TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3152-3p
miRNA Sequence: UGUGUUAGAAUAGGGGCAAUAA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr551177 977 966 889 85 ------
NM_000038chr531460 1343 569 --21605 444 --
NM_000052chrX53160 892 686 674 228 12219 --147
NM_000084chrX66437 5887 2730 2425 2018 1283 26971 1620 11755 --
NM_000087chr43402 62 23 ------
NM_000088chr1711069 ------
NM_000091chr252855 2828 1870 624 590 ------
NM_000103chr1531143 1123 312 ------
NM_000109chrX82558 2543 1908 1846 1811 937 785 250 ------
NM_000112chr575568 4361 3488 2138 905 634 615 1660 1596 --
NM_000115chr1382558 2264 1897 1085 722 269 250 142 12128 ----
NM_000138chr1531866 1855 291 31717 1068 568 11999 --
NM_000153chr1421263 212 --3617 307 235 11141
NM_000167chrX41396 449 278 85 1727 ----
NM_000176chr562932 1517 1494 1133 828 525 31416 1306 1063 23006 943 --
NM_000202chrX52556 1425 1143 498 342 ------
NM_000208chr1964693 4014 3857 3788 3762 3433 --11206 13710
NM_000216chrX83797 2768 2614 2588 2482 1545 1183 381 ------
NM_000217chr1255044 4100 3274 1870 485 21702 449 ----
NM_000222chr432137 1691 815 ------
NM_000232chr433095 3060 2148 ----1177
NM_000242chr1032583 424 141 22697 2636 ----
NM_000252chrX31421 1229 393 --21452 231 1118
NM_000259chr1586172 5876 5535 5197 2447 2333 1908 333 15912 ----
NM_000264chr953377 3086 2868 2792 2480 --12953 --
NM_000267chr1743340 694 558 36 --1640 --
NM_000289chr122376 57 ------
NM_000297chr432043 1403 31 2731 449 ----
NM_000304chr173746 297 198 ------
NM_000314chr1043242 2213 1014 174 --12046 --
NM_000321chr1321518 418 --11135 --
NM_000325chr44617 272 219 194 ----1509
NM_000329chr13868 647 353 2884 687 ----
NM_000332chr667197 6767 6312 5033 4415 1587 26279 80 14487 --
NM_000337chr575776 4231 2512 2371 2014 1777 370 25689 1197 16007 --
NM_000340chr321350 258 1331 11206 11121
NM_000346chr1731732 1632 646 11544 ----
NM_000368chr953348 1753 1565 1263 974 13910 --21706 359
NM_000390chrX42867 1232 548 230 1438 --12158
NM_000393chr242100 2078 1746 1355 1798 ----
NM_000397chrX42342 2319 1824 671 1535 --1604
NM_000401chr1131063 1038 730 --11139 --
NM_000408chr243248 1377 1251 116 33342 889 285 ----
NM_000414chr51115 ----1206
NM_000430chr172676 442 23652 564 23550 2488 --
NM_000439chr532524 2494 2063 11745 --12504
NM_000441chr752259 845 543 270 239 --21727 174 --
NM_000448chr1132025 1147 526 22214 1310 22164 75 --
NM_000449chr131472 1292 600 11520 ----
NM_000461chr384151 1826 1780 1361 1247 925 413 368 ------
NM_000476chr911351 ------
NM_000480chr113333 164 61 ----11609
NM_000489chrX82931 2108 2096 1019 917 901 177 76 22233 575 ----
NM_000495chrX2918 135 ------
NM_000516chr201102 ------
NM_000533chrX130 31935 1811 1366 ----
NM_000550chr91222 1904 2972 760 1110
NM_000555chrX137642 6355 6273 6031 5943 5220 2619 1417 1340 1298 1191 866 597 --1911 1802
NM_000590chr51119 ------
NM_000602chr721578 1499 ------
NM_000610chr1152802 2645 906 296 73 --13048 --
NM_000618chr12115791 4373 2315 1912 1884 1779 1726 1543 1482 953 110 1998 ----
NM_000618chr12115791 4373 2315 1912 1884 1779 1726 1543 1482 953 110 1998 ----
NM_000619chr122556 60 ------
NM_000633chr1854318 3244 1526 523 171 34442 1335 120 ----
NM_000639chr13733 720 525 ----1571
NM_000663chr1643045 2401 2199 1909 ------
NM_000724chr1051845 727 402 394 55 ------
NM_000725chr1221026 665 ------
NM_000726chr21460 11006 --186
NM_000747chr171672 ------
NM_000801chr203857 356 336 ------
NM_000806chr561649 1541 757 527 310 205 --11373 --
NM_000809chr498368 7382 3575 3405 1905 1449 885 838 609 27726 7540 --18165
NM_000813chr584925 3748 3505 1622 1456 1303 1037 734 25531 3587 ----
NM_000814chr15133759 3569 3346 2981 2773 2701 1639 1336 1211 986 817 742 37 ------
NM_000826chr431745 1665 789 --22576 385 --
NM_000827chr582475 2422 2393 2191 2117 1042 389 238 ------
NM_000829chr1121585 274 --21441 133 11494
NM_000833chr1631537 1310 1102 11483 --2447 411
NM_000838chr682415 2402 2091 1720 1705 1036 577 260 ----11696
NM_000840chr71199 ------
NM_000859chr521756 510 ----156
NM_000860chr431094 612 428 ------
NM_000868chrX42182 1775 438 408 32131 696 644 ----
NM_000875chr1576804 6026 2689 2215 576 231 78 26381 1751 25371 456 --
NM_000891chr1733440 2720 618 ------
NM_000901chr452281 2159 1744 375 85 ------
NM_000908chr5----1711 --
NM_000910chr421776 214 11903 ----
NM_000917chr101183 --2776 98 --
NM_000922chr113885 759 129 ------
NM_000926chr11169270 9239 8898 8672 3473 3462 3026 2864 2637 2084 2035 1936 1731 900 323 116 87962 6929 5785 2109 1714 1478 1066 365 --18790
NM_000933chr2061570 1508 1471 1448 663 155 1251 11750 --
NM_000935chr32332 105 --11236 --
NM_000944chr452033 1947 687 459 105 ------
NM_000950chrX22517 753 --162 --
NM_000958chr51311 2886 507 1827 --
NM_000962chr942913 2222 1007 738 42849 2407 1207 303 12033 --
NM_000963chr162400 2386 1729 1700 871 95 ------
NM_000965chr341239 1114 1024 416 ------
NM_001001132chr2111446 11457 ----
NM_001001323chr1252002 1122 952 503 117 2308 63 1931 --
NM_001001389chr1152802 2645 906 296 73 --13048 --
NM_001001390chr1152802 2645 906 296 73 --13048 --
NM_001001391chr1152802 2645 906 296 73 --13048 --
NM_001001392chr1162848 2691 952 342 119 49 --13094 --
NM_001001395chr1242581 2102 1012 747 2329 83 ----
NM_001001396chr164254 4064 2904 1438 393 137 ------
NM_001001419chr555111 4797 3360 955 294 24694 609 ----
NM_001001420chr555111 4797 3360 955 294 24694 609 ----
NM_001001481chr882392 2155 1147 657 557 544 193 25 22271 2224 ----
NM_001001484chr1042196 1837 686 220 1521 --11942
NM_001001521chr21272 ------
NM_001001557chr821959 1758 12110 1890 --
NM_001001664chr253217 3108 2549 2535 246 14075 11249 169
NM_001001668chr1983750 3698 2750 1712 1031 459 147 26 1260 21353 518 --
NM_001001787chr1------1442
NM_001001928chr2253226 2994 962 428 47 --21184 1050 17185
NM_001001933chr12574 100 ------
NM_001001971chr1041322 1251 448 285 2308 88 ----
NM_001001974chr1052291 2143 1782 877 320 ------
NM_001001992chr21198 ------
NM_001001995chrX71768 1713 713 672 484 477 44 11349 ----
NM_001002258chr231737 644 405 11932 2758 438 --
NM_001002295chr101238 11120 ----
NM_001002838chrX21776 1173 11230 --11707
NM_001002860chr1464672 3915 3874 3435 1646 1165 --13260 --
NM_001002909chr1772268 2055 1731 1599 1409 113 78 22046 1678 11970 --
NM_001003652chr18188697 8659 8079 7174 6885 6700 6534 6476 5959 5552 5450 5258 2405 2281 2161 1982 918 780 37765 7462 3315 11976 12216
NM_001003674chr18106847 6342 6137 6003 5836 5762 5090 5055 2796 2039 27069 5217 26216 738 --
NM_001003675chr18106847 6342 6137 6003 5836 5762 5090 5055 2796 2039 27069 5217 26216 738 --
NM_001003679chr121815 411 1137 --11889
NM_001003682chr13282 83 50 11123 ----
NM_001003712chr1264029 3013 2927 735 355 310 1830 ----
NM_001003800chr912560 --133 --
NM_001004317chr654176 4054 3621 2783 1185 1698 13102 --
NM_001004342chr1116110 5734 5130 4859 4650 4424 4278 3761 1470 942 535 11949 ----
NM_001004346chr431254 921 261 1306 1406 11057
NM_001004360chr231797 147 55 --1419 --
NM_001004419chr1253319 867 807 258 199 --13394 23984 3049
NM_001005207chr172263 38 ------
NM_001005375chrY41613 1302 442 240 ------
NM_001005386chr232467 838 379 1333 ----
NM_001005473chr5106647 6358 6047 5980 5088 5067 4578 4244 4145 1418 52496 1748 1677 1456 284 ----
NM_001005474chr361328 1318 569 270 255 27 ------
NM_001005502chr1265252 5127 4690 4056 3361 223 --14849 --
NM_001005739chr23877 689 231 2890 302 ----
NM_001005746chr21460 11006 --186
NM_001005747chr21460 11006 --186
NM_001005849chr171367 ------
NM_001005861chr3--1808 --185
NM_001006600chr511816 1982 12055 --
NM_001006612chrX129 1422 ----
NM_001006613chrX129 1422 ----
NM_001006614chrX129 1422 ----
NM_001006623chr252208 2131 618 437 142 32401 987 924 --1398
NM_001006641chr921783 1594 ------
NM_001006642chr921783 1594 ------
NM_001006643chr921783 1594 ------
NM_001007024chr1744022 3785 3123 128 --12867 1198
NM_001007025chr1744022 3785 3123 128 --12867 1198
NM_001007097chr975100 5052 4475 4190 3147 1991 1422 2541 469 13174 --
NM_001007099chr11611 --1815 --
NM_001007100chr11611 --1815 --
NM_001007246chr2141911 499 325 33 ------
NM_001007278chr1355257 5178 4789 4032 290 --33974 3545 1787 --
NM_001007565chr32401 343 ------
NM_001008239chr1853399 3096 2533 962 189 11538 ----
NM_001008392chr323169 610 ----23403 2495
NM_001008495chr852043 1831 1782 1688 54 ------
NM_001008660chr1151482 1446 1190 574 280 ------
NM_001008723chr104531 401 371 190 ------
NM_001009554chr474508 4326 3391 2976 1227 747 481 34148 3656 58 23206 1430 --
NM_001009554chr474508 4326 3391 2976 1227 747 481 34148 3656 58 23206 1430 --
NM_001009555chr421780 1667 --11483 1698
NM_001009881chr11159 ------
NM_001009882chr11159 ------
NM_001009909chr1163761 3727 3035 2999 1413 523 11452 1279 2650 584
NM_001009959chr252493 1942 877 697 237 42291 2208 2071 829 11953 1790
NM_001010846chr154039 3893 2901 471 91 24245 2893 13967 24477 4305
NM_001010861chr131118 719 64 --1505 2924 232
NM_001010888chrX94624 4551 1705 1240 829 231 135 82 45 155 24131 162 23896 63
NM_001010891chr585830 4669 1966 995 655 638 628 414 21717 592 ----
NM_001010934chr7169 1451 ----
NM_001010942chr1231313 1056 326 1529 ----
NM_001010986chrX22330 1787 --22074 343 --
NM_001011513chr424110 3821 13072 1440 --
NM_001011515chr43759 402 130 ------
NM_001011516chr43759 402 130 ------
NM_001011537chr332363 1963 598 ------
NM_001011551chrX1341 --1438 --
NM_001011553chr72668 118 ------
NM_001011666chr7106533 6224 5562 2598 2396 2058 1796 1123 995 549 25215 4864 ----
NM_001011713chr1431509 1228 278 --1387 --
NM_001012267chr951740 1602 1533 237 205 ------
NM_001012393chr1153623 1295 1181 1106 896 31697 1660 409 1940 --
NM_001012398chr1651084 1048 965 310 147 ------
NM_001012410chr31442 ------
NM_001012751chr1041829 1785 368 66 --1353 --
NM_001012755chrX84589 4406 3990 3600 1930 1502 747 257 ----192
NM_001012968chrX62596 2120 688 588 232 213 1700 ----
NM_001012969chr152305 273 ------
NM_001012989chrX2568 546 ------
NM_001013031chr1033469 2660 2199 1293 --12214
NM_001013415chr461517 1398 1268 1152 385 197 ------
NM_001013659chr1995330 4906 4116 3356 2083 2003 1903 1847 1067 32033 1153 970 14268 --
NM_001013699chr121360 ------
NM_001014286chr131330 ------
NM_001014380chr13115655 5604 5322 4754 4212 2041 1926 1394 1223 1116 402 35444 4984 1448 --11072
NM_001014797chr10108094 7924 7485 7464 5888 2724 2358 700 371 168 27575 5968 17761 --
NM_001014809chr41905 ------
NM_001015048chr1442518 708 651 361 23110 918 ----
NM_001015049chr1442518 708 651 361 23110 918 ----
NM_001015877chrX52942 2373 2003 1990 1225 --1722 --
NM_001017369chr41128 --165 --
NM_001017395chr383560 3537 3409 2738 2276 1315 825 791 --1388 13336
NM_001017420chr851409 1274 906 890 244 ------
NM_001017923chr1431676 1526 404 11492 ----
NM_001017926chr831193 359 274 1255 ----
NM_001017962chr101183 --2776 98 --
NM_001017975chr12418 342 ------
NM_001017977chr1----1139 --
NM_001017979chr42665 110 ------
NM_001017999chr152254 1776 1729 1722 154 ------
NM_001017999chr152254 1776 1729 1722 154 ------
NM_001018000chr152254 1776 1729 1722 154 ------
NM_001018000chr152254 1776 1729 1722 154 ------
NM_001018001chr152254 1776 1729 1722 154 ------
NM_001018008chr152583 85 ------
NM_001018064chr962021 1841 418 366 121 112 ------
NM_001018074chr562932 1517 1494 1133 828 525 31416 1306 1063 23006 943 --
NM_001018075chr562932 1517 1494 1133 828 525 31416 1306 1063 23006 943 --
NM_001018076chr562932 1517 1494 1133 828 525 31416 1306 1063 23006 943 --
NM_001018077chr562932 1517 1494 1133 828 525 31416 1306 1063 23006 943 --
NM_001018089chr1553145 2451 639 504 222 ----12722
NM_001018676chr81130 ------
NM_001018677chr81130 ------
NM_001020658chr151597 1510 531 352 197 11472 ----
NM_001020658chr151597 1510 531 352 197 11472 ----
NM_001023567chr1542249 1992 1806 1766 --1533 --
NM_001024024chr14----1786 --
NM_001024094chr562932 1517 1494 1133 828 525 31416 1306 1063 23006 943 --
NM_001024218chr143807 661 189 ------
NM_001024372chr851856 1621 1408 382 108 11392 ----
NM_001024647chr1267569 7542 5476 4764 1360 310 27171 1106 16413 --
NM_001024649chr56873 811 370 278 249 166 1229 --12078
NM_001024660chr321156 514 11657 ----
NM_001024680chr251542 1285 726 714 476 1453 ----
NM_001024807chr19----1326 --
NM_001024855chr341321 1208 608 233 ------
NM_001024948chr143184 3055 2957 502 2568 48 ----
NM_001024956chr11145729 5324 4926 4891 4495 4240 3832 3640 2109 1531 1009 651 386 254 14046 24487 2247 --
NM_001025068chr311794 ------
NM_001025069chr311794 ------
NM_001025076chr1096007 5592 4709 4571 1776 1190 1153 451 81 34311 2375 872 23948 2097 --
NM_001025077chr10107365 6950 6067 5929 5009 4885 2548 2511 1809 1439 25669 2230 15306 --
NM_001025079chr384142 3382 3066 1203 811 803 770 371 1891 ----
NM_001025108chr253995 3922 3781 1649 780 --13669 13741
NM_001025252chr862283 1186 965 929 769 671 ------
NM_001025253chr862283 1186 965 929 769 671 ------
NM_001025366chr631788 532 444 --11471 --
NM_001025366chr631788 532 444 --11471 --
NM_001025367chr631788 532 444 --11471 --
NM_001025367chr631788 532 444 --11471 --
NM_001025368chr631788 532 444 --11471 --
NM_001025368chr631788 532 444 --11471 --
NM_001025369chr631804 548 460 --11487 --
NM_001025369chr631804 548 460 --11487 --
NM_001025370chr631788 532 444 --11471 --
NM_001025370chr631788 532 444 --11471 --
NM_001025389chr113333 164 61 ----11609
NM_001025390chr113333 164 61 ----11609
NM_001025595chr44302 286 155 58 11514 ----
NM_001025603chr131472 1292 600 11520 ----
NM_001025780chr931611 240 137 21470 67 ----
NM_001029875chr552691 2211 1134 910 242 1769 1662 --
NM_001029997chr192753 47 ------
NM_001030001chr141141 ------
NM_001030007chr1664029 3520 3080 2961 1144 478 ------
NM_001030055chr1474440 4194 3685 3535 1068 1039 807 ------
NM_001031623chr641782 1169 468 235 --11829 --
NM_001031679chr1242781 2254 1414 943 13131 1768 --
NM_001031695chr2274850 4097 3621 3350 1340 870 806 --14792 --
NM_001031700chr4102499 2297 2213 2041 1938 1868 1654 682 262 160 1445 1232 --
NM_001031732chr473685 3134 2623 2254 1014 219 206 23372 1201 --1959
NM_001031743chr6171 1166 ----
NM_001031748chr125510 434 428 120 80 2551 529 ----
NM_001031804chr1653720 3571 3059 2864 2803 23208 2815 --13272
NM_001031812chr521491 551 1428 ----
NM_001032282chr831224 1191 1081 1287 ----
NM_001032293chr172105 22 ------
NM_001032393chrX2650 197 ------
NM_001032410chr21198 ------
NM_001033045chr263887 3840 1128 1051 935 86 ----1743
NM_001033047chr442643 2580 1952 968 1553 ----
NM_001033059chr631734 701 611 ------
NM_001033087chr2043163 3017 2388 713 12855 ----
NM_001033112chr52768 703 134 --1656
NM_001033117chr354476 4264 3564 1952 1927 21302 946 1264 --
NM_001033506chr11----184 --
NM_001033578chr841852 550 379 346 1533 1319 1370
NM_001033756chr631722 466 378 --11405 --
NM_001033756chr631722 466 378 --11405 --
NM_001033925chr1042117 874 868 56 1133 --1297
NM_001034841chr1674921 4827 4746 4536 3692 3541 676 35040 3678 424 2808 719 --
NM_001034845chr45391 294 284 220 87 --11189 --
NM_001034850chr531355 1109 392 11570 2438 170 --
