053 333 12740 12382
NM_004438chr23733 651 553 ------
NM_004441chr33890 511 296 11251 2874 327 --
NM_004442chr151627 1461 1371 362 334 1484 ----
NM_004447chr121948 148 ----
NM_004454chr351879 1444 668 463 225 ------
NM_004458chrX72117 1897 1886 1693 610 473 269 ------
NM_004459chr1721717 143 122 1170 --
NM_004485chr184113 4023 3127 3018 1645 1513 712 365 34202 3906 1259 1108 --
NM_004491chr1974196 4026 3762 3723 3575 1717 1181 11394 22722 1341 --
NM_004498chr151133 ------
NM_004501chr153912 3513 3236 1363 690 23786 3596 ----
NM_004505chr1721555 672 ------
NM_004515chr13272 250 48 ------
NM_004527chr1751472 1156 91 63 48 11254 --1145
NM_004537chr122599 527 ------
NM_004586chrX55178 4180 3470 1998 107 21513 445 23910 3547 --
NM_004588chr11143888 3541 3190 3181 3073 2823 2776 1600 1280 739 608 471 350 139 32862 1160 1091 ----
NM_004591chr22134 40 ------
NM_004593chr3----1917 --
NM_004598chr572795 2303 2224 927 398 332 122 1287 ----
NM_004600chr14409 171 89 74 ------
NM_004602chr2021411 497 2568 37 1269 --
NM_004612chr913122 14296 ----
NM_004615chrX1755 --1319 --
NM_004619chr112111 ----11898
NM_004654chrY155 ------
NM_004656chr361076 800 448 421 345 105 21085 351 --11059
NM_004657chr221369 36 ----11285
NM_004660chrY31765 410 140 ------
NM_004663chr1511058 ------
NM_004680chrY177 ------
NM_004687chr172219 23 ------
NM_004717chr721559 1310 ------
NM_004726chrX95728 5268 1869 1553 1238 1178 930 461 73 --11141 --
NM_004734chr1342219 211 95 41 23121 2488 ----
NM_004742chr32467 159 11359 ----
NM_004744chr453444 2947 2485 923 164 ------
NM_004745chr8146289 6250 6031 5959 5566 5269 5036 4285 2416 1639 1587 685 612 328 25226 1468 ----
NM_004756chr1981347 589 525 264 206 171 130 75 41064 140 115 104 ----
NM_004759chr172052 1492 564 217 155 133 26 11923 21650 301 --
NM_004768chr1--1448 124 --
NM_004781chr121673 378 11297 --1413
NM_004781chr121673 378 11297 --1413
NM_004788chr1121703 753 11810 --12611
NM_004798chr2053014 2993 1202 1162 88 12860 11436 --
NM_004799chr11349 ------
NM_004801chr22469 434 1225 ----
NM_004824chr621111 211 ------
NM_004834chr222362 719 ------
NM_004836chr24748 278 105 71 ------
NM_004840chrX62399 1691 1628 1582 1543 451 --1562 11828
NM_004859chr171278 ------
NM_004860chr171140 --171 149
NM_004863chr1484962 4822 4628 4412 4297 4239 3580 3381 24688 342 14989 14553
NM_004902chr20----1340 --
NM_004904chr7136194 6135 5959 5592 4461 1617 1546 1370 1129 972 758 601 542 12322 1313 --
NM_004925chr92174 61 1830 ----
NM_004932chr521457 350 ----1230
NM_004936chr922852 47 12240 1626 --
NM_004943chr1991149 1115 1051 923 895 811 403 40 26 1276 1838 --
NM_004947chr372303 2099 1622 631 370 356 80 12532 21019 620 --
NM_004948chr1821358 1233 ----11010
NM_004954chr111275 ------
NM_004956chr754627 4601 3572 1797 484 --14228 --
NM_004961chrX61449 1359 1335 417 318 52 1346 ----
NM_004969chr10159 ------
NM_004974chr1130 ------
NM_004976chr11214801 4460 4322 4275 4052 3764 3754 3703 3423 3333 3295 2062 2013 1838 1668 1660 1430 1393 1261 891 117 24855 1753 23870 553 24557 3745
NM_004978chr161672 1638 1424 639 534 118 11698 1630 --
NM_004985chr1213551 13827 --11132
NM_004992chrX208098 7439 7354 7319 6661 6543 6121 5677 3267 2549 1792 1602 764 723 589 565 458 433 333 222 --42996 2501 2091 1329 27763 1664
NM_004992chrX208098 7439 7354 7319 6661 6543 6121 5677 3267 2549 1792 1602 764 723 589 565 458 433 333 222 --42996 2501 2091 1329 27763 1664
NM_004999chr674226 1665 1336 1264 1109 878 744 34200 3861 916 ----
NM_005013chr11187 ------
NM_005023chr5151 ------
NM_005028chr1032260 1439 703 51654 646 624 323 186 ----
NM_005045chr711017 133 ----
NM_005056chr1255109 4634 1623 1229 173 11246 15448 --
NM_005063chr1073364 3290 2838 2762 1490 475 349 ------
NM_005076chr1144234 4026 3591 3550 3487 3474 3386 3339 3003 2691 1529 1333 953 568 1982 11251 13050
NM_005079chr852945 2846 2777 2470 53 11201 ----
NM_005093chr20145281 5094 4924 4692 4647 3425 3337 3291 1691 1402 672 532 344 133 11963 11521 --
NM_005095chr131995 899 497 21937 485 ----
NM_005105chr141809 1776 867 359 --1422 --
NM_005109chr372188 549 457 332 284 71 27 21618 97 ----
NM_005124chr62807 104 ------
NM_005126chr31551 ----12282
NM_005134chr181853 1151 ----
NM_005135chr1593747 3674 3473 3041 2741 2665 2546 229 91 43656 1524 1389 213 12809 --
NM_005140chrX3239 182 149 --1826 --
NM_005156chr984299 4283 3502 3445 1846 1791 1725 76 15358 ----
NM_005160chr2276169 6161 5025 2621 2143 1750 1537 11121 12684 15434
NM_005164chr1272588 2426 2231 803 731 230 46 --11773 --
NM_005180chr103604 341 103 11319 ----
NM_005187chr1682061 1973 1658 1396 1390 1360 585 52 --11544 --
NM_005188chr1178006 7664 6693 6518 6010 3172 3100 --11268 15184
NM_005197chr14105495 4586 4429 4213 3790 2166 2140 1700 915 641 --24181 421 --
NM_005202chr151874 1739 1733 1678 126 --31792 314 259 --
NM_005215chr18183 ------
NM_005219chr5101806 1440 1404 1327 1274 1144 700 642 78 70 1153 2326 220 --
NM_005233chr32870 109 12049 ----
NM_005235chr297795 7595 6312 6277 5337 5219 2029 579 158 47527 2095 1549 543 11006 --
NM_005238chr1133294 2667 300 --13009 --
NM_005257chr182983 335 ------
NM_005259chr211273 21370 55 ----
NM_005264chr101784 1775 ----
NM_005277chr43173 70 62 ------
NM_005291chr24322 238 149 80 3827 93 56 ----
NM_005295chr7------1242
NM_005338chr7103944 3608 1508 1134 1107 995 976 754 724 69 23474 301 22830 2515 11603
NM_005339chr42872 110 ------
NM_005347chr961514 1399 668 553 526 136 11472 --11567
NM_005359chr1856348 6293 5810 2119 1372 11308 13971 --
NM_005375chr61178 2315 70 ----
NM_005382chr81465 ------
NM_005397chr763878 3338 1197 567 344 125 33695 3240 1489 ----
NM_005398chr103396 191 70 ----11071
NM_005399chr194031 3721 3464 3312 2979 1263 1170 725 250 ----1716
NM_005410chr52812 28 ------
NM_005433chr1842603 796 339 216 22496 848 ----
NM_005436chr1073572 3385 3192 627 525 310 59 ----23884 3151
NM_005437chr102393 125 ------
NM_005475chr1252628 2433 2415 411 273 126 --12660
NM_005477chr1552469 2260 1598 826 675 1693 12416 --
NM_005477chr1552469 2260 1598 826 675 1693 12416 --
NM_005509chr52531 195 ------
NM_005529chr15951 796 689 275 42 1810 --2723 48
NM_005540chr161126 1114 612 472 139 63 --1425 --
NM_005562chr131648 407 23 ----11226
NM_005566chr11--1551 --1361
NM_005593chr122486 42 ------
NM_005596chr955382 4867 4525 671 55 ------
NM_005613chr131582 212 111 1314 ----
NM_005614chr72917 169 ------
NM_005634chrX1577 ------
NM_005637chr1851777 1658 1393 1354 186 11502 ----
NM_005638chrX21712 304 ------
NM_005647chrX32854 2614 2311 2521 438 ----
NM_005659chr221426 ------
NM_005665chr164118 3030 3021 1380 790 722 11071 ----
NM_005670chr621423 740 2830 590 --1209
NM_005688chr31525 ------
NM_005715chr642431 777 545 314 21010 990 --12515
NM_005721chr21923 ----1773
NM_005734chr11125 ------
NM_005738chr711982 --2467 144 --
NM_005746chr71429 12736 ----
NM_005751chr71381 ------
NM_005752chr1611234 ------
NM_005780chr131647 1718 ----
NM_005783chr21638 ------
NM_005789chr1731340 226 41 21386 1348 ----
NM_005795chr242144 2015 501 43 ------
NM_005801chr173586 494 280 --1712 --
NM_005808chr362858 2661 1325 1300 371 352 1592 12275 1724
NM_005813chr252416 2214 1861 626 233 ------
NM_005822chr622371 725 1462 --1591
NM_005828chr1774306 3861 1126 678 366 345 211 ------
NM_005840chrX107312 2795 2622 2608 2400 1903 1560 1527 692 330 148 ----
NM_005841chr41845 ------
NM_005842chr132746 199 ------
NM_005862chr3--3728 352 252 ----
NM_005880chr1611391 ------
NM_005901chr1897486 6644 6566 6363 5683 3491 2659 2230 882 15888 13359 --
NM_005903chr544552 4344 1460 1058 33560 1328 294 ----
NM_005909chr52887 284 1818 14066 11098
NM_005910chr1793579 3103 2827 2668 2519 1373 1345 1234 98 22871 277 22694 1186 --
NM_005911chr22985 312 21467 1187 ----
NM_005920chr173732 3278 2694 2628 2476 2379 1527 13235 --1338
NM_005924chr711030 ------
NM_005930chr142564 92 ------
NM_005933chr1122107 800 ----22325 2189
NM_005937chr17154045 3935 3790 3659 3486 2718 2546 1437 1340 902 617 608 524 467 89 1276 23868 1630 --
NM_005941chr831305 274 267 21588 653 ----
NM_005943chr671328 1237 1109 440 286 250 30 --1469 1170
NM_005955chr144845 3855 3791 2068 25018 1384 ----
NM_005957chr174817 4013 3704 3197 2983 1498 1277 24683 3438 23974 808 --
NM_005966chr232302 1979 103 ------
NM_005990chr592035 1910 1825 1020 740 300 167 143 113 11970 11850 --
NM_006011chr15114316 3467 3449 3208 3198 3094 3064 3045 2699 598 443 23552 2756 ----
NM_006051chr5----2243 47 --
NM_006079chr6139 --1311 --
NM_006090chr12569 148 ------
NM_006094chr8--12112 --1617
NM_006095chr433455 577 507 --13383 --
NM_006108chr1132309 864 126 21672 635 --12280
NM_006133chr1162106 2074 1593 822 618 30 1404 1582 11809
NM_006166chr1212250 ------
NM_006167chr861576 1483 845 771 758 658 1386 ----
NM_006186chr22191 104 ----1904
NM_006191chr125678 206 173 142 21 1158 1752 --
NM_006203chr545376 4335 1991 313 14944 14213 --
NM_006206chr472774 2212 2093 2080 1054 918 125 22348 1146 --1314
NM_006218chr31254 ------
NM_006224chr1741675 659 401 312 42276 1955 1552 57 ----
NM_006238chr662027 1941 1839 1677 835 709 11398 21750 1436 11330
NM_006251chr543161 878 700 164 ------
NM_006256chr112200 1652 ----
NM_006275chr201422 --11690 --
NM_006282chr20104176 3965 3926 3074 1070 795 771 764 649 27 1322 14314 --
NM_006283chr874137 3903 3453 3228 3118 3078 1521 11333 --124
NM_006289chr95384 292 175 143 35 199 292 83 --
NM_006306chrX84690 2291 1712 1270 1222 1065 76 54 ----11276
NM_006315chr484227 3746 3142 1526 1417 986 960 684 23593 154 ----
