TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3157-5p
miRNA Sequence: UUCAGCCAGGCUAGUGCAGUCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr52773 464 ------
NM_000081chr11365 180 1370 --
NM_000090chr21919 ------
NM_000092chr244482 4368 3838 1234 ------
NM_000104chr212186 22488 959 ----
NM_000115chr1322487 1646 ------
NM_000138chr1522677 1935 12500 ----
NM_000161chr1431523 176 28 --11315 --
NM_000165chr6--11416 ----
NM_000167chrX21714 257 ------
NM_000170chr91182 ------
NM_000176chr52890 21 --13260 1371
NM_000202chrX43612 3479 2780 887 --12643 --
NM_000210chr221980 1716 --1451 --
NM_000248chr322755 2252 ------
NM_000264chr963204 2195 854 766 610 88 1727 21236 1009 --
NM_000314chr1022890 2884 ------
NM_000319chr12198 1492 ----
NM_000332chr646748 4562 2184 2076 15259 12862 --
NM_000333chr321161 947 --1350 --
NM_000335chr362101 2054 2036 1602 1517 816 21642 555 ----
NM_000337chr552003 1970 1793 523 64 --21542 595 --
NM_000367chr621833 582 11529 ----
NM_000368chr984288 3152 1712 1216 1126 778 484 305 13630 ----
NM_000369chr1421204 402 ------
NM_000386chr171540 ------
NM_000390chrX23267 769 ------
NM_000399chr102954 276 ------
NM_000408chr223066 1113 ------
NM_000437chr132156 746 289 ------
NM_000439chr521737 78 ------
NM_000448chr1112274 --22745 2569 --
NM_000449chr12508 159 ------
NM_000451chrX3843 600 305 11584 1594 --
NM_000461chr31233 1406 --11082
NM_000462chr151363 1193 ----
NM_000480chr111140 --1412 --
NM_000489chrX22374 932 ------
NM_000555chrX46851 2830 2232 556 24952 2836 13106 16126
NM_000615chr1132268 1140 754 ------
NM_000627chr21379 1102 ----
NM_000633chr1874345 3713 1349 1328 1288 468 457 --35082 1787 1145 --
NM_000634chr22896 860 3951 356 333 ----
NM_000698chr101402 ------
NM_000719chr1255220 4744 4738 4361 1777 ----12565
NM_000724chr1021904 216 --1464 --
NM_000826chr4------1616
NM_000831chr1106195 5959 5916 5755 4986 4369 4148 1987 457 37 --21003 999 11045
NM_000844chr31327 ----1712
NM_000868chrX12556 ----11886
NM_000875chr1586636 6121 5971 5144 4640 2027 670 413 --11704 17002
NM_000891chr1722925 293 ------
NM_000899chr121658 --142 --
NM_000901chr4----197 --
NM_000908chr5--161 1508 --
NM_000922chr11190 ----1735
NM_000926chr1119174 27612 3344 39386 8692 7331 13322
NM_000935chr3--11147 177 --
NM_000944chr431637 958 810 ------
NM_000945chr2--11443 11884 --
NM_000958chr531263 299 244 ------
NM_000959chr133982 3479 1365 ------
NM_000962chr9102885 2837 2815 2399 2390 1222 671 468 122 72 --3842 421 292 --
NM_001001323chr1232896 2000 690 ------
NM_001001331chr332565 1885 171 --1861 --
NM_001001342chr1021398 78 11244 2364 336 --
NM_001001549chr742243 1130 1054 1006 2816 23 ----
NM_001001550chr742243 1130 1054 1006 2816 23 ----
NM_001001555chr742243 1130 1054 1006 2816 23 ----
NM_001001556chr1511613 --11112 1149
NM_001001557chr84887 488 112 72 ------
NM_001001668chr1934302 3164 606 1742 ----
NM_001001701chr42941 558 1269 --11616
NM_001001890chr2153453 1486 1149 431 23 ------
NM_001001933chr11564 --1551 --
NM_001001974chr10----1422 12375
NM_001002031chr12296 42 ------
NM_001002295chr101879 ----1843
NM_001002843chr1521065 294 --1459 --
NM_001002860chr1454360 3745 1046 1014 256 --14263 --
NM_001002909chr1722104 1780 11466 ----
NM_001002914chr1721057 252 --1865 --
NM_001003652chr1848324 7686 3042 2715 ------
NM_001003698chr631854 154 85 --1603 --
NM_001003699chr631854 154 85 --1603 --
NM_001003792chr31288 ------
NM_001003793chr31288 ------
NM_001003810chr41567 ------
NM_001003940chr1553482 2622 641 528 237 13376 12466 --
NM_001003942chr1553482 2622 641 528 237 13376 12466 --
NM_001003943chr1553486 2626 645 532 241 13380 12470 --
NM_001004317chr633906 3571 1096 ------
NM_001004419chr1221501 736 1889 1349 --
NM_001005271chr1721145 315 --1251 --
NM_001005273chr1721145 315 --1251 --
NM_001005404chr1744017 3673 3410 651 --11212 1245
NM_001005463chr101436 --12300 --
NM_001005502chr1294496 3764 3625 3458 1771 1622 1465 1009 583 --11900 --
NM_001005781chr2--149 ----
NM_001006636chr21121 1350 ----
NM_001006946chr231923 1875 1498 ----21452 365
NM_001007024chr1753991 3165 2992 1437 158 1676 13376 --
NM_001007025chr1753991 3165 2992 1437 158 1676 13376 --
NM_001007097chr923936 3113 --44473 3678 1008 50 --
NM_001007237chr162523 2401 2159 1090 903 185 12422 22224 1094 --
NM_001007278chr1323954 244 1409 21661 1029 13536
NM_001007466chr654349 3802 2049 380 271 --24468 1426 --
NM_001008220chr583896 3590 3211 2783 749 537 518 493 21343 1229 12597 --
NM_001008225chr71614 ------
NM_001008237chr2--1158 ----
NM_001008388chr4------178
NM_001008405chr731452 593 25 ------
NM_001008408chr756105 5703 1786 569 405 1194 --14662
NM_001008495chr832255 2170 201 ------
NM_001008540chr21458 ------
NM_001008564chr1321871 686 ------
NM_001008701chr1962882 2452 2408 2302 2043 25 22616 594 2578 97 11988
NM_001008707chr1421258 422 ------
NM_001008711chr821467 1065 21125 42 ----
NM_001008895chr13--1998 1586 --
NM_001008938chr111102 ------
NM_001009554chr444360 1059 585 260 13381 ----
NM_001009554chr444360 1059 585 260 13381 ----
NM_001009566chr121302 951 11107 ----
NM_001009880chr2274852 4358 2986 1812 1385 820 571 --24272 1430 --
NM_001009958chr71166 ------
NM_001009993chr263703 3573 3239 2919 1736 514 11244 ----
NM_001010867chr1105361 4545 4062 1543 1083 1042 1006 428 39 27 25184 2027 36645 1811 938 --
NM_001010891chr565789 5579 5292 2711 1091 222 35127 2544 405 21161 431 --
NM_001010911chr102188 27 1935 ----
NM_001010922chr1--21138 530 21433 1383 1477
NM_001010923chr611622 11765 ----
NM_001010924chr1011032 ----1227
NM_001010971chr111001 ------
NM_001011537chr332153 407 224 ------
NM_001011657chrX--129 ----
NM_001011663chr102727 344 ------
NM_001011666chr711551 ----22166 913
NM_001011708chr222321 492 11877 ----
NM_001011885chr15----21495 485 --
NM_001012329chr162206 463 402 225 161 71 11624 32259 2121 433 --
NM_001012393chr1175172 4425 3837 3811 3642 3453 3410 --21389 781 --
NM_001012642chr1521806 705 --22097 656 --
NM_001012761chr532531 392 163 1689 1311 --
NM_001013031chr1023456 374 ------
NM_001013415chr4----1436 --
NM_001013620chr1277261 6177 5962 3036 2461 1817 915 38097 2870 1748 ----
NM_001013622chr451108 463 340 278 216 ------
NM_001014794chr11285 47 ------
NM_001014795chr11285 47 ------
NM_001014797chr1057105 6460 6427 5436 5100 37126 5454 5065 ----
NM_001015877chrX32131 2018 179 --12035 --
NM_001017395chr342878 2679 1239 1055 ------
NM_001017424chr121401 1244 ------
NM_001017425chr121401 1244 ------
NM_001017440chr786356 3076 3056 2776 2287 930 457 147 26101 2919 11979 --
NM_001017926chr8----11825 --
NM_001017930chrX1983 ------
NM_001017977chr11391 ------
NM_001018004chr151211 ------
NM_001018006chr151211 ------
NM_001018007chr151211 ------
NM_001018008chr152517 145 128 --2176 138
NM_001018020chr151211 ------
NM_001018025chrX--2295 117 ----
NM_001018050chr2273241 2413 2213 1220 1082 214 208 12122 13381 1598
NM_001018052chr2273241 2413 2213 1220 1082 214 208 12122 13381 1598
NM_001018054chr12367 240 11051 ----
NM_001018056chr91436 1104 ----
NM_001018057chr1131154 261 80 ------
NM_001018074chr52890 21 --13260 1371
NM_001018075chr52890 21 --13260 1371
NM_001018076chr52890 21 --13260 1371
NM_001018077chr52890 21 --13260 1371
NM_001018100chr151322 ------
NM_001020658chr12344 111 ------
NM_001020658chr12344 111 ------
NM_001023567chr152982 858 ------
NM_001024024chr14----1369 --
NM_001024070chr14----1365 --
NM_001024094chr52890 21 --13260 1371
NM_001024226chr11382 ------
NM_001024227chr11382 ------
NM_001024228chr11382 ------
NM_001024463chr15--11162 1293 --
NM_001024647chr1247075 5314 2937 1343 11426 16667 24781 53
NM_001024649chr532351 236 89 ------
NM_001024858chr1462921 2746 2600 2465 578 386 --21080 738 --
NM_001024947chr51968 ------
NM_001024948chr123134 1063 175 ----
NM_001025068chr321370 557 1108 11346 --
NM_001025069chr321370 557 1108 11346 --
NM_001025077chr1036489 4916 637 ------
NM_001025079chr342772 884 545 125 --13282 --
NM_001025105chr53504 418 103 --1285 --
NM_001025107chr122643 2580 ------
NM_001025107chr122643 2580 ------
NM_001025108chr253132 2935 2726 1048 903 ------
NM_001025109chr131073 889 24 1828 ----
NM_001025389chr111140 --1412 --
NM_001025390chr111140 --1412 --
NM_001025595chr421265 254 ------
NM_001025603chr12508 159 ------
NM_001029858chr633362 2615 1018 11238 ----
NM_001029861chr191693 ----1128
NM_001029863chr62334 259 ----32694 2499 89
NM_001029875chr511207 --12979 --
NM_001030007chr1623575 202 ----14005
NM_001030055chr14--127 23723 392 --
NM_001030059chr101317 ------
NM_001031684chr231411 1245 973 ----11402
NM_001031690chr751028 798 455 243 50 ----1514
NM_001031695chr2274856 4789 4681 4290 4194 1472 521 ----1533
NM_001031702chr34663 631 196 185 --2800 160 --
NM_001031712chr61392 ------
NM_001031717chr32140 72 ------
NM_001031812chr51148 ------
NM_001032288chr20------11008
NM_001032380chr10----21961 1948 --
NM_001033059chr611625 ------
NM_001033117chr344753 4173 962 159 13784 34669 4139 1189 --
NM_001034025chr122381 169 --1706 1136
NM_001035chr11484 ------
NM_001035254chr91907 --2381 339 22057 1025
NM_001035260chr102406 162 ------
NM_001037132chr7------11439
NM_001037133chr7------11439
NM_001037290chr112760 690 ------
NM_001037334chr181710 ----1813
