TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3152-5p
miRNA Sequence: AUUGCCUCUGUUCUAACACAAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000097chr32914 834 1458 ----
NM_000109chrX22085 654 --1506 12260
NM_000112chr544709 2106 1149 705 14623 14120 --
NM_000165chr61512 ------
NM_000267chr1732958 2678 960 12994 --12727
NM_000328chrX1341 ----1408
NM_000332chr645927 5128 1387 921 ------
NM_000335chr351926 1886 1668 1506 232 1146 21945 1475 1279
NM_000345chr41709 ------
NM_000368chr954838 2991 1640 1091 437 --34443 3109 1366 11458
NM_000462chr1511703 ------
NM_000523chr21456 ------
NM_000555chrX97784 7539 7489 6239 6099 3110 2542 490 238 15423 1721 13075
NM_000599chr253421 2969 1201 1072 394 31263 779 533 23019 247 11162
NM_000618chr1221836 1247 34032 1999 1044 24825 1298 --
NM_000618chr1221836 1247 34032 1999 1044 24825 1298 --
NM_000702chr152218 1667 783 641 601 21784 1545 31390 770 129 --
NM_000719chr12136392 5152 4412 2481 2437 2236 2124 2069 1051 634 448 211 198 --16599 --
NM_000793chr1454433 1397 1235 663 50 14565 --23198 719
NM_000812chr4----196 --
NM_000814chr1534050 4020 1329 1934 --23775 1320
NM_000826chr452643 1833 1773 239 37 ------
NM_000875chr1567012 6798 6236 5458 5278 647 26323 5406 24260 2079 11538
NM_000891chr1752798 1003 962 362 283 --22345 128 --
NM_000901chr462313 2124 1944 882 526 431 12065 ----
NM_000902chr32796 330 11040 --13064
NM_000927chr7199 ------
NM_000949chr5150 1936 --1695
NM_000990chr1163501 3321 2944 1566 1518 362 13812 13682 --
NM_001001433chr2043038 2774 1123 120 --22625 2256 22283 464
NM_001001481chr853444 2636 670 187 109 11185 ----
NM_001001664chr221495 516 --22507 960 1570
NM_001001668chr193771 456 157 33760 1659 307 21607 611 --
NM_001001791chr1051395 1190 210 193 187 ----1406
NM_001001973chr10------135
NM_001002759chr101656 ------
NM_001002860chr1461511 1129 1092 917 874 234 23486 3156 ----
NM_001003652chr1887827 7770 6531 6180 2501 2402 1194 313 26798 411 ----
NM_001003712chr1223087 134 21189 668 1992 --
NM_001004065chr953954 1376 953 900 814 1935 21136 539 12723
NM_001004316chr3--1295 ----
NM_001005375chrY--11768 ----
NM_001005386chr21935 ------
NM_001005463chr101494 ------
NM_001005473chr555959 4721 4438 648 516 35238 4122 1382 26015 2565 11388
NM_001005739chr2----1829 --
NM_001007023chr1454433 1397 1235 663 50 14565 --23198 719
NM_001007097chr942044 1785 1295 223 --44915 4611 3713 212 --
NM_001008239chr1822607 713 23208 330 ----
NM_001008495chr8--12062 ----
NM_001008801chr19160 --1260 11373
NM_001009555chr421640 1404 ------
NM_001009881chr1--1509 ----
NM_001009882chr1--1509 ----
NM_001009899chr375895 4882 4849 4052 393 369 27 24967 4746 ----
NM_001010861chr132322 1959 759 22456 2343 ----
NM_001010888chrX53918 3620 1787 308 148 ------
NM_001010891chr536096 5814 4594 42016 1584 716 73 ----
NM_001010984chr11970 2738 322 1682 1272
NM_001011657chrX2395 95 ------
NM_001011713chr141552 ------
NM_001012393chr1154257 3904 3768 3494 713 1358 13887 --
NM_001012398chr162390 288 ------
NM_001012755chrX25011 3756 --13945 --
NM_001013031chr1062885 2873 2744 2193 1296 191 23476 2932 22443 616 1625
NM_001014797chr10127637 7475 6986 6734 6659 6558 6168 5426 5143 5116 2629 2364 11780 36571 6454 5772 --
NM_001015508chr81274 ------
NM_001017440chr787357 6814 4995 2828 2452 1250 913 364 15832 36724 1902 925 --
NM_001017920chr21143 ------
NM_001017923chr14--2377 147 ----
NM_001017995chr563963 1721 1538 1135 1071 400 44062 3190 1409 104 21644 1389 --
NM_001018041chr6195 --177 --
NM_001018050chr2253262 2205 2154 663 387 1918 53144 3096 2265 1356 120 --
NM_001018052chr2253262 2205 2154 663 387 1918 53144 3096 2265 1356 120 --
NM_001018067chr144592 4351 3899 3349 24570 1275 11630 --
NM_001018068chr144592 4351 3899 3349 24570 1275 11630 --
NM_001018069chr144592 4351 3899 3349 24570 1275 11630 --
NM_001024808chr1272712 2139 2097 1921 1842 677 568 22532 2277 21069 231 --
NM_001025076chr1055327 1943 1760 1369 537 15941 14639 24650 653
NM_001025077chr1046685 5084 2727 1895 37299 363 85 15997 26008 2011
NM_001025079chr384090 3431 3398 3249 1456 961 534 333 1921 1268 --
NM_001025107chr162261 2031 1964 665 186 55 2983 517 --22359 230
NM_001025107chr162261 2031 1964 665 186 55 2983 517 --22359 230
NM_001025780chr91124 ------
NM_001029864chr2052360 2266 2160 1724 927 2406 334 11764 22346 534
NM_001029999chr182501 50 1223 ----
NM_001030001chr141135 ------
NM_001031812chr542207 1488 859 592 ------
NM_001031849chr3--1479 ----
NM_001033045chr251527 1425 1284 1241 79 12832 33242 534 93 1561
NM_001033117chr353942 1837 1253 1131 723 24205 1531 --1273
NM_001033576chr1752546 2448 2081 1811 566 22758 2416 ----
NM_001033578chr861841 1799 853 805 780 645 11631 12178 --
NM_001034954chr1032941 2638 588 ----1579
NM_001034955chr1032941 2638 588 ----1579
NM_001034956chr1032941 2638 588 ----1579
NM_001034957chr1032941 2638 588 ----1579
NM_001035005chr18----1450 --
NM_001037132chr721791 822 32210 1861 1834 11630 --
NM_001037133chr721791 822 32210 1861 1834 11630 --
NM_001037317chr132322 1959 759 22456 2343 ----