NM_006352chr111317 1343 11438 --
NM_006380chr1784122 3479 3013 1635 1100 732 535 512 ------
NM_006384chr15136 ------
NM_006386chr2252237 2188 1783 291 133 12248 ----
NM_006420chr2033257 2328 163 --13349 11120
NM_006434chr1071224 998 546 526 416 395 346 ------
NM_006454chr492603 2548 2435 2407 2078 1972 1239 1120 376 --2612 226 1991
NM_006459chr1041515 623 473 42 ----11408
NM_006464chr294655 4302 3698 3513 3428 3295 1256 992 353 --23783 1737 --
NM_006465chr1582129 2084 1850 836 806 295 284 217 --21687 691 --
NM_006467chr521745 274 ------
NM_006469chr131562 1508 1055 ------
NM_006482chr123595 555 97 --13618 13506
NM_006496chr121577 625 ------
NM_006517chrX72304 893 785 394 380 321 33 2920 731 ----
NM_006526chr2011714 ------
NM_006538chr264049 3416 2769 1605 1433 1334 23158 66 11180 --
NM_006544chr1465816 5394 4865 2311 2000 591 ------
NM_006546chr17165967 5506 5384 4991 4730 4224 2028 1987 1972 1956 1687 1124 1084 1027 602 193 15863 --22115 203
NM_006547chr731432 560 203 21875 489 1648 --
NM_006548chr331459 1255 500 150 ----
NM_006555chr771648 1631 1453 1229 1216 759 537 --41956 1875 1870 22 --
NM_006557chr931157 1113 683 --21700 629 --
NM_006559chr111181 11034 ----
NM_006560chr112104 70 ------
NM_006561chr1045078 5054 4608 2014 34963 2195 1776 25701 4379 --
NM_006572chr1763502 3166 2577 1410 1263 262 --1444 --
NM_006595chr1121728 231 1459 ----
NM_006606chr2032836 2056 436 21234 33 --12600
NM_006609chr23623 538 490 ------
NM_006614chr392913 2749 2650 2555 1203 588 267 223 39 ------
NM_006618chr12379 49 --1362 --
NM_006625chr121092 378 ------
NM_006625chr121092 378 ------
NM_006625chr121092 378 ------
NM_006628chr1554190 3474 1492 1398 251 14225 13593 --
NM_006629chr1852641 1974 827 411 138 1100 ----
NM_006644chr131467 ------
NM_006650chr5113510 3404 3145 2809 2743 2714 596 573 488 340 268 23495 238 1756 1377
NM_006654chr1273493 3226 3213 3193 1661 1239 708 34810 3131 1217 --13886
NM_006706chr51593 ------
NM_006726chr4199 ------
NM_006729chrX85314 5167 4755 4700 4634 4041 3560 1150 --24240 3735 --
NM_006731chr955379 5176 4833 2189 921 13970 12087 --
NM_006748chr851528 1204 558 49 30 ----1261
NM_006750chr16127913 7593 7094 6852 6812 6211 5900 5779 2173 2106 1809 1111 12738 ----
NM_006751chr22216 133 ------
NM_006775chr642331 1249 179 36 12014 21978 264 --
NM_006777chrX21986 518 ------
NM_006791chr151504 ------
NM_006823chr81406 ------
NM_006826chr21818 ------
NM_006827chr1452778 2524 1237 800 71 1171 1633 12833
NM_006828chr62567 114 ------
NM_006846chr5----1261 --
NM_006876chr111517 ------
NM_006885chr1632831 1031 237 --13306 --
NM_006896chr761141 1054 298 264 184 143 2417 400 11146 --
NM_006922chr242244 531 398 246 21839 1032 ----
NM_006924chr1754131 3080 2810 1557 1437 2827 149 ----
NM_006930chr51567 --11722 --
NM_006940chr12148 --11629 11552
NM_006943chr2073285 3233 3061 2804 2661 852 575 33226 3193 208 22367 189 --
NM_006965chr181230 ------
NM_006981chr932689 2174 1858 1310 12045 --
NM_006988chr211777 ----11002
NM_006990chr172126 1968 1576 915 737 620 486 21673 70 --12045
NM_007011chr1585546 4572 4208 2403 2008 1835 1700 1307 25413 4182 ----
NM_007030chr5124309 4162 3198 1981 1779 1566 1477 1401 952 474 412 140 34060 1615 180 44483 2013 1786 990 --
NM_007039chr142679 207 11431 21746 70 --
NM_007050chr20197790 7356 5694 5529 5440 5211 3146 3118 2827 2813 2166 1677 1267 1145 622 577 249 228 209 37267 3093 1175 47694 5404 5264 2805 26632 1804
NM_007073chr653830 3807 3632 1123 606 12941 1725 --
NM_007087chr161810 ----1560
NM_007124chr621740 723 ------
NM_007159chr31279 ------
NM_007170chr1----1128 --
NM_007172chr2252442 1278 532 333 205 22051 2042 ----
NM_007174chr1262050 1707 1605 810 796 126 11578 --1878
NM_007189chr7101466 1433 1164 1025 957 399 321 313 142 123 ----1528
NM_007203chr963695 3647 3176 2482 530 390 11490 ----
NM_007212chr122058 484 ------
NM_007214chr62437 417 ------
NM_007222chr8----173 --
NM_007236chr1532226 1845 813 1448 ----
NM_007249chr13109410 8823 7835 7469 6962 6218 6024 935 596 55 48975 2086 1736 1102 --27250 1338
NM_007276chr751076 1004 985 952 345 ------
NM_007292chr1775050 3922 3794 3293 1878 1599 604 ------
NM_007324chr11349 ------
NM_007353chr751994 1033 666 619 535 --1855 2758 463
NM_007365chr152273 1920 512 292 65 11428 ----
NM_007372chr172758 89 1705 ----
NM_012074chr1411105 ------
NM_012102chr111746 --12372 --
NM_012104chr1153666 3394 2580 933 323 ----1511
NM_012104chr1153666 3394 2580 933 323 ----1511
NM_012129chr712225 11707 ----
NM_012134chr181864 1640 1489 1272 1233 482 364 151 11436 ----
NM_012137chr121851 1145 --11979 11946
NM_012156chr2073068 3012 2406 2226 2205 682 103 --21075 35 --
NM_012164chr9157288 6086 6010 5704 5423 5401 5314 4842 4804 4657 2365 1391 1268 1134 801 36513 5540 5016 ----
NM_012193chr1152013 1429 1242 1077 153 34621 1508 160 24085 3326 13772
NM_012199chr154361 3138 2868 1104 607 24589 887 23478 3203 --
NM_012214chr2105875 5394 5209 4313 2575 2010 1745 1575 1423 1130 22322 1290 ----
NM_012215chr1021486 27 ------
NM_012219chr34586 169 104 66 --13125 --
NM_012224chr431062 250 27 ------
NM_012228chr1021129 1019 ------
NM_012244chr1491651 1499 1371 1177 1154 685 544 408 243 1718 11512 --
NM_012247chr101927 ------
NM_012252chr723478 229 14754 ----
NM_012259chr611148 ------
NM_012262chr134352 3701 2067 ----14235
NM_012278chrX1131 ------
NM_012281chr732070 1847 1728 158 ----
NM_012282chrX4643 237 113 80 1316 1615 1325
NM_012288chr6115256 4955 4755 4611 4478 4054 2178 1889 1652 1520 62 11389 24582 4548 --
NM_012289chr193207 163 35 ------
NM_012293chr23906 323 165 22208 343 ----
NM_012294chr743787 3270 1523 1126 ----13411
NM_012296chr1173779 3712 2518 1462 831 600 24 12851 32418 1217 211 13399
NM_012297chr41169 ----1797
NM_012300chr562202 1986 878 693 492 72 --1145 --
NM_012306chr12113298 2843 2396 1314 1141 1067 984 868 283 135 107 23480 2335 2145 140 --
NM_012308chr1172259 1582 1004 959 947 659 650 21854 369 --1612
NM_012309chr1123374 835 13828 33500 1092 683 1277
NM_012316chr195328 4776 4364 3663 2201 876 720 640 290 24644 4559 ----
NM_012334chr564238 3486 3069 3056 429 106 24106 619 182 --
NM_012347chr682818 2756 2669 2003 1057 702 663 465 --32961 966 902 --
NM_012416chr911231 ----1837
NM_012417chr171521 ------
NM_012446chr51171 ------
NM_013230chrY41441 487 75 52 --11130 --
NM_013238chr1331764 1742 1351 11901 ----
NM_013255chr768754 6781 6583 3516 1269 171 22665 2492 ----
NM_013261chr432886 2529 902 1849 --12293
NM_013266chr10----147 --
NM_013267chr12128 ------
NM_013269chr1274191 3970 3514 1514 722 115 21 13909 ----
NM_013281chr2011328 1986 --11489
NM_013316chr72372 138 ------
NM_013372chr1563150 2905 2410 2263 852 113 43366 2284 860 23 ----
NM_013374chr322605 2490 ----1982
NM_013380chr191263 --194 --
NM_013382chr1472126 2030 1589 915 133 105 96 21635 164 12002 --
NM_013402chr1162634 2613 2126 1097 720 400 12087 12366 12706
NM_013423chrX3871 243 53 --1305 --
NM_013427chrX3871 243 53 --1305 --
NM_013444chrX1427 ------
NM_013448chr141516 ------
NM_013450chr21961 1319 ----
NM_013943chr11625 32338 1237 60 ----
NM_013951chr262492 2124 2066 1684 365 288 1971 11731 --
NM_013952chr262569 2201 2143 1761 442 365 --11808 --
NM_013953chr262569 2201 2143 1761 442 365 --11808 --
NM_013989chr1484815 4799 4522 4333 3972 3701 1104 427 14491 1834 --
NM_013992chr262569 2201 2143 1761 442 365 --11808 --
NM_013995chrX42607 1975 743 187 31033 885 57 ----
NM_013999chr1751509 1193 128 100 85 11291 --1182
NM_014011chr252107 1920 860 814 458 ------
NM_014021chr142880 2139 2121 1279 --11239 --
NM_014109chr8169 ------
NM_014112chr844163 1365 636 435 24768 119 13507 --
NM_014117chr1662734 2578 2274 1030 716 627 155 ----
NM_014141chr745290 3981 3762 569 1422 11665 --
NM_014155chr11116554 6066 2886 2678 2405 1552 1456 1287 971 446 118 16076 26176 4850 --
NM_014190chr43288 195 108 ----11474
NM_014217chr151804 639 374 257 101 ------
NM_014231chr1292112 1807 1720 1672 1626 1570 1417 347 110 2170 75 1521 --
NM_014232chr1761652 1362 1218 1155 658 46 --11248 --
NM_014232chr1761652 1362 1218 1155 658 46 --11248 --
NM_014235chrX3591 544 456 11795 21253 29 1397
NM_014240chr363838 3492 3467 3354 3298 2833 23705 455 21280 1060 --
NM_014241chr102298 56 ------
NM_014253chrX3881 528 124 ------
NM_014268chr182237 105 21116 314 --186
NM_014283chr131260 314 283 ------
NM_014292chr22101738 1715 1573 1284 625 616 599 573 84 46 --11180 --
NM_014296chr331603 617 554 11634 ----
NM_014317chr10148 ------
NM_014319chr1221315 447 ------
NM_014323chr2261024 332 315 165 138 127 ------
NM_014331chr477228 7213 7079 6977 2060 1948 34 46381 6065 5393 1377 ----
NM_014332chrX----1294 --
NM_014333chr1121007 371 --132 --
NM_014368chr971785 1594 1332 622 596 440 73 11878 21766 1722 --
NM_014372chr131437 219 71 22056 1443 ----
NM_014381chr1472888 1172 830 405 399 202 106 11039 ----
NM_014388chr175582 4393 4049 2432 1954 488 70 --15818 11459
NM_014390chr72397 26 1341 1409 1514
NM_014391chr102676 59 ------
NM_014392chr41203 ------
NM_014405chr1782272 2226 2031 1783 1745 1633 906 670 ----11757
NM_014423chr545326 4474 1242 929 ------
NM_014445chr332366 2180 896 ------
NM_014491chr71856 ------
NM_014494chr1632139 1885 320 ----11653
NM_014498chr32257 55 ------
NM_014515chr12--170 --1190
NM_014572chr1321241 463 ------
NM_014574chr141630 ------
NM_014588chr20179 ------
NM_014623chr61179 --1186 --
NM_014630chr1543253 3135 272 162 13859 22883 296 23264 1501
