TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3157-3p
miRNA Sequence: CUGCCCUAGUCUAGCUGAAGCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000051chr1111156 ------
NM_000084chrX56295 5786 5690 4691 4670 ------
NM_000138chr1512496 ------
NM_000188chr10----1157 --
NM_000192chr1211174 11425 ----
NM_000208chr1964425 3975 3793 3201 3120 1114 1213 --1246
NM_000217chr1254611 4467 3482 3466 1249 --23838 1743 --
NM_000264chr942192 936 279 238 --11360 12514
NM_000267chr1722678 595 1921 11021 12726
NM_000314chr1012722 --12829 --
NM_000332chr676753 2447 2209 1941 671 546 217 ------
NM_000333chr31128 ------
NM_000430chr172413 221 13383 1292 --
NM_000555chrX47453 6199 5367 2827 --33110 238 60 --
NM_000609chr1062529 1112 585 542 379 93 --11916 --
NM_000719chr1265315 5252 2481 2236 1312 448 16599 24986 4412 16182
NM_000722chr7183 ------
NM_000806chr5--1416 ----
NM_000813chr533592 2241 1357 --12150 13861
NM_000831chr1135787 5554 5204 4837 4778 2174 2027 1934 1925 1555 1348 530 335 23947 1712 21991 1607 14963
NM_000834chr121280 2163 40 --11223
NM_000868chrX21674 176 22119 568 11990 --
NM_000899chr1233330 1519 829 1453 12838 --
NM_000950chrX33615 1203 399 ------
NM_001001436chr16------1339
NM_001001668chr1953829 3637 3535 965 891 12932 ----
NM_001001701chr431511 1455 938 12122 ----
NM_001001924chr82641 630 ----1120
NM_001001925chr82641 630 ----1120
NM_001001928chr2278328 7957 6842 6257 5759 2940 1880 15670 --15907
NM_001001931chr82641 630 ----1120
NM_001001995chrX11283 ----1292
NM_001002264chr13----134 --
NM_001002269chr91414 ------
NM_001002295chr101997 ------
NM_001002838chrX--1539 ----
NM_001002906chrY1414 ------
NM_001003800chr993039 2674 2357 1101 998 891 368 138 112 ------
NM_001005375chrY--140 ----
NM_001005473chr534550 1695 114 --156 --
NM_001005785chrY--140 ----
NM_001005786chrY--140 ----
NM_001007024chr1753988 3592 3395 3016 2941 ------
NM_001007025chr1753988 3592 3395 3016 2941 ------
NM_001007466chr664591 3799 3575 1272 630 242 1743 ----
NM_001007565chr31305 ------
NM_001008220chr5103593 3558 3309 2871 1225 582 540 430 424 180 12931 12956 --
NM_001008738chr51127 ------
NM_001008895chr13--11037 ----
NM_001009554chr424177 1300 13503 13153 11091
NM_001009554chr424177 1300 13503 13153 11091
NM_001009880chr22114245 4143 3613 3256 1949 1439 1382 1298 817 750 397 --11641 --
NM_001009881chr1170 ------
NM_001009882chr1170 ------
NM_001009899chr336413 4457 1318 44882 4745 4368 786 16159 --
NM_001009959chr2----12032 --
NM_001010861chr142507 1833 1065 180 11111 1770 --
NM_001010862chrX53077 2581 2359 2328 729 22428 230 ----
NM_001010888chrX43572 2914 1048 916 ------
NM_001011553chr71184 ------
NM_001011713chr141524 ------
NM_001012398chr161207 ------
NM_001013437chr181108 ------
NM_001013620chr1235290 1084 1067 --15499 15664
NM_001013629chr1052129 1827 1464 532 79 198 ----
NM_001014797chr1077475 7013 5694 3237 2922 1235 1134 --26885 5426 16454
NM_001014972chr2141 ------
NM_001017395chr323070 2946 2370 303 ----
NM_001018050chr2273057 2581 1192 1128 991 886 703 12154 13262 --
NM_001018052chr2273057 2581 1192 1128 991 886 703 12154 13262 --
NM_001024858chr14122930 2918 2783 2511 2236 2025 786 709 513 331 270 253 11073 21999 828 --
NM_001025077chr1025145 593 ----22010 48
NM_001025107chr171998 1964 933 660 558 43 28 2982 516 ----
