TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3148
miRNA Sequence: UGGAAAAAACUGGUGUGUGCUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_017519chr661283 912 831 237 224 65 21196 868 1229 1936
NM_017522chr141234 406 383 128 ----1207
NM_017551chr1042598 2475 2151 764 42495 2129 2088 758 1130 12601
NM_017580chr1081772 1581 1545 782 678 354 245 133 12221 2784 247 22316 357
NM_017588chr931901 552 280 ----21904 326
NM_017594chr983060 2597 2079 2043 899 880 794 496 22494 2060 63062 2425 2411 2082 1195 882 --
NM_017610chr1572095 1669 643 627 387 352 198 --2722 219 1203
NM_017617chr941590 1579 278 142 ----21582 370
NM_017628chr4164856 4843 4831 4504 4431 3662 3553 3330 1653 1640 1633 1051 502 449 322 58 44968 4929 3740 3276 24514 152 54054 3560 1161 918 118
NM_017629chr151291 1252 1206 219 186 --31795 1336 374 --
NM_017633chr693957 3934 3449 2678 2657 2454 1370 1291 202 --31309 1295 953 13961
NM_017637chr9269333 9304 9061 8759 8510 8125 7580 7558 6656 6531 5807 3540 3452 2505 2431 2042 1934 1848 1829 1665 907 867 824 780 588 201 68220 7968 7884 3440 3180 2022 46660 6601 1841 1834 32045 827 204
NM_017643chr1763126 2928 2533 1029 794 303 52282 1246 593 253 133 12481 --
NM_017644chr3185155 4694 4681 4515 4374 4318 3830 3657 3648 3536 3499 1710 1670 1401 1042 797 521 199 34852 1856 1792 54834 3650 3504 1212 523 24519 1406
NM_017649chr10--1962 --2351 272
NM_017650chr7135987 5605 5566 5403 4968 3966 2380 2250 1703 1625 1347 1340 155 24149 999 43993 2274 1839 1120 11929
NM_017655chr181299 1265 595 499 358 290 55 44 21338 320 147 1362
NM_017657chr24744 720 40 34 ----143
NM_017658chr1484602 4114 1548 1533 885 858 328 73 53652 3428 903 471 380 43945 1598 776 260 --
NM_017660chr1962285 1146 941 505 442 433 --32291 934 906 1944
NM_017666chrX72206 2136 1627 1476 811 215 80 2428 419 4386 319 255 217 11696
NM_017672chr1531127 441 65 --31147 1140 1130 --
NM_017705chr1573772 3332 3312 2600 1286 712 661 43697 2564 1253 744 1663 12603
NM_017709chr1112876 1695 1625 1574 1067 1045 855 815 702 373 126 --62787 1577 865 858 817 137 44075 1699 1432 1076
NM_017719chr331940 344 186 11849 22298 1870 --
NM_017736chr1661945 1935 489 471 164 94 --12969 33167 2157 1207
NM_017737chr132124 1885 136 1482 11562 21966 259
NM_017741chr422622 1757 12018 42721 2009 973 835 11733
NM_017742chr1851285 770 413 345 271 21365 130 21967 737 --
NM_017744chr132009 2002 1995 3787 733 566 2224 46 12043
NM_017745chrX4737 659 280 165 --2661 167 --
NM_017752chrX61982 1931 1616 582 540 270 ------
NM_017753chr991042 1028 994 708 312 236 173 138 29 ----21049 921
NM_017758chr1741458 118 111 104 --31472 946 138 --
NM_017761chr131092 602 456 11386 21559 1094 1264
NM_017769chr1492661 2431 2294 2248 1200 752 337 222 176 22161 507 12747 12830
NM_017770chr652889 2600 2520 2103 961 --1863 12462
NM_017774chr62396 348 1368 1387 1403
NM_017778chr851173 390 296 189 132 --21176 195 1457
NM_017779chr132117 1045 798 ----1498
NM_017780chr84874 741 383 272 --3876 849 278 --
NM_017784chr311103 1354 1901 1347
NM_017787chr1092833 2338 2330 1167 1155 721 704 149 128 12407 1723 --
NM_017798chr204934 896 455 216 --21236 899 1172
NM_017801chr362585 2218 981 961 513 196 32252 2155 1007 21591 515 --
NM_017811chr962761 2494 1161 1011 701 255 12745 33106 2497 1163 --
NM_017813chr8145254 5189 4564 4077 2108 1726 1431 1401 1171 977 847 765 734 148 23763 1761 55067 5058 1952 1728 564 11175
NM_017824chr1082682 2425 2210 1932 559 377 275 117 22452 627 1414 1785
NM_017831chr1841677 1666 1383 1086 44375 3895 3296 952 14746 24641 1680
NM_017848chrX104379 3931 3798 3389 3144 619 461 451 145 54 13949 54381 3756 703 468 364 12928
NM_017849chr262925 2867 2443 2267 2206 2100 1199 52912 2869 2278 2271 2193 12106
NM_017896chr2093361 3351 3308 2371 611 603 545 450 121 12934 53558 818 458 424 106 1466
NM_017919chr995623 5594 5406 4822 4347 4204 1087 822 260 15695 35307 5094 1416 25410 5263
NM_017938chrX51912 1766 1714 1612 1373 1319 11850 --
NM_017953chr14451 438 317 296 1783 3307 300 111 --
NM_017954chr7121711 1596 1566 1448 1127 351 298 217 193 180 58 51 --1325 --
NM_017958chr221901 290 42849 2126 2037 416 23006 2882 11153
NM_017987chr1081940 1789 1589 1504 1355 742 694 305 1182 42035 1541 649 307 11592
NM_017994chr7112978 2829 1970 1158 990 970 592 585 577 557 21 1722 72736 1866 1860 1167 1160 1146 521 --
NM_018003chr1572400 1944 918 790 521 194 137 31878 764 170 1541 --
NM_018004chr32163 39 ----125
NM_018017chr1072816 2722 2343 2321 2080 1768 605 --22651 2082 32035 1772 630
NM_018018chr1241891 1845 1735 1495 1768 11737 21498 27
NM_018027chr1052888 2234 1235 1143 223 --32284 2241 225 --
NM_018036chr1463907 3404 3347 1045 358 123 54217 3604 1632 1361 1263 24353 878 --
NM_018043chr1181452 1357 926 533 212 168 149 111 --1929 --
NM_018046chr551647 1465 574 162 34 21658 1615 164 --
NM_018078chr45948 711 656 211 181 1294 --1184
NM_018079chr25498 446 247 190 36 1128 1149 --
NM_018084chr2123250 3055 2396 1159 1123 985 894 858 824 753 568 232 43265 3061 3042 772 63036 2873 2838 987 742 572 22229 362
NM_018085chr146494 1499 734 698 27317 5882 47865 7063 6487 245 1880
