TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3160-3p
miRNA Sequence: AGAGCUGAGACUAGAAAGCCCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr51940 ------
NM_000021chr143942 310 127 ------
NM_000024chr52494 418 1205 1209 --
NM_000035chr93333 160 25 --1291 --
NM_000052chrX62622 2553 2402 2169 817 806 23217 715 22438 174 1825
NM_000053chr1321515 99 --1663 --
NM_000067chr8155 ------
NM_000081chr1------1625
NM_000084chrX76529 6372 6092 4947 1743 823 765 12659 25894 2534 1519
NM_000092chr263949 3914 3025 2956 1011 591 11059 13311 13796
NM_000109chrX62586 1992 1862 1827 901 644 --22319 1063 --
NM_000110chr11919 --2486 84 --
NM_000111chr71378 ------
NM_000115chr132760 263 12280 ----
NM_000125chr674181 2946 2916 1216 1094 275 229 23502 1487 32952 861 157 --
NM_000129chr62238 80 1260 11010 --
NM_000135chr1621000 31 ------
NM_000138chr1542512 1694 1636 554 --1500 --
NM_000165chr621567 583 --11642 --
NM_000168chr752207 1003 750 430 210 --22230 693 22415 612
NM_000176chr531219 706 69 ------
NM_000183chr23183 115 97 ------
NM_000194chrX2553 156 --1208 --
NM_000210chr221801 602 ------
NM_000214chr20--1441 ----
NM_000216chrX41401 463 310 208 11376 ----
NM_000217chr1223716 2154 23382 43 --13727
NM_000222chr412122 11319 ----
NM_000232chr453201 3192 2441 1150 423 --22349 640 12357
NM_000237chr811716 --11918 --
NM_000238chr71125 ------
NM_000240chrX72010 1961 1712 1627 1508 883 745 --1807 --
NM_000248chr352217 2050 1978 1099 264 ------
NM_000252chrX21117 514 --1469 --
NM_000260chr112372 67 ------
NM_000264chr923171 2088 1128 --1955
NM_000266chrX3395 193 50 ------
NM_000267chr1743316 2890 2740 491 12711 22811 985 --
NM_000271chr181129 ------
NM_000278chr1051767 803 640 301 39 --1737 --
NM_000280chr111205 --1121 --
NM_000284chrX71568 1539 1494 650 631 597 445 --11865 --
NM_000289chr123273 137 84 ----147
NM_000291chrX5653 330 295 104 78 ----1162
NM_000304chr17--1312 ----
NM_000310chr131161 256 101 ------
NM_000314chr1022687 2440 23022 2606 12809 --
NM_000318chr861108 852 793 740 431 251 ------
NM_000321chr1321575 1378 --1115 --
NM_000325chr41544 ------
NM_000328chrX----2454 130 --
NM_000330chrX42280 705 623 434 11751 ----
NM_000332chr646403 5985 4361 539 26319 4597 26471 1269 11418
NM_000334chr1752188 698 597 533 372 1552 ----
NM_000337chr575669 4706 4649 4350 1347 1293 510 15849 --15681
NM_000338chr151153 ----1184
NM_000340chr321282 1162 --31050 487 268 --
NM_000351chrX43932 3822 2991 2915 --24246 3457 12944
NM_000361chr2071576 1534 1436 640 437 81 60 11325 ----
NM_000362chr2221430 1411 --12941 21303 982
NM_000369chr1431356 561 345 ----2685 443
NM_000378chr111103 ------
NM_000389chr631476 1346 80 21145 959 11383 --
NM_000393chr222126 1898 ------
NM_000399chr10128 --11105 --
NM_000430chr1733615 1493 1466 ------
NM_000437chr12839 828 11587 11946 --
NM_000449chr111078 --1181 --
NM_000461chr353579 3230 576 288 68 ------
NM_000462chr1521525 209 ------
NM_000474chr71505 ------
NM_000475chrX--137 ----
NM_000476chr91305 127 ----
NM_000484chr212424 262 ------
NM_000486chr1253193 2444 1188 1056 771 ------
NM_000489chrX53051 2667 2368 1275 725 --12432 --
NM_000494chr102200 22 ----1785
NM_000500chr63504 394 35 1312 ----
NM_000503chr851595 1483 518 344 313 ------
NM_000522chr71213 ------
NM_000523chr2--129 1471 --
NM_000525chr1141638 1493 627 417 11216 --1100
NM_000527chr1911737 ----1830
NM_000539chr321511 1393 1320 11436 --
NM_000555chrX106871 6603 6020 5984 5552 4867 2292 1172 629 493 25876 1821 ----
NM_000582chr4197 ------
NM_000595chr6--1119 ----
NM_000597chr21105 ------
NM_000599chr234645 4047 1674 --24474 1189 --
NM_000609chr1022389 44 1230 12157 --
NM_000610chr1132384 719 246 --12569 --
NM_000612chr1123548 2423 23192 1487 ----
NM_000615chr1142759 2379 626 51 --22190 1964 --
NM_000618chr1266189 4253 2323 2056 1934 1274 26180 1548 11491 15362
NM_000618chr1266189 4253 2323 2056 1934 1274 26180 1548 11491 15362
NM_000633chr1875171 4235 3822 3474 1966 1000 198 24806 3387 ----
NM_000637chr8------1428
NM_000668chr42424 217 11427 193 --
NM_000686chrX1616 11573 ----
NM_000719chr1265212 4470 1592 1289 662 257 26338 550 --14059
NM_000722chr72111 88 ------
NM_000723chr1741602 1248 500 164 ------
NM_000724chr1021342 628 ------
NM_000725chr121134 ------
NM_000756chr81449 ------
NM_000767chr192571 119 --11148 1290
NM_000786chr711422 ------
NM_000788chr41301 --21314 48 --
NM_000800chr521340 325 1152 ----
NM_000801chr203979 931 285 --2162 25 --
NM_000806chr521250 187 ------
NM_000807chr42672 529 ------
NM_000809chr478510 8079 8024 3398 1204 686 223 18742 ----
NM_000812chr41139 ------
NM_000813chr595283 5112 5104 4562 4496 1871 1480 1173 1068 13653 21945 814 --
NM_000814chr152790 532 13657 ----
NM_000817chr221108 359 ------
NM_000824chr41280 ------
NM_000826chr432197 1807 887 ------
NM_000827chr572426 1779 1651 1596 770 469 347 ------
NM_000831chr195734 5633 5488 4068 1821 1419 884 400 355 15162 15943 --
NM_000833chr161995 --1540 --
NM_000838chr652741 1716 980 659 542 --32716 2160 848 --
NM_000840chr7164 --121 --
NM_000859chr511295 1283 11173 --
NM_000868chrX--12205 ----
NM_000872chr103471 184 61 ------
NM_000875chr15115616 5443 4909 4730 2818 2582 1163 969 399 201 148 --15451 --
NM_000880chr82288 39 ------
NM_000883chr72632 115 ------
NM_000883chr72632 115 ------
NM_000899chr1242957 1590 1192 78 23658 52 2564 438 24179 3729
NM_000901chr422188 969 12441 12269 --
NM_000912chr843414 3175 1002 29 2535 479 1248 --
NM_000919chr51549 ------
NM_000921chr122488 216 ------
NM_000922chr113999 365 333 1808 ----
NM_000944chr442021 1974 1856 145 ------
NM_000945chr231365 1341 673 ------
NM_000961chr2052632 2499 1060 949 71 22532 1561 13330 23283 2854
NM_000962chr942926 2831 2349 2295 --11014 --
NM_000965chr311130 --144 --
NM_000966chr125961 852 808 779 188 ------
NM_001001132chr2121381 358 ------
NM_001001323chr1222985 2445 ------
NM_001001330chr1041193 839 517 194 --1895 --
NM_001001342chr10--21268 475 ----
NM_001001344chrX11585 ----12463
NM_001001389chr1132384 719 246 --12569 --
NM_001001390chr1132384 719 246 --12569 --
NM_001001391chr1132384 719 246 --12569 --
NM_001001392chr1132430 765 292 --12615 --
NM_001001394chr21123 ----1561
NM_001001395chr1222591 2449 1178 22241 656 --
NM_001001396chr172856 1502 381 280 255 238 54 ----14251
NM_001001419chr584708 4041 3917 3494 1429 1296 1213 1054 33301 240 108 14564 11153
NM_001001420chr584708 4041 3917 3494 1429 1296 1213 1054 33301 240 108 14564 11153
NM_001001433chr203661 562 263 12759 ----
NM_001001436chr161709 ------
NM_001001481chr822890 1330 13062 ----
NM_001001484chr102311 88 22380 1772 11732 --
NM_001001522chr112156 41 ------
NM_001001523chr15985 867 438 265 117 1544 1226 --
NM_001001549chr732778 2219 2034 12341 1578 --
NM_001001550chr732778 2219 2034 12341 1578 --
NM_001001555chr732778 2219 2034 12341 1578 --
NM_001001557chr821582 693 ------
NM_001001586chr11385 ------
NM_001001664chr274048 3895 3035 1346 1323 1236 308 13428 1176 --
NM_001001668chr1923423 560 --23947 3736 --
NM_001001852chr22------1879
NM_001001890chr2122938 718 11003 12752 --
NM_001001924chr852067 1405 1296 737 152 ------
NM_001001925chr852067 1405 1296 737 152 ------
NM_001001931chr852067 1405 1296 737 152 ------
NM_001001936chr101144 --21089 477 --
NM_001001937chr18--132 ----
NM_001001971chr101123 ------
NM_001001974chr1041996 1877 1725 43 --12061 --
NM_001001994chrX2559 221 ------
NM_001001995chrX2620 39 --1756 --
NM_001001996chrX2559 221 ------
NM_001002026chr342339 2128 1613 589 2377 224 ----
NM_001002233chr852085 1733 864 536 385 1479 ----
NM_001002243chr22941 113 ------
NM_001002269chr92452 209 ------
NM_001002295chr101864 ------
NM_001002762chr1032201 1815 73 --12641 --
NM_001002838chrX--1162 21353 293 --
NM_001002843chr151393 --11085 --
NM_001002860chr1433250 3217 1407 181 13755 --
NM_001002909chr1742079 902 591 173 21556 845 ----
NM_001002926chr732269 541 23 --1242 --
NM_001003396chr6----146 1510
NM_001003397chr6----146 1510
NM_001003407chr10105013 4561 4416 3967 3573 2044 1258 1142 654 561 11367 33584 3237 1126 --
NM_001003408chr10105013 4561 4416 3967 3573 2044 1258 1142 654 561 11367 33584 3237 1126 --
NM_001003652chr18117674 7236 6761 6631 5963 3324 3291 2619 1822 1332 1243 25390 2155 ----
NM_001003674chr18136074 5871 5391 5339 4954 4833 2486 2480 2218 1441 437 87 24 11157 35583 2437 1166 36111 2102 1185
NM_001003675chr18136074 5871 5391 5339 4954 4833 2486 2480 2218 1441 437 87 24 11157 35583 2437 1166 36111 2102 1185
NM_001003679chr152122 780 650 604 116 21623 708 ----
NM_001003683chr2137 ------
NM_001003688chr41843 ------
NM_001003698chr611663 11981 ----
NM_001003699chr611663 11981 ----
NM_001003712chr1273843 3745 2512 1286 1212 910 817 12714 --1528
NM_001003792chr3----1990 --
NM_001003793chr3----1990 --
NM_001003794chr372827 2582 2493 1895 1889 486 309 124 12769 --
NM_001003799chr72577 30 1210 ----
NM_001003800chr932730 1307 220 ------
NM_001003845chr21167 --1482 --
NM_001003891chr222923 108 ------
NM_001003927chr17157 1501 ----
NM_001004023chr11182 ------
NM_001004065chr921226 714 ------
NM_001004304chr1272996 2937 2834 2022 1129 518 484 12868 22545 172 1762
NM_001004317chr654074 3933 3532 905 566 --21747 848 --
NM_001004342chr1135877 5067 4414 4384 2298 2222 2142 2031 2013 1454 1245 1167 508 11359 22125 902 --
NM_001004360chr21488 1102 ----
NM_001004419chr1223315 643 ----1728
NM_001004722chr23850 371 37 ------
NM_001005158chr31422 1513 1116 --
NM_001005159chr31422 1513 1116 --
NM_001005209chr2246 37 ------
NM_001005266chr15162 ------
NM_001005267chr15162 ------
NM_001005268chr15162 ------
NM_001005269chr15162 ------
NM_001005271chr172815 146 158 1367 --
NM_001005273chr172815 146 158 1367 --
NM_001005291chr172120 58 ------
NM_001005353chr121180 925 --1291 --
NM_001005353chr121180 925 --1291 --
NM_001005354chr12139 ----1584
NM_001005375chrY2609 100 11263 ----
NM_001005386chr242400 1580 797 493 --12212 --
NM_001005404chr1763973 3774 3298 2989 2836 948 11057 ----
NM_001005408chr171173 ------
NM_001005463chr1012430 --11971 --
NM_001005474chr3143 ------
NM_001005505chr331837 1220 364 2579 463 ----
NM_001005732chr213122 72 31 2141 40 ----
NM_001005733chr213122 72 31 2141 40 ----
NM_001005782chr21740 ------
NM_001006115chr351715 1082 804 482 141 --1213 --
NM_001006600chr521975 760 ------
NM_001006610chr162670 44 ----1647
NM_001006665chr12771 585 --1504 1195
NM_001006684chrX138 1516 ----
NM_001006939chr103714 176 35 ------
NM_001007024chr1753456 2809 2796 395 242 23345 1351 24178 3692 2700 523
NM_001007025chr1753456 2809 2796 395 242 23345 1351 24178 3692 2700 523
NM_001007097chr953746 1817 1521 972 644 14282 11417 --
NM_001007156chr1541682 1268 770 245 1692 ----
NM_001007157chr7--138 ----
NM_001007226chr1741002 964 447 261 --11191 --
NM_001007227chr1741002 964 447 261 --11191 --
NM_001007228chr1741002 964 447 261 --11191 --
NM_001007229chr1741002 964 447 261 --11191 --
NM_001007230chr1741002 964 447 261 --11191 --
NM_001007237chr142253 595 266 192 12067 --12275
NM_001007246chr2171736 1570 781 706 534 420 366 1287 ----
NM_001007257chr12502 143 --1453 --
NM_001007277chr112175 52 ------
NM_001007466chr664569 4132 3874 3241 1207 375 --24912 3500 --
NM_001007471chr91105 ------
NM_001007544chr13501 383 30 ------
NM_001007553chr12810 422 ----11082
NM_001007559chr1831721 1262 319 1185 --11688
NM_001007794chr11693 ------
NM_001008220chr541399 1098 758 105 --1151 1666
NM_001008222chrX21072 1054 --11252 --
NM_001008225chr72728 290 ------
NM_001008239chr1862981 2641 2501 2413 1447 343 --22380 89 --
NM_001008392chr322927 2277 1355 174 --
NM_001008407chr741637 674 337 61 ------
NM_001008408chr785554 5270 4410 4397 4089 3961 1266 724 ------
NM_001008495chr83734 545 501 1706 ----
NM_001008540chr21442 ------
NM_001008541chr10--1629 ----
NM_001008541chr10--1629 ----
NM_001008563chr92278 268 ------
NM_001008564chr1322275 640 ------
NM_001008566chr22----1447 --
NM_001008660chr1121354 515 11225 ----
NM_001008701chr1972272 1115 783 763 427 385 222 ------
NM_001008707chr1421653 140 ------
NM_001008711chr831431 1396 1310 21339 1079 21669 56 11604
NM_001008738chr522932 2127 21897 334 --11873
NM_001008744chr14--21066 583 1309 --
NM_001008777chr171276 ------
NM_001008800chr11146 ------
NM_001008801chr192566 199 ----11530
NM_001008860chr152808 698 1179 1748 1849
NM_001008883chr11146 ------
NM_001008892chr152808 698 1179 1748 1849
NM_001008894chr152808 698 1179 1748 1849
NM_001008925chr463220 3163 1375 425 366 93 1521 23044 777 --
NM_001008938chr112375 32 ------
NM_001009555chr431726 1310 470 ------
NM_001009881chr1290 23 ------
NM_001009882chr1290 23 ------
NM_001009899chr3125744 4770 4693 4396 2433 1860 849 454 396 273 124 117 ----11398
NM_001009909chr1131379 1091 578 23710 1014 ----
NM_001009958chr72225 66 1149 1218 --
NM_001009959chr242500 1603 822 298 --11968 --
NM_001009993chr261061 1005 952 815 234 120 14443 ----
NM_001010000chr1842897 1233 1189 496 12718 13496 --
NM_001010846chr164439 3754 3267 551 537 241 --1826 --
NM_001010853chr612386 22192 1291 --1578
NM_001010861chr112718 --12064 --
NM_001010888chrX43925 3258 1717 1244 12880 ----
NM_001010898chr163155 3067 2671 997 371 198 --23175 2642 --
NM_001010908chr101107 ------
NM_001010924chr10----1328 --
NM_001010935chr141075 798 682 21 ------
NM_001010942chr122156 22 ------
NM_001010971chr121022 647 ----1162
NM_001010980chr152851 2230 1321 1096 81 22544 2193 ----
NM_001010984chr132460 401 221 21626 1610 ----
NM_001010986chrX11888 11916 22384 991 --
NM_001011513chr453408 1554 1412 502 135 13672 ----
NM_001011515chr411048 1188 ----
NM_001011516chr411048 1188 ----
NM_001011537chr321680 579 --22403 2170 --
NM_001011546chr20--1279 ----
NM_001011553chr73938 260 49 ------
NM_001011666chr7105917 5808 4687 4431 4406 4373 2048 1116 358 352 36147 5659 5348 44490 2380 209 106 16152
NM_001011713chr142441 109 ------
NM_001011885chr1521561 447 ------
NM_001012321chr3163 ------
NM_001012329chr152223 1955 1944 715 490 ------
NM_001012333chr111113 ------
NM_001012334chr111113 ------
NM_001012393chr1161956 1753 1506 1482 168 82 14434 ----
NM_001012398chr1621036 363 1415 ----
NM_001012415chr91104 ------
NM_001012418chr684211 4083 3892 3315 3175 2875 1366 81 21186 730 11683 11455
NM_001012426chr662840 2091 857 504 321 139 --33274 940 913 12611
NM_001012427chr662840 2091 857 504 321 139 --33274 940 913 12611
NM_001012514chr2187 ----1935
NM_001012516chr2187 ----1935
NM_001012614chr42590 301 ------
NM_001012755chrX21091 26 34916 1937 1107 24096 3382 25031 1253
NM_001012761chr562419 2210 951 814 442 220 --11913 --
NM_001012977chrX11073 ------
NM_001012989chrX2453 125 ------
NM_001013031chr10111045 1000 974 856 693 503 493 398 388 354 142 12160 ----
NM_001013406chr721696 221 --11544 --
NM_001013415chr421287 255 ------
NM_001013438chr31181 --1267 --
NM_001013439chr3127 --1113 --
NM_001013624chr174979 927 334 104 --11015 --
NM_001013635chr12----1857 --
NM_001013690chr1232285 1767 483 ------
NM_001013693chr172792 2375 2276 826 780 402 254 --12628 --
NM_001013693chr172792 2375 2276 826 780 402 254 --12628 --
NM_001013843chr152877 626 --1333 --
NM_001014380chr1385852 5431 5153 4807 4258 3992 1452 1409 13742 35395 3759 981 25201 2316
NM_001014434chr13793 254 136 ------
NM_001014797chr1047392 6795 706 93 --15473 15961
NM_001015045chr461969 1925 1597 1584 661 70 --1142 --
NM_001015053chr1741560 1031 381 329 1292 21025 172 --
NM_001015877chrX21920 1089 ------
NM_001015887chr311569 ----11201