NM_014634chr2273382 3115 3065 2804 2643 1125 257 32431 124 75 43230 2736 495 301 21174 414
NM_014646chr1873158 2734 1314 1097 595 446 99 1786 ----
NM_014647chr1621993 329 11486 ----
NM_014665chr893362 2766 2603 2540 2380 1344 1191 722 481 22474 614 12696 --
NM_014666chr51500 ------
NM_014677chr821381 252 ------
NM_014683chr1711955 12074 ----
NM_014689chr21247 ------
NM_014690chr763027 2939 789 465 438 337 177 ----
NM_014701chr1543298 3258 1377 1360 2118 74 ----
NM_014703chr351246 1206 1033 369 354 ------
NM_014707chr721833 751 ------
NM_014720chr103628 470 383 ------
NM_014730chr1294900 4169 3248 1996 1878 1541 821 282 230 1967 11271 --
NM_014730chr1294900 4169 3248 1996 1878 1541 821 282 230 1967 11271 --
NM_014746chr283271 3051 3031 2797 2763 505 321 57 11579 12905 --
NM_014747chr1115678 5071 5037 4881 4377 4123 3741 3667 1772 1448 138 35262 5107 1636 15498 14487
NM_014767chr1093642 3183 3117 2956 2694 1195 813 705 396 23316 37 3649 467 414 --
NM_014770chr1281163 1044 835 518 367 292 207 188 --11139 2375 213
NM_014774chr163103 1066 956 741 603 35 152 ----
NM_014776chr1233036 2796 49 ------
NM_014784chr12970 173 188 1216 --
NM_014795chr21223 ------
NM_014802chr12----126 --
NM_014803chr1032897 1839 1007 12208 --11163
NM_014810chr162867 2752 2517 2311 707 478 ------
NM_014822chr4162 ------
NM_014824chr11------1275
NM_014826chr123681 175 33927 3660 3277 13799 21352 181
NM_014828chr1452435 862 783 331 52 ------
NM_014830chr1293676 3440 3253 3001 1289 424 356 307 81 11533 ----
NM_014839chr141760 444 202 117 ------
NM_014841chr61986 1110 ----
NM_014850chr3114594 4387 4351 4062 3082 1883 1666 1651 1228 246 52 1263 ----
NM_014860chr22774 264 2491 45 ----
NM_014870chr174631 3842 3314 3012 1694 1546 1494 1194 --1583
NM_014873chr111180 24853 4208 --1637
NM_014876chr2262102 1823 795 611 521 487 11666 --12160
NM_014877chr1756851 2583 2194 2074 1434 35334 5291 1914 16062 --
NM_014893chrY22086 632 31579 318 151 ----
NM_014897chr171543 --22754 226 --
NM_014901chr5101893 1592 1577 1440 911 809 628 423 91 66 21684 1599 31909 742 147 --
NM_014902chr2081521 1207 975 545 419 378 175 80 --21169 300 --
NM_014903chr1222137 249 12331 1425 --
NM_014906chr1741471 1076 399 118 138 ----
NM_014909chr14143966 3499 2934 2647 2552 1525 1192 1107 743 719 682 415 267 181 12663 --13559
NM_014920chr653823 3079 3007 1351 1094 21320 825 12354 --
NM_014921chr19102955 2912 2706 2669 2656 2143 734 677 255 33 22857 2417 32487 2399 2172 --
NM_014932chr311750 ------
NM_014935chr163230 2934 2687 2454 887 297 33910 2969 1568 1214 --
NM_014936chr632037 925 261 ------
NM_014942chr6102652 1879 1678 1616 987 965 812 510 162 73 ------
NM_014945chr551913 711 652 496 268 1488 1289 --
NM_014946chr22233 91 --12230 --
NM_014947chr142533 952 232 31 1606 11211 --
NM_014949chr1--1281 --1268
NM_014952chr1541485 698 225 102 31402 483 365 11764 --
NM_014964chr1792364 2045 1642 576 377 333 306 296 155 12174 ----
NM_014969chr11335 ------
NM_014970chr1178 ------
NM_014988chr462685 2167 1865 1006 733 258 12225 ----
NM_015000chr1212843 ------
NM_015009chr31122 ------
NM_015018chr61211 ------
NM_015020chr1653533 3004 2389 1519 1274 --1401 --
NM_015027chr1631660 535 321 21669 1575 ----
NM_015035chr20125431 4934 4237 4218 4128 4074 2366 2157 1190 823 151 72 35859 5297 1784 11284 22504 2454
NM_015039chr154117 3390 3112 3034 1162 5442 403 364 325 286 23689 3151 14021
NM_015042chr15154112 3976 3818 3647 3291 3276 2677 1731 1665 1363 1012 966 863 835 319 44062 1038 722 679 24219 1112 13785
NM_015049chr232557 2539 644 13138 ----
NM_015051chr952582 2086 2061 1084 148 ------
NM_015052chr721404 1383 --11375 --
NM_015055chr112925 258 1121 22879 1950 --
NM_015056chr2132669 2174 687 11894 1709 --
NM_015059chr1583795 3296 3120 2704 1489 970 669 633 --12923 --
NM_015063chr1971353 1246 1193 505 492 359 234 11315 ----
NM_015064chr1283565 3510 3244 3218 2627 2572 1383 479 22454 324 ----
NM_015068chr742895 1419 960 770 12728 ----
NM_015071chr595010 4754 4476 4440 4133 2454 1043 723 313 15142 1322 --
NM_015075chrX82042 1889 1611 467 392 295 273 85 51844 615 483 372 345 ----
NM_015076chr644395 3369 2813 1272 3718 267 205 130 --
NM_015077chr17124530 4325 3841 3816 3705 3243 1580 973 823 441 399 161 14740 23970 810 --
NM_015082chr551946 1875 1845 973 375 12414 22492 666 --
NM_015090chr1175914 5812 5726 5681 5032 4697 4691 4678 4653 4367 4344 4052 1924 1377 608 398 179 33867 2103 1478 ----
NM_015092chr1663938 3625 3331 3217 2965 1679 11544 --1193
NM_015093chr611607 1311 1242 --
NM_015094chr2294601 4086 4016 3268 1404 1284 806 240 206 13466 13008 --
NM_015097chr312101 ------
NM_015132chr721954 1322 ------
NM_015133chr1691226 1075 590 531 515 491 264 112 44 1351 51207 1130 962 296 24 --
NM_015139chr1134 ------
NM_015144chr1683163 3151 3076 1561 1334 981 825 773 13530 ----
NM_015163chr1421355 1337 ----1217
NM_015185chrX82635 2550 2375 2344 2198 2082 1212 969 --22524 1924 12120
NM_015194chr17101873 1857 1823 1600 507 495 454 429 232 75 11443 ----
NM_015205chr1344269 4251 3943 719 64349 1986 1070 605 316 253 1363 --
NM_015206chr1533057 2604 1027 22358 1085 ----
NM_015209chr181904 1862 1680 1673 1503 934 595 481 --11736 --
NM_015215chr111995 --12983 --
NM_015219chr17102451 2418 2236 1997 983 944 679 659 396 193 --21828 1704 --
NM_015230chr431394 511 364 ------
NM_015265chr2138 ------
NM_015267chr1261663 1650 1385 627 369 98 169 1753 --
NM_015277chr1851407 1256 567 173 146 1338 --168
NM_015288chr593785 2724 2591 1506 1023 847 791 488 58 11000 33160 676 671 --
NM_015292chr125705 523 277 93 80 1130 ----
NM_015294chr172907 67 ------
NM_015299chr1493468 3449 3151 2974 2922 2621 2510 1405 224 11071 12751 13201
NM_015310chr8107744 7037 6928 3310 2781 2028 1744 1427 1226 455 38429 1958 992 27550 2704 --
NM_015313chr1154002 3778 1633 652 151 1750 ----
NM_015315chr582839 2657 2115 1110 675 389 353 70 23155 2394 --1458
NM_015317chr232598 2512 82 32522 2080 615 ----
NM_015321chr19164941 4766 4749 4280 3875 3382 3357 3017 1263 1013 474 456 289 214 52 38 --34536 4531 171 13447
NM_015326chr142621 2275 2036 319 22949 2318 ----
NM_015328chr762537 2512 2327 888 479 180 1996 ----
NM_015335chr1261926 773 685 475 261 57 1800 1905 --
NM_015343chr172331 82 ------
NM_015344chr821671 481 --11694 --
NM_015349chr632351 2280 1938 12326 ----
NM_015365chrX23454 3445 24319 3211 11365 13324
NM_015382chr142633 191 ----1787
NM_015385chr1071224 998 546 526 416 395 346 ------
NM_015394chr1242457 2088 2078 1715 ------
NM_015455chr533571 3551 948 23528 273 --1187
NM_015460chr33748 681 379 2258 67 31420 793 545 --
NM_015477chr153997 645 639 --1333 --
NM_015520chr361791 953 719 487 413 140 1180 ----
NM_015526chr1981408 1379 1202 1015 921 530 352 248 ------
NM_015534chr11853 ------
NM_015535chr2144031 3694 3442 3176 3015 2575 2550 1681 1582 1555 1548 833 63 49 33602 1687 1352 ----
NM_015537chr931086 977 21 2834 772 1864 2428 420
NM_015542chr10----11218 --
NM_015553chr684827 4534 4224 4074 3625 3385 1250 430 ----11844
NM_015557chr193500 3401 3315 3172 2884 2477 1187 970 194 2940 590 53408 749 472 174 73 --
NM_015564chr553254 3205 1159 993 101 ------
NM_015565chr2121658 387 ------
NM_015568chr2084232 3986 3738 3459 1462 1325 284 137 13883 31440 1243 1110 21069 64
NM_015569chr124506 4080 --14360 --
NM_015575chr283435 3372 3347 2854 2506 2383 724 156 2505 254 23681 2569 --
NM_015609chr162754 2452 1909 1847 1147 674 1284 32688 2673 1986 --
NM_015626chr1711212 ------
NM_015640chr175372 5319 5013 3476 3299 2102 395 14283 --13906
NM_015646chr1231025 407 74 11116 152 --
NM_015651chr962101 1874 1757 654 314 69 12130 --11935
NM_015678chr1331101 599 364 1126 ----
NM_015866chr11955 21419 136 2195 56 --
NM_015878chr842131 1652 1369 671 ------
NM_015906chr164286 3701 3494 3263 1364 764 ------
NM_015980chr551479 1429 1129 1119 576 ------
NM_015981chr593120 2761 2457 2271 2047 2025 1995 1989 285 21262 660 ----
NM_015995chr15105285 5265 4940 3597 2201 1532 1479 1310 1207 510 23934 826 2533 503 --
NM_016009chr154921 3997 3605 1691 270 44805 4453 3387 531 --14120
NM_016018chr821766 317 12781 1867 --
NM_016019chr72342 173 ------
NM_016021chr693031 2974 2629 2266 1859 1002 941 739 33 ------
NM_016040chr132734 320 264 12031 22422 481 --
NM_016059chr61850 1620 1345 --
NM_016061chr231346 1053 571 1187 1464 --
NM_016075chr1352753 2678 2151 1208 681 ------
NM_016078chr172819 61 ------
NM_016081chr43429 143 33 ------
NM_016083chr683942 3104 2865 2661 1557 1250 109 52 1677 13131 --
NM_016103chr5130 ----164
NM_016131chr21803 --1251 --
NM_016206chr3107682 7463 7053 2648 2549 2237 2023 1898 1101 699 13259 ----
NM_016217chr623507 202 --13421 --
NM_016227chr131260 314 283 ------
NM_016231chr1731619 1564 1226 ------
NM_016248chr1344004 3914 987 899 13033 ----
NM_016257chr162782 1407 1289 475 132 53 ----22709 2691
NM_016260chr287572 7184 2972 2928 2801 2175 2015 169 11855 16542 --
NM_016269chr441129 1114 116 31 ----1978
NM_016272chr2292105 1838 1716 1010 724 511 485 396 141 11896 --11801
NM_016287chr161937 1711 1418 650 523 279 --21703 1280 --
NM_016298chr341311 928 706 164 43345 2039 557 154 1316 --
NM_016315chr211874 11191 ----
NM_016376chr1764340 4213 3314 2815 1577 246 24016 48 ----
NM_016396chr1532966 2074 2023 11081 12611 1136
NM_016418chr22173754 3675 3660 3558 3409 3193 3054 2869 1078 1046 1010 988 592 474 350 192 73 11185 53295 856 534 402 209 --
NM_016472chr142368 123 1943 ----
NM_016507chr1732945 2627 900 ------
NM_016513chr653823 3079 3007 1351 1094 21320 825 12354 --