NM_018092chr1671639 1149 1099 1075 646 464 89 21554 1364 2410 389 11042
NM_018112chr96961 846 799 710 278 37 3987 681 351 2801 40 3964 948 73
NM_018120chr871511 1254 1180 433 384 347 232 152 ----
NM_018121chr1073132 3119 2505 1182 564 447 331 22609 2494 43213 3121 3060 2187 --
NM_018133chr362148 2018 1543 1493 776 385 12224 11546 --
NM_018151chr22190 28 1232 2764 508 1196
NM_018155chr363040 2516 2483 911 558 257 1703 12316 2914 854
NM_018157chr1263272 3177 2502 167 73 48 ----13180
NM_018159chrX31467 1147 242 11717 21316 297 --
NM_018169chr123562 468 50 1398 --1471
NM_018178chr181895 1701 1363 816 549 254 108 27 31710 565 394 31854 826 380 --
NM_018184chr362088 1980 1958 1891 1552 780 2807 116 1757 --
NM_018191chr1381965 1930 1745 1609 1533 554 173 115 ----42014 1955 1748 119
NM_018195chr1191924 1893 1862 1856 1833 1655 552 233 177 31986 683 23 ----
NM_018199chr141477 --1215 11106
NM_018200chr1592585 2576 2539 1781 1714 1600 488 424 404 22633 746 11907 --
NM_018211chr121848 446 21820 198 --12181
NM_018214chr661295 1222 837 504 433 208 --21297 839 --
NM_018227chr4112921 2565 2161 1977 1208 1063 1032 958 949 907 391 22944 417 --31981 1967 914
NM_018243chr4143920 3707 3300 3264 3095 3036 2501 1571 1520 1451 1182 463 413 104 43840 3503 1314 928 21562 1363 23963 2504
NM_018254chr172422 1819 1678 838 572 459 445 1163 32173 1766 434 11662
NM_018257chr2071922 1805 705 447 284 234 141 32601 622 539 42506 1902 990 798 11808
NM_018265chr152095 1842 1328 608 136 1520 --1155
NM_018269chr23870 831 204 1723 1392 1650
NM_018279chr1252892 2464 1098 219 145 2770 621 32972 2466 221 1904
NM_018287chr105893 469 329 117 81 --1332 21360 1301
NM_018290chr41834 11284 1836 11167
NM_018293chr372965 2738 2582 2355 1191 1076 438 41938 1910 220 148 12357 --
NM_018299chr8103466 3364 3150 2906 2826 2205 1064 866 271 258 13383 32835 1237 1051 1869
NM_018307chr172943 890 ----1946
NM_018312chr1151979 1407 823 787 587 21507 420 21354 450 --
NM_018313chr372642 2446 2251 2094 367 351 216 21936 724 12134 12254
NM_018315chr461585 1441 1105 1030 544 308 --21422 478 11618
NM_018322chr621279 416 21051 982 1421 2841 129
NM_018323chr441836 1175 646 158 21555 1245 11341 21840 1613
NM_018325chr971650 1558 1517 1144 1103 308 197 ------
NM_018330chr1041101 445 420 338 21615 1377 1447 --
NM_018335chr141496 1373 --2209 134
NM_018340chr16135077 4476 4470 4415 4344 4224 3923 3772 3344 1390 1072 1016 44 --14531 --
NM_018351chr12144618 4496 4468 4433 4344 4069 3706 2867 1791 1778 1627 790 662 335 14405 33257 2875 1012 1178
NM_018360chrX2119 91 ----1102
NM_018362chr11193926 3514 3336 3173 3160 3149 2891 2673 2653 2642 2484 1273 419 400 355 336 299 286 52 54005 3758 1495 450 249 42902 2895 1436 185 1593
NM_018364chr1154120 4098 4026 3840 3800 3675 3662 3039 1441 1303 1108 604 154 35 26 23508 1031 44104 3842 3573 1310 12515
NM_018367chr1162293 2103 1770 1027 337 288 21787 913 22295 2105 --
NM_018371chr861344 1270 1025 638 612 548 --3640 614 35 --
NM_018374chr7165191 4760 3984 3661 3463 3212 1811 1793 1598 1558 1547 1385 1266 1163 1034 932 34474 1260 1174 44880 3429 1731 437 --
NM_018383chr251902 1701 1398 1383 113 1556 21904 260 --
NM_018394chr361449 573 350 242 219 195 1312 21585 91 1223
NM_018403chr3124116 3860 3622 3516 3261 3158 3143 1443 1290 851 831 825 44082 3680 2706 145 13493 11447
NM_018416chr1272621 2049 1942 1669 1042 904 438 12038 52327 1645 1028 963 210 --
NM_018426chr65604 597 586 574 393 --1606 1396
NM_018427chr1681495 1420 1369 1254 1222 1179 284 173 11295 ----
NM_018429chr562873 2663 1839 1046 596 406 2902 445 42674 1133 105 21 1943
NM_018439chr1862537 2108 1960 1848 685 140 42655 1912 1889 673 42573 2539 1850 1048 --
NM_018440chr8168705 8047 7769 7305 7090 7069 6884 6829 5469 3333 3157 2999 2943 1739 1227 411 36728 2761 810 57345 3337 1828 441 393 67861 6832 1907 1494 1230 750
NM_018444chr862157 1654 1622 1482 723 58 2639 440 21756 1683 --
NM_018448chr1251139 1060 828 375 116 --51082 932 873 424 119 1831
NM_018466chrX4682 571 246 207 --1534 2577 211
NM_018475chr42663 564 --2254 213 1666
NM_018482chr8102578 2414 2117 2105 1977 1932 1027 1017 870 167 32549 2136 435 22337 2064 22110 1980
NM_018489chr162389 2066 1996 1632 724 214 22075 1744 42037 1498 1490 330 1728
NM_018490chr1131759 1275 362 1391 2696 289 11762
NM_018557chr251637 329 156 142 133 41657 1613 634 370 2414 117 --
NM_018566chr1124997 4959 3972 3413 3350 1944 1498 1396 1053 1007 968 890 75045 4643 4285 1800 1556 1386 63 44934 4713 4055 928 11010
NM_018569chr461578 1332 1171 1143 1034 381 --31551 1174 1152 --
NM_018571chr23572 446 248 --2481 58 1252
NM_018638chr12115374 4369 4344 3605 3523 2210 2101 1903 954 381 53 14471 34065 3844 328 11996
NM_018640chr1262809 2073 865 771 233 55 1814 12303 21848 868
NM_018650chr172017 2007 1790 1597 751 575 249 32149 2115 1986 ----
NM_018658chr1751669 1662 1587 249 80 --41598 1450 643 188 --
NM_018660chr873052 949 908 688 431 182 156 --33008 2114 209 12575
NM_018667chr1652658 2642 2370 2187 853 22696 252 22821 2660 --
NM_018682chr75673 577 273 230 23 --2232 138 --
NM_018685chr751100 966 751 291 251 --21122 400 1754
NM_018695chr572488 2389 848 822 771 665 445 1569 1428 1859