NM_001025107chr171998 1964 933 660 558 43 28 2982 516 ----
NM_001029875chr512709 --1874 11851
NM_001030001chr14--1115 ----
NM_001031679chr1262775 1419 1280 588 394 104 11316 ----
NM_001031695chr2285035 4806 4786 3458 2165 1839 1634 1170 --15027 --
NM_001031812chr511985 ------
NM_001032289chrX159 ------
NM_001033117chr364584 3877 1698 1253 1241 105 --1723 11750
NM_001033925chr1011801 ------
NM_001037317chr142507 1833 1065 180 11111 1770 --
NM_001039465chr141458 ------
NM_001039618chr1125252 1765 --21373 729 23853 695
NM_001039762chr1011999 ------
NM_001039840chrX24946 1437 ----1760
NM_001039888chr11301 ------
NM_001039937chr1311409 13537 1778 13379
NM_001040057chr71490 ------
NM_001040110chr7----1469 --
NM_001040284chr1622194 353 ------
NM_001040429chr1312601 ------
NM_001040431chr171391 ------
NM_001042492chr1722678 595 1921 11021 12726
NM_001042498chrX1196 ------
NM_001043318chr1483614 3309 3081 1367 1318 1125 221 134 --1151 --
NM_001044722chr511985 ------
NM_001044723chr511985 ------
NM_001111chr171998 1964 933 660 558 43 28 2982 516 ----
NM_001117chr1832222 796 538 1987 1564 1868
NM_001123chr102145 137 ------
NM_001160chr121388 22010 1835 ----
NM_001167chrX2998 182 --11606 --
NM_001204chr247245 6151 4773 566 ------
NM_001206chr93974 937 331 ------
NM_001256chr171238 ------
NM_001257chr16------11293
NM_001270chr51964 ------
NM_001351chr311435 11746 1646 --
NM_001412chrX11233 22852 1367 ----
NM_001417chr1211717 ------
NM_001427chr71273 ------
NM_001438chr1------12964
NM_001453chr621568 1448 ------
NM_001616chr212389 1421 --12507
NM_001620chr111536 ------
NM_001701chr911398 ----1140
NM_001709chr1112098 173 ----
NM_001731chr121260 ------
NM_001759chr1274103 4020 3891 3694 3239 3215 88 1866 --14478
NM_001788chr71184 ------
NM_001796chr16153 ------
NM_001901chr61282 ------
NM_001904chr3193 ----1953
NM_001955chr61827 ------
NM_001967chr31549 ------
NM_002009chr1521928 664 12070 ----
NM_002025chrX58793 8665 2873 2802 181 19004 ----
NM_002051chr101997 ------
NM_002128chr1312038 ------
NM_002211chr10--1319 --178
NM_002223chr1254003 1417 1405 306 274 1540 ----
NM_002271chr13----1427 --
NM_002309chr2252273 1002 801 92 84 1981 32772 1935 795 --
NM_002381chr21659 ------
NM_002390chr1772072 1679 1481 803 491 484 199 21517 1314 11455 --
NM_002408chr141202 ------
NM_002487chr151680 ------
NM_002539chr21109 ------
NM_002546chr81129 ------
NM_002655chr834727 4251 1746 21636 1400 ----
NM_002670chr311607 ------
NM_002710chr121380 ------
NM_002737chr1736335 4477 132 --15606 --
NM_002742chr141475 ------
NM_002787chr71486 ------
NM_002830chr2--1254 ----
NM_002893chrX1244 ------
NM_002959chr131741 852 374 23262 709 1727 --
NM_003024chr211254 ------
NM_003028chr973785 3654 3215 736 662 326 197 23728 398 12463 --
NM_003034chr122320 34 22367 1601 17424 --
NM_003045chr1394396 4282 3541 3270 1670 1595 700 654 582 24617 3523 11116 --
NM_003072chr191407 ------
NM_003074chr331568 808 714 ----1889
NM_003075chr121309 ------
NM_003081chr201873 ------
NM_003149chr321604 357 --11049 --
NM_003161chr171304 13536 ----
NM_003162chr21815 2807 76 1332 --
NM_003189chr153063 2085 162 68 34 12754 11107 --
NM_003204chr1731222 1197 714 ------
NM_003211chr122385 185 1491 ----
NM_003216chr22113228 3123 2832 2742 1233 1088 1080 607 601 594 427 11150 ----
NM_003222chr2021023 784 ------