NM_001017368chr1752586 2210 2125 2080 73 11110 12089 --
NM_001017371chr21493 11275 ----
NM_001017395chr313684 --13286 --
NM_001017405chr42806 347 ------
NM_001017415chr13556 213 83 ------
NM_001017416chr13556 213 83 ------
NM_001017424chr11575 --1350 --
NM_001017425chr11575 --1350 --
NM_001017440chr797908 7620 6806 6362 5971 5320 741 659 585 23011 34 67580 7491 5163 1623 446 173 17570
NM_001017523chr1251792 1309 567 186 42 ------
NM_001017920chr21115 155 ----
NM_001017969chr91163 ------
NM_001017979chr43706 164 106 ------
NM_001017995chr574152 3200 1827 1586 603 535 94 23353 1704 14269 --
NM_001017999chr122164 712 11734 11792 --
NM_001017999chr122164 712 11734 11792 --
NM_001018000chr122164 712 11734 11792 --
NM_001018000chr122164 712 11734 11792 --
NM_001018001chr122164 712 11734 11792 --
NM_001018038chr9--1484 ----
NM_001018054chr11984 --11008 --
NM_001018056chr91101 1611 1200 --
NM_001018057chr112480 446 --2549 161 --
NM_001018064chr941920 1324 754 712 ------
NM_001018065chr963891 3735 1041 644 321 136 ----1396
NM_001018066chr963891 3735 1041 644 321 136 ----1396
NM_001018067chr174671 3449 1597 1516 1113 724 199 --15207 --
NM_001018068chr174671 3449 1597 1516 1113 724 199 --15207 --
NM_001018069chr174671 3449 1597 1516 1113 724 199 --15207 --
NM_001018072chr1251792 1309 567 186 42 ------
NM_001018074chr531219 706 69 ------
NM_001018075chr531219 706 69 ------
NM_001018076chr531219 706 69 ------
NM_001018077chr531219 706 69 ------
NM_001018108chr1572093 1743 1580 1486 1427 664 602 ------
NM_001018676chr81173 ------
NM_001018677chr81173 ------
NM_001020658chr12606 436 ----1404
NM_001020658chr12606 436 ----1404
NM_001023560chr61400 --2916 165 --
NM_001024094chr531219 706 69 ------
NM_001024226chr121137 67 --1233 --
NM_001024227chr121137 67 --1233 --
NM_001024228chr121137 67 --1233 --
NM_001024380chr812032 --32517 950 837 --
NM_001024381chr812032 --32517 950 837 --
NM_001024401chr1642621 2333 910 855 ------
NM_001024460chr63435 258 71 --21047 961 --
NM_001024463chr153750 226 35 ------
NM_001024649chr552102 2039 944 908 701 22538 686 22109 690 --
NM_001024666chrX1579 ------
NM_001024668chr121884 --1329 1310
NM_001024808chr1221848 965 1248 12452 --
NM_001024847chr332361 1543 348 --11905 --
NM_001024858chr1452473 2342 2269 553 235 ------
NM_001024934chr61455 ------
NM_001024935chr61455 ------
NM_001024936chr61455 ------
NM_001024937chr174771 243 224 41 ------
NM_001024947chr5--1408 ----
NM_001024948chr132146 678 624 ----12245
NM_001024956chr1195724 5097 4377 4268 3828 2127 1667 1542 1132 ------
NM_001025076chr1075743 5161 4559 4303 2103 1719 36 14192 22248 2064 25830 2487
NM_001025077chr1077101 6519 5917 5661 946 562 36 25550 1111 --17188
NM_001025079chr363485 3458 3448 2552 481 452 ------
NM_001025108chr231188 819 211 ------
NM_001025201chr22656 161 ------
NM_001025266chr384620 4593 3963 3793 1377 682 540 152 34877 571 134 24222 1321 13783
NM_001025356chr1252637 551 150 144 39 12859 ----
NM_001025580chrX24023 1129 32914 1643 1368 11087 --
NM_001025595chr441474 535 519 127 ------
NM_001025596chr11----1123 --
NM_001025603chr111078 --1181 --
NM_001025616chr441338 638 394 330 ------
NM_001025777chr221150 390 ------
NM_001025780chr921213 102 ------
NM_001029864chr2021688 367 1351 --1876
NM_001029875chr562654 2415 2368 2011 1101 370 --1724 21913 890
NM_001029989chr152169 66 ------
NM_001030006chr1762444 2199 2187 1002 580 174 1890 ----
NM_001030007chr1643542 3410 788 765 ------
NM_001030055chr1464699 4374 4243 3239 2968 1774 ------
NM_001030059chr101101 ------
NM_001031677chr52480 61 ------
NM_001031679chr1253169 3032 2642 2632 221 23490 46 1485 --
NM_001031684chr251467 1040 939 506 439 ------
NM_001031690chr732236 2187 810 22157 468 31132 828 353 --
NM_001031695chr2255318 3589 3321 2150 310 44672 4612 847 42 --1852
NM_001031710chr71186 --1339 --
NM_001031711chr551746 1298 1175 1136 216 11426 2461 348 --
NM_001031716chr211030 1971 1299 --
NM_001031717chr31274 ------
NM_001031723chr41416 --1399 --
NM_001031732chr453635 3389 2564 1175 92 --12910 --
NM_001031746chr1021357 192 ------
NM_001031801chr221160 ------
NM_001032221chr921196 54 --21131 77 --
NM_001032280chr631273 587 74 ----1471
NM_001032283chr121730 --1233 --
NM_001032284chr121730 --1233 --
NM_001032289chrX3624 311 274 ------
NM_001032296chr1362862 2822 2603 2529 1994 834 --1210 --
NM_001032380chr1032038 1929 1369 --1316 --
NM_001032393chrX----1144 --
NM_001032394chr652644 2385 2338 2075 1833 --22324 2217 12411
NM_001032395chr652511 2252 2205 1942 1700 --22191 2084 12278
NM_001032999chr2094675 4246 3931 3447 3260 1747 781 440 309 13501 14184 --
NM_001033045chr244352 4220 111 63 ------
NM_001033047chr442270 953 766 726 12147 ----
NM_001033057chr321621 795 ------
NM_001033059chr632031 1705 1425 ------
NM_001033081chr161299 1276 599 292 187 23 1285 ----
NM_001033082chr161299 1276 599 292 187 23 1285 ----
NM_001033087chr2042914 2859 1118 1009 ------
NM_001033117chr343781 3410 3207 1291 44916 3796 1232 166 ----
NM_001033503chr52431 197 ------
NM_001033506chr111170 ------
NM_001033507chr121553 576 1153 ----
NM_001033518chr782829 2308 2016 1872 835 492 439 219 ------
NM_001033519chr782829 2308 2016 1872 835 492 439 219 ------
NM_001033520chr782829 2308 2016 1872 835 492 439 219 ------
NM_001033551chr17113582 3489 3416 2649 1642 1548 1349 966 607 167 88 ------
NM_001033554chr17134 ----1199
NM_001033557chr231354 1116 110 ------
NM_001033564chr62787 184 ------
NM_001033578chr8--1931 --1361
NM_001033602chr1342005 1692 1027 308 12013 1650 --
NM_001034841chr1675380 5228 4724 3929 3706 1834 1274 14087 ----
NM_001034845chr41224 ------
NM_001034850chr52423 165 ------
NM_001034853chrX41083 943 740 299 ------
NM_001035chr121137 1058 ------
NM_001035003chr41169 --195 11138
NM_001035004chr41169 --195 11138
NM_001035005chr182678 506 ------
NM_001035254chr982518 2245 2159 1922 978 546 355 277 1847 1840 --
NM_001035260chr1011329 ------
NM_001035267chr121294 ------
NM_001035511chr13788 245 134 --1204 --
NM_001035512chr13895 352 241 --1311 --
NM_001035513chr13895 352 241 --1311 --
NM_001035534chr9----21101 68 --
NM_001037131chr22917 525 ------
NM_001037132chr731452 882 390 1297 ----
NM_001037133chr731452 882 390 1297 ----
NM_001037164chr7------11347
NM_001037172chr311162 1209 ----
NM_001037174chr221958 324 ------
NM_001037317chr112718 --12064 --
NM_001037339chr131665 1659 121 21537 170 --11694
NM_001037340chr131665 1659 121 21537 170 --11694
NM_001037341chr131665 1659 121 21537 170 --11694
NM_001037341chr131665 1659 121 21537 170 --11694
NM_001037582chr431323 1112 67 ----2578 273
NM_001037738chr51296 ------
NM_001037954chr1133014 671 454 11151 33119 3002 2246 --
NM_001038493chr2----21202 483 --
NM_001038702chr572537 2178 1694 998 827 546 122 ------
NM_001038707chr172234 2058 1891 1802 778 632 253 --12023 --
NM_001038707chr172234 2058 1891 1802 778 632 253 --12023 --
NM_001039199chr2074899 4845 4741 4353 4045 1391 878 11894 14150 --
NM_001039538chr253379 2347 1451 709 701 12244 ----
NM_001039550chr23664 324 35 ------
NM_001039577chr184169 3707 3301 1792 1681 1370 1241 394 33314 1480 919 13290 13602
NM_001039585chr122658 324 ----1167
NM_001039590chrX64011 3716 3419 3240 1159 815 23444 852 1396 11291
NM_001039591chrX64011 3716 3419 3240 1159 815 23444 852 1396 11291
NM_001039618chr1175272 4915 4301 4075 536 359 141 ------
NM_001039619chr14138 ------
NM_001039690chr1672158 2030 2015 1844 958 219 74 11928 1867 11965
NM_001039693chr234088 2930 1619 ------
NM_001039709chr2094675 4246 3931 3447 3260 1747 781 440 309 13501 14184 --
NM_001039711chr111141 ------
NM_001039712chr111141 ------
NM_001039771chr142893 334 ------
NM_001039802chr1--1935 --11263
NM_001039840chrX45824 5335 4375 1066 ------
NM_001039885chr1931042 1011 494 21268 1095 ----
NM_001039888chr1--168 1594 --
NM_001039916chr12----1844 --
NM_001039917chr12----1844 --
NM_001039918chr12----1844 --
NM_001039919chr12----1844 --
NM_001039920chr12----1844 --
NM_001039937chr1331565 1369 958 ------
NM_001039960chr1231061 558 148 ----11088
NM_001040001chr631940 412 48 ------
NM_001040020chr731538 1294 1119 ------
NM_001040057chr72970 518 --11510 --
NM_001040058chr4197 ------
NM_001040060chr4197 ------
NM_001040100chr31895 155 ----
NM_001040101chr411222 --1247 --
NM_001040110chr741470 1450 1368 1304 ------
NM_001040113chr161637 1865 ----
NM_001040144chr1672158 2030 2015 1844 958 219 74 11928 1867 11965
NM_001040146chr1672158 2030 2015 1844 958 219 74 11928 1867 11965
NM_001040152chr724402 693 --11203 --
NM_001040158chr52109 47 ------
NM_001040202chr43542 380 30 1312 ----
NM_001040214chr631614 1560 706 1699 ----
NM_001040272chr932158 758 185 12392 1546 --
NM_001040284chr1695148 4703 4547 4520 3714 2066 1457 1154 136 --11399 --
NM_001040402chr432032 940 154 13138 ----
NM_001040409chr22856 301 144 ----
NM_001040429chr1343483 2882 2761 2469 1924 ----
NM_001040439chr165964 255 244 175 121 ------
NM_001040440chr52481 23 ------
NM_001040446chr512037 21017 81 1438 --
NM_001040450chr152550 315 ------
NM_001040453chr152550 315 ------
NM_001040624chr842730 2717 2099 611 --21875 152 --
NM_001040625chr842730 2717 2099 611 --21875 152 --
NM_001040626chr842730 2717 2099 611 --21875 152 --
NM_001040627chr842730 2717 2099 611 --21875 152 --
NM_001040628chr842730 2717 2099 611 --21875 152 --
NM_001040629chr842730 2717 2099 611 --21875 152 --
NM_001040630chr842730 2717 2099 611 --21875 152 --
NM_001040665chr754369 4280 3061 1862 73 --14667 12001
NM_001040709chr172024 1918 1844 689 655 414 145 ------
NM_001040712chr943347 2522 1333 779 1363 33567 2925 984 --
NM_001042355chr16104944 3622 3485 2140 1972 1611 1023 732 544 73 --15314 --
NM_001042361chr103498 300 156 ------
NM_001042364chr103498 300 156 ------
NM_001042365chr103498 300 156 ------
NM_001042387chr103498 300 156 ------
NM_001042388chr18----1745 --
NM_001042393chr103498 300 156 ------
NM_001042396chr103498 300 156 ------
NM_001042397chr103498 300 156 ------
NM_001042404chr131293 100 92 ------
NM_001042406chr62467 45 --11140 --
NM_001042412chr16104944 3622 3485 2140 1972 1611 1023 732 544 73 --15314 --
NM_001042413chr983971 3095 2935 2913 1538 1369 1206 997 ------
NM_001042414chr131232 ------
NM_001042424chr462901 2481 2142 1310 1071 98 22662 213 12518 --
NM_001042425chr631273 587 74 ----1471
NM_001042453chrX11498 1565 1373 --
NM_001042473chr1012057 ------
NM_001042476chr1652013 1982 1716 1593 649 ------
NM_001042479chrX1399 1274 ----
NM_001042480chrX1399 1274 ----
NM_001042481chr1431044 327 112 133 ----
NM_001042486chr2021470 177 11330 ----
NM_001042492chr1743316 2890 2740 491 12711 22811 985 --
NM_001042493chr641436 617 567 555 ------
NM_001042494chr1553783 3676 1492 504 425 170 ----
NM_001042495chr1553783 3676 1492 504 425 170 ----
NM_001042496chr1553783 3676 1492 504 425 170 ----
NM_001042497chr1553783 3676 1492 504 425 170 ----
NM_001042510chr842160 1380 455 397 ------
NM_001042511chr842160 1380 455 397 ------
NM_001042537chrX31614 342 275 ------
NM_001042543chr431503 1328 157 ----11605
NM_001042555chr1233602 3574 849 --21284 550 --
NM_001042576chr202386 115 ------
NM_001042599chr277153 6953 4820 3086 2948 2142 961 26090 2517 36022 5392 1330 --
NM_001042601chr343225 2933 2480 2052 --23173 2913 --
NM_001042604chr384302 3737 2971 1752 1279 1038 986 365 11827 11548 --
NM_001042632chr2021722 530 --32008 1777 575 --
NM_001042633chr2021722 530 --32008 1777 575 --
NM_001042669chr441338 638 394 330 ------
NM_001042681chr152237 2136 2088 1812 40 1336 ----
NM_001042682chr152237 2136 2088 1812 40 1336 ----
NM_001042682chr152237 2136 2088 1812 40 1336 ----
NM_001042683chr641434 1372 1220 396 --11210 --
NM_001042728chr125961 852 808 779 188 ------
NM_001042749chrX52023 1762 1753 1520 1467 --11376 --
NM_001042750chrX52023 1762 1753 1520 1467 --11376 --
NM_001042751chrX52023 1762 1753 1520 1467 --11376 --
NM_001043318chr1453302 3240 662 610 155 ------
NM_001043351chr111964 --21648 602 11465
NM_001044305chr661605 1528 1160 301 277 210 ------
NM_001044385chr262713 2604 1265 943 842 503 ------
NM_001046chr5--12689 ----
NM_001050chr17----1160 --
NM_001071775chr132278 226 ------
NM_001076chr41169 ------
NM_001076chr41169 ------
NM_001077628chr1175 ------
NM_001083620chr432195 1805 886 ------
NM_001083621chr184730 3081 1518 781 710 645 109 60 11539 44256 3419 1065 653 --
NM_001092chr1751805 1571 1563 418 127 31821 1022 711 21624 838 --
NM_001095chr121283 1747 ----
NM_001100108chr1118217 7821 7467 6578 5545 5240 2996 1629 935 745 618 37382 5263 2776 ----
NM_001106chr378862 7969 6722 2937 2514 2263 195 27880 1027 28540 6218 16214
NM_001113490chrX93677 3319 3218 2798 2758 2488 2474 1388 868 13164 --1897
NM_001116chr1632731 969 583 22614 1159 ----
NM_001117chr1842203 2057 1818 720 --12139 --
NM_001121chr1021616 1390 --1229 --
NM_001122679chr51940 ------
NM_001126chr11198 --2428 189 --
NM_001128chr1643542 3410 788 765 ------
NM_001144chr1631105 317 22 ------
NM_001148chr442105 222 184 124 ------
NM_001149chr1031359 1138 410 ------
NM_001152chrX191 ------
NM_001167chrX65310 4722 4627 4152 1335 188 16071 32232 1969 969 11280
NM_001172chr142717 548 1196 ----
NM_001173chr1464699 4374 4243 3239 2968 1774 ------
NM_001174chrX42046 1831 1756 401 ------
NM_001186chr2152936 2554 2018 486 342 1971 1564 --
NM_001189chr44834 130 124 44 ------
NM_001191chr2011428 11465 1202 --
NM_001196chr2221114 1053 ----1891
NM_001200chr201424 --11073 --
NM_001204chr2127734 7481 7181 6505 6221 5161 1924 1905 1777 339 167 149 16427 1628 --
NM_001206chr933029 2918 520 --12850 --
NM_001218chr1512197 1105 22630 64 --
NM_001219chr732201 543 49 --1337 --
NM_001222chr1021489 465 ------
NM_001237chr43972 795 781 ------
NM_001237chr43972 795 781 ------
NM_001241chr221519 961 ------
NM_001241chr221519 961 ------
NM_001248chr331077 347 315 ------
NM_001256chr1721132 183 ------
NM_001257chr1631403 1256 333 ------
NM_001259chr765910 4799 1675 1594 1462 198 25941 1885 14747 11248
NM_001275chr141257 ------
NM_001282chr1762444 2199 2187 1002 580 174 1890 ----
NM_001286chr192783 2742 2709 2549 2429 2080 907 876 732 1449 ----
NM_001304chr1783621 3266 3223 2626 2500 2475 1494 52 --13583 --
NM_001310chr1252899 2840 2256 960 673 ------
NM_001315chr612252 21949 1459 ----
NM_001319chr192991 407 ------
NM_001328chr42590 301 ------
NM_001332chr521313 1131 ------
NM_001343chr531264 496 110 11237 11536 --
NM_001351chr32610 511 21625 1237 ----
NM_001356chrX22323 1669 ------
NM_001358chr4139 ------
NM_001364chr1133814 637 326 14567 ----
NM_001386chr821992 666 1139 12304 --
NM_001387chr553153 3094 2942 2679 556 1879 13031 21129 984
NM_001391chr183882 278 73 --1418 --
NM_001396chr212569 548 1217 ----
NM_001402chr611930 ------
NM_001406chr1741643 1511 1376 541 21524 638 ----
NM_001407chr331568 1478 126 --1266 --
NM_001408chr131312 1119 408 ------
NM_001412chrX21173 680 --13210 --
NM_001414chr123670 246 189 133 ----
NM_001415chrX2282 108 ------
NM_001418chr112588 130 ------
NM_001418chr112588 130 ------
NM_001419chr1984785 4716 4389 3677 3650 3551 3460 3017 --14815 --
NM_001427chr761988 1356 684 580 422 120 --1640 --
NM_001430chr231741 380 51 ------
NM_001431chr61174 1835 1244 --
NM_001432chr452837 2617 2554 623 589 21040 322 13806 --
NM_001438chr172867 2434 1064 872 813 779 149 ----13617
NM_001444chr8------157
NM_001448chrX21634 166 21685 1466 ----
NM_001449chrX21274 372 ------
NM_001453chr61711 ----1161
NM_001458chr72667 624 1700 ----