NM_018698chrX41460 573 366 192 71719 1454 543 450 387 141 120 1683 11889
NM_018712chr112281 270 31195 1100 264 1283 --
NM_018715chr142272 292 203 176 11464 51453 530 310 206 178 --
NM_018728chr1571153 1070 1044 1036 572 275 122 1365 128 --
NM_018841chr183624 2836 2774 2671 2435 1565 1304 500 2215 152 22937 2842 33628 2674 2535
NM_018890chr751418 1043 966 607 161 21112 273 --1147
NM_018945chr633486 2707 793 11061 43101 2709 1477 1471 --
NM_018951chr74932 905 829 213 --1514 128
NM_018958chr15103403 3384 3316 3184 3044 3018 2972 2611 1094 829 13479 23386 3358 --
NM_018959chr193564 306 290 --1281 --
NM_018963chr2141401 1310 1292 1206 21282 120 --1465
NM_018970chr721003 600 12818 2952 945 1710
NM_018976chr12122171 2076 2011 987 970 772 692 623 499 439 171 154 22354 1067 --22627 695
NM_018979chr1252458 1050 486 469 221 --2799 494 12425
NM_018981chr23921 896 480 31377 1159 1035 21015 176 --
NM_018992chr1651624 1552 256 138 42 1643 --2259 113
NM_018993chr2041448 1381 1063 432 11073 1426 --
NM_018999chr1074159 3256 1916 1902 1895 1886 1664 54594 4583 4140 1763 106 104839 4527 4199 3850 3207 3197 3172 3162 1904 1293 --
NM_019001chr3164415 4385 4376 4137 4106 3932 3487 3332 3120 3076 1515 1350 1243 706 385 124 14596 34143 3078 3034 23661 127
NM_019004chr751914 1642 406 212 162 ----21981 1650
NM_019006chr152586 62 --167 1464
NM_019008chr2232746 1469 887 31049 1026 377 53727 3010 1404 384 245 11495
NM_019022chr1832724 2195 1190 13119 33076 2666 2197 23220 479
NM_019027chr472438 918 911 610 335 301 167 11682 11794 --
NM_019035chr441851 503 441 248 21899 1612 21294 274 1444
NM_019045chrX6776 741 615 591 128 89 --1619 --
NM_019049chr11104 1632 1126 1531
NM_019050chr451835 1806 1693 863 502 --11758 21842 867
NM_019053chr104926 422 359 327 ----2331 218
NM_019057chr52325 300 --173 1329
NM_019063chr25570 418 351 130 28 1631 1429 --
NM_019072chr573678 1493 1340 1241 960 684 390 1921 11504 13469
NM_019080chr1321031 612 21530 954 11308 21539 1479
NM_019083chr151584 485 373 149 49 --21474 452 --
NM_019084chr1072392 1822 1802 640 551 466 449 --2669 662 --
NM_019087chr561583 1158 622 479 378 110 11238 --11163
NM_019091chr251047 995 823 232 198 --3827 293 85 --
NM_019094chr12113659 3558 2861 2743 2716 2549 1541 1247 373 297 161 32601 1022 141 ----
NM_019098chr851836 1655 710 349 267 11804 11771 11379
NM_019114chr932043 1900 1817 1441 --1199
NM_019116chr1683721 3563 3157 2813 2539 462 450 356 1548 43568 2815 2544 455 --
NM_019555chr341816 1547 1467 1327 193 --11550
NM_019556chrX3941 298 288 ----1302
NM_019590chr1061465 1287 1170 958 520 180 1364 11241 --
NM_019843chr223472 448 381 ----1451
NM_019891chr151327 1230 1091 1022 271 11182 11306 --
NM_019895chr351148 1025 723 63 41 --1726 --
NM_019903chr1061769 1643 1203 634 509 390 21714 662 ----
NM_020066chr13837 641 221 1135 --3975 842 645
NM_020120chr251544 1399 1105 1032 303 --167 11547
NM_020122chr2136037 5562 2183 2050 2012 1915 1729 1637 1434 1387 1203 1163 382 25284 4282 44177 2312 1918 1072 21733 810
NM_020123chr1051152 1138 560 531 522 142 31011 537 453 --
NM_020132chr2145111 5075 935 334 11496 1102 14357
NM_020144chr741740 1675 1314 614 21695 646 21785 668 12029
NM_020148chr1822166 1097 23073 916 --12850
NM_020150chr1061912 1903 1393 835 427 341 31644 418 76 11917 --
NM_020177chr593202 3071 2568 2458 716 705 640 614 367 1574 73216 3209 2828 1297 718 450 369 13295
NM_020182chr2073218 2368 1016 873 625 492 321 12847 33300 3221 1005 11019
NM_020198chr1741215 1187 480 207 --11323 1213
NM_020199chr571279 976 961 462 396 383 164 --2944 466 11282
NM_020204chr13821 639 91 1693 2823 95 --
NM_020205chr1112927 2841 2556 2308 2261 1071 1011 840 806 730 646 --33481 3330 1073 --
NM_020228chr1142574 2370 585 305 11719 1573 --
NM_020239chr141970 1929 652 117 21981 521 12210 22340 1952
NM_020240chr582762 2668 2163 1923 1882 1757 251 221 --1274 31909 1831 258
NM_020245chr6175068 5030 4844 4702 4689 4464 4416 3879 1780 1708 1659 1475 1462 1449 1087 901 213 --55070 4695 4536 1710 1495 --
NM_020336chr20123676 3414 3281 2828 2788 2585 1341 1154 1085 594 552 373 --23662 596 --
NM_020337chr452791 2015 1202 655 387 32163 1178 550 22893 391 12051
NM_020341chr2071965 1947 1851 1631 1461 562 354 3808 334 245 31937 452 404 --
NM_020342chr292568 2531 2424 1602 889 770 746 400 167 ----22576 2427
NM_020347chr362245 1736 1645 1422 932 653 12056 12273 1108
NM_020348chr1032707 1934 161 32327 997 251 11089 11937
NM_020357chr3101587 1546 1535 1202 1119 588 291 117 100 62 1111 2496 104 --
NM_020390chr3164672 4657 4468 4165 3845 3650 3483 3354 3181 3118 1325 1245 1086 917 191 111 23058 858 54676 3955 3848 1419 1327 34078 3486 3121
NM_020416chr462625 2481 1807 1656 867 558 1373 22627 1934 12694
NM_020429chr742885 756 664 639 12173 --1760
NM_020432chr73882 431 171 21786 35 21727 1560 11651
NM_020440chr1113359 3247 3082 2632 2250 1168 664 610 276 235 143 1643 22635 279 11171
NM_020443chr1156716 6652 6474 6159 5729 5718 5658 4774 2496 984 890 876 851 820 442 31346 972 951 3902 895 853 46509 6490 5160 911
NM_020449chrX4784 763 730 66 --1592 1766
NM_020452chr152045 2027 1960 513 356 ----11964