NM_003234chr362333 2281 2044 165 84 37 --12008 --
NM_003262chr323593 827 ------
NM_003281chr1154971 3648 3622 3595 3440 3320 2189 1743 1511 1090 817 781 552 441 245 --24838 1119 --
NM_003290chr191268 ------
NM_003292chr131949 1749 1499 12221 ----
NM_003298chr335367 1168 1127 3475 406 273 34644 2098 538 11871
NM_003341chr3----1102 --
NM_003410chrX12119 ------
NM_003482chr1252194 1801 1049 943 109 22737 636 22228 150 --
NM_003489chr2132579 2457 2430 --1351 --
NM_003559chr17113711 3629 3215 3164 2932 2693 2583 2542 1278 742 316 ------
NM_003566chr121723 ------
NM_003589chr13--11037 ----
NM_003590chr223899 785 ----11304
NM_003597chr21355 ------
NM_003644chr17135845 5750 5468 4798 4786 4539 2070 1527 1432 987 903 397 62 15654 15694 11022
NM_003668chr121130 ------
NM_003759chr433169 3124 843 21469 1369 --11048
NM_003762chr111376 ------
NM_003822chr122136 195 ------
NM_003913chr623364 1616 ----14189
NM_003939chr1053856 3407 2705 1661 935 23266 1419 1440 11479
NM_003983chr1684009 3914 3883 3725 2756 1053 330 123 ------
NM_003994chr1233330 1519 829 1453 12838 --
NM_004050chr146949 809 578 221 130 21 22180 1909 12576 12530
NM_004081chrY--140 ----
NM_004085chrX1680 --1567 --
NM_004162chr3----1900 --
NM_004235chr91302 ------
NM_004290chr5----188 --
NM_004321chr2103204 3193 2920 2223 1393 1128 941 568 506 258 1991 1559 --
NM_004330chr153848 741 730 ------
NM_004384chr511985 ------
NM_004412chr1035727 4664 930 ------
NM_004457chr21436 ------
NM_004504chr21210 ------
NM_004586chrX54817 4402 3508 3435 3410 --11173 --
NM_004588chr11113003 2870 2819 2535 924 868 796 656 557 526 123 --1910 --
NM_004595chrX1179 ------
NM_004630chr111786 ------
NM_004637chr311312 ------
NM_004677chrY1414 ------
NM_004726chrX65174 4325 3769 1394 1287 1262 --11372 --
NM_004762chr17101495 1417 1407 1303 666 555 540 476 263 243 ------
NM_004822chr17143567 3244 3178 2672 2430 1476 1204 1124 982 796 388 355 341 41 ------
NM_004869chr181366 ------
NM_004871chr1753988 3592 3395 3016 2941 ------
NM_004906chr61258 ------
NM_004961chrX51505 1269 1024 955 620 --11151 126
NM_004992chrX97581 6557 5986 3387 3053 3036 1731 1149 76 27804 907 38208 6463 2909 --
NM_004992chrX97581 6557 5986 3387 3053 3036 1731 1149 76 27804 907 38208 6463 2909 --
NM_005011chr7----1469 --
NM_005023chr511086 11076 ----
NM_005036chr2278328 7957 6842 6257 5759 2940 1880 15670 --15907
NM_005045chr71972 ------
NM_005072chr161370 ------
NM_005165chr171343 ------
NM_005206chr1721155 311 11450 ----
NM_005249chr141134 ------
NM_005257chr1811142 ------
NM_005316chr112740 458 ------
NM_005339chr413389 ------
NM_005347chr951640 1616 1451 653 242 ----11610
NM_005358chr131340 ------
NM_005399chr173543 3291 2971 1550 1441 687 464 --13403 --
NM_005596chr935576 1159 1011 11228 ----
NM_005647chrX3941 900 60 --12397 --
NM_005717chr11949 ------
NM_005748chr12----12535 --
NM_005779chr51505 --1308 1603
NM_005785chr1221681 278 --1670 --
NM_005859chr5----11397 --
NM_005910chr17113823 3119 3095 3083 2773 1611 1450 998 882 745 523 11598 ----
NM_005937chr17144137 1441 1298 1149 1082 1029 1009 953 850 840 650 627 583 533 13514 ----
NM_006047chr20----126 1444
NM_006070chr31305 ------
NM_006079chr61648 ------
NM_006212chr1105191 4469 1488 1361 1027 1013 899 739 392 300 1219 14794 --
NM_006226chr2----21127 942 --
NM_006237chr132919 351 11847 1227 --