NM_001482chr151340 --1770 --
NM_001483chr71741 ------
NM_001497chr921732 965 --21972 203 --
NM_001498chr621403 1232 ------
NM_001526chr61158 ------
NM_001530chr141215 2762 204 ----
NM_001542chr142253 595 266 192 12067 --12275
NM_001543chr574768 4595 4232 4086 3768 1279 676 14415 14438 13585
NM_001546chr61931 ------
NM_001560chrX22539 937 1124 ----
NM_001563chr61536 ------
NM_001604chr111205 --1121 --
NM_001610chr112776 683 ------
NM_001614chr171488 ------
NM_001614chr171488 ------
NM_001616chr242729 2700 864 487 --1599 --
NM_001634chr632031 1705 1425 ------
NM_001635chr72951 31 ------
NM_001654chrX1156 ------
NM_001658chr121137 67 --1233 --
NM_001660chr31263 ------
NM_001663chr1421963 318 ------
NM_001664chr32962 368 ------
NM_001667chr111303 ------
NM_001668chr11796 11979 ----
NM_001681chr124713 531 219 180 1522 ----
NM_001682chr1222699 2159 ------
NM_001684chr132573 1219 98 11634 --13968
NM_001690chr342394 2026 1634 107 1458 ----
NM_001694chr161362 ------
NM_001701chr921187 531 --21277 562 --
NM_001704chr61193 ------
NM_001706chr32800 181 ------
NM_001707chr72662 327 ----1776
NM_001709chr1132348 912 84 ------
NM_001718chr631098 403 316 1902 --1483
NM_001721chrX196 ------
NM_001730chr131360 --1570 --
NM_001730chr131360 --1570 --
NM_001731chr122662 270 1857 ----
NM_001742chr7----1657 --
NM_001746chr552102 2039 944 908 701 22538 686 22109 690 --
NM_001753chr721457 144 ------
NM_001754chr2122938 718 11003 12752 --
NM_001755chr162870 474 11784 ----
NM_001759chr1265198 4948 3698 1672 1440 1121 1725 13331 14638
NM_001761chr1621757 361 ------
NM_001773chr11373 21046 231 31360 1050 562 --
NM_001777chr363485 3458 3448 2552 481 452 ------
NM_001788chr73938 260 49 ------
NM_001789chr32562 245 11711 ----
NM_001791chr1--1935 --11263
NM_001792chr1821106 199 ------
NM_001798chr121758 11134 ----
NM_001804chr52791 192 ------
NM_001806chr1952913 2712 2552 2524 156 11802 ----
NM_001822chr22656 161 ------
NM_001830chrX42528 1442 1033 616 --13491 1862
NM_001838chr172933 118 --1728 --
NM_001839chr11280 ------
NM_001854chr11397 ------
NM_001865chr6133 --144 --
NM_001866chrX--144 ----
NM_001884chr52475 24 ------
NM_001895chr20166 ------
NM_001903chr53677 361 268 ------
NM_001904chr31244 ------
NM_001918chr178408 7886 7477 7393 6502 3627 1106 --16966 --
NM_001931chr11----1221 --
NM_001935chr22777 254 --1804 --
NM_001938chr111367 --1463 --
NM_001939chrX73506 3471 3416 1309 1193 976 865 1659 23571 545 --
NM_001946chr123916 461 68 --1442 --
NM_001949chr653078 2137 2120 824 563 --1526 --
NM_001955chr61750 ------
NM_001964chr51218 11079 ----
NM_001970chr171186 ------
NM_001977chr431342 1304 335 ------
NM_001995chr42290 36 11208 ----
NM_002006chr485155 4682 4616 3615 1260 1181 903 473 197 35086 3532 1100 14084
NM_002009chr1542531 2490 1994 28 ------
NM_002010chr132500 399 --198 --
NM_002015chr1342523 2399 2304 656 --1848 --
NM_002017chr1111214 ------
NM_002024chrX3865 447 343 ----12176
NM_002025chrX88591 8377 8345 3504 3179 3070 2548 719 22484 1472 15798 --
NM_002027chr81173 ------
NM_002031chr6194 ------
NM_002035chr1853260 2909 2854 850 49 12892 13744 --
NM_002037chr6160 ------
NM_002039chr41910 --1226 --
NM_002040chr2142193 1106 451 60 1898 ----
NM_002051chr101864 ------
NM_002054chr2----1440 --
NM_002061chr121390 584 ------
NM_002063chrX2909 404 1951 1960 --
NM_002069chr721338 431 ------
NM_002077chr91261 21733 1502 11942 --
NM_002086chr1722005 493 ------
NM_002090chr42469 100 1248 ----
NM_002092chr494824 3811 3774 3293 3248 1199 1045 854 82 34220 1502 587 13112 --
NM_002094chr16----1154 --
NM_002103chr191155 --11021 --
NM_002106chr41147 ------
NM_002114chr6----1157 --
NM_002126chr1751145 1076 561 524 435 13052 1348 --
NM_002128chr1352485 879 684 582 324 1341 ----
NM_002129chr4--186 ----
NM_002130chr511324 ------
NM_002137chr741739 926 263 74 ------
NM_002139chrX--135 ----
NM_002154chr51108 ------
NM_002156chr23151 138 89 ------
NM_002158chr253699 3004 2776 2344 1497 ------
NM_002182chr32496 465 --12805 --
NM_002189chr102241 57 ------
NM_002193chr231598 494 162 1317 ----
NM_002196chr2021072 1018 --1735 --
NM_002196chr2021072 1018 --1735 --
NM_002203chr52848 149 ------
NM_002210chr252347 1430 1403 1207 316 11247 ----
NM_002211chr104983 399 382 224 11117 ----
NM_002214chr775420 5257 4966 4907 4766 2186 1265 --31858 1763 1739 14301
NM_002222chr331354 396 123 ------
NM_002223chr1273473 3264 2708 2585 1373 581 344 --1144 13057
NM_002224chr62489 234 ------
NM_002226chr141757 ------
NM_002247chr102660 328 1275 ----
NM_002252chr2158 ------
NM_002254chr232318 645 327 1613 1626 --
NM_002264chr321086 176 13933 13082 --
NM_002267chr1332369 1559 330 --1961 --
NM_002268chr321524 1189 ------
NM_002270chr565320 4985 4283 3753 3480 1592 --1565 --
NM_002271chr1331624 579 332 ----1939
NM_002285chr231188 819 211 ------
NM_002293chr152677 2528 1014 874 751 --11082 --
NM_002294chrX165 ----1178
NM_002295chr3163 ------
NM_002296chr121706 1437 ------
NM_002310chr595830 4655 2543 1846 1656 939 847 758 731 --15223 --
NM_002313chr10105013 4561 4416 3967 3573 2044 1258 1142 654 561 11367 33584 3237 1126 --
NM_002314chr741035 760 362 83 1813 ----
NM_002334chr1132105 1740 1633 --11677 --
NM_002336chr1274279 4088 1749 1730 1503 855 457 --23721 877 --
NM_002351chrX3323 228 80 ----11062
NM_002356chr61691 12757 --11811
NM_002359chr1733692 2960 1372 1455 43196 3133 1627 219 1460
NM_002360chr732478 688 527 1136 ----
NM_002372chr5187 ------
NM_002373chr1521277 42 11082 ----
NM_002374chr253379 2347 1451 709 701 12244 ----
NM_002375chr321824 1755 1917 ----
NM_002376chr14--2468 444 ----
NM_002382chr143342 275 168 --21229 64 --
NM_002384chr181169 ------
NM_002390chr1741780 1646 1363 625 2297 236 ----
NM_002391chr111113 ------
NM_002395chr621443 542 ------
NM_002398chr241100 953 265 146 ------
NM_002399chr1511070 ------
NM_002401chr1732373 2217 1827 ------
NM_002430chr2232224 1890 778 12501 1703 12148
NM_002442chr1221766 1563 ------
NM_002444chrX1364 ----11808
NM_002479chr12202 114 1284 ----
NM_002480chr1231044 543 290 11435 1393 --
NM_002481chr1127720 7520 6831 4812 3090 1975 1514 1415 1376 769 315 285 17028 45922 5361 2508 381 1889
NM_002486chr942355 595 384 253 ------
NM_002499chr1532310 1725 212 --11703 --
NM_002500chr22510 210 ------
NM_002501chr1961491 1388 1260 612 514 228 --21145 984 --
NM_002509chr203810 277 202 --1137 --
NM_002516chr19----188 --
NM_002518chr211161 --134 --
NM_002519chr111158 --11502 --
NM_002522chr1722843 446 1795 23403 2578 --
NM_002523chr72778 355 ------
NM_002526chr621557 664 1327 11347 --
NM_002537chr1511020 ------
NM_002539chr22245 36 ------
NM_002540chr93704 136 128 ------
NM_002545chr1161956 1753 1506 1482 168 82 14434 ----
NM_002547chrX63266 3029 961 758 327 110 --13094 --
NM_002553chr7172 ------
NM_002556chr1122113 185 ------
NM_002568chr8--1345 1357 --
NM_002570chr153290 273 113 ------
NM_002572chr11----248 34 --
NM_002577chr343551 1060 657 501 ----12556
NM_002581chr964637 4589 4288 958 386 75 ------
NM_002586chr611566 1561 ----
NM_002588chr551701 1495 381 206 54 ------
NM_002594chr2052187 978 766 305 42 --12080 --
NM_002595chr1221713 486 ------
NM_002600chr131665 1659 121 21537 170 --11694
NM_002608chr2231544 1413 441 1221 ----
NM_002609chr53433 262 109 ------
NM_002610chr272391 2369 2166 2038 1221 605 376 --1550 --
NM_002612chr761858 1789 1681 673 276 212 11736 ----
NM_002616chr173517 366 111 ------
NM_002622chr5179 ------
NM_002623chr201254 ------
NM_002628chr32888 775 ------
NM_002633chr1----1466 --
NM_002636chr61458 ------
NM_002641chrX31855 804 547 ------
NM_002645chr1112461 1711 --1310
NM_002646chr12876 116 12091 ----
NM_002648chr641181 1120 1070 70 ------
NM_002655chr865248 4854 4674 3265 1554 187 13942 ----
NM_002656chr62947 65 ------
NM_002657chr2033585 3572 433 11569 11525 22981 23
NM_002660chr202979 199 ------
NM_002687chr14----1448 --
NM_002698chr1942523 1182 1029 793 ------
NM_002706chr21637 ------
NM_002709chr222948 2758 ------
NM_002710chr12----187 --
NM_002714chr651143 1001 978 773 407 --1128 1844
NM_002715chr52522 346 1201 ----
NM_002716chr1163609 3484 2643 2575 1217 796 32970 2635 691 --12952
NM_002717chr81579 1437 ----
NM_002719chr1461846 1502 924 466 89 38 ----12158
NM_002731chr1--1470 12570 --
NM_002733chr122571 230 ------
NM_002734chr1751740 1398 895 578 111 ----1765
NM_002737chr1756609 6044 5552 4226 1405 24065 1186 --14748
NM_002745chr2274477 1540 1525 1392 830 657 65 13012 ----
NM_002748chr15------1809
NM_002763chr11128 1553 ----
NM_002790chr11139 --142 --
NM_002793chr6------129
NM_002806chr14----1370 --
NM_002811chr163507 478 196 ------
NM_002814chrX1175 ------
NM_002816chr171281 ------
NM_002819chr192437 127 1192 ----
NM_002822chr123477 296 48 ----1586
NM_002823chr21509 ------
NM_002825chr7150 ------
NM_002826chr11719 1258 --1299
NM_002828chr182988 951 ------
NM_002829chr92969 246 ------
NM_002830chr2----1389 --
NM_002833chr1521171 82 ------
NM_002834chr1233291 891 691 43498 2807 1269 1064 ----
NM_002835chr72677 513 ------
NM_002839chr943347 2522 1333 779 1363 33567 2925 984 --
NM_002840chr141439 1349 625 58 ------
NM_002841chr32708 566 ------
NM_002844chr6--11380 11325 --
NM_002847chr72542 516 --1117 --
NM_002849chr122430 166 ------
NM_002850chr192847 440 ------
NM_002851chr71614 ------
NM_002852chr31235 1614 ----
NM_002855chr1143409 3166 687 578 11460 11474 --
NM_002858chr141175 532 423 327 ----11088
NM_002868chr1262339 2226 2210 2101 989 137 32319 1899 472 ----
NM_002869chr112485 160 11620 ----
NM_002874chr91384 12145 1240 1971
NM_002884chr141075 798 682 21 ------
NM_002885chr13870 718 379 1824 ----
NM_002886chr385185 4888 4786 3296 1061 837 593 306 --11296 --
NM_002890chr52884 62 --1625 --
NM_002897chr21547 ------
NM_002902chr15155 ------
NM_002906chr1142109 2082 1624 773 1687 1327 --
NM_002907chr121305 ------
NM_002912chr61637 1178 ----
NM_002924chr1--158 ----
NM_002941chr31502 ------
NM_002942chr31576 --21279 324 --
NM_002953chr12771 585 --1504 1195
NM_002955chr611663 11981 ----
NM_002957chr963786 3390 3357 3049 2714 480 22504 2439 13968 12584
NM_002959chr1114299 3642 3467 3162 2982 1694 1507 1356 863 544 109 13634 1397 --
NM_002966chr1175 ------
NM_002973chr12--1152 ----
NM_002977chr253122 2957 2682 1364 252 ------
NM_002994chr421210 135 11311 --1204
NM_002998chr81854 11562 ----
NM_003000chr1--136 ----
NM_003001chr13895 352 241 --1311 --
NM_003010chr1712448 ------
NM_003012chr862581 2321 2193 2157 1080 130 ------
NM_003013chr41124 1285 174 --
NM_003016chr1722036 1635 1635 --1443
NM_003017chr62943 121 11120 ----
NM_003022chrX3958 346 72 ------
NM_003026chr92838 267 ------
NM_003028chr953382 2706 845 740 308 22571 1157 21539 829 --
NM_003029chr141307 1276 1117 478 ------
NM_003031chr162670 44 ----1647
NM_003036chr13238 80 70 1458 1854 --
NM_003042chr321762 1416 ------
NM_003045chr1373851 3717 3412 1304 780 490 275 2980 291 24589 168 1756
NM_003051chr141894 1649 722 249 134 ----
NM_003062chr5140 ------
NM_003069chrX2220 102 ------
NM_003071chr331847 1749 26 --2307 256 --
NM_003074chr31114 ------
NM_003077chr173681 605 126 ------
NM_003079chr17--1332 ----
NM_003081chr2021164 48 --1147 --
NM_003091chr20129 --1197 --
NM_003093chr61220 ------
NM_003095chr121301 ------
NM_003099chr1584726 4436 2548 2382 2271 1144 568 171 15913 11303 --
NM_003107chr622644 2427 ------
NM_003108chr2117198 6477 5747 5561 5303 5257 4625 4475 1959 1831 1578 12789 12811 --
NM_003110chr171714 ------
NM_003111chr21493 11275 ----
NM_003112chr732432 1999 471 ------
NM_003113chr21316 ------
NM_003127chr91109 ------
NM_003131chr62301 273 --1535 --
NM_003133chr121050 180 ------
NM_003137chr622172 1814 ------
NM_003149chr321303 565 ------
NM_003150chr1761818 1774 1671 905 723 332 --1938 11512
NM_003153chr1221047 34 ------
NM_003155chr832390 843 382 ----12242
NM_003156chr112291 31 --2310 284 --
NM_003161chr1753509 3113 2679 1437 1107 ----1557
NM_003162chr23708 308 202 11041 ----
NM_003164chr112537 477 ------
NM_003165chr921295 153 --21230 176 --
NM_003170chr172425 394 ------
NM_003178chr341671 1436 848 424 12258 1152 --
NM_003182chr7----129 --
NM_003182chr7----129 --
NM_003185chr202426 294 --1135 --
NM_003186chr112156 41 ------
NM_003188chr6193 --1573 --
NM_003189chr151201 1192 1051 515 92 --1356 --
NM_003194chr6162 ------
NM_003199chr1864974 4491 2155 1997 524 481 14699 ----
NM_003201chr10------1136
NM_003211chr1241313 1146 231 70 ------
NM_003216chr2242392 2311 680 528 --32342 641 147 --
NM_003217chr1231609 1295 415 ----11930
NM_003220chr631273 587 74 ----1471
NM_003221chr683072 2598 1643 1389 1189 819 644 72 --21555 797 --
NM_003234chr352128 1993 1657 785 152 ------
NM_003242chr332361 1543 348 --11905 --
NM_003244chr182122 23 ------
NM_003246chr152591 277 ------
NM_003247chr621979 792 ----164
NM_003253chr2121444 443 ------
NM_003255chr1772361 1909 907 765 702 470 67 12111 ----
NM_003262chr333471 891 571 --33728 3608 1841 24477 1962
NM_003274chr2142465 2017 1196 1158 ------
NM_003275chr92938 428 --1118 --
NM_003286chr201338 ------
NM_003288chr2031297 629 65 21389 1017 --11332
NM_003290chr191212 --1221 --
NM_003291chr13--1279 ----
NM_003292chr112052 --2525 467 --
NM_003298chr3126163 6006 5996 5376 3839 3825 2273 2259 2234 2053 1099 866 32153 2013 695 25193 4515 --
NM_003305chr4----2315 137 --
NM_003315chr172223 46 171 ----
NM_003317chr141287 ------
NM_003320chr1174086 3057 3006 1401 721 648 319 14108 23066 826 --
NM_003326chr11792 1103 2943 578 --
NM_003335chr3--128 ----
NM_003336chrX2341 240 ------
NM_003337chr541501 1282 483 131 --11753 --
NM_003338chr1021783 367 ----2406 267
NM_003339chr51240 ------
NM_003340chr43975 387 183 ------
NM_003341chr32276 228 ------
NM_003342chr1753165 2426 2071 861 417 ------
NM_003344chr761496 1401 1368 1256 634 393 ------
NM_003348chr1221295 322 ------
NM_003352chr21740 ------
NM_003359chr4--11298 --2529 170
NM_003363chr32620 549 ------
NM_003368chr13556 213 83 ------
NM_003369chr1142671 2500 279 263 ------
NM_003370chr192760 636 ------
NM_003371chr922015 73 ------
NM_003372chrX3708 338 254 ------
NM_003373chr102616 424 ------
NM_003374chr5----1142 --
NM_003375chr102163 153 ------
NM_003380chr10176 ------
NM_003383chr91101 1611 1200 --
NM_003387chr231110 293 218 12243 ----
NM_003392chr374191 4128 3603 3318 3307 1091 305 21158 671 1430 --
NM_003394chr121131 ------
NM_003400chr22657 612 ------
NM_003403chr142785 765 ------
NM_003404chr2052081 2010 1847 1647 1369 ------
NM_003405chr221531 --1495 --
NM_003406chr81625 ------
NM_003409chr181142 --1181 --
NM_003410chrX52814 2619 1945 1235 191 ------
NM_003411chrY1180 ------
NM_003412chr362535 2230 1915 916 379 337 --12732 --
NM_003413chrX31710 1523 711 ------
NM_003418chr31786 ------
NM_003439chr731278 1027 631 13296 1684 --
NM_003455chr112460 362 ------
NM_003458chr353709 1610 829 172 86 --13728 --
NM_003459chr21714 ------
NM_003463chr622692 1222 ------
NM_003466chr261965 1630 1531 975 865 644 1896 ----
NM_003467chr21442 ------
NM_003468chr2104110 4070 2908 2810 2790 2737 840 670 646 493 1189 ----
NM_003470chr1641564 426 347 147 1740 ----
NM_003471chr342213 1730 836 99 ------
NM_003472chr631253 1004 324 ------
NM_003473chr10------196
NM_003474chr1042038 1732 822 451 1426 156 --
NM_003478chr1112849 ------
NM_003482chr1242468 2461 1774 239 ------
NM_003483chr1242965 1186 1082 631 22410 260 ----
NM_003489chr21--22589 470 --11195
NM_003559chr1753610 3595 3084 1441 166 --21042 439 12997
NM_003563chr1741002 964 447 261 --11191 --