NM_016530chr154674 615 233 74 21330 133 ----
NM_016531chr463649 1644 1330 1022 968 639 11663 ----
NM_016542chrX31164 1142 566 ------
NM_016559chr351400 604 213 156 127 11484 ----
NM_016577chr323167 448 54250 4036 3868 2866 894 --1454
NM_016587chr751076 1004 985 952 345 ------
NM_016588chr62780 707 ------
NM_016591chr541210 854 275 120 --11055 179
NM_016604chr511073 21023 160 ----
NM_016605chr562558 2547 2174 1834 552 310 52248 1977 1063 1039 993 ----
NM_016621chr11154458 4375 3951 3810 3163 3109 3013 2940 1673 1598 1103 808 708 524 438 14327 --13652
NM_016626chr183632 623 490 11173 1363 --
NM_016628chr102828 810 --2848 57 --
NM_016652chr2051790 1249 385 223 214 ------
NM_016734chr951528 581 343 288 62 1106 31992 1965 293 11888
NM_016834chr1793579 3103 2827 2668 2519 1373 1345 1234 98 22871 277 22694 1186 --
NM_016835chr1793579 3103 2827 2668 2519 1373 1345 1234 98 22871 277 22694 1186 --
NM_016841chr1793579 3103 2827 2668 2519 1373 1345 1234 98 22871 277 22694 1186 --
NM_016929chr664016 3693 2984 1395 1301 42 ------
NM_016931chr111322 ------
NM_017410chr125942 379 344 191 172 1900 1335 11056
NM_017413chrX41763 1650 712 704 1669 31872 1593 134 --
NM_017420chr1423731 2882 52347 895 795 549 347 ----
NM_017423chr421856 834 11626 ----
NM_017447chr2143986 1355 1031 996 13564 ----
NM_017449chr151627 1461 1371 362 334 1484 ----
NM_017450chr1741364 1277 1244 232 ------
NM_017452chr2021411 497 2568 37 1269 --
NM_017453chr2021411 497 2568 37 1269 --
NM_017454chr2021411 497 2568 37 1269 --
NM_017490chr111275 ------
NM_017519chr61529 ------
NM_017544chrX131 ------
NM_017575chr1761583 1543 1403 493 130 61 1571 21121 1085 --
NM_017580chr1011826 --1556 --
NM_017592chr19152558 2471 2417 2286 1722 1032 897 847 680 635 616 605 512 505 76 22001 1950 1791 12126
NM_017610chr1511350 ------
NM_017615chr10137 ------
NM_017628chr445317 4295 3566 2094 33897 3699 1670 ----
NM_017633chr693729 2945 2882 2519 754 721 494 430 225 ------
NM_017634chr821633 1332 1787 11220 --
NM_017637chr989420 8142 7102 6968 6351 3139 1319 1253 36308 2681 1040 16029 --
NM_017650chr754677 4343 4129 4066 872 45508 4750 4600 1505 24418 2314 --
NM_017660chr1952636 2133 2110 2104 798 12685 12641 1280
NM_017709chr144031 3843 3453 3372 139 ----
NM_017730chr3------1601
NM_017737chr14893 717 354 87 1334 ----
NM_017738chr93891 502 96 ------
NM_017742chr184644 446 407 152 ----11467
NM_017747chr5184 ------
NM_017753chr9174 1749 ----
NM_017761chr191490 1470 1429 1409 1242 1132 1109 539 199 ------
NM_017762chr1522415 1670 ------
NM_017769chr1412404 ------
NM_017770chr612595 ----138
NM_017778chr831073 352 240 ------
NM_017780chr81352 ------
NM_017787chr1052911 2180 2163 478 253 124 --12250
NM_017799chr14--1720 --1797
NM_017801chr31801 --1281 11678
NM_017802chr71687 ------
NM_017848chrX64130 3301 1748 714 508 68 --11829 --
NM_017849chr283131 2724 2503 2433 719 636 373 42 185 12732 11181
NM_017860chr12692 40 1273 --1572
NM_017893chr1081315 1071 589 388 338 286 205 119 173 1158 --
NM_017902chr10105646 2015 1238 1177 1131 679 662 274 244 132 1219 ----
NM_017919chr975378 5186 5026 4855 4317 4285 1367 11247 55749 1281 1276 577 524 --
NM_017921chr17102337 2241 2173 1973 1702 1563 1434 651 356 254 --241 36 --
NM_017957chr172612 348 11531 ----
NM_017994chr752542 2506 2100 188 65 12356 --1393
NM_018018chr1221869 1469 ------
NM_018027chr1062048 1309 1037 899 135 120 12547 ----
NM_018043chr111939 ------
NM_018045chr152730 2539 701 689 608 1197 22522 2416 --
NM_018061chr151541 1512 1281 689 187 ------
NM_018078chr4------1362
NM_018084chr233219 2453 2400 ------
NM_018085chr197272 7143 5336 5065 1757 754 314 253 91 37132 6131 1623 17032 --
NM_018098chr31402 ------
NM_018133chr321799 855 --1479 --
NM_018172chr1171309 1256 1227 1049 1005 322 34 21293 1233 ----
NM_018182chr1772107 2090 2009 1601 768 221 210 21833 805 ----
NM_018184chr311745 1842 ----
NM_018189chr34679 462 345 147 11366 ----
NM_018195chr1141956 708 652 537 ------
NM_018199chr1421208 481 11181 ----
NM_018205chr1092036 1898 1867 1441 951 780 644 527 186 126 12147 --
NM_018207chr161669 1488 1448 418 382 61 11702 2335 275 --
NM_018239chr1092036 1898 1867 1441 951 780 644 527 186 126 12147 --
NM_018241chr42752 252 1727 ----
NM_018247chr662251 2182 2131 1995 825 708 ------
NM_018293chr31986 12290 ----
NM_018299chr82926 501 1479 ----
NM_018312chr1111437 ------
NM_018313chr332303 2061 988 1994 ----
NM_018315chr4126 ------
NM_018323chr431454 1439 164 1712 ----
NM_018327chr2051786 1668 1455 1228 328 ------
NM_018330chr103603 205 120 21557 126 ----
NM_018351chr1274505 4040 3676 2917 1881 859 740 64189 3926 3761 3537 2890 1829 ----
NM_018362chr1143553 3531 3203 989 --13462 --
NM_018364chr132765 1149 628 12749 ----
NM_018371chr81258 ------
NM_018373chr1444093 2400 2051 29 21112 756 14323 --
NM_018383chr251809 1768 1453 1277 218 --21374 706 --
NM_018398chr3----1112 --
NM_018403chr3103339 3285 2913 2832 2499 1655 1323 1064 404 35 --23332 1332 --
NM_018424chr92771 499 ------
NM_018425chr1082472 2109 1861 1698 1692 929 887 432 21705 791 ----
NM_018437chr9129 ------
NM_018440chr886517 6305 5362 2304 1096 847 362 276 27028 6168 47679 5735 5252 564 --
NM_018452chr6_random63554 3046 2969 2730 1535 774 2860 832 1895 --
NM_018460chr2148 ------
NM_018471chr21422 ------
NM_018489chr152393 2113 1714 578 189 --1545 --
NM_018490chr114682 484 207 176 ------
NM_018555chr194893 591 432 310 31997 792 291 ----
NM_018566chr154835 4739 4321 3921 592 33195 417 310 13270 --
NM_018571chr22652 509 ------
NM_018638chr1224870 1694 ------
NM_018644chr1161673 1426 660 634 461 228 21558 624 1144 --
NM_018650chr121459 78 ------
NM_018667chr1672546 2481 1940 1803 1127 741 592 22081 1116 1221 --
NM_018689chr1572014 1991 1942 1831 726 362 88 1682 --11689
NM_018717chr432878 2727 1826 ----3789 322 297
NM_018718chr722168 1488 1522 21604 823 1554
NM_018841chr183958 3492 2537 1315 1266 1086 987 340 136 1937 --
NM_018912chr571318 1224 649 563 550 156 43 21131 377 152 --
NM_018913chr571318 1224 649 563 550 156 43 21131 377 152 --
NM_018914chr571318 1224 649 563 550 156 43 21131 377 152 --
NM_018915chr571318 1224 649 563 550 156 43 21131 377 152 --
NM_018916chr571318 1224 649 563 550 156 43 21131 377 152 --
NM_018917chr571318 1224 649 563 550 156 43 21131 377 152 --
NM_018918chr571318 1224 649 563 550 156 43 21131 377 152 --
NM_018919chr571318 1224 649 563 550 156 43 21131 377 152 --
NM_018920chr571318 1224 649 563 550 156 43 21131 377 152 --
NM_018921chr571318 1224 649 563 550 156 43 21131 377 152 --
NM_018922chr571318 1224 649 563 550 156 43 21131 377 152 --
NM_018923chr571318 1224 649 563 550 156 43 21131 377 152 --
NM_018924chr571318 1224 649 563 550 156 43 21131 377 152 --
NM_018925chr571318 1224 649 563 550 156 43 21131 377 152 --
NM_018926chr571318 1224 649 563 550 156 43 21131 377 152 --
NM_018927chr571318 1224 649 563 550 156 43 21131 377 152 --
NM_018928chr571318 1224 649 563 550 156 43 21131 377 152 --
NM_018929chr571318 1224 649 563 550 156 43 21131 377 152 --
NM_018945chr653674 3662 2938 2753 1030 --21002 89 --
NM_018970chr733193 2566 1979 --12729 --
NM_018976chr122355 58 ------
NM_018983chr41239 ------
NM_018992chr1631662 592 179 11436 1172 11034
NM_018999chr1063747 1943 979 572 333 184 14127 13250 --
NM_019001chr354569 4431 4038 3973 1597 11554 ----
NM_019004chr72601 94 ------
NM_019008chr2273808 3707 3065 789 611 438 180 21211 1082 --12903
NM_019027chr431598 798 679 --11036 --
NM_019036chr62839 446 ------
NM_019056chrX122 ------
NM_019057chr52243 100 ----1275
NM_019063chr21788 ------
NM_019072chr553315 3214 1226 840 23 --21651 1484 --
NM_019084chr1062149 2020 1956 1903 345 255 11943 --11579
NM_019106chr22113374 3338 3228 3020 2878 2522 2135 2125 868 691 85 ------
NM_019114chr92864 113 12219 --1977
NM_019116chr1641482 1036 912 23 --23219 869 1904
NM_019556chrX21311 374 ------
NM_019593chr2032175 864 458 ------
NM_019596chr2122669 589 22922 456 21014 97 --
NM_019610chr121659 813 ------
NM_019854chr121771 ------
NM_019859chr1021086 303 ------
NM_019860chr1021134 351 ------
NM_019884chr19----1427 --
NM_019885chr252571 2444 904 733 448 22003 645 2509 27 --
NM_019895chr34969 921 831 807 ------
NM_020039chr1261702 1228 493 470 288 65 --31509 1305 771 --
NM_020116chr421220 127 ------
NM_020119chr763119 2966 2893 2511 460 188 --43992 3930 3727 411 13936
NM_020122chr285513 5477 4493 4388 3655 1875 1608 466 24732 3995 13884 --
NM_020132chr2195036 4643 4217 3945 3911 3508 3173 1566 1063 1205 21337 1142 --
NM_020140chr12135 ------
NM_020177chr532435 697 429 1167 --13020
NM_020182chr2053095 2630 2447 2361 1021 11294 ----
NM_020205chr132721 2333 1326 11043 149 --
NM_020243chr226847 754 641 282 258 162 ------
NM_020245chr655020 4289 3789 1742 139 1390 --14194
NM_020310chr17112525 2175 2155 1093 859 711 679 484 395 252 96 22050 1824 ----
NM_020336chr2043482 3054 1305 972 ------
NM_020337chr443195 2121 484 154 ------
NM_020342chr22629 84 12218 1136 --
NM_020348chr1042610 916 792 725 22428 2250 22548 2051 --
NM_020374chr1241501 190 113 93 --11561 --
NM_020381chr621469 571 ----11540
NM_020390chr383165 3131 1225 1214 907 860 806 250 --11077 --
NM_020416chr462652 2301 2000 1691 168 32 154 ----
NM_020432chr72708 695 12042 ----
NM_020440chr152927 2668 2565 2335 239 11285 21344 601 --
NM_020443chr1136944 6523 5073 2583 2282 2229 2097 2050 1966 1398 1153 510 459 26982 5450 25893 2509 --
NM_020638chr123745 393 176 41700 296 241 228 ----
NM_020647chr822079 468 22161 513 ----
NM_020654chr321430 446 ------