NM_001037872chr2157 ------
NM_001039547chr397781 7585 7341 5429 4874 4866 2310 1200 199 27740 6655 37560 6496 2237 --
NM_001039618chr1164344 1373 1274 729 695 349 15741 11452 --
NM_001039697chr9--1452 ----
NM_001039762chr10--12296 ----
NM_001039802chr1----11303 --
NM_001039840chrX65739 5524 4364 3987 1491 760 ------
NM_001039937chr1354175 3537 1643 778 413 33656 3380 1299 ----
NM_001040057chr711368 ------
NM_001040272chr922334 712 1256 21998 324 2603 521
NM_001040402chr463058 2017 1169 1069 520 497 12762 ----
NM_001040424chr2142892 585 455 247 32820 2421 2013 2355 26 12336
NM_001040427chr16149 ------
NM_001040440chr51137 ------
NM_001040446chr51478 ------
NM_001040450chr1532904 2215 757 --52857 2831 2696 2100 358 --
NM_001040453chr1532904 2215 757 --52857 2831 2696 2100 358 --
NM_001040708chr81758 ------
NM_001042355chr1612087 44137 1224 38 23 --24427 783
NM_001042404chr111805 11575 ----
NM_001042410chr21152 ------
NM_001042412chr1612087 44137 1224 38 23 --24427 783
NM_001042440chr521458 595 --11294 11878
NM_001042441chr521458 595 --11294 11878
NM_001042442chr521458 595 --11294 11878
NM_001042443chr521458 595 --11294 11878
NM_001042444chr521458 595 --11294 11878
NM_001042445chr521458 595 --11294 11878
NM_001042446chr521458 595 --11294 11878
NM_001042492chr1732958 2678 960 12994 --12727
NM_001042510chr8161 ------
NM_001042511chr8161 ------
NM_001042533chr333121 1125 512 12982 --11062
NM_001042550chr93431 409 377 ----11903
NM_001042555chr1264663 3354 1539 816 623 383 13162 ----
NM_001042599chr257747 6260 2776 1420 281 46990 6009 5111 1868 12397 --
NM_001042601chr332437 2211 1053 ----21091 1020
NM_001044722chr542207 1488 859 592 ------
NM_001044723chr542207 1488 859 592 ------
NM_001083620chr452641 1831 1771 238 37 ------
NM_001099678chr345655 4945 4510 1837 21905 800 34920 4785 1774 14780
NM_001100108chr1136449 6256 6009 5621 5461 3311 2711 2546 2128 1734 1145 326 284 --25596 215 37116 6235 201
NM_001106chr3108281 7932 6509 3580 2528 2217 2129 1782 1068 735 27617 6812 13695 --
NM_001111chr162261 2031 1964 665 186 55 2983 517 --22359 230
NM_001117chr1852030 1963 896 868 564 1988 11545 2912 514
NM_001167chrX56221 4276 4228 1994 994 25277 1290 66196 6063 4744 4436 4404 4203 25388 4399
NM_001202chr141295 ------
NM_001204chr237731 6232 5032 22755 1003 --15002
NM_001284chr51481 128 ----
NM_001289chrX21038 340 11387 --1478
NM_001402chr621790 1684 ------
NM_001455chr624068 3826 2699 30 33801 1174 1080 14106
NM_001609chr101719 21345 1303 --11490
NM_001616chr222426 704 13217 11334 12508
NM_001621chr732438 241 106 32948 732 725 12158 --
NM_001621chr732438 241 106 32948 732 725 12158 --
NM_001650chr1823365 632 14168 --2751 745
NM_001655chr1121993 587 12181 11429 11722
NM_001681chr12--1768 ----
NM_001704chr61240 ------
NM_001750chr521458 595 --11294 11878
NM_001759chr1264232 4076 3891 2025 1502 1433 --13733 1806
NM_001777chr384090 3431 3398 3249 1456 961 534 333 1921 1268 --
NM_001791chr1----11303 --
NM_001858chr654403 3334 1563 1115 558 ------
NM_001873chr4--1162 ----
NM_001918chr188515 7954 7704 5750 3228 2832 2409 1573 27686 6046 32541 1807 480 --
NM_001938chr11509 ----1651
NM_001939chrX31306 1204 194 22585 281 --1466
NM_001955chr611091 ------
NM_001962chr51516 ------
NM_002006chr433991 3740 2171 23659 1138 15094 --
NM_002017chr1111317 ------
NM_002025chrX39266 8412 7741 57827 7660 7267 3497 3260 22353 2256 --
NM_002040chr2142253 1020 717 234 ----12650
NM_002130chr521378 345 ------
NM_002137chr731921 942 764 22370 1553 163 --
NM_002196chr201722 ------
NM_002196chr201722 ------
NM_002210chr243391 3141 1186 1120 32995 2774 2539 ----
NM_002245chr11516 ------
NM_002291chr7--139 ----
NM_002336chr1223499 1857 11486 --24316 104
NM_002395chr621351 948 ------
NM_002446chr191270 ------
NM_002451chr933588 2654 414 13518 23151 1500 1606
NM_002514chr81202 ------
NM_002545chr1154257 3904 3768 3494 713 1358 13887 --
NM_002601chr21162 ------
NM_002610chr243037 2014 897 246 22384 738 ----
NM_002668chrX------1118
NM_002699chr11360 ------
NM_002710chr121818 ------
NM_002717chr81211 ------
NM_002734chr1721543 1445 ------
NM_002787chr7--1612 ----
NM_002825chr7----1262 --
NM_002828chr18--1801 ----
NM_002836chr201516 ------
NM_002844chr6--1940 --1134
NM_002845chr181424 ------
NM_002957chr9103700 3317 3004 2457 1100 1065 1013 925 896 121 13480 2576 217 --
NM_002971chr3--1947 ----
NM_003029chr12911 351 --21150 584 21252 1188
NM_003034chr1225491 2367 57897 5690 2532 1705 975 16742 --
NM_003045chr1384282 3812 3585 3541 3523 3270 3184 65 44473 4160 1940 319 ----
NM_003051chr111723 ----21407 401
NM_003071chr341464 699 133 110 11736 11454 1729
NM_003108chr254534 2634 2367 2066 424 66945 4899 4597 2546 1222 398 16959 15127
NM_003112chr731097 779 551 11217 ----
NM_003128chr21332 22033 1916 --1372
NM_003161chr1733019 2618 1381 2373 32 ----
NM_003168chr171788 ------
NM_003188chr62597 317 1798 ----
NM_003304chr331588 1291 304 ----11419
NM_003320chr1173908 3850 2854 1398 589 434 338 14208 33385 707 180 --
NM_003348chr1231536 1195 381 ------
NM_003350chr81175 ------
NM_003367chr191523 ------