NM_001037954chr1183138 2847 2662 2427 1021 400 324 49 ------
NM_001038702chr532776 730 518 ----11031
NM_001038707chr122038 497 1157 --11637
NM_001038707chr122038 497 1157 --11637
NM_001039538chr212952 23014 3004 33623 3184 622 --
NM_001039577chr163115 3094 1613 648 333 90 ------
NM_001039585chr134239 3736 1622 ------
NM_001039590chrX22587 524 --31227 1110 547 --
NM_001039591chrX22587 524 --31227 1110 547 --
NM_001039618chr1134050 2268 710 ----1489
NM_001039690chr1632356 1539 262 ----1803
NM_001039802chr111272 ------
NM_001039844chr1052889 2754 1912 855 485 22589 690 1802 --
NM_001040056chr161491 1111 1805 --
NM_001040092chr8139 ------
NM_001040102chr1022486 141 22496 48 ----
NM_001040103chr1022486 141 22496 48 ----
NM_001040144chr1632356 1539 262 ----1803
NM_001040146chr1632356 1539 262 ----1803
NM_001040152chr713657 --2610 369 --
NM_001040284chr1624917 1389 ------
NM_001040424chr2132953 2695 114 1574 --1981
NM_001040429chr1322699 2462 --13450 --
NM_001040653chr312544 1512 ----
NM_001040715chr162982 351 ------
NM_001042388chr181642 ------
NM_001042406chr61785 ----1981
NM_001042476chr1651421 798 739 684 520 1699 1272 --
NM_001042539chr161192 ------
NM_001042550chr91207 ------
NM_001042555chr121330 --1276 --
NM_001042599chr267367 7323 6767 6493 4877 927 --16723 1388
NM_001042603chr1243994 3478 3420 3362 --25159 293 14988
NM_001042604chr334174 3603 3389 ------
NM_001042681chr122466 25 ------
NM_001042682chr122466 25 ------
NM_001042682chr122466 25 ------
NM_001042749chrX1366 ------
NM_001042750chrX1366 ------
NM_001042751chrX1366 ------
NM_001043318chr1462824 476 458 218 114 40 32651 1216 376 --11287
NM_001044385chr233824 699 645 11183 ----
NM_001044722chr51148 ------
NM_001044723chr51148 ------
NM_001049chr14----12080 11756
NM_001071775chr1311587 2464 342 ----
NM_001083620chr4------1615
NM_001099678chr325846 4915 15513 1232 --
NM_001100108chr1107814 7790 6585 6229 5591 5457 5058 2684 2161 1079 --27967 6053 --
NM_001106chr387815 6629 6190 3419 2732 2292 1807 1670 --37634 7050 2912 --
NM_001111chr122643 2580 ------
NM_001113490chrX--1997 22428 934 --
NM_001116chr1652958 2074 1231 264 66 ------
NM_001117chr181613 ------
NM_001128chr1623575 202 ----14005
NM_001148chr4----12231 11521
NM_001160chr1221083 139 2917 619 1302 --
NM_001167chrX56058 5815 4198 2065 485 24697 1898 ----
NM_001172chr142556 83 1651 ----
NM_001173chr14--127 23723 392 --
NM_001219chr722153 279 ------
NM_001227chr1021353 311 ------
NM_001241chr222095 858 --1376 --
NM_001241chr222095 858 --1376 --
NM_001247chr2051111 1031 957 724 340 ------
NM_001256chr171367 --22064 1024 --
NM_001263chr4--1106 ----
NM_001271chr1532669 2620 837 --2771 447 1133
NM_001304chr17--1517 13377 --
NM_001310chr1212064 --22408 1203 12271
NM_001315chr642243 1998 1735 467 ------
NM_001331chr112989 141 ----12364
NM_001332chr5----21550 290 --
NM_001358chr4------1289
NM_001364chr1144340 4135 1741 1334 14542 13389 --
NM_001386chr862464 2059 2050 1814 589 443 --11892 --
NM_001390chr1853248 3206 2967 2936 2473 1361 ----
NM_001396chr2122328 1713 11837 11983 11047
NM_001406chr1741591 1324 715 350 --11412 --
NM_001419chr1932999 1603 1372 --1472 13861
NM_001429chr221277 --2396 215 --
NM_001438chr112387 ------
NM_001440chr842433 2176 1970 1078 1870 1444 --
NM_001451chr1611188 --1440 --
NM_001493chrX1563 1788 ----
NM_001530chr1411115 ------
NM_001542chr162523 2401 2159 1090 903 185 12422 22224 1094 --
NM_001543chr5134424 4398 3950 1759 1558 1507 1497 1414 1353 1223 1184 1062 142 21672 509 14154 --
NM_001567chr112540 473 176 ----
NM_001634chr611625 ------
NM_001650chr1821170 813 --14095 --
NM_001655chr1121842 563 1399 --21757 67
NM_001658chr11382 ------
NM_001659chr1242716 2406 1946 333 22326 766 11672 --
NM_001660chr31596 ------
NM_001663chr1432739 2024 1999 ------
NM_001678chr1721301 1147 11158 ----
NM_001682chr1222610 404 ------
NM_001683chr332565 1885 171 --1861 --
NM_001701chr941591 1429 1361 996 ------
NM_001717chr151946 --11271 --
NM_001742chr71736 11707 ----
NM_001746chr532351 236 89 ------
NM_001753chr7----1272 1120
NM_001754chr2153453 1486 1149 431 23 ------
NM_001755chr1631763 897 737 ------
NM_001759chr1244143 2124 1907 64 11619 24613 1838 11312
NM_001760chr63939 718 271 --1869 --
NM_001773chr131439 1255 390 11194 1353 11006
NM_001777chr342772 884 545 125 --13282 --
NM_001781chr121229 ------
NM_001791chr111272 ------
NM_001851chr62740 22 ------
NM_001858chr621647 364 --14349 --
NM_001873chr41657 ------
NM_001874chr1294496 3764 3625 3458 1771 1622 1465 1009 583 --11900 --
NM_001880chr2197 ------
NM_001892chr53504 418 103 --1285 --
NM_001894chr2221244 981 --1506 --
NM_001904chr33385 192 86 ------
NM_001939chrX43535 2973 1524 1501 1986 11003 1808
NM_001969chr1421582 1032 --13584 --
NM_001987chr1233590 889 90 1198 --1556
NM_001999chr511328 ------
NM_002009chr152374 253 1115 11760 --
NM_002014chr122161 122 --1505 --
NM_002025chrX57259 6927 6918 6906 1389 13459 49236 1902 1848 815 26193 1826
NM_002035chr1883314 3172 2937 2921 2616 1147 1103 143 ------
NM_002039chr41877 ------
NM_002044chr1511613 --11112 1149
NM_002048chr92109 25 ------
NM_002051chr101879 ----1843
NM_002076chr1252810 730 641 208 115 22645 1256 12761 --
NM_002077chr92162 35 ------
NM_002086chr174845 634 366 144 ------
NM_002092chr424361 1814 44195 3563 1782 1356 34979 3531 1074 11554
NM_002128chr1322456 1675 ------
NM_002137chr742400 2294 1709 1506 ----11563
NM_002138chr41567 ------
NM_002156chr21113 ----1118
NM_002193chr221355 95 ------
NM_002199chr4124 ------
NM_002221chr132062 686 281 22618 673 1477 --
NM_002247chr1021592 152 ------
NM_002264chr334858 4325 3487 ------
NM_002268chr32638 588 ------
NM_002270chr513924 ----1898
NM_002285chr253132 2935 2726 1048 903 ------
NM_002293chr122570 1848 --12588 1660
NM_002309chr2252360 2276 2191 877 163 1264 181 1761
NM_002336chr1224549 1609 --160 --
NM_002355chr122513 417 ------
NM_002359chr17104089 3522 3160 1458 1314 964 627 417 162 61 ------
NM_002372chr51453 ------
NM_002373chr153971 138 80 11114 ----
NM_002374chr212952 23014 3004 33623 3184 622 --
NM_002375chr332038 1531 112 1825 1438 --
NM_002387chr554230 3815 1875 717 108 11740 13750 12032
NM_002397chr522208 1401 ------
NM_002399chr1521040 510 ------
NM_002409chr2273170 2719 2384 2286 2152 980 629 --22956 984 --
NM_002448chr4--1584 --1184
NM_002481chr167886 6163 6081 5739 5129 2227 11108 17430 --
NM_002482chr15684 646 624 270 112 --2654 650 1147
NM_002486chr952302 1831 1806 1697 1653 ----1407
NM_002487chr152619 222 ------
NM_002499chr152803 149 --22292 468 --
NM_002505chr621503 589 ------
NM_002515chr141374 --11445 --
NM_002518chr21479 ------
NM_002538chr51126 1187 ----
NM_002545chr1175172 4425 3837 3811 3642 3453 3410 --21389 781 --
NM_002556chr111481 21434 605 32018 1598 174 --
NM_002588chr521497 404 1190 ----
NM_002594chr201699 ----12009
NM_002628chr32927 403 ------
NM_002629chr10--1628 ----
NM_002641chrX11374 --1675 --
NM_002646chr131996 209 35 11437 --11800
NM_002709chr21368 13067 13545 --
NM_002710chr121718 ------
NM_002713chr1--2337 164 ----
NM_002714chr611029 ------
NM_002725chr174169 3819 3299 2978 1541 1229 46 --44220 2934 1068 696 --
NM_002755chr152636 342 1268 ----
NM_002758chr17124 ----1415
NM_002763chr11191 --1371 --
NM_002843chr1143393 2655 2564 799 1378 ----
NM_002850chr1941029 1021 899 424 ------
NM_002855chr1122397 1075 13701 ----
NM_002868chr122824 555 ------
NM_002869chr1111948 ------
NM_002886chr333574 949 133 --21545 257 14081
NM_002890chr51743 ------
NM_002892chr1411161 1132 ----
NM_002955chr631854 154 85 --1603 --
NM_002994chr421616 312 ------
NM_002997chr231923 1875 1498 ----21452 365
NM_002999chr2021759 1653 11291 31842 1235 1211 1376
NM_003013chr42333 48 ------
NM_003016chr1741930 1735 1672 201 --1349 --
NM_003026chr911060 --1141 --
NM_003034chr1266566 5018 2783 2760 1301 323 27656 6402 38069 6968 1783 --
NM_003045chr1384264 3711 1873 1690 970 812 649 238 --13459 --
NM_003051chr121506 619 ----1494
NM_003070chr91792 ------
NM_003081chr202955 444 ----1845
NM_003106chr31790 ------
NM_003108chr236044 2172 1750 27245 1728 ----
NM_003112chr72705 72 2836 334 ----
NM_003128chr222654 992 --1111 --
NM_003155chr852543 2502 2290 2112 588 --12618 --
NM_003161chr171601 --12235 1965
NM_003178chr32642 165 ------
NM_003189chr132538 707 165 22366 290 1413 1570
NM_003199chr1845565 5127 1139 273 --35616 4390 3584 --
NM_003221chr633505 755 569 --1407 --
NM_003234chr322336 342 1426 ----
NM_003244chr18----1429 --
NM_003247chr631889 1642 1400 ------
NM_003262chr3--14453 161 11309
NM_003270chrX51045 897 213 181 136 ----184
NM_003274chr2122684 932 --11044 --
NM_003275chr931315 153 143 ------
NM_003339chr51989 --11546 --
NM_003340chr411001 ----1502
NM_003342chr1752998 2904 2782 2223 1208 12037 --1129
NM_003345chr162568 382 ------
NM_003349chr20------11008
NM_003372chrX2340 73 ----1763
NM_003383chr91436 1104 ----
NM_003390chr11--155 ----
NM_003392chr323033 1111 11693 ----
NM_003403chr141582 ------
NM_003404chr2011935 ------
NM_003405chr222631 188 ------
NM_003412chr322018 1952 ------
NM_003418chr3142 ------
NM_003427chr6----187 1531
NM_003467chr21458 ------
NM_003472chr61603 ------
NM_003474chr1012356 --12147 --
NM_003482chr1242353 221 146 119 --1865 --
NM_003483chr12----11165 --