NM_001034954chr1033095 2234 459 32880 946 94 ----
NM_001034955chr1033095 2234 459 32880 946 94 ----
NM_001034956chr1033095 2234 459 32880 946 94 ----
NM_001034957chr1033095 2234 459 32880 946 94 ----
NM_001035511chr131560 1350 371 ------
NM_001035512chr131667 1457 478 ------
NM_001035513chr131667 1457 478 ------
NM_001037174chr251963 1702 1651 794 769 1526 ----
NM_001037317chr131118 719 64 --1505 2924 232
NM_001037334chr1862175 1930 1565 856 827 439 ------
NM_001037553chr213959 127 121 --11973 --
NM_001037631chr211095 ----1748
NM_001038707chr142268 2247 2116 131 --22186 580 --
NM_001038707chr142268 2247 2116 131 --22186 580 --
NM_001039091chrX2501 262 --11385 --
NM_001039199chr2044159 3954 2023 731 --11081 --
NM_001039348chr22781 349 --1879 --
NM_001039349chr22781 349 --1879 --
NM_001039459chr731151 819 51 --11042 --
NM_001039465chr141483 ------
NM_001039538chr293142 2986 2975 2954 2500 2314 2239 1336 529 13109 ----
NM_001039547chr3107989 7970 7710 5044 2951 2460 1973 787 522 351 1803 27469 6747 --
NM_001039569chr243374 1094 404 134 2350 155 ----
NM_001039590chrX83992 3830 2977 2479 1592 649 571 79 24026 3172 ----
NM_001039591chrX83992 3830 2977 2479 1592 649 571 79 24026 3172 ----
NM_001039618chr11115658 5361 3606 2204 1625 1485 1180 840 314 208 185 44982 4147 879 161 22095 1964 --
NM_001039762chr1042236 1842 1452 166 32025 820 306 ----
NM_001039802chr111111 ------
NM_001039840chrX75453 4071 3970 3781 1923 1256 616 44873 2181 2171 1948 31310 1053 705 1917
NM_001039885chr19----11027 --
NM_001039937chr1363858 3003 1618 1314 228 91 13147 --12943
NM_001039938chr1341177 1085 524 73 ------
NM_001040152chr745108 3626 3184 1521 24256 1936 ----
NM_001040157chr482343 2332 1995 1979 1807 948 743 539 ------
NM_001040159chr431058 591 40 ------
NM_001040214chr622349 118 ----31478 632 155
NM_001040284chr16114722 3878 3775 2088 1957 1754 970 643 572 558 164 25421 4050 ----
NM_001040402chr432817 607 550 ------
NM_001040424chr2132069 1203 808 ------
NM_001040429chr1343620 3378 2977 460 33022 2771 532 --1572
NM_001040440chr51462 141 ----
NM_001040450chr1532882 669 344 2467 401 1675 --
NM_001040453chr1532882 669 344 2467 401 1675 --
NM_001040624chr862764 1997 1084 645 585 64 2747 682 --1819
NM_001040625chr862764 1997 1084 645 585 64 2747 682 --1819
NM_001040626chr862764 1997 1084 645 585 64 2747 682 --1819
NM_001040627chr862764 1997 1084 645 585 64 2747 682 --1819
NM_001040628chr862764 1997 1084 645 585 64 2747 682 --1819
NM_001040629chr862764 1997 1084 645 585 64 2747 682 --1819
NM_001040630chr862764 1997 1084 645 585 64 2747 682 --1819
NM_001040653chr352577 2476 1772 433 138 ------
NM_001040665chr774689 1744 1398 1389 1219 973 740 23799 650 23141 769 14083
NM_001040712chr953609 2245 569 452 108 13121 11231 23579 890
NM_001040876chr4--1136 --11763
NM_001042355chr16104889 4346 4299 2101 1616 1363 736 411 251 47 ------
NM_001042388chr181368 ------
NM_001042403chr124949 724 396 128 ------
NM_001042412chr16104889 4346 4299 2101 1616 1363 736 411 251 47 ------
NM_001042413chr983458 3301 2891 1577 1326 1279 1054 764 --11411 --
NM_001042453chrX2209 69 11387 ----
NM_001042459chr31315 ------
NM_001042473chr1051833 1561 302 192 178 1334 ----
NM_001042492chr1743340 694 558 36 --1640 --
NM_001042494chr1563512 2470 1042 796 398 276 1692 ----
NM_001042495chr1563512 2470 1042 796 398 276 1692 ----
NM_001042496chr1563512 2470 1042 796 398 276 1692 ----
NM_001042497chr1563512 2470 1042 796 398 276 1692 ----
NM_001042506chrX11249 1533 ----
NM_001042510chr852024 1962 1808 86 27 165 11556 12146
NM_001042511chr852024 1962 1808 86 27 165 11556 12146
NM_001042517chr134872 856 376 64 ------
NM_001042533chr393152 2748 2703 2641 1278 1171 492 164 114 22179 474 ----
NM_001042550chr962058 1823 1816 1543 824 302 11987 ----
NM_001042555chr1264643 3975 3172 1162 450 378 33570 3461 304 ----
NM_001042599chr2136947 6526 6382 6068 5664 2897 2843 2512 906 831 558 488 108 36880 5492 501 --17529
NM_001042601chr31325 12751 12062 --
NM_001042603chr1283534 2155 1997 1987 1766 1361 1049 321 1307 ----
NM_001042604chr354779 3058 1956 872 794 11676 --13302
NM_001042681chr121924 1043 22572 478 --1370
NM_001042682chr121924 1043 22572 478 --1370
NM_001042682chr121924 1043 22572 478 --1370
NM_001042683chr631637 224 101 2538 425 ----
NM_001043318chr1433745 2572 1590 14072 23248 991 --
NM_001044305chr661463 1174 526 352 344 40 --1661 --
NM_001044385chr283826 3444 3390 3373 3174 1121 193 117 33236 2555 1383 --13565
NM_001044722chr521491 551 1428 ----
NM_001044723chr521491 551 1428 ----
NM_001046chr572936 2837 2751 2496 2435 882 82 21085 76 ----
NM_001049chr1431901 374 150 11533 ----
NM_001071775chr1341408 1318 624 222 ------
NM_001079874chr162097 1984 1924 1322 772 181 1361 12033 --
NM_001083620chr431744 1664 788 --22574 384 --
NM_001095chr1251946 1456 1310 1262 195 ------
NM_001099678chr3176011 5229 4703 4590 4172 2437 1781 1601 1403 955 841 817 788 754 673 597 567 54639 4221 1809 1547 201 15691 11089
NM_001100108chr148269 7132 5342 950 17277 15505 --
NM_001106chr399285 7118 3732 2575 2000 1879 1632 779 577 38760 7678 370 ----
NM_001113490chrX93665 2870 2676 2519 1190 382 272 157 119 12288 ----
NM_001115chr8163 ------
NM_001121chr102689 444 ------
NM_001122679chr551177 977 966 889 85 ------
NM_001128chr1664029 3520 3080 2961 1144 478 ------
NM_001148chr432201 2140 512 21542 698 11848 1682
NM_001149chr1051238 933 517 501 286 11353 ----
NM_001160chr1232548 346 213 ------
NM_001167chrX75206 4940 4927 2676 2581 620 354 35084 4647 2448 ----
NM_001173chr1474440 4194 3685 3535 1068 1039 807 ------
NM_001177chr1232069 707 373 1977 12270 --
NM_001186chr21103123 2880 2778 2661 2416 1258 455 414 338 70 22270 2205 ----
NM_001201chr463785 3647 3399 3304 3164 2710 12529 ----
NM_001204chr277615 7043 6991 2778 2763 2071 561 25665 4749 35562 4916 2591 --
NM_001206chr943115 2993 2168 1058 22937 588 12724 --
NM_001219chr71246 11683 ----
NM_001233chr772213 1740 699 599 411 234 41 161 ----
NM_001256chr1742651 2167 774 190 12430 ----
NM_001257chr161301 ------
NM_001259chr785647 5486 4493 2453 1992 1280 1167 645 55921 5558 5263 4554 2551 15146 --
NM_001269chr13952 785 421 ------
NM_001270chr521076 726 ------
NM_001290chr41295 1228 ----
NM_001293chr111543 ------
NM_001304chr1743490 3093 1383 750 --12907 --
NM_001310chr1252410 1081 642 575 248 1632 ----
NM_001313chr41905 ------
NM_001351chr321587 1276 ----11596
NM_001356chrX2450 40 1978 12434 --
NM_001364chr11104474 4305 1477 1248 1151 907 788 611 459 22 34502 3426 64 ----
NM_001380chr1031038 981 109 ------
NM_001390chr1873424 3152 1031 461 399 174 66 ----12849
NM_001396chr2132843 1822 1722 21762 104 ----
NM_001407chr321349 56 ------
NM_001412chrX63519 2713 2591 1313 1218 689 ------
NM_001419chr1933979 3555 760 2896 857 24271 329 --
NM_001429chr223861 806 48 ------
NM_001438chr121195 92 13215 --11229
NM_001482chr153963 293 121 ------
NM_001491chr682663 1681 591 539 417 410 357 177 11710 ----
NM_001495chr821127 1076 ----1991
NM_001498chr61209 1227 1522 --
NM_001508chr21879 1684 ----
NM_001514chr12448 350 ------
NM_001530chr142977 806 --11125 --
NM_001543chr554860 3242 1659 1537 775 ------
NM_001552chr1711115 ------
NM_001556chr871447 1431 1041 952 902 77 25 ------
NM_001560chrX42591 2249 1035 504 11846 --12489
NM_001584chr1111087 ----21070 868
NM_001616chr253432 2433 971 635 319 1483 11396 --
NM_001627chr351508 962 758 733 688 12406 ----
NM_001634chr631734 701 611 ------
NM_001650chr1894086 4057 3486 3294 2867 2608 415 316 270 ------
NM_001656chr561634 1514 1324 823 587 542 ------
NM_001663chr1452761 2134 1855 1070 244 ------
NM_001664chr331043 213 203 --1345 1241
NM_001677chr1------11080
NM_001682chr123836 666 217 122 1645 --
NM_001684chr153971 3781 2621 1155 110 ------
NM_001689chr231737 644 405 11932 2758 438 --
NM_001742chr721693 545 11797 ----
NM_001746chr56873 811 370 278 249 166 1229 --12078
NM_001755chr1642049 1921 628 224 157 --11497
NM_001777chr384142 3382 3066 1203 811 803 770 371 1891 ----
NM_001788chr72668 118 ------
NM_001791chr111111 ------
NM_001795chr1621449 1314 ------
NM_001797chr162710 292 --2586 282 --
NM_001819chr201228 ------
NM_001830chrX54002 3983 3557 1525 1154 13224 ----
NM_001845chr1321376 59 ----1148
NM_001858chr6124973 4735 4173 3983 3669 3446 1663 1508 898 777 62 34 34188 3993 3120 ----
NM_001859chr963971 3165 984 487 363 211 12905 ----
NM_001870chr3------1350
NM_001873chr43625 95 89 ------
NM_001874chr1265252 5127 4690 4056 3361 223 --14849 --
NM_001931chr11152 ------
NM_001941chr1853532 2515 1198 986 326 ----13427
NM_001942chr1831849 1354 646 31446 443 87 11977 --
NM_001944chr1842048 1541 514 94 ------
NM_001951chr85621 544 511 94 47 --1135 --
NM_001968chr43846 782 597 1624 ----
NM_001969chr1493822 3739 2763 1260 861 749 585 102 26 ------
NM_001977chr451563 1089 472 277 187 11716 ----
NM_001981chr11845 ------
NM_001995chr421352 1200 1214 ----
NM_002006chr455251 2283 1759 943 582 25316 1379 12316 15331
NM_002009chr1552816 1972 759 727 589 32496 815 393 11078 11091
NM_002025chrX118945 7915 7796 6466 6352 5758 3395 2428 2011 166 23 15636 17960 --
NM_002027chr81130 ------
NM_002028chr1421334 930 ------
NM_002035chr1842983 583 188 175 11474 ----
NM_002039chr45897 771 192 135 77 1257 --1846
NM_002040chr2132380 730 257 12883 ----
NM_002051chr101238 11120 ----
NM_002052chr821505 1461 --2499 338 --
NM_002077chr961451 644 614 309 252 38 ----165
NM_002078chr3129 ------
NM_002126chr1793697 3020 2993 2820 2649 1481 511 87 62 ----11644
NM_002128chr1342118 1576 797 586 1152 ----
NM_002130chr561544 1476 1417 374 189 132 ------
NM_002137chr732364 2121 205 ------
NM_002158chr223163 2444 33021 854 458 1442 22599 2333
NM_002167chr11480 ------
NM_002202chr511093 ------
NM_002210chr243242 3011 2616 1141 33439 444 195 ----
NM_002214chr7105647 5347 4806 4431 4398 4068 3600 1966 234 141 35322 5232 756 35613 4922 3946 14982
NM_002223chr1283811 2998 2813 2589 1428 623 558 375 2842 427 --11459
NM_002228chr11291 148 1319 --
NM_002233chr111438 ------
NM_002235chr1231400 1312 43 ------
NM_002239chr21350 ----2916 361
NM_002264chr384721 4158 1647 673 376 358 201 110 24785 1042 14926 --
NM_002267chr1332085 279 231 --12180 1533
NM_002270chr5175508 5355 5291 5064 5027 4896 4475 4455 4264 4184 4065 3947 3918 3910 3609 548 210 14314 ----
NM_002271chr1352384 2110 2074 787 735 --1228 --
NM_002285chr253995 3922 3781 1649 780 --13669 13741
NM_002290chr631230 563 285 ------
NM_002293chr14988 425 204 35 22592 72 --12266
NM_002310chr5146580 5857 5798 5531 5458 5335 5079 4526 4388 2313 1026 930 771 659 --1290 --
NM_002349chr251334 1271 1168 477 322 ------
NM_002356chr672674 2521 2255 2241 2171 1906 455 ------
NM_002374chr293142 2986 2975 2954 2500 2314 2239 1336 529 13109 ----
NM_002395chr651181 538 448 320 118 11355 11069 --
NM_002397chr541832 799 490 204 ----1615
NM_002440chr12125 81 ------
NM_002448chr43658 265 209 ------
NM_002469chr122407 94 ------
NM_002481chr165941 5429 2393 1803 1796 1487 --32141 1963 1012 --
NM_002486chr962531 2351 2311 998 399 187 21961 975 --11746
NM_002487chr152676 605 ------
NM_002515chr1441812 1513 793 351 11304 ----
NM_002518chr211234 ------
NM_002536chrX51519 1081 1022 392 218 --11630 --
NM_002538chr52134 41 ----1469
NM_002544chr171121 ------
NM_002545chr1153623 1295 1181 1106 896 31697 1660 409 1940 --
NM_002546chr81584 --1165 --
NM_002547chrX63905 2979 1696 1313 1190 245 13711 12722 --
NM_002577chr353446 3195 1098 716 639 23486 3133 --13073
NM_002581chr995179 4315 3713 3462 1932 1861 1779 1434 116 24399 1617 ----
NM_002594chr2032416 2299 83 --11626 --
NM_002595chr1251865 1591 1567 1355 650 1350 --1768
NM_002641chrX61782 1358 1285 518 360 284 ------
NM_002645chr1173088 2985 2519 2491 2266 1976 547 12189 1812 --
NM_002652chr7194 ------
NM_002655chr894777 4760 4589 3630 3500 1598 1435 750 342 44326 1908 1818 116 ----
NM_002657chr2023329 3291 --13745 --
NM_002662chr361950 728 652 639 633 531 --11429 --
NM_002667chr631165 1131 414 31217 1200 458 1941 --
NM_002670chr311217 31064 659 182 ----
NM_002687chr1441164 454 412 248 1969 ----
NM_002709chr292586 1403 1342 1316 1117 886 703 158 94 --11016 --
NM_002716chr1163317 2917 2502 885 834 761 --1240 --
NM_002718chr342550 2528 1778 917 ------
NM_002731chr142741 2342 911 446 1212 --1601
NM_002736chr721593 174 22051 617 ----
NM_002737chr1766517 4386 4210 1218 1181 1035 --34218 4197 1610 --
NM_002740chr352847 2449 1937 985 184 11860 ----
NM_002742chr145676 206 129 65 42 ------
NM_002745chr2253719 3216 2857 1607 759 23935 3175 11200 22840 629
NM_002755chr152892 870 ------
NM_002765chrX2501 262 --11385 --
NM_002797chr142213 54 ------
NM_002839chr953609 2245 569 452 108 13121 11231 23579 890
NM_002845chr183481 440 192 ------
NM_002851chr75747 640 274 157 109 ------
NM_002852chr31466 ------
NM_002858chr141312 545 486 408 11306 ----
NM_002867chr11741 ----1205
NM_002869chr1142049 1566 1419 270 21922 1663 ----
NM_002874chr92836 360 --1657 --
NM_002886chr394294 4202 3926 3882 3315 1742 1632 706 311 21532 1458 13411 --
NM_002894chr18------1231
NM_002906chr1152400 1540 682 303 284 1517 11557 --
NM_002922chr13584 141 27 ------
NM_002924chr11243 ------
NM_002940chr4--1136 --11763
NM_002941chr331252 1128 485 170 ----
NM_002942chr311014 11170 --11107
NM_002956chr1251350 974 553 417 61 152 ----
NM_002958chr3--1808 --185
NM_002968chr1661066 1057 1049 749 415 292 ------
NM_002977chr232775 2321 2234 --1864 13447
NM_002979chr11611 --1815 --
NM_002998chr852242 1543 758 730 189 ------
NM_003001chr131667 1457 478 ------
NM_003014chr741519 1441 327 102 ----11167
NM_003016chr1741954 1902 1759 147 ------
NM_003030chr341700 1441 729 377 ------
NM_003034chr1297492 2672 2168 1807 1737 1656 1558 1314 1115 25220 212 --15322
NM_003036chr1----1279 --
NM_003038chr23828 611 207 --12610 12685
NM_003043chr354337 4312 3943 2874 1267 13966 149 --
NM_003045chr1384956 4779 4466 3713 3580 1122 1094 1026 21833 1560 1627 13219
NM_003048chr221807 1785 21771 309 22532 1047 --
NM_003068chr811121 1829 ----
NM_003082chr1451189 894 328 190 42 1497 --21169 316
NM_003108chr2127317 7044 6989 6771 6763 6621 5728 5112 4526 2142 694 585 --15991 15370
NM_003112chr793240 2391 2372 2159 1169 787 708 456 300 21114 421 ----
NM_003130chr731229 1166 112 1490 ----
NM_003142chr21279 ------
NM_003161chr1793539 3408 3365 3273 2818 2216 1306 394 292 23375 3338 ----
NM_003162chr241105 1023 944 761 ------
NM_003199chr1865495 5079 4870 4702 1149 54 31986 1126 237 14596 --
NM_003201chr1021023 158 ------
NM_003216chr2222977 490 ------
NM_003221chr621309 276 23697 2987 23896 1208 --
NM_003234chr322368 2163 22265 160 21898 1530 --
NM_003257chr1531296 484 392 21343 1123 ----
NM_003269chr63983 406 78 3838 513 142 11205 --
NM_003286chr201113 ------
NM_003298chr366218 5568 5381 4336 418 184 1675 --12170
NM_003299chr121174 ------
NM_003336chrX1367 ------
NM_003337chr521306 70 ----11114
NM_003342chr1782925 2637 2279 1235 1169 736 180 169 2553 269 --12158
NM_003360chr4171 --1109 --
NM_003372chrX2704 95 ----1311
NM_003374chr51820 ------
NM_003376chr631788 532 444 --11471 --