NM_006241chr3----12128 --
NM_006252chr155756 1715 1291 931 125 --22834 1132 --
NM_006281chr81474 ------
NM_006281chr81474 ------
NM_006306chrX45701 1885 1137 925 15076 13772 14207
NM_006327chr10--1390 ----
NM_006408chr72888 855 ------
NM_006413chr101329 ------
NM_006546chr17105444 5251 4980 4960 4080 2594 2573 1979 848 761 12468 36559 4764 1076 --
NM_006575chr1411122 --1139 --
NM_006599chr1656297 5721 2689 983 956 35467 5212 537 ----
NM_006609chr222795 2305 12414 1480 --
NM_006614chr313446 ------
NM_006624chr101211 ------
NM_006650chr5103593 3558 3309 2871 1225 582 540 430 424 180 12931 12956 --
NM_006721chr102145 137 ------
NM_006736chr291654 1476 1388 696 661 652 373 285 229 21622 1547 ----
NM_006750chr1668061 7928 7059 6965 2627 869 --11586 --
NM_006815chr122940 914 11152 ----
NM_006902chr1170 --33252 3189 1318 --
NM_006925chr141458 ------
NM_007050chr20116736 6716 6324 6123 5538 2334 1884 1875 1482 1258 588 26465 5010 26246 788 25029 1108
NM_007159chr31132 --11373 --
NM_007175chr843199 2746 1353 627 ------
NM_007249chr1367509 2767 928 711 544 99 16117 18056 --
NM_007366chr2--136 ----
NM_007375chr111994 ------
NM_012141chr1311409 13537 1778 13379
NM_012199chr173990 3917 3839 3532 3340 3313 271 --11656 --
NM_012229chr1031476 945 80 1237 21351 601 --
NM_012234chr3138 ------
NM_012250chr111399 ------
NM_012290chr221180 378 --11333 --
NM_012306chr1273437 3285 2834 2727 734 697 380 1603 32203 684 405 --
NM_012421chr1----1104 --
NM_012434chr61281 ----11434
NM_013229chr121388 22010 1835 ----
NM_013354chr811438 ------
NM_014016chr3------11430
NM_014112chr844348 4314 1810 1249 1492 25156 4498 --
NM_014155chr1147210 2966 2349 631 --16152 --
NM_014157chr1633713 893 213 13998 --11104
NM_014268chr181223 1945 ----
NM_014305chr131265 ------
NM_014309chr2285025 4796 4776 3448 2155 1829 1624 1160 --15017 --
NM_014393chr81617 ------
NM_014423chr565542 5322 3772 3480 1557 337 ------
NM_014497chr2141 ------
NM_014500chrX--161 ----
NM_014504chr711445 ----12107
NM_014577chr221900 ------
NM_014612chr9--140 ----
NM_014647chr161512 ------
NM_014661chr10103737 3707 2971 2957 2793 2721 1065 981 897 689 1635 21216 799 --
NM_014683chr1711611 ------
NM_014701chr15--1462 ----
NM_014729chr812242 ------
NM_014730chr1284904 4569 4275 3922 3724 3297 1010 993 --33672 1982 1846 34205 1522 262
NM_014730chr1284904 4569 4275 3922 3724 3297 1010 993 --33672 1982 1846 34205 1522 262
NM_014747chr1134732 3754 3573 2241 2151 1902 1731 1702 1479 1087 983 873 665 14751 45461 4563 398 357 14155
NM_014755chr243644 2952 2755 1216 11015 ----
NM_014761chr161814 ------
NM_014772chr18103530 3368 3181 3161 2252 2201 1031 381 118 41 ----1874
NM_014810chr122805 2775 --1318 --
NM_014850chr364584 3877 1698 1253 1241 105 --1723 11750
NM_014871chr121126 ------
NM_014873chr124081 1646 11520 1394 --
NM_014877chr1767587 5922 5727 5654 5630 491 16260 11116 --
NM_014909chr14103579 3299 3107 2861 1593 1514 1059 893 515 323 21395 107 ----
NM_014923chr1331702 830 218 ------
NM_014924chr1412607 ------
NM_014952chr15121813 1389 1347 1336 1322 786 308 191 138 58 43 23 2794 340 11673 --
NM_014969chr111164 ------
NM_015000chr1222851 2181 11204 ----
NM_015008chr323070 2946 2370 303 ----
NM_015049chr233067 2962 2128 --13216 --
NM_015050chr661148 905 835 395 64 54 --21188 286 --