NM_020453chr431619 640 391 21925 1329 --191
NM_020455chr682706 2563 2458 2195 1769 1020 694 525 22846 2526 22469 290 22709 2198
NM_020456chr1372138 1639 1622 1613 755 515 428 12077 11630 --
NM_020463chr231405 1027 993 1598 11288 11408
NM_020466chr623457 1997 23212 3050 45006 4908 3825 3746 --
NM_020473chrX61663 394 339 328 142 92 1248 21771 1640 --
NM_020474chr1881760 1523 1484 1345 1299 753 681 401 11770 41762 1441 1335 404 12017
NM_020482chr6--1331 --2755 523
NM_020640chr361997 1963 1785 923 612 528 --22050 535 11981
NM_020644chr114642 369 224 153 1308 2976 157 --
NM_020647chr862065 1910 1772 1542 383 278 ----12097
NM_020648chr1852696 2347 1939 1895 315 21831 970 62844 2468 2456 2314 2108 2034 12202
NM_020651chr251482 1379 1309 408 123 21698 1668 2694 88 21264 411
NM_020654chr361600 1175 1154 1027 637 475 11547 1253 1644
NM_020657chr191436 41850 1788 1758 526 21963 1743 --
NM_020673chr20167603 7064 6315 6133 5962 5345 5026 3076 2770 2749 2667 2105 1713 1681 1369 824 27217 6598 66472 5965 5045 5029 2919 1337 12108
NM_020686chr1621173 189 ----22850 324
NM_020693chr112365 183 --2367 73 1512
NM_020699chr1165230 5212 4853 4440 4425 4030 3361 3343 2140 2008 1700 1682 1363 452 443 244 --54032 2020 1882 437 431 --
NM_020704chr772165 1540 966 821 605 387 255 12085 5968 943 937 751 607 22169 900
NM_020708chr2062496 2064 1670 831 799 654 ----1244
NM_020711chr252465 2458 1726 897 867 31732 500 128 ----
NM_020715chr143899 626 357 11419 1807 1231
NM_020717chrX54280 2005 1063 968 895 --44540 4109 1163 897 23706 3258
NM_020718chr16165720 5662 5648 5617 5394 4877 4855 4594 4193 2232 1624 1492 1377 944 816 100 44578 2381 2319 1334 85695 4437 4195 2049 1635 1628 966 819 --
NM_020727chr2193921 3495 2912 2612 1610 1484 1109 328 86 23805 3741 --13897
NM_020728chr761943 904 817 424 361 182 23004 2453 13050 --
NM_020732chr661283 912 831 237 224 65 21196 868 1229 1936
NM_020734chr12123222 3206 2941 2894 2385 1327 1291 884 794 763 550 306 21071 55 53097 2896 1329 936 559 1313
NM_020739chr15133974 3809 3796 3489 3463 3383 2872 2843 2572 1639 608 540 299 --22899 1240 13977
NM_020742chrX62773 2675 1741 870 831 390 21684 193 ----
NM_020747chr56972 927 800 710 391 385 ------
NM_020748chr1742115 1845 1582 239 22011 1925 --1247
NM_020749chr82807 764 31293 718 299 1753 1843
NM_020752chr1031920 828 504 --11908 12442
NM_020760chr231411 1333 774 1128 --21438 257
NM_020766chrX124580 3757 3206 1801 1712 1641 1439 1322 770 652 418 117 --31441 813 658 1307
NM_020768chr553102 2367 946 889 222 --2434 339 --
NM_020771chr691518 1374 1117 520 355 225 174 160 145 21237 264 ----
NM_020772chr17268450 7943 7867 7857 7551 7523 7407 7034 6658 6643 6095 5665 3452 3335 3015 2923 2303 2136 1781 1612 1238 956 659 572 479 269 68421 7991 5292 5255 2512 966 25392 272 --
NM_020774chr18206241 6196 5518 5335 4949 4548 4325 3985 2418 2149 2005 1472 1443 1278 1084 995 852 524 283 186 66004 4924 4314 2348 979 625 51856 1445 1412 1281 301 35865 5338 4346
NM_020779chr263014 2650 2456 545 304 232 --33215 786 306 --
NM_020782chr12104341 4332 3983 3968 3043 1526 644 408 200 44 14300 54575 3985 3930 3387 414 1635
NM_020783chr1841922 1603 864 56 11510 2665 428 --
NM_020794chr121264 1156 31249 1201 560 11129 11160
NM_020796chr5102911 2770 2484 2470 2373 2108 1947 1935 721 473 --32772 1996 723 --
NM_020801chr5112662 2550 2541 2359 2322 2137 2019 898 503 376 214 22440 1848 42664 2622 2543 900 1394
NM_020803chr431669 500 354 1521 31970 942 393 31673 699 506
NM_020809chr1151966 1890 1762 1539 1494 --1217 21900 679
NM_020810chr1473204 2963 2880 949 756 670 260 1499 ----
NM_020819chr651069 1063 792 481 200 3383 235 224 1421 1806
NM_020834chr1461939 1322 661 588 463 307 21281 651 2508 309 --
NM_020839chr321622 1565 21327 409 11320 1454
NM_020841chr12153908 3755 3151 2816 2806 2667 2504 2457 1594 1350 1195 1105 630 609 409 23688 3299 21529 807 44026 3758 3154 889
NM_020844chr8177512 7280 7251 6961 6712 6526 6519 6356 5034 4994 4916 4902 2866 2171 2003 1668 276 36808 5504 316 25537 1724 47254 6380 4919 1671
NM_020851chr1551641 1109 530 501 491 11771 --11644
NM_020853chr1252647 2358 2157 959 282 2660 404 2993 807 1922
NM_020856chr1921568 467 1339 --11571
NM_020858chr1542266 1866 936 520 2914 543 --1525
NM_020859chr453493 3252 3070 639 486 23615 996 2641 157 11261
NM_020868chr241926 1793 1215 280 21772 754 11675 --
NM_020870chr4112114 1990 1976 1731 1598 1562 724 558 471 324 256 12104 11604 --
NM_020871chrX92525 2472 2459 1924 1648 744 634 378 333 2473 266 ----
NM_020872chr331291 373 88 11807 --191
NM_020873chr35824 671 597 581 148 1885 1587 --
NM_020909chr273936 3732 1399 692 517 443 157 --1275 34079 3105 695
NM_020918chr1033363 1290 909 43185 2297 1320 474 12918 11372
NM_020921chr1493415 3069 3046 2831 1297 1130 847 687 316 23660 2903 11300 22805 142
NM_020922chrX81902 1857 1784 586 359 256 134 100 ----2221 37
NM_020925chr121082 969 11045 --1545
NM_020935chr294645 4494 4457 4343 4120 3869 3466 1718 763 --74605 4497 3710 3219 1453 841 219 --
NM_020940chr1072890 2359 969 875 781 686 578 12082 32188 2096 820 22008 973
NM_020948chr183255 3137 2758 2543 920 748 543 168 73561 3547 3480 2921 1306 1286 1267 33630 3382 471 2834 660