NM_003374chr51166 ------
NM_003410chrX32832 2203 350 --1804 --
NM_003430chr1941065 677 265 95 11303 170 --
NM_003482chr12112737 2228 1702 943 654 645 636 615 150 79 23 11796 21091 328 22731 871
NM_003507chr22767 54 21483 220 11402 21248 775
NM_003574chr1834653 3846 431 14451 1526 12005
NM_003603chr422026 380 11778 1598 1308
NM_003617chr134512 4006 3181 21599 290 --14211
NM_003655chr17----1151 --
NM_003663chr322332 397 23279 143 ----
NM_003692chr9--1360 ----
NM_003722chr362251 2188 1718 933 635 378 ------
NM_003759chr433124 1650 1060 43861 1370 1363 1345 ----
NM_003763chr2043038 2774 1123 120 --22625 2256 22283 464
NM_003768chr12409 83 21754 447 177 1480
NM_003796chr191166 ------
NM_003799chr1833269 1540 233 --13554 14232
NM_003884chr3--1239 ----
NM_003895chr21--11803 ----
NM_003939chr1043266 2764 1619 935 42754 1599 1420 941 --23690 1480
NM_003941chr712087 --1834 --
NM_003953chr152473 2179 2108 980 102 1889 21141 592 --
NM_003971chr171207 ------
NM_003993chr1----1268 --
NM_004006chrX22085 654 --1506 12260
NM_004007chrX22085 654 --1506 12260
NM_004009chrX22085 654 --1506 12260
NM_004010chrX22085 654 --1506 12260
NM_004011chrX22085 654 --1506 12260
NM_004012chrX22085 654 --1506 12260
NM_004013chrX22085 654 --1506 12260
NM_004014chrX22085 654 --1506 12260
NM_004015chrX22085 654 --1506 12260
NM_004016chrX21999 568 --1420 12174
NM_004017chrX22085 654 --1506 12260
NM_004018chrX21999 568 --1420 12174
NM_004020chrX22085 654 --1506 12260
NM_004021chrX21999 568 --1420 12174
NM_004022chrX21999 568 --1420 12174
NM_004023chrX21999 568 --1420 12174
NM_004028chr1823365 632 14168 --2751 745
NM_004081chrY--11768 ----
NM_004094chr1482932 2639 2582 1988 1923 1104 1001 344 22724 355 12662 --
NM_004133chr812546 ------
NM_004161chr211526 ----11206
NM_004171chr1189132 6308 3354 3291 1818 1387 1255 619 27782 2369 28838 7661 16375
NM_004183chr111746 1528 ----
NM_004200chr1182672 2554 2475 641 621 426 356 218 1304 32438 2208 1273 1704
NM_004225chr8--11166 ----
NM_004235chr91609 ------
NM_004331chr852377 559 532 472 172 ----1642
NM_004342chr732344 1923 452 ----12151
NM_004384chr542207 1488 859 592 ------
NM_004432chr941973 1853 216 52 11759 ----
NM_004458chrX42466 2322 1646 36 31635 835 820 ----
NM_004464chr433840 1361 1162 13282 21242 813 1834
NM_004525chr23396 234 134 ------
NM_004537chr12----11075 --
NM_004588chr1162535 1428 910 868 526 277 33841 1216 585 21300 271 11510
NM_004726chrX74861 3983 3948 1774 1262 1159 753 12271 ----
NM_004731chr1231701 1484 1338 21927 557 ----
NM_004733chr3132 ------
NM_004739chr11134 ------
NM_004745chr846640 4806 654 427 25476 1520 1378 15110
NM_004748chr1531345 809 483 13192 13255 1495
NM_004774chr1752905 2829 2415 873 469 2494 65 --12347
NM_004789chr9------1136
NM_004801chr211404 ------
NM_004859chr1731009 998 89 ----12253
NM_004863chr1494842 4434 4359 4066 3943 3788 1726 878 872 24712 1296 21701 1565 14870
NM_004898chr442706 791 737 212 22495 1910 --11046
NM_004948chr1841449 1403 908 329 188 11378 1310
NM_004956chr723746 669 14119 --12959
NM_004969chr101408 ------
NM_004992chrX168426 8208 8048 7988 7804 7508 6557 6463 5747 3163 3134 2909 1933 1315 810 47 --46567 2987 791 486 1908
NM_004992chrX168426 8208 8048 7988 7804 7508 6557 6463 5747 3163 3134 2909 1933 1315 810 47 --46567 2987 791 486 1908
NM_005010chr721791 822 32210 1861 1834 11630 --
NM_005023chr521145 1044 ----1261
NM_005065chr1455084 4548 3527 1761 108 --24778 4561 14571
NM_005066chr1--1154 ----
NM_005076chr1144208 3955 3542 3326 3081 3019 2789 1644 1412 705 471 221 213 150 ------
NM_005095chr11354 1699 ----
NM_005121chr1712545 --13023 --
NM_005171chr122963 447 ------
NM_005188chr11127202 7065 7049 5780 3005 2718 2517 1985 1975 1959 1873 443 28155 7502 12068 16859
NM_005197chr1444135 4028 1981 1874 31781 1343 399 26025 2389 --
NM_005233chr312273 ------
NM_005235chr257747 6260 2776 1420 281 46990 6009 5111 1868 12397 --
NM_005249chr14--1750 ----
NM_005277chr41427 ------
NM_005316chr11------1204
NM_005326chr16149 ------
NM_005347chr931424 653 647 11067 21610 1262 11289
NM_005359chr1855220 4402 2123 1410 1388 2633 387 24720 1124 --
NM_005375chr62744 228 ------
NM_005402chr711473 ------
NM_005433chr1842325 1064 772 722 ------
NM_005455chr111254 ------
NM_005458chr971821 1654 986 584 341 271 160 --1396 --
NM_005497chr1785677 5646 5518 5310 4479 4431 4135 148 45338 2398 2168 2031 ----
NM_005502chr92405 184 12825 --1805
NM_005504chr1265293 2508 2084 1772 1436 651 26418 533 ----
NM_005575chr5--184 ----
NM_005596chr946108 1904 1112 529 34438 2310 206 21205 875 12291
NM_005604chr672132 2035 938 864 243 231 21 32076 504 156 ----
NM_005610chr11363 ------
NM_005611chr1611203 ------
NM_005717chr11885 ------
NM_005722chr21935 ------
NM_005746chr712447 ------
NM_005759chr254273 3527 3304 3160 1500 ------
NM_005813chr222083 530 --21772 461 --
NM_005832chr311323 ------
NM_005840chrX55590 5483 5421 1226 1069 22631 1026 --1872
NM_005871chr1011039 2396 76 ----
NM_005901chr1887827 7770 6531 6180 2501 2402 1194 313 26798 411 ----
NM_005909chr543899 3863 530 306 1558 --11731