NM_003565chr1251100 1088 691 460 196 1160 11113 --
NM_003566chr1262788 2376 2356 1380 817 527 --11009 13326
NM_003567chr12381 48 ------
NM_003574chr1854175 1296 812 234 187 23988 2042 --24904 4819
NM_003576chr1362862 2822 2603 2529 1994 834 --1210 --
NM_003580chr81514 ------
NM_003582chr11182 ------
NM_003583chr1253831 3629 901 859 633 176 --13616
NM_003590chr273892 3794 3488 1140 477 225 170 34028 3959 312 ----
NM_003595chr22----1447 --
NM_003607chr133972 3448 3316 32938 384 215 ----
NM_003613chr151257 ------
NM_003615chr323811 2684 11247 13160 --
NM_003617chr131904 1515 94 23777 1533 23781 243 --
NM_003618chr21106 ------
NM_003626chr1131228 983 495 ------
NM_003629chr112687 13336 13157 --
NM_003631chr102237 161 ------
NM_003632chr173568 94 32 ------
NM_003633chr521972 669 ------
NM_003654chr111744 1129 ----
NM_003655chr171275 ------
NM_003660chr191288 ------
NM_003663chr333188 2431 625 13024 ----
NM_003664chr51227 --1411 --
NM_003670chr361121 1110 941 901 384 336 --1450 --
NM_003671chr952990 2689 2606 883 209 --11200 --
NM_003677chr1211900 ----1503
NM_003688chrX----1211 --
NM_003692chr92916 143 ------
NM_003704chr42516 215 --1172 --
NM_003713chr151529 1477 1119 559 263 ------
NM_003716chr31138 1687 ----
NM_003718chr71108 ------
NM_003722chr342653 2397 2058 91 1821 1565 12385
NM_003728chr41232 ------
NM_003735chr551701 1495 381 206 54 ------
NM_003736chr551701 1495 381 206 54 ------
NM_003743chr231806 1744 497 --1514 --
NM_003745chr162391 145 ------
NM_003749chr1321734 260 11973 --1465
NM_003758chr1531583 1054 1005 --181 --
NM_003758chr1531583 1054 1005 --181 --
NM_003759chr443280 1518 511 237 ------
NM_003760chr1----1557 --
NM_003763chr203661 562 263 12759 ----
NM_003768chr11741 1184 ----
NM_003769chr12----1255 --
NM_003778chr32573 191 1105 ----
NM_003787chr1821350 1278 --11057 --
NM_003794chr3----1123 --
NM_003795chr62214 133 ------
NM_003796chr19----1192 --
NM_003800chr612285 ----12217
NM_003818chr201209 1427 ----
NM_003822chr153075 992 660 575 467 --13129 --
NM_003829chr9--139 ----
NM_003831chr182671 47 --21120 698 1167
NM_003846chr11801 ------
NM_003858chr144730 711 247 192 ------
NM_003861chr141908 ----12365
NM_003872chr242363 2161 685 284 1516 ----
NM_003873chr1012213 11671 2562 203 --
NM_003884chr34572 557 263 154 ------
NM_003885chr1742629 1832 763 66 ------
NM_003887chr25935 746 435 357 299 22149 670 --22183 466
NM_003888chr1551299 1201 551 437 72 ------
NM_003893chr101484 ------
NM_003896chr2--1105 1149 --
NM_003899chr1352335 2109 1689 248 36 ------
NM_003908chr201318 11132 ----
NM_003909chr832330 2025 625 ------
NM_003913chr643720 3336 1668 609 1263 22848 1496 --
NM_003916chrX2945 257 ----179
NM_003924chr41350 ------
NM_003927chr181932 ------
NM_003930chr752409 2055 1918 1701 82 ------
NM_003931chr61455 ------
NM_003939chr1044005 3891 3155 455 --13741 13538
NM_003941chr722404 503 ------
NM_003949chr1711569 --2716 246 --
NM_003953chr142859 2815 2450 2208 ------
NM_003955chr172222 109 --1293 --
NM_003958chr673512 3319 3164 3085 750 487 479 1558 23557 3548 1969
NM_003966chr567041 3075 1991 1951 535 39 --27510 1194 27377 5591
NM_003972chr1041322 1245 1223 39 ------
NM_003980chr641381 1235 1124 538 --11039 --
NM_003983chr1673011 2878 2870 1355 986 528 271 ------
NM_003987chr1051767 803 640 301 39 --1737 --
NM_003988chr1051844 880 717 378 116 --1814 --
NM_003992chr15--1318 ----
NM_003994chr1242957 1590 1192 78 23658 52 2564 438 24179 3729
NM_003996chr6130 ----1197
NM_004006chrX62586 1992 1862 1827 901 644 --22319 1063 --
NM_004007chrX62586 1992 1862 1827 901 644 --22319 1063 --
NM_004009chrX62586 1992 1862 1827 901 644 --22319 1063 --
NM_004010chrX62586 1992 1862 1827 901 644 --22319 1063 --
NM_004011chrX62586 1992 1862 1827 901 644 --22319 1063 --
NM_004012chrX62586 1992 1862 1827 901 644 --22319 1063 --
NM_004013chrX62586 1992 1862 1827 901 644 --22319 1063 --
NM_004014chrX62586 1992 1862 1827 901 644 --22319 1063 --
NM_004015chrX62586 1992 1862 1827 901 644 --22319 1063 --
NM_004016chrX62500 1906 1776 1741 815 558 --22233 977 --
NM_004017chrX62586 1992 1862 1827 901 644 --22319 1063 --
NM_004018chrX62500 1906 1776 1741 815 558 --22233 977 --
NM_004020chrX62586 1992 1862 1827 901 644 --22319 1063 --
NM_004021chrX62500 1906 1776 1741 815 558 --22233 977 --
NM_004022chrX62500 1906 1776 1741 815 558 --22233 977 --
NM_004023chrX62500 1906 1776 1741 815 558 --22233 977 --
NM_004027chr2124 ------
NM_004046chr18--132 ----
NM_004050chr1452261 1872 1694 725 582 --22343 1978 --
NM_004061chr51193 ------
NM_004071chr2184 ------
NM_004077chr123515 450 369 --1189 --
NM_004081chrY2609 100 11263 ----
NM_004082chr2----1126 --
NM_004087chr341505 1410 418 132 ------
NM_004093chr1372960 2953 2664 2507 1128 1075 619 2761 160 ----
NM_004100chr672711 2627 2499 2453 2081 1667 287 ------
NM_004102chr14385 148 142 41 ------
NM_004107chr191152 ------
NM_004111chr111643 ----1202
NM_004112chr1751761 1447 1401 1193 358 21436 350 ----
NM_004114chrX11036 ------
NM_004124chr1453453 3371 2794 810 623 ------
NM_004130chr31223 --1616 --
NM_004136chr1513243 ------
NM_004162chr321032 883 ----11156
NM_004171chr11159527 8745 7883 7277 6720 6187 5995 3590 3430 3424 2411 2294 2282 288 260 18819 --12006
NM_004172chr541539 1409 446 400 177 ----
NM_004176chr172120 58 ------
NM_004183chr113806 610 138 ------
NM_004186chr33749 667 282 --1851 --
NM_004187chrX2948 371 11426 1186 --
NM_004193chr103426 397 177 ------
NM_004215chr81459 --144 --
NM_004227chr763042 2316 2066 2010 349 276 ------
NM_004228chr191118 ------
NM_004229chrX21672 71 ------
NM_004230chr19--12231 --2734 415
NM_004232chr1883413 3055 1450 1400 1276 916 135 111 ------
NM_004236chr151186 1596 ----
NM_004241chr101171 ------
NM_004249chr4--194 ----
NM_004272chr521883 182 ------
NM_004274chr1421158 1087 1363 11218 --
NM_004279chr732073 344 265 ------
NM_004281chr102101 87 ------
NM_004304chr21338 ------
NM_004311chr1083155 2966 2690 2090 998 889 383 105 1855 12989 --
NM_004319chr132898 2131 605 --1378 --
NM_004326chr12787 73 ------
NM_004329chr101213 11083 1422 --
NM_004331chr832045 839 584 ------
NM_004338chr18136074 5871 5391 5339 4954 4833 2486 2480 2218 1441 437 87 24 11157 35583 2437 1166 36111 2102 1185
NM_004342chr742075 798 598 48 ------
NM_004349chr8--1963 11011 --
NM_004369chr21213 ------
NM_004370chr661937 1526 779 699 288 204 ------
NM_004379chr221277 650 --1685 --
NM_004380chr1632288 1714 1627 ------
NM_004385chr52455 92 ------
NM_004386chr192507 453 12321 12075 --
NM_004387chr5149 ------
NM_004389chr2190 ------
NM_004392chr1332170 1747 1736 11679 ----
NM_004393chr322094 230 ------
NM_004395chr55585 312 292 175 94 ------
NM_004397chr1144100 1528 1510 1128 23815 708 13652 --
NM_004405chr23946 255 201 --1429 --
NM_004407chr42887 866 ------
NM_004409chr192579 124 191 ----
NM_004411chr72636 136 ------
NM_004412chr1085507 4809 4363 4213 4135 1134 1072 516 --55286 5171 4819 3672 724 13850
NM_004416chr123965 393 196 ------
NM_004423chr382661 2401 2331 1867 630 408 211 21 --32713 1080 387 --
NM_004426chr1231514 231 183 --1701 --
NM_004427chr11996 --1455 --
NM_004429chrX31165 1074 396 ------
NM_004430chr832049 1707 1033 --1275 --
NM_004432chr941481 420 373 289 ------
NM_004434chr1421653 140 ------
NM_004436chr11516 ------
NM_004437chr1103530 3365 2436 2303 2230 1403 798 780 390 138 1414 12278 11370
NM_004438chr241265 1102 945 461 12540 1906 --
NM_004439chr41172 ------
NM_004441chr33513 298 104 ------
NM_004442chr111720 ------
NM_004444chr72889 354 ------
NM_004447chr1211118 1419 1802 --
NM_004449chr21----1582 --
NM_004454chr3143 ------
NM_004456chr7145 ------
NM_004457chr231405 333 22 ------
NM_004459chr1751585 1557 1457 1415 444 ------
NM_004468chr1----2557 84 --
NM_004475chr1721124 1091 ------
NM_004480chr14----2833 37 2577 53
NM_004481chr141011 696 281 265 --1636 --
NM_004491chr1963315 3099 2655 1682 525 165 13891 23144 1640 --
NM_004494chr1--1840 21313 1288 --
NM_004498chr15------1154
NM_004500chr1471948 1848 1419 1274 416 403 332 1473 ----
NM_004503chr123618 236 226 --1156 --
NM_004504chr253028 2923 1049 308 94 1864 12521 --
NM_004516chr191129 ------
NM_004520chr52267 63 ------
NM_004521chr101380 ------
NM_004529chr911038 11448 21029 155 --
NM_004535chr2031703 700 496 1276 11604 --
NM_004537chr1241500 1292 279 246 ------
NM_004540chr21----1787 --
NM_004560chr91332 ------
NM_004569chr14------1659
NM_004575chr421252 261 ------
NM_004576chr52163 155 ------
NM_004579chr11149 ------
NM_004580chr151171 ----1505
NM_004586chrX63694 3448 2045 1617 1263 398 23779 471 ----
NM_004587chr202386 115 ------
NM_004588chr1173301 3169 2602 1249 914 776 714 ------
NM_004598chr543178 2767 2313 977 --1764 --
NM_004600chr13575 396 194 ------
NM_004612chr943983 3514 1658 1338 13467 11694 --
NM_004621chr111424 --11246 --
NM_004622chr251872 1782 1575 823 93 --1244 --
NM_004631chr11984 --11008 --
NM_004637chr311228 ------
NM_004642chr12--158 1625 --
NM_004643chr142695 617 ----1813
NM_004645chr172837 215 ------
NM_004650chrX51693 756 577 396 381 ------
NM_004654chrY1445 ------
NM_004660chrY1848 ------
NM_004663chr153247 185 147 1393 ----
NM_004673chr131593 1015 293 11233 151 --
NM_004675chr1124 1616 ----
NM_004685chr1322409 1001 22426 764 22552 205 --
NM_004687chr175759 644 630 597 58 ------
NM_004703chr1732441 2102 431 --12423 --
NM_004709chrX11710 --129 --
NM_004710chr172626 243 --1335 --
NM_004719chr1232194 966 492 1713 ----
NM_004725chr103974 569 267 ------
NM_004730chr521924 1515 ----1479
NM_004731chr1221836 93 ------
NM_004734chr1373020 2918 2202 894 851 711 27 12450 ----
NM_004736chr12432 370 ----11638
NM_004739chr111574 --1665 --
NM_004745chr8136696 5961 5178 5038 4889 4860 4724 4326 1737 1312 1060 937 637 21354 331 12613 14608
NM_004747chr101367 11428 160 --
NM_004748chr1574176 3970 3475 3403 599 211 132 23962 437 ----
NM_004756chr1911556 ----11346
NM_004762chr1721478 1307 --1137 --
NM_004768chr11106 ------
NM_004772chr541574 1432 598 344 --11269 --
NM_004774chr1732952 2473 581 --12094 --
NM_004775chr1832239 1944 606 1935 ----
NM_004776chr201731 ----12189
NM_004781chr131739 1483 1118 11314 ----
NM_004781chr131739 1483 1118 11314 ----
NM_004783chr163634 178 118 ------
NM_004786chr18147 ------
NM_004788chr1132180 1814 628 --12274 --
NM_004798chr2012488 --13201 --
NM_004805chr21134 ------
NM_004808chr1011063 22144 517 ----
NM_004822chr1733067 626 548 --11031 12657
NM_004824chr641449 540 66 60 ------
NM_004834chr232589 852 314 ------
NM_004840chrX21693 74 --12364 1354
NM_004842chr621718 1129 ------
NM_004845chrX73790 3642 3410 1270 556 426 156 43889 3630 2737 109 1546 13033
NM_004849chr61219 ----1386
NM_004850chr21699 ------
NM_004856chr153448 127 103 ------
NM_004859chr1742618 1935 858 67 1382 ----
NM_004860chr171126 ------
NM_004866chr574669 4234 3537 3083 1014 910 474 ----14511
NM_004870chr171628 ------
NM_004871chr1753456 2809 2796 395 242 23345 1351 24178 3692 2700 523
NM_004872chr11326 ------
NM_004874chr82187 116 ------
NM_004884chr1531648 1491 204 ------
NM_004893chr52109 47 ------
NM_004896chr1011244 ------
NM_004898chr462921 2372 1937 1035 295 222 12617 ----
NM_004901chr81266 ------
NM_004902chr202790 267 ------
NM_004904chr7105917 5808 4687 4431 4406 4373 2048 1116 358 352 36147 5659 5348 44490 2380 209 106 16152
NM_004906chr61604 ------
NM_004912chr721696 221 --11544 --
NM_004922chr101659 1753 --1263
NM_004929chr811170 --21331 150 --
NM_004937chr1762459 2365 1798 859 799 355 ------
NM_004938chr9------1454
NM_004947chr341782 1624 289 43 --1966 --
NM_004949chr18--21738 1547 ----
NM_004952chr1----1709 --
NM_004960chr16132 ------
NM_004961chrX3420 335 38 11280 2548 301 21358 1285
NM_004962chr10--1103 ----
NM_004965chr212788 104 ----1274
NM_004973chr621219 102 ------
NM_004974chr1--129 ----
NM_004975chr201380 1936 --162
NM_004976chr1162069 1670 1592 1568 1023 555 21289 798 ----
NM_004984chr12138 ------
NM_004985chr1232760 405 126 11129 ----
NM_004992chrX178277 8235 7655 6492 6251 6241 3370 3177 2973 2745 2551 2330 2218 1965 647 435 426 22891 968 11344 --
NM_004992chrX178277 8235 7655 6492 6251 6241 3370 3177 2973 2745 2551 2330 2218 1965 647 435 426 22891 968 11344 --
NM_004995chr1411478 ------
NM_004999chr633729 1318 1100 ------
NM_005006chr211017 ------
NM_005010chr731452 882 390 1297 ----
NM_005011chr741470 1450 1368 1304 ------
NM_005016chr122303 117 ------
NM_005023chr5--150 ----
NM_005045chr73932 400 250 ------
NM_005056chr1235181 1975 1204 25112 2018 14092 --
NM_005060chr15985 867 438 265 117 1544 1226 --
NM_005063chr1043427 1252 948 318 23289 909 --12932
NM_005065chr1434916 4536 1174 14584 --15074
NM_005076chr144211 4074 3022 2749 24058 2832 2941 625 --
NM_005087chr3127 --1113 --
NM_005093chr2094675 4246 3931 3447 3260 1747 781 440 309 13501 14184 --
NM_005103chr11--1300 ----
NM_005105chr122048 342 31856 1703 333 ----
NM_005109chr341697 1678 661 448 --1880 22051 304
NM_005110chr54753 697 275 131 ------
NM_005116chr2033813 1603 674 14217 21708 314 --
NM_005117chr112635 106 --1284 --
NM_005121chr1753212 2939 1128 1043 896 11422 ----
NM_005126chr321972 214 ------
NM_005134chr18----1745 --
NM_005135chr1553783 3676 1492 504 425 170 ----
NM_005148chr17136 ------
NM_005155chr61526 ------
NM_005156chr995309 5137 4966 4230 3905 3316 2149 1367 679 175 ----
NM_005161chr1151925 1881 735 454 244 ------
NM_005168chr211296 1504 11463 --
NM_005180chr1041377 1329 585 71 ------
NM_005184chr1911396 11261 --11573
NM_005187chr1641362 323 216 54 ------
NM_005188chr11117874 5257 3008 2406 2362 2077 1810 1746 1588 1134 956 1701 36780 1552 232 21615 1163
NM_005197chr1445540 5077 312 240 25089 4184 15037 --
NM_005208chr171107 ------
NM_005215chr181127 1150 ----
NM_005219chr551562 1276 702 166 26 --11392 --
NM_005229chrX1188 --1986 --
NM_005230chr121476 --1247 --
NM_005233chr352526 2429 1043 932 583 11689 ----
NM_005235chr277153 6953 4820 3086 2948 2142 961 26090 2517 36022 5392 1330 --
NM_005238chr1143203 2630 2503 142 ------
NM_005241chr311228 ------
NM_005242chr521314 321 ----11063
NM_005244chr201458 1536 ----
NM_005249chr142652 593 ------
NM_005254chr153543 474 231 ------
NM_005256chr11166 ------
NM_005257chr181504 ------
NM_005264chr103609 114 102 ------
NM_005273chr71337 ------
NM_005276chr1241159 687 582 523 --11432 --
NM_005276chr1241159 687 582 523 --11432 --
NM_005277chr411886 --11720 --
NM_005278chrX2559 221 ------
NM_005284chr61366 ------
NM_005308chr101359 ------
NM_005311chr732778 2219 2034 12341 1578 --
NM_005312chr932085 1874 51 ------
NM_005313chr1521149 164 ------
NM_005324chr1741946 1847 1298 831 --11721 --
NM_005327chr41240 --2622 537 --
NM_005329chr162781 170 --32181 2038 896 --
NM_005339chr484063 3987 3786 3437 2642 1301 950 751 ------
NM_005342chrX72588 2463 2175 1876 629 608 553 2979 498 ----
NM_005349chr42618 252 ------
NM_005359chr18116440 6076 5296 4530 2603 1708 1651 1433 1420 1107 614 11009 --12149
NM_005370chr1931070 530 443 ------
NM_005373chr1124 11510 1415 1584
NM_005374chr1772246 1531 671 610 603 384 127 --11820 --
NM_005376chr111116 ------
NM_005382chr8165 ------
NM_005385chr362701 2365 2126 2065 1897 52 11906 12048 22302 2204
NM_005387chr112611 48 ------
NM_005389chr63640 563 139 --165 --
NM_005392chr931538 1350 328 ------
NM_005400chr251208 605 435 377 243 --31959 945 323 --
NM_005406chr18------1395
NM_005407chr1461368 518 431 270 245 51 ------
NM_005415chr21186 ------
NM_005429chr4--122 ----
NM_005433chr1842773 2500 2371 1130 ------