NM_020951chr1972401 2077 385 340 311 228 24 --12403 1231
NM_020960chr9134905 4185 3973 3789 3586 3537 3122 1889 1448 988 904 725 296 23568 1818 21616 298 --
NM_020962chr1562429 2338 2310 1908 1588 753 22521 1996 22434 1582 --
NM_020975chr1032026 597 187 11590 --1381
NM_020981chr24712 687 140 32 171 2702 692 --
NM_020993chr1242764 810 416 308 12801 22746 1963 12728
NM_021005chr1551064 940 434 424 371 --1281 1378
NM_021007chr232008 1730 423 31926 1580 1535 12010 12358
NM_021033chr13103241 3152 3126 2908 2876 2746 2705 1197 1173 422 33056 3003 557 22750 2681 12634
NM_021069chr421540 681 --32117 2068 661 --
NM_021083chrX73137 2701 2272 945 863 551 39 43655 2999 2731 354 11126 22275 990
NM_021090chr2284549 3576 1981 1938 1885 1872 1852 253 54410 4059 1975 1699 198 24439 164 --
NM_021097chr273070 3040 2694 2586 1203 395 368 22528 916 12026 --
NM_021110chr81775 2641 607 --1261
NM_021111chr921022 136 11381 11339 11208
NM_021116chr778763 8653 7470 5964 2427 886 674 39051 8937 7027 15987 --
NM_021132chr102392 318 21188 347 --1399
NM_021140chrX4442 360 344 34 2849 777 11006 --
NM_021148chr772421 823 795 751 728 461 98 11719 32354 1973 1690 1464
NM_021155chr1952325 1115 877 737 581 52703 2430 2416 2307 2161 23036 167 --
NM_021167chr7--22267 2036 21044 227 22115 1090
NM_021183chrX72571 2024 1720 1034 785 628 596 12008 --12509
NM_021190chr15480 262 124 109 94 41383 1305 1015 955 1278 2484 131
NM_021191chr1252486 2291 2005 1753 159 31658 313 47 32551 2540 810 11758
NM_021215chr2022119 2093 1275 42351 2253 1680 237 --
NM_021229chr1241185 1029 982 92 21069 223 11187 --
NM_021238chr1271852 1603 1312 656 502 245 85 11509 11962 --
NM_021249chr1441301 412 403 61 --1137 31232 1223 1210
NM_021252chr1071613 737 492 470 432 359 205 ----21746 817
NM_021255chr14123753 3433 3361 3286 2921 2798 2552 1537 1399 943 609 302 53839 3192 2714 1637 683 52923 1469 949 566 553 23296 2784
NM_021572chr63940 857 795 ----1799
NM_021622chr1082275 2209 1903 1788 1767 1635 751 287 21919 1874 32277 1811 289 1906
NM_021624chr1862062 1900 1579 724 319 272 --12122 1700
NM_021626chr173428 402 209 ----1408
NM_021627chr341221 1124 282 265 2994 967 1948 --
NM_021629chr374793 4754 4333 4138 1320 332 276 13119 24850 1259 1107
NM_021637chrX11324 178 11229 11209
NM_021639chr16901 823 795 224 86 80 ------
NM_021642chr12476 390 --1461 11376
NM_021643chr251806 1785 1736 1382 429 21397 1344 31788 1295 432 --
NM_021644chr1031027 827 165 --1422 11030
NM_021645chr1332053 1914 126 12356 32055 1821 532 --
NM_021647chr494334 4159 3950 1582 684 646 453 420 367 34262 3367 1782 12986 1651
NM_021648chr672242 2173 1922 988 675 206 120 --12185 --
NM_021809chr2092509 2499 2475 2277 1788 960 915 514 501 184 5988 974 965 892 507 --
NM_021813chr6145613 5025 4653 4269 3909 2188 1701 1565 887 819 772 712 374 313 24289 3749 75635 2237 2082 1579 685 618 316 35617 5522 377
NM_021911chr5145546 5401 4601 4449 4146 4124 1838 1694 1664 1533 1367 1257 1177 468 54752 3732 1985 1290 203 34126 1723 1053 21538 882
NM_021912chr1594142 3870 3009 2694 1504 1094 954 597 315 --1317 13804
NM_021914chr1451728 1688 962 873 86 31986 1751 659 --21731 383
NM_021949chrX52299 1087 655 635 250 ----32302 1098 639
NM_021950chr1171586 644 594 401 324 311 31 --22214 1933 --
NM_021954chr1373404 3186 2896 2820 2599 1364 811 33698 3283 766 43478 3176 855 45 22603 2388
NM_021956chr621125 610 --1617 21129 45
NM_021960chr141777 936 760 485 1821 22787 971 1763
NM_021961chr11177523 7246 7048 6534 6459 6299 6146 6098 5788 4693 2572 2455 1661 928 579 563 412 66656 6552 5408 2865 1785 145 36462 4790 583 46538 1690 415 174
NM_021964chr3156303 6250 5606 5069 5059 4941 4921 4122 2186 1883 1531 1424 1344 763 577 96002 5095 4670 4316 2360 1510 1259 774 378 76566 6309 4125 2188 2080 1701 1091 --
NM_021970chr42748 181 --1619 2751 119
NM_021988chr2021411 173 283 66 11505 --
NM_021999chr133743 170 82 --3790 668 172 --
NM_022037chr23655 322 222 ----1325
NM_022048chr15135841 5832 5261 4875 4811 4616 4584 4035 2349 1977 762 689 674 --35027 4768 1621 --
NM_022079chr103965 652 206 --2335 58 1396
NM_022080chr2052536 2086 945 378 237 11799 2739 731 --
NM_022114chr184808 3910 1583 1446 1428 1382 539 506 2656 147 24238 1384 11431
NM_022129chr10148 21421 1288 11150 11397
NM_022130chr561360 1308 1156 902 450 75 --3981 139 54 --
NM_022133chr831849 1327 146 31746 1526 1197 11329 11908
NM_022154chr4--31240 1032 249 --11078
NM_022160chr91137 ----2145 36
NM_022166chr16146242 6199 6141 6130 6080 5733 4764 4052 2263 1878 1705 1695 1113 327 14017 35314 1880 587 --
NM_022173chr23655 322 222 ----1325
NM_022340chr383684 3389 2341 1388 1381 689 671 232 --12500 --
NM_022351chr853519 2578 1291 1198 798 32836 1141 610 22561 1207 --
NM_022442chr2021411 173 283 66 11505 --
NM_022456chr12107410 6255 4693 2849 1615 1365 1349 1057 1021 295 46039 1151 980 464 36173 4675 108 24696 1368
NM_022458chr752987 844 832 175 133 22603 458 --2847 138
NM_022459chr13145696 5597 4561 4386 4320 4248 4231 2551 2424 2326 1827 746 719 610 14700 54251 2554 1832 681 318 11509
NM_022461chr321278 552 1174 --11282
