TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3156-5p
miRNA Sequence: AAAGAUCUGGAAGUGGGAGACA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr511040 ------
NM_000021chr144825 250 196 75 1981 ----
NM_000024chr51396 --1366 --
NM_000025chr81443 ------
NM_000037chr822441 2417 ----1694
NM_000038chr531888 1455 1382 1177 --1702
NM_000045chr61396 ------
NM_000052chrX63282 2367 732 365 304 95 11221 --11364
NM_000080chr17149 ------
NM_000084chrX86976 5701 5439 5354 5051 4410 1701 402 35983 2364 1737 1284 16703
NM_000092chr243779 3524 2814 1453 1410 43486 3326 543 459 --
NM_000109chrX72188 2174 2111 1746 965 844 215 ------
NM_000112chr565539 4694 4151 4107 3534 1561 --24962 4194 --
NM_000115chr1342514 2480 2288 347 ----12301
NM_000138chr1552345 2138 1656 759 444 12221 ----
NM_000141chr1031153 337 156 21401 461 ----
NM_000142chr441556 1137 1123 1111 ------
NM_000158chr3135 ------
NM_000163chr522366 1567 --22082 545 --
NM_000165chr6----2617 432 11393
NM_000166chrX--1632 ----
NM_000167chrX11793 2658 106 ----
NM_000176chr543247 2764 2529 1228 13482 ----
NM_000187chr3246 36 ------
NM_000188chr101239 ------
NM_000189chr242262 825 440 431 ----12005
NM_000202chrX11434 --23168 3070 11386
NM_000210chr231973 1516 396 ------
NM_000214chr2041290 1199 1193 292 ------
NM_000217chr1254774 3711 3606 1553 162 15382 1764 --
NM_000242chr1032707 2271 1891 12131 --12631
NM_000248chr332223 283 57 --21081 338 --
NM_000252chrX2376 269 --11471 --
NM_000253chr41752 --1118 --
NM_000264chr932635 1250 658 12382 ----
NM_000288chr61111 ------
NM_000304chr17--11088 ----
NM_000314chr1032310 2291 1143 ------
NM_000315chr11186 ------
NM_000319chr122904 246 --11128 --
NM_000321chr1351680 1611 1438 1226 683 ----1565
NM_000322chr631502 1150 63 1636 ----
NM_000325chr41452 ------
NM_000332chr6105758 5312 5020 4966 4369 2866 2229 1913 1708 574 --21827 1087 11741
NM_000333chr331079 877 755 ------
NM_000337chr5106116 4825 4602 4153 2239 2022 1798 1757 1677 900 --46464 6107 2604 2336 --
NM_000338chr1551108 1088 1022 402 383 ------
NM_000340chr31308 ------
NM_000346chr1721347 602 --11810 --
NM_000358chr52538 59 ------
NM_000362chr2263481 2833 2347 944 867 139 ------
NM_000369chr1431433 1284 678 ------
NM_000387chr32569 563 1228 ----
NM_000390chrX32096 346 144 32638 2299 318 ----
NM_000393chr222139 1598 2206 138 11818 --
NM_000408chr22622 510 --12839 --
NM_000430chr1763713 3356 3022 2459 1306 1291 31270 704 481 ----
NM_000439chr552535 2233 721 585 58 --2598 511 --
NM_000448chr1142758 705 369 287 --32736 2702 2088 12937
NM_000451chrX21638 438 ------
NM_000461chr364568 4434 4416 1650 1520 933 --22806 1665 --
NM_000462chr151204 ------
NM_000474chr7----1131 --
NM_000486chr1252759 2508 1021 820 88 ------
NM_000489chrX43314 2822 369 289 --147 --
NM_000493chr62816 125 --11051 --
NM_000516chr201133 ------
NM_000533chrX61566 1490 1258 1225 580 159 11322 ----
NM_000555chrX146040 5706 5282 5136 4840 4786 2770 2265 2186 1942 1524 1019 906 452 12134 25892 5852 --
NM_000560chr11523 --1679 --
NM_000601chr72294 57 ------
NM_000610chr1162700 2449 2413 2245 1937 692 ------
NM_000618chr12136030 5672 5467 5142 4866 4812 4145 4072 2389 1687 1605 1593 227 15624 56222 4388 2207 2170 1360 14024
NM_000618chr12136030 5672 5467 5142 4866 4812 4145 4072 2389 1687 1605 1593 227 15624 56222 4388 2207 2170 1360 14024
NM_000619chr121468 ------
NM_000633chr1883975 3963 3592 3434 3313 3278 662 255 13842 35026 3941 1908 --
NM_000635chr19--1397 ----
NM_000681chr1011362 ------
NM_000684chr1021171 56 --1310 11034
NM_000701chr11301 ------
NM_000724chr1021825 671 --1388 --
NM_000726chr21259 11219 ----
NM_000785chr12----157 1270
NM_000788chr421443 1136 --1135 --
NM_000800chr52555 253 11252 11644 --
NM_000809chr4149131 8999 8300 7975 7710 7391 3723 3221 2560 2291 1986 1686 1193 439 18776 26202 1525 --
NM_000813chr543975 1365 466 223 ----13405
NM_000814chr1543306 3054 2970 952 --21470 1048 --
NM_000826chr422051 982 12560 ----
NM_000829chr1142110 1738 256 87 ----1200
NM_000840chr71452 ------
NM_000859chr571525 539 430 395 233 188 157 ------
NM_000875chr15106513 5954 5627 4554 4323 2590 2194 1295 755 113 11157 1806 --
NM_000876chr631391 911 898 ------
NM_000891chr1732521 577 542 --11109 --
NM_000895chr12130 2130 23 ----
NM_000901chr43758 562 288 --22069 1559 --
NM_000902chr34915 848 723 198 --12341 --
NM_000903chr1621538 88 ------
NM_000908chr51271 ------
NM_000909chr42967 201 11293 2830 124 --
NM_000917chr103897 740 630 1988 ----
NM_000921chr121227 --1669 --
NM_000922chr112856 830 ------
NM_000933chr2011194 11324 11112 --
NM_000934chr171702 ------
NM_000944chr412000 ------
NM_000949chr53622 206 39 ------
NM_000950chrX83618 3269 2906 1146 1057 771 667 231 --1440 --
NM_000964chr1721385 542 ------
NM_000969chr1123 ------
NM_001001323chr1262497 2315 1974 732 425 347 12603 12733 12145
NM_001001389chr1162700 2449 2413 2245 1937 692 ------
NM_001001390chr1162700 2449 2413 2245 1937 692 ------
NM_001001391chr1162700 2449 2413 2245 1937 692 ------
NM_001001392chr1162746 2495 2459 2291 1983 738 ------
NM_001001395chr1262163 1894 1023 959 913 231 12150 ----
NM_001001396chr121599 632 13302 13335 --
NM_001001419chr575053 4883 4063 3979 3646 3159 402 21284 260 24786 4657 --
NM_001001420chr575053 4883 4063 3979 3646 3159 402 21284 260 24786 4657 --
NM_001001436chr161551 ------
NM_001001481chr812441 --2864 647 13079
NM_001001484chr102924 608 --11580 --
NM_001001521chr21118 ------
NM_001001549chr742644 2387 1031 499 --11144 --
NM_001001550chr742644 2387 1031 499 --11144 --
NM_001001555chr742644 2387 1031 499 --11144 --
NM_001001556chr153619 591 258 --2554 235 1276
NM_001001664chr263990 3270 3224 1500 695 358 --1595 --
NM_001001668chr1974259 3782 3632 3404 3270 1448 440 11313 --1375
NM_001001701chr421982 1463 --31926 441 297 --
NM_001001890chr2183400 3296 3248 3200 3034 1677 1029 148 ----23530 371
NM_001001924chr851664 342 229 217 49 --31982 762 750 --
NM_001001925chr851664 342 229 217 49 --31982 762 750 --
NM_001001931chr851664 342 229 217 49 --31982 762 750 --
NM_001001971chr101483 1387 ----
NM_001001974chr103749 743 300 --11808 11855
NM_001001994chrX2425 186 ------
NM_001001995chrX41880 1575 1482 703 11342 ----
NM_001001996chrX2425 186 ------
NM_001002243chr23753 718 234 --1908 --
NM_001002838chrX3647 490 254 11419 11782 11426
NM_001002843chr1531078 843 259 1229 ----
NM_001002860chr1494513 4011 3406 3090 3056 2919 1484 1325 117 1329 1549 --
NM_001002909chr173787 425 156 12156 ----
NM_001003407chr1054177 4057 1986 861 749 24808 3824 ----
NM_001003408chr1054177 4057 1986 861 749 24808 3824 ----
NM_001003652chr18147984 7757 7546 7446 7106 7090 5697 3431 3277 2795 2631 2538 1419 125 --58239 5907 5676 525 502 1230
NM_001003674chr1846963 6901 4822 132 --37031 2746 1009 --
NM_001003675chr1846963 6901 4822 132 --37031 2746 1009 --
NM_001003679chr142218 1702 1379 201 --174 --
NM_001003712chr1243284 1227 77 38 --11338 --
NM_001003810chr41603 --1787 --
NM_001003895chrY3294 252 147 ------
NM_001004196chr33904 227 209 --11187 --
NM_001004317chr674213 3820 3402 3307 3209 518 275 21266 103 13413 --
NM_001004342chr176090 6020 4123 4049 3952 1559 1192 --21863 959 14285
NM_001004419chr1274454 4296 4024 3516 1405 1268 322 --24231 358 13107
NM_001005242chr1241070 1059 570 230 1341 ----
NM_001005266chr152626 460 --154 --
NM_001005267chr152626 460 --154 --
NM_001005268chr152626 460 --154 --
NM_001005269chr152626 460 --154 --
NM_001005335chr191253 --190 --
NM_001005375chrY31652 356 341 ------
NM_001005386chr24890 873 611 603 11741 22508 1725 --
NM_001005463chr1042308 1027 910 813 ----22529 151
NM_001005473chr5116508 6486 5455 5151 5095 4235 1305 1267 1122 601 81 12472 22534 1163 11152
NM_001005476chr22523 210 ------
NM_001005746chr21259 11219 ----
NM_001005747chr21259 11219 ----
NM_001005781chr2--1235 1127 --
NM_001005782chr21178 1684 ----
NM_001005845chr851188 667 390 245 31 ------
NM_001006600chr572213 1880 1852 846 712 464 39 21608 348 12078 --
NM_001006612chrX1376 ------
NM_001006613chrX1376 ------
NM_001006614chrX1376 ------
NM_001006684chrX5594 478 173 155 148 ------
NM_001007067chr841051 443 230 175 1971 1759 --
NM_001007068chr841051 443 230 175 1971 1759 --
NM_001007069chr841051 443 230 175 1971 1759 --
NM_001007070chr841051 443 230 175 1971 1759 --
NM_001007072chr15188 1262 ----
NM_001007075chr42835 340 ------
NM_001007097chr964598 4564 1954 802 651 486 --24778 1540 --
NM_001007098chr13892 226 147 ------
NM_001007237chr152268 2248 863 292 231 --12088 --
NM_001007245chr7--1613 1659 --
NM_001007257chr131461 413 296 11341 ----
NM_001007278chr1395223 4546 4136 3816 2041 806 744 595 70 ------
NM_001007466chr664978 4246 3529 3333 1323 1104 13257 24602 146 --
NM_001007527chr53692 580 199 --1726 --
NM_001007553chr111243 ------
NM_001007559chr1832099 784 269 --1367 --
NM_001008225chr73531 81 59 ------
NM_001008401chr1941456 1245 1114 603 --1518 --
NM_001008408chr786298 5725 5066 2542 2183 1757 1630 97 24896 4511 45804 5777 4857 1500 --
NM_001008540chr22379 114 ------
NM_001008541chr1021532 872 11553 1903 --
NM_001008541chr1021532 872 11553 1903 --
NM_001008564chr1322019 99 ------
NM_001008660chr1131337 635 233 ------
NM_001008712chr8165 ------
NM_001008738chr552594 2017 1991 693 421 12654 32736 1083 206 12790
NM_001008744chr1431407 571 318 1440 21364 589 --
NM_001008777chr173636 429 206 ------
NM_001008801chr1922136 1924 ----1854
NM_001008895chr1341362 1198 954 590 --1303 --
NM_001008925chr433122 1210 122 13205 --12903
NM_001009185chr51575 1112 1144 --
NM_001009554chr474542 4321 3638 3614 1545 1499 386 --24332 1402 11121
NM_001009554chr474542 4321 3638 3614 1545 1499 386 --24332 1402 11121
NM_001009881chr11603 --1547 --
NM_001009882chr11603 --1547 --
NM_001009899chr3145946 5725 5665 5516 5255 4077 2520 2190 2117 2037 1544 1004 893 235 14939 25197 685 --
NM_001009959chr252456 2284 2260 2007 456 --11633 --
NM_001010846chr193927 1768 1745 1704 1407 1262 1222 928 799 31820 1776 454 ----
NM_001010853chr642745 2370 388 44 ------
NM_001010861chr122696 2218 --11951 --
NM_001010862chrX92781 2592 2045 1247 1007 971 914 826 682 --11229 --
NM_001010867chr195723 5468 5389 5365 2409 2085 1923 1905 72 ----14198
NM_001010876chr6------172
NM_001010888chrX94077 4030 4024 3506 3485 3425 3181 3055 337 21655 1108 ----
NM_001010895chr9----2407 179 --
NM_001010897chr13--1376 ----
NM_001010923chr631753 1131 677 ------
NM_001010927chr61149 ------
NM_001010932chr72294 57 ------
NM_001010971chr13294 242 225 --1687 --
NM_001010984chr131845 759 499 12041 1690 12352
NM_001010986chrX1771 1762 2746 335 12355
NM_001011513chr453151 2616 1611 1594 1077 1469 1877 --
NM_001011537chr362338 1587 1482 380 331 216 ------
NM_001011546chr20--1265 1246 --
NM_001011553chr7----1354 --
NM_001011666chr795675 5187 4259 4233 4119 2615 2029 1530 1134 --26550 6516 --
NM_001011708chr242558 2123 893 52 ------
NM_001011724chr13171 --1261 --
NM_001011725chr13171 --1261 --
NM_001011885chr1521500 496 --1384 11280
NM_001012393chr1194853 4687 4391 3936 3892 2040 643 571 118 ------
NM_001012420chr1532588 1826 1806 11147 ----
NM_001012423chr1532588 1826 1806 11147 ----
NM_001012425chr1--1131 ----
NM_001012512chr18189 ------
NM_001012513chr181100 ------
NM_001012732chr4----11225 --
NM_001012754chr1351923 1826 1658 124 108 12172 ----
NM_001012756chr1982928 2895 2677 2550 2337 975 900 247 12817 12235 148
NM_001012968chrX52800 2227 1976 944 33 12356 32613 1863 1805 --
NM_001012979chrX1180 ------
NM_001013031chr101347 11379 ----
NM_001013399chr63858 785 56 1130 ----
NM_001013437chr18----195 --
NM_001013635chr121782 ------
NM_001013843chr151621 ------
NM_001014449chr161235 ------
NM_001014451chr161235 ------
NM_001014797chr1087805 7060 6879 2873 2289 2132 2089 1539 --21389 270 23208 1201
NM_001014972chr21175 ------
NM_001015045chr422457 2106 2817 746 --12295
NM_001015877chrX62800 2792 1249 1104 872 435 ------
NM_001015880chr1041365 1242 609 292 11204 ----
NM_001015882chr95689 286 242 229 217 --1762 --
NM_001017368chr1792581 2468 2455 2371 2132 2106 1987 977 248 --12758 1565
NM_001017395chr3113604 3386 3183 3073 1232 1188 886 832 518 490 235 ----23579 181
NM_001017405chr41205 ------
NM_001017440chr787608 7164 2391 2291 1663 1573 1307 580 --46248 2129 1450 1167 --
NM_001017523chr1221917 596 --1610 --
NM_001017923chr1431548 1398 166 1652 1290 --
NM_001017926chr8--11190 --1609
NM_001017962chr103897 740 630 1988 ----
NM_001017973chr5198 ------
NM_001017974chr5198 ------
NM_001017975chr11103 --1452 --
NM_001018004chr151636 ------
NM_001018006chr151636 ------
NM_001018007chr151636 ------
NM_001018020chr151636 ------
NM_001018038chr91192 ----146
NM_001018064chr921867 663 ------
NM_001018065chr975376 4826 4656 3935 1879 830 306 35367 5144 3765 36006 5126 5098 --
NM_001018066chr975376 4826 4656 3935 1879 830 306 35367 5144 3765 36006 5126 5098 --
NM_001018067chr155231 5107 3679 2141 1584 11675 13276 15216
NM_001018068chr155231 5107 3679 2141 1584 11675 13276 15216
NM_001018069chr155231 5107 3679 2141 1584 11675 13276 15216
NM_001018072chr1221917 596 --1610 --
NM_001018074chr543247 2764 2529 1228 13482 ----
NM_001018075chr543247 2764 2529 1228 13482 ----
NM_001018076chr543247 2764 2529 1228 13482 ----
NM_001018077chr543247 2764 2529 1228 13482 ----
NM_001018100chr151682 ------
NM_001018111chr7103844 3795 3586 3331 3119 910 771 752 708 520 --12833 --
NM_001020658chr121674 1316 ------
NM_001020658chr121674 1316 ------
NM_001020825chr51239 1957 ----
NM_001024094chr543247 2764 2529 1228 13482 ----
NM_001024649chr522355 1105 22968 2137 2421 328 --
NM_001024660chr31357 --1652 11471
NM_001024736chr1511512 ------
NM_001024809chr1721385 542 ------
NM_001024847chr321926 247 --11943 --
NM_001024934chr61584 ------
NM_001024935chr61584 ------
NM_001024936chr61584 ------
NM_001024947chr51105 --1310 --
NM_001024948chr12588 146 --21246 646 --
NM_001024956chr1185506 4977 2214 1303 1005 836 702 262 --45029 3973 1881 1172 --
NM_001024959chr3----1245 --
NM_001024960chr3----1245 --
NM_001025076chr1054242 4169 1524 1254 510 1495 ----
NM_001025077chr10115600 5527 5092 4729 2882 2612 1868 1347 1310 703 695 21853 584 ----
NM_001025079chr343290 3176 2783 667 12665 ----
NM_001025108chr263461 2627 1373 1141 749 138 --23988 977 --
NM_001025201chr21575 ------
NM_001025252chr863216 3108 2542 2536 856 330 ------
NM_001025253chr863216 3108 2542 2536 856 330 ------
NM_001025266chr374937 4390 4153 3929 1644 1166 278 --13493 13374
NM_001025356chr1242608 742 452 408 ------
NM_001025580chrX63896 3550 2903 589 545 220 1439 13292 --
NM_001025595chr421446 293 ------
NM_001025780chr921128 457 ----1267
NM_001029858chr622784 887 ----13207
NM_001029863chr622956 1167 ----22240 860
NM_001029875chr562836 2612 2446 2268 1113 295 1159 1984 --
NM_001029998chr411014 ------
NM_001030007chr163815 708 134 --12928 11253
NM_001030055chr14154455 4155 3934 3805 3727 3622 3612 3458 3426 3390 2982 1415 790 779 396 --14364 24502 3443
NM_001031623chr62283 149 --1480 --
NM_001031695chr2273346 2176 1598 1419 1032 946 502 --35313 3640 459 --
NM_001031711chr541861 1561 1402 276 ------
NM_001031732chr453228 3117 2282 1330 340 12703 33405 2495 2242 --
NM_001031801chr221177 ------
NM_001031804chr1644187 2809 1566 509 --22783 1583 13745
NM_001032280chr611382 ------
NM_001032282chr811218 --1293 --
NM_001032283chr12--1872 1663 1395
NM_001032284chr12--1872 1663 1395
NM_001032296chr1362701 2021 1967 1825 925 433 ------
NM_001032380chr1021457 126 ----11614
NM_001032394chr632093 692 177 --22561 2523 12064
NM_001032395chr631960 559 44 --22428 2390 11931
NM_001032999chr2041426 721 655 558 --24521 667 --
NM_001033045chr222860 1654 1172 23936 3567 --
NM_001033117chr364239 3803 1397 1115 514 454 ------
NM_001033559chr151380 ------
NM_001033561chr171639 ------
NM_001033910chr111769 --1706 --
NM_001033925chr103511 213 138 11708 ----
NM_001034837chr5--185 ----
NM_001034838chr5--185 ----
NM_001034850chr51119 --1470 --
NM_001034954chr1052483 2211 2056 1020 64 --23173 2873 --
NM_001034955chr1052483 2211 2056 1020 64 --23173 2873 --
NM_001034956chr1052483 2211 2056 1020 64 --23173 2873 --
NM_001034957chr1052483 2211 2056 1020 64 --23173 2873 --
NM_001035chr1193 --1287 --
NM_001035003chr431085 377 157 1325 ----
NM_001035004chr431085 377 157 1325 ----
NM_001035005chr181474 ------
NM_001035260chr1021043 564 --11606 --
NM_001037131chr211142 ------
NM_001037132chr712102 --11757 --
NM_001037133chr712102 --11757 --
NM_001037164chr741888 1740 535 52 ------
NM_001037165chr758783 7196 6920 5590 1276 1659 27745 2731 --
NM_001037172chr311188 --11236 --
NM_001037174chr232133 2011 707 --21533 28 --
NM_001037317chr122696 2218 --11951 --
NM_001037582chr431178 1096 571 --11373 --
NM_001037872chr21248 --2693 590 --
NM_001037954chr1123493 1025 ------
NM_001039091chrX4511 211 138 66 --1121 11371
NM_001039199chr2054177 3443 3395 3089 1157 1744 1937 11730
NM_001039538chr253374 3188 2698 2403 715 --11218 --
NM_001039547chr3137168 7081 6888 6636 6110 5311 3123 3034 3012 2779 1805 1383 710 1600 15870 --
NM_001039573chr171106 --1496 --
NM_001039577chr183899 3652 3433 1529 1515 1009 980 505 ------
NM_001039582chrX3119 112 44 ------
NM_001039590chrX84020 3201 2891 2802 2454 1114 909 310 --22810 585 --
NM_001039591chrX84020 3201 2891 2802 2454 1114 909 310 --22810 585 --