NM_015064chr1243398 3192 589 226 21192 832 12906 --
NM_015090chr1105448 5313 5068 4238 2018 1994 1434 1023 908 112 12047 34117 2295 1109 --
NM_015092chr1634121 3233 1455 24057 3434 ----
NM_015094chr22104275 3805 3651 3404 3260 2933 2923 1756 1271 334 187 24226 3959 --
NM_015130chr4--1471 ----
NM_015178chr852218 2079 1907 861 509 12134 --1868
NM_015191chr1151991 1780 978 878 270 2770 349 1576 --
NM_015206chr1523571 495 ------
NM_015254chr882636 2581 2383 2209 1126 1120 321 106 2422 112 11265 --
NM_015264chr22114245 4143 3613 3256 1949 1439 1382 1298 817 750 397 --11641 --
NM_015269chr1170 ------
NM_015271chr433190 1066 191 ----11138
NM_015299chr1494015 3162 3138 3068 2978 1349 489 332 324 --12553 --
NM_015310chr846881 5335 1768 46 1764 --16201
NM_015349chr642525 2078 1905 635 ----12029
NM_015455chr521123 630 --12741 --
NM_015567chr1321267 103 --1236 1985
NM_015570chr7--1443 ----
NM_015576chr312061 ------
NM_015609chr172857 2394 2287 1941 756 684 574 ------
NM_015622chr7--1103 ----
NM_015702chr21246 ------
NM_015726chr161807 1216 709 408 206 31 --122 --
NM_015840chr171998 1964 933 660 558 43 28 2982 516 ----
NM_015841chr171998 1964 933 660 558 43 28 2982 516 ----
NM_015906chr11623 ------
NM_016037chr11242 ------
NM_016072chr1212440 ------
NM_016090chr11132 ------
NM_016131chr212245 1659 --11551
NM_016169chr1093186 2965 2818 2302 2292 1037 810 756 631 12154 12022 --
NM_016178chr11102 ------
NM_016206chr336546 2306 1052 --12632 11273
NM_016230chr6160 ------
NM_016287chr1121 ------
NM_016308chr14685 628 595 233 ----21318 693
NM_016312chr122175 102 ------
NM_016319chr121735 ------
NM_016322chr912139 ------
NM_016605chr562421 2074 570 347 126 24 --11927 --
NM_016620chr11187 --2516 467 --
NM_016621chr1164188 4176 3776 3558 3544 1112 23915 1220 13858 13931
NM_016823chr1721025 181 11320 ----
NM_016834chr17113823 3119 3095 3083 2773 1611 1450 998 882 745 523 11598 ----
NM_016835chr17113823 3119 3095 3083 2773 1611 1450 998 882 745 523 11598 ----
NM_016841chr17113823 3119 3095 3083 2773 1611 1450 998 882 745 523 11598 ----
NM_017412chr81525 ------
NM_017456chr17101495 1417 1407 1303 666 555 540 476 263 243 ------
NM_017628chr444642 4123 4014 1759 --14701 --
NM_017635chr111643 ------
NM_017719chr332449 1815 868 --1829 --
NM_017728chr17102819 2741 2689 2594 2494 2074 2066 2059 1009 326 --1101 --
NM_017736chr1642937 716 61 40 12432 --1999
NM_017747chr51293 ------
NM_017790chr91121 ------
NM_017824chr1021938 1877 --21916 144 1596
NM_017902chr1064849 4630 4165 1274 656 161 11363 13601 --
NM_017907chr112399 172 ------
NM_018011chr131442 ------
NM_018084chr2--12489 ----
NM_018086chr22150 107 1562 ----
NM_018159chrX--11074 --1596
NM_018247chr623053 2855 ------
NM_018416chr1232163 2080 1832 22261 1732 21741 822 --
NM_018433chr22400 124 ------
NM_018448chr121292 ------
NM_018650chr111520 ------
NM_018700chr5--11333 ----
NM_019084chr1032201 1040 823 --11708 --
NM_019610chr1--11783 ----
NM_020116chr41347 ------
NM_020119chr723537 2859 ----13353
NM_020141chr1--11720 --11932
NM_020148chr1842121 2077 1153 972 12253 ----
NM_020193chr11--11123 ----
NM_020205chr123117 2799 43270 2857 1257 23 1823 --
NM_020225chr41139 ----1147
NM_020245chr664497 3705 3481 1178 536 148 1649 ----
NM_020342chr212142 ------
NM_020363chrY--140 ----
NM_020364chrY--140 ----
NM_020403chr13----11225 --