NM_005920chr183720 3642 3180 1532 1518 1510 809 690 12856 --2817 512
NM_005937chr1794051 3731 3631 2610 1308 1009 953 583 533 11396 43699 2958 1390 1383 --
NM_005955chr185183 4201 3383 1554 684 626 55 48 --34513 4218 511 --
NM_005957chr1154908 4836 4744 3994 3642 3258 3006 1176 1066 1058 938 659 514 335 294 1398 13175 14864
NM_005966chr212247 ------
NM_006007chr953539 3060 1667 1284 1123 2605 171 14096 --
NM_006076chr772917 2677 970 825 399 383 208 11272 --12807
NM_006160chr1761532 1293 1207 370 288 141 --11483 21456 440
NM_006194chr14--11263 ----
NM_006203chr575293 5240 3515 1915 1479 618 308 12165 15172 --
NM_006216chr21165 ------
NM_006226chr211150 ------
NM_006241chr322354 2117 ------
NM_006252chr177532 6762 5045 1783 598 225 125 35762 2011 370 --15073
NM_006300chr191869 11602 --1853
NM_006306chrX105701 5394 5244 5076 4617 4257 3805 1251 878 504 34840 4208 472 25588 1334 25671 5195
NM_006357chr2--1158 ----
NM_006372chr6--1419 ----
NM_006434chr1032941 2638 588 ----1579
NM_006526chr2012045 1403 ----
NM_006540chr821333 1300 1293 ----
NM_006544chr1465456 4427 1700 1491 846 571 24161 314 12243 --
NM_006546chr17106559 5868 5048 4764 4340 2594 1979 1613 1456 1076 --11063 26288 2469
NM_006561chr1055327 1943 1760 1369 537 15941 14639 24650 653
NM_006575chr14------1343
NM_006599chr1632267 2232 1803 67359 6918 5468 5429 1125 598 12333 --
NM_006609chr22994 602 ------
NM_006621chr111867 --11746 --
NM_006654chr1264663 3354 1539 816 623 383 13162 ----
NM_006690chr2081698 1445 880 794 630 335 164 70 1234 22118 279 12254
NM_006696chr51107 ------
NM_006729chrX55285 5093 4528 945 735 1872 11000 --
NM_006732chr1931561 843 387 ----11410
NM_006751chr21273 ------
NM_006790chr51113 ------
NM_006811chr201995 ------
NM_006813chr61214 ------
NM_006854chr712048 ------
NM_006943chr2093161 3134 2992 2525 2269 2049 1144 1114 183 1606 1869 --
NM_006947chr4168 ------
NM_006951chr101208 ------
NM_007011chr15116216 5639 5430 4983 4869 4517 2577 2329 612 156 124 45287 5215 5059 2092 --16373
NM_007013chr81872 ------
NM_007030chr594503 3503 3184 1656 826 674 645 422 92 33969 1831 655 ----
NM_007036chr53926 670 279 2775 321 ----
NM_007114chr323304 1098 ------
NM_007137chrX95249 4863 4550 4304 4076 3950 3735 3558 1224 24459 1650 14999 24994 3385
NM_007203chr953954 1376 953 900 814 1935 21136 539 12723
NM_007218chr8130 ------
NM_007238chr2094687 4294 3743 3561 3132 3058 1830 992 623 --44213 1670 1535 581 11697
NM_007245chr16----1224 --
NM_007249chr13139014 8056 7686 6459 6117 3330 2492 1249 1241 918 711 553 167 1940 11140 --
NM_007285chr16--1480 ----
NM_007287chr32796 330 11040 --13064
NM_007288chr32796 330 11040 --13064
NM_007289chr32796 330 11040 --13064
NM_007308chr41709 ------
NM_007331chr452782 1710 1067 737 397 --1910 12114
NM_012081chr542609 2268 1123 1050 23677 978 ----
NM_012095chr1023255 2593 1296 23182 2554 33209 1198 748
NM_012137chr14713 693 641 43 32697 2585 780 ----
NM_012141chr1354175 3537 1643 778 413 33656 3380 1299 ----
NM_012175chr111191 ------
NM_012193chr1155271 5005 4735 3381 1454 25280 1954 24861 1307 --
NM_012210chr9--11569 ----
NM_012214chr225992 1308 13896 21694 1443 24493 1470
NM_012234chr322760 2642 ----1980
NM_012281chr71868 ------
NM_012288chr653790 1816 823 595 503 15783 21540 53 11683
NM_012306chr12113285 2966 2709 2680 2634 2212 1293 853 794 684 603 --22879 923 --
NM_012316chr1104975 4821 4662 4527 3849 3811 2222 2216 1892 316 15531 25119 4345 15146
NM_012328chr711099 ------
NM_012399chr2211323 ------
NM_013230chrY2652 414 21235 1206 1253 --
NM_013231chr1444160 4113 3017 520 33179 493 298 13497 --
NM_013233chr2--21446 1101 ----
NM_013257chr861841 1799 853 805 780 645 11631 12178 --
NM_013261chr423408 386 1411 1208 13088
NM_013262chr611391 31217 541 281 1374 --
NM_013263chr161157 ------
NM_013279chr1121948 769 ------
NM_013322chr73378 325 177 1232 11084 --
NM_013354chr8--11030 ----
NM_013363chr31150 ------
NM_013396chr2111149 ------
NM_013423chrX1149 ------
NM_013427chrX1149 ------
NM_013450chr21809 ----11140
NM_013989chr1454433 1397 1235 663 50 14565 --23198 719
NM_014048chr1684677 3445 3270 2089 1330 1019 937 505 33309 1725 393 11500 --
NM_014106chr152979 142 --1200 1381
NM_014112chr8105471 5195 5040 4354 4264 3636 1648 1048 986 492 25122 465 ----
NM_014141chr743262 1795 681 338 13365 23922 126 1531
NM_014155chr1135792 1666 897 12517 26414 222 --
NM_014159chr3137 ------
NM_014166chr132957 891 1104 ----
NM_014214chr181333 ------
NM_014240chr383931 3723 3634 1535 852 692 543 106 --23858 626 33885 2541 1451
NM_014280chr11872 ------
NM_014372chr111286 ------
NM_014577chr22------1876
NM_014630chr1543329 1567 832 771 1675 1669 --
NM_014634chr2283617 3390 2771 1358 1037 337 209 87 11256 33108 1401 1370 --
NM_014683chr1721972 428 31584 1520 404 ----
NM_014707chr711468 ------
NM_014711chr161678 22106 1685 ----
NM_014730chr12104874 4721 4569 4551 3672 1982 1895 1859 1522 1010 13989 24205 3983 1148
NM_014730chr12104874 4721 4569 4551 3672 1982 1895 1859 1522 1010 13989 24205 3983 1148
NM_014751chr831809 329 104 11435 --1484