NM_022465chr1252927 2654 2114 1218 843 12640 42940 1881 362 215 --
NM_022474chr1462775 2635 895 741 717 636 22254 1878 1743 --
NM_022484chr761432 1268 936 434 135 67 21310 342 1910 2941 437
NM_022491chr12113250 3178 3051 2978 2968 2936 2662 2211 288 191 69 22897 1172 23056 34 --
NM_022497chr383924 3841 3562 3385 2495 1501 1254 527 23502 487 13927 --
NM_022552chr26509 494 487 475 321 276 31135 300 208 1279 --
NM_022574chr751534 1519 351 343 209 --1198 --
NM_022648chr233707 1765 364 14245 23145 439 23712 1716
NM_022716chr111114 1840 1250 21121 580
NM_022725chr1181640 1326 847 689 542 396 367 182 11496 21533 337 21556 359
NM_022726chr651396 1117 700 435 205 1308 11585 --
NM_022728chr74534 256 241 188 1148 1243 1744
NM_022745chr173004 2455 2355 1155 846 758 230 1656 22910 1157 12360
NM_022753chr182558 1860 790 638 483 255 245 173 1110 32780 1058 797 22309 663
NM_022757chr33714 419 395 --4814 400 374 71 --
NM_022758chr662793 827 624 613 419 393 1774 33224 2795 395 12835
NM_022763chr3123060 2828 2568 2367 2313 2250 1264 753 331 266 196 92 22877 2211 ----
NM_022776chr321155 1058 --11329 11496
NM_022780chr251506 723 551 365 284 --11877 11509
NM_022781chr9133234 3118 3093 2841 2827 2764 2735 2714 2090 989 939 814 603 12980 52338 2300 942 605 226 12234
NM_022826chr22841 313 21120 953 31048 435 246 --
NM_022831chr131756 1594 563 2272 242 21748 660 11615
NM_022836chr141637 1184 559 221 21679 104 --21861 1643
NM_022840chr183124 74 53 --11068 1127
NM_022841chr1562769 2742 2547 2300 1877 957 1928 22303 959 --
NM_022845chr16111893 1865 1844 647 455 393 384 371 299 229 196 12165 22057 1991 32120 387 234
NM_022893chr2153134 3032 2852 2753 2566 2395 2352 1978 1951 1935 1014 349 227 192 99 22893 49 103017 2578 2229 907 236 221 214 208 202 195 22756 103
NM_022894chr2101559 1335 1148 1111 613 579 524 363 351 68 1451 1373 21127 583
NM_022898chr14214740 4635 3837 3743 3648 3603 3587 3572 2924 1654 1301 1058 1034 724 592 584 569 535 443 341 252 24519 521 44742 3576 1306 287 11575
NM_022912chr272103 1955 462 359 237 225 192 2874 322 33098 2349 227 --
NM_022918chr1151915 1737 1707 621 444 --1138 1624
NM_022977chrX72435 2305 1813 1653 843 750 686 22045 1799 22307 1816 --
NM_023000chr1481664 1655 1608 1436 1418 463 447 250 1125 2232 163 1451
NM_023001chr1481664 1655 1608 1436 1418 463 447 250 1125 2232 163 1451
NM_023009chr13677 622 550 --1624 1687
NM_023016chr242413 2391 1144 617 32546 1135 180 --12806
NM_023037chr132431 369 --3456 449 442 1135
NM_023072chr1951082 1076 1040 992 385 1797 31111 856 787 21089 1044
NM_023073chr531277 1106 1091 1113 --1855
NM_023076chr1692950 2876 2196 1856 938 852 695 444 231 1616 ----
NM_023923chr153388 2901 2585 646 624 11034 2687 249 --
NM_023929chr892650 2586 2155 2117 827 520 467 258 162 1499 12668 22532 532
NM_024007chr543112 1194 1044 509 12438 3712 278 272 12275
NM_024028chr53933 248 184 1372 --1945
NM_024052chr1752876 2192 1259 787 266 12813 12878 22336 2003
NM_024055chr54645 570 109 93 1454 199 --
NM_024077chr92770 529 4704 641 593 81 170 --
NM_024095chr1251433 1152 1033 351 206 --21209 1051 11373
NM_024294chr662793 827 624 613 419 393 1774 33224 2795 395 12835
NM_024334chr341852 1736 1404 748 --1696 11740
NM_024341chr1973464 3412 2618 2581 1448 783 617 24141 2791 13483 11394
NM_024345chr996012 5895 5240 5174 4087 3977 2410 890 76 11448 24241 995 --
NM_024408chr1113387 3343 3268 3172 2763 2717 2333 1496 1479 933 744 23276 1412 43389 2373 863 799 --
NM_024429chr731035 1017 835 1281 1838 11042
NM_024430chr1861813 1466 1301 550 194 130 31249 1196 681 21303 25 --
NM_024524chr3103203 3059 2488 2009 966 934 891 881 627 259 31236 776 328 12491 21043 656
NM_024525chr14599 155 145 60 --1603 --
NM_024539chrX3975 295 177 3864 279 203 1411 1180
NM_024546chr1351059 911 475 338 294 21257 995 171 --
NM_024548chr361728 1682 1402 499 69 38 1144 31595 1572 513 --
NM_024569chr152925 2689 2240 1041 639 22970 2875 1651 12267
NM_024582chr461051 1019 1001 965 940 786 1848 21086 265 --
NM_024586chr13673 451 179 1261 --2664 454
NM_024590chr451545 1270 578 538 495 1695 21326 597 --
NM_024613chr851665 1637 402 260 231 1474 --2688 405
NM_024631chr113647 543 251 1496 --1546
NM_024639chr652386 2268 1961 972 890 12854 32389 2272 1963 --
NM_024646chr193998 3549 2535 1489 1442 1321 1158 885 322 1236 23600 2537 11325
NM_024665chr3224289 4151 4119 3995 3936 3825 3813 3295 3009 1451 1389 1278 1144 1024 996 878 832 798 773 759 544 392 13349 43835 3371 785 394 32864 1358 547
NM_024674chr183184 3058 3043 2092 939 709 446 321 13174 23045 711 1451
NM_024692chr231490 1166 403 --41675 748 428 338 --
NM_024713chr1541137 517 460 406 135 1121 --
NM_024721chr882582 1949 1901 1878 940 772 704 484 32058 837 518 42329 943 774 136 --
NM_024725chr114838 661 553 26 --2546 66 2730 664
NM_024740chr11103930 3787 3456 2933 2675 949 896 890 734 709 11646 32936 1669 282 13578
NM_024744chr252368 2208 2091 1061 414 11655 32327 1873 876 1944
NM_024749chr142175 1630 498 434 1400 1564 2722 279
NM_024751chr452111 2017 1759 429 422 --11523 22020 456
NM_024761chr9105187 5175 4987 3886 3868 3664 3238 2050 765 423 24493 4145 23583 1748 34476 1200 377