NM_020420chrY--140 ----
NM_020440chr152482 2385 1233 933 788 11016 --152
NM_020651chr21331 ------
NM_020711chr2----12032 --
NM_020713chr2082854 2434 910 798 747 424 205 190 --42033 1212 928 131 1714
NM_020749chr82641 630 ----1120
NM_020768chr52375 182 ------
NM_020772chr1777419 3291 2753 2275 1479 683 666 15362 11246 --
NM_020794chr111573 ------
NM_020800chr311175 162 ----
NM_020810chr1441022 415 290 80 ------
NM_020818chr141360 ------
NM_020834chr1431867 1627 1204 --2235 181 --
NM_020858chr15170 ------
NM_020919chr21312 ------
NM_020922chrX--1539 ----
NM_020956chr19124383 4292 3972 3884 3743 3708 3541 3358 2955 1305 636 522 34392 4065 3348 ----
NM_021072chr5--12341 ----
NM_021116chr7138713 8036 6723 6034 5936 5873 5790 2761 2319 2044 1857 1725 1670 13302 38920 3198 2163 --
NM_021148chr7--11799 ----
NM_021202chr2042655 1938 1036 758 --12071 --
NM_021220chr201146 ------
NM_021638chr4124352 3929 3697 3669 3384 3359 1125 1110 939 932 884 481 ----13219
NM_021647chr424177 1300 13503 13153 11091
NM_021785chrX1332 ------
NM_021911chr533592 2241 1357 --12150 13861
NM_021914chr14------1917
NM_021942chr41817 ------
NM_021961chr1156217 5516 2898 1188 524 15654 14532 15547
NM_021984chrX51505 1269 1024 955 620 --11151 126
NM_021987chrX51505 1269 1024 955 620 --11151 126
NM_021990chrX51505 1269 1024 955 620 --11151 126
NM_022075chr1172 ------
NM_022123chr141454 ------
NM_022140chr532053 1708 22 ------
NM_022166chr1694462 4391 3834 2519 2371 2256 1791 474 66 35496 4194 3846 ----
NM_022340chr373664 2418 725 529 339 127 68 --21366 414 --
NM_022374chr2----1129 --
NM_022455chr5143 ------
NM_022459chr1366262 6220 5708 5511 1986 975 11196 11186 --
NM_022465chr1252838 2380 2239 1988 950 12350 --11941
NM_022476chr161207 ------
NM_022481chr5127 ------
NM_022483chr521887 1624 ----1372
NM_022552chr211169 ------
NM_022648chr2114099 3799 3602 3480 3452 3084 1863 1442 1291 1033 708 ------
NM_022716chr111198 --33096 3033 1162 --
NM_022719chr22113235 1446 1282 1116 1096 1073 837 387 317 152 49 ------
NM_022735chr1131 ------
NM_022758chr653182 3026 2684 2520 2462 --12827 165
NM_022822chr11--1133 ----
NM_022823chr2--1103 ----
NM_023039chr51354 ------
NM_023927chr5----11002 --
NM_023929chr81134 ------
NM_024294chr653182 3026 2684 2520 2462 --12827 165
NM_024345chr946069 3888 1346 949 12072 ----
NM_024567chr81128 ------
NM_024615chr51195 ------
NM_024665chr333872 868 734 --24109 1846 --
NM_024721chr812279 ------
NM_024920chr411397 ------
NM_025146chr321669 333 --1602 12425
NM_025191chr1----1855 --
NM_030625chr10------11802
NM_030627chr512889 13949 13018 --
NM_030647chr724383 214 --11483 1316
NM_030648chr444466 1891 715 708 ------
NM_030650chr232936 1630 99 23592 3582 ----
NM_030753chr171263 ------
NM_030784chr6197 ------
NM_030806chr1108435 8251 7954 7930 6946 5707 2646 1863 1385 872 12677 18537 23487 2809
NM_030938chr171224 ------
NM_031216chr1811913 ------
NM_031372chr4----11600 --
NM_031417chr19122538 2495 2477 2069 2041 1854 761 631 565 559 533 432 1403 12572 --
NM_031886chr1992604 2564 1787 894 802 659 538 422 56 169 ----
NM_032138chr13--1119 ----
NM_032186chr11187 --2516 467 --
NM_032312chr2--1338 ----
NM_032413chr151115 ------
NM_032440chr102842 759 ------
NM_032505chr332141 875 140 12725 1328 --
NM_032632chr142637 81 1520 1588 --
NM_032664chr8--11562 ----