NM_003376chr631788 532 444 --11471 --
NM_003390chr1141117 1029 1016 963 ------
NM_003392chr322829 666 63174 3071 1429 909 290 249 ----
NM_003400chr21764 ------
NM_003403chr141810 1602 ----
NM_003404chr2061919 1888 1786 776 652 232 1682 ----
NM_003406chr81184 ------
NM_003410chrX63114 2741 980 767 483 442 12501 --11973
NM_003413chrX51665 1492 696 491 303 ------
NM_003423chr1922455 879 11782 11794 --
NM_003430chr1951572 1476 1345 1219 505 ------
NM_003431chr11456 ------
NM_003453chr131199 ------
NM_003457chr172105 22 ------
NM_003458chr353178 2954 2616 1353 687 1106 22737 655 1751
NM_003463chr632368 1044 741 22688 2345 ----
NM_003468chr264084 3656 1707 1337 1033 709 --23411 3188 --
NM_003469chr2192 ------
NM_003472chr631475 1381 1076 21300 1292 ----
NM_003474chr1022232 1820 42321 2154 1706 926 --11739
NM_003478chr1152273 2042 1111 886 454 --12943 1864
NM_003483chr1272093 1144 830 635 449 308 263 ------
NM_003489chr21123030 2559 2360 2338 1354 1066 827 772 741 221 206 174 1389 13057 --
NM_003503chr161109 441 333 286 191 114 ------
NM_003566chr1272652 2599 1055 988 926 625 483 23151 432 21275 38 --
NM_003574chr18115503 5182 4334 4207 4093 1628 1101 992 600 491 224 25467 578 14698 13827
NM_003583chr1283790 3066 2810 1291 1146 815 609 271 22652 882 13106 --
NM_003590chr294035 3759 3299 3174 2501 1468 1350 769 390 13447 ----
NM_003601chr41199 ------
NM_003607chr144147 850 264 181 12933 ----
NM_003615chr363242 3185 3118 1562 1310 462 13566 13487 --
NM_003617chr154805 4153 3624 3505 3485 34620 4584 4410 ----
NM_003618chr22933 453 11035 ----
NM_003626chr1131147 988 107 ------
NM_003663chr351235 1015 885 501 409 ------
NM_003668chr12129 ------
NM_003671chr942231 931 577 510 22986 66 ----
NM_003686chr1286 48 ------
NM_003692chr92924 650 2733 698 ----
NM_003704chr41610 1641 ----
NM_003716chr31671 ------
NM_003743chr242194 1502 806 522 --12000 --
NM_003749chr1362197 1940 966 817 647 251 ------
NM_003758chr1541590 1446 241 142 2355 61 ----
NM_003758chr1541590 1446 241 142 2355 61 ----
NM_003759chr474165 3746 3662 2717 2688 473 168 24203 261 11524 --
NM_003764chr65808 798 743 340 250 ------
NM_003766chr171491 ------
NM_003774chr125704 607 389 107 31 --11061 --
NM_003795chr62502 100 --1119 --
NM_003800chr632120 573 352 11986 ----
NM_003816chr841523 998 462 213 --2422 49 1139
NM_003821chr83564 222 141 1166 ----
NM_003822chr132418 636 109 --12118 --
NM_003829chr951017 844 170 127 74 21029 990 1179 --
NM_003831chr1861772 1762 1521 547 321 231 131 ----
NM_003864chr43134 38 23 ------
NM_003884chr341796 1198 351 123 ------
NM_003887chr251918 1874 1686 627 26 22137 867 ----
NM_003895chr2151740 1587 1345 371 341 1482 ----
NM_003902chr13815 743 656 ------
NM_003913chr663626 1696 1681 1180 592 133 23513 2765 ----
NM_003916chrX21451 976 ------
NM_003921chr151790 1767 1440 1296 373 ------
NM_003927chr1871092 1015 968 870 705 299 132 ------
NM_003932chr2241894 1457 719 605 174 ----
NM_003941chr752359 2351 616 403 299 1600 ----
NM_003947chr321372 1301 ------
NM_003948chr452670 2278 2170 2006 570 12466 ----
NM_003972chr1031354 1343 1228 11122 ----
NM_003980chr641113 395 355 176 ------
NM_004006chrX82558 2543 1908 1846 1811 937 785 250 ------
NM_004007chrX82558 2543 1908 1846 1811 937 785 250 ------
NM_004009chrX82558 2543 1908 1846 1811 937 785 250 ------
NM_004010chrX82558 2543 1908 1846 1811 937 785 250 ------
NM_004011chrX82558 2543 1908 1846 1811 937 785 250 ------
NM_004012chrX82558 2543 1908 1846 1811 937 785 250 ------
NM_004013chrX82558 2543 1908 1846 1811 937 785 250 ------
NM_004014chrX82558 2543 1908 1846 1811 937 785 250 ------
NM_004015chrX82558 2543 1908 1846 1811 937 785 250 ------
NM_004016chrX92472 2457 1822 1760 1725 990 851 699 164 ------
NM_004017chrX82558 2543 1908 1846 1811 937 785 250 ------
NM_004018chrX92472 2457 1822 1760 1725 990 851 699 164 ------
NM_004020chrX82558 2543 1908 1846 1811 937 785 250 ------
NM_004021chrX92472 2457 1822 1760 1725 990 851 699 164 ------
NM_004022chrX92472 2457 1822 1760 1725 990 851 699 164 ------
NM_004023chrX92472 2457 1822 1760 1725 990 851 699 164 ------
NM_004028chr1894086 4057 3486 3294 2867 2608 415 316 270 ------
NM_004035chr17104003 3190 2013 1861 1591 1466 1300 963 594 191 45229 3267 900 882 ----
NM_004071chr2199 ------
NM_004079chr122313 608 11961 1237 --
NM_004081chrY41613 1302 442 240 ------
NM_004087chr322052 1677 --11751 --
NM_004093chr1322066 662 33103 2045 824 ----
NM_004094chr1432877 466 138 11005 ----
NM_004098chr101363 --1942 11247
NM_004105chr22781 349 --1879 --
NM_004124chr14103595 3470 3449 3357 3069 1343 1074 868 789 730 --12787 13488
NM_004136chr1552682 1254 942 825 803 12152 ----
NM_004162chr32838 171 11085 --1131
NM_004171chr1189567 8892 7350 6494 6233 3294 2887 545 59387 9371 8425 1464 1365 18028 --
NM_004172chr541761 1673 1277 420 ----1528
NM_004180chr2157 ----1526
NM_004228chr191141 ------
NM_004229chrX52176 733 725 545 32 1639 ----
NM_004232chr18113803 3688 3542 3481 3455 3395 2835 1305 792 586 385 23294 2644 --23160 2537
NM_004238chr21269 ------
NM_004251chrX3265 225 105 ------
NM_004252chr171517 ------
NM_004272chr551932 1715 794 748 324 1805 ----
NM_004274chr1443106 2680 2596 1121 ----12521
NM_004293chr962964 2776 2406 1408 924 373 --13417 --
NM_004302chr1212636 ------
NM_004316chr121812 --1394 --
NM_004331chr852632 1776 1703 616 226 1948 --12227
NM_004338chr18106847 6342 6137 6003 5836 5762 5090 5055 2796 2039 27069 5217 26216 738 --
NM_004349chr83500 400 264 ------
NM_004370chr641883 1592 504 447 11636 11977 --
NM_004371chr131426 387 73 ------
NM_004374chr81128 ------
NM_004384chr521491 551 1428 ----
NM_004392chr1342672 1711 725 629 1940 12198 --
NM_004393chr342108 433 381 226 ----2131 121
NM_004411chr72775 718 --1747 1767
NM_004423chr332742 1989 1686 1951 ----
NM_004438chr253104 2952 2391 2294 1302 1579 ----
NM_004440chr62787 503 11941 ----
NM_004458chrX41960 829 529 427 1513 ----
NM_004459chr1722003 100 ----124
NM_004469chrX139 ------
NM_004480chr144242 185 153 98 1326 ----
NM_004496chr1421378 1307 1904 ----
NM_004500chr1421822 263 ------
NM_004501chr1114103 3937 3746 3701 2876 2860 1496 1321 1212 708 539 22500 1281 23597 3378 13876
NM_004504chr243077 3014 241 179 1342 ----
NM_004516chr191425 ------
NM_004525chr261536 1351 473 299 237 79 1583 ----
NM_004535chr2021784 1175 ------
NM_004586chrX94529 4236 3822 1985 1398 647 589 422 69 22006 48 ----
NM_004598chr583053 2892 2495 2439 2258 1187 829 315 22777 1278 ----
NM_004606chrX----1120 --
NM_004612chr954028 3729 3670 3444 257 --24297 498 --
NM_004660chrY42178 1957 449 41 ------
NM_004661chr531102 307 166 1316 11140 11096
NM_004673chr141083 363 333 316 130 ----
NM_004681chrY2680 196 --1515 --
NM_004685chr1362369 2115 1160 123 112 93 22800 2062 12701 --
NM_004709chrX51824 1417 664 624 606 21484 1283 ----
NM_004717chr741461 1357 1121 972 ------
NM_004718chr21101 ------
NM_004719chr1272898 2657 2640 2271 1987 1754 472 1128 ----
NM_004721chr32300 270 ------
NM_004725chr1031508 1363 608 ------
NM_004726chrX65541 5310 4043 2198 1301 298 1607 ----
NM_004734chr1362638 2000 1203 422 319 284 --12590 12968
NM_004736chr142072 1828 1514 23 21722 113 ----
NM_004741chr1021139 145 ----11530
NM_004745chr865848 5683 5627 4338 2747 1545 26052 4588 11334 --
NM_004747chr1031564 1228 239 1226 11240 --
NM_004748chr1573897 3694 3625 3496 1695 1493 570 ----23062 2926
NM_004756chr1911363 11533 ----
NM_004758chr171326 ------
NM_004760chr752425 1847 1652 497 192 1597 ----
NM_004774chr1732919 2507 2264 --1726 --
NM_004775chr1822423 2073 11807 --1542
NM_004781chr111512 ----1415
NM_004781chr111512 ----1415
NM_004788chr1131825 1070 810 --12308 32210 1049 956
NM_004791chr134760 663 237 191 1223 ----
NM_004798chr2083188 3123 2803 2781 2386 2272 675 61 12433 12995 --
NM_004799chr11100 ------
NM_004801chr211574 1367 1226 --
NM_004815chr194847 4319 3474 3038 1875 1823 338 316 157 1724 14544 --
NM_004827chr471641 1464 1400 1392 1357 374 297 --11596 --
NM_004834chr273438 2945 2421 1047 842 473 360 33277 3232 1230 ----
NM_004836chr22301 27 --1841 --
NM_004850chr211450 --21541 496 --
NM_004855chr15121 1179 ----
NM_004857chr1464172 3529 3482 3469 3194 1287 24803 239 24353 397 --
NM_004859chr1782860 2688 2533 2292 1176 1141 1089 346 22765 921 ----
NM_004866chr564687 3384 943 849 327 174 11573 24563 4190 --
NM_004869chr1821132 187 11223 ----
NM_004871chr1744022 3785 3123 128 --12867 1198
NM_004873chr1442518 708 651 361 23110 918 ----
NM_004898chr432376 1081 227 12122 1663 --
NM_004902chr201151 ------
NM_004904chr7106533 6224 5562 2598 2396 2058 1796 1123 995 549 25215 4864 ----
NM_004926chr141107 ----1183
NM_004929chr831128 1087 522 21156 254 ----
NM_004946chr54496 411 362 169 ------
NM_004949chr1871711 1638 1481 589 221 187 70 ------
NM_004965chr213505 478 277 ------
NM_004966chr104812 772 222 174 ------
NM_004972chr94890 449 396 253 ------
NM_004985chr12114246 3873 3602 3437 3298 1359 1344 1167 812 701 217 ------
NM_004999chr663711 3630 3239 1170 1111 632 13529 14201 1668
NM_005028chr1032305 2176 1831 --1625 --
NM_005036chr2253226 2994 962 428 47 --21184 1050 17185
NM_005045chr73774 359 286 1349 ----
NM_005056chr1273778 2241 2231 2010 1605 1293 565 1551 ----
NM_005079chr862283 1186 965 929 769 671 ------
NM_005086chr1241670 580 239 186 135 ----
NM_005095chr131556 1505 626 --11828 --
NM_005116chr2074263 4212 3593 3559 3358 1459 1250 14272 14479 --
NM_005121chr1773750 3086 2774 1049 931 831 232 23218 1417 12611 --
NM_005124chr621015 32 1701 ----
NM_005134chr181368 ------
NM_005135chr1563512 2470 1042 796 398 276 1692 ----
NM_005151chr1862175 1930 1565 856 827 439 ------
NM_005154chr154455 174 168 160 --1135 --
NM_005156chr975358 5030 4987 4917 3974 786 743 14900 11010 --
NM_005160chr2265234 5059 4857 4761 1915 1312 56471 6246 5697 5567 1563 ----
NM_005166chr19----1326 --
NM_005171chr1221233 1163 ------
NM_005180chr1011201 --1347 187
NM_005188chr1177895 6135 5615 2751 2036 1353 803 27157 455 1811 17036
NM_005197chr1486150 5740 5724 5647 5165 4652 1758 234 25531 4774 ----
NM_005214chr211058 ----1711
NM_005235chr2136947 6526 6382 6068 5664 2897 2843 2512 906 831 558 488 108 36880 5492 501 --17529
NM_005238chr1122323 277 1859 11150 --
NM_005239chr2141949 1626 511 498 1604 ----
NM_005243chr221232 ------
NM_005259chr231291 1193 550 1539 1573 --
NM_005264chr102775 367 1930 1809 --
NM_005274chr11147 1104 ----
NM_005277chr491785 1732 1439 1348 1226 746 626 339 159 --1281 --
NM_005324chr1731884 360 206 --1809 --
NM_005339chr461623 1141 896 644 416 309 32918 2817 1042 ----
NM_005349chr4154 ------
NM_005359chr1875719 5526 4948 4894 4157 3984 148 --15495 --
NM_005387chr11------154
NM_005398chr1031398 1325 245 ------
NM_005400chr273087 2623 2211 1186 983 783 694 22403 837 ----
NM_005402chr761781 1645 1310 1206 96 40 --21719 656 --
NM_005417chr2051868 1846 1630 1552 1469 ------
NM_005436chr1093926 3014 2978 2938 2710 1541 1423 1191 545 21135 1041 42827 2782 2775 749 --
NM_005440chr1732036 528 214 13052 11031 --
NM_005455chr141724 1334 1228 542 ----1751
NM_005458chr931535 696 253 21855 689 ----
NM_005460chr52590 555 ------
NM_005475chr1273122 3107 2787 2479 2446 2341 421 13164 33070 652 352 --
NM_005493chr61600 ------
NM_005494chr7160 2467 453 ----
NM_005502chr952925 2858 2592 2384 670 22324 464 2924 625 1958
NM_005509chr531645 367 164 1228 ----
NM_005530chr1541311 448 345 136 1439 ----
NM_005539chr1021006 274 ------
NM_005542chr71402 ------
NM_005578chr363169 1680 1030 920 866 677 23387 835 11544 --
NM_005584chr135728 544 297 272 80 1132 1658 --
NM_005585chr15----1421 --
NM_005587chr152709 640 ------
NM_005593chr123479 243 188 1228 --146
NM_005596chr996375 5413 5240 5005 4755 4051 2429 2088 868 12448 ----
NM_005602chr3--11201 --11129
NM_005614chr7----11055 --
NM_005638chrX41492 1120 613 87 21499 1107 1399 --
NM_005639chr1251507 1458 1401 682 499 11583 --1112
NM_005644chr11125 ------
NM_005655chr831224 1191 1081 1287 ----
NM_005665chr1114891 4666 4428 3742 3558 1906 1418 1341 1222 1133 252 34821 4571 1323 11072 --
NM_005668chr574367 4303 4181 1516 1461 1194 293 --14094 --
NM_005717chr11452 --1355 --
NM_005721chr24845 805 781 116 --1774 --
NM_005722chr232467 838 379 1333 ----
NM_005725chr131931 744 80 ------
NM_005735chr22836 188 ------
NM_005739chr1552264 1723 939 416 288 2760 552 ----
NM_005746chr772725 2388 2280 1088 778 529 418 138 ----
NM_005748chr1231363 564 195 1356 --22126 300
NM_005779chr573587 3200 2670 2508 1393 1344 1090 --1749 13577
NM_005780chr132649 118 ------
NM_005797chr1121309 485 1637 ----
NM_005798chr1355257 5178 4789 4032 290 --33974 3545 1787 --
NM_005807chr14585 577 534 56 ------
NM_005808chr323169 610 ----23403 2495
NM_005813chr24517 506 382 132 1279 1824 --
NM_005822chr652312 2287 1987 1978 315 --12226 1954
NM_005828chr1734888 465 410 ------
NM_005832chr32981 111 ----11113
NM_005836chr8263 36 ------
NM_005840chrX135925 5322 5256 4976 2571 2112 1367 1265 959 946 803 337 295 27013 5042 36447 2500 686 --
NM_005843chr221271 711 ------
NM_005859chr541035 578 283 175 1475 21101 461 --
NM_005862chr321031 418 11002 ----
NM_005868chr731701 1538 527 2723 161 12251 --
NM_005875chr31329 ------
NM_005877chr226943 818 629 479 393 337 22002 637 ----
NM_005885chr53586 422 182 31485 1409 1194 ----
NM_005891chr63189 156 44 ------
NM_005898chr1172862 2652 1173 932 779 631 401 1572 ----
NM_005901chr18188697 8659 8079 7174 6885 6700 6534 6476 5959 5552 5450 5258 2405 2281 2161 1982 918 780 37765 7462 3315 11976 12216
NM_005903chr555111 4797 3360 955 294 24694 609 ----
NM_005907chr621539 1107 --11381 --
NM_005910chr1744101 3939 3539 3406 ------
NM_005911chr221291 1204 1572 ----
NM_005924chr71965 --1800 --
NM_005935chr463400 3316 2083 847 588 431 24547 1345 ----
NM_005941chr873926 3622 3517 1668 1588 1536 990 54149 4098 3450 1000 701 --13395
NM_005943chr611367 ------
NM_005966chr261833 905 623 593 365 53 ------
NM_005967chr121497 ------
NM_005986chr1362788 2013 1908 1010 875 821 --1206 --
NM_006007chr944109 3448 3395 818 1732 ----
NM_006015chr11947 ------
NM_006016chr621981 274 ----11901
NM_006017chr43796 768 700 --1845 1370
NM_006037chr243482 1810 1449 352 1390 13953 13452
NM_006041chr171173 ------
NM_006055chr252814 2634 2325 1179 733 ------
NM_006060chr7----23051 2896 23537 1204
NM_006070chr32401 343 ------
NM_006073chr662241 2191 2005 1928 1841 1399 31386 879 326 ----
NM_006080chr731886 205 175 --22062 193 --
NM_006089chrX3327 237 50 ------
NM_006095chr474020 3457 3436 1397 982 790 187 21724 1054 ----
NM_006106chr1153435 3143 951 666 456 ----198
NM_006113chr162097 1984 1924 1322 772 181 1361 12033 --
NM_006141chr1632604 2565 312 ----1914
NM_006157chr11------1356
NM_006166chr1231620 639 496 12294 ----
NM_006180chr962021 1841 418 366 121 112 ------
NM_006183chr122592 146 ------
NM_006195chr91236 ------
NM_006203chr5135391 3923 2056 1508 1497 1397 1204 1180 1127 976 437 253 228 14306 15494 --
NM_006206chr452348 795 705 662 627 ------
NM_006216chr21278 ------
NM_006224chr1742557 1955 1857 636 --22167 587 --
NM_006226chr221392 1294 --1878 11084
NM_006241chr31465 --1976 --