NM_024763chr11214 31199 1142 424 123 1225
NM_024779chr1211355 11586 31090 208 191 11073
NM_024831chr82720 232 2549 94 --1587
NM_024834chr1052014 1571 1527 1372 725 21701 406 21258 553 2728 422
NM_024838chr1041182 481 470 22 1953 11077 128
NM_024847chr1641278 1202 455 442 31212 962 132 21015 114 --
NM_024854chr1231539 626 472 --41541 1460 1229 615 --
NM_024900chr431745 1695 192 ----11914
NM_024900chr431745 1695 192 ----11914
NM_024920chr431423 459 373 21510 506 31426 312 45 --
NM_024921chrX3425 378 41 31639 1287 200 11462 2788 84
NM_024941chr53995 928 111 31327 966 207 1997 --
NM_024947chr3269296 9063 8946 8914 8218 8051 7669 7291 6726 6612 6306 6230 3343 2959 2830 2082 1793 1537 1246 1197 1009 629 391 379 293 42 32430 410 264 28711 7301 42518 1250 1012 394
NM_024949chr454993 1914 1511 1400 96 14362 11606 2598 28
NM_024989chr2157791 7540 7113 6194 6120 5915 5738 5567 5411 5242 3235 3198 3182 600 385 47502 1661 1642 670 87793 7302 7290 5674 3238 3185 915 658 1388
NM_024991chr1062965 2823 2084 854 776 717 --43192 3176 2969 874 12257
NM_024993chr261539 1531 1184 609 452 173 11643 --11415
NM_024997chr1661386 1334 1283 855 493 31 ----136
NM_025004chr114714 590 523 495 --2511 497 --
NM_198503chr131967 1621 558 --31623 561 26 --
NM_198504chr34909 741 632 95 2595 330 1913 --
NM_198506chr461089 1023 585 423 333 187 --1190 --
NM_198513chr841760 763 338 21 11489 11918 124
NM_198569chr672573 2430 2325 2062 887 561 392 22713 2393 22336 157 22576 2065
NM_198570chr72138 132 1321 --134
NM_198578chr1271508 1448 1330 931 322 315 99 ----2938 394
NM_198581chr2247522 7458 7218 6940 6585 6576 6432 6060 5859 5633 5479 5444 5312 5152 5141 4820 4612 3000 2322 2293 1988 1695 1380 931 47485 7154 800 705 57524 4783 2284 2275 933 --
NM_198584chr882335 2098 2019 781 717 344 178 167 ------
NM_198715chr195587 5372 4312 4049 3930 2170 1603 1270 274 44652 4502 1263 757 21027 446 11606
NM_198793chr3174127 3912 3837 3780 3737 3288 3258 2842 2829 2814 2689 2636 1245 946 773 693 236 --23434 2915 13009
NM_198794chr143550 269 155 21356 999 11147 --
NM_198829chr751418 1043 966 607 161 21112 273 --1147
NM_198859chr3114889 4858 4846 4415 3410 3276 1925 1887 1727 769 563 64715 4706 3207 1718 749 617 --34409 582 355
NM_198889chr421129 155 1553 3236 229 217 11105
NM_198896chr1162202 1409 391 276 265 97 --21379 278 --
NM_198900chr1297205 7020 6401 6126 2254 2091 803 691 358 47502 7250 5978 5031 37207 2181 362 --
NM_198901chr741356 1212 977 254 31258 928 315 ----
NM_198904chr511875 1271 1759 21613 1318
NM_198935chr2093201 2637 2283 2264 2131 1000 438 399 256 13089 12639 23206 3028
NM_198968chr13124021 3113 2571 2534 2502 2493 996 888 694 331 319 305 23580 496 32776 387 270 33124 2931 308
NM_198990chr792690 2477 2223 1027 975 962 851 448 304 32330 1295 114 3980 450 48 32988 2197 56
NM_198992chr1281404 1054 891 874 515 295 157 133 ------
NM_199000chr732255 874 198 11713 --1878
NM_199003chr85561 472 450 409 39 11000 11071 --
NM_199040chr12113659 3558 2861 2743 2716 2549 1541 1247 373 297 161 32601 1022 141 ----
NM_199054chr1962070 1996 1768 1345 173 61 --41778 1354 207 178 --
NM_199076chr10--1962 --2351 272
NM_199132chr1972138 2011 1762 1628 1469 1455 1440 --11461 11859
NM_199144chr2021411 173 283 66 11505 --
NM_199168chr1031233 1207 356 ----21431 268
NM_199169chr2073218 2368 1016 873 625 492 321 12847 33300 3221 1005 11019
NM_199170chr2073218 2368 1016 873 625 492 321 12847 33300 3221 1005 11019
NM_199171chr2073218 2368 1016 873 625 492 321 12847 33300 3221 1005 11019
NM_199188chr12113884 3529 3283 2982 2589 1301 1163 858 617 433 396 --53519 3144 2683 1499 861 42985 2592 623 260
NM_199190chr12113884 3529 3283 2982 2589 1301 1163 858 617 433 396 --53519 3144 2683 1499 861 42985 2592 623 260
NM_199203chr2021411 173 283 66 11505 --
NM_199229chr231744 417 105 1389 11750 1421
NM_199245chr1272511 1008 973 545 400 360 340 --22513 656 --
NM_199320chr452892 2475 1912 1168 138 22705 435 12162 1142
NM_199320chr452892 2475 1912 1168 138 22705 435 12162 1142
NM_199324chr4113301 2826 2644 2601 2340 1452 1157 949 850 276 201 21074 24 22342 325 13650
NM_199327chr451027 926 389 83 58 --2150 96 --
NM_199342chr12243 234 ----1284
NM_199421chr1494362 4083 3570 1999 1976 1671 1614 1366 1325 11011 84174 2033 1676 876 287 257 61 41 31591 150 86
NM_199436chr293061 3016 2569 1975 837 771 488 427 192 32541 2433 433 3531 494 399 41978 1075 777 633
NM_199437chr1142574 2370 585 305 11719 1573 --
NM_199438chr1142574 2370 585 305 11719 1573 --
NM_199439chr1142574 2370 585 305 11719 1573 --
NM_199454chr184808 3910 1583 1446 1428 1382 539 506 2656 147 24238 1384 11431
NM_199461chr1042938 2884 874 404 53095 2740 2629 2573 738 12921 --
NM_199482chr241902 1788 1341 682 1386 22081 1906 11395
NM_201269chr151215 576 551 328 59 ----11218
NM_201428chr1181524 1467 1311 1053 527 460 138 120 --11055 --
NM_201429chr1181524 1467 1311 1053 527 460 138 120 --11055 --
NM_201430chr1181450 1393 1237 979 453 386 64 46 --1981 --
NM_201437chr841533 386 308 85 --41131 1020 310 226 21307 390
NM_201438chr12------2359 84
NM_201548chr231435 1059 442 2995 546 1121 11276
NM_201591chr441606 1359 638 228 1205 11643 11362