NM_020673chr20107397 7165 5195 5078 4915 2873 1469 1383 1216 1006 16782 25330 2248 --
NM_020686chr1662607 2308 871 474 228 68 2315 42 1298 --
NM_020689chr2031291 1102 147 1236 21619 1194 11335
NM_020698chr1243154 3115 2335 704 1595 32658 723 268 --
NM_020699chr1104549 3885 3758 1257 910 795 739 527 419 66 23911 1130 14976 13733
NM_020717chrX84847 4137 3980 1582 1382 1312 952 162 34714 1147 620 24263 36 --
NM_020718chr1686005 5268 4813 4715 2592 2548 1363 1204 --1116 12006
NM_020727chr2143786 1240 497 421 12962 ----
NM_020732chr61529 ------
NM_020737chr61215 ------
NM_020742chrX22089 335 1817 --1482
NM_020749chr81194 --11381 1786
NM_020760chr231652 216 203 --1386 --
NM_020766chrX41522 1099 835 524 ------
NM_020769chrX1186 ------
NM_020772chr1778399 8370 7716 7289 6910 2586 1359 11677 16566 --
NM_020774chr1846146 4583 4473 2298 11622 ----
NM_020778chr15164810 4486 4184 3989 3762 3508 3225 3074 1846 1642 1151 1124 996 848 568 358 21188 32 1712 11751
NM_020779chr222386 1169 12023 --13125
NM_020783chr1832449 1647 1545 ------
NM_020796chr532019 449 75 12934 ----
NM_020801chr541919 822 334 115 1191 ----
NM_020807chr1651804 1624 1321 647 110 --1369 155
NM_020810chr1463245 2767 2761 2650 1128 479 ------
NM_020832chr12461 124 --1455 1236
NM_020834chr1451812 1535 696 417 218 ------
NM_020841chr1243988 2564 1535 529 ------
NM_020845chr1241950 679 445 331 31654 897 406 11900 11674
NM_020856chr1921213 1067 ------
NM_020868chr231879 166 43 ------
NM_020873chr31311 ------
NM_020888chr15747 670 530 436 363 11752 ----
NM_020909chr222555 198 23241 2865 1164 --
NM_020918chr1083169 2891 2683 1171 913 893 171 71 22883 2300 ----
NM_020921chr1443277 2232 1247 70 --187 --
NM_020935chr254435 4356 3106 1383 371 33787 3656 943 23093 1838 --
NM_020952chr93550 58 31 ------
NM_020956chr19154258 4119 3866 3799 3526 3384 3264 1698 1575 1518 1503 1065 542 509 129 1490 34522 4039 249 --
NM_020967chr203852 426 152 --1323 --
NM_020977chr441966 257 249 181 2850 276 ----
NM_021005chr151801 ------
NM_021033chr1323023 1272 --138 --
NM_021061chr864215 4042 3563 3315 674 69 34177 329 203 11595 --
NM_021064chr671798 1678 1194 714 344 44 28 --11313 --
NM_021072chr522612 1896 11635 ----
NM_021079chr1783335 2926 2763 2564 2282 2074 1071 77 12212 ----
NM_021088chr262035 1502 843 769 640 447 ------
NM_021090chr2294531 4033 3514 3080 1624 1586 1265 866 60 14190 ----
NM_021096chr22103315 3036 2980 2834 2722 2659 2141 1270 806 432 --11195 1132
NM_021135chr692968 2738 2578 2344 1278 796 650 544 22 21031 378 --13394
NM_021144chr9128 ------
NM_021159chr421570 1357 11444 ----
NM_021161chr141102 ------
NM_021202chr2063004 2706 2141 2081 1973 976 42650 915 219 134 1496 --
NM_021253chr63972 343 206 11359 ----
NM_021255chr1462940 2930 1046 719 459 189 12844 ----
NM_021638chr474460 1187 1137 828 325 220 86 ------
NM_021647chr421662 698 11429 ----
NM_021738chr10------140
NM_021783chrX51972 1686 1657 823 40 1438 1267 --
NM_021813chr6104499 4493 3896 1868 1779 1398 502 301 256 212 35098 3592 555 ----
NM_021814chr63624 440 68 ------
NM_021911chr521915 1405 35185 4177 885 --1325
NM_021912chr1553786 3406 3049 1294 1232 23891 892 13583 --
NM_021913chr1951672 1481 1334 706 274 ------
NM_021925chr261770 1463 1303 669 537 266 ------
NM_021940chr611263 --1263 --
NM_021949chrX52867 2564 581 172 69 --11918 --
NM_021950chr1132221 746 648 11605 ----
NM_021952chr11147 ------
NM_021956chr61485 --1324 1357
NM_021960chr132774 2350 528 ------
NM_021961chr1186040 6008 5288 2988 2873 2366 1505 138 55198 1820 1762 1161 418 11408 14733
NM_021962chr1782216 1991 1779 1676 708 497 381 191 22182 102 2185 60 22314 2295
NM_021964chr345325 4148 636 307 12511 ----
NM_021970chr42121 100 ------
NM_021984chrX61449 1359 1335 417 318 52 1346 ----
NM_021987chrX61449 1359 1335 417 318 52 1346 ----
NM_021990chrX61449 1359 1335 417 318 52 1346 ----
NM_022041chr161502 12518 1472 1483
NM_022048chr1575614 5435 4772 1196 558 369 200 44245 2434 1447 1379 11742 --
NM_022062chr1131910 196 170 21851 1277 21479 706 --
NM_022080chr2062666 2284 1026 1008 350 230 12062 ----
NM_022085chr621483 1328 11280 133 --
NM_022090chr51550 ------
NM_022166chr1695049 5017 4955 4682 3917 1819 539 470 38 25568 2233 11176 --
NM_022340chr373460 2914 2828 1417 938 335 31 12694 --1621
NM_022351chr853468 3290 2423 485 181 --12785 11037
NM_022456chr12157278 6903 6483 5299 4938 4721 2929 2890 2791 2736 2290 2166 1496 832 98 57600 7242 6051 5166 2119 12305 --
NM_022459chr13106368 6098 6063 5280 4394 2507 2443 2149 1618 504 25850 4211 1463 --
NM_022469chr153060 2358 2264 931 250 22898 286 ----
NM_022474chr1422645 758 1672 --170
NM_022477chr2061388 1253 645 311 280 183 1218 11584 --
NM_022484chr71511 ------
NM_022491chr1273107 2773 1025 478 462 199 175 ------
NM_022497chr353625 2595 1127 1031 75 1994 33015 2874 664 --
NM_022648chr284464 4156 4072 3758 3123 1472 698 394 44447 3027 842 290 11170 14007
NM_022650chr5----1891 144
NM_022716chr1127 12385 ----
NM_022733chr13918 215 119 --1151 --
NM_022744chr164963 855 27 21 --2376 289 --
NM_022753chr112292 ------
NM_022758chr622450 2021 22575 2218 22083 1278 23009 2190
NM_022763chr313163 ----13202
NM_022784chr152974 105 ------
NM_022802chr10--11563 11463 --
NM_022824chr541657 1406 1304 348 --1568 --
NM_022826chr221210 91 ------
NM_022831chr141526 538 491 135 ------
NM_022841chr1512757 ------
NM_022894chr21631 ------
NM_022897chr54890 154 134 88 ------
NM_022898chr1464262 4208 1794 1455 137 119 11817 11276 1851
NM_022902chr51401 ------
NM_022913chr5------1229
NM_022977chrX72117 1897 1886 1693 610 473 269 ------
NM_023923chr193162 3137 3031 2816 2631 2406 1334 698 463 31197 757 90 23225 3091 --
NM_023929chr81385 --12549 --
NM_024007chr523087 2723 ------
NM_024015chr171765 ------
NM_024045chr10148 ------
NM_024052chr1743124 1184 997 431 21971 451 --11013
NM_024061chr71106 1641 ----
NM_024072chr1251480 1308 1085 451 180 11342 1634 11291
NM_024076chr1982300 2213 2047 2028 1878 1702 1588 215 3908 828 257 1761 --
NM_024103chr19121599 1310 1239 1178 585 485 333 303 199 141 69 25 41514 516 478 164 ----
NM_024294chr622450 2021 22575 2218 22083 1278 23009 2190
NM_024345chr945801 4254 2002 1705 11573 15927 --
NM_024411chr2031011 379 305 1507 1135 11027
NM_024511chr43969 729 474 13327 22933 1126 --
NM_024522chr171804 1777 1678 1641 1217 643 361 1343 1121 --
NM_024523chr751355 1142 1025 841 448 ------
NM_024524chr323123 2655 1180 ----
NM_024554chr131741 1252 64 11694 ----
NM_024594chr551902 1611 1487 1183 299 11353 ----
NM_024639chr672360 2061 598 241 211 190 152 2454 167 ----
NM_024659chr23823 199 33 1855 ----
NM_024665chr313490 ------
NM_024680chr11------1371
NM_024740chr1184096 3580 3555 3225 2966 1361 1312 1224 --13919 --
NM_024744chr212017 ------
NM_024769chr112254 73 1928 ----
NM_024770chr2126704 5353 4724 4377 2584 2375 2079 1929 808 511 462 214 21945 674 21716 1574 --
NM_024779chr1221593 383 ------
NM_024798chr1582707 2338 2190 1117 757 500 419 118 2920 283 --1205
NM_024811chr1171672 1630 482 437 305 184 116 21519 1405 21208 669 --
NM_024817chr15155243 4711 4308 2348 2261 2133 1892 1428 1214 1100 849 485 428 410 101 1887 1681 12172
NM_024887chr141414 849 615 401 ----11971
NM_024889chr10--111202 1187 1165 1151 1136 720 705 661 647 635 620 ----
NM_024900chr452300 2184 1940 1871 42 ----11548
NM_024900chr452300 2184 1940 1871 42 ----11548
NM_024939chr1691506 1465 1412 1251 1021 441 146 138 82 ------
NM_024941chr511368 ------
NM_024947chr358121 7737 7340 6549 6242 --171 --
NM_024949chr4104830 4223 4213 4112 3988 3904 1726 1239 510 253 24437 1620 ----
NM_024971chr93550 58 31 ------
NM_024989chr287687 7419 6380 6230 2740 1530 1317 1306 27529 5985 22968 2470 --
NM_024991chr1071224 998 546 526 416 395 346 ------
NM_025057chr14------1491
NM_025073chr194435 4257 3598 3589 2880 1190 1087 659 632 14660 11559 --
NM_025076chr21159 ------
NM_025133chr22321 148 ------
NM_025134chr1632423 559 281 ------
NM_025152chr1421295 712 ------
NM_025160chr133130 1018 139 13597 ----
NM_025179chr194711 3978 3653 3620 1660 1527 1521 1456 41 24365 879 1428 --
NM_025221chr4--2885 27 --11107
NM_025222chr382702 2210 2128 1205 990 983 377 154 12284 ----
NM_030621chr1443655 2837 1318 295 11606 ----
NM_030623chr2111681 1651 1530 1485 1451 1215 643 293 266 188 44 11729 ----
NM_030625chr1011875 1469 ----
NM_030634chr162178 2110 2062 1535 422 340 ------
NM_030637chr14128 ------
NM_030647chr735028 1314 119 1850 ----
NM_030648chr434882 4759 1993 ------
NM_030664chr1042381 1773 943 194 ------
NM_030674chr1285679 4893 1923 1337 1306 998 859 850 ----2946 569
NM_030758chr2251188 976 329 105 94 11421 --1555
NM_030761chr1112552 2372 2127 2058 1948 1932 1664 783 674 664 42 11051 32617 2449 2078 --
NM_030773chr2021782 655 ------
NM_030786chr131555 1404 88 ------
NM_030806chr1169212 8936 8607 8139 8045 7862 7405 7177 7171 6846 6726 6344 3460 3204 1598 331 28003 2427 ----
NM_030810chr621483 1328 11280 133 --
NM_030820chr611013 ------
NM_030881chr2252237 2188 1783 291 133 12248 ----
NM_030885chr3----12210 --
NM_030918chr194456 4328 4223 4155 4145 3929 2034 1864 1729 54859 4629 4541 4235 745 11066 --
NM_030938chr172754 95 ------
NM_030964chr573552 3191 2556 702 623 348 134 32720 1385 1272 13172 --
NM_030965chr12601 517 1327 ----
NM_030979chr131371 ------
NM_030984chr7124 ------
NM_031268chr16124532 4050 4020 1504 1425 1242 806 380 308 279 169 49 14597 14771 23979 1822
NM_031372chr4----1139 --
NM_031417chr1992234 1871 934 863 727 651 609 257 133 42430 2208 1840 603 --1906