NM_001039618chr1165200 4800 4551 2057 1648 376 22157 689 12329 --
NM_001039693chr284129 4026 1522 1194 1080 977 547 94 --166 --
NM_001039709chr2041426 721 655 558 --24521 667 --
NM_001039802chr131254 927 553 ------
NM_001039840chrX84736 4488 4428 4315 4140 1936 1006 63 13846 --1655
NM_001039937chr1353568 3542 3391 1281 74 23113 2560 ----
NM_001039960chr1221608 25 ------
NM_001040001chr6--1724 ----
NM_001040020chr741440 1076 513 447 1369 ----
NM_001040033chr11523 --1679 --
NM_001040057chr7----11277 --
NM_001040092chr81337 ------
NM_001040110chr72184 149 ------
NM_001040142chr222276 91 --1644 11952
NM_001040143chr222276 91 --1644 11952
NM_001040152chr755145 4781 4081 3482 1173 --1704 --
NM_001040158chr51509 ------
NM_001040159chr421188 587 1406 --11005
NM_001040202chr42483 157 21701 458 21975 1640 12392
NM_001040260chr4----11139 --
NM_001040261chr4----11139 --
NM_001040284chr1695281 4731 3907 2100 1844 1254 1241 1223 273 --25824 598 14069
NM_001040402chr422951 1954 12388 12122 --
NM_001040429chr1343520 3005 793 754 --13131 --
NM_001040441chr163648 2050 1248 510 461 314 25441 1255 11428 14157
NM_001040450chr152633 111 ------
NM_001040453chr152633 111 ------
NM_001040633chr72770 716 1228 --1165
NM_001040665chr785028 4950 4814 4773 3818 3581 1883 123 --24271 1061 2669 403
NM_001040666chr74730 652 516 475 ------
NM_001040712chr922373 25 1245 ----
NM_001040875chr821671 947 --22419 904 --
NM_001040876chr41769 187 1288 --
NM_001042355chr1673852 3824 3507 3266 1805 672 521 11694 24256 4215 --
NM_001042357chr101199 ----1334
NM_001042358chr101199 ----1334
NM_001042360chr101199 ----1334
NM_001042363chr101199 ----1334
NM_001042383chr363199 3120 2355 954 850 709 1327 ----
NM_001042388chr182875 664 ------
NM_001042389chr101199 ----1334
NM_001042390chr101199 ----1334
NM_001042392chr101199 ----1334
NM_001042395chr101199 ----1334
NM_001042403chr122832 687 ------
NM_001042404chr171539 1458 1376 1319 639 419 255 --1298 --
NM_001042412chr1673852 3824 3507 3266 1805 672 521 11694 24256 4215 --
NM_001042424chr452249 2212 1283 847 630 ------
NM_001042425chr611382 ------
NM_001042475chr61105 ------
NM_001042486chr202443 317 129 --1195
NM_001042493chr621801 708 ------
NM_001042533chr333173 2687 637 1903 ----
NM_001042537chrX5825 763 539 299 216 ----11578
NM_001042543chr41420 --1993 --
NM_001042548chr23659 571 39 --1137 --
NM_001042550chr931701 1679 252 1215 2793 550 --
NM_001042555chr1244615 1602 1312 280 --23854 640 --
NM_001042599chr2137491 7277 6481 5645 5581 5232 5207 5031 2661 2561 2056 1134 77 14777 26415 1775 --
NM_001042601chr352375 2358 2216 2204 835 --12234 --
NM_001042603chr12115309 5145 4646 4341 4266 4021 3821 2092 2058 1879 415 --11392 --
NM_001042604chr354773 4383 1580 1294 551 64901 4877 4815 4678 1509 460 33434 3328 3031 14606
NM_001042635chr141138 ------
NM_001042681chr172394 2201 996 984 656 201 112 ------
NM_001042682chr172394 2201 996 984 656 201 112 ------
NM_001042682chr172394 2201 996 984 656 201 112 ------
NM_001042683chr62391 194 --1678 --
NM_001042749chrX11710 11694 21595 96 --
NM_001042750chrX11710 11694 21595 96 --
NM_001042751chrX11710 11694 21595 96 --
NM_001046chr542877 2609 2101 2056 --1888 --
NM_001068chr3------1255
NM_001071775chr1321566 1451 21337 686 --11361
NM_001079874chr132016 792 160 ------
NM_001083620chr422049 981 12558 ----
NM_001099678chr334331 4178 2195 --34616 2451 1731 14519
NM_001100108chr1137663 7075 6739 6589 6525 5158 5089 3247 3130 3003 2601 1017 877 --27761 7544 11264
NM_001106chr3169634 9577 8534 7638 7110 6784 6282 6163 6032 5961 3035 2375 2107 2019 573 38 28612 1969 ----
NM_001109977chr42731 90 1539 ----
NM_001117chr1822359 971 --1506 --
NM_001121chr1051566 1289 1280 1243 676 --11641 --
NM_001122679chr511040 ------
NM_001124chr11----1479 --
NM_001128chr163815 708 134 --12928 11253
NM_001140chr172582 257 ------
NM_001148chr432054 2048 1691 ------
NM_001149chr101138 ----1904
NM_001151chr42105 28 ------
NM_001153chr2------1231
NM_001160chr1242787 2626 1087 897 --11895 --
NM_001167chrX52715 1138 732 329 174 25912 1039 46533 6390 1246 1171 --
NM_001173chr14154455 4155 3934 3805 3727 3622 3612 3458 3426 3390 2982 1415 790 779 396 --14364 24502 3443
NM_001174chrX1293 --12247 --
NM_001177chr1212237 --21579 379 --
NM_001179chr4----1260 --
NM_001186chr2163092 2625 2303 687 599 188 1534 --12341
NM_001200chr203862 299 232 ------
NM_001201chr423150 2534 --33230 1009 213 --
NM_001204chr266712 6478 6271 2253 2243 144 35589 5230 1868 --17725
NM_001206chr953010 2931 2511 1146 144 --11988 --
NM_001219chr731740 628 223 1369 ----
NM_001233chr73374 245 192 1888 32272 1767 155 11984
NM_001256chr1712010 12533 11063 --
NM_001257chr161259 --11529 --
NM_001259chr785100 4718 2164 1801 1501 1354 465 297 ----1871
NM_001267chr171528 ------
NM_001269chr11908 ------
NM_001284chr51219 1190 ----
NM_001288chr6----1185 --
NM_001289chrX1496 --1182 145
NM_001290chr42372 142 --1690 --
NM_001295chr32296 289 ------
NM_001304chr17123836 3473 3381 3357 3251 3174 1297 1079 929 746 711 525 --13533 --
NM_001332chr511214 ----11051
NM_001349chr2----2394 223 --
NM_001351chr33304 260 245 ------
NM_001356chrX42168 1760 963 831 12462 ----
NM_001357chr11247 ------
NM_001379chr19--1207 ----
NM_001383chr171843 ------
NM_001385chr82293 148 1388 1421 --
NM_001390chr1893509 3460 2686 2402 1399 1393 1233 992 238 --23225 879 1505
NM_001396chr2172736 2539 2174 817 804 323 136 12615 ----
NM_001400chr161377 1059 1018 882 278 260 ------
NM_001401chr9----21064 313 --
NM_001402chr631888 1849 1765 --11711 --
NM_001412chrX62686 2359 829 586 522 59 --1425 --
NM_001417chr1251977 1448 1197 477 390 ------
NM_001418chr11--1725 --1514
NM_001418chr11--1725 --1514
NM_001419chr1964003 1756 1467 1198 971 720 --14483 11301
NM_001429chr22--1858 ----
NM_001430chr241446 678 440 245 ------
NM_001431chr611178 --154 --
NM_001438chr12731 553 13079 21051 1014 --
NM_001448chrX1547 1278 11275 --
NM_001453chr611396 ------
NM_001482chr151834 ------
NM_001483chr731062 867 674 --1394 --
NM_001498chr6----11166 1949
NM_001514chr11493 ------
NM_001518chr71953 1231 1286 --
NM_001527chr684578 4268 4117 3902 3359 3222 1683 299 14538 ----
NM_001530chr1421120 998 1956 ----
NM_001533chr191253 --190 --
NM_001542chr152268 2248 863 292 231 --12088 --
NM_001546chr641477 1397 1326 1022 ------
NM_001550chr7--1613 1659 --
NM_001554chr1--1597 --1623
NM_001584chr112378 37 --11240 1891
NM_001609chr1054407 3896 1690 1189 481 --11570 13936
NM_001612chr111229 ------
NM_001614chr171180 ------
NM_001614chr171180 ------
NM_001616chr242637 1254 327 283 ----1411
NM_001642chr111348 ------
NM_001649chrX22425 1544 --1826 --
NM_001650chr1884099 4039 3137 927 790 297 80 53 ------
NM_001654chrX2372 344 ------
NM_001655chr1142044 1411 870 84 ------
NM_001660chr31699 ------
NM_001663chr1421923 352 ------
NM_001664chr3----1421 --
NM_001668chr121948 884 1632 11898 --
NM_001682chr1262211 2029 1040 446 139 61 12317 12447 11859
NM_001684chr121316 349 13019 23052 1540 --
NM_001690chr332557 2374 684 ----1161
NM_001695chr8123996 3859 3751 3065 1582 1547 999 877 766 624 276 210 --33295 2895 2708 --
NM_001698chr91199 ------
NM_001709chr1142529 2418 2255 1004 ------
NM_001716chr1111480 ------
NM_001717chr1571494 1228 553 489 300 268 258 --2369 221 --
NM_001718chr631374 1242 241 ----2435 147
NM_001723chr63766 610 185 --1737 --
NM_001730chr1321038 238 11256 --1402
NM_001730chr1321038 238 11256 --1402
NM_001731chr124890 731 117 50 ------
NM_001742chr73434 428 394 1715 11228 --
NM_001745chr52281 229 --11148 --
NM_001746chr522355 1105 22968 2137 2421 328 --
NM_001753chr731500 1465 34 --1450 --
NM_001754chr2183400 3296 3248 3200 3034 1677 1029 148 ----23530 371
NM_001755chr1632034 1729 921 ----11606
NM_001759chr1264924 4882 4189 3465 3315 588 11240 1139 15216
NM_001777chr343290 3176 2783 667 12665 ----
NM_001788chr7----1354 --
NM_001791chr131254 927 553 ------
NM_001792chr18--2450 237 ----
NM_001797chr16----1816 --
NM_001801chr52221 118 --1651 1474
NM_001806chr1942923 2859 2274 435 21011 505 --12592
NM_001822chr21575 ------
NM_001843chr121217 ------
NM_001850chr3------140
NM_001854chr111376 --11012 --
NM_001858chr6104775 4067 3797 3339 1891 1763 1433 660 236 190 13627 1905 --
NM_001872chr131380 --1113 --
NM_001873chr43500 246 63 --176 --
NM_001880chr22230 203 ------
NM_001902chr12397 302 ------
NM_001918chr1119257 8366 7667 6614 5697 2275 1267 1133 1101 951 124 12876 ----
NM_001921chr4----11225 --
NM_001931chr111506 --21213 215 --
NM_001938chr11738 ------
NM_001941chr1863897 3768 1210 877 233 99 11140 125 --
NM_001946chr123781 436 173 ------
NM_001949chr693273 3176 3164 3024 2843 2175 702 452 244 13211 12318 --
NM_001951chr81574 --2628 487 --
NM_001954chr61727 --1778 --
NM_001955chr61805 --1422 --
NM_001957chr422150 433 --1412 --
NM_001964chr531055 281 154 ------
NM_001967chr3----1133 --
NM_001968chr4153 ----1314
NM_001969chr1483818 3811 3369 2525 1284 1077 877 296 1825 23062 1027 13947
NM_001980chr1251988 1922 1744 686 679 --12250 --
NM_001981chr151681 667 612 553 144 --11931 --
NM_001987chr1293832 3489 3265 3032 2741 1512 1168 549 527 --23379 1461 --
NM_001995chr411175 --2922 496 --
NM_001999chr531498 474 188 1586 ----
NM_002006chr455346 1859 1363 1330 251 25770 790 21550 898 --
NM_002009chr1552540 322 216 190 42 --12429 --
NM_002010chr131165 ------
NM_002015chr1331277 1238 749 --2668 304 --
NM_002021chr12323 40 ------
NM_002024chrX21783 181 11715 --1250
NM_002025chrX58896 7292 2979 970 877 28342 373 23366 2745 --
NM_002026chr24915 682 427 275 --1824 --
NM_002037chr6--1350 ----
NM_002040chr2182945 2815 2672 784 664 208 161 125 ------
NM_002044chr153619 591 258 --2554 235 1276
NM_002061chr111652 ------
NM_002063chrX11108 ------
NM_002069chr751609 755 728 672 59 1349 ----
NM_002072chr9--2971 164 ----
NM_002078chr32432 49 ----1212
NM_002088chr191131 ------
NM_002091chr18189 ------
NM_002092chr494838 4588 4473 3409 1658 1612 266 247 118 ------
NM_002106chr4--1280 ----
NM_002107chr11335 ------
NM_002114chr6----1494 --
NM_002128chr1332211 487 110 --21838 1767 12060
NM_002129chr4----1120 --
NM_002136chr12171 --1261 --
NM_002137chr72784 293 --2714 376 1949
NM_002138chr41603 --1787 --
NM_002139chrX1434 ------
NM_002140chr92747 476 1285 ----
NM_002146chr1731257 427 78 ------
NM_002154chr52121 97 ------
NM_002156chr2--1335 ----
NM_002158chr231055 335 243 11117 11186 --
NM_002160chr91541 157 1553 --
NM_002163chr163798 500 436 ------
NM_002166chr21685 ------
NM_002193chr211695 ------
NM_002199chr42741 222 --1989 --
NM_002210chr262763 2724 2425 2207 507 62 --22799 2691 --
NM_002223chr1231499 1396 756 --22658 696 1747
NM_002239chr21809 ------
NM_002242chr241837 1282 584 461 --11619 --
NM_002247chr102620 410 --11729 --
NM_002253chr421191 105 1980 159 --
NM_002264chr374934 4653 4405 3237 1069 772 530 11199 11495 --
NM_002267chr131514 --21805 1703 1493
NM_002269chr6----1333 --
NM_002270chr5155513 5344 5160 4832 4388 3900 3725 3629 3528 3510 1724 1295 1121 1038 822 31433 1256 1048 24642 1810 13545
NM_002285chr263461 2627 1373 1141 749 138 --23988 977 --
NM_002312chr1321046 223 --1766 1777
NM_002313chr1054177 4057 1986 861 749 24808 3824 ----
NM_002336chr1295075 4782 3232 3089 1976 1228 787 201 65 34013 3984 839 11211 --
NM_002350chr81834 11246 1499 --
NM_002355chr1231304 1146 63 ------
NM_002356chr652605 2443 2355 2295 617 22556 111 ----
NM_002374chr253374 3188 2698 2403 715 --11218 --
NM_002387chr574838 4818 3755 1970 1758 1695 1441 --34409 1219 358 --
NM_002395chr611475 11282 139 2593 110
NM_002397chr521957 1752 --21933 375 1244
NM_002398chr221317 1121 --1589 --
NM_002408chr141171 ------
NM_002442chr1221658 433 ------
NM_002467chr82415 124 ------
NM_002480chr12----1257 --
NM_002481chr1146592 6382 6326 5985 5593 5576 5530 5377 3117 2733 1551 1248 1235 932 ----15914
NM_002491chr21107 ------
NM_002500chr22450 336 2999 947 ----
NM_002508chr161960 1883 1853 1843 789 628 --11754 --
NM_002515chr1421620 259 11873 ----
NM_002518chr22972 429 ----11043
NM_002519chr1111263 ------
NM_002524chr121100 403 ------
NM_002538chr5--1207 ----
NM_002545chr1194853 4687 4391 3936 3892 2040 643 571 118 ------
NM_002546chr81208 ----1765
NM_002553chr7----1438 --
NM_002556chr1122132 366 ------
NM_002569chr1511475 ------
NM_002577chr353288 2934 1452 625 285 --1242 --
NM_002581chr965606 5383 4250 3680 1695 1551 24575 686 34352 1121 816 --
NM_002590chr132569 495 ------
NM_002594chr2031727 1674 522 --11708 --
NM_002601chr2187 ------
NM_002610chr263001 2593 2100 1011 616 450 --23120 3068 12504
NM_002628chr311104 11008 ----
NM_002633chr11501 ------
NM_002635chr121151 ------
NM_002641chrX41717 1516 1489 1310 11911 --126
NM_002645chr1132783 2468 659 ------
NM_002655chr865205 4639 4138 1526 823 799 --13993 1320
NM_002662chr351789 1715 1516 699 372 --11554 11736
NM_002670chr341549 1454 1002 364 ------
NM_002687chr1421307 46 ------
NM_002699chr111273 197 ----
NM_002703chr421607 688 21655 609 2723 137 --
NM_002709chr273217 2750 2420 2402 1382 1181 33 33443 634 143 11169 11353
NM_002710chr1241080 766 310 101 ------
NM_002713chr13991 823 446 ------
NM_002715chr51995 ------
NM_002719chr1441873 800 692 335 ------
NM_002730chr19----2494 330 1959
NM_002731chr122110 1011 1852 1128 --
NM_002734chr1742163 1809 1579 844 --21567 351 --
NM_002737chr1776338 5928 5886 4893 4408 1057 345 11214 15589 --
NM_002740chr332455 2421 523 --12076 --
NM_002745chr2234028 1563 817 ----13675
NM_002748chr15--1118 ----
NM_002752chr5----1223 --
NM_002758chr171363 ------
NM_002765chrX4511 211 138 66 --1121 11371
NM_002809chr171352 ------
NM_002811chr161552 ------
NM_002819chr19------1105
NM_002825chr7----1478 --
NM_002828chr18--1349 ----
NM_002834chr1223378 1537 33155 2841 2819 13010 --
NM_002835chr7165 ------
NM_002839chr922373 25 1245 ----
NM_002840chr131655 1213 380 1361 ----
NM_002844chr641403 1283 873 472 ----196
NM_002845chr181537 ------
NM_002848chr1221140 1062 ------
NM_002849chr122843 159 --1268 --
NM_002851chr7--2621 271 1543 --
NM_002858chr11524 1941 ----
NM_002886chr3104995 4945 4044 3807 3704 3406 2023 1808 859 251 1965 24025 3746 14694
NM_002892chr1421493 623 11371 11301 --
NM_002894chr18294 85 ------
NM_002897chr2167 --1269 --
NM_002906chr1122031 1750 ----1815
NM_002911chr1921660 641 ------
NM_002922chr11599 ----1678
NM_002940chr41769 187 1288 --
NM_002941chr341408 1304 1235 26 11346 ----
NM_002942chr311294 ------
NM_002945chr171839 ------
NM_002948chr31312 ----11278
NM_002956chr1241088 904 233 142 --1399 --
NM_002959chr153551 3120 1304 1071 605 11402 21062 802 --
NM_002993chr431111 970 699 --1950 --
NM_002994chr431985 1326 65 1727 198 --
NM_002998chr831437 624 520 1372 2698 79 --
NM_002999chr2021938 56 ------
NM_003003chr17----1215 --
NM_003016chr1731536 1477 1233 --169 1335
NM_003020chr151365 ------
NM_003034chr1278156 3218 2472 2459 758 504 222 11394 13138 12714
NM_003043chr363991 2773 2665 398 380 101 --12867 --
NM_003048chr242586 2376 792 22 --22388 1833 1330
NM_003051chr13549 472 146 ----1508
NM_003070chr91589 ------
NM_003095chr12151 ------
NM_003100chr51425 ------
NM_003101chr121260 488 ------
NM_003107chr612144 11804 11048 --
NM_003108chr2116228 5986 5550 5433 5117 2113 1374 1227 1202 576 465 --26322 5238 --
NM_003110chr1711039 ------
NM_003112chr732119 1295 478 23169 1281 21985 588 --
NM_003113chr21107 ------
NM_003128chr262477 2431 2184 495 253 115 --1223 --
NM_003129chr81126 ------
NM_003137chr632083 888 661 1429 32077 641 115 --
NM_003155chr872250 1750 1090 826 723 529 93 ------
NM_003157chr32676 52 ------
NM_003161chr1743148 2923 1185 268 32894 2758 154 32856 1102 545 13195
NM_003182chr7----1396 --
NM_003182chr7----1396 --
NM_003185chr201445 ------
NM_003188chr61640 --1711 --
NM_003198chr1--1237 ----
NM_003199chr1885544 4403 3880 3474 1333 1316 1051 777 2793 613 45610 4999 4097 1226 1760
NM_003203chr252296 1854 959 734 265 ------
NM_003204chr1731328 1189 700 ----11746
NM_003211chr1251610 1224 1095 428 269 11332 --11723
NM_003217chr1221923 1288 --21878 1716 --
NM_003220chr611382 ------
NM_003221chr663280 3229 2943 1685 1562 246 1626 13336 --
NM_003222chr2011179 ----1875
NM_003242chr321926 247 --11943 --
NM_003257chr153506 341 255 ------
NM_003262chr395089 4832 4624 3943 1270 878 483 239 48 24329 944 25302 3307 --
NM_003286chr20------2955 872
NM_003292chr152249 1576 1440 652 227 1734 ----
NM_003298chr374928 4780 4234 4222 3921 2413 2294 14845 25893 225 11235
NM_003300chr141323 ------
NM_003304chr311507 21495 1272 1237 --
NM_003337chr5--11663 1346 --
NM_003338chr1071838 650 598 578 389 275 116 ----21402 791
NM_003340chr42458 73 ------
NM_003341chr32547 61 --1144 --
NM_003342chr1763328 2825 2713 2305 1067 644 --11013 33008 2760 380
NM_003344chr711571 1612 1161 --
NM_003350chr81691 --1993 --
NM_003352chr21178 1684 ----
NM_003359chr431273 447 26 --1872 --
NM_003367chr19----1122 --
NM_003369chr1131114 456 201 1224 22611 188 --
NM_003370chr191646 ------
NM_003371chr922055 1879 --21613 32 11742
NM_003375chr10142 ------
NM_003379chr61411 ------
NM_003380chr101119 ------
NM_003385chr22989 793 ------
NM_003392chr354174 3859 1496 1173 233 --43414 2877 814 479 --
NM_003404chr2041988 1493 224 116 ------
NM_003410chrX31986 823 469 --12840 1458
NM_003439chr752808 1353 1307 586 238 ------
