TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3156-3p
miRNA Sequence: CUCCCACUUCCAGAUCUUUCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001106chr3117807 7527 6836 6399 3823 3709 3336 3221 3029 2861 2752 11799 18157 16547
NM_021116chr7138226 7683 7149 6429 2805 2659 2135 1832 1782 1667 1584 1549 458 23420 41 --28043 515
NM_022719chr22113238 1444 1328 962 836 826 788 684 618 397 385 23202 1068 22988 1208 1902