NM_003488chr171630 ------
NM_003489chr2122312 214 --12317 --
NM_003566chr1222312 101 ------
NM_003574chr1832286 1484 893 15550 11940 12092
NM_003583chr1211124 21091 63 --13729
NM_003586chr161621 ------
NM_003589chr13--1998 1586 --
NM_003590chr212562 ------
NM_003597chr211867 --2679 567 --
NM_003598chr193192 174 112 ------
NM_003633chr562318 984 769 745 643 398 --1492 1502
NM_003644chr1776391 5700 5324 4789 4783 1073 46 35538 279 226 ----
NM_003663chr3----2883 839 --
NM_003671chr932871 1271 785 --1293 13451
NM_003735chr521497 404 1190 ----
NM_003736chr521497 404 1190 ----
NM_003758chr1511239 1532 ----
NM_003758chr1511239 1532 ----
NM_003759chr473479 3172 3159 2936 2930 1223 202 --33981 3635 1316 --
NM_003787chr1821688 1285 ------
NM_003850chr13------125
NM_003885chr1762635 2333 2244 1847 381 348 ------
NM_003887chr212204 ------
NM_003902chr1----1272 --
NM_003908chr201127 ----31286 992 48
NM_003913chr622771 256 --1315 --
NM_003916chrX11381 11161 ----
NM_003930chr71475 11878 ----
NM_003939chr1033752 3598 980 12737 ----
NM_003941chr712131 11773 --12165
NM_003972chr1011030 --11202 1869
NM_003980chr61320 11272 --11259
NM_003982chr141250 ------
NM_003994chr121658 --142 --
NM_004016chrX21758 944 --1949 --
NM_004018chrX21758 944 --1949 --
NM_004021chrX21758 944 --1949 --
NM_004022chrX21758 944 --1949 --
NM_004023chrX21758 944 --1949 --
NM_004028chr1821170 813 --14095 --
NM_004079chr152733 1856 1055 354 323 1886 ----
NM_004096chr1011803 --22026 382 --
NM_004097chr24912 885 815 178 --1182 --
NM_004100chr652440 2347 1981 1736 1065 ------
NM_004103chr81161 ----1858
NM_004124chr1423037 2840 --12558 --
NM_004136chr1512971 ----12891
NM_004161chr231416 534 286 11371 ----
NM_004171chr1179158 8599 8375 7682 6478 3783 1031 11982 --1682
NM_004209chr161976 ------
NM_004225chr831299 1016 564 ------
NM_004229chrX2741 30 ------
NM_004232chr181634 ------
NM_004236chr15192 ------
NM_004242chr6124 ------
NM_004280chr6----1321 --
NM_004293chr91551 --22695 189 --
NM_004321chr273207 2806 2750 2478 2415 955 244 --11206 --
NM_004323chr942233 983 303 212 --2635 534 --
NM_004342chr731662 628 509 ------
NM_004349chr811310 ------
NM_004374chr8--132 ----
NM_004380chr1622324 1867 ----1602
NM_004384chr51148 ------
NM_004397chr1143974 3936 2930 770 2590 168 ----
NM_004423chr332676 1881 1746 ------
NM_004426chr1251651 751 633 582 160 ------
NM_004432chr922295 378 ------
NM_004434chr1421258 422 ------
NM_004438chr232523 2260 2235 12758 ----
NM_004449chr2121056 119 ----1545
NM_004454chr32775 89 --2679 174 --
NM_004459chr17146 ------
NM_004486chr951118 772 489 441 324 142 ----
NM_004501chr143659 2701 670 141 --23347 1309 --
NM_004505chr1722007 1749 ------
NM_004514chr1731191 239 97 --11993 --
NM_004516chr19----1444 --
NM_004517chr11285 47 ------
NM_004529chr9168 ------
NM_004537chr12--1974 ----
NM_004566chr1031748 669 539 --21600 585 12585
NM_004588chr11113943 3910 3482 3281 3171 3130 2873 2584 1295 879 786 1493 ----
NM_004615chrX--1683 ----
NM_004622chr21446 ------
NM_004631chr12367 240 11051 ----
NM_004637chr341321 1213 524 478 ------
NM_004646chr1951037 967 453 317 144 ------
NM_004654chrY21371 495 --1521 --
NM_004655chr172168 62 ------
NM_004660chrY1929 ------
NM_004685chr1321064 853 --12367 --
NM_004690chr6--1560 ----
NM_004730chr51292 ------
NM_004733chr3------1137
NM_004736chr111484 1901 --1399
NM_004742chr321776 1176 11426 ----
NM_004788chr1132647 2555 2496 ------
NM_004796chr1431742 1688 893 ------
NM_004799chr11165 ------
NM_004800chr131225 ------
NM_004801chr231547 596 518 ------
NM_004815chr134824 3856 3822 ----14648
NM_004836chr21243 ----1657
NM_004849chr631619 1185 166 --11514 1376
NM_004850chr221725 1688 1199 1217 --
NM_004866chr534280 3504 655 11420 14537 --
NM_004871chr1753991 3165 2992 1437 158 1676 13376 --
NM_004896chr102321 77 ------
NM_004902chr201708 ------
NM_004904chr711551 ----22166 913
NM_004921chr11247 ------
NM_004937chr1741839 1665 365 105 --11844 --
NM_004947chr341809 1013 580 457 ----1585
NM_004956chr714528 ------
NM_004966chr10------1663
NM_004973chr631567 1493 483 --1278 --
NM_004976chr1174352 4033 3328 1655 1216 715 196 11561 ----
NM_004979chrX1913 21095 843 31154 858 402 --
NM_004985chr1214371 ------
NM_004992chrX77842 7606 7584 6459 3208 2919 815 26032 214 ----
NM_004992chrX77842 7606 7584 6459 3208 2919 815 26032 214 ----
NM_004998chr155628 621 614 359 159 --1674 --
NM_005010chr7------11439
NM_005022chr171191 ------
NM_005045chr71827 --1764 --
NM_005056chr1254238 3722 3664 3606 66 13446 25403 537 25232 118
NM_005057chr121475 1351 --11840 --
NM_005063chr1063217 2775 2752 1229 1013 702 12736 13031 --
NM_005065chr1434846 3747 861 12095 11076 --
NM_005116chr2064105 3750 1700 1393 1100 335 ------
NM_005121chr1713483 11114 ----
NM_005134chr181642 ------
NM_005151chr181710 ----1813
NM_005153chr16------1207
NM_005176chr12296 42 ------
NM_005178chr191395 ------
NM_005188chr1157422 7089 5060 1485 389 --17683 --
NM_005197chr1413914 --15844 21666 332
NM_005222chr71654 --1727 --
NM_005227chr1--1485 ----
NM_005235chr267367 7323 6767 6493 4877 927 --16723 1388
NM_005238chr1142918 1368 679 60 ------
NM_005241chr311122 1286 ----
NM_005243chr221312 ------
NM_005257chr182464 367 --1574 --
NM_005259chr221218 167 1584 ----
NM_005261chr8----1862 --
NM_005311chr742243 1130 1054 1006 2816 23 ----
NM_005313chr1521272 256 ------
NM_005324chr1732026 1913 851 ------
NM_005328chr8----1663 --
NM_005338chr773623 2605 705 624 555 487 237 ----13902
NM_005358chr1321523 50 ----11901
NM_005359chr1846034 2622 2289 796 1121 --15943
NM_005388chr921137 595 1668 ----
NM_005402chr721807 488 ------
NM_005406chr18------11549
NM_005417chr2061993 1241 541 319 307 46 1114 ----
NM_005433chr1822109 137 ------
NM_005436chr1033819 1057 647 12535 --1251
NM_005458chr94925 614 439 89 11508 2929 114 --
NM_005479chr103425 170 81 1575 ----
NM_005497chr1775642 5171 4403 2337 1830 597 155 11657 15469 --
NM_005502chr912810 ----128
NM_005542chr72390 111 ------
NM_005578chr313134 ----1320
NM_005595chr12319 198 ------
NM_005596chr946020 5190 1707 1140 1283 ----
NM_005602chr31180 1436 ----
NM_005604chr622495 900 ------
NM_005607chr8------1137
NM_005611chr1611012 ------
NM_005630chr341954 551 498 223 --1454 --
NM_005652chr1631102 782 408 1131 --1932
NM_005657chr151163 ------
NM_005665chr134033 3885 436 1541 1702 --
NM_005667chr21157 ------
NM_005686chr151183 518 472 235 226 ----1377
NM_005704chr14965 895 832 309 1813 ----
NM_005730chr1262904 1188 1140 1018 663 623 ------
NM_005748chr12--12717 --1236
NM_005766chr1341140 884 393 31 ------
NM_005782chr172230 60 --175 --
NM_005798chr1323954 244 1409 21661 1029 13536
NM_005806chr2111308 ------
NM_005822chr61103 ------
NM_005828chr1794466 3674 3492 3135 1998 1847 1498 326 217 --24088 1830 --
NM_005832chr31208 ------
NM_005839chr1--2850 119 ----
NM_005852chr1721145 315 --1251 --
NM_005863chr1021020 129 ------
NM_005871chr101122 ------
NM_005880chr1631180 533 390 ------
NM_005899chr1721480 1292 ------
NM_005901chr1848324 7686 3042 2715 ------
NM_005904chr1831028 530 130 ------
NM_005924chr711025 ------
NM_005927chr521153 321 ------
NM_005930chr141332 ------
NM_005933chr111539 --1129 --
NM_005955chr152053 781 658 446 244 ----25132 1892
NM_005964chr1731413 1097 320 1570 ----
NM_005966chr221757 1745 ------
NM_006007chr924030 978 13673 24297 4038 --
NM_006016chr641777 897 426 224 --11463 --
NM_006022chr132739 27 ----1921
NM_006040chr16----2475 225 --
NM_006047chr2023225 1260 --1145 --
NM_006080chr71431 ------
NM_006106chr1142719 1090 765 272 1527 12862 --
NM_006108chr112660 184 ----157
NM_006136chr71947 --1419 --
NM_006141chr1622134 901 ----12424
NM_006156chr141241 ------
NM_006158chr831699 1289 451 ----11795
NM_006159chr12------1596
NM_006162chr1831654 1392 296 1694 ----
NM_006186chr21364 ------
NM_006195chr91498 ------
NM_006203chr544584 4047 3687 3533 --11833 14683
NM_006206chr4186 --1103 --
NM_006209chr8139 ------
NM_006243chr11918 1749 ----
NM_006245chr65949 899 738 218 85 ------
NM_006252chr1117221 7111 7034 6947 6552 5566 5041 4862 2870 2277 1100 --24588 1036 16890
NM_006279chr12830 232 ------
NM_006292chr11126 ------
NM_006293chr151245 --160 --
NM_006306chrX65092 4915 3659 1996 1888 1541 24873 424 13877 --
NM_006311chr171245 ------
NM_006313chr12------1391
NM_006317chr51695 ------
NM_006321chr332065 246 40 --11606 --
NM_006323chr41663 ------
NM_006333chr21537 1673 ----
NM_006352chr131709 722 441 11358 ----
NM_006362chr11163 ------
NM_006372chr6141 ------
NM_006375chrX31849 1240 240 ------
NM_006379chr71283 --12101 --
NM_006380chr1763484 3411 3143 1711 1441 1018 189 --13212
NM_006386chr22--1416 --12181
NM_006389chr1151331 1194 1053 920 316 1104 1327 --
NM_006393chr1023862 587 23773 169 14424 --
NM_006401chr9144 ------
NM_006420chr20------1618
NM_006439chr41394 ------
NM_006459chr1041921 1822 1481 768 ------
NM_006469chr121488 1015 1591 ----
NM_006472chr111282 11274 ----
NM_006482chr1211124 21091 63 --13729
NM_006486chr222438 275 --1617 1215
NM_006489chr141374 --11445 --
NM_006496chr1------1714
NM_006509chr191366 ------
NM_006517chrX52171 1713 1569 761 556 ------
NM_006546chr1776084 5232 5092 5083 4050 1050 856 --34804 2579 701 15237
NM_006547chr711812 --1723 --
NM_006565chr1611155 11246 ----