NM_031426chr982494 2394 2043 1809 1710 902 530 23 12092 ----
NM_031427chr1465238 4631 4298 3747 1688 1290 24163 1554 ----
NM_031442chrX52939 2267 1054 857 433 142 ----
NM_031444chr22111943 1821 1805 1701 997 924 540 498 431 78 50 2585 287 12403 --
NM_031445chr21200 --12846 12339
NM_031468chr7157571 7526 6500 6400 6078 2972 2951 2840 2497 2176 2028 2014 1097 980 739 27841 5586 13062 11882
NM_031483chr2043114 2525 1076 808 11008 ----
NM_031844chr153912 3513 3236 1363 690 23786 3596 ----
NM_031845chr222806 569 33539 2286 1470 ----
NM_031847chr222806 569 33539 2286 1470 ----
NM_031890chr2241079 646 237 45 12833 --12097
NM_031935chr111044 ------
NM_032013chr2061388 1253 645 311 280 183 1218 11584 --
NM_032042chr562301 1153 821 420 116 83 22917 1763 ----
NM_032047chr332151 930 186 ------
NM_032050chr2261024 332 315 165 138 127 ------
NM_032088chr571318 1224 649 563 550 156 43 21131 377 152 --
NM_032092chr571318 1224 649 563 550 156 43 21131 377 152 --
NM_032104chr14475 213 129 21 ------
NM_032105chr1177333 6633 6496 5905 5478 4927 2572 2496 2345 2287 2174 741 475 432 213 129 21 47114 4933 2212 2095 ----
NM_032121chrX2872 319 ------
NM_032145chr611922 1616 ----
NM_032154chr101933 ------
NM_032199chr1093839 3694 3672 3394 941 233 138 125 24 22608 222 23028 1228 --
NM_032208chr233196 2381 439 2533 283 13278 --
NM_032211chr1061099 880 767 445 346 83 ------
NM_032213chr241186 304 247 25 ------
NM_032221chr2011459 ------
NM_032229chr132757 475 ------
NM_032239chr411331 ------
NM_032256chr121369 1202 --1136
NM_032281chr1972264 1219 1114 748 502 402 86 23069 414 12799 --
NM_032312chr21713 ------
NM_032373chr1075791 5346 4055 2034 1699 707 351 13922 ----
NM_032403chr571318 1224 649 563 550 156 43 21131 377 152 --
NM_032424chr113452 296 151 1421 1500 --
NM_032438chr611150 --1550 --
NM_032439chr1031702 1186 466 ------
NM_032441chrX3479 318 181 ------
NM_032445chr1512392 ------
NM_032446chr521112 731 13647 ----
NM_032449chr1102682 2643 2434 2117 2085 1046 792 356 64 52 --11781 --
NM_032452chr1451460 1371 496 364 236 --1611 --
NM_032457chr422741 977 31569 603 236 13841 --
NM_032458chrX1468 --1441 --
NM_032466chr8----146 --
NM_032468chr8----146 --
NM_032521chr2061155 912 692 582 351 200 22935 455 22968 770 --
NM_032538chr692589 2523 2351 2345 2192 2114 2022 1969 122 42801 2504 400 82 1100 --
NM_032582chr1721721 1578 ------
NM_032594chr142926 298 ------
NM_032646chr1771510 1368 702 536 422 145 103 11324 1411 --
NM_032711chr1774114 3961 3811 3068 1348 572 244 23118 3086 --1468
NM_032782chr53481 250 216 --1841 --
NM_032881chr1126 ----1126
NM_032900chr1053504 1334 596 255 142 --21557 350 13798
NM_032924chr751111 1078 1002 959 879 173 ----
NM_032966chr1161562 1244 1038 318 229 210 169 ----
NM_032968chrX54141 3698 3690 2616 996 --11105 --
NM_032969chrX54141 3698 3690 2616 996 --11105 --
NM_032973chrY43690 3682 2615 996 --11105 --
NM_032978chr183993 793 760 ------
NM_032979chr183993 793 760 ------
NM_032981chr183993 793 760 ------
NM_032982chr752468 1894 1017 619 471 ------
NM_032983chr763282 2708 2088 1285 631 374 ------
NM_032993chr41239 ------
NM_032995chr261537 1216 1118 593 542 310 3566 441 117 --1553
NM_033020chr164286 3701 3494 3263 1364 764 ------
NM_033030chr22245 45 --130 --
NM_033081chr201926 11276 ----
NM_033082chr12175 ------
NM_033102chr161080 1063 1044 955 943 49 --2978 839 --
NM_033102chr161080 1063 1044 955 943 49 --2978 839 --
NM_033129chr20101988 1265 789 737 731 418 273 206 196 156 --31818 515 84 --
NM_033132chr134926 917 589 61 ------
NM_033133chr1783622 3276 2686 2327 935 602 349 327 43682 3531 1161 200 41286 1203 337 332 --
NM_033181chr683942 3104 2865 2661 1557 1250 109 52 1677 13131 --
NM_033201chr1631059 358 80 2485 383 --1865
NM_033224chr7126689 6139 5920 5701 5617 5551 5239 3199 1653 357 281 34 15119 16752 --
NM_033240chr15101717 1621 1544 1266 1196 1130 1086 667 144 60 ------
NM_033274chr5123412 3030 2947 2706 2553 2370 2324 1261 1193 525 323 185 --22634 1093 --
NM_033280chr181127 ------
NM_033285chr833311 2832 1099 --11040 --
NM_033290chrX73383 3361 3213 2588 2581 1378 138 ------
NM_033309chr164982 918 715 28 1757 --1239
NM_033315chr1772047 1974 1640 1544 578 457 409 --2255 182 1674
NM_033326chr1152073 2066 1831 760 272 155 ----
NM_033338chr1031300 906 376 ----11031
NM_033339chr1031300 906 376 ----11031
NM_033340chr1031416 1022 492 ----11147
NM_033360chr1213672 13948 --11253
NM_033375chr1721054 27 --31451 1019 34 --
NM_033429chr1543208 866 780 121 1595 --12041
NM_033480chr682818 2756 2669 2003 1057 702 663 465 --32961 966 902 --
NM_033481chr682818 2756 2669 2003 1057 702 663 465 --32961 966 902 --
NM_033503chr1583552 3056 2988 2577 2531 1505 1411 591 31218 902 477 33540 3130 3099 --
NM_033516chr961588 1457 1435 1212 1120 461 11500 --1227
NM_033549chr54812 715 164 82 --1286 1219
NM_033551chr582839 2657 2115 1110 675 389 353 70 23155 2394 --1458
NM_033631chr153532 692 686 451 219 33334 869 307 2443 209 1897
NM_033632chr4126 ------
NM_033637chr10133923 3814 3717 2951 2709 2698 2555 1533 471 464 183 111 31 1530 23377 523 13973
NM_033644chr562202 1986 878 693 492 72 --1145 --
NM_033645chr562202 1986 878 693 492 72 --1145 --
NM_033656chr21114925 4687 4479 4469 4199 4082 3972 2157 1275 1134 790 --13942 --
NM_052818chr1351764 1708 1660 1556 854 12104 ----
NM_052851chr1362052 1910 757 319 281 119 --1561 --
NM_052860chr5262 36 195 1142 --
NM_052869chr1771510 1368 702 536 422 145 103 11324 1411 --
NM_052880chr2221088 1002 1192 21264 1125 --
NM_052885chr1244511 3100 886 410 13644 ----
NM_052900chr821443 686 11558 ----
NM_052905chr21184 11653 ----
NM_052906chr22165048 4012 3827 1979 1872 1805 1404 1357 1347 972 596 588 532 275 168 106 11272 21604 1106 14290
NM_052927chr521365 352 ------
NM_052934chr151783 1586 619 513 504 11431 11448 11689
NM_052937chr812483 ------
NM_052954chr2141788 1595 471 169 1770 ----
NM_052958chr83677 626 159 ------
NM_052996chr1641645 1317 588 54 ------
NM_053023chr1132811 655 329 32367 707 636 ----
NM_053024chr311581 11152 1455 --
NM_053056chr1142881 2248 1028 926 33112 728 307 ----
NM_054025chr1161673 1426 660 634 461 228 21558 624 1144 --
NM_054027chr522173 903 12039 --11406
NM_054033chr2187 --1120 --
NM_057169chr1233036 2796 49 ------
NM_057170chr1233036 2796 49 ------
NM_058172chr421784 1354 ------
NM_078470chr1042274 1868 643 366 1992 1898 --
NM_078471chr1771126 1074 1016 894 820 494 97 ------
NM_078487chr943155 350 319 133 12543 2929 105 --
NM_080491chr1173779 3712 2518 1462 831 600 24 12851 32418 1217 211 13399
NM_080546chr941915 810 654 520 ----1570
NM_080599chr10----11218 --
NM_080617chr201739 --1799 --
NM_080621chr2031249 417 250 2441 32 1127 1522
NM_080629chr12248 241 ----11089
NM_080630chr12248 241 ----11089
NM_080672chr20187 ------
NM_080743chr632106 1854 567 1960 1862 --
NM_080829chr205828 769 695 152 119 1237 2248 55 --
NM_080836chr2084326 3820 3473 3052 1324 1239 947 683 53919 3346 2976 1803 131 ----
NM_080867chr1454065 3602 1280 749 105 14325 13720 --
NM_080872chr854069 3324 2998 2508 81 ------
NM_080927chr343086 1313 1142 851 ------
NM_100264chr102828 810 --2848 57 --
NM_100486chr102828 810 --2848 57 --
NM_130385chr1172864 2306 2195 2182 1991 1088 79 ------
NM_130436chr212748 195 ------
NM_130438chr2151325 772 338 270 195 2442 69 ----
NM_130846chr121258 1879 ----
NM_133170chr20197790 7356 5694 5529 5440 5211 3146 3118 2827 2813 2166 1677 1267 1145 622 577 249 228 209 37267 3093 1175 47694 5404 5264 2805 26632 1804
NM_133172chr5----2243 47 --
NM_133173chr5----2243 47 --
NM_133174chr5----2243 47 --
NM_133264chr1763665 3409 3331 2945 2496 146 22556 99 12994 --
NM_133334chr466120 5056 2511 1602 1306 1226 34773 4433 496 --14441
NM_133367chr643041 2381 2329 1228 23133 2843 1780 1874
NM_133370chr443484 3352 1218 248 13000 ----
NM_133378chr21907 1358 --1333
NM_133432chr21907 1358 --1333
NM_133437chr21907 1358 --1333
NM_133445chr943397 2841 274 148 ------
NM_133476chr122279 62 ------
NM_133496chr174534 4057 3698 3678 2941 362 76 11559 1834 --
NM_133625chr351241 527 477 154 26 1196 131 --
NM_133647chr1593747 3674 3473 3041 2741 2665 2546 229 91 43656 1524 1389 213 12809 --
NM_134265chr1711212 ------
NM_134325chr181318 1121 677 611 489 154 48 39 ----11224
NM_138270chrX2672 85 22921 1369 ----
NM_138286chr1933834 1333 1148 24106 217 ----
NM_138300chr131331 565 277 1361 11530 1374
NM_138317chr141102 ------
NM_138318chr141102 ------
NM_138338chr22123359 3274 3117 2470 2378 2339 2148 1260 1096 1089 995 953 ------
NM_138357chr101196 ------
NM_138426chr722331 2103 ------
NM_138434chr721202 115 --11276 --
NM_138444chr1374812 1688 1610 837 394 50 34 ----11406
NM_138457chr6123348 2924 2770 2581 2398 2189 831 646 502 445 284 71 32469 2405 1064 11259 --
NM_138468chr275880 4747 3884 2350 2149 2111 1522 34714 2216 1389 --14465
NM_138473chr1294817 4370 3893 3155 1434 846 710 284 73 --11610 14424
NM_138576chr1464262 4208 1794 1455 137 119 11817 11276 1851
NM_138621chr264049 3416 2769 1605 1433 1334 23158 66 11180 --
NM_138735chr22469 434 1225 ----
NM_138782chr531756 524 331 --1954 --
NM_138959chr196773 5728 5308 4676 4388 4300 2046 894 679 56216 6102 5362 2116 790 --1823
NM_138967chr1572431 2345 1696 725 380 171 54 11814 12206 --
NM_138971chr1153666 3394 2580 933 323 ----1511
NM_138971chr1153666 3394 2580 933 323 ----1511
NM_138972chr1153666 3394 2580 933 323 ----1511
NM_138972chr1153666 3394 2580 933 323 ----1511
NM_138973chr1153666 3394 2580 933 323 ----1511