NM_006251chr553235 3054 2631 2274 166 --23028 913 --
NM_006252chr1116414 6103 5874 4694 2986 2848 2056 1403 537 435 165 35487 4832 296 ----
NM_006264chr41217 ------
NM_006265chr861545 1160 1086 455 380 252 ------
NM_006275chr2082225 2163 1560 995 745 681 629 240 --1808 --
NM_006282chr2064543 4254 3763 3754 3617 1318 ------
NM_006283chr874956 4443 4269 1724 1271 1151 219 21040 913 ----
NM_006287chr242629 886 785 22 12159 --12073
NM_006296chr21133 ------
NM_006298chr662763 2247 1341 1006 614 553 1760 23046 1159 --
NM_006300chr1961800 1616 401 226 101 53 42211 2120 679 440 ----
NM_006310chr1731212 1104 303 11027 ----
NM_006313chr123603 366 183 1202 ----
NM_006320chr41441 1738 ----
NM_006330chr831629 638 524 3488 281 134 ----
NM_006346chr132137 126 ------
NM_006358chr2221053 402 --1465 --
NM_006363chr203100 90 71 ------
NM_006367chr131107 393 356 ------
NM_006372chr61125 ------
NM_006375chrX11833 1496 --1623
NM_006379chr731657 1651 35 11790 1180 --
NM_006380chr17114406 4193 4166 3951 3755 1522 1005 989 700 494 382 31204 1147 484 ----
NM_006389chr11164 ------
NM_006393chr1084560 4528 3927 2906 2764 1817 1641 973 43433 3389 1728 799 ----
NM_006401chr91377 ------
NM_006410chr11138 1534 ----
NM_006416chr6------1175
NM_006420chr2063438 2969 2627 841 703 299 1210 ----
NM_006434chr1033095 2234 459 32880 946 94 ----
NM_006447chr21198 ------
NM_006449chr23815 406 363 --11784 --
NM_006451chr52880 147 --1845 11021
NM_006457chr424110 3821 13072 1440 --
NM_006460chr172289 60 2385 103 --11396
NM_006469chr131564 104 27 ------
NM_006482chr1283790 3066 2810 1291 1146 815 609 271 22652 882 13106 --
NM_006489chr1441812 1513 793 351 11304 ----
NM_006495chr172426 180 169 ----
NM_006504chr1031188 409 232 --12666 1346
NM_006516chr131280 184 91 ------
NM_006517chrX41872 563 382 128 11435 1732 --
NM_006520chrX61489 1173 520 364 295 225 --21316 432 11323
NM_006529chr421623 1501 ------
NM_006536chr1284 70 1763 ----
NM_006544chr14196084 6015 5964 5663 5615 5368 5175 4831 4754 4700 4396 4335 4179 3895 1989 1792 879 583 523 2356 105 ----
NM_006547chr741748 694 680 198 2775 583 2496 490 --
NM_006548chr321789 57 ----1328
NM_006555chr71390 ------
NM_006561chr1096007 5592 4709 4571 1776 1190 1153 451 81 34311 2375 872 23948 2097 --
NM_006565chr1621300 1282 ------
NM_006591chr1111413 11811 ----
NM_006595chr111489 ------
NM_006599chr16127297 6680 5798 3255 2850 2498 1087 965 547 540 216 192 57434 6746 6025 1317 590 ----
NM_006601chr122865 340 2754 330 1429 --
NM_006609chr262895 2871 2658 2567 2081 997 ----1354
NM_006614chr352764 1039 970 795 536 ------
NM_006620chr684668 4473 1359 1194 1172 978 700 626 21128 652 ----
NM_006621chr121679 312 ------
NM_006624chr1052137 2109 1844 344 199 21486 538 1749 --
NM_006626chr942413 865 814 152 22539 677 ----
NM_006628chr15114326 3288 2876 1432 947 623 604 539 276 178 106 23182 1261 14502 --
NM_006629chr1852618 2400 2300 929 917 ----11984
NM_006646chr1373055 2757 2368 2264 766 173 97 --1920 --
NM_006654chr1264643 3975 3172 1162 450 378 33570 3461 304 ----
NM_006660chr151269 ------
NM_006667chrX41022 234 144 131 1223 ----
NM_006691chr1141154 1059 465 261 11095 ----
NM_006717chr943050 2093 1060 538 --11205 --
NM_006729chrX105354 4499 3805 1779 1767 1231 1198 632 485 153 --14317 --
NM_006731chr9105412 5035 4989 4537 3883 2278 1874 1699 1088 932 34439 4409 2094 24034 1486 15387
NM_006734chr641398 1263 476 161 ------
NM_006745chr41128 --165 --
NM_006750chr1696913 6892 6776 6163 6106 2738 2612 2602 2329 48012 6239 5226 1425 1197 --
NM_006751chr25971 897 426 135 118 1230 1247 --
NM_006754chr72306 86 --1490 --
NM_006759chr21272 ------
NM_006761chr172868 244 ------
NM_006766chr852662 2641 867 796 63 32697 1740 927 ----
NM_006777chrX42788 1835 399 369 ------
NM_006790chr5191 --1397 --
NM_006791chr151567 ------
NM_006805chr531424 1090 293 11212 1544 --
NM_006823chr841296 1265 1249 1197 ------
NM_006827chr1443409 2833 1165 554 ----13157
NM_006828chr61186 ------
NM_006838chr1251901 1485 689 112 95 ------
NM_006868chr1863210 2966 2725 2301 950 787 23192 839 ----
NM_006873chr243068 2683 2470 2391 1766 13564 --
NM_006874chr45832 805 470 196 48 --2942 311 --
NM_006884chr341700 1441 729 377 ------
NM_006885chr1674112 3422 3248 2724 2715 999 963 23557 372 ----
NM_006892chr2011184 --1231 --
NM_006892chr2011184 --1231 --
NM_006895chr262077 1956 1701 1557 1380 331 1237 1708 --
NM_006908chr731197 1091 535 ------
NM_006915chrX42410 612 545 335 32147 696 69 ----
NM_006918chr11145729 5324 4926 4891 4495 4240 3832 3640 2109 1531 1009 651 386 254 14046 24487 2247 --
NM_006920chr232064 1296 320 11334 1233 --
NM_006922chr262379 2105 1783 781 666 111 --21840 227 --
NM_006924chr1753864 2958 2902 1149 1002 14347 21368 150 --
NM_006925chr141483 ------
NM_006930chr581887 1677 1477 720 271 219 37 28 11750 1712 --
NM_006937chr171367 ------
NM_006939chr1441179 789 481 26 1827 ----
NM_006948chr2162388 2368 1530 418 312 212 ------
NM_006955chr1062926 2882 2699 2353 418 224 --12392 --
NM_006981chr982985 2925 2216 1919 720 704 530 281 --22317 41 12752
NM_006996chr12444 156 11330 1135 --
NM_007005chr941446 315 245 43 ------
NM_007007chr1284598 4421 4289 4132 1743 1581 1262 1085 33898 1428 815 1903 --
NM_007010chr173760 432 356 11603 11525 --
NM_007017chr55762 696 665 596 198 ------
NM_007026chr171208 ------
NM_007027chr31444 ------
NM_007030chr5125192 4929 4152 4060 3895 3860 3825 3755 3720 3685 3650 1838 --1429 1231
NM_007033chr121643 57 22257 650 ----
NM_007034chr11853 ------
NM_007035chr124797 708 283 48 ------
NM_007038chr2145314 4628 3943 3852 24591 363 34917 4786 4074 185
NM_007040chr1931108 1021 1010 ------
NM_007042chr31297 22126 1850 12250 --
NM_007050chr2088065 8052 7710 6206 5615 5416 2059 1811 22931 1669 --15912
NM_007054chr573841 3525 3296 1436 611 582 180 --31262 515 476 --
NM_007064chr321156 514 11657 ----
NM_007106chr1362733 2240 2234 2028 334 273 1229 22698 2528 --
NM_007107chr332200 2073 1538 22020 493 ----
NM_007115chr2184 ------
NM_007118chr51867 ------
NM_007124chr632034 1310 333 1273 ----
NM_007137chrX65562 5545 4614 4043 1804 44 15360 ----
NM_007146chr1752720 818 779 367 229 --12872 --
NM_007159chr321567 315 ----11739
NM_007166chr1151482 1446 1190 574 280 ------
NM_007172chr2232821 2347 2305 31319 1023 921 22043 1146 --
NM_007195chr1843499 3299 2710 90 ------
NM_007197chr122697 410 ------
NM_007207chr12208 151 1263 ----
NM_007217chr33358 315 275 ------
NM_007220chrX94893 3937 3794 1560 1131 603 483 450 403 ------
NM_007222chr831193 359 274 1255 ----
NM_007246chr44952 835 671 661 1712 181 --
NM_007249chr1398504 8318 7301 7155 6772 5763 3722 2487 2165 46762 2566 2533 91 15851 --
NM_007282chr34862 748 360 189 ------
NM_007285chr161489 ------
NM_007292chr17104003 3190 2013 1861 1591 1466 1300 963 594 191 45229 3267 900 882 ----
NM_007324chr11100 ------
NM_007347chr1552563 1293 1187 527 320 31163 934 519 11134 --
NM_007350chr1234380 3687 2957 24099 3849 2655 507 --
NM_007374chr141392 ------
NM_007375chr192834 2660 2534 2494 2486 2458 2141 2064 482 ------
NM_012072chr2084576 4495 3820 3253 1692 1652 850 651 23720 1071 --13740
NM_012089chr131390 517 218 ------
NM_012096chr373703 3485 1298 1289 1229 480 214 ------
NM_012097chr251963 1702 1651 794 769 1526 ----
NM_012102chr121924 1043 22572 478 --1370
NM_012104chr1153209 2724 2352 1534 1279 23843 848 21324 512 --
NM_012104chr1153209 2724 2352 1534 1279 23843 848 21324 512 --
NM_012118chr41297 ------
NM_012120chr642122 1875 1163 1077 12396 12787 --
NM_012124chr113706 125 48 ------
NM_012141chr1363858 3003 1618 1314 228 91 13147 --12943
NM_012158chr1351580 1429 1195 324 21 1603 ----
NM_012164chr977367 6916 6856 6167 5813 2360 1345 37380 6981 1289 ----
NM_012193chr1164934 1912 1423 826 371 110 1513 ----
NM_012197chr941621 1253 1200 194 --21387 1262 --
NM_012214chr256442 5724 5625 4819 4202 --23922 1352 24943 271
NM_012234chr3113634 3508 3468 2999 2900 2563 1489 1244 785 230 192 ------
NM_012242chr104847 564 333 127 ------
NM_012249chr243216 3089 2872 2716 13107 ----
NM_012250chr112997 898 ----1160
NM_012252chr785188 5167 5041 4795 4324 1684 1568 1486 15318 ----
NM_012257chr71725 ------
NM_012262chr1105177 5021 4666 4530 4406 1930 1455 1310 617 87 11428 34811 1230 678 --
NM_012281chr741939 1927 1657 975 2943 305 ----
NM_012286chrX----1556 --
NM_012287chr333297 2919 996 12966 11686 --
NM_012290chr231111 369 333 ----1431
NM_012294chr743876 3746 1015 567 22837 639 --1844
NM_012297chr472444 2338 2038 1772 1051 630 501 2910 92 ----
NM_012300chr521615 721 ----1843
NM_012302chr131241 1222 443 ------
NM_012309chr1154674 3244 3216 1819 1212 --1247 --
NM_012316chr155452 4726 3590 3515 521 --24958 4560 --
NM_012325chr2031488 449 212 ------
NM_012329chr1751665 1648 1526 1221 461 ------
NM_012338chr73938 425 116 ----1404
NM_012343chr53955 807 28 ----1393
NM_012382chr554369 3783 3268 2864 1431 --11246 --
NM_012384chr201267 ----11740
NM_012395chr753422 3245 2574 2147 1214 33334 3310 2536 ----
NM_012417chr17--1419 1456 --
NM_012420chr1062331 2324 2244 1735 490 104 ------
NM_012431chr743489 3123 2986 2781 2630 112 ----
NM_012479chr751723 671 621 574 489 ------
NM_013229chr1232548 346 213 ------
NM_013231chr1473900 3364 3075 1306 1185 878 606 --13389 --
NM_013235chr51864 --1844 --
NM_013255chr7198606 7143 6732 6715 6269 6062 5374 3328 3128 2931 2852 2492 1794 1577 1074 511 370 208 78 57886 6380 6342 2629 1766 12539 --
NM_013257chr841852 550 379 346 1533 1319 1370
NM_013261chr453776 3607 2892 736 555 12513 2886 850 11253
NM_013269chr1253246 794 734 185 126 --13321 23911 2976
NM_013281chr2021182 1082 ------
NM_013296chr14340 316 158 85 194 ----
NM_013330chr11191 ------
NM_013372chr1553402 2974 1311 1146 781 --21031 861 12850
NM_013377chr122534 498 3555 519 424 ----
NM_013386chr121609 1285 ------
NM_013396chr2161163 982 616 592 564 481 1536 ----
NM_013411chr132610 2428 1135 --12228 12823
NM_013444chrX31018 884 132 ------
NM_013449chr121379 ------
NM_013943chr172797 2386 2061 1257 656 536 60 1959 22487 663 --
NM_013958chr83178 123 87 ------
NM_013959chr83178 123 87 ------
NM_013961chr83178 123 87 ------
NM_013962chr83178 123 87 ------
NM_013986chr221232 ------
NM_014016chr331628 1453 1257 ------
NM_014021chr163211 2882 2518 403 303 93 22258 652 1720 --
NM_014028chr653316 3235 2463 557 179 --1365 1329
NM_014043chr331493 1375 596 1613 11337 11265
NM_014048chr16114834 4476 4440 3860 3771 3330 2061 1691 1488 799 718 24848 203 13228 --
NM_014055chr121390 --1499 --
NM_014057chr951432 1384 1108 1020 45 ----21589 621
NM_014058chr42753 30 1252 ----
NM_014106chr1522154 1057 22404 164 ----
NM_014112chr873669 1814 1723 1532 1182 1078 264 13697 ----
NM_014141chr775292 4184 3242 1955 1309 1032 734 45220 1346 1023 234 ----
NM_014153chr161498 ------
NM_014154chr341049 1008 502 24 --3531 275 241 --
NM_014155chr1176972 6042 2464 2379 1879 571 479 32924 2815 2670 15228 26574 5013
NM_014160chr32523 266 11385 ----
NM_014171chr22273 88 ------
NM_014182chr121516 ------
NM_014191chr121944 1149 1878 1959
NM_014211chr561598 1584 1428 565 450 185 ------
NM_014243chr452160 1802 1359 659 381 ------
NM_014253chrX32479 2383 2055 1230 ----
NM_014265chr82758 121 ------
NM_014271chrX1682 ------
NM_014283chr121339 1302 11038 11263 --
NM_014290chr92167 152 ------
NM_014309chr2274840 4087 3611 3340 1330 860 796 --14782 --
NM_014315chr141182 ------
NM_014331chr4106615 6112 5303 5217 3050 2904 2061 2040 831 316 57311 6884 2865 1124 768 17470 --
NM_014368chr951747 1741 1530 598 431 ------
NM_014372chr142013 1497 455 289 12117 11444 --
NM_014379chr81945 1221 1326 1191
NM_014382chr331426 1325 308 11101 --1400
NM_014415chr331481 468 242 ------
NM_014423chr585244 4822 4107 4072 3650 883 713 447 176 --13999
NM_014447chr44302 286 155 58 11513 ----
NM_014491chr7----1701 --
NM_014494chr1611470 ------
NM_014548chr153602 149 123 1504 21604 1246 --
NM_014575chr31511 ------
NM_014584chr1451529 1099 1075 207 186 ------
NM_014607chr262082 1826 1455 1442 561 316 ----1700
NM_014613chr563098 2747 2681 1030 958 560 1126 ----
NM_014614chr231511 1186 242 1362 11214 --
NM_014615chr1683631 3109 2859 2572 2392 2261 1176 330 --12976 13056
NM_014616chr322951 739 43127 2773 853 643 ----
NM_014629chr84909 521 500 416 ----11195
NM_014630chr1534006 2440 756 33564 3375 3095 --1466
NM_014637chr861377 1252 1105 335 231 220 1489 ----
NM_014655chr132297 1815 677 ------
NM_014666chr521338 289 ------
NM_014670chr221438 512 11119 ----
NM_014676chr151597 1510 531 352 197 11472 ----
NM_014679chr111995 ------
NM_014682chr811964 ------
NM_014686chr1931023 1001 564 --190 --
NM_014701chr1553473 3451 3440 3021 602 13044 ----
NM_014702chr683285 2570 2186 1226 1051 946 633 394 --1571 --
NM_014705chr721778 1604 --1655 1411
NM_014709chr21516 ------
NM_014721chr6147265 6813 6470 6028 5938 5801 5617 4613 2993 2769 1810 1137 953 696 26104 2726 --14992
NM_014739chr673940 3209 2990 1651 1630 1547 536 --11426 13033
NM_014743chr463050 2962 2859 2380 2263 353 ------
NM_014746chr2----24227 1580 --
NM_014751chr832041 1574 176 11517 ----
NM_014752chr1151872 1608 1602 744 296 ----1166
NM_014755chr273361 3300 3254 3124 2975 2699 60 1192 23110 2664 --
NM_014765chr12647 532 12636 --12216
NM_014774chr131068 52 37 13257 --11259
NM_014787chr162388 2321 551 520 331 99 ------
NM_014800chr731151 819 51 --11042 --
NM_014810chr142696 2302 1141 584 13105 1258 --
NM_014811chr91158 --1728 --
NM_014824chr115723 674 607 571 275 2587 224 --11679
NM_014826chr144147 850 264 181 12933 ----
NM_014830chr1263783 3619 3029 1097 892 374 1157 ----
NM_014835chr2042278 869 560 103 --11475 12218
NM_014839chr142180 2105 1992 207 ------
NM_014850chr354476 4264 3564 1952 1927 21302 946 1264 --
NM_014862chr1534149 3991 766 --1775 --
NM_014872chr932146 660 127 11905 2580 143 1918
NM_014873chr124091 197 ------
NM_014877chr17106299 5802 5079 4987 2864 2628 1557 1342 540 276 17255 27516 2482 --
NM_014887chr133777 703 215 ----123
NM_014890chr31315 ------
NM_014897chr1732972 1044 888 ----1546
NM_014900chr22932 98 ------
NM_014901chr532297 2190 2054 12140 ----
NM_014903chr122853 711 22261 927 ----
NM_014904chr1083903 3607 3262 3221 934 890 850 733 --11481 13759
NM_014906chr1753932 3149 2745 1433 1104 1638 --13811
NM_014912chr1082893 2721 2463 2290 2177 725 717 450 12861 --11300
NM_014917chr12977 816 ----176
NM_014918chr151381 11497 ----
NM_014923chr132257 97 1118 1411 --
NM_014924chr1423225 2901 --21199 383 --
NM_014926chr341156 1000 906 863 ------
NM_014934chr1343768 3324 2513 243 12655 ----
NM_014936chr672890 2680 380 251 223 184 175 32805 2535 1881 12383 --
NM_014942chr622082 647 --11882 11765
NM_014949chr15345 281 243 157 69 ------
NM_014950chr1461766 1255 1152 554 224 115 ------
NM_014951chr1031988 1768 796 22264 126 11783 12010
NM_014961chr441925 835 812 360 1702 ----
NM_014962chr2052607 2477 2408 1010 209 --12146 --
NM_014964chr1741522 1508 672 654 ------
NM_014982chr1434778 4268 1696 --14828 --
NM_014988chr432648 899 69 1154 ----
NM_014989chr642019 1721 550 243 11761 ----
NM_014991chr452322 2020 1000 529 476 33236 2961 1073 12683 --