NM_006572chr1713043 --11343 1167
NM_006575chr14--11031 ----
NM_006595chr111224 ------
NM_006599chr161835 1322 26875 3241 12697
NM_006601chr122889 169 1805 1426 --
NM_006603chrX1366 ------
NM_006609chr221123 457 ------
NM_006622chr52405 145 ----1471
NM_006624chr1022060 534 ------
NM_006650chr583896 3590 3211 2783 749 537 518 493 21343 1229 12597 --
NM_006654chr121330 --1276 --
NM_006717chr912246 ----13111
NM_006722chr322755 2252 ------
NM_006729chrX24838 4674 24779 87 25264 1491 1604
NM_006750chr1666985 6436 5915 5373 2158 1138 12006 25175 2432 --
NM_006751chr211032 --1961 --
NM_006766chr811937 ------
NM_006775chr622248 1071 --12463 12254
NM_006813chr63838 714 597 --1744 --
NM_006815chr1221363 521 ------
NM_006823chr83373 165 105 ----1207
NM_006868chr1832294 1978 1964 23066 2699 12517 12829
NM_006885chr1633246 1439 1245 --13029 13017
NM_006920chr211501 ------
NM_006922chr211662 ------
NM_006941chr223233 121 103 3942 214 113 ----
NM_006943chr2052919 2289 813 568 88 ----12965
NM_006965chr18--1996 ----
NM_006981chr932558 877 587 ------
NM_007005chr9------1581
NM_007011chr15105916 5757 5693 5561 2530 2335 915 659 396 275 12756 12200 --
NM_007017chr51740 ------
NM_007026chr171427 --190 --
NM_007030chr5114989 4270 4192 1674 1589 1199 1087 761 694 329 123 14580 --11813
NM_007039chr1411447 1176 --1813
NM_007040chr191411 ------
NM_007042chr332210 885 588 --1714 12672
NM_007050chr2088070 7708 7214 7204 5375 1856 1827 801 17130 ----
NM_007054chr533557 2856 1347 12686 --11552
NM_007073chr643890 3478 3462 1533 1612 21490 1214 --
NM_007108chr162537 57 --1175 --
NM_007126chr91447 ------
NM_007146chr1732646 2257 2149 --32658 400 152 --
NM_007157chrX12755 ------
NM_007170chr14691 678 308 155 ----1801
NM_007174chr121385 --1175 --
NM_007175chr853463 2682 2496 1167 285 11095 --12774
NM_007185chr111080 ------
NM_007212chr121886 340 ------
NM_007222chr8----11825 --
NM_007236chr1532405 977 922 22218 1520 12098 12492
NM_007249chr1323055 1666 169 47424 6540 1658 1172 --
NM_007275chr34880 200 167 93 ------
NM_007324chr11165 ------
NM_007345chr1842249 2229 1704 699 ----1577
NM_007350chr1224356 1785 11435 14345 1533
NM_007358chr111575 ------
NM_007375chr1122 1210 --1226
NM_012064chr124873 272 194 132 --1733 --
NM_012081chr543725 634 579 98 ------
NM_012089chr1--11456 ----
NM_012102chr122466 25 ------
NM_012153chr112705 252 11940 --1834
NM_012156chr2021123 220 12085 32153 1169 236 --
NM_012164chr922417 345 45918 4990 2780 2252 --11063
NM_012193chr1154956 4940 4136 3971 715 15176 23439 504 --
NM_012197chr941378 1259 1103 303 ------
NM_012199chr184149 4100 3772 3343 3058 1720 1589 594 13158 ----
NM_012207chr101288 ------
NM_012214chr255928 4081 1709 1625 1438 12581 11676 16234
NM_012215chr103486 330 173 --31802 1291 1287 --
NM_012224chr411072 1351 ----
NM_012232chr1721504 251 --2561 82 12068
NM_012244chr1421590 646 --11299 11148
NM_012249chr223061 870 ------
NM_012250chr1111063 ------
NM_012285chr171115 ------
NM_012288chr664558 1955 1535 957 470 334 14140 2714 297 --
NM_012290chr21350 ------
NM_012295chr221407 ------
NM_012300chr541917 1853 898 872 ------
NM_012306chr1283369 3218 3162 2837 2460 1281 874 526 32859 903 258 --13274
NM_012308chr1112007 21867 707 ----
NM_012309chr1111271 --44413 3887 1745 163 --
NM_012316chr1115114 4971 4791 4432 3841 2189 1560 933 913 669 262 --14567 --
NM_012333chr11297 --11470 --
NM_012383chr9----1342 --
NM_012419chr62613 34 ------
NM_012421chr1177 --1160 --
NM_012428chr15----1904 --
NM_012479chr722045 760 12089 ----
NM_013229chr1221083 139 2917 619 1302 --
NM_013230chrY------11824
NM_013231chr1423549 1245 24304 827 ----
NM_013236chr22--1424 ----
NM_013245chr16140 --1479 --
NM_013253chr1131154 261 80 ------
NM_013261chr413435 ----13618
NM_013269chr1221428 663 1816 1276 --
NM_013281chr20------2459 451
NM_013302chr1694360 4210 3172 3132 3100 3046 1320 929 500 33876 705 335 --12886
NM_013341chr222321 492 11877 ----
NM_013354chr8------171
NM_013363chr3----1130 --
NM_013374chr321068 321 ------
NM_013376chr19121 ----152
NM_013382chr1442167 1658 879 646 --11894 --
NM_013433chr1951838 1695 805 605 454 --2799 94 --
NM_013436chr21158 --1179 --
NM_013438chr911275 --11399 --
NM_013986chr221312 ------
NM_014011chr22891 262 ------
NM_014028chr612254 12124 --12637
NM_014089chr1321871 686 ------
NM_014106chr152288 259 --12868 --
NM_014110chr1--2337 164 ----
NM_014112chr825084 3873 ----14914
NM_014117chr1621997 133 ----22691 2635
NM_014141chr725033 3347 23864 1601 11840 24407 267
NM_014190chr42659 510 11373 --2629 208
NM_014213chr21160 ------
NM_014217chr121401 1244 ------
NM_014240chr343853 3719 3145 520 13304 12950 --
NM_014253chrX12394 --1611 --
NM_014293chr2263914 3095 1465 1347 810 117 --12865 --
NM_014309chr2274846 4779 4671 4280 4184 1462 511 ----1523
NM_014316chr1651421 798 739 684 520 1699 1272 --
NM_014319chr1231356 757 287 1497 ----
NM_014323chr2211029 ------
NM_014333chr1122530 971 ------
NM_014338chr222112 23 1249 ----
NM_014363chr1311117 ----1834
NM_014372chr13792 570 133 ------
NM_014382chr321506 660 11538 ----
NM_014415chr311547 --11494 --
NM_014417chr191237 ----1741
NM_014423chr512073 11065 ----
NM_014431chr1021532 640 --31568 221 73 11371
NM_014447chr421264 254 ------
NM_014456chr1031611 1433 415 ----1571
NM_014480chr192646 609 ------
NM_014494chr1631646 1594 371 ------
NM_014515chr122973 50 ------
NM_014562chr21754 ----1760
NM_014574chr14--1468 ----
NM_014575chr3154 ------
NM_014586chr2134516 3941 3120 12953 11650 --
NM_014602chr31317 ----1307
NM_014607chr2--1146 ----
NM_014614chr21415 11267 ----
NM_014616chr323402 1203 ------
NM_014623chr6173 ------
NM_014659chr15--11162 1293 --
NM_014661chr1093704 3450 2968 1522 1371 1054 860 772 26 --21439 833 1730
NM_014663chr15849 359 302 253 233 ----1295
NM_014665chr883008 2685 2505 1121 556 497 276 266 3509 399 232 1208 --
NM_014670chr221195 153 ------
NM_014671chr72449 416 ------
NM_014676chr12344 111 ------
NM_014686chr1932466 2072 153 11620 --1551
NM_014689chr2--1211 ----
NM_014690chr751028 798 455 243 50 ----1514
NM_014705chr722119 1413 ----1204
NM_014713chr21486 ------
NM_014720chr1041682 1409 1183 714 11760 ----
NM_014721chr612767 --32154 1875 145 --
NM_014729chr811727 11414 11747 --
NM_014730chr1235151 4978 2101 11600 1222 --
NM_014730chr1235151 4978 2101 11600 1222 --
NM_014731chr2021131 620 1671 1550 --
NM_014735chrX1533 --1853 --
NM_014743chr453085 2312 2292 957 933 ------
NM_014746chr222747 1554 2994 134 --14399
NM_014755chr294191 3812 3334 2955 2604 1445 962 520 456 ------
NM_014756chr111102 ------
NM_014772chr1843486 3465 2267 965 21402 415 13392 11347
NM_014774chr122917 2851 ------
NM_014776chr1211134 11170 --22974 338
NM_014779chr31105 ------
NM_014787chr112116 ------
NM_014810chr123279 726 ------
NM_014819chr522437 2087 ------
NM_014820chr321865 167 ------
NM_014828chr142745 115 2958 294 12154 --
NM_014836chr10----21961 1948 --
NM_014839chr121894 568 --11580 --
NM_014840chr124508 444 90 72 12454 12186 11110
NM_014841chr611258 ------
NM_014850chr344753 4173 962 159 13784 34669 4139 1189 --
NM_014873chr154749 4171 4145 1412 450 ------
NM_014901chr53707 554 541 2616 486 11902 --
NM_014904chr1011082 --1369 --
NM_014921chr1962882 2452 2408 2302 2043 25 22616 594 2578 97 11988
NM_014924chr1432074 1048 685 ----1407
NM_014925chr12--159 1214 --
NM_014934chr1352902 2819 1133 755 562 11398 ----
NM_014935chr163434 2388 1030 1005 665 151 --41521 1275 329 24 --
NM_014939chr18196 ------
NM_014944chr121302 951 11107 ----
NM_014961chr422223 1970 ------
NM_014964chr1721942 457 --22394 1983 1735
NM_014982chr1414919 --14361 --
NM_014991chr41386 ------
NM_015000chr1222832 170 --11005 --
NM_015002chr121133 ----1382
NM_015005chr1431714 1564 1125 11263 ----
NM_015008chr342878 2679 1239 1055 ------
NM_015020chr1643404 1280 479 318 2442 152 ----
NM_015025chr232066 1816 791 --1434 --
NM_015032chr1312717 179 ----
NM_015039chr144139 2669 1374 1209 --13280 --
NM_015045chr1032036 1418 544 ------
NM_015051chr932931 1220 499 --12545 13397
NM_015055chr1142438 1824 858 273 ------
NM_015064chr1263445 2864 2348 1389 1314 760 11173 ----
NM_015068chr722509 1595 ----11022
NM_015071chr546488 5913 5040 393 21386 425 ----
NM_015076chr623397 2947 13412 11351 14537
NM_015077chr17134693 4252 3821 3517 3291 3192 2974 2904 1594 1347 1235 633 90 23655 2996 24400 2944 --
NM_015080chr114330 272 214 104 ------
NM_015092chr1643377 1694 509 503 --11514 --
NM_015094chr2294003 3747 3730 3295 3181 2936 1759 685 275 ------
NM_015100chr121806 1263 ------
NM_015101chr122198 817 32183 312 213 12168 --
NM_015107chrX42048 838 832 826 12186 1845 --
NM_015110chr922111 138 11945 --1212
NM_015113chr173936 928 437 1174 --12331
NM_015120chr2------185
NM_015138chr1512267 191 --1969
NM_015144chr1643400 3178 908 261 --23569 233 --
NM_015149chr1148 21832 570 22216 1909 --
NM_015156chr1431349 1256 756 ------
NM_015157chr1151148 1132 880 360 211 ------
NM_015185chrX52858 2459 1091 996 238 ------
NM_015200chr411632 12496 ----
NM_015206chr1513852 ------
NM_015235chr1031649 413 24 --1866 --
NM_015264chr2274852 4358 2986 1812 1385 820 571 --24272 1430 --
NM_015265chr242683 2110 2036 1682 ------
NM_015277chr1841748 1179 713 25 --21718 215 11846