NM_138973chr1153666 3394 2580 933 323 ----1511
NM_139072chr22881 101 ------
NM_139182chr431394 511 364 ------
NM_139207chr1221464 48 1523 ----
NM_139279chr253104 2696 1417 711 91 1658 ----
NM_139280chr1741332 1157 130 25 --1959 --
NM_139321chr2031285 838 341 ------
NM_139323chr20--21375 49 11887 --
NM_144567chr161759 972 906 843 786 487 --11878 --
NM_144571chr435826 2656 1195 42265 2022 1984 1003 --1302
NM_144574chr141451 ------
NM_144578chr1455367 4986 4680 3959 905 1454 14954 --
NM_144582chr2102533 2482 2432 2335 2201 1907 872 665 440 123 11836 --1402
NM_144583chr251756 1706 1620 609 374 1196 ----
NM_144599chr1584485 3400 2082 1821 1206 647 202 191 13832 35070 3535 173 --
NM_144607chr1772649 2236 2131 1856 890 746 702 1557 1945 11622
NM_144628chr2043010 2891 2519 2390 12837 --12675
NM_144658chrX1245 1134 ----
NM_144778chr1342748 1911 1878 212 ------
NM_144949chr252107 1920 860 814 458 ------
NM_144967chrX21030 229 ------
NM_144969chrX2290 276 ------
NM_144973chr1243963 3315 47 28 11663 22109 1531 --
NM_145013chr1192611 2472 2412 2098 2031 815 408 116 36 ------
NM_145259chr2127014 6619 6092 6010 5735 5706 5522 4985 4417 2568 731 232 35559 5394 4394 ----
NM_145274chr17--1732 1778 --
NM_145686chr222362 719 ------
NM_145687chr222362 719 ------
NM_145690chr811948 ------
NM_145759chr112111 ----11898
NM_145793chr101784 1775 ----
NM_145800chrX2930 281 1198 1713 --
NM_145802chrX2879 230 1147 1662 --
NM_145912chr22163971 3823 3725 3341 3268 3087 2975 1629 1402 1387 1114 622 494 312 215 180 --34075 3697 258 --
NM_146388chr19101247 1025 903 884 525 478 458 249 87 72 --11053 --
NM_147147chr653830 3807 3632 1123 606 12941 1725 --
NM_147150chr963695 3647 3176 2482 530 390 11490 ----
NM_147171chr71381 ------
NM_147175chrX2393 80 ------
NM_147181chr4--2885 27 --11107
NM_147182chr4--2885 27 --11107
NM_147183chr4--2885 27 --11107
NM_147185chr71381 ------
NM_147202chr9102620 2419 2167 1745 1701 856 803 449 380 78 2472 273 2564 417 --
NM_147223chr252448 2199 668 583 574 ----1149
NM_147233chr252265 2016 485 400 391 ------
NM_148174chr842131 1652 1369 671 ------
NM_148894chr41284 --11025 --
NM_148898chr71856 ------
NM_148899chr71856 ------
NM_148921chr1792364 2045 1642 576 377 333 306 296 155 12174 ----
NM_152132chr14184 ------
NM_152253chr22104180 4116 4054 3747 3709 2707 1413 966 816 605 --23880 95 --
NM_152261chr122850 417 ------
NM_152277chr51549 1276 ----
NM_152280chr121025 292 13178 1647 --
NM_152299chr22176 ------
NM_152338chr16_random177 ------
NM_152371chr151875 1764 1751 1238 685 1678 ----
NM_152384chr26740 689 679 605 358 343 11727 21309 321 --
NM_152388chr253614 2986 2884 2465 969 13444 13622 13601
NM_152390chr23155 97 70 ------
NM_152409chr541379 675 227 145 1927 ----
NM_152414chr821051 660 ------
NM_152424chrX93972 3715 3620 3353 3124 1848 669 494 205 22957 1210 11532 --
NM_152437chr1222466 1559 ------
NM_152450chr1542103 2024 661 464 11546 ----
NM_152455chr1562616 1865 1078 650 465 33 --21010 584 --
NM_152470chr18123526 3492 2879 2776 1670 1024 986 924 902 665 563 277 23354 2734 33208 910 252 --
NM_152523chr2176 ------
NM_152538chr341640 1220 446 303 1500 1327 --
NM_152545chr41498 ----1679
NM_152554chr63580 226 24 ------
NM_152556chr711652 ------
NM_152563chr1171309 1256 1227 1049 1005 322 34 21293 1233 ----
NM_152594chr151276 --1167 --
NM_152607chr13344 141 68 ------
NM_152622chr543146 484 366 333 1272 ----
NM_152624chr586041 5777 5078 2681 2561 1028 785 587 21749 747 1413 --
NM_152629chr973814 2890 2737 1302 716 497 478 11648 1102 --
NM_152641chr1222869 2826 ----12071
NM_152678chr331717 940 852 22428 1056 1355 --
NM_152686chr572334 2266 1906 1757 1607 882 589 21623 946 22112 486 --
NM_152688chr62792 364 ------
NM_152694chrX2281 93 ------
NM_152695chrX21877 903 --22021 1648 --
NM_152699chr383742 3602 3343 3060 2981 2841 2722 891 12807 ----
NM_152731chr63780 387 290 2985 829 ----
NM_152733chr6146359 6222 6161 5892 5710 5018 4972 4851 4094 1961 1787 1025 532 286 24982 4768 14965 --
NM_152744chr7113247 3059 3035 3020 2950 2803 2598 1035 532 457 307 ------
NM_152749chr71753 11044 --1811
NM_152753chr681969 1877 1871 1813 1288 481 320 24 12112 ----
NM_152754chr733265 2909 1352 ------
NM_152755chr72578 538 ------
NM_152756chr52651 168 1589 ----
NM_152787chrX63741 3190 2553 1567 302 89 1569 ----
NM_152788chr12135 ------
NM_152866chr1132221 746 648 11605 ----
NM_152924chr1585546 4572 4208 2403 2008 1835 1700 1307 25413 4182 ----
NM_152989chr12148 --11629 11552
NM_152991chr111545 ------
NM_152999chr753736 3175 1781 1667 1633 ----14081
NM_153013chr522014 775 11632 ----
NM_153029chr16133793 3630 3612 3261 3122 2773 2689 2635 1562 1156 927 784 708 --24174 3920 --
NM_153035chr153158 3023 2929 2020 620 1268 --1215
NM_153042chr621366 471 11294 ----
NM_153050chr2294531 4033 3514 3080 1624 1586 1265 866 60 14190 ----
NM_153051chr2294531 4033 3514 3080 1624 1586 1265 866 60 14190 ----
NM_153184chr31216 ------
NM_153235chr651995 1583 850 748 421 ------
NM_153262chr153042 2942 2365 2197 466 155 ----
NM_153350chr16131579 1544 1420 1282 1247 1168 1138 1115 605 493 453 183 159 --1119 --
NM_153367chr1063635 1573 1187 879 810 43 1513 33866 3661 824 --
NM_153456chr1375566 4559 4269 4228 1318 1016 774 21523 1158 12034 1868
NM_153487chr6104752 4623 4599 4512 4408 3491 3468 823 95 27 1717 34437 1861 1279 --
NM_153607chr542185 1077 719 506 22993 462 ----
NM_153619chr1563306 952 880 788 269 131 22413 2269 1841 --
NM_153620chr751792 1275 1142 420 73 --1190 --
NM_153645chr2252442 1278 532 333 205 22051 2042 ----
NM_153812chr13396 148 127 --11611 --
NM_153836chr241916 1760 1715 197 11632 ----
NM_170665chr1273964 3301 3000 2973 1570 1361 1278 22808 1308 32915 2829 911 --
NM_170674chr153288 200 164 11079 --1323
NM_170677chr153288 200 164 11079 --1323
NM_170679chr5----11027 --
NM_170706chr154117 3390 3112 3034 1162 5442 403 364 325 286 23689 3151 14021
NM_170723chrY3248 217 90 ------
NM_170731chr1111801 12481 ----
NM_170732chr1111801 12481 ----
NM_170733chr1111801 12481 ----
NM_170734chr1111801 12481 ----
NM_170735chr1111801 12481 ----
NM_170751chr621111 211 ------
NM_170752chr621111 211 ------
NM_171825chr593120 2761 2457 2271 2047 2025 1995 1989 285 21262 660 ----
NM_171998chrX21673 92 ------
NM_172016chr63972 343 206 11359 ----
NM_172020chr751741 1504 1276 693 655 --21298 784 --
NM_172070chr212086 21607 301 ----
NM_172071chr1106890 6113 5602 4704 2234 2177 1625 1584 1146 430 15587 ----
NM_172103chr641911 922 416 270 ------
NM_172105chr641911 922 416 270 ------
NM_172159chr32775 53 12011 1109 --
NM_172160chr32775 53 12011 1109 --
NM_172240chr12------140
NM_172315chr153288 200 164 11079 --1323
NM_172316chr153288 200 164 11079 --1323
NM_172373chr1321130 161 ------
NM_172375chr14----1328 2370 142
NM_173054chr711017 133 ----
NM_173075chr431816 1615 1175 ------
NM_173083chr13973 89 22 2853 75 ----
NM_173167chr1772507 2458 2175 2128 2015 1960 1082 22566 863 ----
NM_173171chr22191 104 ----1904
NM_173172chr25499 412 172 161 67 ----11212
NM_173173chr22191 104 ----1904
NM_173198chr932689 2174 1858 1310 12045 --
NM_173200chr932689 2174 1858 1310 12045 --
NM_173354chr2161511 1379 753 617 516 177 11808 --1824
NM_173463chr473746 3580 3348 3071 2917 1610 1376 21651 359 ----
NM_173469chr1511408 ------
NM_173470chrX12928 12127 1677 11173
NM_173495chrX32480 2105 1778 1519 ----
NM_173500chr152936 339 ------
NM_173505chr182109 50 2873 847 11141 --
NM_173508chr131131 229 138 ------
NM_173511chr253497 3358 1560 1441 1222 1580 ----
NM_173552chr31880 ------
NM_173557chr18--1177 --1678
NM_173562chr693249 2958 2924 2570 2240 1159 1078 552 112 23113 919 ----
NM_173576chr103455 365 281 1269 ----
NM_173595chr12175221 5066 3935 3874 3687 3223 3217 2073 1874 1813 1758 1536 1437 1060 749 647 328 11233 ----
NM_173642chr1169086 8949 8760 8195 8173 8145 7838 6979 6111 5589 2849 2371 2210 1437 325 214 17537 17433 11928
NM_173662chr4------153
NM_173667chr521819 729 --1848 162
NM_173694chrX11983 --12350 --
NM_173797chr5------11198
NM_173807chr1150 ------
NM_173808chr133092 985 648 ------
NM_173809chr1031064 935 136 --11289 11479
NM_173812chr1221596 330 21433 1008 ----
NM_173825chr362707 2114 2006 1896 537 172 12411 ----
NM_173830chr61153 ------
NM_174902chr1131364 660 378 11170 ----
NM_174965chr12890 50 --1729 3269 260 31
NM_174967chr12890 50 --1729 3269 260 31
NM_174970chr12890 50 --1729 3269 260 31
NM_175061chr711386 ------
NM_175607chr341654 692 680 639 ------
NM_175611chr211212 1242 ----
NM_175612chr341654 692 680 639 ------
NM_175623chr12157278 6903 6483 5299 4938 4721 2929 2890 2791 2736 2290 2166 1496 832 98 57600 7242 6051 5166 2119 12305 --
NM_175624chr12157373 6998 6578 5394 5033 4816 3024 2985 2886 2831 2385 2261 1591 927 193 57695 7337 6146 5261 2214 12400 --
NM_175625chr12157373 6998 6578 5394 5033 4816 3024 2985 2886 2831 2385 2261 1591 927 193 57695 7337 6146 5261 2214 12400 --
NM_175634chr831116 147 74 ------
NM_175635chr831116 147 74 ------
NM_175636chr831116 147 74 ------
NM_175733chr1161971 1820 1686 1611 1493 202 31879 712 374 ----
NM_175736chr12187686 7133 6435 6253 6247 5871 5467 4969 4866 2765 2322 1711 1576 1115 321 287 122 107 36483 2158 866 152 11314
NM_175854chr1332735 1098 823 ------
NM_175863chr61529 ------
NM_175866chr12281 143 ------
NM_175921chr553126 1244 902 840 272 13688 1803 --
NM_175931chr1682061 1973 1658 1396 1390 1360 585 52 --11544 --
NM_176801chr43288 195 108 ----11474
NM_176863chr1731340 226 41 21386 1348 ----