NM_201592chr441606 1359 638 228 1205 11643 11362
NM_201624chr141105 815 232 103 ----1107
NM_201995chr114780 309 96 64 1259 4713 615 73 66 --
NM_201998chr113845 161 129 1324 4778 680 138 131 --
NM_203282chr1911495 --11586 1637
NM_203283chr42576 435 1249 1605 1615
NM_203284chr42576 435 1249 1605 1615
NM_203301chr142650 61 1285 --166
NM_203304chr195849 640 631 291 282 1884 ----
NM_203327chr2054419 4373 4314 4234 143 33389 1509 951 --14475
NM_203341chr13911 893 269 21003 882 11094 21014 896
NM_203342chr193206 3014 2588 2465 1311 1304 1237 1231 270 23331 920 32468 1029 632 33209 1240 204
NM_203343chr193206 3014 2588 2465 1311 1304 1237 1231 270 23331 920 32468 1029 632 33209 1240 204
NM_203349chr1581758 1551 1544 1519 1350 508 479 454 31816 1805 526 ----
NM_203350chr151218 1092 689 635 571 --21328 1221 --
NM_203364chr112369 172 1255 --2845 237
NM_203372chr261631 1593 1578 623 408 198 11373 1255 --
NM_203390chr891678 1654 1419 1355 349 224 190 163 81 1692 2354 226 1197
NM_203391chrX31474 708 206 2619 474 2682 576 21778 1477
NM_203394chr1292702 2689 2603 2345 1974 1920 1676 857 544 11809 32628 1681 1046 32707 547 307
NM_203399chr11703 1250 2234 81 1201
NM_203401chr11703 1250 2234 81 1201
NM_203406chr572784 2768 2238 2130 801 515 171 22264 2219 2852 318 12256
NM_203417chr2131552 1227 303 ----11231
NM_203418chr2131552 1227 303 ----11231
NM_203437chr24744 720 40 34 ----143
NM_203446chr2122016 624 ----12341
NM_203451chr1332076 537 142 1428 2694 128 --
NM_203458chr173710 3039 2763 2414 1036 160 123 33129 2850 1271 33713 3195 2769 --
NM_203459chr152553 2546 2171 2151 365 --42614 2397 1045 414 --
NM_203463chr274934 4673 3580 1210 1123 609 264 14400 54914 4783 4747 3763 747 11213
NM_203504chr452417 2098 2078 1944 69 21797 552 52081 1951 1835 818 416 1757
NM_203505chr452417 2098 2078 1944 69 21797 552 52081 1951 1835 818 416 1757
NM_205768chr1112005 1929 1891 1802 1563 1496 824 552 367 360 352 --51923 1556 435 333 215 --
NM_205852chr1231543 1350 671 22014 485 --1846
NM_205860chr143163 3092 2464 2020 1918 --13169
NM_206594chr182856 1053 475 389 372 345 317 255 32677 889 801 43249 521 463 246 2844 392
NM_206595chr182856 1053 475 389 372 345 317 255 32677 889 801 43249 521 463 246 2844 392
NM_206839chr154601 427 184 120 1633 2653 171 1191
NM_206853chr694043 3893 3693 3186 2642 2539 1402 989 935 33649 946 719 63031 1600 1288 1008 938 698 --
NM_206854chr6135304 5154 4954 4447 3903 3800 3541 3429 564 518 380 189 115 34910 1980 524 54292 3543 1959 192 117 --
NM_206855chr6156269 6119 5919 5412 4868 4765 4506 4394 3994 1529 1483 1345 1154 1080 915 45875 3939 1489 711 45257 4508 1157 1082 13949
NM_206866chr21123094 2772 2674 2627 2524 2468 2438 2376 977 408 102 36 13120 22677 104 62933 2441 1093 980 894 411
NM_206876chr2133518 3107 2752 2422 2404 1297 1285 993 929 907 506 439 151 --41029 919 913 441 32407 1185 155
NM_206907chr5102962 2767 2705 2676 2606 2534 1282 661 507 418 22988 2872 23169 2964 --
NM_206909chr8138118 7788 6988 5753 3262 3085 2618 2022 1021 345 286 225 126 57705 6814 6642 6442 52 55811 5464 1514 1508 900 1129
NM_207012chr1042136 1006 616 245 22353 38 --1249
NM_207015chr392215 1734 870 854 667 582 141 93 72 1728 3790 669 186 --
NM_207042chr12219 205 1669 --1222
NM_207045chr12219 205 1669 --1222
NM_207046chr12219 205 1669 --1222
NM_207171chr1122037 2021 1925 1584 1463 777 735 620 398 354 262 110 --1300 31601 1468 542
NM_207299chr991042 1028 994 708 312 236 173 138 29 ----21049 921
NM_207303chr1034036 3543 352 23948 3298 13426 13223
NM_207304chr1352072 1949 1832 1818 1761 12092 42266 1952 1834 1824 --
NM_207337chr123896 437 315 ----11121
NM_207352chr461830 989 507 368 204 181 --3194 187 119 --
NM_207371chr105592 513 167 150 23 --41353 543 177 152 11297
NM_207396chr151308 562 258 97 88 11336 11322 11311
NM_207406chr496421 6370 6334 5596 4943 4674 4201 1826 1529 46153 1942 673 448 35912 2049 597 21990 1924
NM_207418chr1_random71043 1012 851 190 137 96 36 --2309 223 21015 39
NM_207429chr1152449 2390 2324 2098 393 51914 1727 890 871 720 ----
NM_207481chr241232 1171 552 521 --1977 21235 1176
NM_207491chr441329 1249 1163 1074 31386 1373 162 11165 --
NM_207517chr152195 61 31879 720 169 11814 1778
NM_207518chr193532 234 29 --31189 42 35 --
NM_207645chr1141057 1025 501 87 181 162 1994
NM_207647chr962391 1936 772 582 546 50 32178 1003 458 21988 515 21602 590
NM_212460chr791774 1449 1441 1353 739 657 509 479 39 12017 11782 11459
NM_212471chr1772256 1682 1569 582 353 73 27 ----31572 1485 590
NM_212472chr1772256 1682 1569 582 353 73 27 ----31572 1485 590
NM_212554chr1061599 1483 1381 1135 332 304 21519 84 1104 --
NM_212558chr964209 4085 3684 3109 2713 742 --33686 3515 3274 33024 2969 745
NM_213589chr295300 5170 4860 4058 3909 2153 1434 1084 251 55555 5475 4833 3709 1071 55437 5275 2185 1422 525 12221
NM_213590chr13185294 4674 4629 4413 4333 4293 4047 3747 3705 2078 1899 927 875 531 360 195 98 26 35050 2113 819 45184 3578 3357 1296 14336
NM_213598chr1951411 1024 1004 420 255 11150 21087 984 --
NM_213606chr1052726 2207 1012 746 587 21668 488 1592 --
NM_213651chr161373 1345 1194 1154 237 108 21717 607 2523 64 1111