NM_015299chr1493832 3634 3545 3343 1441 813 698 380 22 ------
NM_015315chr522408 2402 13398 ----
NM_015317chr211120 ------
NM_015321chr19124754 4680 4365 3617 3362 1812 1679 1509 1152 1143 945 220 ------
NM_015328chr732517 642 229 12268 11051 --
NM_015335chr12----2547 291 --
NM_015339chr201106 ------
NM_015344chr81290 11779 --11758
NM_015358chr21146 ------
NM_015393chr463281 1017 507 213 154 125 12615 ----
NM_015423chr1111482 ------
NM_015435chr8------157
NM_015443chr1711151 11292 1471 --
NM_015455chr524121 3966 --1823 --
NM_015462chr171247 ------
NM_015493chr193889 572 267 --11782 --
NM_015503chr161680 --1174 1193
NM_015511chr201424 --11110 1245
NM_015520chr321966 1851 ------
NM_015535chr241219 1087 751 111 13700 12641 1278
NM_015549chr142580 230 ------
NM_015553chr655076 4229 3544 3532 808 14080 --25210 4130
NM_015569chr154338 4119 3275 907 824 ------
NM_015575chr293352 2916 2899 2891 2791 2677 2445 589 261 21420 1146 12587 --
NM_015578chr1911439 --11443 --
NM_015635chr922209 1992 21550 86 --12145
NM_015642chr31274 ------
NM_015652chr101218 ------
NM_015678chr13--1626 ----
NM_015702chr2151 ------
NM_015726chr151730 1186 688 351 28 ----11480
NM_015840chr122643 2580 ------
NM_015841chr122643 2580 ------
NM_015879chr1847589 2017 930 30 16570 16172 --
NM_015881chr1131154 261 80 ------
NM_015981chr553096 2643 358 341 237 --12573 12310
NM_015982chr172306 271 ------
NM_015993chr163767 520 180 133 ----
NM_015995chr1594873 4227 3991 3985 3766 2073 2048 1733 1389 15052 51838 746 545 407 403 21454 613
NM_016070chr17------151
NM_016073chr152225 58 ------
NM_016097chr18--11024 194 --
NM_016107chr531100 263 53 ------
NM_016131chr231803 1639 623 ------
NM_016132chr1522614 427 --12755 --
NM_016206chr368773 8434 2663 2479 1752 807 17432 16690 --
NM_016217chr623621 1359 --12533 --
NM_016231chr172506 189 ------
NM_016248chr1343782 2800 2470 451 --23131 352 --
NM_016257chr132927 2367 649 --173 12465
NM_016258chr11262 ------
NM_016260chr245823 5761 4748 2312 ------
NM_016282chr911236 --1323 --
NM_016315chr2------11849
NM_016322chr932711 2113 1079 --12345 --
NM_016353chr8----12511 2681 116
NM_016376chr1743622 455 419 381 12837 ----
NM_016418chr2273496 3039 2629 2460 888 743 724 12875 52811 2582 688 652 158 --
NM_016424chr17--1359 ----
NM_016441chr22887 433 ------
NM_016447chr71173 ------
NM_016454chr15----1350 --
NM_016530chr1543594 2598 1104 843 --1943 --
NM_016577chr374409 4238 3232 1206 732 221 159 11558 --1554
NM_016603chr522024 127 --174 --
NM_016604chr521287 171 ------
NM_016605chr572722 2527 2475 1962 889 383 78 --12430 --
NM_016607chrX--11472 11639 --
NM_016621chr1143515 1822 1666 1095 13888 --1547
NM_016628chr101859 ------
NM_016931chr111333 ----1368
NM_017413chrX51978 1024 1018 505 177 ------
NM_017455chr15----1904 --
NM_017522chr12367 240 11051 ----
NM_017548chr31330 11802 ----
NM_017580chr1032121 1668 291 ------
NM_017582chr111646 1720 --11749
NM_017583chr1131805 281 202 ------
NM_017590chr2262400 1706 925 899 553 344 1790 3816 275 255 --
NM_017596chr194600 4008 3986 3904 3340 3240 3017 1074 790 ------
NM_017629chr131329 638 261 --11619 --
NM_017633chr623715 3334 ------
NM_017635chr111560 ------
NM_017637chr979325 8789 7014 6978 5888 1372 576 ----13500
NM_017641chr12------1256
NM_017643chr17----1721 --
NM_017644chr345210 4620 909 219 33711 1633 417 14196 13327
NM_017651chr62523 401 ------
NM_017658chr142321 170 --13713 14008
NM_017661chr1521065 294 --1459 --
NM_017684chr1511254 1448 --11424
NM_017709chr133415 2845 304 ----2889 623
NM_017714chr20178 ------
NM_017719chr3----32494 2036 1025 --
NM_017741chr422111 216 1352 11927 --
NM_017744chr152407 2137 2091 1843 1617 21633 284 ----
NM_017752chrX2689 437 ------
NM_017753chr9----1279 --
NM_017769chr1442273 1002 666 271 ------
NM_017778chr821243 1042 1977 --11117
NM_017779chr1------12110
NM_017786chr81496 ------
NM_017798chr202867 101 ------
NM_017801chr332518 700 287 ------
NM_017811chr962662 2433 2327 1229 768 578 --1882 --
NM_017813chr875645 5632 5051 2153 1051 1036 754 31986 1148 364 12299 --
NM_017824chr10------22729 2578
NM_017848chrX23717 3107 ------
NM_017849chr242488 2179 999 448 12319 11017 1630
NM_017851chr152847 91 ------
NM_017902chr1055766 5260 4568 3876 283 --25611 2101 11214
NM_017913chr9----1330 --
NM_017925chr92592 464 21938 1392 ----
NM_017938chrX3805 580 307 2383 187 ----
NM_017944chr1132794 2394 93 ------
NM_017983chr172422 182 ----1430
NM_017998chr921290 914 --131 --
NM_018003chr1531713 1578 368 1326 1460 --
NM_018030chr181279 ------
NM_018045chr113028 1680 ----
NM_018061chr131387 400 300 ------
NM_018064chr61317 ------
NM_018067chr11499 ------
NM_018084chr222432 2135 ------
NM_018092chr161282 ------
NM_018116chr11521 ------
NM_018149chr172215 62 ------
NM_018157chr1222757 1264 ----1293
NM_018159chrX31064 345 179 ------
NM_018184chr31790 ------
NM_018193chr151478 --1184 --
NM_018247chr621084 635 ----21189 686
NM_018270chr203872 635 297 --165 --
NM_018293chr321010 383 ------
NM_018312chr112506 313 ------
NM_018313chr322437 259 ------
NM_018315chr4----1436 --
NM_018339chr91554 ------
NM_018340chr1663971 3399 1710 1575 1343 772 13804 ----
NM_018362chr1123208 72 12715 --11560
NM_018371chr82588 63 ------
NM_018375chr1411904 ------
NM_018403chr353466 2928 730 724 433 ------
NM_018424chr91544 ------
NM_018429chr51114 --12744 11795
NM_018440chr897197 7170 6320 6182 2643 1993 1435 548 121 --15854 11587
NM_018442chr11391 ------
NM_018444chr832350 2083 1551 ------
NM_018445chr151109 ------
NM_018452chr6_random43051 2990 2591 2448 ------
NM_018509chr1721637 117 --11654 --
NM_018557chr221427 334 ------
NM_018566chr124034 281 123 ----
NM_018569chr411615 ------
NM_018602chr152541 161 ------
NM_018660chr832868 1142 725 --1473 --
NM_018682chr71708 ------
NM_018691chr5----1371 --
NM_018700chr521408 1364 --11593 --
NM_018718chr71885 ------
NM_018844chr741694 1304 835 267 ------
NM_018847chr91446 11848 11351 --
NM_018898chr51657 1365 1451 --
NM_018899chr51657 1365 1451 --
NM_018900chr51657 1365 1451 --
NM_018901chr51657 1365 1451 --
NM_018902chr51657 1365 1451 --
NM_018903chr51657 1365 1451 --
NM_018904chr51657 1365 1451 --
NM_018905chr51657 1365 1451 --
NM_018906chr51657 1365 1451 --
NM_018907chr51657 1365 1451 --
NM_018908chr51657 1365 1451 --
NM_018909chr51657 1365 1451 --
NM_018910chr51657 1365 1451 --
NM_018911chr51657 1365 1451 --
NM_018912chr521497 404 1190 ----
NM_018913chr521497 404 1190 ----
NM_018914chr521497 404 1190 ----
NM_018915chr521497 404 1190 ----
NM_018916chr521497 404 1190 ----
NM_018917chr521497 404 1190 ----
NM_018918chr521497 404 1190 ----
NM_018919chr521497 404 1190 ----
NM_018920chr521497 404 1190 ----
NM_018921chr521497 404 1190 ----
NM_018922chr521497 404 1190 ----
NM_018923chr521497 404 1190 ----
NM_018924chr521497 404 1190 ----
NM_018925chr521497 404 1190 ----
NM_018926chr521497 404 1190 ----
NM_018927chr521497 404 1190 ----
NM_018928chr521497 404 1190 ----
NM_018929chr521497 404 1190 ----
NM_018970chr713108 12454 --12912
NM_018999chr1023703 1090 11949 --1899
NM_019001chr334174 3603 3389 ------
NM_019005chr7--1234 --1272
NM_019006chr151450 --1187 --
NM_019027chr42932 572 ----11709
NM_019036chr61785 ----1981
NM_019046chr102708 254 ------
NM_019063chr212169 ------
NM_019072chr513628 11538 1434 --
NM_019095chr201167 ------
NM_019116chr1673524 3475 1376 1280 881 824 409 ------
NM_019556chrX1459 ------
NM_019610chr132085 1803 420 ------
NM_019613chr175337 245 216 138 58 196 ----
NM_019857chrX------11789
NM_019885chr232158 180 49 1924 22315 2311 --
NM_020062chr202148 96 21025 68 ----
NM_020116chr41121 ------
NM_020122chr254876 3957 3670 1741 795 --14679 --
NM_020144chr7--21871 225 ----
NM_020182chr2083382 3148 2694 2566 2458 1143 1076 23 12404 12883 --
NM_020205chr131387 970 163 22175 184 --1123
NM_020211chr1531442 634 61 1291 ----
NM_020239chr122038 497 1157 --11637
NM_020240chr532776 730 518 ----11031
NM_020245chr654255 3708 1955 286 177 --24374 1332 --
NM_020248chr162206 463 402 225 161 71 11624 32259 2121 433 --
NM_020310chr1742723 1804 774 750 --22375 553 --
NM_020311chr21182 ----1561
NM_020337chr411056 11233 ----
NM_020341chr2011519 ------
NM_020346chr1131391 418 235 ------
NM_020381chr631818 1351 58 1577 ----
NM_020390chr331131 711 624 1964 ----
NM_020403chr131617 ------
NM_020443chr156317 5779 2666 2349 1901 24693 1919 12477 1504
NM_020449chrX1794 ----1236
NM_020456chr1321841 1425 --1657 --
NM_020465chr1631934 1748 1347 ------
NM_020473chrX11374 --1675 --
NM_020640chr321504 124 12235 --182
NM_020648chr1842851 982 915 74 ------
NM_020651chr211132 ------
NM_020689chr201297 ----11567
NM_020717chrX54862 3210 1915 554 449 --13308 --
NM_020718chr1635353 1974 600 16390 ----
NM_020724chr442585 1956 871 862 ----1814
NM_020728chr723058 2790 ------
NM_020734chr1212276 --13250 --
NM_020766chrX33671 1138 85 --14096 13360
NM_020772chr1737678 6680 2183 12394 ----
NM_020783chr1831902 631 498 ----1652
NM_020794chr131381 1122 220 ------
NM_020796chr542354 2263 1848 1219 ------
NM_020800chr3176 ------
NM_020801chr542522 925 567 58 ----11769
NM_020809chr112745 657 ------
NM_020810chr1433527 894 822 ----1508
NM_020814chr261302 1150 1037 550 324 156 1256 ----
NM_020819chr62465 187 ------
NM_020821chr1511254 1448 --11424