NM_014999chr1241359 541 140 115 11681 ----
NM_015000chr1282997 1170 809 765 680 655 398 334 ----12678
NM_015002chr1242120 1830 589 545 1652 ----
NM_015008chr383560 3537 3409 2738 2276 1315 825 791 --1388 13336
NM_015009chr31214 1534 ----
NM_015026chr12114146 3965 3519 3098 2995 1853 961 825 477 445 242 2806 600 13106 --
NM_015032chr1362534 2475 2400 1857 332 189 22004 1174 ----
NM_015040chr263421 3167 2591 2519 2146 378 33113 2535 2256 ----
NM_015045chr1021866 236 ------
NM_015049chr242725 2541 2497 305 21303 39 13041 --
NM_015059chr1532497 1547 1044 22453 722 ----
NM_015064chr1283375 3149 2766 1062 801 718 673 107 ------
NM_015068chr753960 2478 1425 1154 373 33108 930 788 ----
NM_015071chr575760 5451 5325 4989 2412 1295 827 36270 778 760 ----
NM_015076chr664180 4099 1735 1714 1474 580 13054 ----
NM_015079chr1563236 2897 2867 2617 2407 57 --12304 11275
NM_015090chr144730 4614 4317 1139 25408 4160 --16151
NM_015091chr141582 ------
NM_015092chr1684651 4287 3927 1111 918 782 768 477 23249 1346 23119 1606 13850
NM_015093chr62294 158 ------
NM_015097chr341624 1493 377 225 ------
NM_015099chr17152 1598 ----
NM_015106chr31166 ------
NM_015115chr432817 607 550 ------
NM_015116chr1331490 1065 519 11673 1481 --
NM_015132chr761955 1923 1559 1366 803 389 1130 ----
NM_015137chr852498 2465 2355 1826 1042 192 ----
NM_015144chr1643584 2827 1341 469 23012 2851 1412 --
NM_015154chr1583439 2854 2542 2511 1116 859 219 207 22162 1011 ----
NM_015155chr1042758 1233 761 284 1198 ----
NM_015156chr1453944 1284 987 512 493 22945 2486 --11373
NM_015170chr831794 1483 851 ------
NM_015172chr141644 1531 543 215 31590 1385 353 --1159
NM_015176chr131739 1488 1277 1364 ----
NM_015180chr141620 ------
NM_015184chr31195 ------
NM_015186chr9142 ------
NM_015192chr2073048 2709 2352 2322 2114 577 409 ------
NM_015199chr332912 2849 2053 12348 ----
NM_015200chr422169 289 1334 1398 --
NM_015205chr1365067 4963 4575 2042 2004 76 25044 4523 15129 --
NM_015206chr1563781 2473 1541 1320 981 754 1374 ----
NM_015208chr1863211 2694 1529 1371 292 200 --13896 --
NM_015209chr152254 1776 1729 1722 154 ------
NM_015213chr111646 ------
NM_015215chr152923 2418 1105 422 175 1856 ----
NM_015216chr51520 ------
NM_015236chr431475 1342 323 --140 --
NM_015239chr91388 ------
NM_015245chr63312 277 216 ------
NM_015247chr16104889 4346 4299 2101 1616 1363 736 411 251 47 ------
NM_015252chr23895 220 94 1627 ----
NM_015265chr221801 709 12577 ----
NM_015269chr11159 ------
NM_015271chr484093 3527 3284 3266 3253 3231 2833 317 --13201 --
NM_015275chr1252069 1949 1907 688 419 ------
NM_015278chr653201 3028 2836 737 577 --11113 --
NM_015285chr1842429 2195 1933 1011 12215 1420 --
NM_015286chr152850 406 1767 21530 425 11864
NM_015296chr134874 481 355 271 1825 ----
NM_015299chr1431262 950 778 21354 238 11072 --
NM_015310chr8157939 7458 7355 6301 5115 2330 2299 2273 2255 2224 1675 1489 1001 992 557 27128 6504 ----
NM_015313chr1174601 4147 4098 3687 3150 1876 1702 ------
NM_015314chr762369 1802 1617 879 569 70 ------
NM_015315chr533363 2475 1228 13472 13156 --
NM_015317chr242835 2505 741 487 2644 409 1616 --
NM_015328chr783144 3030 2450 2423 996 631 522 445 ------
NM_015336chr1252185 1020 769 577 159 2997 747 ----
NM_015340chr311267 ------
NM_015345chr632799 2503 388 --11021 11827
NM_015347chr1252255 2030 1158 374 299 --11884 12310
NM_015350chr11495 ------
NM_015361chr22723 85 ------
NM_015375chr194591 4542 4210 4081 3960 3924 3891 3677 1182 11325 14639 11362
NM_015378chr11295 ------
NM_015381chr2211612 ------
NM_015385chr1033095 2234 459 32880 946 94 ----
NM_015387chr242088 1323 563 40 1600 ----
NM_015393chr443409 2842 1525 516 12702 12576 --
NM_015423chr1111716 2598 474 11554 1516
NM_015436chr482652 2644 2429 1135 1103 1044 515 325 12047 ----
NM_015455chr573982 3686 3046 1649 1029 344 164 ------
NM_015458chr875351 5095 1870 1429 1260 542 478 11798 34775 3998 977 --
NM_015464chr72982 917 --11024 --
NM_015483chr741100 1040 761 449 --21066 270 --
NM_015526chr1981242 559 473 379 275 223 156 42 199 153 --
NM_015535chr244229 502 425 148 ----14035
NM_015541chr331421 1200 285 1381 ----
NM_015548chr63688 310 223 --1234 --
NM_015550chr763634 3239 2869 2600 295 24 11199 ----
NM_015553chr664936 4424 3896 1910 1716 1430 24548 191 ----
NM_015555chr641782 1169 468 235 --11829 --
NM_015564chr583498 3347 1109 1097 919 910 797 628 11173 --23528 3183
NM_015568chr2054127 3563 2914 1053 585 23615 340 --1217
NM_015569chr144868 3374 1391 826 23405 3343 23787 3047 --
NM_015570chr741538 1374 1315 501 21327 489 ----
NM_015571chr621855 1653 11006 ----
NM_015576chr342563 2391 769 358 32414 1901 1891 12441 12248
NM_015578chr1951936 1582 1345 791 291 ------
NM_015601chr102863 223 --1265 1669
NM_015622chr71266 ------
NM_015635chr932231 563 161 1692 ----
NM_015646chr1231313 1056 326 1529 ----
NM_015713chr863612 2253 1447 1041 437 171 22711 1020 12877 --
NM_015874chr4154 ------
NM_015878chr851750 1546 809 800 607 ------
NM_015879chr18128328 8172 7620 5914 5865 5718 5679 2897 1999 1203 856 249 27982 1829 17184 26598 6264
NM_015885chr111683 ------
NM_015886chr8145281 4931 4675 4486 4458 4319 3881 1991 992 754 547 518 412 154 34727 1571 504 13720 13475
NM_015888chr173277 2526 2093 1094 726 577 360 13218 ----
NM_015906chr143816 3703 3680 1765 34726 3602 3053 ----
NM_015913chr12748 160 ----1276
NM_015955chr22518 118 ------
NM_016002chr1144 ------
NM_016009chr194227 4149 3876 3162 3090 1517 1363 309 244 54619 4007 1879 1355 1000 14480 --
NM_016018chr832170 2024 565 --12782 --
NM_016019chr72903 407 1209 ----
NM_016021chr662931 2909 2565 2125 294 172 12440 ----
NM_016023chr83720 524 133 134 ----
NM_016040chr172358 2031 1919 880 643 345 25 21117 591 ----
NM_016045chr2031630 1525 568 11385 ----
NM_016067chr44462 172 119 23 ------
NM_016072chr1222394 762 11487 12245 --
NM_016073chr152373 65 ------
NM_016076chr142298 2152 766 387 52466 2396 1160 816 615 ----
NM_016083chr693760 3716 3357 3317 2772 2614 2501 1489 637 --13657 --
NM_016096chr852024 1962 1808 86 27 165 11556 12146
NM_016107chr551205 1090 1018 955 410 11037 ----
NM_016126chr1134 ------
NM_016131chr252365 2089 1631 1575 356 ------
NM_016132chr1593026 2846 2664 2375 2221 1147 1067 545 134 11176 --12355
NM_016152chr341239 1114 1024 416 ------
NM_016206chr3128572 8230 7550 6786 6168 6032 3537 3259 2128 1925 1201 813 37731 6667 6410 ----
NM_016217chr653175 2776 2609 518 451 13261 13700 --
NM_016227chr121339 1302 11038 11263 --
NM_016231chr171121 ------
NM_016248chr1373865 3133 3015 2946 2549 428 96 --11143 --
NM_016252chr21359 ------
NM_016260chr2117656 7472 7053 6923 6834 6089 5083 4898 2954 1002 753 21794 796 16565 11935
NM_016262chr62556 161 1249 ----
NM_016264chr19----1202 --
NM_016271chr182538 405 41895 1847 1799 364 ----
NM_016275chr372503 1947 982 804 792 220 66 --22509 995 --
NM_016289chr262266 1482 1475 939 731 724 --1863 --
NM_016303chrX129 1422 ----
NM_016311chr1296 75 ------
NM_016312chr12----1219 1479
NM_016315chr241605 1191 756 550 11691 ----
NM_016322chr952455 916 902 681 640 22413 146 ----
NM_016356chr652191 1025 508 130 98 12582 ----
NM_016374chr121352 523 11214 ----
NM_016374chr121352 523 11214 ----
NM_016376chr1784357 3533 1734 1395 686 623 584 292 11055 23194 2676 --
NM_016395chr1591774 1658 1570 1440 583 568 340 237 142 ----1289
NM_016396chr1521081 780 22502 2447 ----
NM_016442chr532000 728 107 22382 2226 ----
NM_016447chr71188 ------
NM_016472chr141533 ------
NM_016480chr52768 703 134 --1656
NM_016516chr23877 689 231 2890 302 ----
NM_016522chr1121353 539 --11267 --
NM_016530chr1553745 3581 2981 957 170 23248 1448 23845 2941 13544
NM_016531chr474152 3522 3466 3248 2883 1436 1227 24225 1168 13351 2309 78
NM_016542chrX2209 69 11387 ----
NM_016603chr531986 1399 1393 ------
NM_016607chrX21712 1214 ----11047
NM_016620chr121096 431 11003 11315 --
NM_016622chr242144 2050 842 220 ----1851
NM_016628chr10164 ------
NM_016631chr211395 1109 ----
NM_016644chr52404 353 ------
NM_016653chr221002 448 ------
NM_016824chr102689 444 ------
NM_016834chr1744101 3939 3539 3406 ------
NM_016835chr1744101 3939 3539 3406 ------
NM_016841chr1744101 3939 3539 3406 ------
NM_016950chr431058 591 40 ------
NM_016953chr245828 4930 4862 4828 15617 35487 2169 103 --
NM_017412chr83537 364 95 --11395 --
NM_017420chr1443430 1068 869 573 22494 388 --21343 349
NM_017423chr441718 857 168 36 1366 ----
NM_017437chr1441812 944 666 217 193 ----
NM_017447chr2183772 3430 3411 3374 1577 1197 712 135 23824 555 1636 13868
NM_017457chr191141 ------
NM_017516chr11269 25 ------
NM_017558chr161303 ------
NM_017563chr386353 6267 6255 4827 4516 4091 424 237 ----11740
NM_017569chr131367 ------
NM_017577chr33476 148 126 31568 348 289 ----
NM_017593chr41192 ------
NM_017594chr953392 3121 2202 676 62 ------
NM_017599chr1221458 360 1796 ----
NM_017610chr1531713 837 551 ------
NM_017628chr464182 3743 3364 1530 1450 367 34001 3601 670 1421 --
NM_017633chr683866 3622 3220 2769 1169 979 738 558 32607 917 632 ----
NM_017634chr831475 196 95 ------
NM_017637chr998859 6770 6738 6480 6076 5998 5981 3174 1448 25938 984 13088 28666 6310
NM_017641chr1241099 741 156 43 ------
NM_017643chr172311 280 --22592 696 --
NM_017644chr335172 5098 481 --11649 --
NM_017650chr7116000 5649 5499 4366 3740 2425 2319 1800 1092 1038 220 1343 ----
NM_017658chr14124432 4397 3918 3715 3607 3508 3466 2925 2861 2854 1079 535 24095 3355 ----
NM_017664chr131277 --11047 --
NM_017666chrX52249 2025 1917 818 117 2209 199 --12019
NM_017672chr1511055 ------
NM_017693chr131472 --1635 --
NM_017694chr221448 139 1515 12004 1411
NM_017709chr142898 2684 953 293 33223 2960 1013 1271 --
NM_017736chr1692897 2486 2046 1145 979 788 527 505 157 ------
NM_017737chr151893 1764 1666 443 188 ------
NM_017739chr11120 ----1472
NM_017742chr1831979 1548 1467 128 ----
NM_017745chrX--166 --1692
NM_017762chr1552309 1683 130 90 60 ------
NM_017768chr13945 828 68 ------
NM_017770chr662609 2010 907 531 287 38 ------
NM_017779chr132468 1968 27 21906 232 --12217
NM_017831chr1861097 866 700 462 308 214 11538 ----
NM_017902chr1045657 3833 2198 530 25737 2167 --12081
NM_017919chr9125221 5070 4379 4363 4287 3983 2304 1946 1712 1409 1318 1254 44611 1856 1702 641 1710 --
NM_017938chrX31892 1700 1497 --11663 --
NM_017994chr742208 945 629 513 ----11028
NM_018015chrX3819 747 374 ------
NM_018028chr192154 116 ------
NM_018036chr1473326 3200 1549 954 172 140 61 --1328 --
NM_018046chr51173 1544 --11412
NM_018078chr41187 --1363 --
NM_018084chr2113320 3149 3126 3000 2608 2412 2040 1276 1212 145 101 --13302 --
NM_018094chrX----1393 --
NM_018105chr83860 199 88 1966 ----
NM_018133chr361953 1800 1455 1350 492 283 12134 ----
NM_018155chr353065 2209 1228 1179 591 23119 637 ----
NM_018156chr11295 ------
NM_018167chr141357 --1351 --
NM_018178chr131806 1695 1594 11576 11356 --
NM_018184chr321926 407 --1413 --
NM_018203chr1153 ------
NM_018227chr44818 476 195 89 --13026 --
NM_018243chr4103637 3158 3078 1418 1376 918 824 761 570 343 33399 3199 1001 --11507
NM_018247chr632554 961 882 32928 2568 471 ----
NM_018252chr14714 646 513 182 1734 ----
NM_018263chr262444 2436 1002 863 393 272 ------
NM_018264chr71939 ------
NM_018293chr342691 2605 724 671 ------
NM_018299chr882392 2155 1147 657 557 544 193 25 22271 2224 ----
NM_018312chr1132150 883 296 ------
NM_018313chr322627 983 --1995 --
NM_018315chr461517 1398 1268 1152 385 197 ------
NM_018325chr92604 421 ----11203
NM_018351chr1254227 3321 1675 1195 290 23006 1142 11830 14362
NM_018362chr1183999 3976 3101 1402 944 507 190 150 ------
NM_018364chr163726 3580 3277 3104 1174 562 34016 1346 1210 --13477
NM_018367chr112301 293 12205 12035 --
NM_018368chr6----174 --
NM_018370chr1251926 530 246 198 148 ------
NM_018373chr1445189 5103 2498 1199 ------
NM_018374chr754845 4456 3608 1610 78 35076 3580 3492 24218 586 --
NM_018375chr1451850 1641 1435 496 428 21741 1386 ----
NM_018387chr91147 2483 381 ----
NM_018403chr394146 4000 3730 3304 1369 1341 890 857 435 ------
NM_018409chr422549 2290 22897 2839 139 --
NM_018424chr931913 1904 524 ------
NM_018427chr163364 327 293 1306 ----
NM_018429chr552380 2135 962 802 377 31016 672 581 ----
NM_018439chr1832648 782 765 ------
NM_018440chr867528 5857 5305 3473 2258 1959 33489 2628 78 ----
NM_018442chr1----1139 --
NM_018452chr6_random53456 1196 860 732 363 23390 2624 ----
NM_018462chr32607 238 1695 --1716
NM_018482chr832097 1656 370 1700 1244 --
NM_018490chr111619 ------
NM_018566chr1114546 4070 3715 3151 1825 1604 1572 1201 1141 864 744 15008 43222 411 304 266 14838
NM_018569chr41502 21415 1379 ----
NM_018638chr1274525 4478 1891 1577 1386 1157 308 14849 ----
NM_018640chr1242581 2102 1012 747 2329 83 ----
NM_018691chr521252 817 ------
NM_018695chr511816 1982 12055 --
NM_018697chr762122 2043 1700 911 169 133 21741 451 --21963 69
NM_018698chrX71816 743 734 502 417 343 144 ----1265
NM_018700chr571652 1506 1327 1072 673 663 222 --1308 --
NM_018841chr163863 3800 2653 1073 734 101 1194 ----
NM_018847chr94520 384 196 156 41751 1503 593 184 146 --
NM_018890chr731197 1091 535 ------
NM_018898chr562389 1771 718 625 348 161 ------
NM_018899chr562389 1771 718 625 348 161 ------
NM_018900chr562389 1771 718 625 348 161 ------
NM_018901chr562389 1771 718 625 348 161 ------
NM_018902chr562389 1771 718 625 348 161 ------
NM_018903chr562389 1771 718 625 348 161 ------
NM_018904chr562389 1771 718 625 348 161 ------
NM_018905chr562389 1771 718 625 348 161 ------
NM_018906chr562389 1771 718 625 348 161 ------
NM_018907chr562389 1771 718 625 348 161 ------
NM_018908chr562389 1771 718 625 348 161 ------
NM_018909chr562389 1771 718 625 348 161 ------
NM_018910chr562389 1771 718 625 348 161 ------
NM_018911chr562389 1771 718 625 348 161 ------
NM_018940chr52981 420 1992 ----
NM_018947chr754896 3736 3080 1046 112 11408 ----
NM_018970chr762644 2151 2079 857 796 662 33162 3020 612 ----
NM_018979chr1242473 1654 1628 143 ------
NM_018981chr241283 952 285 42 ------
NM_018993chr2031481 1092 582 21472 1298 ----
NM_018999chr1074804 4770 4761 3947 3826 1671 124 11539 13844 1624
NM_019000chr531355 1109 392 11570 2438 170 --
NM_019001chr354779 3058 1956 872 794 11676 --13302
NM_019004chr73635 226 114 21467 445 ----
NM_019006chr151470 ------
NM_019022chr1862767 2696 1027 715 469 120 22918 968 1829 11152
NM_019027chr412283 --11898 --
NM_019040chr11385 60 40 ----1171
NM_019044chr264645 4275 3231 2931 283 213 23239 1333 ----
NM_019045chrX3875 338 198 ----182
NM_019050chr441907 1771 677 78 11686 ----
NM_019063chr231920 1477 215 11496 12097 --
NM_019072chr583483 3070 2886 1270 604 531 255 207 11080 23396 1018 12789
NM_019084chr1022140 187 2888 800 ----
NM_019114chr91482 --1978 184
NM_019556chrX2211 87 11479 --11037
NM_019590chr1021323 52 21097 89 ----
NM_019597chrX2650 197 ------
NM_019600chr153548 306 84 1589 ----
NM_019605chr12748 512 1547 ----
NM_019610chr142211 2034 1704 581 12202 ----
NM_019891chr131028 861 351 ------
NM_019903chr102689 444 ------
NM_020039chr1251946 1456 1310 1262 195 ------
NM_020119chr744059 3709 3032 2479 13069 ----
NM_020122chr2106006 5771 5606 5415 5097 4495 2117 2054 1050 189 --1262 --