NM_005437chr1041363 1220 106 69 --1216 --
NM_005443chr42484 139 ------
NM_005450chr17178 ------
NM_005455chr141720 1441 667 360 ------
NM_005458chr921644 1612 --183 --
NM_005461chr2031536 588 558 ------
NM_005465chr131802 1550 79 ------
NM_005471chr521249 170 1866 ----
NM_005474chr1741560 1031 381 329 1292 21025 172 --
NM_005475chr1282736 2728 2518 2332 2046 910 860 250 12432 33064 2701 514 --
NM_005493chr6164 ------
NM_005494chr7--1135 ----
NM_005497chr1785925 5719 5125 4121 4000 1771 1739 1514 26086 54 14026 11681
NM_005499chr191531 ------
NM_005501chr1721206 976 ------
NM_005506chr421076 289 11104 22634 1083 22048 557
NM_005509chr521731 93 ------
NM_005517chr121010 573 --1955 --
NM_005519chr10----1132 --
NM_005520chr51194 ------
NM_005522chr751279 1052 999 375 75 ----1883
NM_005523chr71223 1420 1424 --
NM_005529chr12385 358 1950 ----
NM_005539chr1031377 1231 318 ------
NM_005540chr111329 ----2336 62
NM_005544chr22292 153 ----1860
NM_005546chr551778 1644 611 547 292 1697 --11975
NM_005559chr18122 ------
NM_005562chr111515 --11614 --
NM_005575chr51754 ----1135
NM_005578chr325115 3761 23354 1836 ----
NM_005587chr151636 ----1803
NM_005593chr122399 113 ------
NM_005595chr11630 ------
NM_005596chr965991 5717 3883 1884 1094 1001 ------
NM_005598chr141486 1318 1192 382 11094 ----
NM_005603chr1821829 634 1727 ----
NM_005604chr642170 1658 663 407 ------
NM_005607chr82370 108 ------
NM_005613chr122056 1872 --1849 --
NM_005614chr7----1781 --
NM_005627chr6----1382 --
NM_005632chr1631004 827 435 --1140 --
NM_005634chrX2569 87 ------
NM_005637chr1831721 1262 319 1185 --11688
NM_005639chr1211591 ------
NM_005647chrX52829 760 573 274 68 13425 ----
NM_005648chr8160 ------
NM_005660chrX2220 203 ----1181
NM_005664chr15----1271 1225
NM_005665chr154637 4607 4551 4358 44 ----23120 565
NM_005667chr2145 ------
NM_005668chr564174 3653 2958 2807 1378 985 ----1727
NM_005687chr21427 ------
NM_005688chr331087 893 125 21216 983 ----
NM_005698chr11227 --151 --
NM_005700chr112277 126 ------
NM_005708chr13137 ------
NM_005711chr52943 847 --11036 --
NM_005715chr642850 2470 826 262 --1761 11047
NM_005717chr121129 158 1396 21081 109 11010
NM_005721chr22700 325 ------
NM_005722chr242400 1580 797 493 --12212 --
NM_005723chr4144 ------
NM_005724chr152762 130 --1844 --
NM_005725chr132343 1812 385 171 ----
NM_005730chr1242945 2922 936 335 1150 12706 --
NM_005737chr242786 2547 2158 356 1243 ----
NM_005738chr7------11347
NM_005739chr152182 96 --11542 --
NM_005742chr2--1674 ----
NM_005746chr712097 --22780 2691 --
NM_005748chr1223257 707 ----13367
NM_005751chr71328 1116 ----
NM_005752chr1611219 ------
NM_005761chr121154 ------
NM_005766chr132230 125 ------
NM_005768chr121714 ----1238
NM_005776chr141111 ------
NM_005779chr533264 755 532 --1976 --
NM_005786chr1821295 1080 ----1912
NM_005795chr252055 638 441 314 168 ------
NM_005797chr1131824 1271 114 --11415 --
NM_005801chr172761 96 --1324 --
NM_005802chr9--1237 ----
NM_005808chr322927 2277 1355 174 --
NM_005822chr63903 849 634 22370 588 ----
NM_005826chr11266 ------
NM_005832chr31282 ------
NM_005839chr11744 150 ----
NM_005840chrX56292 6225 2594 2480 2403 1227 15864 --
NM_005850chr1178 ------
NM_005852chr172815 146 158 1367 --
NM_005857chr121055 65 --11472 --
NM_005862chr31876 ------
NM_005866chr94605 339 331 301 ------
NM_005868chr711887 ------
NM_005870chr13140 ------
NM_005871chr1021065 904 ------
NM_005875chr31264 1326 ----
NM_005882chr42806 347 ------
NM_005885chr51426 1409 ----
NM_005898chr1162776 2751 2737 2096 565 477 11178 42882 1100 960 159 --
NM_005900chr41843 ------
NM_005901chr18117674 7236 6761 6631 5963 3324 3291 2619 1822 1332 1243 25390 2155 ----
NM_005902chr1594372 4231 4132 3011 2802 1299 950 452 329 11636 ----
NM_005903chr584708 4041 3917 3494 1429 1296 1213 1054 33301 240 108 14564 11153
NM_005907chr621600 1566 ------
NM_005909chr563902 2793 2683 1182 696 165 23995 242 24300 3548 --
NM_005910chr1784053 3278 2973 2782 1460 1008 155 113 --23892 1361 --
NM_005911chr251366 1158 1028 526 152 --1108 --
NM_005920chr153163 2442 2356 883 869 12954 11172 --
NM_005924chr73942 879 824 ------
NM_005930chr14151 ------
NM_005933chr1132756 2653 218 12844 ----
NM_005935chr465099 4384 1761 1241 684 263 --14197 --
NM_005937chr17134141 3785 3645 3634 3586 3501 3055 3033 1455 1417 1210 904 469 13866 --13257
NM_005941chr863751 3204 1035 734 552 531 --1243 13463
NM_005943chr621710 1253 1439 --11364
NM_005955chr11687 1630 --24844 1109
NM_005962chr10--1629 ----
NM_005962chr10--1629 ----
NM_005964chr1711200 ------
NM_005966chr221813 537 ----1102
NM_005975chr202962 202 1371 1375 --
NM_005977chr132349 82 ------
NM_005982chr14199 ------
NM_005990chr532257 2102 29 1112 ----
NM_005996chr1231239 1001 518 21439 39 ----
NM_005998chr11146 ------
NM_005999chr11117 --11537 --
NM_006007chr921347 805 --1929 13697
NM_006009chr12181 ------
NM_006011chr1573451 3096 3035 1506 1411 1108 396 ------
NM_006015chr131148 831 123 ------
NM_006016chr611855 ----12264
NM_006022chr132319 252 --1943 --
NM_006030chr331837 1220 364 2579 463 ----
NM_006037chr233735 3388 347 --24359 2996 --
NM_006038chr2041622 604 266 23 1631 21553 1368 --
NM_006039chr171807 --1438 --
NM_006040chr1651371 1252 153 83 74 ------
NM_006041chr172378 157 ------
NM_006047chr2043407 3202 2464 800 ------
NM_006054chr1121461 371 --197 --
NM_006060chr764096 3709 3612 3599 2904 540 13991 23320 2935 --
NM_006076chr772244 1950 599 577 463 322 305 12254 ----
NM_006080chr71129 --22444 615 --
NM_006082chr12----152 159
NM_006089chrX51641 1315 269 184 100 1146 --11327
NM_006090chr11693 ------
NM_006094chr81565 ------
NM_006095chr453916 1672 1022 606 336 23447 1111 14268 11284
NM_006100chr3--1142 ----
NM_006106chr1132316 2310 1341 --1417 --
NM_006107chr171150 ------
NM_006109chr14138 ------
NM_006121chr122330 145 1128 126 --
NM_006122chr1542687 1853 1100 917 --21070 995 --
NM_006133chr1131653 925 84 --1971 22217 167
NM_006134chr2141436 1198 1167 233 ------
NM_006135chr111225 ------
NM_006136chr741286 374 204 152 ------
NM_006141chr1631810 852 96 ------
NM_006147chr12383 80 ------
NM_006148chr174696 339 134 109 22820 2452 --22470 2200
NM_006153chr31196 ------
NM_006154chr15--21892 1182 ----
NM_006157chr11----1375 --
NM_006159chr121109 ------
NM_006161chr51539 ------
NM_006162chr1821743 1145 --1659 172
NM_006164chr2----1418 --
NM_006177chr1461046 930 752 682 343 332 ------
NM_006180chr941920 1324 754 712 ------
NM_006185chr11--1539 195 --
NM_006186chr241100 1011 303 291 1374 --1103
NM_006190chr21943 ----11042
NM_006191chr124169 136 79 23 ------
NM_006195chr91100 ------
NM_006196chr22298 108 ------
NM_006203chr535453 4055 3720 --33916 1034 240 --
NM_006206chr41469 22211 1808 ----
NM_006224chr1731768 544 61 --12197 --
NM_006238chr642029 1968 1402 191 --1227 --
NM_006241chr342429 2363 1683 366 11519 12204 --
NM_006242chr2041522 873 864 299 ------
NM_006246chr142954 381 ------
NM_006251chr51866 --33346 743 610 1563
NM_006252chr167377 6918 6538 5329 2382 44 1945 26250 2043 --
NM_006258chr1021602 41 ------
NM_006264chr41525 ------
NM_006265chr831347 1307 596 1257 ----
NM_006267chr231520 720 58 1131 186 11414
NM_006268chr112784 165 1347 --1949
NM_006275chr2042083 878 801 619 ------
NM_006277chr2198 --1238 --
NM_006282chr2064440 4283 3928 1397 586 29 --12876 13104
NM_006288chr11171 11174 ----
NM_006289chr91315 --1344 --
NM_006293chr154337 207 170 38 ------
NM_006298chr62187 144 --13087 --
NM_006300chr1942355 816 387 339 ------
NM_006306chrX65109 4167 1504 1313 904 684 24509 1711 13961 --
NM_006313chr122693 457 ------
NM_006315chr4104544 4368 4211 2925 1691 1160 1137 600 478 354 21525 764 ----
NM_006317chr52772 566 ------
NM_006321chr332025 1897 1506 ------
NM_006325chr121208 ------
NM_006328chr111512 ----1415
NM_006336chr941392 1308 1114 270 --1481 --
NM_006350chr52317 242 ------
NM_006352chr12649 560 ------
NM_006357chr21449 1486 ----
NM_006359chrX31614 342 275 ------
NM_006364chr1411240 --1993 --
NM_006367chr14954 288 213 188 ----2843 228
NM_006369chr1188 --143 --
NM_006371chr344937 4444 4328 2096 ----1281
NM_006373chr171504 11134 --1403
NM_006375chrX21416 767 --11475 1116
NM_006377chr93432 116 67 ------
NM_006379chr741885 797 593 416 ------
NM_006380chr1733647 953 184 --14017 --
NM_006387chr193467 429 416 192 196 --
NM_006389chr113556 461 101 1163 11171 --
NM_006391chr111322 ------
NM_006393chr1044112 3606 1019 354 1884 1671 --
NM_006400chr121319 162 ----
NM_006405chr14169 ------
NM_006420chr2053058 2614 1240 491 30 ------
NM_006421chr8------1238
NM_006431chr121189 ------
NM_006449chr262024 1957 1729 1625 1522 582 12018 --1258
NM_006451chr521028 23 ------
NM_006454chr482621 2326 2138 1056 811 228 72 62 12252 ----
NM_006457chr453408 1554 1412 502 135 13672 ----
NM_006459chr1031445 1368 1316 --11912 --
NM_006460chr1731150 485 149 1573 ----
NM_006469chr121482 621 ------
NM_006471chr18287 78 ------
NM_006482chr1253831 3629 901 859 633 176 --13616
NM_006496chr1--11678 21815 775 --
NM_006497chr172310 126 --3749 244 173 --
NM_006517chrX41776 1429 323 35 11440 21867 1816 --
NM_006520chrX51296 466 427 351 285 ----1180
NM_006527chr42655 33 ----1122
NM_006529chr431494 1319 148 ----11596
NM_006532chr1961993 1722 1598 1402 741 351 ------
NM_006534chr2043298 3076 1167 112 ----12266
NM_006544chr1445388 3950 1549 437 --21247 33 --
NM_006546chr17106307 5874 5611 5152 4192 4092 2180 1731 1468 1397 --34197 4043 2422 --
NM_006547chr742102 690 473 205 --11307 --
NM_006548chr31679 ------
NM_006557chr9--11156 122 --
NM_006559chr1128 ------
NM_006560chr11----1123 --
NM_006561chr1075743 5161 4559 4303 2103 1719 36 14192 22248 2064 25830 2487
NM_006565chr1641173 1134 819 463 ------
NM_006571chr81233 ------
NM_006575chr14--1542 ----
NM_006589chr11556 --1430 --
NM_006593chr2271 60 1603 --1202
NM_006595chr112411 162 --11575 --
NM_006599chr16138185 8144 7977 7698 7636 7465 6561 5647 5506 5111 2656 514 332 12271 16063 16449
NM_006601chr122204 88 ----2792 361
NM_006603chrX52023 1762 1753 1520 1467 --11376 --
NM_006609chr242846 2611 976 35 ------
NM_006621chr121558 387 1530 ----
NM_006622chr52398 174 ------
NM_006624chr1022068 634 ----1462
NM_006625chr1--132 ----
NM_006625chr1--132 ----
NM_006625chr1--132 ----
NM_006626chr96982 964 926 908 156 120 12021 1954 --
NM_006628chr1543537 1292 1105 110 11374 2631 534 --
NM_006629chr1831997 380 266 ------
NM_006633chr51302 ------
NM_006636chr22856 301 144 ----
NM_006650chr541399 1098 758 105 --1151 1666
NM_006654chr1233602 3574 849 --21284 550 --
NM_006656chr112960 159 ------
NM_006660chr152245 32 ------
NM_006667chrX11189 ------
NM_006690chr2041543 393 344 74 ----11774
NM_006696chr5178 ------
NM_006699chr172679 2520 2480 2387 2244 1712 992 ------
NM_006703chr6--1445 ----
NM_006704chr131364 ------
NM_006706chr51827 ------
NM_006709chr61246 145 ----
NM_006711chr161606 149 --1257
NM_006717chr923295 2741 11193 1634 --
NM_006718chr62947 65 ------
NM_006720chr10105013 4561 4416 3967 3573 2044 1258 1142 654 561 11367 33584 3237 1126 --
NM_006722chr352217 2050 1978 1099 264 ------
NM_006726chr411168 --11130 --
NM_006729chrX54646 4340 4014 3413 701 25105 1898 1413 --
NM_006734chr631226 462 449 ------
NM_006738chr1544619 1562 1278 1103 21356 552 ----
NM_006741chr12----11011 --
NM_006742chr1651968 1788 1549 1538 693 --11599 --
NM_006744chr10----258 44 --
NM_006749chr83964 120 105 ------
NM_006751chr21776 ------
NM_006756chr8--1489 --11414
NM_006761chr171221 1588 ----
NM_006763chr111702 12113 ----
NM_006765chr8----149 --
NM_006766chr852099 2034 1917 1863 387 --11807 --
NM_006772chr631306 1083 698 ------
NM_006775chr632955 2103 69 11981 21206 186 --
NM_006777chrX42456 2265 604 350 --22417 1173 1229
NM_006788chr1841953 709 576 80 11793 --1239
NM_006791chr151163 ------
NM_006802chr11884 --123 1438
NM_006805chr5142 11260 ----
NM_006807chr1711347 --21235 872 --
NM_006808chr91154 ------
NM_006811chr202845 712 ------
NM_006813chr61143 ------
NM_006814chr2062646 2507 2270 258 199 177 --1237 --
NM_006818chr12872 865 --1352 --
NM_006823chr81290 ------
NM_006826chr22309 143 ------
NM_006832chr14--1990 ----
NM_006836chr122503 494 ------
NM_006838chr1241544 1401 629 360 11503 ----
NM_006851chr1242868 2571 2280 891 --1250 --
NM_006852chr1772121 1778 813 686 586 479 192 ------
NM_006854chr721628 701 ------
NM_006856chr12----1359 --
NM_006857chr22804 728 --1103 --
NM_006861chr123640 562 86 --1760 --
NM_006868chr1873223 3105 3074 2858 2721 2104 471 ------
NM_006870chr20--1279 ----
NM_006873chr233503 3050 2982 ------
NM_006874chr441011 936 782 434 1271 1886 --
NM_006876chr11----1501 --
NM_006885chr1684054 3319 2711 1299 967 942 660 564 ------
NM_006888chr142325 217 ------
NM_006892chr202365 98 --1126 --
NM_006892chr202365 98 --1126 --
NM_006896chr74858 817 782 179 1717 11107 --
NM_006902chr11615 12100 ----
NM_006908chr711145 1566 1570 --
NM_006915chrX22463 592 --1806 21780 205
NM_006918chr1195724 5097 4377 4268 3828 2127 1667 1542 1132 ------
NM_006920chr211300 ------
NM_006922chr222199 568 ------
NM_006924chr1743181 1182 615 605 ------
NM_006930chr531777 1361 1312 11661 11633 --
NM_006931chr1242015 444 350 284 ------
NM_006938chr182997 73 --1930 --
NM_006940chr1241377 1259 261 140 ------
NM_006947chr42356 295 11704 --11619
NM_006948chr211360 11952 --11845
NM_006951chr105828 696 644 625 154 ------
NM_006981chr93966 920 116 ------
NM_006988chr21121 --11032 --
NM_006990chr122418 1607 --22497 1540 12328
NM_006997chr102326 73 ------
NM_006999chr541696 1636 632 177 ------
NM_007007chr1264651 4531 3417 1590 711 174 ----13121
NM_007008chr21373 ------
NM_007011chr15126055 5960 5515 5013 2215 1964 1490 1060 827 788 461 159 --14220 --
NM_007013chr811027 1159 ----
NM_007017chr53815 321 142 ------
NM_007024chr34581 511 505 61 ------
NM_007026chr173528 437 240 ------
NM_007039chr1432129 1539 707 149 ----
NM_007040chr192755 720 --1387 --
NM_007042chr331813 495 457 --1400 --
NM_007054chr553885 1301 1117 778 311 1265 13000 12710
NM_007067chr1711433 ------
NM_007073chr633240 3064 2976 --23428 188 1636
NM_007078chr1042051 855 473 299 22872 2403 1747 --
NM_007099chr24722 163 115 104 1209 ----
NM_007106chr1342789 2349 2075 793 12449 ----
NM_007107chr311660 12246 ----
NM_007114chr323007 636 ------
NM_007118chr5294 46 ------
NM_007124chr631447 1326 1298 ------
NM_007125chrY----1418 --
NM_007126chr9--1128 ----
NM_007129chr132831 735 ------
NM_007137chrX94678 4401 4185 3761 1751 1727 1487 1473 251 11970 24355 448 --
NM_007144chr172451 94 ------
NM_007146chr1732371 581 225 ------
NM_007150chrX31779 1508 464 ------
NM_007158chr12810 422 ----11082
NM_007159chr31446 ------
NM_007166chr1121354 515 11225 ----
NM_007167chr12700 296 --1823 --
NM_007170chr12581 43 ------
NM_007172chr2232913 645 71 --13281 --
NM_007174chr1251778 1709 559 361 285 22049 1669 2738 502 --
NM_007175chr822736 2536 12294 12298 --
NM_007178chr121385 --1130 --
NM_007185chr12970 959 1412 ----
NM_007189chr741081 466 236 153 ------
NM_007191chr122659 121 ------
NM_007192chr1421040 966 ------
NM_007195chr1833167 2727 1466 11235 12811 --
NM_007200chr1544619 1562 1278 1103 21356 552 ----
NM_007203chr921226 714 ------
NM_007207chr11753 ------
NM_007212chr131435 1414 335 ------
NM_007214chr61493 --1371 --
NM_007218chr81360 ----150
NM_007236chr1511870 --11888 12014
NM_007245chr163587 186 147 ------
NM_007246chr41942 ------
NM_007249chr13108255 7520 7159 3564 3029 2516 2417 2123 2099 1647 11816 26956 1286 28627 3707