NM_177424chr131809 1691 1379 11640 ----
NM_177438chr1443655 2837 1318 295 11606 ----
NM_177969chr21727 --1664 --
NM_177977chr1781773 1497 1405 582 461 313 281 44 11603 21848 1567 --
NM_177996chr2073068 3012 2406 2226 2205 682 103 --21075 35 --
NM_177999chr973648 3310 2649 2574 2301 328 59 12501 32833 2450 70 23250 507
NM_178006chr1362052 1910 757 319 281 119 --1561 --
NM_178007chr1362052 1910 757 319 281 119 --1561 --
NM_178010chr12148 --11629 11552
NM_178013chr1472864 2648 2391 2157 743 294 184 1463 12079 --
NM_178014chr64628 381 162 54 ------
NM_178037chr1283565 3510 3244 3218 2627 2572 1383 479 22454 324 ----
NM_178038chr1283565 3510 3244 3218 2627 2572 1383 479 22454 324 ----
NM_178140chr572365 2039 1970 952 884 588 366 21095 358 ----
NM_178151chrX97497 7175 7116 5768 2606 2488 2157 499 71 --15215 27050 81
NM_178152chrX97497 7175 7116 5768 2606 2488 2157 499 71 --15215 27050 81
NM_178153chrX97497 7175 7116 5768 2606 2488 2157 499 71 --15215 27050 81
NM_178177chr3--135 1574 --
NM_178229chr161031 764 356 206 138 116 1337 ----
NM_178496chr311413 ------
NM_178505chr1042566 2392 554 79 12545 1517 --
NM_178539chr1231799 116 67 ------
NM_178554chr341448 589 405 357 32263 2242 653 11250 --
NM_178815chr1022022 370 --1723 --
NM_178818chr1641565 852 765 744 22459 2323 ----
NM_181054chr1421083 909 ------
NM_181077chr1531598 467 28 ------
NM_181302chr141451 ------
NM_181308chr141451 ------
NM_181332chrX22089 335 1817 --1482
NM_181351chr1121935 1849 22877 70 --12141
NM_181358chr143705 3338 2976 955 ------
NM_181481chr1865612 5030 4355 2261 1389 674 26215 1201 12057 1737
NM_181482chr1865612 5030 4355 2261 1389 674 26215 1201 12057 1737
NM_181483chr1865612 5030 4355 2261 1389 674 26215 1201 12057 1737
NM_181504chr543733 3690 1052 176 22764 651 12670 11189
NM_181521chr1696346 5633 5546 5525 2025 2014 510 232 153 27240 7104 ----
NM_181523chr543733 3690 1052 176 22764 651 12670 11189
NM_181524chr543733 3690 1052 176 22764 651 12670 11189
NM_181671chr172832 301 ------
NM_181672chrX2710 44 11319 ----
NM_181673chrX2710 44 11319 ----
NM_181780chr332105 1393 402 1294 --168
NM_181828chr22173754 3675 3660 3558 3409 3193 3054 2869 1078 1046 1010 988 592 474 350 192 73 11185 53295 856 534 402 209 --
NM_181829chr22173754 3675 3660 3558 3409 3193 3054 2869 1078 1046 1010 988 592 474 350 192 73 11185 53295 856 534 402 209 --
NM_181830chr22173754 3675 3660 3558 3409 3193 3054 2869 1078 1046 1010 988 592 474 350 192 73 11185 53295 856 534 402 209 --
NM_181832chr22183769 3690 3675 3573 3424 3208 3069 2884 1093 1061 1025 1003 607 489 365 207 88 25 11200 53310 871 549 417 224 --
NM_181836chr552179 2135 2057 885 442 ------
NM_181839chr81406 ------
NM_181846chr1953003 2826 1194 868 428 11811 1501 1609
NM_181876chr462652 2301 2000 1691 168 32 154 ----
NM_182509chr1421582 580 21417 417 41174 1133 308 59 1247
NM_182526chr1492982 2516 2475 2437 2016 813 761 243 142 12041 12906 --
NM_182607chrX41693 1181 1096 71 ------
NM_182641chr1721717 143 122 1170 --
NM_182643chr8--12112 --1617
NM_182648chr141516 ------
NM_182664chr121725 1653 21575 54 --1249
NM_182691chr711020 ------
NM_182692chr711020 ------
NM_182697chr72183 43 11167 ----
NM_182728chr1491651 1499 1371 1177 1154 685 544 408 243 1718 11512 --
NM_182729chr1241661 436 130 58 ------
NM_182742chr1241661 436 130 58 ------
NM_182743chr1241661 436 130 58 ------
NM_182760chr3128 --1127 --
NM_182767chr121746 21687 134 ----
NM_182797chr2011458 --1258 --
NM_182830chr141918 ------
NM_182898chr7136194 6135 5959 5592 4461 1617 1546 1370 1129 972 758 601 542 12322 1313 --
NM_182899chr7136194 6135 5959 5592 4461 1617 1546 1370 1129 972 758 601 542 12322 1313 --
NM_182970chr20174216 4032 3989 3870 3662 2987 2921 2818 2765 1169 811 505 377 357 200 72 48 23656 2839 33241 1174 318 --
NM_182972chr131130 585 26 --1839 --
NM_183004chr1433625 3609 3555 1445 1161 --
NM_183006chr2081521 1207 975 545 419 378 175 80 --21169 300 --
NM_183058chr10160 ------
NM_183078chr663078 964 920 845 525 126 23471 2863 11097 --
NM_183244chr20187 ------
NM_183246chr20187 ------
NM_183377chr172237 49 ----1169
NM_183397chr2084887 4731 4490 2049 1874 688 323 255 24640 1740 --14271
NM_184234chr20----1340 --
NM_194247chr263810 3542 3299 1232 1221 1143 13169 ----
NM_194278chr14103525 2764 2645 1632 1510 1450 1410 1236 1172 481 13285 13659 --
NM_194286chr12226120 6000 5866 5750 5576 5319 4900 4860 2488 2435 2406 2365 1905 1767 1741 1625 1505 1005 945 726 537 56 1686 46024 4342 422 211 25790 717
NM_194313chr961603 1379 749 472 166 139 11766 21593 448 --
NM_194314chr164386 4326 3440 3420 1109 1015 --11477 --
NM_194317chr252721 2513 1933 673 224 2560 526 ----
NM_197941chr552036 1981 1896 937 911 42957 2347 2172 1882 ----
NM_197970chr22245 45 --130 --
NM_197977chr9124 1628 --171
NM_197978chr9129 ------
NM_198056chr382080 1817 1738 1613 1390 633 503 267 --11964 --
NM_198066chr14103068 2957 2894 2637 2612 2351 2325 2285 2222 2166 1528 13084 1512
NM_198123chr821443 686 11558 ----
NM_198124chr821443 686 11558 ----
NM_198181chr1532739 2566 553 ------
NM_198196chr342284 1963 796 605 21830 147 1803 12404
NM_198236chr12970 173 188 1216 --
NM_198243chr152251 236 ------
NM_198268chr143705 3338 2976 955 ------
NM_198269chr143705 3338 2976 955 ------
NM_198277chr1141108 195 93 54 --1174 --
NM_198324chr12147 ------
NM_198391chr2011328 1986 --11489
NM_198513chr821791 778 ------
NM_198530chr1711274 ------
NM_198581chr2167365 7022 6567 6276 5796 5506 5436 5295 5088 4998 4879 4631 2792 2746 2328 1709 21418 273 ----
NM_198595chr474460 1187 1137 828 325 220 86 ------
NM_198700chr112104 70 ------
NM_198715chr175822 4835 4188 2125 710 557 536 26205 563 ----
NM_198793chr313070 14144 1220 --
NM_198859chr344044 3599 3299 1452 ------
NM_198880chr3------1601
NM_198900chr12187686 7133 6435 6253 6247 5871 5467 4969 4866 2765 2322 1711 1576 1115 321 287 122 107 36483 2158 866 152 11314
NM_198904chr52362 124 1415 2837 164 12120
NM_198965chr121375 ------
NM_198966chr121375 ------
NM_198990chr71701 ----22567 181
NM_199000chr742265 2236 1691 1675 ------
NM_199160chr951726 1535 563 537 381 11819 21707 1663 --
NM_199169chr2053095 2630 2447 2361 1021 11294 ----
NM_199170chr2053095 2630 2447 2361 1021 11294 ----
NM_199171chr2053095 2630 2447 2361 1021 11294 ----
NM_199245chr1292518 2213 2126 2078 2032 1976 1823 753 516 2576 481 1927 --
NM_199320chr432825 2427 796 1970 ----
NM_199320chr432825 2427 796 1970 ----
NM_199324chr44542 512 496 114 ------
NM_199327chr41845 ------
NM_199355chr1631359 1336 172 --1433 --
NM_199421chr1454065 3602 1280 749 105 14325 13720 --
NM_199423chr1631274 376 54 1981 1265 --
NM_199436chr22233 91 --12230 --
NM_199478chrX4637 536 259 242 ------
NM_201263chr151719 1608 700 316 99 ----1189
NM_201413chr212439 356 ------
NM_201414chr212439 356 ------
NM_201432chr1796139 4626 4436 2401 2086 1663 849 742 186 --11335 --
NM_201433chr1796139 4626 4436 2401 2086 1663 849 742 186 --11335 --
NM_201516chr73902 739 579 1942 ----
NM_201542chr1169 ------
NM_201567chr351673 1622 1478 167 30 ------
NM_201591chr43173 70 62 ------
NM_201592chr43173 70 62 ------
NM_201995chr111116 ------
NM_203318chr1771126 1074 1016 894 820 494 97 ------
NM_203342chr173495 2926 2262 1340 1150 326 24 21053 333 12740 12382
NM_203343chr173495 2926 2262 1340 1150 326 24 21053 333 12740 12382
NM_203351chr1782371 2198 1937 1780 956 511 334 203 --2869 120 --
NM_203354chr142564 92 ------
NM_203355chr142564 92 ------
NM_203356chr142564 92 ------
NM_203382chr551627 1446 1321 411 249 21197 1155 ----
NM_203390chr821486 1473 ------
NM_203406chr522802 2249 22427 2400 ----
NM_203446chr2132350 1139 633 --12700 --
NM_203459chr121590 197 ----12017
NM_203463chr284735 4563 4412 3927 3493 3402 1651 380 14692 ----
NM_203499chr172758 89 1705 ----
NM_203500chr193207 163 35 ------
NM_203504chr41169 ----1797
NM_203505chr41169 ----1797
NM_205768chr111317 1343 11438 --
NM_205860chr152528 2503 2280 2203 597 33149 1996 510 13198 --
NM_205861chr141414 849 615 401 ----11971
NM_206839chr151504 ------
NM_206854chr643550 3351 1805 1251 1199 1943 --
NM_206876chr243086 2609 798 621 ------
NM_206907chr543161 878 700 164 ------
NM_206909chr8107744 7037 6928 3310 2781 2028 1744 1427 1226 455 38429 1958 992 27550 2704 --
NM_206914chr124884 870 293 70 2285 192 --22055 1443
NM_206944chr93550 58 31 ------
NM_206945chr93550 58 31 ------
NM_206946chr93550 58 31 ------
NM_206947chr93550 58 31 ------
NM_206998chr11----138 --
NM_207015chr331900 1612 98 22405 675 --12274
NM_207032chr2051601 1572 1381 1132 258 ------
NM_207033chr2051509 1480 1289 1040 166 ------
NM_207034chr2051509 1480 1289 1040 166 ------
NM_207043chr171960 1587 1420 524 385 226 31 1738 11658 --
NM_207044chr171960 1587 1420 524 385 226 31 1738 11658 --
NM_207047chr171960 1587 1420 524 385 226 31 1738 11658 --
NM_207119chr1092036 1898 1867 1441 951 780 644 527 186 126 12147 --
NM_207299chr9174 1749 ----
NM_207303chr1043030 849 689 546 22913 1085 1581 --
NM_207304chr1342635 1798 1765 99 ------
NM_207343chr11----1435 --
NM_207372chr1032054 1943 183 32295 2186 416 ----
NM_207380chr15103541 3108 3044 2489 2288 1434 1409 1393 769 298 1351 21382 468 --
NM_207387chr1761322 1251 707 161 83 31 21537 1270 ----
NM_207406chr455537 5304 1598 1074 84 14597 16057 16121
NM_207481chr2--1966 --11290
NM_212460chr711982 --2467 144 --
NM_212464chr153772 752 347 21657 1376 22046 1528 --
NM_212467chr1511696 22234 1953 42623 2105 1814 278 --
NM_213589chr264719 4187 4099 3960 3391 1327 21549 1039 ----