NM_003442chr111326 --1682 --
NM_003463chr63972 558 151 13361 12907 --
NM_003467chr22379 114 ------
NM_003468chr233818 2947 759 12818 24267 170 12920
NM_003472chr63947 46 38 11492 ----
NM_003478chr1193212 3009 2988 2715 2367 2335 2281 1002 381 23325 585 ----
NM_003482chr1232749 2142 698 11912 11974 --
NM_003483chr1252025 2002 578 96 43 ------
NM_003489chr2141011 703 60 28 23134 2437 ----
NM_003496chr71856 ------
NM_003503chr131114 944 201 --2918 258 1232
NM_003505chr751907 1764 1541 1445 755 --1285 --
NM_003506chr831327 1172 993 --11155 --
NM_003507chr252017 1994 1795 212 151 --21837 618 --
NM_003528chr121276 646 --11199 11727
NM_003566chr1242910 2123 968 962 21069 656 272 46 --
NM_003574chr1885338 4941 4465 4374 3663 1436 951 59 35111 1395 1142 25103 4614 --
NM_003576chr1362701 2021 1967 1825 925 433 ------
NM_003583chr1263248 3079 3051 2640 1468 993 23814 2531 1541 --
NM_003589chr1341362 1198 954 590 --1303 --
NM_003590chr254057 3373 1318 652 442 --22937 350 14012
NM_003597chr252180 784 312 103 32 12324 21852 546 12020
NM_003607chr122659 1470 --21555 343 13235
NM_003615chr333215 2949 746 22826 1038 13627 11179
NM_003620chr171179 --11023 2755 335
NM_003628chr22523 210 ------
NM_003630chr61739 ------
NM_003633chr54858 665 202 67 --12609 --
NM_003645chr151174 ------
NM_003651chr121144 ------
NM_003659chr22990 337 ------
NM_003663chr363269 3153 2914 2470 1069 798 1700 13467 --
NM_003664chr5----1478 --
NM_003668chr121125 ------
NM_003672chr12547 217 --1419 --
NM_003701chr13----1727 --
NM_003713chr121397 116 --11289 --
NM_003722chr31284 --1365 --
NM_003725chr121437 ------
NM_003741chr31292 ------
NM_003743chr2----179 --
NM_003750chr101346 ------
NM_003759chr453781 3538 2772 1007 466 --23559 824 --
NM_003760chr1----1516 --
NM_003766chr172608 586 ------
NM_003772chr113894 459 445 11028 ----
NM_003774chr121723 11220 --22636 481
NM_003794chr321080 344 ------
NM_003809chr171468 ------
NM_003816chr81281 ------
NM_003819chr11245 ------
NM_003825chr1531205 469 301 ------
NM_003846chr12617 119 ------
NM_003873chr1031794 917 75 --42370 2359 1831 1822 --
NM_003884chr331591 1518 1273 1452 --1214
NM_003888chr1521706 1457 ------
NM_003893chr101162 ------
NM_003913chr653384 3107 1237 647 350 ------
NM_003931chr61584 ------
NM_003980chr641323 901 334 132 1344 ----
NM_004006chrX72188 2174 2111 1746 965 844 215 ------
NM_004007chrX72188 2174 2111 1746 965 844 215 ------
NM_004009chrX72188 2174 2111 1746 965 844 215 ------
NM_004010chrX72188 2174 2111 1746 965 844 215 ------
NM_004011chrX72188 2174 2111 1746 965 844 215 ------
NM_004012chrX72188 2174 2111 1746 965 844 215 ------
NM_004013chrX72188 2174 2111 1746 965 844 215 ------
NM_004014chrX72188 2174 2111 1746 965 844 215 ------
NM_004015chrX72188 2174 2111 1746 965 844 215 ------
NM_004016chrX82102 2088 2025 1660 1008 879 758 129 ------
NM_004017chrX72188 2174 2111 1746 965 844 215 ------
NM_004018chrX82102 2088 2025 1660 1008 879 758 129 ------
NM_004019chrX1327 ------
NM_004020chrX72188 2174 2111 1746 965 844 215 ------
NM_004021chrX82102 2088 2025 1660 1008 879 758 129 ------
NM_004022chrX82102 2088 2025 1660 1008 879 758 129 ------
NM_004023chrX82102 2088 2025 1660 1008 879 758 129 ------
NM_004028chr1884099 4039 3137 927 790 297 80 53 ------
NM_004035chr1794865 4810 4521 3877 3824 1571 919 778 146 --13201 --
NM_004050chr1422626 1065 ----11916
NM_004061chr5----142 --
NM_004065chrX3296 90 23 --160 --
NM_004067chr731448 1167 218 11105 11226 --
NM_004081chrY31652 356 341 ------
NM_004093chr1321112 475 12479 --12774
NM_004098chr1011299 ------
NM_004113chr341548 1456 507 450 --11871 --
NM_004114chrX1791 --21118 1055 --
NM_004117chr611780 ------
NM_004119chr131614 ------
NM_004124chr1432320 2205 1267 ----1600
NM_004133chr841881 1751 1067 53 --22641 1909 --
NM_004136chr1511280 1174 ----
NM_004157chr32771 761 ------
NM_004161chr21442 --11246 --
NM_004171chr11159008 8663 7546 7335 6759 6687 6655 3366 3067 2938 2829 2419 2314 1853 1784 --49509 6546 3376 3309 --
NM_004172chr52310 162 ----2462 272
NM_004180chr2144 --1580 --
NM_004187chrX31335 1215 1115 ------
NM_004199chr5198 ------
NM_004215chr81557 1108 ----
NM_004225chr831491 372 308 ----11026
NM_004229chrX22168 379 12220 ----
NM_004232chr183568 520 323 13799 ----
NM_004241chr101270 ------
NM_004242chr6--2370 29 ----
NM_004252chr173524 462 132 ------
NM_004274chr1422221 447 12124 32041 1250 1190 --
NM_004281chr101404 ------
NM_004295chr1751350 1066 476 395 389 --1198 --
NM_004311chr1041913 1043 475 167 --1281 1982
NM_004316chr1211083 ------
NM_004319chr142721 723 694 77 ----12860
NM_004326chr151108 970 946 770 214 1438 ----
NM_004329chr10----11339 --
NM_004330chr151436 ------
NM_004331chr822260 1864 --2803 698 --
NM_004337chr832179 795 669 11473 148 1615
NM_004338chr1846963 6901 4822 132 --37031 2746 1009 --
NM_004342chr72616 488 ------
NM_004343chr192351 132 ------
NM_004349chr821055 278 1316 ----
NM_004354chr43611 583 145 --2307 246 1544
NM_004369chr21495 ------
NM_004385chr51104 ------
NM_004389chr21752 ------
NM_004392chr133513 298 179 --21982 1641 1993
NM_004397chr1173074 2725 2633 1480 1344 1185 41 ------
NM_004419chr10147 --1946 --
NM_004432chr92962 812 --2840 151 --
NM_004436chr11588 ------
NM_004437chr193185 2931 2659 2463 2368 1250 1205 1181 176 ------
NM_004442chr131665 1232 1123 --11634 11103
NM_004447chr121380 ------
NM_004449chr2121456 1378 1305 ----
NM_004454chr341954 1918 1892 805 ------
NM_004457chr231476 1191 499 1283 1579 --
NM_004458chrX52042 1811 997 918 702 31837 1017 957 22607 2124 --
NM_004459chr17----11438 --
NM_004462chr8----1662 --
NM_004482chr22890 387 ------
NM_004499chr51481 ------
NM_004500chr1421259 564 11573 ----
NM_004501chr143847 3188 813 145 12967 13174 --
NM_004503chr12----1613 --
NM_004504chr232546 977 833 22178 91 12712 --
NM_004505chr1731324 514 352 --11610 11671
NM_004516chr19----11068 --
NM_004529chr931293 1005 75 --11087 --
NM_004535chr2011429 ------
NM_004537chr1231066 1032 1026 --11113 11165
NM_004559chr11348 --1301 1394
NM_004571chr2163427 3352 2894 1345 368 216 ------
NM_004575chr42634 349 --1519 11171
NM_004586chrX75134 4581 4303 3805 3579 3479 926 --34827 1802 191 --
NM_004598chr553089 2979 2477 168 93 12214 42907 2489 1222 280 --
NM_004612chr994797 4574 3735 3215 3174 3077 1519 1313 41 41830 1628 488 292 ----
NM_004619chr111769 --1706 --
NM_004637chr371300 1247 1075 426 418 405 202 11090 ----
NM_004639chr6184 ------
NM_004654chrY41166 1155 946 313 ----147
NM_004660chrY22117 840 12333 --11695
NM_004663chr1561556 1151 471 333 58 51 1144 ----
NM_004670chr1041365 1242 609 292 11204 ----
NM_004680chrY3294 252 147 ------
NM_004685chr1332736 2333 1188 --1541 --
NM_004703chr1752506 2483 742 645 256 11629 1307 --
NM_004709chrX31741 1326 341 ------
NM_004715chr181687 ------
NM_004725chr1031135 1083 284 ------
NM_004726chrX105723 4968 2021 1799 1630 1619 1397 810 650 520 --149 --
NM_004730chr51322 ------
NM_004734chr1333201 1041 403 22797 517 2682 160 --
NM_004745chr867003 4524 1477 1388 1364 892 --15689 15743
NM_004755chr143286 125 67 ------
NM_004759chr122183 1785 ------
NM_004760chr752382 1968 1866 188 30 ----1166
NM_004772chr541534 1145 1072 73 ------
NM_004774chr1753124 3016 2552 2191 94 --12680 --
NM_004775chr183844 796 703 ----11490
NM_004776chr2033336 2567 482 --22673 61 --
NM_004779chr521336 1214 --1822 --
NM_004781chr13556 373 217 ------
NM_004781chr13556 373 217 ------
NM_004792chr21155 141 ----
NM_004795chr1361735 1412 1240 1202 678 641 ------
NM_004796chr1441897 1874 844 77 12097 22182 1575 --
NM_004797chr343344 2947 2751 1370 ------
NM_004799chr11319 ------
NM_004801chr2----11392 11420
NM_004815chr154819 3348 2986 1440 1065 --33056 1766 440 13104
NM_004821chr51194 ------
NM_004822chr1743901 3159 2981 1345 --12975 --
NM_004842chr621478 510 11715 --11515
NM_004845chrX23264 2793 --23871 145 --
NM_004850chr211285 ------
NM_004855chr15------1192
NM_004856chr151377 ------
NM_004859chr171568 12638 ----
NM_004865chr6--1154 ----
NM_004866chr574333 4092 3209 3069 1810 1004 938 21617 454 --11392
NM_004867chrX3438 255 45 ------
NM_004879chr115824 646 623 368 201 ------
NM_004884chr152430 66 ------
NM_004888chr92307 192 ------
NM_004893chr51509 ------
NM_004896chr102958 479 --21521 619 --
NM_004897chr102826 780 --1178 --
NM_004898chr432164 852 816 ------
NM_004904chr795675 5187 4259 4233 4119 2615 2029 1530 1134 --26550 6516 --
NM_004906chr6----1692 --
NM_004929chr831437 538 288 11235 ----
NM_004932chr511271 ------
NM_004939chr2125 ------
NM_004947chr372574 2212 1668 982 772 683 61 12432 --11938
NM_004956chr764438 3410 3007 2881 2872 1477 13714 --13664
NM_004965chr212737 539 ------
NM_004973chr61307 --3413 206 115 --
NM_004985chr1273990 3765 3734 3677 3306 1557 252 --23107 1253 23324 809
NM_004999chr664125 3823 3428 858 649 71 ----1122
NM_005010chr712102 --11757 --
NM_005011chr72184 149 ------
NM_005012chr1160 ------
NM_005016chr121148 ------
NM_005028chr1051805 1736 1659 1584 179 ------
NM_005040chr113329 107 69 ------
NM_005045chr7----1742 1326
NM_005056chr1295553 5389 4890 4585 4510 4265 4065 2123 659 1230 11636 --
NM_005057chr12551 233 ----11650
NM_005063chr1093757 2871 2820 2705 2541 1283 1241 844 362 ------
NM_005065chr1475234 4657 4649 4598 1808 1547 1516 13541 24210 2013 --
NM_005076chr122675 196 ------
NM_005078chr1531459 439 265 ------
NM_005079chr863216 3108 2542 2536 856 330 ------
NM_005088chrX1775 ------
NM_005093chr2041426 721 655 558 --24521 667 --
NM_005095chr14541 535 525 473 ------
NM_005102chr23659 571 39 --1137 --
NM_005113chr143430 403 52 ------
NM_005114chr43630 508 484 --1281 --
NM_005119chr12389 313 1417 ----
NM_005121chr1733367 3055 1100 --23064 2378 23269 795
NM_005124chr6198 --1742 1775
NM_005126chr332168 1568 460 11522 ----
NM_005134chr182875 664 ------
NM_005153chr162707 648 1228 ----
NM_005156chr974477 907 810 716 565 296 150 --44582 955 929 507 --
NM_005160chr22136835 6145 5779 5496 4831 4768 4757 2605 1860 930 841 698 395 16305 --16351
NM_005164chr1232142 282 252 --11855 1128
NM_005171chr1211048 ----1904
NM_005184chr191145 ------
NM_005186chr11--1593 ----
NM_005188chr11137106 6535 5484 5064 3227 3218 2840 2458 2198 1883 1717 204 148 16024 48057 7942 5575 1823 --
NM_005190chr63858 785 56 1130 ----
NM_005197chr1475525 4909 4490 4446 3949 2235 61 --23783 982 --
NM_005203chr101415 ------
NM_005230chr121143 ------
NM_005231chr1111374 ------
NM_005235chr2137491 7277 6481 5645 5581 5232 5207 5031 2661 2561 2056 1134 77 14777 26415 1775 --
NM_005238chr1152910 2602 2332 2191 423 ------
NM_005241chr321257 443 ------
NM_005243chr22139 ------
NM_005249chr141305 ------
NM_005254chr152559 449 3914 309 27 ----
NM_005257chr182481 405 --2322 308 --
NM_005261chr8----1169 --
NM_005277chr42309 299 --1200 --
NM_005278chrX2425 186 ------
NM_005281chr111015 ------
NM_005296chrX2372 71 ------
NM_005302chr73347 41 27 1143 ----
NM_005311chr742644 2387 1031 499 --11144 --
NM_005316chr11----1819 --
NM_005328chr81194 ------
NM_005339chr484266 4074 3211 3004 2892 974 329 85 --23601 3088 --
NM_005358chr132526 66 ------
NM_005359chr1846329 2559 2293 1336 24945 379 42023 1794 1732 1345 --
NM_005370chr1931036 501 177 --1873 --
NM_005375chr61190 --1267 --
NM_005378chr2149 ------
NM_005388chr951431 489 334 303 25 1327 1468 --
NM_005397chr7103844 3795 3586 3331 3119 910 771 752 708 520 --12833 --
NM_005399chr183926 3564 3546 3372 3120 2730 1222 700 34333 3993 1022 31078 971 330 --
NM_005407chr14188 ------
NM_005410chr52555 104 ----1147
NM_005417chr2011883 ------
NM_005429chr4130 ------
NM_005433chr1862164 1879 1815 820 763 576 11991 22221 61 --
NM_005436chr1043431 3242 1257 1025 --11624 --
NM_005443chr41493 1408 1434 --
NM_005479chr10--11487 --1222
NM_005493chr62607 162 --187 --
NM_005497chr1755808 5318 4664 1810 248 --26149 603 --
NM_005504chr12124648 4491 2415 2330 1833 1492 1448 1172 842 670 264 87 26370 278 35913 5390 686 25926 4666
NM_005507chr111166 ------
NM_005509chr5--11258 11495 --
NM_005522chr721343 537 11098 1554 --
NM_005524chr31274 ------
NM_005534chr211148 1216 1508 --
NM_005536chr8145 11225 ----
NM_005542chr741874 1779 1429 1400 --2449 39 --
NM_005575chr51800 --1631 --
NM_005578chr354866 1649 1433 1421 200 24897 4462 45154 4394 803 149 --
NM_005585chr151128 ------
NM_005593chr122504 103 ------
NM_005595chr11138 ------
NM_005596chr975104 5019 2083 2037 1916 1659 646 --24746 3944 --
NM_005599chr13994 479 239 ----11438
NM_005603chr1842048 1992 1855 226 ------
NM_005604chr61620 ------
NM_005611chr162462 255 ----1873
NM_005625chr841051 443 230 175 1971 1759 --
NM_005627chr64986 623 321 310 132 ----
NM_005634chrX1644 ------
NM_005637chr1832099 784 269 --1367 --
NM_005639chr1221238 297 ------
NM_005647chrX1417 ----1887
NM_005655chr811218 --1293 --
NM_005662chr8126 ------
NM_005668chr533126 849 57 --13436 --
NM_005680chr22428 357 ----161
NM_005685chr71111 ------
NM_005688chr321360 439 1107 ----
NM_005711chr511072 1194 ----
NM_005718chr3----1245 --
NM_005722chr24890 873 611 603 11741 22508 1725 --
NM_005725chr141616 918 433 100 ----12122
NM_005732chr531472 1092 130 ------
NM_005734chr111759 ------
NM_005737chr242445 2153 2094 1784 ------
NM_005738chr741888 1740 535 52 ------
NM_005742chr2154 ----1571
NM_005746chr741903 442 320 259 --12379 1795
NM_005748chr1223431 2262 --11153 1158
NM_005749chr172260 53 --1588 --
NM_005751chr7142 133 ----
NM_005754chr52856 298 ------
NM_005759chr273813 3757 3741 1122 905 322 183 1703 33512 1795 44 --
NM_005766chr131485 ------
NM_005776chr141581 --1805 1204
NM_005778chr3----1454 1111
NM_005779chr542742 1424 867 348 --13659 23644 638
NM_005788chr113750 631 240 ------
NM_005795chr252517 2379 2264 1053 417 ------
NM_005798chr1395223 4546 4136 3816 2041 806 744 595 70 ------
NM_005802chr92763 133 ------
NM_005806chr21------11344
NM_005822chr642334 1949 1875 693 ------
NM_005826chr12639 52 ------
NM_005828chr1724654 3454 11817 1230 --
NM_005832chr33582 466 358 21204 1003 11101 --
NM_005839chr13920 903 355 ------
NM_005840chrX67523 7336 6813 6696 6659 1432 --15175 16500
NM_005842chr13137 ------
NM_005853chr161483 ----1547
NM_005857chr11122 2430 158 ----
NM_005859chr521145 1126 ----11024
NM_005868chr762059 2030 1975 1959 705 169 ------
NM_005880chr1631421 294 31 --1315 --
NM_005882chr41205 ------
NM_005885chr53620 201 175 --21415 72 --
NM_005888chr121151 ------
NM_005898chr1143083 3056 2372 869 ------
NM_005899chr172348 47 11317 ----
NM_005901chr18147984 7757 7546 7446 7106 7090 5697 3431 3277 2795 2631 2538 1419 125 --58239 5907 5676 525 502 1230
NM_005902chr1574571 4086 3965 3395 1651 1263 735 --14506 --
NM_005903chr575053 4883 4063 3979 3646 3159 402 21284 260 24786 4657 --
NM_005909chr564057 3854 3677 3486 514 29 --11716 --
NM_005923chr6157 ----1262
NM_005935chr484969 3229 1804 1247 1175 769 465 226 --55208 5182 4528 3848 1380 --
NM_005941chr863653 3151 2936 1686 1060 604 ------
NM_005944chr33904 227 209 --11187 --
NM_005955chr195236 4715 4433 3366 1606 1162 1061 953 374 --25166 5142 --
NM_005962chr1021532 872 11553 1903 --
NM_005962chr1021532 872 11553 1903 --
NM_005964chr1731479 1388 70 ------
NM_005966chr242229 585 111 42 --22421 1940 --
NM_006007chr943343 3273 3054 653 ------
NM_006010chr31225 ------
NM_006016chr651577 1480 562 420 107 --22153 2011 --
NM_006031chr21151 ------
NM_006033chr1852089 2082 2065 1602 260 --11848 --
NM_006036chr252492 2439 2430 2187 960 ------
NM_006037chr294801 4252 3469 3036 1533 1376 701 381 172 --23714 1797 --
NM_006038chr2021397 765 11633 ----
NM_006047chr2062758 2730 2403 2387 427 229 --132 --
NM_006048chr11462 ------
NM_006076chr74900 684 653 273 --13220 --
NM_006080chr742316 1174 1026 264 --12801 --
NM_006095chr493995 3516 1629 1563 797 619 423 204 112 11200 1853 --
NM_006106chr1142850 2360 2212 40 33192 2586 597 32893 2502 674 12747
NM_006107chr171211 --153 --
NM_006108chr1152303 1935 1738 1526 477 --12110 --
NM_006113chr132016 792 160 ------
NM_006136chr7----11303 --
NM_006139chr232563 2304 194 --12220 --
NM_006147chr14331 142 71 55 ------
NM_006154chr1522964 2325 12205 2558 113 --
NM_006159chr12124 ------
NM_006164chr21301 ------
NM_006167chr82300 121 1688 ----
NM_006180chr921867 663 ------
NM_006183chr121134 ------
NM_006186chr211239 ------
NM_006195chr931211 537 232 11086 ----
NM_006197chr83753 234 182 ------
NM_006203chr545404 4091 2209 234 13588 55470 5234 3449 1334 580 14320
NM_006206chr422419 606 --12939 --
NM_006207chr81214 ------
NM_006209chr81337 ------
NM_006212chr1185261 4376 4349 4249 4078 3805 3772 3642 3580 3487 3463 1730 1548 1302 872 863 621 326 54970 4913 4623 2082 1503 --13914
NM_006232chr31220 ------
NM_006241chr342191 1831 1619 391 --12172 12222
NM_006251chr563112 2665 2046 411 263 246 13006 --12812
NM_006252chr197073 6755 6261 5251 2292 906 660 647 515 --32688 1630 258 15720
NM_006256chr132134 536 136 ----11119
NM_006258chr1041506 1432 1297 454 1552 --1610
NM_006265chr81321 21431 249 198 --
NM_006273chr171327 --1431 1159
NM_006275chr204817 731 468 329 1223 ----
NM_006281chr83839 281 273 1931 192 --
NM_006281chr83839 281 273 1931 192 --
NM_006283chr884179 4025 3843 3202 1262 379 358 29 13740 --21565 1018
NM_006285chr91255 ------
NM_006306chrX74808 3783 3730 3625 2006 1687 168 --15182 --
NM_006307chrX1245 ----195
NM_006313chr1221721 664 11146 --1140