NM_007276chr71279 ------
NM_007283chr372827 2582 2493 1895 1889 486 309 124 12769 --
NM_007285chr16168 ------
NM_007286chr572093 1981 1786 1520 1508 571 184 3845 759 674 1230 --
NM_007294chr1731182 1033 504 ------
NM_007295chr1731182 1033 504 ------
NM_007296chr1731182 1033 504 ------
NM_007297chr1731182 1033 504 ------
NM_007298chr1731182 1033 504 ------
NM_007299chr1731182 1033 504 ------
NM_007300chr1731182 1033 504 ------
NM_007302chr1731182 1033 504 ------
NM_007303chr1731182 1033 504 ------
NM_007304chr1731182 1033 504 ------
NM_007305chr1731182 1033 504 ------
NM_007315chr231492 1459 174 ------
NM_007331chr442554 1007 364 45 ------
NM_007347chr151366 --12627 --
NM_007353chr762954 2475 899 668 275 195 --11955 --
NM_007358chr131980 661 322 155 ----
NM_007363chrX2943 877 --1210 1415
NM_007372chr172712 29 ------
NM_007373chr1021841 1802 ----11190
NM_007375chr122615 2357 1542 ----
NM_009588chr63205 141 77 ------
NM_012081chr573699 3640 3075 2712 2279 682 279 --1961 13752
NM_012082chr82785 682 ------
NM_012083chr1021066 59 ------
NM_012090chr111056 --11071 --
NM_012097chr221958 324 ------
NM_012098chr91476 193 1447 --
NM_012102chr152237 2136 2088 1812 40 1336 ----
NM_012120chr632594 1831 63 11172 ----
NM_012124chr111152 ------
NM_012141chr1331565 1369 958 ------
NM_012156chr2073211 3061 2687 2281 2273 2133 906 11259 23007 717 --
NM_012158chr1331377 660 396 1433 11715 --
NM_012164chr987098 6670 6475 6205 4815 2685 1658 803 56407 4742 2962 1767 555 42855 2096 1362 464 --
NM_012180chr42532 26 ------
NM_012193chr1185219 4648 4243 2154 1210 1011 277 96 --13673 --
NM_012197chr921483 1362 1208 ----
NM_012199chr164606 3746 3655 3078 724 342 --13098 --
NM_012207chr1021076 823 ------
NM_012210chr91242 11323 ----
NM_012215chr1021669 1352 179 11944 --
NM_012216chrX146 ------
NM_012218chr1942063 409 310 86 2666 265 ----
NM_012224chr42963 455 ------
NM_012234chr3103550 3459 3341 3276 3031 2611 2455 1159 844 461 ------
NM_012238chr1021242 244 --11628 --
NM_012244chr1451514 1501 1157 437 308 ------
NM_012247chr1021020 213 ------
NM_012249chr2--1100 32334 1361 824 12926
NM_012250chr112296 65 ------
NM_012252chr775086 4277 3780 3615 3527 1969 281 --11085 --
NM_012257chr7------11005
NM_012259chr62909 203 ----158
NM_012262chr164441 4418 4323 3998 1655 1224 35002 4232 1143 23901 67 --
NM_012281chr731956 1634 511 ------
NM_012286chrX1123 ------
NM_012290chr221696 1164 ------
NM_012297chr42738 141 --12246 --
NM_012300chr582532 2396 1958 1933 661 632 208 184 ------
NM_012301chr742055 1667 873 45 11948 --1785
NM_012302chr13480 151 74 1489 ----
NM_012304chr562027 705 665 612 356 101 12407 12097 --
NM_012306chr1233447 2289 1043 --33506 2316 1269 --
NM_012307chr182285 278 ------
NM_012308chr1121910 300 ------
NM_012309chr11103735 3542 3136 1636 1224 1203 694 685 410 342 11562 11082 --
NM_012311chr102415 147 1449 ----
NM_012316chr195507 5272 5258 5100 4925 4863 4745 3771 3665 --44454 3706 2175 1359 --
NM_012323chr2211527 1527 146 --
NM_012325chr2011104 --11290 --
NM_012327chr1831498 1245 271 --1443 11389
NM_012328chr721487 1318 ------
NM_012330chr102727 417 ------
NM_012333chr1--1346 ----
NM_012343chr521040 24 ------
NM_012383chr91423 ------
NM_012384chr2052234 2182 1971 1909 1585 11722 2990 796 --
NM_012395chr763398 2123 1375 1284 1161 109 1976 ----
NM_012402chr1121109 363 ------
NM_012408chr203406 178 123 ----1746
NM_012410chr162334 209 ------
NM_012412chr71810 ------
NM_012416chr921124 1036 1834 ----
NM_012417chr171426 ------
NM_012420chr1031888 1442 478 --124 11861
NM_012421chr1----1172 --
NM_012448chr17----32267 728 26 1663
NM_012461chr142605 284 --1665 --
NM_012464chr452829 2757 2137 1790 279 1590 2699 563 --
NM_012465chr1083405 3109 2991 2313 2203 1278 850 453 ------
NM_012471chrX21392 744 11248 21929 554 --
NM_012479chr742653 2500 2128 935 --22033 431 --
NM_012482chr11623 --1162 --
NM_013230chrY1372 ------
NM_013233chr221276 580 ------
NM_013244chr12124 ------
NM_013253chr112480 446 --2549 161 --
NM_013255chr7118756 8369 6628 6133 6040 5934 5916 5446 3394 2595 66 13072 27429 2000 26303 6080
NM_013257chr8--1931 --1361
NM_013261chr433358 960 433 --1258 --
NM_013262chr621151 906 ------
NM_013269chr1223242 570 ----1655
NM_013272chr151338 ------
NM_013279chr1142213 842 496 103 ------
NM_013281chr20----11346 --
NM_013293chr71145 ------
NM_013296chr1--199 ----
NM_013305chr18----4880 761 187 131 --
NM_013309chr1542245 1697 1014 428 ------
NM_013316chr72921 78 ------
NM_013354chr83494 423 399 ------
NM_013374chr352711 2492 798 160 23 1244 11990 12046
NM_013381chr122952 259 ------
NM_013386chr131249 530 367 --11560 --
NM_013390chr931158 405 163 1533 ----
NM_013392chr22414 277 ------
NM_013396chr2121546 315 ------
NM_013410chr121180 925 --1291 --
NM_013411chr142837 2372 2281 1116 --21077 352 --
NM_013423chrX11008 1137 ----
NM_013427chrX11008 1137 ----
NM_013433chr1962054 1647 1533 771 738 722 --11864 --
NM_013437chr811200 ------
NM_013438chr921708 49 11158 ----
NM_013444chrX21131 809 --1996 --
NM_013446chr711228 ------
NM_013448chr141696 --1705 --
NM_013449chr1252927 2657 2179 2121 1097 12984 ----
NM_013937chr631041 1034 997 --1377 --
NM_013951chr261965 1630 1531 975 865 644 1896 ----
NM_013956chr8196 ------
NM_013957chr8196 ------
NM_013960chr82772 50 1248 1252 --
NM_013964chr8196 ------
NM_013995chrX32188 487 102 22033 1016 ----
NM_013996chr7----129 --
NM_013996chr7----129 --
NM_013997chr7----129 --
NM_013997chr7----129 --
NM_013998chr7----129 --
NM_013998chr7----129 --
NM_014000chr102616 424 ------
NM_014007chr941180 344 323 142 ------
NM_014011chr212426 21012 529 ----
NM_014016chr331191 344 307 1384 2619 250 --
NM_014018chr8143 ------
NM_014023chr1052729 2593 1915 532 147 --1508 11000
NM_014035chr521424 102 1134 ----
NM_014038chr71302 ------
NM_014039chr1131321 391 190 ------
NM_014043chr32647 296 ------
NM_014055chr122451 432 ------
NM_014057chr921559 1347 ----11447
NM_014089chr1322275 640 ------
NM_014106chr151396 ------
NM_014109chr81916 11002 137 --
NM_014112chr854677 4064 3756 3673 2132 --24976 1601 --
NM_014117chr1642552 2444 1070 727 ------
NM_014154chr331195 1045 473 ------
NM_014155chr11167327 6925 5807 5770 5725 5223 4940 2722 1996 1326 1068 973 658 585 542 293 36918 6553 1317 ----
NM_014181chr222297 2129 22162 897 --11079
NM_014183chr201258 ----1277
NM_014190chr441608 653 226 101 --1571 --
NM_014210chr17157 1501 ----
NM_014216chr1421444 64 ------
NM_014217chr11575 --1350 --
NM_014240chr363997 3807 2910 2841 950 898 1384 1504 13328
NM_014243chr421571 311 11807 --2752 108
NM_014245chr32379 169 1258 ----
NM_014248chr221117 ------
NM_014252chr13--151 ----
NM_014268chr1811179 ------
NM_014275chr5--1705 2843 789 --
NM_014278chr4190 ------
NM_014279chr93831 668 313 --1374 --
NM_014280chr11838 ------
NM_014283chr131386 330 286 ------
NM_014288chr11111 ------
NM_014289chrX31083 423 338 --11373 --
NM_014294chr821379 193 ------
NM_014299chr1931755 1504 1465 --139 --
NM_014309chr2255308 3579 3311 2140 300 44662 4602 837 32 --1842
NM_014316chr1652013 1982 1716 1593 649 ------
NM_014319chr1241577 1372 218 204 11842 ----
NM_014323chr2211001 ------
NM_014331chr496834 5292 3127 2622 2051 1510 1478 745 119 ------
NM_014332chrX--161 ----
NM_014333chr1152674 2158 2064 960 507 2798 534 ----
NM_014344chr112766 666 1237 1131 --
NM_014361chr112207 37 ------
NM_014363chr133986 478 89 ------
NM_014368chr921471 300 21950 1687 --11692
NM_014372chr11498 ------
NM_014382chr341394 1207 474 253 1510 ----
NM_014390chr72399 112 ------
NM_014392chr411222 --1247 --
NM_014393chr812151 --1367 --
NM_014394chr102885 86 ------
NM_014397chr93951 425 246 ------
NM_014405chr1751496 629 582 457 46 ------
NM_014415chr321570 1073 ------
NM_014423chr564611 4546 3904 3591 1102 167 11096 24652 4024 --
NM_014431chr1051592 1548 1141 556 419 ------
NM_014445chr332287 714 380 ------
NM_014447chr441473 535 519 127 ------
NM_014452chr621102 914 ------
NM_014454chr62912 189 ------
NM_014458chr141453 982 457 73 ------
NM_014469chr111330 ------
NM_014472chr104678 635 232 186 ------
NM_014482chr21128 ------
NM_014494chr162954 148 ------
NM_014498chr31338 ------
NM_014507chr2211215 ------
NM_014517chr32292 231 ------
NM_014554chr12145 --1268 --
NM_014564chr941067 795 148 59 --11038 --
NM_014573chr1721161 524 --21334 1271 21861 247
NM_014574chr1411381 ------
NM_014575chr32454 427 ------
NM_014577chr221101 ------
NM_014584chr1411592 ------
NM_014586chr2164483 4140 4113 4058 1703 1565 33355 2977 1066 ----
NM_014587chr161192 --11215 --
NM_014588chr20196 ------
NM_014603chr1791617 1531 1231 1207 604 350 271 224 70 ------
NM_014607chr221871 460 --21533 268 --
NM_014608chr151376 ------
NM_014614chr231469 168 161 ----11151
NM_014616chr363088 2591 2571 1100 369 84 132 12623 --
NM_014620chr121624 --1149 1663
NM_014629chr851335 1039 868 257 55 ------
NM_014630chr1562905 2640 1224 1129 414 200 ------
NM_014634chr2253280 2738 956 259 246 23381 213 ----
NM_014635chr251340 1256 1090 490 180 11392 ----
NM_014636chr984080 3555 3188 2741 1555 1228 949 922 --24307 3225 --
NM_014637chr811094 --1189 --
NM_014646chr1852464 2083 2031 1165 525 32504 2418 184 22889 188 --
NM_014647chr1631670 1480 166 --11722 --
NM_014657chr201279 --1319 --
NM_014659chr153750 226 35 ------
NM_014660chr7--122 ----
NM_014665chr873323 3205 3097 2683 2338 882 260 22765 901 ----
NM_014666chr52472 41 ------
NM_014667chr352093 1570 922 644 260 --1410 --
NM_014670chr21245 1311 ----
NM_014676chr12606 436 ----1404
NM_014677chr831339 554 290 ------
NM_014683chr1741865 1844 826 64 1483 ----
NM_014686chr1972028 997 699 655 328 160 85 ------
NM_014689chr2--1246 ----
NM_014690chr732236 2187 810 22157 468 31132 828 353 --
NM_014701chr1532703 598 161 ----1224
NM_014702chr61937 13178 ----
NM_014703chr331072 850 492 11245 1218 --
NM_014705chr721717 713 --1103 --
NM_014706chr123480 338 130 11031 ----
NM_014707chr731804 831 50 ------
NM_014709chr22479 92 ------
NM_014711chr162719 126 11752 ----
NM_014713chr2138 ------
NM_014717chr19173 ------
NM_014718chr121270 1727 ----
NM_014721chr647064 6673 4974 743 --27248 139 --
NM_014723chr2042942 2418 2359 809 1943 ----
NM_014726chr172884 490 --21165 176 --
NM_014729chr832215 2160 82 ------
NM_014730chr12104261 3481 3355 1922 1732 1585 1401 1258 971 763 11206 11592 --
NM_014730chr12104261 3481 3355 1922 1732 1585 1401 1258 971 763 11206 11592 --
NM_014731chr2021217 167 --11708 --
NM_014736chr152194 91 ------
NM_014739chr684159 4060 3746 2984 1213 1108 766 308 --1374 --
NM_014742chr203519 513 200 --1396 --
NM_014743chr442611 2566 2457 1183 --22531 397 --
NM_014748chr21377 ------
NM_014751chr831878 856 119 ------
NM_014752chr1131217 442 186 ------
NM_014755chr272920 1706 1677 1461 1433 1279 64 1291 ----
NM_014756chr112375 32 ------
NM_014757chr531773 1657 710 --21663 582 --
NM_014761chr1631156 1092 181 11176 ----
NM_014764chr12----1976 11150
NM_014765chr162222 775 536 326 69 32 31963 1831 1772 12142 --
NM_014770chr1211009 1210 ----
NM_014772chr1893360 2549 2256 1385 1172 1146 853 818 673 ------
NM_014774chr163274 2544 2437 1135 732 382 11155 ----
NM_014776chr1242878 2119 965 386 --1942 --
NM_014779chr31194 1368 ----
NM_014784chr11719 ------
NM_014787chr122843 1904 ------
NM_014790chr51152 ------
NM_014795chr211293 ----1521
NM_014798chr1731505 1416 731 --11336 --
NM_014807chr111330 1541 1323 --
NM_014810chr123053 3023 --12553 --
NM_014812chr131293 100 92 ------
NM_014819chr541835 1685 1578 263 ------
NM_014820chr33456 442 195 ------
NM_014822chr4----1150 --
NM_014824chr1121748 1716 ------
NM_014826chr133972 3448 3316 32938 384 215 ----
NM_014827chr121446 333 21289 547 --11543
NM_014828chr1411592 1583 21622 365 1982
NM_014829chr522234 2199 ------
NM_014830chr1212517 32666 2553 1352 11254 11119
NM_014832chr1342118 1893 1316 835 21605 722 ----
NM_014836chr1032038 1929 1369 --1316 --
NM_014839chr131714 599 505 1443 --11595
NM_014840chr1252837 2587 2468 2171 189 --32726 2492 814 --
NM_014841chr631348 1173 186 ------
NM_014846chr8187 ------
NM_014847chr1----1140 --
NM_014850chr343781 3410 3207 1291 44916 3796 1232 166 ----
NM_014859chr1721327 428 1405 ----
NM_014860chr232470 612 430 ------
NM_014868chr121184 1561 1114 --
NM_014869chr321216 592 ------
NM_014870chr184730 3081 1518 781 710 645 109 60 11539 44256 3419 1065 653 --
NM_014872chr942092 1731 1495 786 ------
NM_014873chr151890 1452 997 398 376 2907 629 24654 3960 11271
NM_014877chr17137693 7648 7325 7308 6749 4773 4702 2880 2853 2235 2166 213 93 --21698 519 15973
NM_014883chr461969 1925 1597 1584 661 70 --1142 --
NM_014888chr731538 1294 1119 ------
NM_014893chrY42344 1738 1583 686 ------
NM_014897chr172536 301 --1446 --
NM_014899chr553143 2492 1013 995 294 ------
NM_014902chr2021470 177 11330 ----
NM_014903chr1222412 1865 ------
NM_014904chr1033614 403 386 --12796 --
NM_014905chr231630 722 701 ------
NM_014906chr1734042 1603 23 ------
NM_014909chr1473968 3652 3477 2936 2460 745 469 22947 137 12964 --
NM_014912chr1033387 1387 801 11274 1508 --
NM_014914chr22917 525 ------
NM_014916chr73533 151 145 ------
NM_014917chr11909 ------
NM_014918chr1521618 72 ------
NM_014920chr633636 1196 58 1948 21483 952 13311
NM_014921chr1972272 1115 783 763 427 385 222 ------
NM_014926chr311004 1785 ----
NM_014931chr192660 570 ----1463
NM_014932chr321616 802 ------
NM_014939chr1851453 474 461 402 39 --11278 --
NM_014947chr17722 523 435 393 274 227 152 --22089 859 1982
NM_014949chr12690 340 ------
NM_014951chr1032574 1694 481 --2615 588 --
NM_014952chr152489 417 --1218 --
NM_014961chr411381 1794 ----
NM_014962chr2052726 2611 884 299 23 ----171
NM_014969chr12985 258 ------
NM_014970chr1------134
NM_014974chr1051533 1431 1189 555 235 ------
NM_014978chr1021371 169 --11319 --
NM_014982chr1465323 3634 3571 1017 853 222 11041 14767 --
NM_014988chr432818 706 327 22304 257 ----
NM_014989chr611517 ------
NM_014990chr141830 ------
NM_014991chr43958 251 65 ------
NM_014994chr1552339 1904 1714 1508 1497 --1360 --
NM_014997chr752776 1973 1853 1114 159 ------
NM_015008chr313684 --13286 --
NM_015017chr1------21305 292
NM_015018chr6125 ------
NM_015023chr141420 628 456 367 ------
NM_015025chr232268 2219 412 1751 ----
NM_015026chr1253378 1920 861 680 520 11296 24595 1481 --
NM_015032chr132975 811 22182 1896 11939 --
NM_015035chr2044076 1455 785 412 12382 24715 220 1673
NM_015037chr10----1106 --
NM_015039chr194149 4106 3568 1552 1333 422 383 344 305 13925 13525 --
NM_015040chr233180 1205 592 --32890 2863 123 --
NM_015042chr1562825 1625 1454 1042 968 91 11148 33709 3668 33 --
NM_015044chr1653072 2830 2273 1124 716 ------
NM_015045chr1012169 2452 405 ----
NM_015051chr923367 2890 11332 ----
NM_015054chr12133 ------
NM_015063chr192895 53 21356 178 1487 --
NM_015064chr1252401 2221 1278 230 162 ------
NM_015068chr713254 --155 --
NM_015069chr16--2646 540 ----
NM_015074chr184309 3781 3341 1863 1807 1402 858 146 --1931 24574 3473
NM_015075chrX52070 2044 1627 1432 543 --12082 --
NM_015076chr643310 1365 953 161 ------
NM_015077chr17124357 4129 4016 3529 3199 3128 966 912 679 590 558 66 13679 2349 283 --
NM_015078chr32823 183 --131 1969
NM_015079chr1533197 2225 837 ------
NM_015082chr522545 336 ------
NM_015087chr1322491 1805 ----1736
NM_015090chr1135728 5720 4233 2222 1989 1871 1709 1671 1649 1528 1379 632 242 12023 ----
NM_015092chr1644581 2996 1285 303 --14318 --
NM_015093chr631828 1764 1740 --11728 --
NM_015097chr352250 2160 1688 1655 624 11827 ----