NM_020830chr242415 2336 2152 405 ------
NM_020831chr2251007 957 373 93 35 ------
NM_020850chr1633096 2992 2212 22684 51 42860 2304 235 27 --
NM_020856chr1921522 1245 1131 ----
NM_020861chr621118 416 ------
NM_020888chr161416 1385 1276 599 413 287 ----11707
NM_020898chr121317 ----1229
NM_020899chr1712068 --1712 --
NM_020917chr1952873 1534 660 606 492 ----22852 615
NM_020924chr92465 413 ------
NM_020940chr101808 ------
NM_020948chr123188 63 ------
NM_020956chr19214711 3935 3635 3468 3410 3361 3355 3147 3132 3126 3060 3051 1895 1817 1739 1661 917 878 870 827 409 23942 2961 13336 --
NM_020962chr1531951 658 268 --2467 137 --
NM_020977chr4----12231 11521
NM_021033chr1322356 1003 ------
NM_021061chr853210 3050 1647 849 524 24192 1482 14147 13178
NM_021097chr222840 258 11957 ----
NM_021120chrX52735 1939 1180 1149 693 ------
NM_021140chrX1318 ----1103
NM_021141chr21233 ------
NM_021145chr741130 382 218 184 ------
NM_021155chr1953017 781 535 391 107 2615 415 ----
NM_021190chr12893 361 ------
NM_021202chr2032159 1108 419 2815 74 --12946
NM_021222chr111094 ----1569
NM_021238chr1241868 620 370 287 1123 1641 --
NM_021239chr141173 ------
NM_021249chr1421200 319 --11469 --
NM_021253chr611433 1175 ----
NM_021622chr10----1422 12375
NM_021627chr31898 --1870 --
NM_021643chr211245 --190 --
NM_021644chr101288 ------
NM_021647chr444360 1059 585 260 13381 ----
NM_021649chr5--11223 125 --
NM_021705chr621503 589 ------
NM_021728chr14--151 --2755 392
NM_021809chr2062400 2339 2264 1591 699 322 ------
NM_021813chr654759 2349 1889 1723 1522 15425 11954 --
NM_021825chr11126 ----1349
NM_021943chr631350 1344 162 --3835 526 189 1173
NM_021946chrX31432 1210 218 ------
NM_021956chr611419 --1275 --
NM_021964chr325944 995 ------
NM_021976chr63935 687 205 ------
NM_021988chr20------11008
NM_021998chrX11424 --1306 --
NM_022048chr1546216 4540 1403 432 1478 36221 1877 263 --
NM_022062chr1141529 1351 1314 741 ------
NM_022103chr1931210 410 289 --2868 245 --
NM_022133chr821427 1386 ------
NM_022143chr731148 635 119 1292 ----
NM_022166chr1625405 2096 1707 34943 602 246 1411
NM_022351chr823513 561 ------
NM_022442chr20------11008
NM_022456chr1247075 5314 2937 1343 11426 16667 24781 53
NM_022465chr12------13069
NM_022469chr11140 --23025 476 12764
NM_022484chr721051 561 ------
NM_022497chr373593 2603 2571 1008 964 442 23 12610 31523 600 417 --
NM_022650chr51743 ------
NM_022719chr2263196 3043 3004 2909 1133 809 11228 32894 2597 1456 --
NM_022735chr131852 1430 326 ------
NM_022755chr941662 992 796 90 21725 49 2853 777 --
NM_022756chr131253 1123 1059 11432 1312 --
NM_022758chr653124 2876 1305 1294 1101 --11254 --
NM_022763chr311131 ----12361
NM_022768chr1------154
NM_022780chr21701 --1649 --
NM_022831chr11433 ------
NM_022832chr472054 1889 890 881 598 292 129 --1608 --
NM_022841chr151881 ----11951
NM_022845chr1641717 907 851 691 ------
NM_022893chr232539 1233 1169 ------
NM_022898chr143954 917 179 ----11762
NM_022900chr71154 ------
NM_022910chr1631934 1748 1347 ------
NM_022912chr2--13038 11868 --
NM_022917chr91899 ----1122
NM_022918chr1131986 1647 1431 ------
NM_023000chr1411161 1132 ----
NM_023001chr1411161 1132 ----
NM_023034chr81185 ------
NM_023071chr123874 741 230 ------
NM_023076chr1652608 1131 728 145 111 --42674 2570 2460 959 12588
NM_023079chr1741582 1474 1199 447 ------
NM_023927chr5----1977 21193 557
NM_023929chr81205 ------
NM_024007chr511172 ------
NM_024061chr71166 ------
NM_024090chr41153 --11216 11257
NM_024092chr1121217 771 ------
NM_024294chr653124 2876 1305 1294 1101 --11254 --
NM_024324chr221158 ------
NM_024328chr142456 170 ------
NM_024345chr945160 1720 1187 468 21499 1270 ----
NM_024420chr11172 --1114 --
NM_024496chr141252 ------
NM_024524chr322905 1032 ----12088
NM_024546chr131262 --11026 --
NM_024548chr321625 1419 ------
NM_024556chr11--1124 ----
NM_024565chr521129 541 ------
NM_024595chr151155 974 423 171 48 ------
NM_024613chr8--11311 ----
NM_024659chr21121 1350 ----
NM_024665chr313806 ------
NM_024702chr171213 ------
NM_024704chr201312 1237 1455 1845
NM_024721chr822310 1637 ----1199
NM_024725chr111864 ------
NM_024742chr1661772 1733 1647 1521 1309 685 11423 ----
NM_024745chr163903 872 730 ------
NM_024770chr265924 2676 2094 1203 706 688 11461 ----
NM_024811chr1121314 356 21950 644 ----
NM_024814chr71400 ------
NM_024884chr1494388 4118 3736 1664 1134 724 495 347 220 1571 11690 --
NM_024885chrX1706 1292 ----
NM_024899chr181543 1188 ----
NM_024947chr357345 7141 1231 877 725 28263 7396 ----
NM_024949chr434383 3291 3053 14739 --13925
NM_024953chr1211018 --180 --
NM_024989chr242388 1254 888 833 12223 12874 18224
NM_025054chr821282 189 --161 11228
NM_025073chr144183 4070 3584 155 13907 11868 123
NM_025106chr14687 585 450 146 --11912 --
NM_025134chr1612252 ------
NM_025138chr131154 1311 ----
NM_025164chr1141499 811 708 46 --11493 --
NM_025179chr134777 3698 1951 --23872 749 --
NM_025187chr165875 497 452 165 146 ------
NM_025195chr831809 1759 197 ------
NM_025211chr91207 ------
NM_025222chr363067 2663 2587 2432 2254 635 2742 104 ----
NM_025250chr782947 2894 2703 2490 2195 841 828 412 32120 1067 935 12278 --
NM_030594chr151886 ------
NM_030621chr1423620 2682 --2596 132 --
NM_030625chr101584 ------
NM_030627chr511104 1641 --13881
NM_030628chr11133 ------
NM_030634chr132399 2354 389 ------
NM_030647chr745183 2289 1699 688 --15985 --
NM_030648chr434592 2165 430 11393 ----
NM_030661chr751160 1072 216 204 61 ------
NM_030674chr1244161 4103 689 142 ------
NM_030761chr14262 248 211 97 22606 2252 22102 2011 11809
NM_030780chr81219 21268 539 ----
NM_030806chr1107957 7321 6821 6491 3193 2910 2753 2745 1776 515 37891 6897 918 26301 2383 --
NM_030816chr113156 ------
NM_030881chr22--1416 --12181
NM_030884chr332038 1531 112 1825 1438 --
NM_030915chr262106 1839 1542 938 631 502 --12176 --
NM_030920chr12729 505 ------
NM_030939chr611191 ------
NM_030945chr54672 612 435 118 ----12016
NM_030958chr8--1163 --137
NM_030964chr552928 2563 1139 1014 102 --12760 12796
NM_030965chr11624 ------
NM_031243chr742400 2294 1709 1506 ----11563
NM_031309chr821995 1540 ----11932
NM_031369chr41567 ------
NM_031370chr41567 ------
NM_031411chr51657 1365 1451 --
NM_031418chr111477 --1429 12663
NM_031426chr932223 1880 249 --12031 --
NM_031442chrX2447 145 12293 ----
NM_031445chr223381 2327 1361 ----
NM_031452chr152394 170 ------
NM_031468chr786356 3076 3056 2776 2287 930 457 147 26101 2919 11979 --
NM_031483chr2033537 3213 2964 12436 ----
NM_031844chr143659 2701 670 141 --23347 1309 --
NM_031845chr212952 23014 3004 33623 3184 622 --
NM_031847chr212952 23014 3004 33623 3184 622 --
NM_031849chr51657 1365 1451 --
NM_031857chr51657 1365 1451 --
NM_031858chr1721480 1292 ------
NM_031860chr51657 1365 1451 --
NM_031862chr1721480 1292 ------
NM_031936chr17727 530 495 192 103 97 35 ------
NM_031938chr112760 690 ------
NM_032012chr931609 1465 1310 --24083 687 1783
NM_032047chr322311 742 ----11897
NM_032050chr2211029 ------
NM_032051chr22125 1621 ----
NM_032052chr2221414 354 ------
NM_032088chr521497 404 1190 ----
NM_032092chr521497 404 1190 ----
NM_032102chr1132573 2195 716 --13076 --
NM_032109chr511163 ----1960
NM_032121chrX42816 1125 852 710 1686 12311 --
NM_032144chr221804 1165 ------
NM_032153chr3--1555 --12523
NM_032154chr102727 344 ------
NM_032160chr1853821 3364 1582 1456 699 13656 11714 --
NM_032174chr12392 246 1407 --1282
NM_032182chr101614 ------
NM_032195chr21189 ------
NM_032199chr1033558 3482 708 --22692 199 13522
NM_032208chr21124 --1780 13324
NM_032217chr4----1289 11407
NM_032221chr20------1552
NM_032268chr1633210 2422 2082 --53135 3131 3127 2929 550 13140
NM_032271chr1641133 440 368 63 ----1343
NM_032283chr131304 424 162 11612 ----
NM_032288chr332153 407 224 ------
NM_032373chr1035592 4496 4070 11624 12091 11817
NM_032376chr172666 490 ------
NM_032403chr521497 404 1190 ----
NM_032410chr811122 --2828 497 --
NM_032424chr1131414 479 75 --11189 11491
NM_032430chr191286 ------
NM_032440chr1012584 ----12931
NM_032441chrX--129 ----
NM_032445chr151426 ------
NM_032446chr523761 151 ----1272
NM_032452chr14287 33 --21221 473 --
NM_032457chr413050 11577 21074 429 --
NM_032458chrX32461 2348 509 --12365 --
NM_032521chr2021195 323 32885 1281 918 ----
NM_032582chr1711761 ------
NM_032590chr121441 ------
NM_032682chr322599 1407 ------
NM_032711chr17104089 3522 3160 1458 1314 964 627 417 162 61 ------
NM_032784chr61207 ------
NM_032818chr942363 2147 2027 893 --11848 --
NM_032846chr1411444 --2396 86 --
NM_032873chr1111112 --24472 3068 23092 569
NM_032875chr171607 ------
NM_032876chr14----1597 --
NM_032905chr103220 92 57 ------
NM_032975chr1853248 3206 2967 2936 2473 1361 ----
NM_032980chr1853248 3206 2967 2936 2473 1361 ----
NM_032995chr231723 1237 634 --1100 --
NM_033029chr31303 ------
NM_033036chr1151556 1461 518 310 245 2208 175 --1634
NM_033055chr11382 ------
NM_033058chr8----1151 196
NM_033119chr161821 ------
NM_033132chr131267 --11524 --
NM_033133chr17102801 2408 2321 1442 1306 992 839 656 422 255 1832 31476 1029 806 --
NM_033136chr52456 271 127 2409 242 --
NM_033137chr52456 271 127 2409 242 --
NM_033138chr731662 628 509 ------
NM_033139chr731662 628 509 ------
NM_033140chr731662 628 509 ------
NM_033157chr731662 628 509 ------
NM_033201chr16--1107 ----