NM_006315chr433560 869 490 13935 21472 331 --
NM_006320chr43387 251 150 ------
NM_006323chr42740 31 --1174 --
NM_006359chrX5825 763 539 299 216 ----11578
NM_006363chr20----1596 197
NM_006366chr6--1214 ----
NM_006372chr61102 1182 ----
NM_006379chr71384 ----22221 238
NM_006380chr1731592 1253 715 34107 3117 379 24242 2689 --
NM_006390chr1221773 1666 --11291 11676
NM_006393chr10104156 3727 3631 3379 3193 3064 1600 1412 1363 542 --21304 921 --
NM_006401chr9161 ------
NM_006420chr2062290 2258 2178 686 579 110 ------
NM_006421chr821029 182 --1481 1958
NM_006434chr1052483 2211 2056 1020 64 --23173 2873 --
NM_006451chr51257 ------
NM_006457chr453151 2616 1611 1594 1077 1469 1877 --
NM_006471chr181285 --159 --
NM_006475chr131663 ------
NM_006480chr5----1448 --
NM_006482chr1263248 3079 3051 2640 1468 993 23814 2531 1541 --
NM_006489chr1421620 259 11873 ----
NM_006526chr2052205 2061 1884 787 554 --21634 28 --
NM_006534chr2022508 827 22085 166 2963 760 --
NM_006537chr15178 ------
NM_006538chr22778 275 --24165 3275 --
NM_006540chr831523 1151 263 ----1439
NM_006544chr1493844 2440 2268 2205 2084 1045 998 910 560 --34652 2131 2106 1717
NM_006546chr1766502 6232 5825 5643 2459 1715 22535 895 --16117
NM_006547chr741884 1864 1759 1494 --1710 --
NM_006549chr1262257 2050 1160 651 571 316 --22791 2577 --
NM_006557chr921620 1528 ------
NM_006559chr13973 485 210 ------
NM_006561chr1054242 4169 1524 1254 510 1495 ----
NM_006571chr81229 ------
NM_006572chr1752536 2511 630 578 196 ------
NM_006587chr421201 300 ------
NM_006595chr1121988 430 ------
NM_006599chr1655949 5017 3045 1699 460 1645 21672 53 25290 130
NM_006601chr1261036 839 766 707 56 25 ------
NM_006603chrX11710 11694 21595 96 --
NM_006614chr353048 2696 2418 2307 109 22326 314 11462 --
NM_006620chr684599 4377 3833 3641 1925 731 480 263 --11031 --
NM_006621chr121992 102 21412 236 ----
NM_006624chr102642 366 1694 1312 1292
NM_006626chr972225 1994 1875 1859 1831 1724 874 1668 22632 2344 --
NM_006628chr1584684 4483 4394 3498 3398 1033 488 408 ------
NM_006633chr51112 ------
NM_006646chr1332402 365 151 --12360 148
NM_006654chr1244615 1602 1312 280 --23854 640 --
NM_006667chrX11087 11150 1999 --
NM_006670chr62632 254 ------
NM_006699chr122286 760 --22578 2432 --
NM_006700chr121621 --1118 1112
NM_006704chr13----1382 --
NM_006706chr52706 603 ------
NM_006708chr641192 1130 1081 27 --11006 --
NM_006717chr932910 2831 2396 --13199 1294
NM_006720chr1054177 4057 1986 861 749 24808 3824 ----
NM_006722chr332223 283 57 --21081 338 --
NM_006726chr41357 ------
NM_006729chrX74139 3970 3609 2204 2154 1921 862 --13663 --
NM_006735chr71135 ------
NM_006738chr1573730 2860 1662 1578 1219 1119 348 13472 24541 3459 --
NM_006741chr122849 811 ----11076
NM_006750chr16156458 6440 6351 6040 5720 2795 2620 2473 2162 1492 1437 1317 1002 795 575 --27888 7630 --
NM_006751chr22741 329 1768 ----
NM_006756chr82961 47 1534 11428 11090
NM_006759chr21118 ------
NM_006761chr17--1208 ----
NM_006769chr1142 ------
NM_006772chr621092 397 ------
NM_006775chr622233 1059 13001 12372 --
NM_006777chrX82633 2260 1066 810 767 600 133 61 --11975 --
NM_006807chr1721372 1300 --1326 --
NM_006808chr91142 ------
NM_006813chr62720 705 1330 1353 --
NM_006818chr11331 ------
NM_006820chr173944 3938 3681 2853 2786 1712 1005 1409 191 --
NM_006826chr21851 ------
NM_006827chr1453379 1018 902 233 209 1524 22840 397 --
NM_006828chr61404 1601 ----
NM_006838chr1231777 579 437 ----11233
NM_006851chr1222439 438 1445 --11017
NM_006854chr721814 1285 --2299 219 --
NM_006857chr24586 97 59 26 ------
NM_006870chr20--1265 1246 --
NM_006873chr283183 2847 2610 1296 1020 511 300 119 13431 ----
NM_006885chr162901 673 1183 22755 596 --
NM_006888chr1463445 3148 2809 2752 1091 925 ------
NM_006897chr12----1421 --
NM_006898chr21521 ------
NM_006901chr151516 ------
NM_006910chr161144 ------
NM_006915chrX31618 1584 913 12300 1523 --
NM_006916chr241233 1075 248 242 ------
NM_006918chr1185506 4977 2214 1303 1005 836 702 262 --45029 3973 1881 1172 --
NM_006920chr231599 685 306 ------
NM_006924chr1764041 3683 3563 3223 1580 1072 --24449 1614 13092
NM_006939chr141413 ------
NM_006940chr1221892 1291 11431 11696 --
NM_006948chr212192 103 --21795 969 11767
NM_006963chr1031198 873 119 --1463 --
NM_006981chr942520 2000 1150 1048 ------
NM_006996chr12502 69 21633 260 ----
NM_007007chr1294563 4318 3478 3328 1704 1397 756 634 136 1964 33564 1417 1212 13865
NM_007011chr15156715 6669 6572 6534 6517 6342 6317 6275 6005 1822 1738 1282 332 99 73 1693 11338 --
NM_007013chr82980 348 ------
NM_007017chr52643 608 ------
NM_007027chr33414 379 75 ------
NM_007034chr11167 ------
NM_007038chr2195865 5750 5243 4667 1607 1339 667 485 75 14977 15703 11623
NM_007040chr19--11018 ----
NM_007050chr20117280 6159 5932 5823 5722 5122 2526 1261 1253 871 326 12056 37047 2945 2885 13179
NM_007064chr31357 --1652 11471
NM_007078chr1042951 2010 1863 1122 --1817 --
NM_007080chr41115 ------
NM_007107chr312105 1896 ----
NM_007114chr363323 2474 786 755 266 220 ----13341
NM_007125chrY11191 ----1971
NM_007126chr91203 ------
NM_007129chr132148 113 --1993 --
NM_007137chrX74178 3989 3803 3789 1447 1433 56 --14807 --
NM_007146chr1732890 2130 1125 22841 405 --1103
NM_007157chrX41880 802 155 142 --1267 --
NM_007158chr111243 ------
NM_007159chr331467 1343 558 ------
NM_007166chr1131337 635 233 ------
NM_007173chr11102262 1905 1899 1849 1756 1556 467 350 321 35 ------
NM_007175chr843644 2921 927 228 1980 2599 42 12328
NM_007187chr132839 107 --1782 --
NM_007192chr14--11093 ----
NM_007195chr1883611 3575 3489 3001 2985 2946 1147 21 ------
NM_007198chr821653 1156 11480 145 --
NM_007200chr1573730 2860 1662 1578 1219 1119 348 13472 24541 3459 --
NM_007207chr1----1621 --
NM_007212chr11168 --31706 369 92 --
NM_007222chr8--11190 --1609
NM_007231chrX62283 2153 1833 918 124 41 ----11999
NM_007235chr123134 89 66 ------
NM_007241chr171237 ------
NM_007242chr161235 ------
NM_007249chr13169210 9127 8656 7295 6613 3604 3344 3112 2706 2378 2239 2055 2003 1777 1730 39 38923 3216 3010 11675 --
NM_007276chr71361 156 162 --
NM_007282chr33968 83 64 ------
NM_007287chr34915 848 723 198 --12341 --
NM_007288chr34915 848 723 198 --12341 --
NM_007289chr34915 848 723 198 --12341 --
NM_007292chr1794865 4810 4521 3877 3824 1571 919 778 146 --13201 --
NM_007294chr1731146 927 897 --31274 961 179 1251
NM_007295chr1731146 927 897 --31274 961 179 1251
NM_007296chr1731146 927 897 --31274 961 179 1251
NM_007297chr1731146 927 897 --31274 961 179 1251
NM_007298chr1731146 927 897 --31274 961 179 1251
NM_007299chr1731146 927 897 --31274 961 179 1251
NM_007300chr1731146 927 897 --31274 961 179 1251
NM_007302chr1731146 927 897 --31274 961 179 1251
NM_007303chr1731146 927 897 --31274 961 179 1251
NM_007304chr1731146 927 897 --31274 961 179 1251
NM_007305chr1731146 927 897 --31274 961 179 1251
NM_007315chr221348 560 11499 ----
NM_007324chr11319 ------
NM_007345chr1832275 2233 1456 21897 305 1378 --
NM_007349chr71361 ------
NM_007350chr1274597 4222 4151 3340 1237 1075 568 --13976 --
NM_007358chr151729 1652 440 233 39 11346 11295 --
NM_007362chr331536 264 101 ------
NM_007372chr173797 788 281 --153 --
NM_007373chr103461 454 103 11748 --11653
NM_007375chr132749 2375 409 --12712 --
NM_009588chr61559 ------
NM_012069chrX32642 2336 179 ------
NM_012081chr531318 1009 321 13133 22855 1137 --
NM_012089chr111424 --1171 --
NM_012090chr131212 812 523 ------
NM_012095chr1052802 2540 2321 1105 243 1408 2630 231 --
NM_012096chr363762 3516 3385 2981 2387 178 --33735 3350 777 1531
NM_012097chr232133 2011 707 --21533 28 --
NM_012102chr172394 2201 996 984 656 201 112 ------
NM_012105chr211169 ------
NM_012110chr41252 ------
NM_012115chr61545 ------
NM_012120chr642530 1904 792 328 12904 ----
NM_012137chr142897 2779 2612 742 --32589 2089 536 --
NM_012141chr1353568 3542 3391 1281 74 23113 2560 ----
NM_012153chr1142150 2000 639 259 12337 ----
NM_012154chr83745 177 163 1122 ----
NM_012157chr33881 384 267 ------
NM_012175chr112880 54 --1616 --
NM_012177chr6186 ------
NM_012180chr43687 628 504 ------
NM_012183chr11406 ----1493
NM_012193chr11104991 4508 3990 3952 3570 1295 855 667 426 179 --24441 1590 11435
NM_012199chr154530 1224 1108 486 454 --24226 578 --
NM_012207chr102281 66 ------
NM_012214chr296305 6277 6014 5966 5409 4736 4616 1911 1222 11094 26179 495 2716 197
NM_012218chr1941161 1057 797 21 ----1427
NM_012219chr363185 2721 2629 2335 959 735 11082 1436 --
NM_012224chr441181 415 302 112 ------
NM_012233chr22432 218 ------
NM_012234chr32584 223 ----13588
NM_012243chr11350 ----1263
NM_012247chr102394 43 ------
NM_012249chr253019 2551 2260 1385 728 ------
NM_012250chr1131291 1237 1058 ------
NM_012255chr202331 66 ------
NM_012262chr195082 4912 4869 3976 3608 3287 1248 861 282 24634 3305 1732 --
NM_012281chr71782 --11685 11810
NM_012287chr394570 4104 4073 3695 3088 2936 669 336 258 ----13581
NM_012290chr211295 --11206 --
NM_012297chr442405 1942 730 712 --31908 1853 753 --
NM_012300chr512039 ------
NM_012307chr181865 --1172 --
NM_012309chr1174545 4505 3206 1626 1338 846 168 --14301 --
NM_012328chr731188 368 344 --11260 --
NM_012329chr1731633 1446 308 ----1296
NM_012330chr1031595 1378 705 11490 ----
NM_012333chr141535 1145 1053 423 1185 ----
NM_012334chr564014 1839 1827 1237 975 769 ------
NM_012339chr101551 ------
NM_012343chr53966 732 301 --21100 158 1997
NM_012347chr672415 2201 2118 1122 803 346 334 ------
NM_012383chr93361 296 24 ------
NM_012388chr1553189 3139 2531 403 239 ------
NM_012399chr2221916 764 11889 11329 1381
NM_012405chr153825 3482 3142 3004 89 ----12477
NM_012414chr11706 ------
NM_012416chr9------171
NM_012420chr1062154 2147 2015 1942 1646 278 --11498 --
NM_012428chr15------1916
NM_012431chr742979 2648 839 102 --2991 756 12998
NM_012433chr21261 ------
NM_012443chr10198 ----1229
NM_012454chr61149 ------
NM_012464chr451073 1011 613 380 361 11918 22713 2344 --
NM_013229chr1242787 2626 1087 897 --11895 --
NM_013233chr221190 500 1350 ----
NM_013243chr15----1209 --
NM_013255chr7128717 8597 8020 7344 6861 6847 6475 2896 2707 826 612 45 48516 5658 3263 127 1327 25899 5862
NM_013261chr493736 3588 3204 3113 3103 2687 2421 2300 914 ------
NM_013262chr621251 252 --1397 --
NM_013269chr1274381 4223 3951 3443 1332 1195 249 --24158 285 13034
NM_013277chr1221009 344 ------
NM_013282chr19170 --1278 11319
NM_013286chr363153 2570 1042 972 322 180 12408 1170 --
NM_013293chr72575 71 ------
NM_013309chr1532176 1978 475 ------
NM_013316chr72743 699 ------
NM_013320chr12164 ------
NM_013322chr721496 1072 --1254 --
NM_013330chr12242 169 ------
NM_013333chr191370 ------
NM_013341chr242558 2123 893 52 ------
NM_013354chr811044 1491 --1170
NM_013363chr3152 ----1349
NM_013374chr372921 2727 2409 1228 997 686 186 ----13041
NM_013377chr12--132 1197 --
NM_013380chr192774 165 ------
NM_013381chr1212078 --1102 --
NM_013390chr931709 486 240 --1353 11600
NM_013396chr2111486 1239 11424 11465
NM_013400chr711084 ------
NM_013437chr831410 1070 888 ------
NM_013438chr91445 --1276 --
NM_013442chr9----147 --
NM_013444chrX1368 ------
NM_013449chr1222295 121 --21843 585 --
NM_013450chr2----11153 --
NM_013937chr64860 823 412 293 ------
NM_013943chr142791 2555 2216 907 12471 2612 586 12720
NM_013986chr22139 ------
NM_013993chr61727 --1778 --
NM_013994chr61727 --1778 --
NM_013995chrX3867 537 466 --1349 --
NM_013996chr7----1396 --
NM_013996chr7----1396 --
NM_013997chr7----1396 --
NM_013997chr7----1396 --
NM_013998chr7----1396 --
NM_013998chr7----1396 --
NM_014011chr262601 2119 1049 823 800 751 --1604 --
NM_014016chr331134 570 203 11681 194 11646
NM_014021chr143343 2214 1214 532 --53297 2863 753 737 398 --
NM_014028chr663170 2555 882 606 184 152 ------
NM_014034chr61447 ----11439
NM_014035chr521264 1158 --21398 438 1407
NM_014043chr321656 67 1206 ----
NM_014048chr1664710 4372 2039 1030 609 80 21570 763 35234 1387 658 --
NM_014089chr1322019 99 ------
NM_014106chr1552548 2065 927 867 576 141 11154 --
NM_014109chr811042 1992 ----
NM_014110chr13991 823 446 ------
NM_014112chr843899 2091 1983 1125 --33601 3534 552 --
NM_014153chr164644 622 462 91 ----2714 478
NM_014154chr321245 384 1439 ----
NM_014155chr11177541 7037 6648 6470 5796 5538 5104 3019 3007 2443 2017 1465 1441 831 325 111 53 1435 22802 1694 12892
NM_014171chr2--138 ----
NM_014191chr122116 32 1344 1212 --
NM_014211chr541667 1577 1339 196 --134 --
NM_014212chr121809 ------
NM_014239chr14----1340 --
NM_014243chr421685 1316 ------
NM_014253chrX1461 --1197 --
NM_014263chr1021407 321 1298 11378 --
NM_014264chr4169 ------
NM_014267chr112766 721 --1638 --
NM_014278chr41372 ------
NM_014280chr11851 ------
NM_014290chr9----138 --
NM_014294chr831297 509 111 --174 --
NM_014309chr2273336 2166 1588 1409 1022 936 492 --35303 3630 449 --
NM_014323chr222374 171 1668 2185 102 --
NM_014325chr1221529 128 12062 ----
NM_014331chr487087 6603 5826 5410 2485 1885 1160 58 36528 2989 2955 35107 4820 350 --
NM_014332chrX1300 1266 ----
NM_014333chr1171769 1713 1087 888 596 539 381 12445 ----
NM_014344chr112793 28 ------
NM_014374chr711084 ------
NM_014382chr331648 1188 86 ----11096
NM_014386chr5190 ------
NM_014390chr71427 ------
NM_014393chr841816 1563 953 279 21848 413 ----
NM_014395chr431949 257 102 ------
NM_014415chr341646 1147 524 205 ------
NM_014417chr191939 --1734 --
NM_014423chr555280 5141 2113 1509 30 34293 3497 842 55654 5567 5411 4449 998 13796
NM_014435chr43502 177 44 ------
NM_014445chr322398 645 22022 1977 1350 --
NM_014447chr421445 293 ------
NM_014454chr61735 --2680 399 --
NM_014470chr12----1225 --
NM_014491chr731078 961 245 ----1749
NM_014497chr21175 ------
NM_014498chr31299 ------
NM_014500chrX1238 ------
NM_014504chr741960 1606 262 75 21829 1758 ----
NM_014517chr321750 705 193 ----
NM_014520chr17--184 ----
NM_014574chr1451612 990 452 296 31 --11311 --
NM_014577chr22289 25 1724 ----
NM_014588chr203724 683 103 ------
NM_014592chr5--185 ----
NM_014606chr431134 970 316 11196 21410 1106 --
NM_014607chr21608 21633 533 ----
NM_014612chr94959 455 411 155 31413 1155 602 ----
NM_014616chr321397 826 12255 13329 11082
NM_014636chr924252 3378 --1450 --
NM_014637chr83281 253 113 ------
NM_014647chr1631893 1687 847 --21437 1422 --
NM_014660chr72982 229 167 1932 1729
NM_014663chr121044 913 1781 ----
NM_014666chr51378 ----21076 959
NM_014670chr221575 215 ------
NM_014672chr141139 ------
NM_014673chr82207 29 ------
NM_014674chr364030 4004 3929 661 637 416 1756 ----
NM_014676chr121674 1316 ------
NM_014677chr821221 221 ------
NM_014679chr1141140 525 308 78 --11196 --
NM_014682chr862200 943 807 556 520 58 ----1218
NM_014683chr172628 520 --52152 2036 1715 1460 804 --
NM_014700chr16----11319 --
NM_014701chr1542640 2581 2530 213 --12090 1266
NM_014702chr643362 2500 2422 581 12901 23408 2965 11272
NM_014705chr711936 ------
NM_014709chr21129 ------
NM_014711chr1631999 1586 384 --1664 --
NM_014729chr841685 1603 1573 327 21867 623 --1245
NM_014733chr52146 106 1339 --1468
NM_014735chrX--178 ----
NM_014737chr2063510 3354 1261 883 427 21 21665 224 22900 1035 14224
NM_014739chr654068 1535 884 481 63 1756 --11371
NM_014743chr433046 2351 1954 --1187 --
NM_014746chr284183 3436 3175 2995 1635 1175 762 604 21399 1163 11030 --
NM_014751chr831331 253 189 --196 --
NM_014757chr52699 679 1357 21570 454 12189
NM_014764chr1261301 1100 391 352 302 261 11122 ----
NM_014774chr132912 2247 770 ----21042 229
NM_014781chr81884 --11078 --
NM_014782chrX144 ------
NM_014787chr122560 2480 --32091 2006 414 --
NM_014791chr9--181 ----
NM_014793chr151618 ------
NM_014795chr221236 1161 ------
NM_014802chr1241060 464 208 122 2853 285 ----
NM_014810chr173654 2971 2943 2825 2738 2464 2444 ------
NM_014811chr91183 ------
NM_014812chr171539 1458 1376 1319 639 419 255 --1298 --
NM_014819chr592423 2298 2053 1831 1723 1652 1549 882 461 ------
NM_014820chr371613 1480 462 432 398 306 240 --31444 1326 649 --
NM_014824chr1121448 766 --11597 11664
NM_014826chr122659 1470 --21555 343 13235
NM_014827chr131514 1101 588 --1171 --
NM_014829chr551676 835 600 583 115 --192 --
NM_014830chr1253645 2791 2561 1320 268 1759 1452 --
NM_014836chr1021457 126 ----11614
NM_014838chr2242747 1982 1859 66 11045 1958 1256
NM_014839chr132563 340 162 11590 --12002
NM_014841chr6----11121 --
NM_014844chr1434208 3113 1649 ------
NM_014846chr8----2329 44 --
NM_014850chr364239 3803 1397 1115 514 454 ------
NM_014853chr1711478 ------
NM_014864chr164352 3619 3411 1398 1240 386 2713 617 11540 34412 1487 1154
NM_014873chr164908 4791 4763 4125 3237 3223 ----11228
NM_014877chr17117262 7029 6441 5542 5302 5188 5171 4959 2753 2014 1292 15059 46546 5257 3030 2902 14826
NM_014883chr422457 2106 2817 746 --12295
NM_014888chr741440 1076 513 447 1369 ----
NM_014892chr61494 ----1482
NM_014893chrY52103 2076 1567 804 250 --1819 --
NM_014897chr1753121 2892 2526 2399 2090 ------
NM_014899chr532841 2146 929 32050 2011 170 --1460
NM_014900chr231151 254 192 ------
NM_014901chr532195 1743 392 ------
NM_014902chr202443 317 129 --1195
NM_014904chr1043836 3039 2667 1094 --1340 --
NM_014905chr261902 1710 1265 410 276 21 ------
NM_014906chr1763686 3021 1113 624 615 139 2972 533 --11642
NM_014912chr1083030 2910 2184 643 625 599 132 113 1786 33179 2472 654 --
NM_014914chr211142 ------
NM_014917chr12988 865 --1745 --