NM_015100chr152048 1953 1725 1665 1656 1501 ----
NM_015101chr132254 1986 1853 ----32925 275 33
NM_015107chrX41953 1679 1588 739 ------
NM_015113chr1772057 1932 694 672 665 551 103 12008 ----
NM_015115chr432032 940 154 13138 ----
NM_015129chrX31256 704 72 1624 ----
NM_015130chr421298 870 ------
NM_015133chr165964 255 244 175 121 ------
NM_015134chr172445 40 1564 ----
NM_015138chr1542472 1932 959 700 31955 1129 297 12668 --
NM_015147chr233177 3054 961 --11153 --
NM_015149chr142135 2064 1554 765 ------
NM_015153chr61587 ------
NM_015155chr101665 53201 3061 3043 2382 1343 1888 12119
NM_015156chr1463513 2866 1610 1104 335 318 23713 3104 ----
NM_015161chr162358 98 1322 ----
NM_015163chr1421701 155 1475 1522 --
NM_015170chr812167 --11970 1642
NM_015172chr121464 527 1369 ----
NM_015176chr111428 140 1632 --
NM_015180chr143682 269 165 ------
NM_015191chr111531 --12705 --
NM_015197chr1432326 801 75 ------
NM_015199chr332855 2150 2138 12567 ----
NM_015200chr43931 303 54 1695 ----
NM_015206chr1543737 2658 1076 189 129 ----
NM_015208chr182723 452 --1910 --
NM_015209chr122164 712 11734 11792 --
NM_015213chr11151 ------
NM_015215chr173105 2961 2891 2774 2549 2394 161 1709 12183 --
NM_015216chr541350 1212 1121 375 ------
NM_015225chr972929 2591 2382 827 724 517 369 32793 2289 1229 22583 752 --
NM_015229chr173901 878 759 --1252 --
NM_015231chr111628 ------
NM_015233chr1342005 1692 1027 308 12013 1650 --
NM_015234chr611130 ------
NM_015236chr4--11108 ----
NM_015238chr51707 ------
NM_015245chr672723 2319 1960 892 857 551 90 22479 447 ----
NM_015246chr1631586 1480 230 11493 137 --
NM_015247chr16104944 3622 3485 2140 1972 1611 1023 732 544 73 --15314 --
NM_015265chr212089 1679 ----
NM_015269chr1290 23 ------
NM_015270chr1271892 1716 1576 683 577 332 24 1667 ----
NM_015271chr423506 558 --11583 --
NM_015272chr1621766 436 11384 ----
NM_015275chr121127 --12078 --
NM_015278chr663483 2812 2734 2230 995 422 --33022 2886 585 22818 668
NM_015282chr272554 1024 977 660 362 146 81 1792 1961 --
NM_015285chr182952 574 12268 ----
NM_015288chr553427 2748 2586 681 213 11222 12997 --
NM_015293chr62493 118 ------
NM_015299chr1463551 2931 2833 915 540 191 154 43914 3425 2717 37 --
NM_015305chr1421840 1267 ------
NM_015308chr11------153
NM_015310chr887511 6584 2251 1580 1017 642 540 308 1553 27807 5709 --
NM_015313chr1154340 3841 3826 1281 1246 --13323 14476
NM_015314chr732166 1886 947 --2485 351 1593
NM_015317chr241887 1768 990 794 1957 ----
NM_015319chr121336 ------
NM_015323chr61131 --11409 --
NM_015326chr142486 2277 382 91 1583 11077 --
NM_015327chr11536 11053 31180 1120 268 --
NM_015328chr762731 2633 1252 984 752 572 --22558 410 --
NM_015329chr1972839 2735 2589 1187 840 537 24 --1610 --
NM_015331chr11573 237 29 ----
NM_015332chr773162 2599 2460 2424 2384 1234 56 23639 3262 --1865
NM_015335chr1221065 589 1474 133 --
NM_015336chr1282337 2139 2005 1886 929 824 597 352 ------
NM_015339chr201135 ------
NM_015344chr821366 375 --11652 --
NM_015346chr1431314 461 235 ------
NM_015347chr1232061 874 192 1645 ----
NM_015349chr622559 1076 --12759 --
NM_015353chr1741980 1875 670 333 ------
NM_015355chr1731954 1500 1288 ------
NM_015359chr862857 2849 2609 2509 2481 2343 1266 ----
NM_015361chr2------1953
NM_015365chrX24023 1129 32914 1643 1368 11087 --
NM_015378chr152547 2072 1010 73 67 --22319 2162 --
NM_015381chr2262050 1877 819 665 332 71 ------
NM_015382chr142285 157 1632 ----
NM_015387chr242071 1980 1544 748 ------
NM_015393chr483742 3151 3090 2557 939 909 563 556 ------
NM_015397chr931399 570 48 1329 ----
NM_015409chr1232646 1715 832 ------
NM_015416chr121884 --1329 1310
NM_015435chr821130 1003 1540 ----
NM_015436chr453039 2982 1194 244 185 1340 22863 596 --
NM_015439chr61397 ------
NM_015444chr32224 176 ------
NM_015449chr12544 41 ------
NM_015455chr563682 3578 2813 1476 897 578 ------
NM_015458chr874457 4277 3789 1866 1688 1599 1104 ----175
NM_015460chr321760 352 ------
NM_015461chr182778 684 ------
NM_015466chr3----1215 --
NM_015470chr2----21243 259 --
NM_015483chr71896 1296 ----
NM_015488chr241342 1170 1126 344 ------
NM_015503chr161665 ------
NM_015508chr321451 1230 ----11126
NM_015509chr1231425 1068 603 ------
NM_015513chr3186 ------
NM_015526chr1911357 11424 ----
NM_015534chr12385 151 ------
NM_015535chr294141 4025 3407 3064 1575 1176 772 294 33 13203 31199 853 156 33724 3192 947
NM_015542chr1021230 1147 ------
NM_015548chr61274 ------
NM_015550chr732711 478 117 ------
NM_015553chr665013 4980 3390 1834 630 222 --24735 118 14104
NM_015554chr1522479 633 --11042 --
NM_015567chr13----1133 --
NM_015568chr2084095 3313 3284 3035 2880 1245 286 145 --12848 --
NM_015571chr621907 735 1777 22304 1885 --
NM_015576chr332136 1156 75 32921 145 113 1428 --
NM_015578chr1942028 1629 1480 40 ------
NM_015601chr102646 24 ------
NM_015605chr103498 300 156 ------
NM_015609chr132454 787 651 11150 ----
NM_015610chr782829 2308 2016 1872 835 492 439 219 ------
NM_015626chr171143 1948 ----
NM_015635chr9171 21598 856 ----
NM_015640chr174671 3449 1597 1516 1113 724 199 --15207 --
NM_015646chr122156 22 ------
NM_015651chr941787 1500 183 71 --21679 692 --
NM_015659chr1663096 2735 2612 2165 989 685 12793 --13281
NM_015670chr17174 ------
NM_015678chr131610 ------
NM_015686chrX62405 2276 1892 1723 165 50 --144 11685
NM_015687chr6178 ------
NM_015695chr641747 766 745 95 21935 285 ----
NM_015702chr22294 233 ------
NM_015713chr822528 311 1970 2852 789 --
NM_015716chr174771 243 224 41 ------
NM_015723chr72220 147 ------
NM_015726chr141711 1578 1359 1323 ------
NM_015844chr181169 ------
NM_015846chr181169 ------
NM_015847chr181169 ------
NM_015850chr841793 866 749 39 --12223 1165
NM_015866chr12502 143 --1453 --
NM_015874chr42618 252 ------
NM_015878chr8--11930 1157 12103
NM_015879chr18108545 5854 5485 5451 5205 2847 2730 2652 2514 337 11535 25653 3302 22699 967
NM_015881chr112480 446 --2549 161 --
NM_015889chr222923 108 ------
NM_015895chr61200 ------
NM_015898chr1912449 11670 ----
NM_015902chr81775 1880 1743 --
NM_015904chr23526 208 191 ------
NM_015905chr7----1417 --
NM_015906chr134732 3082 894 31629 1179 484 ----
NM_015912chr851936 1565 578 491 56 ------
NM_015975chrX31654 1483 130 1663 ----
NM_015980chr521247 1189 11428 11263 --
NM_015981chr542459 2101 706 292 --22197 1019 --
NM_015982chr172289 127 ------
NM_015995chr1595416 5185 4954 4727 4582 3913 2204 1928 926 13719 13388 --
NM_016002chr1148 1687 ----
NM_016003chr782829 2308 2016 1872 835 492 439 219 ------
NM_016009chr153822 1702 1158 742 252 ------
NM_016018chr821080 940 --11138 --
NM_016019chr72355 213 ------
NM_016021chr612087 --11141 --
NM_016032chrX21072 1054 --11252 --
NM_016045chr2031532 1428 415 --11281 --
NM_016059chr63869 52 24 ------
NM_016060chr1731105 852 245 ------
NM_016066chr1137 ------
NM_016072chr1212033 ------
NM_016073chr152954 358 1928 ----
NM_016076chr152995 2310 904 730 582 12269 12557 1133
NM_016081chr432274 1856 1569 ----11764
NM_016083chr641467 1198 870 145 ------
NM_016096chr842160 1380 455 397 ------
NM_016103chr52431 197 ------
NM_016107chr531082 988 358 ------
NM_016120chrX21104 21 ------
NM_016128chr31217 ------
NM_016129chr4156 ------
NM_016131chr271999 1656 1478 932 280 263 22 ----1249
NM_016133chr231195 467 200 ------
NM_016141chr31791 ------
NM_016152chr311130 --144 --
NM_016166chr151179 ------
NM_016201chr34927 902 825 733 1307 22094 498 --
NM_016205chr441182 185 96 21 21327 1144 1324 --
NM_016206chr3118268 7082 2742 2706 2270 2224 1708 1566 1391 1169 383 22492 698 --17456
NM_016216chr3----1800 1100
NM_016223chr11154 --1277 --
NM_016227chr131386 330 286 ------
NM_016231chr171568 ------
NM_016248chr1383791 3754 3214 2743 2489 530 504 109 ------
NM_016250chr141182 1650 ----
NM_016255chr631302 592 557 13248 22537 315 --
NM_016258chr11737 ------
NM_016260chr246632 6315 4787 1151 11881 11970 --
NM_016264chr192504 367 1123 ----
NM_016269chr42850 315 ------
NM_016271chr1861723 1696 861 808 735 202 --12043 --
NM_016272chr2221994 1759 12109 21873 1110 --
NM_016279chr5--1209 ----
NM_016281chr12--1918 ----
NM_016284chr161377 --3950 666 85 --
NM_016287chr12543 464 --1304 1785
NM_016289chr241947 1659 615 50 11502 ----
NM_016300chr31163 ------
NM_016308chr152049 1612 829 755 239 --2662 449 --
NM_016312chr121197 ----1120
NM_016322chr922267 2175 1831 --12888
NM_016329chr31422 1513 1116 --
NM_016339chr1721772 402 --1652 --
NM_016340chr551310 1161 1090 1084 491 195 ----
NM_016376chr1711112 --24281 892 34351 2854 910
NM_016377chr621718 1129 ------
NM_016396chr1552940 2824 2485 2315 1040 ----12623
NM_016410chr91228 --1246 --
NM_016423chr14123 ------
NM_016424chr1721655 212 ------
NM_016436chr2052400 2314 2282 2147 780 ------
NM_016441chr221505 714 1383 21528 346 --
NM_016453chr33668 426 30 ------
NM_016467chr231349 514 377 2323 242 ----
NM_016505chr11681 1241 ----
NM_016506chr112255 183 ------
NM_016507chr1773177 3050 2923 2551 1048 192 57 ------
NM_016513chr633636 1196 58 1948 21483 952 13311
NM_016519chr4148 ------
NM_016521chrX----126 --
NM_016522chr1111126 --11181 --
NM_016529chr13142 --11132 --
NM_016530chr15103853 3122 2924 2802 2751 2715 1247 1210 1072 937 ------
NM_016531chr452791 2616 797 477 111 31329 674 602 2842 324 --
NM_016532chr172267 50 1919 ----
NM_016542chrX11498 1565 1373 --
NM_016564chr112716 618 ------
NM_016569chr1231239 1001 518 21439 39 ----
NM_016578chr112164 43 ------
NM_016586chr142517 138 ------
NM_016587chr71279 ------
NM_016588chr62748 677 --1238 --
NM_016592chr20--1285 11250 --
NM_016598chr311347 ------
NM_016603chr541524 737 618 37 ------
NM_016605chr572359 2252 1971 731 691 598 312 12568 ----
NM_016607chrX3533 399 89 ------
NM_016613chr41277 ------
NM_016620chr11987 ------
NM_016621chr1164428 4259 3326 3271 3172 2913 13813 14113 --
NM_016628chr101349 ------
NM_016630chr152548 206 ------
NM_016631chr212754 267 ------
NM_016644chr51528 ------
NM_016654chr153543 474 231 ------
NM_016734chr941994 1781 794 744 ------
NM_016824chr1021616 1390 --1229 --
NM_016831chr162369 2039 1572 1541 1514 702 12074 ----
NM_016834chr1784053 3278 2973 2782 1460 1008 155 113 --23892 1361 --
NM_016835chr1784053 3278 2973 2782 1460 1008 155 113 --23892 1361 --
NM_016836chr21547 ------
NM_016839chr21547 ------
NM_016841chr1784053 3278 2973 2782 1460 1008 155 113 --23892 1361 --
NM_016929chr664385 3397 1104 606 527 64 14019 --13211
NM_016936chr163668 258 227 ------
NM_016946chr162914 2820 2552 1139 1061 156 23602 891 32417 1102 1024 --
NM_017410chr1241060 1035 434 234 1457 ----
NM_017412chr821034 533 1376 ----
NM_017413chrX42120 601 431 136 --197 --
NM_017415chr574496 3965 3175 3128 815 801 548 --1907 1682
NM_017418chr9172 ------
NM_017420chr1422642 1327 1578 22957 649 --
NM_017423chr42131 106 --21590 277 --
NM_017426chr41180 ------
NM_017449chr111720 ------
NM_017450chr171923 21243 1113 180 --
NM_017451chr1731006 891 220 ------
NM_017456chr1721478 1307 --1137 --
NM_017457chr191118 ------
NM_017512chr182142 113 ------
NM_017520chr131217 ------
NM_017522chr11984 --11008 --
NM_017544chrX2854 169 ------
NM_017548chr31434 ------
NM_017551chr1031892 546 425 --1477 12583
NM_017563chr3115612 5264 5147 4965 4683 4669 4362 1498 876 244 35 162 45424 4856 4141 1842 13861
NM_017575chr1751585 1384 1196 549 422 --11047 --
NM_017581chr41130 ------
NM_017582chr141457 1349 302 123 ------
NM_017590chr2262512 2374 468 300 287 245 --1536 --
NM_017599chr1241974 1836 1673 57 ------
NM_017602chrX1961 ------
NM_017610chr1551649 810 778 757 314 ------
NM_017628chr474998 4620 4113 3540 2110 1999 1971 13565 1214 --
NM_017629chr131421 658 118 ----1439
NM_017633chr653229 2940 2384 600 443 ----13434
NM_017635chr1131241 495 348 1614 --1626
NM_017637chr989046 8813 8483 6031 2788 1732 653 30 28639 6093 --15909
NM_017640chr61791 ------
NM_017641chr1211164 ------
NM_017643chr173971 871 459 --2836 122 --
NM_017649chr1011275 --1276 --
NM_017650chr755377 1088 1026 854 113 --45719 4461 4087 1740 --
NM_017657chr22941 113 ------
NM_017658chr1463926 3755 3223 3113 1742 771 11402 1353 --
NM_017661chr151393 --11085 --
NM_017664chr131914 153 ----
NM_017666chrX21923 123 --2147 137 --
NM_017668chr162548 140 1688 ----
NM_017672chr151989 ------
NM_017686chr131088 989 836 ------
NM_017694chr221780 1299 11526 1249 --
NM_017700chr4137 ------
NM_017707chr121293 282 ------
NM_017709chr143647 3149 1529 1038 --33270 876 111 13452
NM_017719chr352476 1630 1007 989 690 158 ----
NM_017737chr13855 356 325 ------
NM_017740chr1621251 1163 177 1474 --
NM_017742chr1822004 409 ------
NM_017744chr112109 ----1237
NM_017745chrX1189 ------
NM_017752chrX41790 1730 1512 57 32099 1657 768 ----
NM_017753chr91322 --31024 704 194 --
NM_017754chr694810 4591 3569 3247 3157 1945 1237 942 925 11827 13327 --
NM_017758chr1721467 975 ------
NM_017763chr1741150 931 471 189 ------
NM_017772chr61222 11394 ----
NM_017778chr811228 1221 ----
NM_017780chr81648 --1797 --
NM_017787chr1062819 2781 2410 2040 951 169 ------
NM_017789chr2145 ------
NM_017798chr2011150 --174 1227
NM_017799chr1431432 625 368 11630 138 --
NM_017801chr342031 937 425 337 1279 ----
NM_017811chr983033 3007 2870 1910 669 501 154 126 --22644 2355 --
NM_017813chr855485 5296 4359 4326 26 11418 13623 12010
NM_017824chr1031815 894 27 --22149 2033 --
NM_017830chr43842 780 43 ------
NM_017848chrX--1754 14001 13175
NM_017849chr273022 2620 1241 1074 874 440 52 ----12345
NM_017856chrX1399 1274 ----
NM_017857chr111650 --199 --
NM_017880chr21116 ------
NM_017893chr102507 274 --21444 1137 --
NM_017902chr10145638 4659 4483 4372 4341 4065 2307 2053 1838 1686 1311 775 402 276 34315 1439 1246 24751 4731 15364
NM_017907chr11123 ------
NM_017910chr2197 ------
NM_017913chr91439 ------
NM_017915chr1241157 912 785 221 ------
NM_017921chr1751892 1770 1565 534 243 11442 22279 795 12291
NM_017923chr4----2681 99 --
NM_017938chrX41908 1619 1522 1340 1209 1602 1598
NM_017944chr11--2780 656 ----
NM_017969chr21148 ------
NM_017987chr1061968 596 567 379 350 81 --11617 1140
NM_017988chr122113 36 ------
NM_017994chr722769 2198 12642 12854 --
NM_017998chr91993 ------
NM_017999chr14155 ------
NM_018000chr251566 1535 535 352 289 ------
NM_018010chr311072 --21596 461 --
NM_018011chr131121 1563 ----
NM_018017chr1062860 2449 948 845 557 522 11011 ----
NM_018025chr192191 69 ------
NM_018027chr1082619 2609 2542 2050 604 572 499 204 --1686 --
NM_018036chr1484145 4052 4043 3488 814 383 340 68 --24251 3903 --
NM_018043chr111544 1938 ----
NM_018045chr1----2117 80 --
NM_018046chr51146 ------
NM_018048chr1241390 779 770 538 --21832 677 --
NM_018063chr102356 108 1335 ----
NM_018078chr411044 ----1372
NM_018084chr252846 2019 1306 609 56 ------
NM_018086chr211412 1593 1232 --
NM_018092chr1621046 351 ------
NM_018094chrX----1148 --
NM_018095chr112255 183 ------
NM_018098chr32861 275 1401 ----
NM_018105chr82821 354 1114 ----
NM_018115chr4--1322 1574 --
NM_018121chr1043218 3095 2058 1965 --12700 --
NM_018126chr421450 318 ------
NM_018128chr1731197 981 157 --1994 --
NM_018133chr32641 543 1477 ----
NM_018150chr12301 246 ----1666
NM_018156chr152547 2072 1010 73 67 --22319 2162 --
NM_018157chr1242149 975 594 57 11116 --12106
NM_018171chr123740 731 324 ------
NM_018172chr1141106 1051 213 175 ------
NM_018176chr431489 1444 1291 --141 --
NM_018177chr421011 253 ------
NM_018178chr132001 1848 1788 11688 12091 --
NM_018181chr1821631 343 --31865 1697 695 --
NM_018182chr1741729 1385 284 251 ------
NM_018184chr321471 179 --12005 --
NM_018200chr1532158 1976 1760 ----1307