NM_032876chr141637 ------
NM_033020chr11623 ------
NM_033133chr1772680 1342 1303 673 659 419 274 13415 ----
NM_033222chr921132 1086 11060 ----
NM_033389chr1753593 1948 1904 920 51 21917 1595 --11230
NM_033406chr11138 ------
NM_033426chr1431004 351 299 --12865 1276
NM_033496chr10----1157 --
NM_033497chr10----1157 --
NM_033498chr10----1157 --
NM_033500chr10----1157 --
NM_033637chr1053856 3407 2705 1661 935 23266 1419 1440 11479
NM_033656chr2125668 224 --15103 11100
NM_052818chr1342174 1854 1689 424 ----1239
NM_052898chr83327 288 90 --11525 --
NM_052906chr22144079 3427 3223 3203 2029 1891 1786 1730 1493 1013 916 693 362 78 34326 4095 863 44402 3778 3190 424 --
NM_052907chr1213219 24294 927 ----
NM_052913chr6131 --1351 --
NM_052965chr12194 89 ------
NM_057749chr81377 ------
NM_058191chr211898 ------
NM_080669chr17124094 3854 3680 3622 1788 1540 1388 1368 1295 758 653 114 21921 28 14599 --
NM_080717chr1211174 11425 ----
NM_130811chr201873 ------
NM_133170chr20116736 6716 6324 6123 5538 2334 1884 1875 1482 1258 588 26465 5010 26246 788 25029 1108
NM_133329chr211485 ----1118
NM_133372chr51127 ------
NM_133445chr92425 196 ------
NM_133468chr742321 2041 462 446 --1641 --
NM_133477chr443011 1281 470 63 ------
NM_138292chr1111156 ------
NM_138316chr10------1962
NM_138338chr2273057 2581 1192 1128 991 886 703 12154 13262 --
NM_138340chr181439 ------
NM_138444chr1334217 1271 1023 ----13768
NM_138638chr14------1917
NM_138713chr1656297 5721 2689 983 956 35467 5212 537 ----
NM_138714chr1656297 5721 2689 983 956 35467 5212 537 ----
NM_138731chr14----1452 --
NM_138927chr211954 ------
NM_139067chr121309 ------
NM_139078chr121130 ------
NM_144571chr436950 4853 179 24667 1734 22607 1074 --
NM_144578chr14199 --13600 15380
NM_144579chr2102784 2524 2475 2342 1963 900 888 723 573 54 ------
NM_144582chr262411 1740 682 640 317 206 22573 29 1308 --
NM_144604chr16------144
NM_144664chr11------11703
NM_145025chr6----1163 --
NM_145174chr2211509 ------
NM_145251chr14----11424 --
NM_145279chr121774 51 --1259 --
NM_145912chr2284266 3610 3546 1582 723 657 205 50 21836 1824 23218 387 --
NM_148977chr10------1962
NM_148978chr10------1962
NM_152309chr1042033 1931 503 488 ------
NM_152417chr811299 ------
NM_152594chr1511812 ------
NM_152653chr31466 ------
NM_152671chr2198 ------
NM_152678chr332656 1945 131 ------
NM_152680chr422074 373 ----12286
NM_152688chr61390 ------
NM_152716chr11----11642 --
NM_152733chr6116284 5932 5846 5460 4474 4423 4118 2223 1895 1535 1328 24349 2572 35911 2501 1454 --
NM_152754chr71612 23691 163 1957 --
NM_152756chr534313 3657 3054 11163 13891 1390
NM_152787chrX43179 1354 962 531 1517 ----
NM_152789chr71490 ------
NM_152838chr20----126 1444
NM_152890chr11283 ------
NM_153261chr1611542 ------
NM_153607chr5--12977 ----
NM_153616chr15170 ------
NM_153617chr15170 ------
NM_153618chr15170 ------
NM_153634chr1211392 ------
NM_153695chr91239 ------
NM_153759chr211169 ------
NM_170665chr1233429 3329 3085 11091 --1163
NM_170731chr1112098 173 ----
NM_170732chr1112098 173 ----
NM_170733chr1112098 173 ----
NM_170734chr1112098 173 ----
NM_170735chr1112098 173 ----
NM_172344chr211485 ----1118
NM_172349chr5143 ------
NM_173054chr71972 ------
NM_173214chr1656297 5721 2689 983 956 35467 5212 537 ----
NM_173463chr453415 2900 1354 928 202 21069 485 ----
NM_173478chr17181 ------