NM_014918chr1521466 1277 ------
NM_014923chr1331810 1503 225 12003 1701 --
NM_014932chr331769 1509 262 21300 1272 --1741
NM_014942chr662642 2194 2178 1647 103 40 1739 2845 548 --
NM_014946chr283049 3014 2826 2536 2305 2028 1191 274 --158 --
NM_014947chr132217 1078 305 22373 149 1507 --
NM_014949chr12817 796 --1870 --
NM_014950chr1441580 1168 330 83 ------
NM_014961chr412184 ------
NM_014962chr2032443 1974 662 --12873 1734
NM_014969chr13933 900 328 1973 ----
NM_014982chr14103795 2162 2002 1678 1612 1328 833 593 512 419 --14967 --
NM_014988chr452644 2492 1996 712 440 --12319 --
NM_014990chr141345 ------
NM_014992chr141222 --1735 --
NM_014996chr33204 172 92 ------
NM_014997chr742814 2086 1104 1006 --22884 1189 --
NM_014999chr1221534 1193 --11587 --
NM_015000chr1232577 779 547 --31889 1176 1100 --
NM_015002chr123772 605 295 --12265 1861
NM_015008chr3113604 3386 3183 3073 1232 1188 886 832 518 490 235 ----23579 181
NM_015015chr191432 ------
NM_015025chr232750 1850 850 32314 825 142 ----
NM_015026chr1254549 3762 948 777 369 34368 1458 914 44426 1606 1450 1013 --
NM_015032chr1372795 2787 2687 2418 2118 734 355 --12207 1390
NM_015039chr194243 4165 3917 3848 2765 1664 1461 1361 1288 --21174 809 12791
NM_015045chr1022177 129 --31933 1737 845 --
NM_015047chr11338 ------
NM_015049chr221330 1282 --22336 2199 --
NM_015051chr932539 2475 2267 ------
NM_015052chr74258 179 115 99 ------
NM_015055chr11--12837 11818 --
NM_015056chr21191 22365 233 ----
NM_015061chr93907 857 707 ------
NM_015068chr753997 3633 2933 973 25 ------
NM_015073chr1962027 1939 1891 1410 728 706 --12082 --
NM_015074chr164799 4655 3619 3519 3465 316 --24378 3775 --
NM_015090chr185964 5318 5156 5025 2366 2205 1231 901 14481 11625 --
NM_015092chr1633154 810 451 --24208 3872 --
NM_015110chr932376 2206 483 --22349 846 --
NM_015115chr422951 1954 12388 12122 --
NM_015130chr451339 1188 1162 515 49 ------
NM_015132chr751870 516 451 443 190 --160 --
NM_015138chr1552726 2218 1104 622 262 --22499 692 --
NM_015143chr4----1385 --
NM_015144chr1663895 3315 1409 1248 1197 485 ------
NM_015149chr131987 1686 1633 ------
NM_015151chr211361 ------
NM_015153chr62661 256 ------
NM_015155chr1063371 3033 2559 2099 250 179 ------
NM_015156chr1421616 1464 12462 --23732 999
NM_015161chr1651472 1392 1115 1038 622 ------
NM_015163chr1422015 1911 --21222 279 --
NM_015170chr822250 1627 --11636 --
NM_015173chr441748 1391 1162 519 ----21721 659
NM_015176chr11209 1326 11664 --
NM_015180chr142657 254 ----1679
NM_015184chr31436 1106 ----
NM_015191chr1111944 ----1990
NM_015194chr171138 ------
NM_015199chr382953 2359 2085 1130 1007 553 351 132 --12169 --
NM_015200chr42644 584 --22101 879 --
NM_015206chr1552537 1503 1204 838 798 --63808 3387 1453 1069 1013 590 --
NM_015213chr111140 ------
NM_015215chr123089 2860 1172 ----
NM_015216chr521412 452 --11010 --
NM_015225chr962659 2373 1930 984 645 414 ----1221
NM_015231chr112781 89 1843 ----
NM_015236chr441529 1370 1313 160 ------
NM_015245chr612617 ------
NM_015247chr1673852 3824 3507 3266 1805 672 521 11694 24256 4215 --
NM_015250chr921832 1509 --11977 1629
NM_015252chr22249 206 ------
NM_015256chr51575 1112 1144 --
NM_015263chr15----11231 --
NM_015265chr252379 2200 1688 642 45 --12389 --
NM_015269chr11603 --1547 --
NM_015270chr121672 ------
NM_015271chr464045 3639 3121 1634 1315 34 --14022 --
NM_015272chr16----170 1467
NM_015275chr1241937 1530 679 215 --1345 1203
NM_015277chr1851805 1655 1603 1267 390 ----1399
NM_015291chr173362 2713 2693 2380 2334 1107 21 1832 12230 1105
NM_015308chr111598 ----1109
NM_015310chr898023 7070 6100 5456 3276 2431 1934 1505 196 15866 3981 897 59 --
NM_015313chr1184258 3928 3014 1778 1727 1643 315 108 ------
NM_015314chr72123 80 1516 --1162
NM_015323chr641667 590 430 223 11722 ----
NM_015335chr122995 578 1831 --12108
NM_015339chr2051000 849 771 710 420 ------
NM_015344chr831810 294 189 ----12196
NM_015346chr141709 --21719 1445 --
NM_015347chr1242898 2298 2187 2122 21172 737 ----
NM_015349chr663103 2684 1949 1209 980 124 ------
NM_015352chr2052734 1346 795 482 349 --21169 334 --
NM_015355chr1772006 1582 1562 1460 1375 474 427 --11891 --
NM_015358chr212449 422 ------
NM_015359chr842802 2382 811 670 12824 11977 --
NM_015361chr21761 ------
NM_015365chrX63896 3550 2903 589 545 220 1439 13292 --
NM_015367chr2221527 1096 --11563 --
NM_015381chr2211988 ------
NM_015384chr51167 ------
NM_015385chr1052483 2211 2056 1020 64 --23173 2873 --
NM_015387chr231900 1824 1319 ------
NM_015393chr453346 2831 2772 1275 651 13667 23722 3450 12668
NM_015394chr1211621 --31768 660 193 1166
NM_015396chr321003 147 --2456 414 --
NM_015397chr951767 1355 467 68 26 --31899 1718 443 --
NM_015409chr1222568 475 12732 11082 --
NM_015436chr422941 1029 13024 --12722
NM_015439chr61482 ------
NM_015446chr12454 285 11329 1129 --
NM_015455chr544048 3708 1137 89 --1253 --
NM_015457chr11--1876 ----
NM_015460chr3111968 1962 1893 1682 1479 1473 1337 769 752 563 192 --1328 --
NM_015462chr17--1252 ----
NM_015472chr3--1352 ----
NM_015472chr3--1352 ----
NM_015475chr21386 --3909 162 141 --
NM_015477chr151893 ------
NM_015485chr11345 ------
NM_015514chr141596 ------
NM_015542chr1011162 ------
NM_015550chr733004 2989 1409 13178 11034 --
NM_015553chr633211 1276 664 14099 ----
NM_015554chr1532855 1834 946 --11153 --
NM_015555chr62283 149 --1480 --
NM_015564chr582818 2373 1183 1058 864 765 686 300 --22695 1350 --
NM_015568chr2073888 2941 1708 1433 1279 1081 259 1860 14165 11691
NM_015569chr184025 3901 3742 3604 3528 1655 1208 525 --11887 --
NM_015570chr721551 1447 --31595 194 185 --
NM_015571chr622212 1067 ----11852
NM_015575chr232608 2467 800 1266 ----
NM_015576chr332538 1840 940 32460 2194 412 31997 1847 1011 --
NM_015578chr1941327 835 802 765 ------
NM_015589chr141140 ------
NM_015602chr161409 1232 1163 413 355 342 ------
NM_015626chr173298 217 103 1782 ----
NM_015630chr2--1283 ----
NM_015633chr123973 787 762 --11014 --
NM_015635chr921568 52 --42189 1810 1448 136 11475
NM_015640chr155231 5107 3679 2141 1584 11675 13276 15216
NM_015641chr72959 272 --21083 123 --
NM_015668chr81155 ------
NM_015678chr1321148 593 ------
NM_015690chr21148 ------
NM_015711chr193794 649 595 --1722 --
NM_015713chr853153 2946 2269 784 537 --1550 --
NM_015866chr131461 413 296 11341 ----
NM_015878chr83210 191 26 ----1564
NM_015879chr18127726 7515 6382 6176 5989 5621 5247 2257 1773 1236 1090 168 1283 25712 2286 --
NM_015885chr113711 265 52 ------
NM_015888chr142709 972 848 573 ----12183
NM_015895chr61193 ------
NM_015898chr191190 --1927 11623
NM_015902chr8----154 --
NM_015904chr22310 298 1328 2841 789 --
NM_015906chr164398 4246 4179 3183 1581 512 33737 1832 564 23588 3258 11493
NM_015938chr33915 223 88 ------
NM_015971chr171325 ------
NM_015980chr521460 559 ------
NM_015984chr11542 2496 447 1357 --
NM_015990chr42835 340 ------
NM_015999chr12746 487 ----1289
NM_016002chr12279 185 1194 1258 --
NM_016009chr154013 1797 959 830 300 2548 428 ----
NM_016018chr831150 988 371 1746 12352 11850
NM_016019chr71307 ------
NM_016021chr662744 2402 2247 1184 794 786 11946 22032 720 --
NM_016022chr111095 --1983 --
NM_016025chr1631907 1485 211 ------
NM_016027chr81391 ------
NM_016039chr141130 ------
NM_016040chr132695 1713 83 22082 785 1562 --
NM_016041chr172282 60 ----1112
NM_016059chr62900 368 --1856 --
NM_016073chr1511109 --1265 --
NM_016076chr152918 844 478 470 399 22607 2024 ----
NM_016087chr721725 1405 --11562 1684
NM_016123chr12167 ------
NM_016125chr17180 ------
NM_016126chr1284 28 ------
NM_016127chr8146 ------
NM_016128chr3--1214 1131 --
NM_016129chr41277 ------
NM_016131chr212072 --11473 --
NM_016132chr1532712 503 422 --2471 345 --
NM_016133chr211638 --21408 1256 11149
NM_016151chr161329 ------
NM_016200chr7198 ------
NM_016203chr72770 716 1228 --1165
NM_016205chr42581 451 --1223 --
NM_016206chr3118593 8465 8316 6292 3607 2440 2231 1801 1400 681 300 13111 17004 27111 3125
NM_016217chr633533 2792 970 11067 1390 11214
NM_016221chr542331 1637 687 526 --1953 --
NM_016224chr642162 1723 1523 183 ------
NM_016231chr1721704 430 ------
NM_016248chr13103992 3186 2804 2461 1458 1417 1149 1008 455 267 --23807 476 --
NM_016252chr22776 153 1679 ----
NM_016255chr642331 1153 287 267 22796 233 12186 --
NM_016258chr11319 ------
NM_016260chr297577 6283 5752 5578 5540 5446 5409 3066 2819 25952 672 --35380 1533 1133
NM_016269chr4--11047 ----
NM_016271chr1822163 566 ------
NM_016272chr2231068 551 106 --32784 2343 99 12724
NM_016275chr322657 360 12680 12727 --
NM_016279chr5----1187 --
NM_016287chr1----2582 352 --
NM_016289chr232227 641 212 ------
NM_016303chrX1376 ------
NM_016308chr131345 808 616 1762 ----
NM_016315chr231842 1643 1322 11909 ----
NM_016316chr21248 --2693 590 --
NM_016322chr952218 1165 964 533 313 22866 1182 12637 --
NM_016328chr71111 ------
NM_016351chr71497 ------
NM_016357chr1231178 1044 983 ----11263
NM_016376chr1744344 4158 2984 1559 ------
NM_016377chr621478 510 11715 --11515
NM_016396chr1562866 2138 2102 1843 851 792 1325 ----
NM_016410chr9189 ------
NM_016424chr1731716 766 321 --11558 --
NM_016426chr225860 787 708 690 642 --11715 --
NM_016427chr183316 161 40 ------
NM_016436chr2031766 844 122 ------
NM_016448chr141686 1171 711 107 11381 ----
NM_016463chr51127 ------
NM_016470chr203512 369 55 ------
NM_016472chr141336 ------
NM_016485chr6----1142 --
NM_016507chr1721988 379 ------
NM_016530chr1512898 24090 2547 12570 23684 1005
NM_016545chr11898 ------
NM_016578chr111208 ------
NM_016586chr141313 ------
NM_016587chr71361 156 162 --
NM_016588chr61932 1865 1842 --
NM_016591chr511069 ----1236
NM_016598chr311429 --11165 --
NM_016603chr52878 517 ------
NM_016608chrX--1249 2268 100 --
NM_016622chr242093 1737 700 177 12134 ----
NM_016626chr1821316 337 ------
NM_016628chr101197 1605 ----
NM_016631chr2131021 956 881 1739 ----
NM_016640chr52100 69 ------
NM_016653chr24839 824 438 386 ------
NM_016654chr152559 449 3914 309 27 ----
NM_016824chr1051566 1289 1280 1243 676 --11641 --
NM_016836chr2167 --1269 --
NM_016839chr2167 --1269 --
NM_016931chr111276 ------
NM_016936chr1651928 1694 806 642 58 ------
NM_016950chr421188 587 1406 --11005
NM_016954chrX1137 ------
NM_017412chr81943 ----150
NM_017420chr1433742 2906 834 1820 ----
NM_017423chr41353 21354 159 12113 --
NM_017425chr112285 92 ------
NM_017426chr41205 ------
NM_017431chr2------1691
NM_017437chr1422293 1965 21490 920 2636 134 --
NM_017449chr131665 1232 1123 --11634 11103
NM_017455chr15------1916
NM_017519chr61900 --21193 295 --
NM_017544chrX1379 --144 1237
NM_017545chr201520 ------
NM_017548chr342023 510 343 88 ------
NM_017594chr942474 2217 1207 792 --22595 2182 1841
NM_017599chr1232066 1310 621 --21829 183 --
NM_017610chr1572093 2046 833 342 208 175 93 ------
NM_017617chr921493 1278 1135 11213 --
NM_017628chr453869 3328 932 914 357 11968 11978 --
NM_017629chr131333 487 105 ------
NM_017633chr663932 2564 1289 734 546 421 --12613 --
NM_017634chr831753 1744 191 1364 --11785
NM_017635chr1131439 1262 444 --11222 --
NM_017637chr9139474 8799 8437 8257 7274 7250 7053 1546 778 772 710 367 239 --12668 17705
NM_017640chr61229 3938 808 696 ----
NM_017643chr1762761 2374 954 738 429 116 22722 39 2421 130 --
NM_017644chr364200 3691 3607 1694 1613 1347 --13534 --
NM_017650chr7116102 5978 2378 1623 1009 955 900 792 501 443 232 --34966 4290 1107 14957
NM_017657chr23753 718 234 --1908 --
NM_017658chr1494023 3056 1876 1775 1546 1531 1364 1161 377 24394 1434 1893 --
NM_017661chr1531078 843 259 1229 ----
NM_017666chrX32180 1826 1365 1712 1589 --
NM_017672chr151273 ----2876 359
NM_017693chr1381637 1605 1589 1343 1319 1054 526 321 --21438 109 179
NM_017704chr113849 336 215 ------
NM_017705chr1553694 3423 3345 1393 1073 22294 199 13109 --
NM_017709chr194196 4006 3741 3167 1570 1440 1329 963 616 13315 ----
NM_017735chr2187 ------
NM_017737chr11134 --1479 --
NM_017739chr12537 80 ------
NM_017742chr1831450 127 109 21953 558 11397 --
NM_017747chr5168 ------
NM_017761chr11234 ------
NM_017768chr11112 --1203 --
NM_017769chr1413122 1282 --12337
NM_017778chr851482 567 187 100 57 ------
NM_017786chr81504 ------
NM_017801chr332581 2124 947 --1235 12612
NM_017824chr1022172 411 --22423 547 --
NM_017830chr4----1168 --
NM_017845chr4------135
NM_017846chr11803 ----1101
NM_017848chrX83338 2965 1742 1644 976 527 114 102 21595 61 22854 700 14110
NM_017902chr1085544 4650 4205 2185 2086 1990 1602 1114 11091 --15312
NM_017919chr955018 4820 4707 3842 3547 15252 55621 5107 3950 722 258 --
NM_017922chr142653 234 ------
NM_017925chr931818 1339 48 --1214 --
NM_017935chr41132 ------
NM_017938chrX11610 --31885 1559 499 --
NM_017944chr111985 13032 ----
NM_017964chr23668 323 247 --1983 --
NM_017987chr1072032 1873 1656 1644 1582 1499 456 --2591 437 --
NM_017988chr123882 328 199 ------
NM_017998chr911257 1280 ----
NM_018011chr131642 ------
NM_018014chr22537 480 ----11004
NM_018017chr1022648 2078 1695 ----
NM_018027chr1032886 2486 2232 13154 ----
NM_018030chr18--11053 --1759
NM_018043chr1121246 924 --11012 --
NM_018051chr7144 ----1314
NM_018063chr10--1426 ----
NM_018078chr421056 286 --1259 --
NM_018084chr263350 2528 1239 1095 983 273 ------
NM_018085chr187733 7481 6941 5879 2753 2165 732 690 13221 12589 16026
NM_018086chr22336 155 --1484 --
NM_018090chr111093 --11157 --
NM_018098chr32211 141 1921 ----
NM_018105chr831179 1057 267 ------
NM_018121chr101847 --23117 2093 13150
NM_018126chr431513 1213 575 1451 ----
NM_018133chr331738 1346 859 11964 --1797
NM_018157chr1233235 760 333 1269 ----
NM_018159chrX11313 ------
NM_018171chr122921 363 1637 ----
NM_018177chr42457 167 ------
NM_018184chr321373 329 --2804 344 --
NM_018200chr1562412 2254 2112 953 291 253 12489 12574 --
NM_018206chr161755 --1517 --
NM_018214chr631154 996 206 ------
NM_018227chr472424 2287 2242 2136 608 414 40 12782 21040 837 --
NM_018237chr10--195 ----
NM_018247chr611148 12433 ----
NM_018254chr152332 2242 1573 498 268 ------
NM_018257chr2032150 1960 1654 --1795 12371
NM_018263chr232336 2232 461 --1156 --
NM_018287chr102107 49 --21356 1284 --
NM_018299chr812441 --2864 647 13079
NM_018300chr191598 --1422 1183
NM_018302chr41348 2741 632 ----
NM_018312chr113785 529 348 --1268 --
NM_018313chr342532 2180 1896 774 --1214 --
NM_018318chr121962 ------
NM_018319chr1431407 571 318 1440 21364 589 --
NM_018327chr2051651 1232 753 466 198 ------
NM_018330chr101426 21566 612 ----
NM_018351chr1264342 4264 3479 1789 1755 1106 --23334 1007 --
NM_018361chr872742 2651 1469 1337 920 746 165 33899 583 557 23304 882 --
NM_018362chr1132694 1492 801 24042 1007 33512 284 261 11244
NM_018364chr132626 1326 389 --23871 1301 --
NM_018365chr151112 --131 --
NM_018370chr123548 514 340 --1234 --
NM_018373chr1476045 5631 5166 1263 395 379 102 1615 --14982
NM_018374chr794266 4163 3910 3826 3313 1439 886 700 198 --44905 4810 4471 4182 --
NM_018375chr141423 ------
NM_018387chr9--1144 ----
NM_018388chrX1297 --1922 --
NM_018394chr321598 217 ------
NM_018398chr3--1136 ----
NM_018399chr65810 665 555 321 271 --1188 --
NM_018403chr323588 2675 24021 1502 33968 3118 1175 --
NM_018409chr463054 2858 2419 2265 1165 1065 ----1735
NM_018412chr7------1117
NM_018413chr12----147 --
NM_018429chr552583 2294 351 118 37 --1404 --
NM_018434chr5131 ------
NM_018439chr1872553 2173 2126 1923 809 670 458 1482 21886 985 --
NM_018444chr82437 202 12070 4721 636 310 56 --
NM_018445chr151529 ------
NM_018448chr1231153 495 462 1273 1929 --
NM_018452chr6_random33566 1395 719 --11165 --
NM_018460chr21139 ------
NM_018465chr91203 --185 1101
NM_018472chrX1138 ------
NM_018490chr111388 1256 ----
NM_018553chr1761681 1504 1400 1222 712 670 --1277 --
NM_018566chr185063 3868 3550 3411 1550 1173 846 738 25092 602 34146 1368 1051 --
NM_018569chr441102 437 293 158 21125 492 ----
NM_018571chr21661 ------
NM_018638chr1285659 4182 3445 2177 1676 1441 1138 522 --32228 1566 1297 --
NM_018640chr1262163 1894 1023 959 913 231 12150 ----
NM_018650chr132156 1475 309 --12112 --
NM_018658chr1731878 1757 411 11886 --12250
NM_018667chr1652616 2392 2368 909 249 ------
NM_018674chr2--1686 ----
NM_018683chr2011688 ------
NM_018685chr72220 72 --1336 --
NM_018686chr12--1288 ----
NM_018695chr572213 1880 1852 846 712 464 39 21608 348 12078 --
NM_018703chr161144 ------
NM_018704chr151940 1340 668 179 42 11685 1359 --
NM_018708chr1921518 1506 --11317 1667
NM_018834chr51767 ----1706
NM_018841chr153876 3143 1563 1302 69 --13742 --
NM_018845chr1----1211 --
NM_018945chr643503 1468 1322 556 1439 33469 3098 2514 --
NM_018948chr121170 487 11416 ----
NM_018970chr732890 2075 2039 --11001 --
NM_018972chr821671 947 --22419 904 --
NM_018975chr162748 249 --1147 --
NM_018993chr2021446 1282 1579 ----
NM_018999chr1074787 4591 3983 3487 1662 1222 1074 24850 3779 ----
NM_019000chr51119 --1470 --
NM_019001chr354773 4383 1580 1294 551 64901 4877 4815 4678 1509 460 33434 3328 3031 14606
NM_019004chr711912 ------
NM_019006chr151295 --1124 --
NM_019022chr1862355 2008 819 417 234 84 ------
NM_019024chr22179 165 ----1399
NM_019027chr441695 633 358 123 --12565 --
NM_019044chr223176 1438 21182 35 13999 --
NM_019049chr12250 166 ------
NM_019053chr1041096 850 168 54 ------
NM_019063chr242049 1681 315 47 --1107 --
NM_019071chr7----1143 149
NM_019072chr564069 4045 2724 2623 958 918 ------
NM_019083chr12483 462 21446 360 ----