NM_014755chr244112 3853 2913 483 12645 --1380
NM_014765chr182020 1826 1763 1723 1698 1680 999 841 32319 342 87 ----
NM_014776chr1212979 ------
NM_014810chr143352 2889 472 354 ----12356
NM_014812chr111805 11575 ----
NM_014819chr51853 12162 ----
NM_014827chr111487 ------
NM_014840chr1242963 1176 708 362 12818 1993 12376
NM_014850chr353942 1837 1253 1131 723 24205 1531 --1273
NM_014873chr133158 3008 696 33334 3122 1860 ----
NM_014877chr1785922 5814 5347 2680 1489 1363 1116 491 37171 6261 1542 ----
NM_014892chr6--1197 ----
NM_014897chr1733270 3222 310 ----22483 2136
NM_014906chr1744092 2977 2635 595 1509 ----
NM_014920chr611279 ----13518
NM_014926chr311107 ------
NM_014932chr321966 1930 ----1750
NM_014953chr1323917 635 33404 1214 580 --11161
NM_014988chr44922 906 866 592 12310 12452 --
NM_015011chr1311153 ------
NM_015026chr1233555 3356 997 34735 3605 1677 14221 --
NM_015035chr20126326 6209 5319 5002 4498 2644 2479 2143 1592 1579 1082 494 14801 46519 6298 4354 2606 12664
NM_015042chr1573544 3368 2761 1472 1019 1005 710 2945 141 21322 704 --
NM_015045chr103417 401 314 11493 --1781
NM_015064chr1263308 2560 2465 1192 392 226 1833 23579 3450 13606
NM_015071chr544112 1995 501 290 --13942 44350 3969 1814 874
NM_015074chr153891 3300 3066 1619 1123 13087 34026 3371 1256 24986 1283
NM_015115chr463058 2017 1169 1069 520 497 12762 ----
NM_015176chr111770 ------
NM_015191chr1141740 576 405 349 1452 2770 763 12764
NM_015208chr1824015 230 13425 13990 23622 1488
NM_015216chr51129 ------
NM_015236chr4--11397 ----
NM_015247chr1612087 44137 1224 38 23 --24427 783
NM_015269chr1--1509 ----
NM_015271chr433327 1216 1061 12877 --12968
NM_015285chr1842107 1978 196 162 11784 --22290 1907
NM_015310chr877662 6713 5747 5540 2059 1859 466 47655 7542 5402 3352 37271 764 537 --
NM_015375chr174300 3655 1992 1562 901 741 145 11630 21919 876 21946 295
NM_015385chr1032941 2638 588 ----1579
NM_015455chr534020 1592 72 23257 2948 1729 --
NM_015525chr611041 ------
NM_015541chr321235 52 1192 11319 --
NM_015568chr2024264 748 33264 2956 808 24184 903 12807
NM_015569chr153797 3457 3414 573 111 13820 ----
NM_015601chr10191 ------
NM_015608chr101630 ------
NM_015640chr144592 4351 3899 3349 24570 1275 11630 --
NM_015840chr162261 2031 1964 665 186 55 2983 517 --22359 230
NM_015841chr162261 2031 1964 665 186 55 2983 517 --22359 230
NM_015878chr812165 ----12246
NM_015975chrX21513 388 11529 11621 --
NM_016022chr11688 ------
NM_016096chr8161 ------
NM_016125chr171241 ------
NM_016131chr2--1891 ----
NM_016206chr367141 5952 2748 2632 2572 2097 46019 1715 1493 1274 --12523
NM_016230chr61155 ------
NM_016252chr2196 ------
NM_016260chr276936 6860 6725 4658 2455 1733 821 21951 1645 1150 12228
NM_016277chr6--1454 ----
NM_016281chr121823 ------
NM_016287chr122040 414 ----11879
NM_016316chr2157 ------
NM_016374chr11439 ------
NM_016374chr11439 ------
NM_016424chr1731361 451 194 --137 --
NM_016507chr173869 726 162 --196 12749
NM_016513chr611279 ----13518
NM_016516chr2----1829 --
NM_016607chrX31658 1465 622 --11538 1506
NM_016621chr1164176 3657 3544 1515 1321 813 11221 24009 3535 13916
NM_016937chrX--1672 ----
NM_016953chr274938 2288 2125 2019 1040 485 199 21000 550 12263 --
NM_017412chr81871 1137 ----
NM_017420chr1423130 2591 13154 13574 --
NM_017447chr2174314 3655 3603 2770 1320 1049 126 23453 685 14086 --
NM_017519chr61536 ------
NM_017599chr1222087 206 ------
NM_017628chr454701 4661 3993 294 249 1335 ----
NM_017637chr959293 9145 8046 7371 7184 16843 11225 18694
NM_017650chr765952 5482 3759 1286 1182 591 13839 --14438
NM_017672chr1531245 547 219 ------
NM_017686chr111036 ------
NM_017742chr1821853 1231 ------
NM_017745chrX--1471 ----
NM_017786chr82258 167 ------
NM_017849chr253004 2983 1156 773 640 1590 ----
NM_017860chr13815 663 141 ------
NM_017902chr1055672 4298 2042 1363 1242 23480 1282 1157 --
NM_017919chr964834 4739 4295 2322 1348 971 44577 2146 870 230 ----
NM_017938chrX11413 ------
NM_018046chr541298 724 647 540 1449 ----
NM_018086chr2--1553 ----
NM_018089chr21152 ------
NM_018126chr411031 ------
NM_018133chr31739 ------
NM_018182chr172844 365 ------
NM_018206chr161103 ------
NM_018293chr31301 --11044 12522
NM_018299chr853444 2636 670 187 109 11185 ----
NM_018317chr4----1348 --
NM_018323chr431882 445 261 ------
NM_018373chr1465341 2337 1921 1679 810 313 34274 997 943 21462 1329 --
NM_018374chr734704 4625 68 ------
NM_018439chr1822344 259 ------
NM_018440chr852726 2345 1374 1026 175 13229 16325 36352 5920 1986
NM_018559chr13122 ------
NM_018569chr421456 1387 ------
NM_018590chr1021599 1150 ------
NM_018650chr12221 49 ------
NM_018683chr20--11715 ----
NM_018710chr821010 985 --1915 --
NM_018719chr71299 ------
NM_018945chr662610 2469 2366 2339 646 340 --12958 --
NM_018958chr1522578 2550 21632 1445 ----
NM_018970chr732716 1048 123 12967 1755 1383
NM_019026chr11237 ------
NM_019084chr1011758 ------
NM_020116chr421628 1467 ------
NM_020122chr245569 4905 4624 1254 1195 13675 24882 3702
NM_020133chr675935 5398 5008 3958 1761 1660 1466 22319 1737 26089 555 15828
NM_020144chr73777 601 417 --11529 --