NM_020132chr213959 127 121 --11973 --
NM_020147chr153741 709 176 21042 410 1439 --
NM_020148chr1852807 2703 1060 728 363 --1513 --
NM_020177chr583327 2845 2679 2641 2489 224 79 22 ------
NM_020178chr1721259 380 ------
NM_020192chr73151 130 55 ------
NM_020198chr1721378 637 21336 299 --11411
NM_020239chr142268 2247 2116 131 --22186 580 --
NM_020307chr31380 ------
NM_020336chr2073137 2373 2367 2347 947 573 526 23855 50 ----
NM_020338chr1033714 3605 3594 --12900 --
NM_020342chr232433 899 712 1479 ----
NM_020346chr111681 21464 405 11426 --
NM_020357chr321409 142 11565 11395 --
NM_020390chr384935 4859 4852 4153 3805 3770 1515 1468 14666 13857 --
NM_020403chr135554 485 132 105 24 21146 708 147 --
NM_020420chrY41613 1302 442 240 ------
NM_020424chr161568 1683 ----
NM_020432chr731818 1664 653 ------
NM_020440chr153002 2771 2600 1263 474 ------
NM_020443chr166493 5535 5175 5110 1019 789 22247 1997 ----
NM_020456chr1332204 264 255 ------
NM_020463chr241230 532 394 156 ------
NM_020466chr694642 3692 3549 1944 1410 782 234 156 63 --23716 1177 --
NM_020473chrX61782 1358 1285 518 360 284 ------
NM_020474chr1831915 1352 819 ------
NM_020528chr211125 ------
NM_020640chr331512 1417 455 ------
NM_020647chr852328 901 589 343 28 11614 ----
NM_020648chr1862863 2478 686 322 294 203 2620 405 ----
NM_020666chr53762 740 80 ------
NM_020673chr20197734 7577 7380 7045 6904 6730 6601 6127 5567 4864 4855 2352 1360 1303 763 592 344 323 55 47715 7428 7106 442 --12652
NM_020686chr1643045 2401 2199 1909 ------
NM_020711chr252493 1942 877 697 237 42291 2208 2071 829 11953 1790
NM_020714chr1954310 3353 3326 3288 164 ------
NM_020715chr1482241 2107 1894 1639 1511 868 774 93 ------
NM_020717chrX54356 4089 3310 911 151 --24776 1438 --
NM_020718chr1664646 2223 877 557 475 232 15745 15305 --
NM_020727chr21113763 3475 3410 3125 2855 2772 1536 1437 931 630 609 22712 996 23384 518 --
NM_020734chr1262135 2119 891 852 686 490 22295 810 1824 --
NM_020739chr1573897 3694 3625 3496 1695 1493 570 ----23062 2926
NM_020762chr121164 ------
NM_020766chrX44264 3421 1451 1315 11423 24053 3590 --
NM_020768chr573140 2832 2378 2026 1122 774 165 12004 1723 --
NM_020771chr661452 1352 1262 1247 1024 574 11494 ----
NM_020772chr1777908 5792 5499 3077 2827 761 331 35782 2976 1386 1939 11411
NM_020773chr452591 2287 2107 1807 1056 1614 2123 75 --
NM_020774chr1875766 4977 4703 1723 1019 765 99 14083 12452 --
NM_020776chr1842742 2349 156 120 2260 197 ----
NM_020777chr412540 ------
NM_020791chr1711376 ------
NM_020796chr532207 1210 541 1689 12935 --
NM_020800chr311319 1558 ----
NM_020801chr562383 1902 1018 725 497 479 12222 11985 --
NM_020806chr143807 661 189 ------
NM_020810chr1433032 481 320 43137 2983 872 199 ----
NM_020819chr6----1387 --
NM_020826chr1153703 2332 898 775 585 --186 --
NM_020830chr262943 1108 1101 757 284 186 12956 ----
NM_020832chr12631 93 ------
NM_020839chr361515 1031 649 333 271 105 --11040 --
NM_020841chr1264029 3013 2927 735 355 310 1830 ----
NM_020844chr877295 6088 5777 5384 3067 2716 1616 37009 6333 6082 ----
NM_020850chr16--2939 224 --13265
NM_020856chr1941436 1177 539 292 11502 11444 --
NM_020858chr1552399 2334 2122 2112 1570 --12183 --
NM_020860chr421166 1154 11001 ----
NM_020868chr231797 147 55 --1419 --
NM_020888chr121320 102 ------
NM_020917chr1973355 3259 3000 2961 925 754 709 21199 392 --1543
NM_020918chr10113027 2904 2733 2383 2262 1323 1147 933 851 683 203 13415 ----
NM_020921chr1443381 3050 2649 540 --1581 --
NM_020922chrX21776 1173 11230 --11707
NM_020940chr1042920 2853 2373 796 12724 ----
NM_020948chr132782 534 424 23308 729 13551 --
NM_020958chr141283 ------
NM_020962chr1552011 1959 1748 837 433 --22170 1840 --
NM_020977chr432201 2140 512 21542 698 11848 1682
NM_020981chr21667 ------
NM_020987chr1051238 933 517 501 286 11353 ----
NM_021003chr142864 76 1652 ----
NM_021004chr141354 ------
NM_021033chr1393529 3254 3181 2983 2609 1281 853 838 167 --12638 23388 544
NM_021038chr353394 2707 2597 968 574 ----22549 283
NM_021072chr562325 1856 1847 1635 581 408 ------
NM_021083chrX53615 3256 2990 2395 271 --11100 --
NM_021097chr23928 698 81 12290 --12968
NM_021101chr362256 1019 819 611 365 69 1888 --1677
NM_021116chr769091 7488 7053 6605 1127 466 26700 59 ----
NM_021137chr1742391 2232 2032 1817 --32018 872 106 --
NM_021144chr91199 ------
NM_021151chr72293 112 --1102 --
NM_021159chr41152 --1118 --
NM_021183chrX71886 1567 780 651 511 286 209 ------
NM_021191chr1252556 1999 1595 340 227 11638 1642 --
NM_021194chr11236 1282 ----
NM_021204chr44839 822 689 656 1758 1918 --
NM_021255chr142721 33 13731 ----
NM_021622chr1052291 2143 1782 877 320 ------
NM_021643chr261748 1516 1278 671 509 327 ----1242
NM_021647chr474508 4326 3391 2976 1227 747 481 34148 3656 58 23206 1430 --
NM_021813chr675330 5147 5098 4800 2099 605 238 12057 --21526 1516
NM_021814chr651631 1141 657 284 79 --1195 --
NM_021815chr273115 3073 2292 1239 1220 522 411 42885 1985 856 844 ----
NM_021911chr584925 3748 3505 1622 1456 1303 1037 734 25531 3587 ----
NM_021912chr15133759 3569 3346 2981 2773 2701 1639 1336 1211 986 817 742 37 ------
NM_021940chr661463 1174 526 352 344 40 --1661 --
NM_021943chr622155 1559 ------
NM_021949chrX2659 297 ------
NM_021954chr1383535 3208 3137 3041 2910 1313 925 185 ------
NM_021961chr1187318 6743 6492 5815 5797 4994 4668 677 67412 6786 5854 5209 1243 751 11821 --
NM_021964chr3126523 6098 5907 5525 4978 2201 1769 1590 1567 1352 316 26 35701 1371 918 ----
NM_021977chr673775 3062 1048 1006 937 228 118 ----13206
NM_021998chrX31096 1016 975 ------
NM_022048chr1556267 5139 4245 2037 1152 14852 ----
NM_022049chr131848 1370 430 ------
NM_022060chr14----197 --
NM_022068chr182624 34 ------
NM_022079chr102863 223 --1265 1669
NM_022091chr652332 2009 1730 1032 867 22688 948 1583 1777
NM_022098chr2221070 230 1318 11254 --
NM_022114chr134549 4020 1467 ------
NM_022166chr1676228 5553 5133 5018 4058 2142 418 14504 22540 1434 --
NM_022170chr731530 491 155 11706 ----
NM_022343chr931249 1082 322 ------
NM_022368chrX182 ------
NM_022373chr72903 211 ------
NM_022443chr3142 ------
NM_022456chr1267569 7542 5476 4764 1360 310 27171 1106 16413 --
NM_022459chr1364954 4531 3988 2261 1590 1583 44665 792 329 145 11472 --
NM_022461chr3174 ------
NM_022473chr1594353 3996 3568 3458 3185 2911 739 514 135 13646 ----
NM_022474chr1472743 2107 1952 1854 1725 888 400 1917 ----
NM_022475chr41704 ------
NM_022476chr1651084 1048 965 310 147 ------
NM_022483chr551351 773 690 393 297 1594 2620 494 --
NM_022491chr1243186 2254 563 502 --23456 1071 --
NM_022497chr373892 3614 2802 2434 602 324 230 13096 23551 430 --
NM_022716chr132126 1953 185 22066 875 ----
NM_022730chr2------11059
NM_022735chr131676 1391 411 ------
NM_022753chr162526 2376 2079 1074 739 466 ------
NM_022758chr62272 29 23264 437 ----
NM_022763chr343158 2482 1039 623 147 ----
NM_022771chr124865 843 721 211 11042 ----
NM_022781chr933217 2571 485 23149 2262 22181 255 --
NM_022824chr541769 1465 763 510 11267 11516 --
NM_022827chr171176 ------
NM_022831chr121679 747 1349 ----
NM_022841chr1531854 1762 172 32227 1056 25 --1709
NM_022843chr132452 208 122 ----
NM_022845chr1642003 1875 582 178 ----11451
NM_022875chr51427 ------
NM_022877chr51427 ------
NM_022893chr252613 1235 826 678 582 1501 138 --
NM_022912chr263091 2888 2478 2451 1053 1009 21127 135 ----
NM_022977chrX41960 829 529 427 1513 ----
NM_023074chr192537 86 ------
NM_023927chr531102 508 416 --11208 --
NM_023929chr841748 831 337 44 21070 475 ----
NM_024007chr552956 2466 2105 922 596 11092 12173 --
NM_024293chr2----1818 --
NM_024294chr62272 29 23264 437 ----
NM_024301chr19----11027 --
NM_024345chr985233 5029 3928 3797 2394 939 730 721 16123 ----
NM_024411chr201387 --2508 43 --
NM_024415chr5290 72 ------
NM_024416chr951432 1384 1108 1020 45 ----21589 621
NM_024420chr12334 154 ------
NM_024423chr1853746 2729 1412 1200 540 ----13641
NM_024490chr151230 1204 --2440 118
NM_024491chr3144 ------
NM_024524chr382918 2803 2013 1992 1954 1260 192 180 --12540 --
NM_024539chrX2784 129 ------
NM_024548chr341749 1616 1566 1190 1649 ----
NM_024551chr1262585 2274 2151 1880 879 682 22125 390 --1870
NM_024551chr1262585 2274 2151 1880 879 682 22125 390 --1870
NM_024556chr11166 ------
NM_024567chr83631 74 46 ----1642
NM_024582chr431074 860 45 11107 ----
NM_024583chr23998 834 21 ------
NM_024590chr431866 1200 527 --11288 --
NM_024593chr821300 144 1334 ----
NM_024594chr52701 27 1411 ----
NM_024611chr1553145 2451 639 504 222 ----12722
NM_024615chr5121 ------
NM_024624chr231351 343 252 ------
NM_024639chr682552 2310 2093 1991 1166 476 167 21 ------
NM_024641chr693023 2909 2597 2429 1840 1148 1124 995 590 42789 2683 2437 327 11168 --
NM_024665chr364380 3134 3084 1669 1547 1175 34001 1568 1500 ----
NM_024670chr103451 336 54 11777 ----
NM_024680chr11------1373
NM_024692chr231631 1186 453 ------
NM_024713chr1561636 1276 1230 1187 1117 290 ------
NM_024721chr882564 2108 1921 1026 1006 721 434 332 ------
NM_024744chr241827 1752 657 230 1547 ----
NM_024749chr151938 1919 859 798 382 21700 867 1776 --
NM_024751chr442126 1648 441 258 ------
NM_024753chr2131 ------
NM_024761chr9115272 5009 4885 4567 3436 1349 992 938 731 625 527 192 1944 --
NM_024770chr285866 5482 4505 2670 2503 2150 961 602 26086 4476 ----
NM_024811chr1121836 1295 --21406 1399 1498
NM_024817chr1564137 3835 1722 1661 663 396 1540 35640 4992 456 --
NM_024824chr141188 ------
NM_024834chr1051923 1337 572 562 140 ------
NM_024900chr411719 ------
NM_024900chr411719 ------
NM_024908chr151115 --1579 --
NM_024921chrX31375 430 206 32001 1928 749 ----
NM_024939chr1631587 1524 331 --11457 11427
NM_024947chr3159514 9163 8804 7986 7970 7174 7122 6470 3731 2739 2348 1441 985 142 90 37057 6392 2216 15963 --
NM_024949chr494978 4840 4558 3960 3525 3263 1495 1378 707 24330 1992 11025 --
NM_024989chr287836 6059 6046 5311 2907 1143 1082 959 16466 13174 15987
NM_024991chr1033095 2234 459 32880 946 94 ----
NM_025054chr863830 3521 3172 3062 3020 582 11250 ----
NM_025073chr154448 3919 3788 3433 1236 1448 1917 --
NM_025076chr2194 1660 ----
NM_025106chr121932 620 ------
NM_025133chr251066 454 306 136 38 --1421 --
NM_025134chr1642303 2088 1003 377 ----12152
NM_025138chr1351184 941 533 196 71 ------
NM_025146chr342726 2022 1936 157 21077 980 ----
NM_025160chr184273 4081 3988 3822 2665 1047 659 388 11437 ----
NM_025191chr173391 3378 2263 1149 837 734 606 1710 174 --
NM_025195chr83660 498 35 --21748 1496 --
NM_025208chr1152418 2299 1885 1510 733 --12218 --
NM_025216chr21484 ------
NM_025235chr1041705 304 214 143 ----1343
NM_030621chr1463837 3257 2946 2776 1466 1002 22889 168 13208 --
NM_030625chr1052517 2429 2295 909 343 ------
NM_030627chr5113059 2991 2825 2543 1592 1296 879 551 532 428 411 34023 1166 371 1958 --
NM_030639chrX2212 46 192 11434 --
NM_030640chr122856 165 --1191 --
NM_030647chr7146251 5501 5125 4952 4890 4810 4800 4727 4532 2502 1504 1166 362 341 14601 1660 --
NM_030648chr475137 3797 3510 1288 1013 687 68 2947 402 ----
NM_030650chr253529 1476 1371 1013 714 11222 --22681 1667
NM_030664chr1042196 1837 686 220 1521 --11942
NM_030674chr1265347 5234 4756 2307 1222 744 35873 5122 503 --14629
NM_030751chr10111796 1682 1548 1534 1425 1338 1324 1220 745 597 269 11444 ----
NM_030751chr10111796 1682 1548 1534 1425 1338 1324 1220 745 597 269 11444 ----
NM_030762chr1241824 1486 1267 427 11465 2778 226 --
NM_030763chrX2679 34 --1165 --
NM_030791chr1441191 1175 460 447 ------
NM_030797chr22272 84 169 ----
NM_030799chr531907 1851 486 11585 ----
NM_030806chr1108484 6345 6303 3594 2295 2160 1830 1275 1125 852 26833 5982 13741 --
NM_030809chr1242177 2126 1648 446 11640 3795 789 61 --
NM_030816chr193281 3178 2641 1032 887 673 501 158 133 1238 --13461
NM_030885chr362374 2357 1938 1475 711 422 1845 ----
NM_030918chr134657 1573 899 25446 3537 15365 --
NM_030953chr551647 1564 1362 1043 152 ----1592
NM_030962chr1141147 390 234 89 --11075 --
NM_031226chr1531143 1123 312 ------
NM_031243chr732364 2121 205 ------
NM_031271chr851548 1537 671 386 74 11238 1185 1157
NM_031314chr1421822 263 ------
NM_031362chr252781 2754 1796 550 516 ------
NM_031365chr252917 2890 1932 686 652 ------
NM_031366chr252917 2890 1932 686 652 ------
NM_031371chr121352 523 11214 ----
NM_031371chr121352 523 11214 ----
NM_031372chr411405 ------
NM_031411chr562389 1771 718 625 348 161 ------
NM_031418chr1162570 2377 2086 2033 2026 33 32781 2485 2233 1980 --
NM_031419chr361328 1318 569 270 255 27 ------
NM_031427chr1445846 5259 4917 4483 15270 35626 4956 1844 --
NM_031435chr1252217 2139 1058 229 112 32946 2571 2259 ----
NM_031442chrX52861 2508 2415 2391 387 --12155 --
NM_031453chr1032256 534 252 12100 ----
NM_031461chr842302 1817 326 76 32098 1860 1459 ----
NM_031469chr682856 2664 1392 878 826 632 532 304 11093 ----
NM_031483chr2093475 2638 1320 1228 1164 698 669 279 217 1232 1771 --
NM_031492chr111416 --1585 --
NM_031844chr1114103 3937 3746 3701 2876 2860 1496 1321 1212 708 539 22500 1281 23597 3378 13876
NM_031845chr293142 2986 2975 2954 2500 2314 2239 1336 529 13109 ----
NM_031847chr293142 2986 2975 2954 2500 2314 2239 1336 529 13109 ----
NM_031849chr562389 1771 718 625 348 161 ------
NM_031857chr562389 1771 718 625 348 161 ------
NM_031860chr562389 1771 718 625 348 161 ------
NM_031889chr421405 45 11376 21266 198 11616
NM_031904chr1122163 2065 ------
NM_031911chr472794 2201 1978 1001 371 264 126 ------
NM_031992chr731530 491 155 11706 ----
NM_032021chr1121008 859 ------
NM_032041chr862764 1997 1084 645 585 64 2747 682 --1819
NM_032042chr532487 1108 261 1897 12189 --
NM_032104chr1155 ------
NM_032105chr176074 5562 2526 1936 1929 1620 55 --32274 2096 1145 --
NM_032116chr13115655 5604 5322 4754 4212 2041 1926 1394 1223 1116 402 35444 4984 1448 --11072
NM_032119chr5--1121 1276 --
NM_032124chr182777 433 --1903 --
NM_032144chr231423 1276 120 21778 1519 --1585
NM_032145chr651959 1914 1892 1774 516 11679 --122
NM_032147chr124949 724 396 128 ------
NM_032148chr121458 ------
NM_032153chr351986 1869 916 705 231 ------
NM_032160chr18103916 3567 3260 3249 3161 2959 1720 943 176 32 34362 4183 3174 34114 3595 1329 2908 460
NM_032175chr511632 21616 277 21645 603 --
NM_032186chr121096 431 11003 11315 --
NM_032189chr1354869 4765 4377 1844 1806 34846 4325 1943 14931 --
NM_032217chr411024 ------
NM_032228chr1183569 2912 2442 2273 1341 1323 412 149 21309 352 ----
NM_032246chr1521287 1232 11096 11019 --
NM_032288chr332363 1963 598 ------
NM_032303chr981842 1469 1457 1355 1319 1184 1130 588 ----11194
NM_032329chr224275 779 --12874 --
NM_032373chr10105561 5296 4728 4484 3984 2203 1571 973 578 427 35570 4873 4152 ----
NM_032410chr841148 973 818 263 --21012 984 --
NM_032439chr1041502 1237 510 237 11307 ----
NM_032440chr1041975 1162 564 99 ----12466
NM_032445chr1542191 1659 583 345 12221 12363 --
NM_032446chr513092 2945 805 23648 154 --
NM_032452chr1411564 ------
NM_032457chr463939 3812 3608 2818 2496 1370 22935 2526 11570 --
NM_032458chrX53272 2703 2333 2320 269 --11052 --
NM_032466chr851214 584 488 471 396 ------
NM_032468chr851214 584 488 471 396 ------