NM_019084chr1031851 320 94 ----1634
NM_019114chr942352 355 326 117 ----1468
NM_019116chr1653719 3704 3419 530 313 --12594 --
NM_019555chr3--2511 284 --11530
NM_019590chr102477 148 --1516 --
NM_019593chr2042453 2300 1185 358 ----11076
NM_019605chr13672 203 77 ------
NM_019610chr12870 442 --22060 340 --
NM_019843chr222470 446 1167 ----
NM_019857chrX21223 446 --1664 --
NM_019891chr121295 1228 ------
NM_019903chr1051566 1289 1280 1243 676 --11641 --
NM_020069chr111229 ------
NM_020122chr255256 1780 1721 1008 100 ----11893
NM_020133chr666062 5923 4217 2404 1728 791 --35596 5295 4299 --
NM_020147chr151930 --138 --
NM_020148chr182746 528 12780 2693 125 12719
NM_020150chr1011419 11429 --1773
NM_020159chr411292 --1382 --
NM_020182chr2023052 386 --1613 --
NM_020189chr81142 ------
NM_020194chr22485 55 ------
NM_020199chr51259 --1872 11321
NM_020205chr153465 2259 2137 1069 534 --13312 --
NM_020228chr1172416 2360 583 444 277 238 91 --32272 2101 220 --
NM_020231chr33245 165 42 ------
NM_020245chr664884 4152 3435 3239 1229 1010 13163 24508 52 --
NM_020337chr422245 653 --23041 897 --
NM_020341chr2041897 1672 1357 331 --21622 1264 --
NM_020342chr261858 887 818 768 184 127 ------
NM_020348chr1062585 2119 1972 1078 490 246 --22705 159 22742 822
NM_020351chr3------140
NM_020354chr101283 2830 625 1167 1669
NM_020357chr331150 642 189 --21347 586 --
NM_020379chr11349 ------
NM_020390chr354464 3885 1135 410 51 13991 23502 1243 --
NM_020416chr462117 1805 1081 865 646 329 --22252 612 12172
NM_020420chrY31652 356 341 ------
NM_020425chr621801 708 ------
NM_020440chr143266 3235 2992 2630 12111 12902 --
NM_020443chr1126214 5324 4924 2757 2396 2313 1791 1500 1473 497 412 277 36352 5172 4426 1440 --
NM_020452chr121958 1935 11763 ----
NM_020453chr44752 594 259 51 --11294 1343
NM_020455chr632093 692 177 --22561 2523 12064
NM_020463chr21528 135 11333 --
NM_020473chrX41717 1516 1489 1310 11911 --126
NM_020474chr1821343 389 11890 1399 1599
NM_020475chr822378 2354 ----1631
NM_020476chr822378 2354 ----1631
NM_020477chr822378 2354 ----1631
NM_020478chr822441 2417 ----1694
NM_020480chr822378 2354 ----1631
NM_020640chr351783 1606 1496 1443 496 12039 11888 --
NM_020642chr111590 ------
NM_020648chr1822031 281 1190 62764 2583 2361 2081 1946 719 --
NM_020649chr17168 ------
NM_020651chr211687 --1691 --
NM_020653chr171161 ------
NM_020654chr331346 1216 171 ------
NM_020661chr1241955 1811 188 156 1688 1426 --
NM_020673chr2085343 5024 4902 4860 3049 1810 1504 1238 12219 37616 6313 2173 21634 315
NM_020689chr201445 --11350 --
NM_020699chr145228 4919 4407 263 14195 ----
NM_020704chr762463 1699 1009 964 626 426 11893 11750 --
NM_020711chr252456 2284 2260 2007 456 --11633 --
NM_020718chr1686141 4351 2389 2316 2154 1787 1340 1190 15335 21915 1410 14587
NM_020726chr51105 ------
NM_020727chr2153272 3130 2789 1525 42 22491 928 23738 618 --
NM_020732chr61900 --21193 295 --
NM_020734chr1223350 401 13373 --12529
NM_020738chr251765 1534 290 201 61 ------
NM_020742chrX42618 2144 868 269 12449 1474 --
NM_020747chr5------1142
NM_020748chr1752019 765 629 500 198 ------
NM_020749chr851664 342 229 217 49 --31982 762 750 --
NM_020752chr1032572 1918 355 ------
NM_020754chr321447 1197 ------
NM_020755chr6--11278 --1133
NM_020760chr221669 583 --11566 1682
NM_020766chrX33920 3112 1050 23181 1582 14080 --
NM_020768chr563100 1301 692 468 391 187 --12038 --
NM_020770chr111111 ------
NM_020771chr631372 1049 518 --11115 1219
NM_020772chr17158608 8532 7549 7164 7025 6427 6142 6054 5609 5489 3372 3072 1979 500 411 --38416 6596 86 11730
NM_020774chr1885904 5570 5526 5090 4929 4814 1686 328 --13909 152
NM_020782chr1264267 3981 3866 3284 3218 214 23491 349 24330 1657 24313 1809
NM_020783chr1821920 356 ----12114
NM_020791chr1731153 416 328 --11270 --
NM_020794chr111473 11041 ----
NM_020796chr562864 2740 2161 1933 978 645 ------
NM_020799chr10166 ------
NM_020801chr522437 204 ------
NM_020810chr1453531 3371 2717 2421 734 ------
NM_020830chr243008 1224 558 198 ------
NM_020841chr1243284 1227 77 38 --11338 --
NM_020854chr181177 ------
NM_020856chr1931015 603 524 ------
NM_020860chr41988 ------
NM_020861chr611091 ------
NM_020871chrX22508 2238 2465 124 1683 --
NM_020873chr31822 --1669 --
NM_020898chr121160 ------
NM_020917chr1963765 2397 1236 1024 497 479 --12385 --
NM_020918chr1083614 3578 3242 1288 1116 601 165 157 11452 13276 --
NM_020921chr1482959 2749 2606 2552 724 619 370 211 11076 32951 2829 2467 13606
NM_020922chrX3647 490 254 11419 11782 11426
NM_020935chr274492 4102 3616 3597 3566 3027 775 12839 13634 --
NM_020940chr1042436 2055 873 684 ------
NM_020948chr163600 2579 2409 1291 541 280 11226 2687 166 12822
NM_020951chr1932299 1936 36 ------
NM_020958chr14195 1331 ----
NM_020975chr1051781 665 595 377 185 --1583 --
NM_020977chr432054 2048 1691 ------
NM_020983chr121672 ------
NM_020987chr101138 ----1904
NM_021003chr142269 171 ------
NM_021007chr222276 91 --1644 11952
NM_021032chr341548 1456 507 450 --11871 --
NM_021064chr631789 1370 188 ----1224
NM_021072chr542522 2248 633 503 1375 11688 163
NM_021079chr17102328 2193 2109 2094 1224 1200 1149 608 524 395 --1854 --
NM_021101chr322455 1733 --32339 2089 219 --
NM_021109chrX--1363 ----
NM_021109chrX--1363 ----
NM_021111chr91166 ----11191
NM_021116chr7148871 8651 8241 7939 7771 7071 6766 5862 3287 2770 2425 1932 1263 1241 --1697 --
NM_021140chrX----11037 --
NM_021156chr2061092 1086 1023 983 858 222 1804 ----
NM_021180chr11635 ------
NM_021183chrX42517 2489 2410 2022 12204 22016 166 --
NM_021190chr131129 881 92 ------
NM_021194chr11305 ------
NM_021204chr4----1850 1731
NM_021220chr202296 56 ------
NM_021227chr41363 ------
NM_021228chr191231 ------
NM_021238chr1232042 1850 141 1292 21453 741 --
NM_021239chr1431395 96 33 ------
NM_021242chrX1634 ------
NM_021249chr1421575 1206 ----1530
NM_021252chr1042010 1727 1570 1494 ------
NM_021253chr611175 ------
NM_021255chr1432919 1386 875 13577 151 171
NM_021622chr103749 743 300 --11808 11855
NM_021629chr394562 4322 3989 3817 3640 3084 1697 1458 652 --25034 103 --
NM_021631chr8168 ------
NM_021639chr12683 643 --1222 --
NM_021644chr102281 66 ------
NM_021647chr474542 4321 3638 3614 1545 1499 386 --24332 1402 11121
NM_021648chr642529 1973 1828 1778 --22213 2171 --
NM_021722chr71456 ------
NM_021723chr71497 ------
NM_021728chr14133 ------
NM_021804chrX4864 574 235 33 ------
NM_021814chr61188 ----1664
NM_021815chr262743 2518 2209 1064 474 218 --12572 --
NM_021818chr14--11510 ----
NM_021911chr543975 1365 466 223 ----13405
NM_021912chr1543306 3054 2970 952 --21470 1048 --
NM_021914chr1411822 129 21748 1726 --
NM_021947chr172916 122 ----1462
NM_021951chr92823 809 ------
NM_021952chr1--1194 ----
NM_021956chr621166 1005 ------
NM_021960chr142260 1049 947 273 12389 ----
NM_021964chr396327 5476 5358 4833 4299 1467 771 549 92 24699 4171 1978 --
NM_021988chr20--11610 ----
NM_021998chrX1948 ----1136
NM_021999chr131293 --1787 --
NM_022037chr23979 742 77 ------
NM_022048chr1586108 5746 5699 5079 4636 3943 1681 1558 --21835 1438 --
NM_022058chr22805 102 ------
NM_022114chr154488 4209 1581 414 215 ------
NM_022121chr641129 1015 828 337 ----11034
NM_022123chr14----1559 1552
NM_022130chr521483 543 --11358 --
NM_022133chr81734 1633 11684 --
NM_022143chr731500 1420 998 --11011 --
NM_022154chr431281 526 68 ------
NM_022166chr1684345 4014 3994 2249 1386 1139 316 34 35923 4892 3866 ----
NM_022173chr23979 742 77 ------
NM_022351chr843623 2627 2503 432 --22558 384 --
NM_022374chr21111 ------
NM_022442chr20--11610 ----
NM_022443chr31189 ------
NM_022458chr763091 2620 2600 799 361 171 12458 ----
NM_022459chr13106284 5993 5417 5031 4369 4186 2549 2481 1290 111 14723 ----
NM_022461chr341213 1107 550 539 --2114 91 --
NM_022473chr1554310 3126 1670 1196 205 --1593 --
NM_022474chr1462593 1822 1773 713 134 122 --12117 12443
NM_022475chr43678 304 235 ------
NM_022488chr3143 ------
NM_022494chr10----2467 438 --
NM_022552chr21205 ------
NM_022566chr151565 ------
NM_022652chr123781 436 173 ------
NM_022716chr153105 2475 2040 1102 697 12883 ----
NM_022726chr621697 367 --1305 11141
NM_022731chr1------129
NM_022733chr111146 ------
NM_022735chr121612 1447 --31891 1268 673 --
NM_022753chr182624 2149 788 750 659 636 196 95 1103 ----
NM_022763chr362417 1204 329 283 194 119 --33133 2826 2428 1694
NM_022771chr1231051 351 155 11022 1741 --
NM_022780chr231444 282 208 ------
NM_022781chr982952 2825 2811 2433 2176 1004 987 315 ----12881
NM_022784chr1531111 873 85 1314 ----
NM_022817chr212258 --170 1255
NM_022828chr511445 ------
NM_022841chr1552663 1905 1091 912 286 1693 11808 --
NM_022845chr1631988 1683 875 ----11560
NM_022893chr273095 3007 2224 1933 1160 736 97 ------
NM_022898chr1484421 4393 4293 4017 3922 3685 1616 1213 --24727 312 --
NM_022900chr721077 1023 21090 288 ----
NM_022913chr51120 --1295 --
NM_022965chr441556 1137 1123 1111 ------
NM_022970chr1031153 337 156 21401 461 ----
NM_022977chrX52042 1811 997 918 702 31837 1017 957 22607 2124 --
NM_023000chr1421493 623 11371 11301 --
NM_023001chr1421493 623 11371 11301 --
NM_023074chr19------1908
NM_023075chr18----2828 797 --
NM_023929chr852372 1981 1925 1774 594 --32598 2528 481 --
NM_024007chr552906 2371 2334 1042 182 --2507 130 --
NM_024052chr1762989 2874 2332 2282 343 231 ------
NM_024090chr411802 --1386 --
NM_024295chr811909 ------
NM_024308chr17--164 1142 --
NM_024315chr72442 115 ------
NM_024345chr965857 4630 4236 2342 827 362 24958 653 35824 888 634 22173 91
NM_024415chr5159 ------
NM_024420chr11390 ------
NM_024423chr1874111 3982 1424 1091 447 313 100 11354 1239 --
NM_024429chr72770 716 1228 --1165
NM_024430chr183716 435 138 ------
NM_024501chr22685 482 ------
NM_024512chr363493 3174 2544 2488 2288 922 ------
NM_024524chr323057 2113 157 12451 --
NM_024529chr13854 348 91 ------
NM_024548chr331726 582 181 11641 ----
NM_024561chr1331111 309 111 ----11305
NM_024576chr61187 ------
NM_024582chr42905 293 ------
NM_024583chr21108 --1402 --
NM_024586chr11200 1552 1449 --
NM_024590chr411628 21857 1225 11268 --
NM_024607chr853925 3806 3724 3341 877 24087 2811 ----
NM_024612chr172895 194 ------
NM_024615chr52181 59 ------
NM_024617chr92583 206 1216 1131 --
NM_024624chr211306 ------
NM_024631chr11----1535 --
NM_024639chr642860 2074 1936 775 12587 ----
NM_024645chr861406 1177 345 225 149 143 ------
NM_024646chr153725 3576 3518 1546 1354 32631 848 179 ----
NM_024665chr354709 3451 3400 3338 1373 ----11626
NM_024670chr1011224 ------
NM_024686chr12483 358 ------
NM_024705chr13----1245 --
NM_024713chr1521396 1054 1309 11133 --
NM_024721chr821899 905 ------
NM_024726chr2------1508
NM_024744chr251980 1848 1771 1059 873 ----22566 535
NM_024745chr162134 38 ------
NM_024749chr152161 1528 664 589 543 --1901 1245
NM_024751chr432076 1618 320 --11901 --
NM_024755chr151621 ------
NM_024757chr9--1866 ----
NM_024770chr236667 6654 263 --15164 --
NM_024780chr161201 ------
NM_024785chr211170 --11470 --
NM_024837chr1521921 81 --1249 --
NM_024854chr1211457 --21300 612 --
NM_024899chr183725 444 22 ------
NM_024911chr12694 584 ------
NM_024920chr421323 90 ------
NM_024927chr17163 ------
NM_024947chr398702 8114 7924 6518 3368 2752 2469 1244 124 --19350 --
NM_024948chr101745 ----130
NM_024949chr464154 3876 3644 3327 1018 68 11908 44931 1398 693 148 --
NM_024953chr1242054 1953 930 554 191 ----
NM_024969chr23617 369 205 1197 ----
NM_024979chr131426 ------
NM_024989chr2137896 7584 5823 5775 5693 5164 3193 2710 2648 2051 726 545 322 37633 5745 5190 ----
NM_024991chr1052483 2211 2056 1020 64 --23173 2873 --
NM_024993chr23509 466 432 11296 11640 --
NM_024997chr16----2905 491 1432
NM_025054chr842847 742 539 221 --33377 3334 1440 --
NM_025073chr174525 3309 1662 1184 421 385 96 ------
NM_025076chr21534 1466 1187 --
NM_025115chr82386 34 ------
NM_025126chr12--1743 ----
NM_025133chr23442 188 71 ------
NM_025134chr1651954 1672 962 43 36 --12011 --
NM_025160chr154244 4227 3922 920 875 --1502 --
NM_025180chr363198 3120 2355 954 850 709 1327 ----
NM_025182chr9----1268 --
NM_025191chr143538 2615 591 301 33409 3018 2650 --13297
NM_025211chr9149 ------
NM_025221chr431085 377 157 1325 ----
NM_025235chr1052153 1677 683 608 547 --11450 --
NM_025244chr2155 ------
NM_030579chr1653293 2959 1453 660 152 --13668 --
NM_030621chr1463851 3766 3457 3105 900 705 --1579 11048
NM_030623chr231156 512 182 ------
NM_030625chr1042549 2040 1841 1773 22514 340 --12000
NM_030627chr543113 1127 1046 1014 --23739 3428 --
NM_030629chr162531 318 ------
NM_030634chr13963 743 198 --1542 --
NM_030637chr144629 473 80 38 ------
NM_030647chr766243 4378 2013 1389 840 404 14676 45085 4290 1208 347 --
NM_030648chr485403 4222 1872 1281 643 618 179 47 ------
NM_030664chr102924 608 --11580 --
NM_030665chr171903 ------
NM_030667chr1221140 1062 ------
NM_030668chr1221140 1062 ------
NM_030669chr1221140 1062 ------
NM_030670chr1242172 2094 1597 313 --2593 198 --
NM_030671chr1242172 2094 1597 313 --2593 198 --
NM_030674chr1285442 5335 5039 4636 4320 2269 1640 189 14458 ----
NM_030755chr1483037 2503 2439 923 650 480 249 34 22614 1076 --1842
NM_030773chr2041772 1564 708 184 ------
NM_030786chr11613 --21692 643 1656
NM_030789chr202294 268 --1276 --
NM_030791chr1421775 646 11453 ----
NM_030799chr51105 --32012 1493 310 --
NM_030806chr199376 8519 7234 6208 5968 5865 3154 2826 2517 11579 38067 7519 2266 --
NM_030816chr133619 2517 2295 11380 12246 --
NM_030885chr342156 1681 1658 47 1322 ----
NM_030912chr103827 173 144 --1129 --
NM_030929chr101657 ----1603
NM_030934chr13724 621 544 1755 21714 649 --
NM_030939chr62339 148 --1845 --
NM_030953chr531492 1050 46 ------
NM_031157chr12171 --1261 --
NM_031208chr163968 908 694 ------
NM_031216chr1821427 505 --21900 889 --
NM_031217chr11------1576
NM_031243chr72784 293 --2714 376 1949
NM_031262chr91419 1228 ----
NM_031263chr92747 476 1285 ----
NM_031266chr51481 ------
NM_031271chr841297 665 343 86 --11246 --
NM_031296chr45949 728 706 452 78 --11823 --
NM_031314chr1421259 564 11573 ----
NM_031369chr41603 --1787 --
NM_031370chr41603 --1787 --
NM_031372chr451245 1223 487 359 74 ------
NM_031412chr1221094 501 11067 ----
NM_031418chr1132477 549 341 ------
NM_031427chr1465307 2020 1456 1423 412 236 11342 13841 25602 4832
NM_031431chr1321670 1539 --11885 --
NM_031435chr1243457 3293 2393 2199 1567 33166 2952 2423 13360
NM_031438chr521520 454 ------
NM_031442chrX93179 3138 2604 2376 2328 2111 1235 693 316 ------
NM_031445chr243197 2139 684 628 --21193 655 --
NM_031453chr1021774 138 1630 11902 --
NM_031461chr821786 850 --11628 --
NM_031468chr787608 7164 2391 2291 1663 1573 1307 580 --46248 2129 1450 1167 --
NM_031469chr672912 2695 2676 1603 1562 328 201 23085 2813 1481 --
NM_031483chr2063059 2548 2357 957 187 144 --21113 389 1227
NM_031844chr143847 3188 813 145 12967 13174 --
NM_031845chr253374 3188 2698 2403 715 --11218 --
NM_031847chr253374 3188 2698 2403 715 --11218 --
NM_031858chr172348 47 11317 ----
NM_031862chr172348 47 11317 ----
NM_031892chrX3905 381 262 ------
NM_031914chr144819 810 711 625 ------
NM_031922chr6--1441 1580 --
NM_031953chr42459 101 ----1434
NM_031989chr121148 ------
NM_031990chr19------1105
NM_031991chr19------1105
NM_032012chr985078 5066 4432 3323 1996 1934 1754 24 --33305 1902 1172 --
NM_032018chr1190 1286 --1597
NM_032027chr1275 24 141 ----
NM_032042chr552555 2506 2427 2370 452 ------
NM_032047chr331930 1513 698 1798 ----
NM_032050chr222374 171 1668 2185 102 --
NM_032120chr7------185
NM_032121chrX42288 1949 856 525 1352 ----
NM_032124chr1821057 882 --1239 --
NM_032132chr11545 ------
NM_032138chr131103 --1462 --
NM_032145chr611421 --1391 --
NM_032147chr122832 687 ------
NM_032153chr332682 2402 512 12384 --1894
NM_032160chr1834071 3124 3019 --23302 452 --
NM_032182chr10----11595 --
NM_032199chr1042934 1280 891 163 --32651 680 477 --
NM_032208chr2103553 3483 3170 3061 2451 1260 1184 1081 936 218 --21435 1251 --
NM_032226chr94824 730 627 163 --1807 --
NM_032228chr1132228 2192 843 11189 ----
NM_032231chr151141 ------
NM_032233chr141640 1747 2880 263 --
NM_032239chr431306 496 403 ----1262
NM_032246chr1521255 906 ----1880
NM_032271chr161325 ------
NM_032288chr362338 1587 1482 380 331 216 ------
NM_032291chr111797 ----167
NM_032293chr91234 ------
NM_032295chr721428 57 ------
NM_032299chr111263 ------
NM_032312chr22647 190 ------
NM_032373chr1075600 5049 4641 4192 3704 2345 958 1944 45060 3645 1796 106 --
NM_032410chr811047 --21106 325 --
NM_032424chr1131405 1304 1193 --2320 46 --
NM_032440chr1022821 971 --2750 118 11050
NM_032445chr1542569 2433 2077 238 ----11635
NM_032446chr521083 744 13514 43507 3308 2540 617 --
NM_032457chr42890 408 21008 394 11537 --
NM_032458chrX73130 3122 1202 765 183 143 26 --189 --
NM_032466chr841674 1546 1207 514 --2110 79 --
NM_032468chr841674 1546 1207 514 --2110 79 --
NM_032491chr1221062 345 ------
NM_032499chr1541308 1088 708 349 11432 ----
NM_032505chr362407 2113 2083 1943 517 152 12601 ----
NM_032521chr2093091 2784 2683 1078 936 783 701 470 442 23188 2042 ----
NM_032539chrX1155 1785 1300 --
NM_032547chr411269 --1873 --
NM_032552chr911970 ------
NM_032557chr41993 1704 1881 --
NM_032558chr941153 514 409 225 ------
NM_032574chr2143 ------
NM_032576chrY174 ------
NM_032581chr741736 1702 1681 79 --1206 --
NM_032582chr1731343 525 363 --11633 11679