NM_033207chr1022486 141 22496 48 ----
NM_033211chr52639 334 11593 ----
NM_033224chr786922 6805 6344 5254 5133 4960 1026 889 27840 6635 11851 22511 1032
NM_033285chr8122 --12909 1523
NM_033300chr12367 240 11051 ----
NM_033326chr1122505 2184 --11702 --
NM_033331chr932871 1271 785 --1293 13451
NM_033338chr1021353 311 ------
NM_033339chr1021353 311 ------
NM_033340chr1021469 427 ------
NM_033360chr1214492 ------
NM_033389chr1744770 3890 3726 1342 11565 ----
NM_033407chr11467 ------
NM_033425chr1183138 2847 2662 2427 1021 400 324 49 ------
NM_033503chr1553482 2622 641 528 237 13376 12466 --
NM_033505chr256332 6019 5192 2042 1575 --1217 --
NM_033512chr832986 908 887 --148 --
NM_033551chr522408 2402 13398 ----
NM_033624chr121133 ----1382
NM_033631chr153358 3098 2982 2931 2692 22654 592 12683 2801 114
NM_033632chr4----1436 --
NM_033637chr1033752 3598 980 12737 ----
NM_033644chr541917 1853 898 872 ------
NM_033645chr541917 1853 898 872 ------
NM_052811chr1323954 244 1409 21661 1029 13536
NM_052879chr1213385 --1511 11326
NM_052882chr192523 40 ------
NM_052886chr832104 614 328 ----11455
NM_052900chr82641 205 ------
NM_052906chr22154825 4819 4733 4453 4227 4101 3803 3660 3516 1663 1330 1318 696 310 42 --24469 4417 --
NM_052911chr182126 56 ------
NM_052913chr63151 126 81 ------
NM_052918chr1023655 573 ------
NM_052965chr12111 92 ----11217
NM_053002chr311048 ------
NM_053016chr967812 6818 6270 6021 5175 977 --12322 --
NM_053023chr1143020 2806 914 491 23206 989 ----
NM_053025chr31135 ------
NM_053026chr31135 ------
NM_053027chr31135 ------
NM_053028chr31135 ------
NM_053031chr31135 ------
NM_053032chr31135 ------
NM_053043chr756105 5703 1786 569 405 1194 --14662
NM_053053chr11969 186 ----
NM_053056chr1173092 3073 2999 2892 2781 2306 135 ----1656
NM_054016chr12666 489 --1288 --
NM_054016chr12666 489 --1288 --
NM_054016chr12666 489 --1288 --
NM_054027chr532188 622 289 ----1694
NM_057169chr1211134 11170 --22974 338
NM_057170chr1211134 11170 --22974 338
NM_057175chr41474 ------
NM_058172chr411684 --21806 1469 11811
NM_058241chr221995 758 --1276 --
NM_058241chr221995 758 --1276 --
NM_078470chr1042552 2533 1833 815 1649 ----
NM_078471chr1741253 918 839 46 ------
NM_078485chr62740 22 ------
NM_078487chr923061 2329 1206 ----
NM_080591chr9102885 2837 2815 2399 2390 1222 671 468 122 72 --3842 421 292 --
NM_080597chr181279 ------
NM_080669chr17114981 4445 4256 4074 3844 3351 1791 1655 715 540 360 11299 11048 2980 584
NM_080679chr62629 166 --1798 1771
NM_080680chr62629 166 --1798 1771
NM_080681chr62629 166 --1798 1771
NM_080738chr121609 583 --11348 --
NM_080742chr61185 ------
NM_080927chr322578 112 ------
NM_100264chr101859 ------
NM_100486chr101859 ------
NM_130436chr2122328 1713 11837 11983 11047
NM_130438chr2142905 2290 516 344 12414 12560 --
NM_130811chr202955 444 ----1845
NM_130830chr373754 3732 3191 2895 2741 2631 24 22882 2516 22809 1286 --
NM_130838chr151363 1193 ----
NM_130839chr151363 1193 ----
NM_133170chr2088070 7708 7214 7204 5375 1856 1827 801 17130 ----
NM_133177chr14965 895 832 309 1813 ----
NM_133178chr14965 895 832 309 1813 ----
NM_133264chr1753533 2833 2512 781 423 11037 ----
NM_133265chrX--1997 22428 934 --
NM_133445chr932580 2302 1469 ------
NM_133467chr11417 ------
NM_133468chr732404 2231 1788 --1609 --
NM_133478chr232503 2102 907 --12305 --
NM_133486chrX1458 ------
NM_134325chr131161 703 317 ----11640
NM_138270chrX22374 932 ------
NM_138316chr101974 ----11396
NM_138338chr2273241 2413 2213 1220 1082 214 208 12122 13381 1598
NM_138357chr10--11466 ----
NM_138444chr1334233 1650 94 23866 549 1790 --
NM_138459chr621472 377 ------
NM_138473chr1234047 3766 851 --33318 545 472 --
NM_138492chr51328 ------
NM_138558chr1--2337 164 ----
NM_138576chr143954 917 179 ----11762
NM_138713chr161835 1322 26875 3241 12697
NM_138714chr161835 1322 26875 3241 12697
NM_138727chr152407 2137 2091 1843 1617 21633 284 ----
NM_138728chr152407 2137 2091 1843 1617 21633 284 ----
NM_138730chr6149 ------
NM_138731chr14------13690
NM_138732chr114330 272 214 104 ------
NM_138734chr114330 272 214 104 ------
NM_138735chr231529 596 518 ------
NM_138736chr1684196 3614 3252 3046 926 912 759 121 --21279 1227 --
NM_138799chr222009 1748 --11830 --
NM_138811chr72974 157 ------
NM_138966chr181199 ------
NM_138970chr1431742 1688 893 ------
NM_139012chr642243 1998 1735 467 ------
NM_139014chr642323 2078 1815 547 ------
NM_139045chr91792 ------
NM_139048chr31271 169 ----
NM_139072chr22836 296 ------
NM_139159chr192213 42 ------
NM_139177chr1731516 1426 54 --11495 --
NM_139246chr9------1680
NM_139280chr173580 283 117 21249 297 ----
NM_139283chr122900 292 ----1832
NM_139323chr2011935 ------
NM_144571chr476280 5717 4479 1309 1018 856 582 35906 1168 183 ----
NM_144574chr141526 ------
NM_144586chr241156 907 785 274 1402 1486 --
NM_144609chr17155 ----1444
NM_144628chr2033052 2043 1063 ------
NM_144632chr212286 ----12014
NM_144635chr351121 830 507 478 179 ------
NM_144721chr432649 2080 718 ------
NM_144732chr191411 ------
NM_144775chr1774862 4705 4080 3159 1081 822 368 1796 11988 24049 3528
NM_144778chr1312724 ------
NM_144949chr22891 262 ------
NM_145008chr112816 251 ------
NM_145053chr11------1583
NM_145063chr62196 137 ------
NM_145176chr6--1831 1259 --
NM_145203chr131102 --1284 --
NM_145206chr1022708 2473 32819 2743 135 ----
NM_145277chr1--1154 ----
NM_145313chr1041274 530 95 73 --1537 --
NM_145341chr1031611 1433 415 ----1571
NM_145735chr1312784 ------
NM_145799chrX33107 2560 383 22623 917 1423 --
NM_145804chr11171 ----11275
NM_145861chr121609 583 --11348 --
NM_145891chr162232 225 --1251 1480
NM_145892chr162232 225 --1251 1480
NM_145893chr162354 347 --1373 1602
NM_147147chr643890 3478 3462 1533 1612 21490 1214 --
NM_147202chr962733 2611 944 923 680 297 1827 ----
NM_148571chr1721477 632 ----1398
NM_148921chr1721942 457 --22394 1983 1735
NM_148977chr101974 ----11396
NM_148978chr101974 ----11396
NM_152221chr2221244 981 --1506 --
NM_152233chr1421200 319 --11469 --
NM_152253chr2242649 1571 766 318 24213 636 ----
NM_152261chr1212088 --12459 --
NM_152265chr11616 11003 ----
NM_152275chr21663 1405 1656 --
NM_152277chr5--11346 ----
NM_152280chr123469 436 1271 11269 --
NM_152298chr15684 646 624 270 112 --2654 650 1147
NM_152385chr2155 ------
NM_152388chr233824 699 645 11183 ----
NM_152409chr542282 1310 1076 448 --1905 --
NM_152424chrX54584 3611 3268 1614 1069 --11880 14486
NM_152429chr102323 28 1449 ----
NM_152451chr151322 ------
NM_152462chr173732 270 211 ------
NM_152545chr43619 530 59 ------
NM_152556chr742445 2415 1959 1647 ------
NM_152588chr12--11866 ----
NM_152606chr191328 1532 ----
NM_152608chr111683 1525 11810 --
NM_152636chr1132377 2223 2217 12145 --11888
NM_152638chr1211240 ------
NM_152641chr12------1923
NM_152688chr62884 270 ------
NM_152734chr655147 1797 1404 962 320 34745 4230 51 25517 472 --
NM_152749chr721061 972 ------
NM_152754chr723843 2348 ------
NM_152756chr512651 --13862 --
NM_152772chr12--1414 ----
NM_152787chrX12650 127 ----
NM_152793chr714943 14562 1276 --
NM_152835chr111125 ----173
NM_152836chr821427 1386 ------
NM_152837chr821427 1386 ------
NM_152838chr2023225 1260 --1145 --
NM_152857chr61744 1813 ----
NM_152858chr61744 1813 ----
NM_152924chr15105916 5757 5693 5561 2530 2335 915 659 396 275 12756 12200 --
NM_152996chr121673 190 --1770 --
NM_153029chr1693780 3730 3004 2668 2574 1528 1330 535 37 --34025 3619 41 --
NM_153035chr163173 2988 2831 2238 231 101 --22399 92 22744 2478
NM_153042chr611827 --1339 1305
NM_153181chr181199 ------
NM_153184chr3--139 21974 1751 --
NM_153188chr513924 ----1898
NM_153207chr121537 1651 11488 --
NM_153235chr611679 --2666 215 --
NM_153354chr52388 70 ------
NM_153367chr1042913 1025 521 125 --22853 1389 --
NM_153464chr19----2225 37 --
NM_153487chr633984 3031 136 --14037 23036 1527
NM_153607chr522888 2714 ------
NM_153631chr751160 1072 216 204 61 ------
NM_153632chr751160 1072 216 204 61 ------
NM_153634chr121180 ----1671
NM_153687chr1221010 440 ------
NM_153812chr152167 680 671 587 536 --1768 --
NM_153831chr8------1137
NM_170665chr1213459 11626 1106 22907 1511
NM_170674chr1521040 510 ------
NM_170675chr152716 186 ------
NM_170676chr152716 186 ------
NM_170677chr1521040 510 ------
NM_170695chr18----1429 --
NM_170706chr144139 2669 1374 1209 --13280 --
NM_170719chr131154 1311 ----
NM_171825chr553096 2643 358 341 237 --12573 12310
NM_171998chrX21941 248 --12205 --
NM_172016chr611433 1175 ----
NM_172070chr221858 709 ----21977 1704
NM_172071chr165971 5893 5093 2839 2254 876 12240 21689 1405 --
NM_172103chr652440 2347 1981 1736 1065 ------
NM_172105chr652440 2347 1981 1736 1065 ------
NM_172127chr4--11686 ----
NM_172128chr41830 11642 ----
NM_172164chr15684 646 624 270 112 --2654 650 1147
NM_172315chr1521040 510 ------
NM_172316chr1521040 510 ------
NM_172337chr14--151 --2755 392
NM_172373chr13----21029 552 --
NM_172387chr1831607 1345 249 1647 ----
NM_172388chr1831654 1392 296 1694 ----
NM_172389chr1831654 1392 296 1694 ----
NM_173054chr71827 --1764 --
NM_173065chr1103447 3122 1336 1243 935 903 857 639 339 222 12955 21213 360 --
NM_173075chr41541 11127 1529 1379
NM_173171chr21364 ------
NM_173172chr2--21009 151 ----
NM_173173chr21364 ------
NM_173174chr81161 ----1858