NM_032471chr61100 1242 --1872
NM_032505chr322465 76 --2946 668 22413 436
NM_032521chr2073085 2914 2610 2451 2378 2183 808 ------
NM_032538chr622731 876 ------
NM_032539chrX1811 ------
NM_032557chr41163 1153 2847 44 --
NM_032558chr911208 11437 ----
NM_032622chr441434 1351 1299 1118 ----11188
NM_032632chr1421691 1399 ------
NM_032682chr343630 3283 2369 1147 13337 ----
NM_032727chr102155 84 11647 11237 11549
NM_032731chr1721299 1282 2934 171 ----
NM_032778chr393152 2748 2703 2641 1278 1171 492 164 114 22179 474 ----
NM_032796chrX3186 47 32 ------
NM_032801chr1121549 162 ----12519
NM_032804chr1022301 873 22067 1963 --11760
NM_032833chr162495 1929 802 724 717 27 12663 12096 --
NM_032837chr1761850 1815 1706 1694 594 143 ------
NM_032842chr741733 1376 133 24 21391 1191 ----
NM_032859chr1393980 3555 3469 2982 2781 879 856 785 503 53766 3707 2691 1432 1207 ----
NM_032873chr1163926 3810 3334 1453 1090 822 --1594 --
NM_032884chr1----1273 --
NM_032918chr123494 183 139 ------
NM_032940chr161834 ------
NM_032968chrX73301 3196 3103 2926 1502 1127 219 32770 1650 1266 --13515
NM_032969chrX73301 3196 3103 2926 1502 1127 219 32770 1650 1266 --13515
NM_032973chrY73296 3191 3098 1502 1127 818 219 32765 1644 1266 --13511
NM_032975chr1873424 3152 1031 461 399 174 66 ----12849
NM_032980chr1873424 3152 1031 461 399 174 66 ----12849
NM_033014chr951432 1384 1108 1020 45 ----21589 621
NM_033020chr143816 3703 3680 1765 34726 3602 3053 ----
NM_033030chr271563 1422 1225 628 441 432 124 ------
NM_033117chr91353 1129 ----
NM_033119chr162869 130 ------
NM_033122chr4159 ------
NM_033135chr1152418 2299 1885 1510 733 --12218 --
NM_033143chr453669 3484 3334 1412 42 --13235 1528
NM_033181chr693760 3716 3357 3317 2772 2614 2501 1489 637 --13657 --
NM_033211chr51536 11642 1305 --
NM_033224chr7127970 7961 7711 6239 6078 5990 5934 5593 2261 1644 1607 210 27193 137 ----
NM_033225chr842656 2281 1208 550 ----12099
NM_033285chr844416 1534 484 192 --1473 --
NM_033331chr942231 931 577 510 22986 66 ----
NM_033360chr12124367 3994 3723 3558 3419 2831 1480 1465 1288 933 822 338 ------
NM_033380chrX2918 135 ------
NM_033381chrX2918 135 ------
NM_033389chr1731720 1121 1076 11659 34593 4415 4079 --
NM_033406chr11143 ------
NM_033429chr1583275 2842 2679 2607 2041 836 533 144 --12267 --
NM_033430chr453130 3022 1195 1061 511 23458 242 ----
NM_033437chr453130 3022 1195 1061 511 23458 242 ----
NM_033505chr284476 2691 2369 1972 1118 1086 574 357 ----25654 563
NM_033512chr843007 2854 2697 313 13022 ----
NM_033542chr2032079 1476 45 21396 1376 130 --
NM_033551chr533363 2475 1228 13472 13156 --
NM_033624chr1242120 1830 589 545 1652 ----
NM_033632chr461517 1398 1268 1152 385 197 ------
NM_033644chr521615 721 ----1843
NM_033645chr521615 721 ----1843
NM_052811chr1355257 5178 4789 4032 290 --33974 3545 1787 --
NM_052818chr1331541 831 750 12205 21501 1436 --
NM_052832chr882929 2703 2493 2438 1907 1216 834 729 ----1412
NM_052834chr1842429 2195 1933 1011 12215 1420 --
NM_052867chr1331311 1246 50 ----1936
NM_052879chr1274107 3750 2953 2906 672 660 602 24022 3344 ----
NM_052885chr12114709 4525 3644 3469 3346 3323 1888 1586 1341 1335 224 13497 --13476
NM_052886chr862168 2070 1683 1569 717 583 ------
NM_052888chr171132 ------
NM_052897chr121891 ------
NM_052900chr8------11672
NM_052901chr921783 1594 ------
NM_052904chr641278 1082 440 319 ------
NM_052905chr241734 728 358 175 ------
NM_052907chr1264310 4096 3347 2819 750 92 24298 3817 ----
NM_052910chr1362179 1851 1485 787 499 293 ------
NM_052911chr181783 ------
NM_052917chr253331 3275 3025 2355 2193 --22841 2248 1743
NM_052918chr1033668 2859 2398 1492 --12413
NM_052927chr561770 1436 1415 697 545 300 139 ----
NM_052950chr1332238 2130 228 21805 871 ----
NM_053016chr957225 7106 6176 5447 1440 26916 5577 ----
NM_053023chr1142925 2192 1060 860 ------
NM_053025chr321270 165 ----11245
NM_053026chr321270 165 ----11245
NM_053027chr321270 165 ----11245
NM_053028chr321270 165 ----11245
NM_053031chr321270 165 ----11245
NM_053032chr321270 165 ----11245
NM_053042chr483119 3086 2694 2606 1216 665 547 296 1570 --11053
NM_053064chr1462736 2556 2468 2316 2011 1148 --1676 --
NM_053274chr1129 ------
NM_054016chr161948 1864 1503 1403 1247 376 ------
NM_054016chr161948 1864 1503 1403 1247 376 ------
NM_054016chr161948 1864 1503 1403 1247 376 ------
NM_054027chr551948 686 624 156 48 22157 1808 --11379
NM_057175chr461857 1767 1024 923 405 319 12522 1178 --
NM_057749chr831344 1265 973 ------
NM_058163chrX2735 224 ------
NM_058170chr121414 1293 1506 21571 555 --
NM_078469chr1031301 485 411 21347 92 --21186 1072
NM_080425chr201102 ------
NM_080426chr201102 ------
NM_080546chr962071 1906 1836 1829 311 179 --1656 --
NM_080591chr942913 2222 1007 738 42849 2407 1207 303 12033 --
NM_080645chr641883 1592 504 447 11636 11977 --
NM_080671chr232223 1895 602 ------
NM_080676chr2043163 3017 2388 713 12855 ----
NM_080678chr21244 --153 --
NM_080683chr41217 ------
NM_080684chr41217 ------
NM_080685chr41217 ------
NM_080759chr1342672 1711 725 629 1940 12198 --
NM_080760chr1342672 1711 725 629 1940 12198 --
NM_080832chrX51835 1492 668 437 319 ------
NM_080867chr1484627 3162 1775 1572 1082 825 554 136 --14533 14238
NM_080872chr8--23918 3276 21021 958 21248 768
NM_100264chr10164 ------
NM_100486chr10164 ------
NM_130391chr953609 2245 569 452 108 13121 11231 23579 890
NM_130392chr953609 2245 569 452 108 13121 11231 23579 890
NM_130393chr953609 2245 569 452 108 13121 11231 23579 890
NM_130434chr1551125 1019 444 278 114 --1177 --
NM_130435chr1031188 409 232 --12666 1346
NM_130436chr2132843 1822 1722 21762 104 ----
NM_130438chr2143420 2399 2299 499 22339 681 1351 1463
NM_130442chr731151 819 51 --11042 --
NM_130783chr1131991 1962 162 12146 1548 --
NM_133170chr2088065 8052 7710 6206 5615 5416 2059 1811 22931 1669 --15912
NM_133264chr171650 11186 1100 --
NM_133265chrX93665 2870 2676 2519 1190 382 272 157 119 12288 ----
NM_133329chr251898 1882 1792 479 394 --11522 --
NM_133334chr466278 5187 4919 915 555 410 1947 ----
NM_133370chr473685 3134 2623 2254 1014 219 206 23372 1201 --1959
NM_133445chr943466 2582 917 213 1406 --11419
NM_133465chr9------2307 246
NM_133468chr741913 1820 323 46 11756 1586 --
NM_133478chr262511 2497 2266 1700 1687 182 12282 31563 759 449 --
NM_133493chr683800 3307 3140 2880 1870 1546 151 28 14115 134 11698
NM_133496chr123993 1002 23595 3253 --11561
NM_133631chr331252 1128 485 170 ----
NM_133647chr1563512 2470 1042 796 398 276 1692 ----
NM_138270chrX82931 2108 2096 1019 917 901 177 76 22233 575 ----
NM_138288chr1471840 1825 1746 807 568 509 226 11760 ----
NM_138333chr932588 2502 254 ------
NM_138423chr1552333 2186 1957 1454 599 ----11646
NM_138444chr1354198 4102 3540 3182 609 34744 3523 3388 ----
NM_138459chr642761 2295 1404 1074 23689 1053 12496 --
NM_138468chr286366 6013 5449 4809 4116 2058 765 119 15478 11451 --
NM_138473chr1244844 4424 3398 394 1561 ----
NM_138694chr653648 2672 2470 304 284 ------
NM_138713chr16127297 6680 5798 3255 2850 2498 1087 965 547 540 216 192 57434 6746 6025 1317 590 ----
NM_138714chr16127297 6680 5798 3255 2850 2498 1087 965 547 540 216 192 57434 6746 6025 1317 590 ----
NM_138731chr1474204 2946 2882 2871 2711 1394 890 ------
NM_138735chr211556 1367 1226 --
NM_138771chr72993 365 21149 345 ----
NM_138775chr111555 ------
NM_138799chr241610 1555 60 43 --11861 --
NM_138811chr721088 204 ------
NM_138923chrX----1120 --
NM_138927chr212887 42 --1377 --
NM_138961chr11----2454 347 167
NM_138971chr1153209 2724 2352 1534 1279 23843 848 21324 512 --
NM_138971chr1153209 2724 2352 1534 1279 23843 848 21324 512 --
NM_138972chr1153209 2724 2352 1534 1279 23843 848 21324 512 --
NM_138972chr1153209 2724 2352 1534 1279 23843 848 21324 512 --
NM_138973chr1153209 2724 2352 1534 1279 23843 848 21324 512 --
NM_138973chr1153209 2724 2352 1534 1279 23843 848 21324 512 --
NM_139078chr12129 ------
NM_139126chr62670 137 ----133
NM_139131chr11------154
NM_139135chr11947 ------
NM_139168chr551447 688 634 500 115 ----21502 250
NM_139175chr7----156 --
NM_139242chr1521158 1010 --11514 --
NM_139279chr273259 2833 2340 1365 1219 658 190 1695 ----
NM_139323chr2061919 1888 1786 776 652 232 1682 ----
NM_144498chr2042278 869 560 103 --11475 12218
NM_144570chr1642268 2201 1999 410 --22660 1067 --
NM_144571chr496642 6584 2188 1621 1544 615 496 259 222 ------
NM_144578chr1464624 4266 2023 2000 1449 1183 --11263 --
NM_144599chr1584956 3976 2073 1492 1190 528 470 304 21002 797 35089 3884 3750 --
NM_144609chr1751267 1041 493 327 251 ------
NM_144628chr2033079 877 519 --12170 1184
NM_144629chr231157 1024 992 2956 935 ----
NM_144664chr1152119 1829 1613 578 564 --32106 2067 2030 --
NM_144665chr113216 200 191 ------
NM_144690chr191365 ----1203
NM_144710chr231291 1234 483 11509 11225 --
NM_144722chr541131 1014 74 36 ------
NM_144723chr51693 ------
NM_144724chr53913 829 623 ------
NM_144728chr12208 151 1263 ----
NM_144729chr12208 151 1263 ----
NM_144732chr1931108 1021 1010 ------
NM_144778chr1342650 2626 2048 678 12104 ----
NM_144963chr832706 1886 119 12698 --11761
NM_144973chr1241571 1193 260 75 55278 4521 3811 3584 3381 11725 --
NM_144982chr123726 277 241 ------
NM_145000chr54510 449 196 148 1649 ----
NM_145010chr1062206 1497 894 312 189 56 ------
NM_145048chr42765 395 ------
NM_145055chr1853399 3096 2533 962 189 11538 ----
NM_145119chrX182 ------
NM_145174chr2271278 1185 1010 194 82 75 24 ------
NM_145175chr231440 1155 229 --11255 11033
NM_145206chr10103332 3196 2559 2160 1140 1091 862 578 295 91 ------
NM_145251chr1431020 511 186 31591 1429 463 ----
NM_145253chr161724 ------
NM_145259chr2176135 6105 5903 5559 5394 5348 5011 4718 4476 4388 4359 2678 1832 1550 1355 1155 667 --16415 15167
NM_145263chr442349 2342 2335 2000 ------
NM_145284chrX32363 2314 2035 11820 ----
NM_145303chr62377 111 ------
NM_145305chrX41274 296 253 33 21135 533 --11312
NM_145307chr10104476 4449 4066 3736 1535 1305 807 675 396 28 --24523 4040 --
NM_145313chr102312 262 ------
NM_145320chr763634 3239 2869 2600 295 24 11199 ----
NM_145321chr763634 3239 2869 2600 295 24 11199 ----
NM_145322chr763634 3239 2869 2600 295 24 11199 ----
NM_145350chr17----11634 --
NM_145351chr17----12774 --
NM_145649chr682663 1681 591 539 417 410 357 177 11710 ----
NM_145655chr682663 1681 591 539 417 410 357 177 11710 ----
NM_145686chr273438 2945 2421 1047 842 473 360 33277 3232 1230 ----
NM_145687chr273438 2945 2421 1047 842 473 360 33277 3232 1230 ----
NM_145690chr81184 ------
NM_145698chr1051833 1561 302 192 178 1334 ----
NM_145728chr152850 406 1767 21530 425 11864
NM_145735chr1362551 2083 933 804 102 24 --12270 --
NM_145793chr102775 367 1930 1809 --
NM_145808chr773110 2794 2550 2440 2434 300 247 12222 ----
NM_145859chr33358 315 275 ------
NM_145860chr33358 315 275 ------
NM_147166chr73767 562 346 ------
NM_147175chrX32180 1735 490 ------
NM_147202chr922699 2586 22749 1738 11767 --
NM_147223chr242377 1685 989 705 --12183 --
NM_147233chr242194 1502 806 522 --12000 --
NM_148174chr851750 1546 809 800 607 ------
NM_148898chr7----1701 --
NM_148899chr7----1701 --
NM_148921chr1741522 1508 672 654 ------
NM_152261chr1232466 2316 419 21649 835 21577 626 --
NM_152265chr121309 40 1601 --11408
NM_152275chr242376 1651 749 260 22162 1761 11491 --
NM_152280chr142749 2565 2129 1017 13390 --1626
NM_152284chr82748 82 ------
NM_152300chr173760 432 356 11603 11525 --
NM_152344chr172214 115 ------
NM_152388chr283826 3444 3390 3373 3174 1121 193 117 33236 2555 1383 --13565
NM_152409chr5103220 3186 2929 2854 2702 1290 466 385 222 164 ----12185
NM_152422chr92266 101 ----11432
NM_152429chr102478 400 ------
NM_152442chr1251413 1187 978 449 298 11207 ----
NM_152446chr143760 90 52 1662 --1237
NM_152447chr142350 313 ------
NM_152470chr1853820 3297 2898 2615 320 --22735 2719 11243
NM_152493chr111374 ------
NM_152512chr221394 --1153 --
NM_152519chr261605 1369 817 771 650 584 11765 --11800
NM_152527chr271958 1504 943 886 691 495 37 1532 ----
NM_152529chr263887 3840 1128 1051 935 86 ----1743
NM_152549chr51462 141 ----
NM_152556chr72816 243 11816 22318 72 --
NM_152588chr1241831 1222 538 177 --1471 --
NM_152594chr1561866 1721 1657 833 763 416 ------
NM_152608chr122213 1954 ------
NM_152622chr563486 3111 3041 2526 2386 978 11293 ----
NM_152624chr577287 6497 6243 5899 5610 2822 954 11084 ----
NM_152629chr983458 3301 2891 1577 1326 1279 1054 764 --11411 --
NM_152630chrX31347 1057 488 1353 11017 --
NM_152641chr1222010 1000 ------
NM_152665chr14894 849 813 524 ------
NM_152666chr15836 658 209 153 143 ------
NM_152671chr21344 1384 ----
NM_152678chr342605 389 211 55 21821 1037 21993 807 12430
NM_152682chr411711 ------
NM_152687chr521326 859 --1173 --
NM_152688chr66955 906 856 373 348 185 ------
NM_152692chrX1341 --1438 --
NM_152699chr353752 3283 1095 804 719 --11134 11141
NM_152737chr662039 1869 1473 805 231 114 ------
NM_152749chr721044 827 11158 --1813
NM_152756chr574074 3493 2883 1596 1378 894 544 54158 3871 2962 1410 398 ----
NM_152758chr852529 1124 340 63 38 1127 ----
NM_152774chr722728 313 22164 2121 --11685
NM_152787chrX43527 3251 2471 1094 53621 2739 1379 1231 871 ----
NM_152793chr764666 3737 1316 1101 309 90 34460 4305 1966 24752 1227 13493
NM_152835chr151917 1848 934 268 49 12681 ----
NM_152996chr151900 1360 800 587 529 1834 ----
NM_152999chr774689 1744 1398 1389 1219 973 740 23799 650 23141 769 14083
NM_153013chr552403 2275 1632 524 479 12038 12132 --
NM_153020chr661704 1426 1164 93 82 70 11315 ----
NM_153038chr2----2691 638 --
NM_153040chr151118 ------
NM_153042chr621840 1566 ----11296
NM_153182chr393152 2748 2703 2641 1278 1171 492 164 114 22179 474 ----
NM_153184chr31269 21985 243 ----
NM_153188chr5175508 5355 5291 5064 5027 4896 4475 4455 4264 4184 4065 3947 3918 3910 3609 548 210 14314 ----
NM_153207chr1293807 3627 3422 2734 2693 2497 1394 1256 61 ------
NM_153223chr531605 1254 1167 1574 ----
NM_153235chr63393 288 207 ------
NM_153262chr183220 2926 2096 2078 1161 810 240 162 12648 ----
NM_153267chr93921 891 92 ------
NM_153321chr173746 297 198 ------
NM_153322chr173746 297 198 ------
NM_153331chr32706 276 ------
NM_153332chr843258 2441 2321 372 1685 ----
NM_153358chr193563 214 46 --1438 --
NM_153362chr62365 312 --1746 --
NM_153426chr44617 272 219 194 ----1509
NM_153427chr44617 272 219 194 ----1509
NM_153456chr1395733 5005 4818 4539 3963 2055 1391 1347 1037 12411 2869 636 --
NM_153616chr1552399 2334 2122 2112 1570 --12183 --
NM_153617chr1552399 2334 2122 2112 1570 --12183 --
NM_153618chr1552399 2334 2122 2112 1570 --12183 --
NM_153619chr1583637 3572 3360 3350 2808 2413 2389 2229 12590 13421 --
NM_153634chr1231455 1340 268 ------
NM_153645chr2232821 2347 2305 31319 1023 921 22043 1146 --
NM_153687chr1231627 546 342 11167 ----
NM_153689chr282217 1795 1640 1620 1602 1460 377 229 ------
NM_153810chr10103578 3558 3243 1910 1725 1320 1099 911 843 301 ----14870
NM_170606chr731735 742 183 11293 11522 --
NM_170665chr1263771 2808 1322 1270 899 282 11141 1223 --
NM_170679chr541192 982 392 25 11055 ----
NM_170709chr841852 550 379 346 1533 1319 1370
NM_170719chr1351184 941 533 196 71 ------