NM_020205chr173270 3117 2872 823 549 243 23 1375 23075 1257 --
NM_020336chr20--13715 13129 12986
NM_020420chrY--11768 ----
NM_020432chr71807 ------
NM_020466chr644877 4660 4397 1747 23361 940 44746 4311 4220 483 --
NM_020699chr164942 3981 3968 3952 780 562 15296 24657 3693 --
NM_020718chr1646368 4316 687 547 1222 --15786
NM_020727chr2121468 1175 12464 22751 31 1142
NM_020728chr762868 2820 2654 2294 956 332 22123 154 22795 2191 --
NM_020732chr61536 ------
NM_020734chr1233297 2570 1255 ----2998 207
NM_020739chr1531345 809 483 13192 13255 1495
NM_020772chr1778286 2753 2678 2049 1246 371 181 38155 5363 395 ----
NM_020809chr112438 99 11914 ----
NM_020810chr1432403 1138 415 1421 22560 2462 --
NM_020819chr61179 ------
NM_020841chr1223087 134 21189 668 1992 --
NM_020870chr422084 404 ------
NM_020871chrX1372 ------
NM_020899chr1732216 1555 242 1795 31986 803 279 12042
NM_020919chr2------1210
NM_020935chr243980 1496 1177 597 --13586 21584 1250
NM_020948chr143204 1215 957 367 12863 ----
NM_020956chr19134383 3924 3913 3898 3348 3222 1843 1765 1687 1255 818 447 158 13045 64065 3695 3311 3155 1580 992 --
NM_020993chr1272712 2139 2097 1921 1842 677 568 22532 2277 21069 231 --
NM_021003chr141645 ------
NM_021069chr422026 380 11778 1598 1308
NM_021116chr7138749 8627 8430 8212 6889 6453 6287 6281 5944 5936 5873 1670 1284 --56976 2839 1897 1615 692 27677 3303
NM_021140chrX1463 ------
NM_021148chr721807 702 11567 ----
NM_021159chr421364 200 ----11537
NM_021163chr713431 43369 2807 1279 304 2743 583 --
NM_021176chr211881 21902 500 1333 11610
NM_021629chr331973 709 536 21624 179 23239 1900 33635 3368 1927
NM_021638chr453288 1980 1866 884 481 44766 1960 1359 278 23219 1011 1557
NM_021912chr1534050 4020 1329 1934 --23775 1320
NM_022048chr1544415 2453 2055 1665 --14664 --
NM_022079chr10191 ------
NM_022130chr5--1424 ----
NM_022144chrX1126 ------
NM_022145chr5----1438 --
NM_022154chr4--1464 ----
NM_022166chr1676088 4458 2204 1791 1533 942 731 45324 4195 4071 1996 13846 13828
NM_022340chr362874 2848 1366 162 127 73 23264 3183 2958 824 1985
NM_022372chr16----1500 --
NM_022476chr162390 288 ------
NM_022484chr7----11119 --
NM_022648chr2104099 3978 3799 3602 3480 2980 1586 1016 960 917 23750 1688 ----
NM_022758chr662827 2292 1265 1113 1001 65 12429 12375 12662
NM_022763chr322244 991 12118 ----
NM_022843chr131307 ------
NM_022894chr21516 ------
NM_022977chrX42466 2322 1646 36 31635 835 820 ----
NM_023929chr812427 11853 22732 631 --
NM_023934chrX11656 ------
NM_024055chr5--1676 ----
NM_024104chr19------11018
NM_024122chrX--140 ----
NM_024294chr662827 2292 1265 1113 1001 65 12429 12375 12662
NM_024345chr954921 2182 2072 1798 976 14340 11725 11752
NM_024524chr321287 601 ------
NM_024582chr411037 ------
NM_024594chr531663 484 60 --11558 --
NM_024639chr642833 2774 2558 2466 1961 ----
NM_024665chr334044 3179 601 ------
NM_024721chr8----1786 --
NM_024744chr252051 1915 1737 998 485 1778 ----
NM_024751chr41483 11998 ----
NM_024761chr954870 3524 3505 1151 605 11740 21883 124 1212
NM_024770chr286425 5939 4990 4968 2680 1966 1353 853 14196 22099 693 24674 2126
NM_024834chr1031839 475 92 132 --21235 802
NM_024835chr171147 ------
NM_024949chr414071 14274 33076 468 304 21827 1101
NM_024953chr124843 689 681 527 164 ----
NM_024969chr21784 ------
NM_024991chr1032941 2638 588 ----1579
NM_024993chr21423 ----148
NM_025133chr2--1816 ----
NM_025160chr113040 ------
NM_030625chr101929 ----1120
NM_030647chr746062 5913 4335 1483 25015 1546 12408 --
NM_030648chr445255 4418 3674 219 21558 1056 ----
NM_030650chr254265 4057 3592 3301 1557 23829 3575 14192 14219
NM_030755chr1432280 490 330 22334 1195 ----
NM_030791chr1421563 602 21216 71 ----
NM_030806chr1158537 8527 8500 7930 7911 7895 7414 7068 6946 5938 5836 3601 3487 2698 353 48996 7297 5694 3760 26658 2809 --
NM_030816chr133016 1385 804 --13137 --
NM_030938chr171181 ------
NM_031243chr731921 942 764 22370 1553 163 --
NM_031371chr11439 ------
NM_031371chr11439 ------
NM_031417chr1992471 2262 1096 1074 1007 992 761 631 565 ----42703 2247 697 404
NM_031427chr1462050 1959 1781 1733 1572 457 11057 24318 1708 14345
NM_031468chr787357 6814 4995 2828 2452 1250 913 364 15832 36724 1902 925 --
NM_031483chr2053483 3003 831 415 30 12326 2789 560 --
NM_031935chr11156 ------
NM_032105chr1107576 5420 4962 4942 4892 3080 2895 2390 1612 672 37423 6303 5897 37492 7457 2365 --
NM_032121chrX42632 2604 1129 192 11046 1995 --
NM_032124chr1811050 ------
NM_032199chr1043853 2403 2363 1555 1348 2379 358 --
NM_032205chr81147 ------
NM_032256chr12--1105 ----
NM_032265chr17--1104 ----
NM_032312chr21765 ------
NM_032373chr1013941 44391 4351 3749 1792 24075 3678 13575
NM_032433chr1921493 211 ------
NM_032440chr1011127 12772 ----
NM_032441chrX2395 95 ------
NM_032445chr1532524 2236 1812 32260 2030 193 ----
NM_032457chr443281 1097 1066 503 12978 --159
NM_032505chr321014 280 --1400 12726
NM_032539chrX----1826 --
NM_032557chr41873 ----1383
NM_032663chr1241564 435 339 269 1540 21364 1324 --
NM_032778chr333121 1125 512 12982 --11062
NM_032839chr32472 167 ------