NM_173495chrX32531 1864 1772 22159 2136 ----
NM_173552chr32448 332 --1565 --
NM_173595chr12145095 5055 4849 4839 4086 3843 3484 3404 1327 1212 1116 797 556 518 1227 179 13707
NM_173808chr111020 13850 12952 --
NM_173822chr24820 674 576 329 11928 ----
NM_173854chr122202 898 ------
NM_175607chr311493 ------
NM_175612chr311493 ------
NM_175629chr211169 ------
NM_175709chr2292923 2772 2342 1172 875 524 497 483 239 ------
NM_175854chr1332638 2087 2071 ------
NM_175861chr1235069 1596 87 32168 1602 209 --25381 1121
NM_175876chr11654 ------
NM_175910chr19----12340 --
NM_176081chr1035727 4664 930 ------
NM_176083chr1035727 4664 930 ------
NM_177999chr973652 3177 3157 3088 1138 867 856 12902 1965 --
NM_178037chr1243398 3192 589 226 21192 832 12906 --
NM_178038chr1243398 3192 589 226 21192 832 12906 --
NM_178039chr1233033 2827 224 2827 467 12541 --
NM_178040chr1233033 2827 224 2827 467 12541 --
NM_178140chr512164 12474 ----
NM_178151chrX47453 6199 5367 2827 --33110 238 60 --
NM_178152chrX47453 6199 5367 2827 --33110 238 60 --
NM_178153chrX47453 6199 5367 2827 --33110 238 60 --
NM_178527chr1128 ------
NM_178562chr7--1894 ----
NM_178565chr811596 ------
NM_178818chr1632288 705 273 12082 --150
NM_181486chr1211174 11425 ----
NM_181521chr16107069 5486 5054 2420 2070 1882 1851 1744 331 205 16863 12588 14831
NM_181746chr1172 ------
NM_181861chr121388 22010 1835 ----
NM_181868chr121388 22010 1835 ----
NM_181869chr121473 22095 1920 ----
NM_182503chr653863 2093 1020 976 456 1827 12032 --
NM_182580chr1102360 2169 2150 2144 1881 1778 1600 984 807 698 1945 12324 --
NM_182666chr3----1102 --
NM_182691chr71183 ------
NM_182692chr71183 ------
NM_182970chr20104244 3253 2876 2862 1541 1362 1186 1039 467 77 --33367 1477 1317 --
NM_183058chr10143 ------
NM_183387chr14----1311 --
NM_183398chr5----188 --
NM_183399chr5----188 --
NM_183400chr5----188 --
NM_183401chr5----188 --
NM_194278chr1483614 3309 3081 1367 1318 1125 221 134 --1151 --
NM_194286chr1295425 5275 4889 2059 1850 1652 1471 1273 206 31869 1289 148 11110 13861
NM_194314chr144684 3685 2146 77 ------
NM_194358chr1221681 278 --1670 --
NM_194359chr1221681 278 --1670 --
NM_197955chr151115 ------
NM_198081chr632491 681 605 --12462 12121
NM_198086chr141637 ------
NM_198097chr7--1103 ----
NM_198490chr3103290 3201 3053 2726 2184 2170 1288 1132 860 420 13147 --11393
NM_198595chr4124352 3929 3697 3669 3384 3359 1125 1110 939 932 884 481 ----13219
NM_198794chr1411122 --1139 --
NM_199053chr41839 ------
NM_199320chr431801 748 618 ----1648
NM_199320chr431801 748 618 ----1648
NM_199355chr1621305 29 1344 --1673
NM_201269chr11187 --2516 467 --
NM_201403chr121774 51 --1259 --
NM_201432chr17135845 5750 5468 4798 4786 4539 2070 1527 1432 987 903 397 62 15654 15694 11022
NM_201433chr17135845 5750 5468 4798 4786 4539 2070 1527 1432 987 903 397 62 15654 15694 11022
NM_201521chr61145 ------
NM_201522chr61145 ------
NM_201523chr61145 ------
NM_203372chr21436 ------
NM_203394chr1231830 1106 552 11024 --1341
NM_203406chr522145 1895 12013 ----
NM_203487chr13----11225 --
NM_205860chr122136 195 ------
NM_206594chr1------12964
NM_206595chr1------12964
NM_206808chr13135 ------
NM_206909chr846881 5335 1768 46 1764 --16201
NM_207371chr1021488 188 ------
NM_207406chr466009 5751 5308 2208 2201 155 ----11707
NM_213651chr121504 505 ------