NM_170740chr643477 2620 2198 86 21267 553 ----
NM_171998chrX42330 524 201 139 21979 623 ----
NM_172070chr22521 89 1680 ----
NM_172071chr1107399 6594 6505 5359 5332 5279 4920 4778 2116 918 11551 22974 831 --
NM_172127chr42556 360 134 ----
NM_172128chr42512 316 ------
NM_172344chr251898 1882 1792 479 394 --11522 --
NM_173054chr73774 359 286 1349 ----
NM_173198chr982985 2925 2216 1919 720 704 530 281 --22317 41 12752
NM_173200chr982985 2925 2216 1919 720 704 530 281 --22317 41 12752
NM_173214chr16127297 6680 5798 3255 2850 2498 1087 965 547 540 216 192 57434 6746 6025 1317 590 ----
NM_173359chr341551 662 582 59 1499 11691 --
NM_173468chr435585 4793 1720 1492 ----
NM_173469chr1531115 576 145 --158 --
NM_173470chrX72867 2485 2361 2205 2127 470 431 ------
NM_173475chr161401 ------
NM_173478chr172398 249 ----1694
NM_173495chrX42150 945 702 322 --1520 12371
NM_173500chr1531382 1248 122 1152 --11432
NM_173511chr253855 3341 2899 1321 1153 --11224 --
NM_173552chr332001 695 143 ------
NM_173576chr1032147 2057 2029 11514 ----
NM_173582chr1196180 5921 4865 4430 2528 1885 1614 276 24 --35127 1989 1142 --
NM_173591chr122905 100 1759 ----
NM_173602chr1273744 2834 2783 1393 1244 435 197 42752 1519 883 369 ----
NM_173607chr1451565 1381 695 559 163 289 51 ----
NM_173642chr1189194 8708 8128 8077 8039 7920 7824 7256 6917 6453 6293 3172 2200 1990 1142 706 694 138 33193 3003 1790 1807 12800
NM_173648chr25252 200 192 152 87 ------
NM_173694chrX32396 1853 52 --22140 409 --
NM_173808chr184486 4128 3211 1725 1040 955 779 653 23417 504 11500 --
NM_173812chr1261582 1532 1449 1427 994 548 --21434 538 --
NM_174887chr171246 ------
NM_174889chr5150 ------
NM_174890chr102576 205 1585 ----
NM_174907chr3152 ------
NM_174916chr1551702 734 413 402 388 ------
NM_174921chr42891 32 ------
NM_175056chr332139 1670 886 ------
NM_175061chr721388 433 3729 573 538 ----
NM_175069chr91966 --1821 --
NM_175610chr1531296 484 392 21343 1123 ----
NM_175623chr1267569 7542 5476 4764 1360 310 27171 1106 16413 --
NM_175634chr83500 400 264 ------
NM_175635chr83500 400 264 ------
NM_175636chr83500 400 264 ------
NM_175767chr551157 240 130 121 91 1685 ----
NM_175848chr2011184 --1231 --
NM_175848chr2011184 --1231 --
NM_175849chr2011184 --1231 --
NM_175849chr2011184 --1231 --
NM_175850chr2011184 --1231 --
NM_175850chr2011184 --1231 --
NM_175854chr1321795 459 ------
NM_175861chr1295470 4748 4175 2100 1831 1353 1066 570 504 44294 1854 1545 130 14072 --
NM_175866chr12501 350 ------
NM_175884chr711226 ----1938
NM_175907chr1831810 610 195 22560 1976 ----
NM_175921chr564158 4003 2752 1465 480 255 3739 724 331 ----
NM_176812chr20------1682
NM_176823chr123402 979 ----23105 831
NM_177423chr11----1152 --
NM_177424chr171979 1896 1466 719 457 371 315 11419 ----
NM_177438chr1463837 3257 2946 2776 1466 1002 22889 168 13208 --
NM_177452chr1442095 2042 1877 817 21726 136 1753 --
NM_177538chr2128159 7015 5639 3547 3357 3279 2849 2364 2198 2176 1534 1149 35705 2611 1351 22582 1881 --
NM_177947chrX21712 1214 ----11047
NM_177948chrX21712 1214 ----11047
NM_177951chr14145 ------
NM_177952chr142864 76 1652 ----
NM_177974chr1552333 2186 1957 1454 599 ----11646
NM_177985chr251963 1702 1651 794 769 1526 ----
NM_177995chr92266 101 ----11432
NM_178011chr1043305 2298 695 424 32268 779 593 ----
NM_178012chr61344 ------
NM_178037chr1283375 3149 2766 1062 801 718 673 107 ------
NM_178038chr1283375 3149 2766 1062 801 718 673 107 ------
NM_178123chr23315 179 147 1127 ----
NM_178151chrX137642 6355 6273 6031 5943 5220 2619 1417 1340 1298 1191 866 597 --1911 1802
NM_178152chrX137642 6355 6273 6031 5943 5220 2619 1417 1340 1298 1191 866 597 --1911 1802
NM_178153chrX137642 6355 6273 6031 5943 5220 2619 1417 1340 1298 1191 866 597 --1911 1802
NM_178154chr144242 185 153 98 1326 ----
NM_178155chr144242 185 153 98 1326 ----
NM_178156chr144242 185 153 98 1326 ----
NM_178157chr144242 185 153 98 1326 ----
NM_178190chr12277 256 ------
NM_178191chr121618 1597 ------
NM_178313chr252131 1709 485 345 318 1329 11697 --
NM_178424chr53499 433 402 ------
NM_178439chr24542 502 130 62 ------
NM_178554chr323414 1028 ------
NM_178565chr831196 538 126 ------
NM_178566chr921242 317 --11437 1178
NM_178584chr231291 1234 483 11509 11225 --
NM_178585chr452322 2020 1000 529 476 33236 2961 1073 12683 --
NM_178812chr861545 1514 1359 1264 611 277 ------
NM_178815chr1022726 2432 22631 187 12413 --
NM_180989chr1321638 867 32008 1802 422 ----
NM_181054chr1421123 952 --11271 --
NM_181077chr1552242 1990 1804 1764 532 ------
NM_181354chr871403 1335 447 307 197 92 45 1503 ----
NM_181358chr154127 4099 3227 3067 3029 1982 ----
NM_181361chr32981 111 ----11113
NM_181443chr2052607 2477 2408 1010 209 --12146 --
NM_181481chr18106847 6342 6137 6003 5836 5762 5090 5055 2796 2039 27069 5217 26216 738 --
NM_181482chr18106847 6342 6137 6003 5836 5762 5090 5055 2796 2039 27069 5217 26216 738 --
NM_181483chr18106847 6342 6137 6003 5836 5762 5090 5055 2796 2039 27069 5217 26216 738 --
NM_181504chr543696 3463 3408 2764 ----11465
NM_181521chr1676871 6584 5906 2165 1711 1421 1392 14932 25190 1333 --
NM_181523chr543696 3463 3408 2764 ----11465
NM_181524chr543696 3463 3408 2764 ----11465
NM_181533chr141142 ------
NM_181571chr101124 ------
NM_181581chr73960 357 336 ------
NM_181670chr1251459 1374 1290 1268 330 11501 1383 --
NM_181671chr17--1730 1767 --
NM_181672chrX51639 1514 715 587 498 31835 140 74 ----
NM_181673chrX51639 1514 715 587 498 31835 140 74 ----
NM_181705chr544752 4712 3730 514 15455 1871 --
NM_181714chr641998 1802 1598 1292 153 ----
NM_181723chr851487 934 907 847 469 21626 606 ----
NM_181762chrX1367 ------
NM_181777chrX1367 ------
NM_181784chr262587 2427 2154 561 459 279 ------
NM_181787chr853809 3693 3245 360 255 33600 746 633 12762 13028
NM_181789chr1563215 2962 2442 2131 2097 1122 12280 ----
NM_181794chr61100 1242 --1872
NM_181795chr61100 1242 --1872
NM_181836chr552656 2545 2365 2118 896 ------
NM_181839chr841296 1265 1249 1197 ------
NM_181861chr1232548 346 213 ------
NM_181868chr1232548 346 213 ------
NM_181869chr1232633 431 298 ------
NM_181897chr342550 2528 1778 917 ------
NM_182314chrX11833 1496 --1623
NM_182485chr483752 3306 3155 789 639 534 74 27 12898 ----
NM_182493chr1675295 4655 4418 3902 3587 812 430 --11719 12003
NM_182603chr111813 1107 1778 --
NM_182606chr41116 --1909 --
NM_182607chrX51765 1703 1539 210 116 --1223 --
NM_182641chr1722003 100 ----124
NM_182646chr483752 3306 3155 789 639 534 74 27 12898 ----
NM_182691chr751383 1338 240 81 33 ------
NM_182692chr751383 1338 240 81 33 ------
NM_182715chr72306 86 --1490 --
NM_182717chr101529 ------
NM_182718chr101124 ------
NM_182719chr101124 ------
NM_182720chr101529 ------
NM_182721chr101529 ------
NM_182722chr101529 ------
NM_182723chr101529 ------
NM_182724chr101124 ------
NM_182725chr101124 ------
NM_182757chr653527 2893 2880 2873 2421 13177 ----
NM_182765chr1022061 257 1419 1372 1382
NM_182767chr1262012 1961 1900 493 318 134 21990 1435 1589 --
NM_182769chr101124 ------
NM_182770chr101124 ------
NM_182771chr101124 ------
NM_182772chr101124 ------
NM_182789chr52880 147 --1845 11021
NM_182797chr2061590 1528 1491 1468 683 175 1271 11770 --
NM_182848chr1321334 89 ------
NM_182850chr101124 ------
NM_182853chr101529 ------
NM_182896chr341773 1506 1183 548 ----11155
NM_182898chr7106533 6224 5562 2598 2396 2058 1796 1123 995 549 25215 4864 ----
NM_182899chr7106533 6224 5562 2598 2396 2058 1796 1123 995 549 25215 4864 ----
NM_182910chr141620 ------
NM_182913chr141620 ------
NM_182914chr141620 ------
NM_182943chr32332 105 --11236 --
NM_182948chr142741 2342 911 446 1212 --1601
NM_182972chr162537 2520 2468 2447 2325 384 22079 2052 ----
NM_182976chr12152 91 ------
NM_182977chr53955 807 28 ----1393
NM_183004chr1493822 3739 2763 1260 861 749 585 102 26 ------
NM_183011chr101529 ------
NM_183012chr101529 ------
NM_183013chr101529 ------
NM_183060chr101124 ------
NM_183323chr52880 147 --1845 11021
NM_183380chr63688 310 223 --1234 --
NM_183381chr34862 748 360 189 ------
NM_183383chr34862 748 360 189 ------
NM_183384chr34862 748 360 189 ------
NM_183393chr31671 ------
NM_183394chr31671 ------
NM_183404chr20298 30 ------
NM_184234chr201151 ------
NM_194071chr755242 4973 1667 1077 764 24542 991 --14111
NM_194247chr284230 4089 3652 2777 1810 608 471 434 23063 1252 ----
NM_194278chr1433745 2572 1590 14072 23248 991 --
NM_194282chr453087 2419 679 378 132 ----12539
NM_194283chr544219 3511 454 390 2938 315 ----
NM_194301chr144914 904 90 45 21161 461 ----
NM_194314chr155239 4209 3779 3641 1027 15311 ----
NM_194328chr933217 2571 485 23149 2262 22181 255 --
NM_194329chr933217 2571 485 23149 2262 22181 255 --
NM_194330chr933217 2571 485 23149 2262 22181 255 --
NM_194332chr933217 2571 485 23149 2262 22181 255 --
NM_194356chr1241663 433 125 108 21756 340 ----
NM_194434chr18115503 5182 4334 4207 4093 1628 1101 992 600 491 224 25467 578 14698 13827
NM_194449chr18------1241
NM_194463chrX2784 129 ------
NM_197941chr533013 358 144 22827 2495 12958 --
NM_197968chr131199 ------
NM_197970chr271563 1422 1225 628 441 432 124 ------
NM_197972chr11191 ------
NM_198077chr13452 226 123 ------
NM_198123chr8------11672
NM_198124chr8------11672
NM_198128chr182538 405 41895 1847 1799 364 ----
NM_198181chr1542890 1855 1115 622 12705 11797 --
NM_198196chr342536 2348 2152 464 --22318 1728 11893
NM_198212chr762175 1702 661 561 373 196 123 ----
NM_198215chr1041322 1251 448 285 2308 88 ----
NM_198240chr1251350 974 553 417 61 152 ----
NM_198268chr154127 4099 3227 3067 3029 1982 ----
NM_198269chr154127 4099 3227 3067 3029 1982 ----
NM_198270chrX72789 2240 1213 1203 1087 775 299 ------
NM_198273chr562355 2330 2310 866 653 123 42230 2079 497 462 ----
NM_198279chrX41118 970 165 84 --198 --
NM_198291chr2051868 1846 1630 1552 1469 ------
NM_198320chr1265252 5127 4690 4056 3361 223 --14849 --
NM_198336chr71314 ------
NM_198391chr2021182 1082 ------
NM_198399chr311794 ------
NM_198459chr121018 869 ------
NM_198474chr1131137 713 364 1830 ----
NM_198503chr141875 763 694 254 32185 1826 783 ----
NM_198507chr51123 ------
NM_198578chr1221374 516 --1992 --
NM_198581chr297570 7476 6318 6176 1758 1647 852 777 681 --11419 --
NM_198715chr176160 4190 2176 1990 1753 954 563 25644 5468 12092 24564 1779
NM_198793chr384138 3378 3062 1199 807 799 766 367 1887 ----
NM_198829chr731197 1091 535 ------
NM_198859chr374817 4506 4022 3966 3247 1711 1041 15149 --13336
NM_198889chr411024 ------
NM_198896chr1142049 1566 1419 270 21922 1663 ----
NM_198901chr731229 1166 112 1490 ----
NM_198935chr2072975 2776 2723 2304 2001 1292 1198 ------
NM_198947chr112248 214 1727 ----
NM_198968chr1343768 3324 2513 243 12655 ----
NM_199000chr741975 1817 610 325 22124 1523 ----
NM_199003chr831144 483 372 11250 ----
NM_199160chr951688 1682 1471 539 372 ------
NM_199168chr1031475 1016 452 ------
NM_199188chr1274107 3750 2953 2906 672 660 602 24022 3344 ----
NM_199190chr1274107 3750 2953 2906 672 660 602 24022 3344 ----
NM_199324chr483495 3210 3015 1140 880 866 758 27 31382 1241 415 ----
NM_199421chr1484627 3162 1775 1572 1082 825 554 136 --14533 14238
NM_199454chr134549 4020 1467 ------
NM_199461chr1063655 3444 3405 3346 2580 724 11117 ----
NM_199462chr194591 4542 4210 4081 3960 3924 3891 3677 1182 11325 14639 11362
NM_199478chrX130 31935 1811 1366 ----
NM_199482chr242088 1323 563 40 1600 ----
NM_201269chr121096 431 11003 11315 --
NM_201570chr1051845 727 402 394 55 ------
NM_201571chr1051845 727 402 394 55 ------
NM_201572chr1051845 727 402 394 55 ------
NM_201590chr1051845 727 402 394 55 ------
NM_201591chr491785 1732 1439 1348 1226 746 626 339 159 --1281 --
NM_201592chr491785 1732 1439 1348 1226 746 626 339 159 --1281 --
NM_201593chr1051845 727 402 394 55 ------
NM_201596chr1051845 727 402 394 55 ------
NM_201597chr1051845 727 402 394 55 ------
NM_201613chr122659 575 1703 ----
NM_201628chr153380 2428 2367 1193 1183 21204 618 --13277
NM_201999chr45832 805 470 196 48 --2942 311 --
NM_203282chr1941705 1486 1477 342 11355 ----
NM_203283chr4154 ------
NM_203284chr4154 ------
NM_203291chr18------1231
NM_203292chr18------1224
NM_203327chr2074263 4212 3593 3559 3358 1459 1250 14272 14479 --
NM_203341chr14956 410 309 256 ------
NM_203349chr1541709 675 312 164 --1604 --
NM_203350chr141619 1229 1123 437 ----1646
NM_203364chr1131062 990 434 ------
NM_203390chr831824 1504 1495 11697 ----
NM_203391chrX41396 449 278 85 1727 ----
NM_203394chr1262710 1957 905 750 353 184 3678 647 538 1328 --
NM_203403chr91938 31153 1004 245 1157 --
NM_203406chr562744 2632 1918 936 829 468 22593 2072 ----
NM_203446chr2172550 2397 2155 1181 1151 813 639 11911 ----
NM_203453chr921983 648 ------
NM_203458chr133350 2541 59 33616 3293 1043 13102 --
NM_203459chr13866 804 640 22366 1678 ----
NM_203463chr234939 3640 1518 34790 863 215 24488 3827 --
NM_203487chr135554 485 132 105 24 21146 708 147 --
NM_203504chr472444 2338 2038 1772 1051 630 501 2910 92 ----
NM_203505chr472444 2338 2038 1772 1051 630 501 2910 92 ----
NM_205849chrX1314 ------
NM_205860chr132418 636 109 --12118 --
NM_206594chr121195 92 13215 --11229
NM_206595chr121195 92 13215 --11229
NM_206839chr151567 ------
NM_206853chr643109 481 96 49 23042 2915 ----
NM_206854chr6104370 3632 3319 1742 1357 1310 1076 531 487 42 34303 4176 3609 ----
NM_206855chr6115335 4597 4284 4196 2322 2275 2041 1496 1452 1007 491 35268 5141 4574 ----
NM_206866chr21103123 2880 2778 2661 2416 1258 455 414 338 70 22270 2205 ----
NM_206876chr292586 1403 1342 1316 1117 886 703 158 94 --11016 --
NM_206907chr553235 3054 2631 2274 166 --23028 913 --
NM_206909chr8157939 7458 7355 6301 5115 2330 2299 2273 2255 2224 1675 1489 1001 992 557 27128 6504 ----
NM_207015chr342324 2063 675 76 2559 541 ----
NM_207122chr1131063 1038 730 --11139 --
NM_207123chr45897 771 192 135 77 1257 --1846
NM_207292chr353394 2707 2597 968 574 ----22549 283
NM_207293chr353394 2707 2597 968 574 ----22549 283
NM_207294chr353394 2707 2597 968 574 ----22549 283
NM_207295chr353394 2707 2597 968 574 ----22549 283
NM_207296chr353394 2707 2597 968 574 ----22549 283
NM_207297chr353419 2732 2622 993 599 ----22574 308
NM_207303chr1064013 3806 3192 2758 1468 1282 13143 21247 243 --
NM_207304chr1342537 2513 1935 565 11991 ----
NM_207325chr1962085 1993 1641 531 315 235 11569 ----
NM_207361chr13116015 5371 5152 4830 4222 4149 4044 2090 1818 1067 322 --14695 --
NM_207372chr1062460 2075 1561 890 612 206 1356 --12297
NM_207406chr466271 5744 4836 2414 1618 931 1781 26122 4158 --
NM_207422chrX2168 99 ------
NM_207445chr1581423 748 641 582 481 355 163 65 11605 ----
NM_207506chr81516 ------
NM_207517chr1531955 1822 1261 11730 11580 1344
NM_207578chr13537 294 34 ----1168
NM_207660chr141188 ------
NM_207661chr141188 ------
NM_207662chr141188 ------
NM_212554chr1031594 1318 590 --11469 1158
NM_212558chr973366 3334 874 665 626 608 255 ------
NM_213589chr253498 3409 1394 1342 765 45524 1932 1184 904 34814 4692 560 --
NM_213590chr1355257 5178 4789 4032 290 --33974 3545 1787 --
NM_213651chr121609 1285 ------
NM_213654chr341049 1008 502 24 --3531 275 241 --