NM_032859chr1333180 2644 999 23387 3186 ----
NM_032876chr1441794 735 657 624 21938 80 ----
NM_032906chr4182 ------
NM_033121chr1251706 1575 1427 740 114 ------
NM_033133chr1773415 3154 3099 2332 744 413 219 --13283 42384 1429 896 407
NM_033138chr732344 1923 452 ----12151
NM_033139chr732344 1923 452 ----12151
NM_033140chr732344 1923 452 ----12151
NM_033143chr434171 1692 1493 13613 21573 1144 11165
NM_033157chr732344 1923 452 ----12151
NM_033224chr767732 2631 2149 1583 832 344 2869 686 35259 2302 1663 --
NM_033228chr5122 ------
NM_033272chr2--1157 ----
NM_033389chr1764715 4339 3386 1904 447 51 1279 21595 532 --
NM_033495chrX----1949 --
NM_033550chr2042338 1807 775 639 2853 187 12166 --
NM_033631chr1103698 3666 3280 3247 3196 2718 1009 952 148 95 13799 ----
NM_033637chr1043266 2764 1619 935 42754 1599 1420 941 --23690 1480
NM_033656chr2134405 492 224 34962 4551 1554 34464 1100 369 --
NM_052834chr1842107 1978 196 162 11784 --22290 1907
NM_052845chr1232834 950 594 1272 1975 12283
NM_052875chr1162182 1578 1527 1359 442 228 --11699 --
NM_052918chr1073084 3072 2943 2392 1495 390 26 23675 3131 22642 815 1824
NM_052966chr132983 2408 2378 13277 42910 2424 706 542 1164
NM_052978chr14----124 --
NM_053016chr987538 6848 6674 6632 6196 6153 5179 1110 21735 808 36775 3201 3175 15648
NM_053023chr1143282 2915 975 21 12864 ----
NM_054016chr151310 744 696 537 131 --21254 671 --
NM_054016chr151310 744 696 537 131 --21254 671 --
NM_054016chr151310 744 696 537 131 --21254 671 --
NM_054027chr531609 675 553 11589 12193 22221 1866
NM_057169chr1212979 ------
NM_057170chr1212979 ------
NM_057175chr411973 ------
NM_058237chr142198 36 ----126
NM_080546chr93804 621 242 31589 679 359 ----
NM_080618chr201216 1868 --11022
NM_080743chr651877 1835 1021 978 603 ----12200
NM_080745chr15144 ------
NM_080821chr2042148 1825 938 102 1684 ----
NM_080840chr201516 ------
NM_080841chr201516 ------
NM_080872chr832716 1504 716 33700 326 159 21290 606 --
NM_130385chr1172631 2376 2271 799 364 357 340 12341 ----
NM_130838chr1511703 ------
NM_130839chr1511703 ------
NM_130850chr141295 ------
NM_130851chr141295 ------
NM_133329chr211342 --11628 --
NM_133334chr475698 5302 4617 2165 1643 265 168 15691 21736 506 --
NM_133445chr982440 1480 1239 757 705 697 575 489 1852 ----
NM_133478chr242014 1721 985 819 --3912 777 507 31966 1838 939
NM_134325chr1--21190 640 11549 21660 1571
NM_134447chr191166 ------
NM_138333chr922386 1769 1907 --22358 61
NM_138338chr2253262 2205 2154 663 387 1918 53144 3096 2265 1356 120 --
NM_138426chr71536 ------
NM_138444chr1344379 3206 3099 743 44443 1621 1571 1426 1590 --
NM_138694chr673700 3140 2322 1461 1360 1001 527 2231 36 ----
NM_138713chr1632267 2232 1803 67359 6918 5468 5429 1125 598 12333 --
NM_138714chr1632267 2232 1803 67359 6918 5468 5429 1125 598 12333 --
NM_138735chr211386 ------
NM_138775chr112521 321 1623 --1227
NM_138782chr51508 ------
NM_138959chr166469 6257 6165 4783 4271 667 1829 35932 4818 4557 --
NM_139072chr21750 ----1651
NM_139207chr121107 --11749 --
NM_144571chr497021 2607 2572 2443 2176 1843 1716 1074 378 14456 11273 --
NM_144590chr1042743 1997 1011 355 22882 2212 ----
NM_144599chr1561345 1238 992 783 611 497 25097 1864 ----
NM_144657chrX1644 ------
NM_144658chrX--2328 219 ----
NM_144664chr1112082 1630 ----
NM_144967chrX2780 107 2805 94 ----
NM_144973chr1273549 3335 1877 1829 1106 787 97 1148 21804 1682 --
NM_144992chr21540 --196 --
NM_145055chr1822607 713 23208 330 ----
NM_145117chr111649 ----12266
NM_145203chr131220 ------
NM_145247chr101656 ------
NM_145251chr1421525 286 ------
NM_145259chr276682 5715 5366 4622 2741 2529 136 11823 ----
NM_145307chr1044636 3308 284 61 42912 2869 303 92 2999 223 --
NM_145331chr62597 317 1798 ----
NM_145912chr22144271 3568 3364 3218 2995 2859 1836 1242 657 523 507 450 236 50 24321 3156 43245 1824 590 515 11107
NM_147150chr953954 1376 953 900 814 1935 21136 539 12723
NM_147175chrX--1179 ----
NM_148174chr812165 ----12246
NM_152253chr2263821 3588 1448 873 474 436 13161 1323 11250
NM_152263chr186105 4564 4218 1918 1672 1218 1170 1008 --55016 4883 4193 1444 1145 34532 3965 3901
NM_152265chr11562 11515 11268 --
NM_152271chr8--1768 ----
NM_152332chr1412233 12111 --21046 86
NM_152407chr543112 2251 630 90 1750 1759 --
NM_152409chr522614 1106 13051 31081 946 442 12676
NM_152433chr1111266 165 ----
NM_152527chr241614 528 509 69 --21966 1829 --
NM_152529chr251527 1425 1284 1241 79 12832 33242 534 93 1561
NM_152549chr51137 ------
NM_152556chr712507 ------
NM_152660chr11859 ------
NM_152787chrX11267 12459 23232 2949 1518
NM_152789chr711368 ------
NM_152793chr734967 3678 3663 54761 4432 4014 3981 1895 13835 --
NM_152890chr1142 ------
NM_152896chr91662 ------
NM_152924chr15116216 5639 5430 4983 4869 4517 2577 2329 612 156 124 45287 5215 5059 2092 --16373
NM_153013chr532049 1797 286 1502 --12176
NM_153182chr333121 1125 512 12982 --11062
NM_153184chr311363 ------
NM_153261chr16--11590 ----
NM_153332chr8150 11032 ----
NM_153367chr1073369 2802 2770 920 697 658 268 ----13484