NM_032594chr142968 271 ------
NM_032622chr421409 1366 --21545 1289 --
NM_032632chr1431763 1324 429 --21405 413 --
NM_032682chr373348 2937 1018 837 261 191 114 ----12847
NM_032765chr53342 267 131 ----1904
NM_032778chr333173 2687 637 1903 ----
NM_032802chr15136 ------
NM_032804chr1072263 1913 764 747 616 562 91 --11943 --
NM_032812chr101136 ------
NM_032813chr133323 188 115 ------
NM_032826chr754430 3481 1749 331 58 25269 5216 25474 5395 --
NM_032833chr132139 1812 122 12632 --12535
NM_032842chr72264 129 1445 1308 --
NM_032859chr131830 32492 1152 960 ----
NM_032866chr1533196 730 172 ----1851
NM_032869chr892020 1875 1784 1639 593 478 193 118 59 ------
NM_032870chr6130 --1175 --
NM_032876chr1462120 2092 1961 1885 1717 328 ------
NM_032884chr12283 60 ------
NM_032892chr151298 ------
NM_032900chr1033455 3404 3227 --23556 2463 --
NM_032905chr1021235 271 ------
NM_032932chr17146156 5439 5395 5117 4869 2565 2418 1670 1546 1450 1196 1186 440 277 11317 ----
NM_032949chr132569 495 ------
NM_032960chr131556 1158 615 ------
NM_032961chr41123 --1229 --
NM_032966chr1111480 ------
NM_032968chrX113869 2874 2701 2664 1088 974 852 673 667 480 90 --24044 1592 --
NM_032969chrX113869 2874 2701 2664 1088 974 852 673 667 480 90 --24044 1592 --
NM_032973chrY123861 2869 2696 2659 1458 1088 974 852 673 667 480 90 --24036 1591 --
NM_032975chr1893509 3460 2686 2402 1399 1393 1233 992 238 --23225 879 1505
NM_032980chr1893509 3460 2686 2402 1399 1393 1233 992 238 --23225 879 1505
NM_032982chr742581 890 672 72 --1697 --
NM_032999chr71953 1231 1286 --
NM_033000chr71953 1231 1286 --
NM_033001chr71953 1231 1286 --
NM_033012chr13----1727 --
NM_033020chr164398 4246 4179 3183 1581 512 33737 1832 564 23588 3258 11493
NM_033030chr231599 1433 1020 --11550 --
NM_033044chr131212 812 523 ------
NM_033055chr111156 --122 31107 427 43
NM_033081chr201154 185 21172 1151 2578 383
NM_033083chr331195 891 176 22931 938 ----
NM_033103chr1921173 1001 ------
NM_033132chr1322248 2002 2718 660 ----
NM_033136chr53736 434 189 11433 11825 --
NM_033137chr53736 434 189 11433 11825 --
NM_033138chr72616 488 ------
NM_033139chr72616 488 ------
NM_033140chr72616 488 ------
NM_033157chr72616 488 ------
NM_033161chr931992 1934 1873 --11909 --
NM_033211chr531738 1579 1421 ------
NM_033224chr7115641 3164 3078 2991 2560 1520 1504 972 602 485 422 21930 1037 36035 2022 492 --
NM_033225chr8113229 3063 2596 2554 2392 2021 1171 856 173 150 114 ----1829
NM_033259chr3--1776 ----
NM_033260chr61731 ------
NM_033281chr52752 671 ------
NM_033285chr821608 156 --14024 --
NM_033360chr1274111 3886 3855 3798 3427 1678 373 --23228 1374 23445 930
NM_033389chr17104506 4488 4280 3364 3230 3090 1766 1711 693 560 --14797 --
NM_033425chr1123493 1025 ------
NM_033429chr1543123 2775 1184 197 1209 43248 2993 478 184 --
NM_033480chr672415 2201 2118 1122 803 346 334 ------
NM_033481chr672415 2201 2118 1122 803 346 334 ------
NM_033495chrX------1903
NM_033496chr101239 ------
NM_033497chr101239 ------
NM_033498chr101239 ------
NM_033500chr101239 ------
NM_033505chr2116361 4996 4553 4530 4301 2683 2216 1810 1245 746 102 --34323 2390 605 --
NM_033506chr71190 ------
NM_033515chr631349 919 153 11054 ----
NM_033624chr123772 605 295 --12265 1861
NM_033631chr153153 2415 1545 1368 467 ----12596
NM_033642chrX1791 --21118 1055 --
NM_033644chr512039 ------
NM_033645chr512039 ------
NM_033656chr21105443 4783 4602 4218 2209 884 795 557 229 175 14044 35245 4720 4116 14442
NM_044472chr1--1704 ----
NM_048368chr181806 ------
NM_052811chr1395223 4546 4136 3816 2041 806 744 595 70 ------
NM_052832chr842862 2630 2288 702 --42904 2670 966 956 --
NM_052845chr1252545 1147 520 422 227 --12528 --
NM_052867chr1341449 1151 955 134 ------
NM_052879chr1273978 3882 3516 2536 325 292 135 --21299 615 --
NM_052886chr811991 --31851 1692 1598 --
NM_052904chr621460 263 1364 1575 1107
NM_052905chr241880 1633 1314 123 ------
NM_052907chr1294210 3623 2949 2728 1674 1579 353 340 113 32960 1556 1421 ----
NM_052910chr1352099 1608 1587 1558 882 --22038 1419 --
NM_052913chr62440 50 1204 ----
NM_052918chr101546 ------
NM_052925chr191697 --1172 --
NM_052927chr522262 601 --22010 1849 --
NM_052937chr82323 302 --12059 1656
NM_052954chr2151647 1630 349 228 40 1726 ----
NM_053023chr1122110 874 --11149 --
NM_053024chr321426 313 11330 11070 --
NM_053025chr31228 1272 ----
NM_053026chr31228 1272 ----
NM_053027chr31228 1272 ----
NM_053028chr31228 1272 ----
NM_053031chr31228 1272 ----
NM_053032chr31228 1272 ----
NM_053043chr786298 5725 5066 2542 2183 1757 1630 97 24896 4511 45804 5777 4857 1500 --
NM_053056chr11--1297 ----
NM_053064chr1452983 2729 1947 199 148 --12216 --
NM_053067chr9----1276 --
NM_054016chr1--11642 11797 --
NM_054016chr1--11642 11797 --
NM_054016chr1--11642 11797 --
NM_057159chr9----21064 313 --
NM_057161chr6------1537
NM_057164chr21495 ------
NM_057165chr21495 ------
NM_057166chr21495 ------
NM_057167chr21495 ------
NM_057168chr721725 1405 --11562 1684
NM_057175chr41461 ----1370
NM_057178chr1792581 2468 2455 2371 2132 2106 1987 977 248 --12758 1565
NM_057749chr8--1141 ----
NM_058170chr131512 1134 1099 ------
NM_058172chr421129 59 --2663 440 --
NM_058237chr141660 ------
NM_058243chr19131 ------
NM_078470chr1041085 819 498 455 1388 32177 1933 523 12225
NM_080391chr13425 408 238 ------
NM_080425chr201133 ------
NM_080426chr201133 ------
NM_080546chr921771 1690 11722 11982 2433 337
NM_080597chr18--11053 --1759
NM_080599chr1011162 ------
NM_080629chr111376 --11012 --
NM_080630chr111376 --11012 --
NM_080671chr261693 781 629 545 522 437 ------
NM_080678chr22582 531 ------
NM_080702chr6184 ------
NM_080703chr6184 ------
NM_080723chr63916 473 83 --1434 --
NM_080743chr622302 675 --11576 --
NM_080759chr133513 298 179 --21982 1641 1993
NM_080760chr133513 298 179 --21982 1641 1993
NM_080792chr2042312 898 483 365 ------
NM_080798chr101415 ------
NM_080799chr101415 ------
NM_080800chr101415 ------
NM_080801chr101415 ------
NM_080802chr101415 ------
NM_080803chr101415 ------
NM_080804chr101415 ------
NM_080805chr101415 ------
NM_080806chr101415 ------
NM_080807chr101415 ------
NM_080808chr101415 ------
NM_080809chr101415 ------
NM_080810chr101415 ------
NM_080811chr101415 ------
NM_080812chr101415 ------
NM_080813chr101415 ------
NM_080814chr101415 ------
NM_080815chr101415 ------
NM_080822chr171325 ------
NM_080867chr1464337 3862 3563 3207 3094 82 --34081 1997 740 --
NM_080874chr421293 345 11226 11487 11719
NM_100264chr101197 1605 ----
NM_100486chr101197 1605 ----
NM_130386chr182614 210 ------
NM_130391chr922373 25 1245 ----
NM_130392chr922373 25 1245 ----
NM_130393chr922373 25 1245 ----
NM_130434chr151436 ------
NM_130436chr2172736 2539 2174 817 804 323 136 12615 ----
NM_130439chr1021532 872 11553 1903 --
NM_130439chr1021532 872 11553 1903 --
NM_130440chr131655 1213 380 1361 ----
NM_130446chr384123 3461 3073 2957 1404 1324 1213 1038 --24208 427 --
NM_130469chr14------1742
NM_130798chr1531205 469 301 ------
NM_130808chr31134 ------
NM_130809chr573055 2499 2460 2160 978 662 276 ------
NM_130838chr151204 ------
NM_130839chr151204 ------
NM_130846chr122843 159 --1268 --
NM_130847chr1164157 2246 1693 573 544 121 1202 25808 5036 --
NM_133170chr20117280 6159 5932 5823 5722 5122 2526 1261 1253 871 326 12056 37047 2945 2885 13179
NM_133171chr2041155 459 108 41 ------
NM_133264chr1763424 3204 2728 2632 1280 211 --11300 --
NM_133330chr452249 2212 1283 847 630 ------
NM_133331chr452249 2212 1283 847 630 ------
NM_133335chr452249 2212 1283 847 630 ------
NM_133370chr453228 3117 2282 1330 340 12703 33405 2495 2242 --
NM_133372chr552594 2017 1991 693 421 12654 32736 1083 206 12790
NM_133477chr483129 2084 1294 990 748 597 103 85 --1871 --
NM_133482chr531472 1092 130 ------
NM_133489chr121274 ------
NM_133493chr6104413 4273 3555 3398 1819 1681 1267 570 184 170 --14338 14348
NM_133496chr174530 3116 1699 1593 890 211 182 11343 24216 3743 --
NM_133509chr14----1426 --
NM_133510chr142383 139 ------
NM_133631chr341408 1304 1235 26 11346 ----
NM_133638chr51534 --11091 --
NM_134265chr173298 217 103 1782 ----
NM_134428chr91244 ------
NM_138270chrX43314 2822 369 289 --147 --
NM_138286chr1963713 3138 2794 1172 372 227 --13413 --
NM_138288chr1441766 1589 517 460 12035 1620 --
NM_138290chr71307 --2409 150 --
NM_138316chr1051268 1237 1164 955 155 1369 --1401
NM_138333chr932642 1990 285 ----1659
NM_138426chr731668 143 52 12085 1993 --
NM_138444chr13114654 4336 4309 4207 3465 1836 1319 859 693 408 326 --34854 4732 4116 --
NM_138473chr1224462 1578 --34610 4248 3499 --
NM_138555chr151377 ------
NM_138558chr13991 823 446 ------
NM_138559chr22527 470 ----1994
NM_138565chr1111374 ------
NM_138569chr62201 73 ------
NM_138571chr63497 159 90 1224 123 --
NM_138576chr1484421 4393 4293 4017 3922 3685 1616 1213 --24727 312 --
NM_138609chr51509 ------
NM_138610chr51509 ------
NM_138620chr9--1120 ----
NM_138621chr22778 275 --24165 3275 --
NM_138633chr621478 510 11715 --11515
NM_138638chr1411822 129 21748 1726 --
NM_138694chr643047 2796 1202 400 2555 281 21438 1175 --
NM_138713chr1655949 5017 3045 1699 460 1645 21672 53 25290 130
NM_138714chr1655949 5017 3045 1699 460 1645 21672 53 25290 130
NM_138730chr6--2395 54 ----
NM_138731chr1463696 3275 1155 886 865 625 13472 11045 22648 2577
NM_138735chr2----11374 11402
NM_138771chr721422 1301 ------
NM_138782chr552369 2124 726 701 599 --22351 2175 --
NM_138927chr211288 ------
NM_138959chr184927 4562 4393 2389 2305 2245 1641 595 --12562 16263
NM_138962chr171343 ------
NM_138970chr1441897 1874 844 77 12097 22182 1575 --
NM_138991chr211169 ------
NM_138992chr211366 ------
NM_139045chr91589 ------
NM_139070chr5----1223 --
NM_139076chr4----126 --
NM_139078chr121125 ------
NM_139207chr1261740 1706 1700 1469 1382 637 --21787 1409 11839
NM_139279chr273540 2433 2307 1101 985 940 566 --22882 440 --
NM_139286chr92222 69 ------
NM_139312chr1021407 321 1298 11378 --
NM_139318chr141271 ------
NM_139321chr2064263 4174 3862 1603 812 411 --13586 13535
NM_139323chr2041988 1493 224 116 ------
NM_144571chr446698 6084 5737 30 --36485 2144 1976 --
NM_144578chr1495341 5130 4615 4085 2099 1413 1289 749 223 14036 14926 --
NM_144590chr1072359 2163 1958 1934 1017 805 439 ------
NM_144604chr16164 ------
NM_144609chr1741141 553 547 221 ----1485
NM_144618chr12411 288 ----1326
NM_144632chr262348 2047 1737 1508 336 246 1885 --138
NM_144643chr41381 ------
NM_144658chrX182 ------
NM_144664chr1152273 1771 961 920 722 11838 1666 --
NM_144710chr2179 --1334 --
NM_144728chr1----1621 --
NM_144729chr1----1621 --
NM_144732chr19--11018 ----
NM_144767chr1573730 2860 1662 1578 1219 1119 348 13472 24541 3459 --
NM_144778chr1362365 2088 2082 1720 970 574 --22307 813 --
NM_144949chr262601 2119 1049 823 800 751 --1604 --
NM_144963chr8--42597 2475 952 849 --1610
NM_144967chrX51036 723 665 272 99 ----1711
NM_144979chr41262 ------
NM_145025chr6--195 ----
NM_145044chr341230 621 513 31 31437 633 421 31834 1658 587 --
NM_145117chr1122173 921 --22832 931 --
NM_145203chr131775 ------
NM_145207chr445125 3438 1743 760 --45105 2095 1630 151 24945 4324
NM_145251chr1421309 1269 ------
NM_145259chr286375 5110 4924 2403 2206 2099 1576 1351 26715 1977 --25481 5019
NM_145274chr173810 193 71 ------
NM_145284chrX3375 246 108 21591 646 1405 --
NM_145307chr1033730 1416 902 13074 24651 1292 14557
NM_145320chr733004 2989 1409 13178 11034 --
NM_145321chr733004 2989 1409 13178 11034 --
NM_145322chr733004 2989 1409 13178 11034 --
NM_145331chr61640 --1711 --
NM_145332chr61788 --1859 --
NM_145333chr61788 --1859 --
NM_145644chr21335 1376 ----
NM_145647chr8163 ------
NM_145725chr141323 ------
NM_145726chr141323 ------
NM_145735chr1332073 1899 1837 --22640 1722 --
NM_145753chr311481 --21541 1399 11423
NM_145756chr181499 ------
NM_145759chr111769 --1706 --
NM_145808chr752783 1022 888 626 349 12758 ----
NM_145909chr61422 --1140 --
NM_147127chr4149 ------
NM_147156chr1051348 1158 612 328 153 ------
NM_147171chr7142 133 ----
NM_147175chrX32167 1480 747 1487 11686 --
NM_147181chr431085 377 157 1325 ----
NM_147182chr431085 377 157 1325 ----
NM_147183chr431085 377 157 1325 ----
NM_147185chr7142 133 ----
NM_147189chr852260 1710 933 444 66 --21971 1516 --
NM_147223chr2----1262 --
NM_147233chr2----179 --
NM_148174chr83210 191 26 ----1564
NM_148894chr4--1927 --11245
NM_148898chr731078 961 245 ----1749
NM_148899chr731078 961 245 ----1749
NM_148904chr11200 1552 1449 --
NM_148905chr11200 1552 1449 --
NM_148906chr11200 1552 1449 --
NM_148907chr11200 1552 1449 --
NM_148908chr11200 1552 1449 --
NM_148909chr11200 1552 1449 --
NM_148957chr1312605 --12485 --
NM_148977chr1051268 1237 1164 955 155 1369 --1401
NM_148978chr1051268 1237 1164 955 155 1369 --1401
NM_152233chr1421575 1206 ----1530
NM_152265chr131498 164 36 21155 500 1478 --
NM_152272chr831008 350 304 1124 ----
NM_152275chr252237 1601 1566 728 230 1715 ----
NM_152280chr163172 2712 2257 883 875 288 11082 13203 1672
NM_152282chr311188 --11236 --
NM_152283chr53817 238 145 ------
NM_152291chr431105 208 112 --11084 --
NM_152305chr351460 1369 245 165 42 --12039 --
NM_152349chr171704 ------
NM_152400chr4----11726 --
NM_152409chr523283 2366 ------
NM_152415chr82177 148 --1387 --
NM_152433chr1141127 299 273 72 ------
NM_152437chr1231859 1776 1669 11940 --1591
NM_152448chr15--1470 ----
NM_152450chr1531732 363 252 1475 ----
NM_152451chr151682 ------
NM_152495chr111035 --11005 --
NM_152510chr222804 333 ------
NM_152527chr21455 ----1199
NM_152529chr222860 1654 1172 23936 3567 --
NM_152556chr712194 ------
NM_152557chr721310 1099 ------
NM_152574chr92147 87 ------
NM_152610chr1--194 ----
NM_152622chr563450 3037 2347 1380 753 563 23425 2229 32309 2209 2148 11021
NM_152624chr597061 6761 4898 2881 1942 1124 901 665 200 25387 1496 24814 2530 15565
NM_152638chr122852 108 --1509 --
NM_152640chr12126 ------
NM_152641chr1232951 849 267 --1612 --
NM_152653chr32251 243 ------
NM_152660chr11869 1974 1729 --
NM_152667chr2041116 954 585 432 --31246 417 142 --
NM_152678chr352754 2559 2552 2302 82 --1650 --
NM_152688chr6--1997 1354 --
NM_152695chrX3643 202 193 --12324 31719 582 25
NM_152699chr353148 3112 2312 692 312 ------
NM_152707chr101863 ------
NM_152713chr111175 --164 --
NM_152726chr13157 --1419 --
NM_152732chr6148 ------
NM_152737chr611901 11596 ----
NM_152740chr71143 ------
NM_152744chr733527 382 156 22658 134 23192 2553 --
NM_152754chr733678 3299 1188 23099 2683 --12852
NM_152756chr584274 4259 4228 2720 1478 1307 903 382 --23450 1715 --
NM_152758chr852658 1874 1186 1069 424 --13008 --
NM_152765chr852313 2133 1753 530 367 ------
NM_152787chrX33841 2580 1393 32793 1509 830 1174 --
NM_152789chr7----11277 --
NM_152829chr72959 272 --21083 123 --
NM_152835chr12517 131 --22617 119 12073
NM_152836chr81734 1633 11684 --
NM_152837chr81734 1633 11684 --
NM_152838chr2062758 2730 2403 2387 427 229 --132 --
NM_152857chr6------1398
NM_152858chr6------1398
NM_152890chr111040 ------
NM_152896chr91301 1313 ----
NM_152902chr121485 205 --2612 108 --
NM_152903chr1332817 2119 448 ------
NM_152924chr15156715 6669 6572 6534 6517 6342 6317 6275 6005 1822 1738 1282 332 99 73 1693 11338 --
NM_152989chr1221892 1291 11431 11696 --
NM_152999chr785028 4950 4814 4773 3818 3581 1883 123 --24271 1061 2669 403
NM_153013chr532022 975 130 --1438 --
NM_153015chr81768 ------
NM_153020chr641536 1398 1384 301 --31714 1338 435 --
NM_153035chr162803 2558 2202 1240 1159 1034 --1112 --
NM_153040chr15--1115 ----
NM_153042chr651791 1688 643 321 199 --11761 --
NM_153047chr6--1350 ----
NM_153048chr6--1350 ----
NM_153182chr333173 2687 637 1903 ----
NM_153183chrX3894 357 27 1939 ----
NM_153184chr311603 ----1688
NM_153188chr5155513 5344 5160 4832 4388 3900 3725 3629 3528 3510 1724 1295 1121 1038 822 31433 1256 1048 24642 1810 13545
NM_153207chr1273989 3900 3530 3128 1105 1001 945 --13321 --
NM_153226chr104888 804 797 417 1946 --1980
NM_153252chrX1303 ------
NM_153261chr16--11090 11340 --
NM_153262chr111262 1341 --12002
NM_153321chr17--11088 ----
NM_153322chr17--11088 ----
NM_153331chr3160 ------
NM_153332chr862348 2086 1296 1177 702 469 1950 1160 22019 426
NM_153333chrX5594 478 173 155 148 ------
NM_153341chr12343 89 ------
NM_153343chr461951 1941 1783 978 487 68 --11527 --
NM_153362chr61724 --1143 --
NM_153365chr432610 1883 814 12145 22418 1833 --
NM_153367chr1052823 2741 2438 1491 1446 ------
NM_153371chr1362360 2288 1926 1761 820 327 --147 --
NM_153377chr121297 ------
NM_153426chr41452 ------
NM_153427chr41452 ------
NM_153453chr6------1397
NM_153456chr1386298 6114 5121 4222 2352 1883 1670 1205 --24961 899 1480
NM_153464chr19----1661 --
NM_153607chr532475 2467 330 11043 22122 734 --
NM_153634chr1211494 11588 11626 --
NM_153686chr462220 1811 1719 346 207 78 22005 973 12309 --
NM_153687chr1221228 63 11269 ----
NM_153689chr221486 338 11792 ----
NM_153693chr12----1613 --
NM_153695chr9----1270 --
NM_153704chr81136 ------
NM_153713chr1275 64 ------
NM_153759chr21205 ------
NM_153810chr1095049 3943 3424 1595 1559 761 504 419 211 --13684 --
NM_153816chr62364 358 ------
NM_153825chr431574 1216 385 --187 --
NM_170606chr711866 --191 --
NM_170665chr1233745 3690 1816 --2169 133 1351
NM_170679chr511143 ------
NM_170696chr1521706 1457 ------
NM_170697chr1521706 1457 ------