NM_173175chr81161 ----1858
NM_173176chr81161 ----1858
NM_173177chr21537 1673 ----
NM_173198chr932558 877 587 ------
NM_173199chr92401 188 ------
NM_173200chr932558 877 587 ------
NM_173207chr18----1429 --
NM_173208chr18----1429 --
NM_173209chr18----1429 --
NM_173210chr18----1429 --
NM_173211chr18----1429 --
NM_173214chr161835 1322 26875 3241 12697
NM_173468chr475061 4799 3811 3678 2340 2332 1883 15616 1906 --
NM_173470chrX22801 2084 ------
NM_173475chr16--1395 ----
NM_173476chr1682143 2050 2031 1830 1504 578 542 349 1145 --11938
NM_173494chrX1634 ------
NM_173511chr253439 2618 1175 1079 1025 11447 12854 --
NM_173624chr17125 ------
NM_173662chr4------138
NM_173665chr51783 ------
NM_173672chr621823 359 21571 320 1783 --
NM_173683chr811307 11347 --11313
NM_173694chrX21882 1740 ------
NM_173808chr11570 --14220 155
NM_173809chr1021398 78 11244 2364 336 --
NM_173822chr241436 718 295 241 ------
NM_173854chr132290 1543 935 ----1432
NM_174886chr18----1429 --
NM_174911chr851420 955 917 551 512 11179 ----
NM_174921chr42965 254 ------
NM_174934chr1163258 2745 2487 645 488 269 21380 456 ----
NM_174937chr102613 34 ------
NM_174963chr12830 232 ------
NM_174964chr12830 232 ------
NM_174965chr12849 251 ------
NM_174966chr12830 232 ------
NM_174967chr12849 251 ------
NM_174968chr12830 232 ------
NM_174969chr12830 232 ------
NM_174970chr12849 251 ------
NM_174971chr12830 232 ------
NM_175623chr1247075 5314 2937 1343 11426 16667 24781 53
NM_175634chr811310 ------
NM_175635chr811310 ------
NM_175636chr811310 ------
NM_175709chr226720 653 511 460 375 193 --22062 380 --
NM_175856chr52144 56 ------
NM_175859chrX------11789
NM_175921chr523358 2892 --33558 2750 1419 --
NM_176801chr42659 510 11373 --2629 208
NM_176814chr7------11493
NM_176871chr893336 3317 3305 3071 2532 1037 991 640 62 11191 32908 1070 504 --
NM_177438chr1423620 2682 --2596 132 --
NM_177947chrX--11472 11639 --
NM_177948chrX--11472 11639 --
NM_177990chr2011519 ------
NM_177996chr2021123 220 12085 32153 1169 236 --
NM_178026chr201498 ------
NM_178037chr1263445 2864 2348 1389 1314 760 11173 ----
NM_178038chr1263445 2864 2348 1389 1314 760 11173 ----
NM_178123chr22913 701 ------
NM_178126chr1721618 648 3807 528 478 31954 1916 131 --
NM_178140chr532541 1072 571 --12587 --
NM_178151chrX46851 2830 2232 556 24952 2836 13106 16126
NM_178152chrX46851 2830 2232 556 24952 2836 13106 16126
NM_178153chrX46851 2830 2232 556 24952 2836 13106 16126
NM_178424chr51477 ----1234
NM_178450chr5122 ------
NM_178554chr3113587 2606 1431 1305 1074 925 737 428 362 331 193 ----1635
NM_178565chr811407 --11372 --
NM_178585chr41386 ------
NM_178815chr1021890 70 --12017 --
NM_180976chr65949 899 738 218 85 ------
NM_180977chr65949 899 738 218 85 ------
NM_180989chr1311877 ------
NM_181054chr1411261 ------
NM_181302chr141526 ------
NM_181308chr141526 ------
NM_181351chr1132268 1140 754 ------
NM_181354chr81621 ------
NM_181358chr123989 3771 ------
NM_181361chr31208 ------
NM_181442chr201106 ------
NM_181491chr963099 2193 2152 2078 382 270 22482 757 11096 --
NM_181504chr511043 12784 ----
NM_181521chr1696332 5514 5472 2600 2365 2078 1692 1584 525 1742 37024 4427 1667 --
NM_181523chr511043 12784 ----
NM_181524chr511043 12784 ----
NM_181672chrX21729 1695 ----11894
NM_181673chrX21729 1695 ----11894
NM_181702chr8----1862 --
NM_181706chr1152133 1675 965 834 468 22191 1723 ----
NM_181828chr2273496 3039 2629 2460 888 743 724 12875 52811 2582 688 652 158 --
NM_181829chr2273496 3039 2629 2460 888 743 724 12875 52811 2582 688 652 158 --
NM_181830chr2273496 3039 2629 2460 888 743 724 12875 52811 2582 688 652 158 --
NM_181838chr51989 --11546 --
NM_181839chr83373 165 105 ----1207
NM_181861chr1221083 139 2917 619 1302 --
NM_181868chr1221083 139 2917 619 1302 --
NM_181869chr1221168 224 21002 704 1387 --
NM_181886chr411001 ----1502
NM_181887chr411001 ----1502
NM_181888chr411001 ----1502
NM_181889chr411001 ----1502
NM_181890chr411001 ----1502
NM_181891chr411001 ----1502
NM_181892chr411048 ----1549
NM_181893chr411001 ----1502
NM_182314chrX31849 1240 240 ------
NM_182485chr432912 2852 496 ------
NM_182503chr635358 5228 4833 24456 1238 23417 1660 --
NM_182515chr1964724 4179 1925 1460 972 537 11760 ----
NM_182526chr1442560 978 854 541 --2413 276 12652
NM_182568chr17------135
NM_182603chr112164 90 --1938 --
NM_182641chr17146 ------
NM_182646chr432912 2852 496 ------
NM_182688chr2121705 844 ----11627
NM_182689chr1--1301 ----
NM_182690chr1--1363 ----
NM_182717chr1031334 1266 979 ------
NM_182720chr1031334 1266 979 ------
NM_182721chr1031334 1266 979 ------
NM_182722chr1031334 1266 979 ------
NM_182723chr1031334 1266 979 ------
NM_182728chr1421590 646 --11299 11148
NM_182757chr642184 1121 766 525 ------
NM_182830chr141526 --1364 1282
NM_182853chr1031334 1266 979 ------
NM_182898chr711551 ----22166 913
NM_182899chr711551 ----22166 913
NM_182918chr2121056 119 ----1545
NM_182931chr71708 ------
NM_182943chr3--11147 177 --
NM_182970chr2084155 4012 3235 2847 2605 1227 978 253 ----11075
NM_183004chr1421582 1032 --13584 --
NM_183011chr1031334 1266 979 ------
NM_183012chr1031334 1266 979 ------
NM_183013chr1031334 1266 979 ------
NM_183238chr1232690 2603 1012 22861 985 ----
NM_183419chr8------157
NM_183422chr132739 27 ----1921
NM_184234chr201708 ------
NM_194259chr162568 382 ------
NM_194260chr162568 382 ------
NM_194261chr162568 382 ------
NM_194278chr1462824 476 458 218 114 40 32651 1216 376 --11287
NM_194285chr1143166 2959 2885 1213 ------
NM_194314chr175541 5296 4030 3732 1827 1718 1340 --1931 --
NM_194434chr1832286 1484 893 15550 11940 12092
NM_194449chr182896 735 ------
NM_197939chr1721037 452 ----1346
NM_198056chr362101 2054 2036 1602 1517 816 21642 555 ----
NM_198086chr14----1597 --
NM_198123chr82641 205 ------
NM_198124chr82641 205 ------
NM_198158chr322755 2252 ------
NM_198159chr322755 2252 ------
NM_198177chr322755 2252 ------
NM_198178chr322755 2252 ------
NM_198225chr10----21961 1948 --
NM_198243chr151149 ------
NM_198268chr123989 3771 ------
NM_198269chr123989 3771 ------
NM_198279chrX11195 ------
NM_198291chr2061993 1241 541 319 307 46 1114 ----
NM_198318chr192174 38 ------
NM_198319chr192174 38 ------
NM_198320chr1294496 3764 3625 3458 1771 1622 1465 1009 583 --11900 --
NM_198336chr72302 23 ------
NM_198391chr20------2459 451
NM_198399chr321370 557 1108 11346 --
NM_198468chr624467 3217 ----1984
NM_198513chr811506 ------
NM_198581chr267098 6621 5677 5049 1020 347 87185 6471 6200 5512 5184 4885 2971 2582 11831 --
NM_198793chr342768 880 541 121 --13278 --
NM_198794chr14--11031 ----
NM_198859chr341919 1913 1348 153 ----1652
NM_198889chr4----1289 11407
NM_198896chr1111948 ------
NM_198965chr12----1358 --
NM_198966chr12----1358 --
NM_198968chr1352902 2819 1133 755 562 11398 ----
NM_199129chr204899 463 119 25 --31126 921 334 --
NM_199144chr20------11008
NM_199169chr2083382 3148 2694 2566 2458 1143 1076 23 12404 12883 --
NM_199170chr2083382 3148 2694 2566 2458 1143 1076 23 12404 12883 --
NM_199171chr2083382 3148 2694 2566 2458 1143 1076 23 12404 12883 --
NM_199188chr1213385 --1511 11326
NM_199190chr1213385 --1511 11326
NM_199203chr20------11008
NM_199320chr4--12179 ----
NM_199320chr4--12179 ----
NM_199324chr42979 735 33399 2907 1027 --12622
NM_199440chr21113 ----1118
NM_201274chr172590 253 168 ----
NM_201348chr174169 3819 3299 2978 1541 1229 46 --44220 2934 1068 696 --
NM_201432chr1776391 5700 5324 4789 4783 1073 46 35538 279 226 ----
NM_201433chr1776391 5700 5324 4789 4783 1073 46 35538 279 226 ----
NM_201570chr1021904 216 --1464 --
NM_201571chr1021904 216 --1464 --
NM_201572chr1021904 216 --1464 --
NM_201590chr1021904 216 --1464 --
NM_201593chr1021904 216 --1464 --
NM_201596chr1021904 216 --1464 --
NM_201597chr1021904 216 --1464 --
NM_201613chr121875 ------
NM_201633chr51345 ------
NM_201995chr111248 ------
NM_202004chr1--1154 ----
NM_203305chr91907 --2381 339 22057 1025
NM_203318chr1741253 918 839 46 ------
NM_203327chr2064105 3750 1700 1393 1100 335 ------
NM_203354chr141332 ------
NM_203355chr141332 ------
NM_203356chr141332 ------
NM_203391chrX21714 257 ------
NM_203446chr211154 ------
NM_203458chr143837 3657 2644 1317 1509 12975 --
NM_203487chr131617 ------
NM_203506chr174845 634 366 144 ------
NM_205768chr131709 722 441 11358 ----
NM_205842chr21158 --1179 --
NM_205846chr51328 ------
NM_206594chr112387 ------
NM_206595chr112387 ------
NM_206853chr613603 --12786 --
NM_206854chr624864 637 --14047 --
NM_206855chr635829 1602 203 --15012 --
NM_206876chr21368 13067 13545 --
NM_206943chr21379 1102 ----
NM_207015chr311934 --1485 --
NM_207043chr11338 1153 ----
NM_207044chr11338 1153 ----
NM_207047chr11338 1153 ----
NM_207123chr41877 ------
NM_207171chr121806 1263 ------
NM_207299chr9----1279 --
NM_207303chr1033970 1513 1142 13010 22544 1055 --
NM_207304chr1312611 ------
NM_207344chr121963 ----2443 415
NM_207371chr1011079 21167 357 ----
NM_207406chr485944 4848 4525 2412 2227 2130 1368 345 ------
NM_207429chr112924 187 1432 ----
NM_207481chr2--1121 ----
NM_207517chr1521588 128 ------
NM_207645chr111974 ------
NM_213589chr254575 4104 1280 1159 673 --1471 1538
NM_213590chr1323954 244 1409 21661 1029 13536
NM_213606chr1031951 1817 676 ------
NM_213652chr1--1154 ----
NM_213653chr1--1154 ----