NM_153487chr664284 4192 3091 1077 456 100 34644 1027 897 21746 511 11764
NM_153619chr1562476 2312 931 797 308 44 33485 2982 2955 ----
NM_170665chr1263391 3077 2855 1602 1091 652 14603 22817 163 --
NM_170709chr861841 1799 853 805 780 645 11631 12178 --
NM_170721chr1711328 ------
NM_171998chrX3895 603 242 22371 1591 --1869
NM_172071chr146585 6279 2649 2160 12853 1131 --
NM_172344chr211342 --11628 --
NM_173039chr111180 ------
NM_173060chr521458 595 --11294 11878
NM_173061chr521458 595 --11294 11878
NM_173063chr521458 595 --11294 11878
NM_173082chr611120 --126 --
NM_173167chr1752546 2448 2081 1811 566 22758 2416 ----
NM_173214chr1632267 2232 1803 67359 6918 5468 5429 1125 598 12333 --
NM_173463chr443818 3415 1069 928 --2942 580 --
NM_173478chr171367 1779 ----
NM_173511chr2--32982 2645 631 ----
NM_173552chr322124 1741 ------
NM_173582chr1155352 4810 4533 4418 1493 36102 5859 386 55279 5043 1638 1420 1287 --
NM_173667chr552275 1644 550 488 125 --12017 12027
NM_173834chrX1105 ------
NM_173851chr823743 166 33340 1331 337 11569 --
NM_174909chr51285 1582 ----
NM_175061chr732140 1989 505 ------
NM_175624chr1277803 5692 5487 5279 2408 1798 701 12568 22467 482 35441 2234 2228
NM_175625chr1277803 5692 5487 5279 2408 1798 701 12568 22467 482 35441 2234 2228
NM_175854chr1322290 2136 1474 ----
NM_175861chr1255599 1677 1514 209 87 21177 380 15381 13838
NM_175863chr61536 ------
NM_175920chr5--184 ----
NM_177947chrX31658 1465 622 --11538 1506
NM_177948chrX31658 1465 622 --11538 1506
NM_177952chr141645 ------
NM_177972chr1173908 3850 2854 1398 589 434 338 14208 33385 707 180 --
NM_178037chr1263308 2560 2465 1192 392 226 1833 23579 3450 13606
NM_178038chr1263308 2560 2465 1192 392 226 1833 23579 3450 13606
NM_178151chrX97784 7539 7489 6239 6099 3110 2542 490 238 15423 1721 13075
NM_178152chrX97784 7539 7489 6239 6099 3110 2542 490 238 15423 1721 13075
NM_178153chrX97784 7539 7489 6239 6099 3110 2542 490 238 15423 1721 13075
NM_178454chr12714 586 1726 ----
NM_180989chr131170 ------
NM_181361chr311323 ------
NM_181489chr3116471 6442 5812 5057 4842 4760 4174 1879 1517 961 653 21597 994 25551 1154 --
NM_181504chr534080 3553 2807 12976 11322 1406
NM_181521chr1676402 5783 2588 2070 1570 495 405 57113 6960 5806 5430 778 26945 6863 --
NM_181523chr534080 3553 2807 12976 11322 1406
NM_181524chr534080 3553 2807 12976 11322 1406
NM_181672chrX31931 1594 1410 ------
NM_181673chrX31931 1594 1410 ------
NM_182511chr1811257 ------
NM_182515chr1966249 4867 2631 845 557 108 12383 34595 977 27 64756 4211 4185 4058 54 22
NM_182678chr2--1158 ----
NM_182688chr2182158 2013 1959 1911 1753 1522 922 715 32080 518 104 32207 1886 849 1876
NM_182691chr731242 1212 133 ------
NM_182692chr731242 1212 133 ------
NM_182700chr721792 372 ------
NM_182758chr1512458 13723 ----
NM_182762chr756247 5253 2188 2028 446 --43853 2163 462 41 --
NM_182767chr1251724 1621 505 227 96 --21930 1431 --
NM_182896chr31446 ----11368
NM_182964chr111649 ----12266
NM_182970chr20124134 3823 3804 3409 3367 3068 1477 1272 1111 467 439 77 ----1987
NM_183227chr6--1454 ----
NM_183376chr1552500 1867 413 372 126 22461 1661 ----
NM_194286chr1274904 4066 2374 1996 1869 1850 1110 24310 3862 ----
NM_194291chr822909 2158 ------
NM_194314chr144035 3612 1839 787 45069 4074 2020 702 11649 11621
NM_194434chr1834653 3846 431 14451 1526 12005
NM_198056chr351926 1886 1668 1506 232 1146 21945 1475 1279
NM_198086chr1441794 735 657 624 21938 80 ----
NM_198439chr1111266 165 ----
NM_198549chr173310 3262 2052 1049 489 222 51 --33237 2901 644 --
NM_198560chr372887 2816 2545 2538 2369 1196 682 12770 33027 2945 2317 --
NM_198568chr63871 791 330 1498 ----
NM_198595chr453288 1980 1866 884 481 44766 1960 1359 278 23219 1011 1557
NM_198793chr384086 3427 3394 3245 1452 957 530 329 1917 1264 --
NM_198794chr14------1343
NM_198859chr354254 4229 3902 1214 1178 11017 44992 3927 3175 140 --
NM_198956chr721792 372 ------
NM_199072chr743157 690 630 512 23194 2618 2605 370 --
NM_199131chr1051107 729 710 576 329 ----22482 75
NM_199132chr19160 --1260 11373
NM_199324chr431137 612 173 ----23065 2490
NM_199461chr10103662 3216 2858 2448 2204 1359 1122 379 287 87 21370 1263 22423 2289 --
NM_199462chr174300 3655 1992 1562 901 741 145 11630 21919 876 21946 295
NM_201521chr61417 ------
NM_201522chr61417 ------
NM_201523chr61417 ------
NM_201559chr624068 3826 2699 30 33801 1174 1080 14106
NM_201591chr41427 ------
NM_201592chr41427 ------
NM_201613chr121752 ----158
NM_203364chr1111072 ------
NM_203406chr532411 2013 684 22328 769 ----
NM_203451chr1342343 1991 263 69 ------
NM_206853chr6--23345 1507 ----
NM_206909chr877662 6713 5747 5540 2059 1859 466 47655 7542 5402 3352 37271 764 537 --
NM_207012chr1023255 2593 1296 23182 2554 33209 1198 748
NM_207291chr191523 ------
NM_207303chr1053494 3120 2888 509 477 33837 3734 3280 1979 190
NM_207343chr111129 ------
NM_207387chr1771527 1419 596 331 252 165 54 31815 1486 419 ----
NM_207406chr445751 3951 2208 923 35610 4062 1748 1556 11708
NM_212471chr1721543 1445 ------
NM_212472chr1721543 1445 ------
NM_213589chr264730 3896 3556 2058 584 297 13669 ----