NM_170706chr194243 4165 3917 3848 2765 1664 1461 1361 1288 --21174 809 12791
NM_170731chr1142529 2418 2255 1004 ------
NM_170732chr1142529 2418 2255 1004 ------
NM_170733chr1142529 2418 2255 1004 ------
NM_170734chr1142529 2418 2255 1004 ------
NM_170735chr1142529 2418 2255 1004 ------
NM_170741chr1731878 1757 411 11886 --12250
NM_170742chr1731878 1757 411 11886 --12250
NM_170774chr2063510 3354 1261 883 427 21 21665 224 22900 1035 14224
NM_171999chr183588 570 140 ------
NM_172016chr611175 ------
NM_172071chr1167218 7104 6979 6842 6636 6399 6209 5713 5474 5204 5018 2400 2389 1827 1325 794 26462 359 47459 5244 4766 2131 25700 5221
NM_172127chr451786 1463 1308 531 356 ------
NM_172128chr451742 1419 1264 487 312 ------
NM_172216chr1262257 2050 1160 651 571 316 --22791 2577 --
NM_172242chr101105 ----1236
NM_172337chr14133 ------
NM_172373chr1321273 855 --2314 247 --
NM_172375chr1421205 1052 ------
NM_173054chr7----1742 1326
NM_173075chr431765 1620 1223 11143 1238 --
NM_173078chrX------1181
NM_173082chr62537 128 --1415 --
NM_173171chr211239 ------
NM_173172chr211547 ----11091
NM_173173chr211239 ------
NM_173198chr942520 2000 1150 1048 ------
NM_173200chr942520 2000 1150 1048 ------
NM_173214chr1655949 5017 3045 1699 460 1645 21672 53 25290 130
NM_173359chr341847 1382 573 277 156 ----
NM_173468chr455065 4716 4521 1912 63 --35074 4273 667 11007
NM_173469chr1511520 11503 21297 1059 --
NM_173470chrX72101 2020 1992 1943 419 329 104 ------
NM_173487chr41811 1820 ----
NM_173491chr531187 984 283 ------
NM_173500chr1531183 1004 100 --2575 37 --
NM_173511chr242858 2704 1187 237 --23523 1203 --
NM_173517chr71131 ------
NM_173540chr102508 171 ----2146 46
NM_173552chr31367 12503 11879 1134
NM_173557chr182745 279 ------
NM_173567chr11188 ------
NM_173576chr1032327 2020 1716 ----12048
NM_173582chr1156327 5636 4476 1025 905 22086 845 --1874
NM_173596chr12--194 ----
NM_173602chr1293416 3295 3122 2700 2542 2407 969 961 592 ------
NM_173609chr152626 460 --154 --
NM_173626chr171541 ------
NM_173631chr1911181 ------
NM_173642chr1119093 8900 8671 6186 3510 3386 3218 1837 1576 1555 974 12665 23378 1186 16166
NM_173670chr52392 303 --1670 --
NM_173683chr81534 ------
NM_173694chrX1837 1828 2812 401 12421
NM_173808chr134267 3132 1750 14066 1516 --
NM_173822chr21110 --11707 11448
NM_173825chr342716 1197 1181 430 --12581 --
NM_173826chr321726 541 11448 11590 1372
NM_173829chr5105928 5859 5800 5696 5616 2424 877 759 556 517 --25499 4816 23878 1802
NM_173851chr873699 3351 2672 2425 1504 1430 509 ----11495
NM_174900chr421183 375 ------
NM_174911chr842752 1404 1099 307 --22666 1480 13269
NM_174916chr1541578 1462 900 103 --11887 --
NM_175038chr121217 ------
NM_175056chr372174 2013 1836 1546 535 494 390 ------
NM_175061chr741675 1662 174 51 --1362 --
NM_175610chr153506 341 255 ------
NM_175611chr21----150 --
NM_175629chr21205 ------
NM_175634chr821055 278 1316 ----
NM_175635chr821055 278 1316 ----
NM_175636chr821055 278 1316 ----
NM_175733chr1131535 527 451 --1690 163
NM_175839chr201102 ------
NM_175840chr201102 ------
NM_175841chr201102 ------
NM_175842chr201102 ------
NM_175847chr19------1105
NM_175852chr143048 2466 1175 144 --1416 --
NM_175854chr132324 232 11702 21955 571 12464
NM_175859chrX21223 446 --1664 --
NM_175861chr1295048 4605 1479 1127 911 757 319 280 217 25039 1312 45952 5000 258 103 14821
NM_175863chr61900 --21193 295 --
NM_175873chr521246 593 ------
NM_175895chr12----11104 --
NM_175902chr171299 ------
NM_175907chr183558 311 138 1403 --1348
NM_175920chr51800 --1631 --
NM_176814chr72928 457 1399 --21276 1036
NM_176824chr42840 401 1240 ----
NM_177401chr1951637 1494 1306 1232 632 ------
NM_177414chr121397 116 --11289 --
NM_177424chr121754 230 22096 2044 1509 --
NM_177438chr1463851 3766 3457 3105 900 705 --1579 11048
NM_177531chr82464 161 ------
NM_177538chr288715 7510 7326 7306 6316 6161 1923 142 --38653 8627 5777 --
NM_177925chr1232801 2555 1230 ------
NM_177949chrX144 ------
NM_177951chr14----163 --
NM_177952chr142269 171 ------
NM_177968chr231428 793 767 ----11481
NM_177985chr232133 2011 707 --21533 28 --
NM_177990chr2041897 1672 1357 331 --21622 1264 --
NM_178010chr1221892 1291 11431 11696 --
NM_178011chr1043109 2558 2336 543 --1688 --
NM_178013chr1462789 2672 2144 1248 1051 335 --22620 2447 --
NM_178033chr12545 176 --2210 202 --
NM_178123chr2124 --1796 --
NM_178140chr531769 505 447 11836 --11827
NM_178150chr101285 ------
NM_178151chrX146040 5706 5282 5136 4840 4786 2770 2265 2186 1942 1524 1019 906 452 12134 25892 5852 --
NM_178152chrX146040 5706 5282 5136 4840 4786 2770 2265 2186 1942 1524 1019 906 452 12134 25892 5852 --
NM_178153chrX146040 5706 5282 5136 4840 4786 2770 2265 2186 1942 1524 1019 906 452 12134 25892 5852 --
NM_178313chr2----11817 1238
NM_178426chr112048 1732 11998 --
NM_178427chr121948 884 1632 11898 --
NM_178454chr11593 --1578 --
NM_178496chr341461 1431 1403 1342 ----1269
NM_178509chr1723395 1255 12847 33374 3302 291 11210
NM_178539chr1251934 1786 213 203 82 --191 --
NM_178557chr4----11734 --
NM_178565chr811415 --122 11193
NM_178581chr202294 268 --1276 --
NM_178584chr2179 --1334 --
NM_178586chr1441873 800 692 335 ------
NM_178815chr10----1162 --
NM_178864chr111140 ------
NM_180989chr131430 1700 ----
NM_181054chr1421266 1144 11102 ----
NM_181332chrX42618 2144 868 269 12449 1474 --
NM_181353chr201561 ------
NM_181354chr831630 1390 342 11169 ----
NM_181358chr163727 3130 2911 2854 2835 2801 --13095 --
NM_181361chr33582 466 358 21204 1003 11101 --
NM_181442chr2051000 849 771 710 420 ------
NM_181443chr2032443 1974 662 --12873 1734
NM_181481chr1846963 6901 4822 132 --37031 2746 1009 --
NM_181482chr1846963 6901 4822 132 --37031 2746 1009 --
NM_181483chr1846963 6901 4822 132 --37031 2746 1009 --
NM_181503chr13128 ------
NM_181504chr554027 3520 3164 2825 915 --34189 2600 1077 --
NM_181521chr1697184 6483 5641 5381 5135 4685 4511 1785 80 15927 21382 753 1249
NM_181523chr554027 3520 3164 2825 915 --34189 2600 1077 --
NM_181524chr554027 3520 3164 2825 915 --34189 2600 1077 --
NM_181532chrX----1205 --
NM_181552chr72863 653 ------
NM_181659chr2022508 827 22085 166 2963 760 --
NM_181659chr2022508 827 22085 166 2963 760 --
NM_181670chr122968 376 1574 ----
NM_181672chrX51314 356 272 256 247 --2783 635 --
NM_181673chrX51314 356 272 256 247 --2783 635 --
NM_181698chr101488 ------
NM_181701chr922267 2045 194 --1255
NM_181702chr8----1169 --
NM_181705chr575517 5402 5284 5030 5015 4527 1339 25675 306 25775 5023 --
NM_181714chr651856 1544 1432 782 114 ----1249
NM_181723chr851636 1454 462 419 82 ------
NM_181783chr1262010 1678 1602 1562 1318 755 --21614 143 --
NM_181784chr252493 1958 1712 405 382 --12379 22338 2161
NM_181836chr532492 1654 361 --11646 --
NM_181861chr1242787 2626 1087 897 --11895 --
NM_181868chr1242787 2626 1087 897 --11895 --
NM_181869chr1242872 2711 1172 982 --11980 --
NM_181872chr9129 ------
NM_181876chr462117 1805 1081 865 646 329 --22252 612 12172
NM_181886chr42458 73 ------
NM_181887chr42458 73 ------
NM_181888chr42458 73 ------
NM_181889chr42458 73 ------
NM_181890chr42458 73 ------
NM_181891chr42458 73 ------
NM_181892chr42505 120 ------
NM_181893chr42458 73 ------
NM_182485chr431411 500 378 23486 997 --13030
NM_182493chr16104533 4392 3880 3675 2122 1919 1784 908 677 487 24020 1066 11575 --
NM_182503chr624326 1558 35082 4378 1410 ----
NM_182515chr1945091 4323 2049 432 25468 4488 36490 4445 1583 11175
NM_182540chrX2864 832 --1826 --
NM_182547chr72272 80 ------
NM_182565chr17------1127
NM_182641chr17----11438 --
NM_182645chr6------1397
NM_182646chr431411 500 378 23486 997 --13030
NM_182666chr32547 61 --1144 --
NM_182691chr711129 ------
NM_182692chr711129 ------
NM_182697chr711571 1612 1161 --
NM_182700chr741934 1438 1370 660 ------
NM_182717chr10----21402 1061 --
NM_182720chr10----21402 1061 --
NM_182721chr10----21402 1061 --
NM_182722chr10----21402 1061 --
NM_182723chr10----21402 1061 --
NM_182757chr642393 880 857 281 --11092 --
NM_182762chr765523 4790 4493 4439 2439 1836 --25484 956 26190 1034
NM_182764chr2041155 459 108 41 ------
NM_182765chr1052173 1771 611 584 491 ------
NM_182789chr51257 ------
NM_182797chr2011214 11344 11132 --
NM_182847chr2--1686 ----
NM_182853chr10----21402 1061 --
NM_182896chr331653 1387 90 11476 1538 11252
NM_182898chr795675 5187 4259 4233 4119 2615 2029 1530 1134 --26550 6516 --
NM_182899chr795675 5187 4259 4233 4119 2615 2029 1530 1134 --26550 6516 --
NM_182901chr111590 ------
NM_182910chr142657 254 ----1679
NM_182911chr2155 ------
NM_182913chr142657 254 ----1679
NM_182914chr142657 254 ----1679
NM_182918chr2121456 1378 1305 ----
NM_182948chr122110 1011 1852 1128 --
NM_182964chr1122173 921 --22832 931 --
NM_182972chr182808 2435 2346 2224 880 652 566 136 ------
NM_182975chr1--1428 145 --
NM_182977chr53966 732 301 --21100 158 1997
NM_183004chr1483818 3811 3369 2525 1284 1077 877 296 1825 23062 1027 13947
NM_183006chr202443 317 129 --1195
NM_183011chr10----21402 1061 --
NM_183012chr10----21402 1061 --
NM_183013chr10----21402 1061 --
NM_183049chr4--1358 ----
NM_183323chr51257 ------
NM_183376chr1531901 774 402 ------
NM_183381chr33968 83 64 ------
NM_183383chr33968 83 64 ------
NM_183384chr33968 83 64 ------
NM_194071chr734339 2101 94 --24240 1437 --
NM_194247chr254360 4056 4046 3429 1702 1787 1271 --
NM_194271chr12--1743 ----
NM_194281chr18162 ------
NM_194282chr432078 1003 66 12209 1236 12994
NM_194283chr573780 3644 3290 3283 1555 1045 417 1468 31517 883 40 --
NM_194285chr1183272 2344 2336 2309 816 757 706 93 --23040 1074 --
NM_194291chr842592 699 393 158 --1433 --
NM_194301chr141173 ------
NM_194314chr174915 3485 2125 1896 1066 711 218 --43977 3847 1084 26 --
NM_194318chr1312326 --21847 655 1135
NM_194328chr982952 2825 2811 2433 2176 1004 987 315 ----12881
NM_194329chr982952 2825 2811 2433 2176 1004 987 315 ----12881
NM_194330chr982952 2825 2811 2433 2176 1004 987 315 ----12881
NM_194332chr982952 2825 2811 2433 2176 1004 987 315 ----12881
NM_194356chr1252111 2045 1867 809 802 --12373 --
NM_194434chr1885338 4941 4465 4374 3663 1436 951 59 35111 1395 1142 25103 4614 --
NM_194439chr431356 1267 497 ------
NM_197941chr552208 2164 2158 1955 778 ------
NM_197970chr231599 1433 1020 --11550 --
NM_197972chr12242 169 ------
NM_198066chr1452153 1989 1220 787 219 32923 2599 965 ----
NM_198081chr672356 1920 1869 1164 698 238 130 --12271 12479
NM_198086chr1462120 2092 1961 1885 1717 328 ------
NM_198120chr81557 1108 ----
NM_198128chr1822163 566 ------
NM_198141chr1521292 154 --178 1178
NM_198158chr332223 283 57 --21081 338 --
NM_198159chr332223 283 57 --21081 338 --
NM_198173chr11635 ------
NM_198174chr11635 ------
NM_198177chr332223 283 57 --21081 338 --
NM_198178chr332223 283 57 --21081 338 --
NM_198181chr1532652 2356 275 11168 ----
NM_198212chr73336 207 154 1850 32234 1729 117 11946
NM_198215chr101483 1387 ----
NM_198225chr1021457 126 ----11614
NM_198240chr1241088 904 233 142 --1399 --
NM_198268chr163727 3130 2911 2854 2835 2801 --13095 --
NM_198269chr163727 3130 2911 2854 2835 2801 --13095 --
NM_198270chrX83176 2948 2840 2698 2363 840 734 488 ----1920
NM_198279chrX1909 --1446 --
NM_198281chr443396 2446 2379 1034 11191 ----
NM_198291chr2011883 ------
NM_198336chr741786 1691 1341 1312 --1361 --
NM_198390chr162531 318 ------
NM_198395chr52856 298 ------
NM_198400chr1522964 2325 12205 2558 113 --
NM_198404chr131761 ------
NM_198439chr1141127 299 273 72 ------
NM_198465chrX52860 1102 1012 421 65 --1382 1305
NM_198468chr634277 1048 119 13174 ----
NM_198506chr441382 463 207 185 ------
NM_198513chr811781 --21458 563 --
NM_198529chr17----1417 --
NM_198569chr631960 559 44 --22428 2390 11931
NM_198581chr2126232 5907 5895 5530 5353 5053 4780 4770 2015 1378 1009 847 26172 1836 ----
NM_198716chr11309 ------
NM_198717chr11309 ------
NM_198721chr4------184
NM_198793chr343286 3172 2779 663 12661 ----
NM_198859chr375043 4767 4741 3342 3147 1885 1361 13631 13585 --
NM_198935chr20103013 2957 2947 2919 2909 2446 1297 979 391 345 ------
NM_198947chr112210 52 ------
NM_198956chr741934 1438 1370 660 ------
NM_198965chr121398 1363 ----
NM_198966chr121398 1363 ----
NM_198992chr122384 155 --1445 --
NM_199000chr72760 196 --12332 --
NM_199003chr831463 1341 551 ------
NM_199005chr91775 ------
NM_199039chr42835 340 ------
NM_199072chr763230 2938 2144 1161 960 942 --11149 --
NM_199132chr1922136 1924 ----1854
NM_199169chr2023052 386 --1613 --
NM_199170chr2023052 386 --1613 --
NM_199171chr2023052 386 --1613 --
NM_199188chr1273978 3882 3516 2536 325 292 135 --21299 615 --
NM_199189chr51767 ----1706
NM_199190chr1273978 3882 3516 2536 325 292 135 --21299 615 --
NM_199229chr251697 1233 1075 248 242 ----1577
NM_199320chr432702 2614 641 --21910 452 --
NM_199320chr432702 2614 641 --21910 452 --
NM_199324chr422382 308 --13313 --
NM_199351chr11114 ------
NM_199418chr113329 107 69 ------
NM_199421chr1464337 3862 3563 3207 3094 82 --34081 1997 740 --
NM_199436chr283049 3014 2826 2536 2305 2028 1191 274 --158 --
NM_199437chr1172416 2360 583 444 277 238 91 --32272 2101 220 --
NM_199438chr1172416 2360 583 444 277 238 91 --32272 2101 220 --
NM_199439chr1172416 2360 583 444 277 238 91 --32272 2101 220 --
NM_199440chr2--1335 ----
NM_199454chr154488 4209 1581 414 215 ------
NM_199478chrX61566 1490 1258 1225 580 159 11322 ----
NM_199482chr231900 1824 1319 ------
NM_201428chr1111522 --11504 --
NM_201429chr1111522 --11504 --
NM_201430chr1111448 --11430 --
NM_201437chr82961 47 1534 11428 11090
NM_201545chr121176 1129 --21192 331 11319
NM_201548chr21992 ------
NM_201570chr1021825 671 --1388 --
NM_201571chr1021825 671 --1388 --
NM_201572chr1021825 671 --1388 --
NM_201590chr1021825 671 --1388 --
NM_201591chr42309 299 --1200 --
NM_201592chr42309 299 --1200 --
NM_201593chr1021825 671 --1388 --
NM_201596chr1021825 671 --1388 --
NM_201597chr1021825 671 --1388 --
NM_201613chr122879 320 ------
NM_203291chr18294 85 ------
NM_203292chr18287 78 ------
NM_203301chr142648 398 11555 --11621
NM_203341chr131091 671 390 1996 ----
NM_203342chr193185 2931 2659 2463 2368 1250 1205 1181 176 ------
NM_203343chr193185 2931 2659 2463 2368 1250 1205 1181 176 ------
NM_203350chr1----11773 --
NM_203365chr2------1497
NM_203372chr231476 1191 499 1283 1579 --
NM_203382chr531562 1182 335 11146 ----
NM_203391chrX11793 2658 106 ----
NM_203394chr1242700 2687 1889 278 ------
NM_203403chr941100 222 121 82 ------
NM_203406chr562658 2463 1966 961 914 745 --1284 --
NM_203437chr23753 718 234 --1908 --
NM_203446chr2162854 2638 2407 1967 558 71 ------
NM_203451chr1342319 2074 1604 487 ------
NM_203453chr95558 540 519 327 138 --1688 1463
NM_203459chr142381 2234 2042 235 --12149 12097
NM_203463chr264592 4395 3418 774 672 645 --13737 11367
NM_203488chr14----1331 --
NM_203499chr173797 788 281 --153 --
NM_203504chr442405 1942 730 712 --31908 1853 753 --
NM_203505chr442405 1942 730 712 --31908 1853 753 --
NM_205836chr51160 ------
NM_205852chr1231996 1902 1340 11699 1867 --
NM_206594chr12731 553 13079 21051 1014 --
NM_206595chr12731 553 13079 21051 1014 --
NM_206832chr171251 --1208 --
NM_206853chr693255 3197 2902 1470 1400 1273 973 477 39 23942 366 --13794
NM_206854chr6134516 4458 4163 3715 3587 1738 1300 902 694 684 257 222 177 35203 1627 1280 --25055 3675
NM_206855chr6145481 5423 5128 4680 4552 3992 2265 1867 1659 1649 1222 1187 1142 335 36168 2245 52 2708 40 26020 4640
NM_206866chr2163092 2625 2303 687 599 188 1534 --12341
NM_206876chr273217 2750 2420 2402 1382 1181 33 33443 634 143 11169 11353
NM_206907chr563112 2665 2046 411 263 246 13006 --12812
NM_206909chr898023 7070 6100 5456 3276 2431 1934 1505 196 15866 3981 897 59 --
NM_206937chr1321046 223 --1766 1777
NM_207012chr1052802 2540 2321 1105 243 1408 2630 231 --
NM_207015chr321794 725 --170 --
NM_207032chr2041397 1330 627 158 ----11453
NM_207033chr2041305 1238 535 66 ----11361
NM_207034chr2041305 1238 535 66 ----11361
NM_207042chr11588 ------
NM_207045chr11588 ------
NM_207046chr11588 ------
NM_207291chr19----1122 --
NM_207303chr1053759 3643 1656 903 93 180 22619 488 1938
NM_207304chr1362252 1975 1969 1607 857 461 --22194 700 --
NM_207311chr12--21228 367 ----
NM_207325chr1921885 1729 11363 ----
NM_207337chr1241010 906 325 74 --1894 1782
NM_207343chr112407 65 ------
NM_207359chr331511 735 226 11388 ----
NM_207371chr101400 11335 ----
NM_207406chr4115909 5531 4357 4297 4246 2118 1592 1453 997 978 232 16504 36332 4332 1501 --
NM_207435chr1241087 972 901 739 11028 1423 --
NM_207445chr152843 273 ------
NM_207481chr221308 1045 185 ----
NM_207518chr19----2494 330 1959
NM_207577chr1172733 2457 1902 566 388 370 296 11855 ----
NM_207647chr942361 1802 864 778 --1753 --
NM_212460chr741888 1740 535 52 ------
NM_212471chr1742163 1809 1579 844 --21567 351 --
NM_212472chr1742163 1809 1579 844 --21567 351 --
NM_212474chr24915 682 427 275 --1824 --
NM_212475chr24915 682 427 275 --1824 --
NM_212476chr24915 682 427 275 --1824 --
NM_212478chr24915 682 427 275 --1824 --
NM_212482chr24915 682 427 275 --1824 --
NM_212554chr1031390 422 55 ------
NM_212558chr943830 3673 3102 1602 13216 --11099
NM_212559chrX1774 1578 ----
NM_213589chr275614 4278 4132 3998 2151 1925 329 1887 21878 1736 --
NM_213590chr1395223 4546 4136 3816 2041 806 744 595 70 ------
NM_213594chr1221062 345 ------
NM_213611chr121151 ------
NM_213654chr321245 384 1439 ----