NM_018202chr11178 ------
NM_018214chr61226 1442 ----
NM_018223chr12124 ------
NM_018227chr433098 2490 1239 23058 2992 --23034 83
NM_018237chr101283 ------
NM_018244chr2041154 882 430 209 ------
NM_018246chr852317 2310 2227 1906 313 12682 22646 508 --
NM_018247chr62570 198 12185 1903 --
NM_018254chr122083 1723 ----1168
NM_018263chr262584 2549 2450 2204 1895 107 ------
NM_018266chr34936 840 433 359 ------
NM_018270chr203870 765 182 1233 ----
NM_018272chr12----1204 --
NM_018281chr11201 ------
NM_018287chr101396 ------
NM_018293chr342294 996 272 75 ------
NM_018299chr822890 1330 13062 ----
NM_018302chr452225 2209 1690 617 283 ------
NM_018310chr8141 1523 ----
NM_018314chr112573 297 1598 ----
NM_018315chr421287 255 ------
NM_018317chr41130 ------
NM_018319chr14--21066 583 1309 --
NM_018322chr62977 96 1942 1108 1325
NM_018325chr921415 140 21463 57 ----
NM_018327chr2051284 460 296 165 121 ------
NM_018340chr1664955 3887 3188 1051 609 223 13828 ----
NM_018351chr1234010 3935 531 11880 13187 14203
NM_018353chr14--2688 173 ----
NM_018354chr20----133 --
NM_018361chr853865 3562 735 576 388 ------
NM_018362chr112365 39 53263 2739 2599 988 487 --13233
NM_018364chr122658 1409 11128 ----
NM_018369chr51673 ------
NM_018374chr7135201 5104 4715 3732 3203 1966 880 761 502 495 479 310 152 ----24196 3917
NM_018383chr21537 21725 1306 11315 --
NM_018387chr91197 ------
NM_018388chrX21403 994 11439 ----
NM_018399chr62258 73 --1530 --
NM_018403chr363522 3512 3220 1353 467 281 23608 2768 23923 321 --
NM_018424chr931625 1308 1159 ------
NM_018425chr1082306 1953 1808 1676 952 718 629 457 ------
NM_018429chr552313 1950 1072 1066 911 ------
NM_018433chr21442 ------
NM_018437chr91457 145 ----
NM_018439chr1831781 627 135 1114 21893 976 --
NM_018440chr8138725 8216 5727 5565 5546 5445 3035 2683 1735 1132 725 566 158 46975 2303 1891 1595 27647 7106 --
NM_018448chr1231044 878 467 ------
NM_018449chr9----1686 --
NM_018457chr12139 ----1584
NM_018471chr21537 ----136
NM_018482chr842618 1813 1698 540 12168 1452 --
NM_018489chr112078 3577 321 198 --1823
NM_018509chr1731679 1461 341 11646 ----
NM_018553chr1711838 2481 340 31689 1611 636 --
NM_018557chr221379 504 ------
NM_018561chr6--11011 ----
NM_018566chr184638 3134 1353 1265 923 788 421 314 --23597 974 --
NM_018569chr4130 ------
NM_018584chr12887 294 ------
NM_018638chr1295134 5089 4978 3811 3677 3437 986 781 249 --34752 3917 2157 15572
NM_018640chr1222591 2449 1178 22241 656 --
NM_018650chr121734 1420 --1533 --
NM_018657chr32750 338 ------
NM_018660chr843014 1936 347 320 ------
NM_018674chr25628 558 551 504 154 --1121 --
NM_018682chr72749 573 ------
NM_018695chr521975 760 ------
NM_018710chr8145 11356 11107 --
NM_018712chr1141546 621 416 353 178 ----
NM_018715chr142002 1883 767 681 12167 1777 --
NM_018717chr422661 404 ------
NM_018718chr761491 879 825 804 335 151 --11797 --
NM_018719chr731355 1265 1168 --1333 --
NM_018841chr13989 533 56 --2542 120 21480 81
NM_018844chr731542 1508 198 ----11369
NM_018846chr71186 --1339 --
NM_018847chr921729 59 ------
NM_018890chr711145 1566 1570 --
NM_018896chr17154 ------
NM_018898chr522049 387 2707 465 22088 1603 11870
NM_018899chr522049 387 2707 465 22088 1603 11870
NM_018900chr522049 387 2707 465 22088 1603 11870
NM_018901chr522049 387 2707 465 22088 1603 11870
NM_018902chr522049 387 2707 465 22088 1603 11870
NM_018903chr522049 387 2707 465 22088 1603 11870
NM_018904chr522049 387 2707 465 22088 1603 11870
NM_018905chr522049 387 2707 465 22088 1603 11870
NM_018906chr522049 387 2707 465 22088 1603 11870
NM_018907chr522049 387 2707 465 22088 1603 11870
NM_018908chr522049 387 2707 465 22088 1603 11870
NM_018909chr522049 387 2707 465 22088 1603 11870
NM_018910chr522049 387 2707 465 22088 1603 11870
NM_018911chr522049 387 2707 465 22088 1603 11870
NM_018912chr551701 1495 381 206 54 ------
NM_018913chr551701 1495 381 206 54 ------
NM_018914chr551701 1495 381 206 54 ------
NM_018915chr551701 1495 381 206 54 ------
NM_018916chr551701 1495 381 206 54 ------
NM_018917chr551701 1495 381 206 54 ------
NM_018918chr551701 1495 381 206 54 ------
NM_018919chr551701 1495 381 206 54 ------
NM_018920chr551701 1495 381 206 54 ------
NM_018921chr551701 1495 381 206 54 ------
NM_018922chr551701 1495 381 206 54 ------
NM_018923chr551701 1495 381 206 54 ------
NM_018924chr551701 1495 381 206 54 ------
NM_018925chr551701 1495 381 206 54 ------
NM_018926chr551701 1495 381 206 54 ------
NM_018927chr551701 1495 381 206 54 ------
NM_018928chr551701 1495 381 206 54 ------
NM_018929chr551701 1495 381 206 54 ------
NM_018945chr632907 2389 26 1719 ----
NM_018948chr11892 11060 ----
NM_018952chr171168 --1564 --
NM_018958chr1573277 3252 2878 1599 1419 1145 37 --23696 1185 1732
NM_018959chr19----1253 --
NM_018963chr212585 79 --1156 --
NM_018970chr753103 1956 1205 1077 791 11978 ----
NM_018976chr1242296 958 927 89 ------
NM_018977chrX2429 291 ------
NM_018979chr1262599 764 665 593 236 217 ------
NM_018992chr1611105 ----11647
NM_018994chr11530 ------
NM_018999chr1064858 1381 1312 801 794 346 ----23248 1973
NM_019000chr52423 165 ------
NM_019001chr384302 3737 2971 1752 1279 1038 986 365 11827 11548 --
NM_019005chr7--165 ----
NM_019036chr62467 45 --11140 --
NM_019063chr262150 1980 1934 879 524 35 ------
NM_019071chr7139 1674 ----
NM_019083chr121355 1207 ------
NM_019087chr51674 ------
NM_019091chr23873 455 371 ------
NM_019096chr6284 22 ------
NM_019102chr71413 ------
NM_019102chr71413 ------
NM_019114chr912139 12543 --1561
NM_019116chr1641361 914 199 173 --42975 2874 603 218 21210 1091
NM_019555chr341143 686 375 268 ------
NM_019590chr101464 --11441 --
NM_019592chr93918 596 251 ------
NM_019593chr2053091 2658 2241 341 146 1323 12885 23070 105
NM_019595chr2198 --1238 --
NM_019597chrX----1144 --
NM_019600chr152693 278 ------
NM_019605chr1145 --150 --
NM_019610chr121356 769 135 ----
NM_019613chr1771220 1067 900 470 274 262 226 ------
NM_019842chr6132 ------
NM_019845chr21786 ------
NM_019849chr191188 ------
NM_019859chr103502 215 92 ------
NM_019860chr103550 263 140 ------
NM_019885chr23939 363 202 1746 12354 1235
NM_019896chr2----172 149
NM_019903chr1021616 1390 --1229 --
NM_020039chr121283 1747 ----
NM_020066chr1156 1144 ----
NM_020120chr221150 390 ------
NM_020122chr2125515 4830 4562 4215 3902 1764 1379 1330 1246 1219 1159 570 --15173 --
NM_020123chr101295 1272 ----
NM_020127chr111482 1454 1458 11303
NM_020135chr61154 --1316 --
NM_020141chr151994 1516 842 203 92 --22357 330 --
NM_020142chr12----1441 --
NM_020144chr71496 1763 ----
NM_020148chr1852402 2356 2325 2233 906 --22468 291 --
NM_020150chr1042030 1981 845 59 --12109 --
NM_020152chr211152 ------
NM_020159chr421545 1206 ------
NM_020177chr542997 1291 685 95 42909 2434 980 696 13277 --
NM_020178chr171454 1789 ----
NM_020179chr111331 ------
NM_020193chr1121000 157 ----1486
NM_020194chr22208 187 ----1644
NM_020198chr1711080 11383 ----
NM_020199chr511098 ------
NM_020204chr13793 254 136 ------
NM_020205chr1--12475 13033 --
NM_020211chr1531208 239 43 --2978 339 --
NM_020235chr3--1317 ----
NM_020239chr172234 2058 1891 1802 778 632 253 --12023 --
NM_020240chr572537 2178 1694 998 827 546 122 ------
NM_020245chr664475 4038 3780 3147 1113 281 --24818 3406 --
NM_020246chr71303 ------
NM_020248chr152223 1955 1944 715 490 ------
NM_020307chr3----130 --
NM_020310chr1731867 261 74 ------
NM_020311chr21498 ------
NM_020336chr2062882 2658 1523 656 491 314 12468 ----
NM_020337chr432500 272 53 ------
NM_020338chr1013276 ------
NM_020341chr2021627 509 --1632 --
NM_020342chr252366 2230 671 441 48 ------
NM_020346chr1121674 504 1696 ----
NM_020353chr321474 79 ------
NM_020357chr321308 491 --1574 --
NM_020362chr12744 521 ------
NM_020366chr14171 ------
NM_020374chr1211389 1112 1803 --
NM_020381chr631673 1384 34 ------
NM_020382chr1211568 ------
NM_020390chr3104939 4912 4440 4108 4014 3811 3794 1445 779 514 ----1988
NM_020403chr1321770 1369 11627 11795 --
NM_020420chrY2609 100 11263 ----
NM_020425chr641436 617 567 555 ------
NM_020429chr732304 635 59 131 ----
NM_020432chr741436 691 411 101 12243 ----
NM_020440chr153088 2153 416 247 188 12273 ----
NM_020443chr192733 2431 2239 1892 1675 1108 764 359 50 11152 160 25804 5589
NM_020449chrX2129 45 ------
NM_020455chr652644 2385 2338 2075 1833 --22324 2217 12411
NM_020457chr161566 ------
NM_020463chr24437 378 259 136 ------
NM_020465chr1611445 2398 62 ----
NM_020473chrX31855 804 547 ------
NM_020530chr223971 922 78 ------
NM_020532chr21373 ------
NM_020546chr543065 1060 500 361 --1850 --
NM_020640chr311958 ------
NM_020644chr111906 1201 ----
NM_020647chr831885 1565 54 11593 ----
NM_020651chr2--1519 ----
NM_020654chr331334 1314 1050 3599 445 79 ----
NM_020655chr1621394 268 ------
NM_020662chr6------11883
NM_020666chr51732 --1657 --
NM_020673chr20117697 7352 5766 5287 5139 2815 1524 1311 1259 1071 143 26336 617 15903 26033 5108
NM_020689chr201257 --129 --
NM_020692chr14285 27 1805 ----
NM_020699chr143972 3457 3290 240 21287 1271 11800 1489
NM_020704chr71184 2927 94 2501 42 --
NM_020711chr242500 1603 822 298 --11968 --
NM_020717chrX75032 4677 4191 3606 1359 784 399 24261 1530 24003 1534 13747
NM_020718chr1666347 6227 5169 4949 1372 585 ------
NM_020727chr2173758 3544 3309 2512 1254 725 186 ------
NM_020728chr772512 2422 2408 269 244 214 37 --23209 2521 --
NM_020734chr1232445 494 458 ------
NM_020739chr1574176 3970 3475 3403 599 211 132 23962 437 ----
NM_020742chrX22417 1080 --11805 --
NM_020747chr5----169 --
NM_020749chr852067 1405 1296 737 152 ------
NM_020750chr621523 1201 --1547 --
NM_020752chr1012689 ------
NM_020753chr172506 165 ------
NM_020760chr221282 236 --1302 --
NM_020761chr1771904 1683 1665 1323 353 123 82 ----11618
NM_020766chrX104483 4153 4105 3745 3352 3301 3197 261 205 191 --11737 --
NM_020769chrX2768 743 --1681 --
NM_020771chr6----11306 --
NM_020772chr1787653 7263 5963 5855 2959 1860 1303 1153 17314 37432 6902 6781 --
NM_020773chr422549 1666 1197 ----
NM_020774chr18156053 5420 5349 4864 4722 3875 2376 1973 1715 1643 1482 1009 928 356 28 46060 5305 4708 4586 15859 --
NM_020777chr442456 927 717 553 --12565 12134
NM_020778chr15104665 4562 4047 3969 3368 3190 1669 1462 1153 55 --1156 1540
NM_020792chr32355 346 ------
NM_020795chr1741997 1941 1806 1324 --11249 --
NM_020796chr572636 2286 2155 1140 766 597 276 ----2962 61
NM_020801chr521783 369 --21664 589 --
NM_020804chr642653 2381 1930 1858 --1796 --
NM_020805chr1821666 254 ----1741
NM_020807chr164494 469 112 75 ------
NM_020809chr1131571 1518 647 ------
NM_020825chr1622583 461 23814 2818 ----
NM_020830chr272829 2731 2651 969 610 70 41 12798 ----
NM_020834chr1431421 1411 1262 --1655 1726
NM_020841chr1273843 3745 2512 1286 1212 910 817 12714 --1528
NM_020843chr151401 ------
NM_020850chr1632423 1227 1096 12485 11306 --
NM_020854chr1831120 512 94 ------
NM_020856chr1931379 1338 178 1485 ----
NM_020858chr1511658 2872 260 21956 730 --
NM_020868chr21488 1102 ----
NM_020870chr41542 1821 11862 --
NM_020871chrX62218 1950 1939 1026 555 245 12061 ----
NM_020888chr131362 699 67 ------
NM_020892chr7----1347 --
NM_020897chr1------1170
NM_020899chr1742458 328 252 66 --22352 590 --
NM_020917chr192630 594 ------
NM_020918chr1061121 952 923 477 173 62 ------
NM_020919chr22320 230 ------
NM_020922chrX--1162 21353 293 --
NM_020926chrX128 ------
NM_020927chr1641688 383 272 127 ------
NM_020935chr263174 1304 1290 550 469 458 21318 119 ----
NM_020940chr1012041 --32612 574 67 --
NM_020948chr1----22262 807 22592 1069
NM_020952chr91105 ------
NM_020962chr152524 507 ------
NM_020967chr2021139 403 ------
NM_020972chr4--1770 1213 --
NM_020974chr111528 --1226 --
NM_020975chr1042055 1967 1304 1284 --21887 111 --
NM_020977chr442105 222 184 124 ------
NM_020983chr1271892 1716 1576 683 577 332 24 1667 ----
NM_020987chr1031359 1138 410 ------
NM_020993chr1221848 965 1248 12452 --
NM_021003chr141752 155 ----
NM_021013chr17191 --1245 --
NM_021025chr51529 ------
NM_021033chr1353438 2462 1385 538 149 --12688 --
NM_021035chr2041334 1164 237 55 ------
NM_021038chr342888 2668 2643 1351 13071 ----
NM_021072chr51433 ------
NM_021079chr1763099 2242 2076 559 543 279 1474 --22381 959
NM_021083chrX52978 2734 2510 2480 105 32649 896 221 ----
NM_021090chr2294525 4434 4223 3879 3366 3346 3055 1839 1513 13891 11846 14799
NM_021097chr242904 2698 974 119 1227 1766 --
NM_021104chr121294 ------
NM_021106chr92571 491 ------
NM_021109chrX170 ------
NM_021109chrX170 ------
NM_021120chrX72618 2609 2250 2214 1265 449 189 ------
NM_021133chr1140 ------
NM_021136chr142525 57 ------
NM_021137chr1782202 2043 1833 1795 1656 726 360 344 1753 ----
NM_021140chrX158 ------
NM_021145chr721156 842 126 ----
NM_021149chr1631125 422 76 ------
NM_021155chr1952706 2200 997 923 31 ------
NM_021156chr20----149 --
NM_021159chr421430 420 11088 ----
NM_021173chr11----131 193
NM_021174chr81712 ------
NM_021180chr11755 ------
NM_021183chrX32257 1950 332 1890 1723 --
NM_021190chr131184 1088 247 ------
NM_021191chr121416 22157 1665 ----
NM_021204chr41698 ----1182
NM_021220chr201166 1112 169 --
NM_021229chr121331 ------
NM_021235chr19144 ------
NM_021238chr12--11537 ----
NM_021239chr1411285 ------
NM_021240chr91194 ------
NM_021249chr14----11635 --
NM_021252chr1021827 466 ----1634
NM_021253chr6----11342 --
NM_021255chr1453907 3408 2717 1616 487 32889 2496 1036 22866 785 --
NM_021260chr143961 505 248 ------
NM_021267chr191154 ------
NM_021614chr5160 ------
NM_021622chr1041996 1877 1725 43 --12061 --
NM_021625chr122432 23 ------
NM_021629chr383888 3348 3182 1591 1576 1222 758 311 13582 ----
NM_021633chr131204 1012 501 ------
NM_021639chr12764 333 ------
NM_021644chr1021076 823 ------
NM_021645chr1321682 973 11497 31699 665 498 --
NM_021808chr123481 209 190 ------
NM_021813chr664840 2201 1748 1321 968 390 1632 11823 12142
NM_021814chr641422 644 591 496 ----11664
NM_021818chr1421416 1375 ------
NM_021831chr21301 ------
NM_021905chr63878 400 38 ------
NM_021911chr595283 5112 5104 4562 4496 1871 1480 1173 1068 13653 21945 814 --
NM_021912chr152790 532 13657 ----
NM_021914chr1432318 2035 416 21635 53 ----
NM_021931chr203890 313 93 1819 --1751
NM_021940chr661605 1528 1160 301 277 210 ------
NM_021943chr622143 761 --1669 --
NM_021945chr6102573 2518 1401 1086 1004 841 734 622 392 42 1600 ----
NM_021947chr1721190 465 ------
NM_021949chrX21880 232 ----12758
NM_021959chr61361 --2875 722 --
NM_021960chr14816 672 500 220 --1846 --
NM_021961chr1185357 5336 4968 4798 2390 1593 1275 1082 15026 27377 4851 --
NM_021962chr1751805 1571 1563 418 127 31821 1022 711 21624 838 --
NM_021963chrX1535 ------
NM_021964chr375711 4333 1896 1650 1262 912 733 --14225 --
NM_021970chr43558 249 169 ------
NM_021984chrX3420 335 38 11280 2548 301 21358 1285
NM_021987chrX3420 335 38 11280 2548 301 21358 1285
NM_021990chrX3420 335 38 11280 2548 301 21358 1285
NM_021998chrX11241 --11343 --
NM_022037chr21344 ------
NM_022048chr15116151 5896 5788 4608 4219 2537 2302 2125 1075 669 60 11128 --36254 5211 1056
NM_022049chr131794 1672 1642 11430 ----
NM_022075chr12697 618 --1287 --
NM_022079chr102646 24 ------
NM_022085chr6135 --11533 --
NM_022090chr51515 ------
NM_022091chr612709 12261 11945 --
NM_022095chr202299 42 ------
NM_022114chr154538 3973 1678 1226 1084 ------
NM_022130chr52465 318 1383 1335 --
NM_022143chr721473 1461 ------
NM_022154chr41536 ------
NM_022157chr1--135 ----
NM_022162chr167950 838 811 792 781 450 28 ------
NM_022170chr741713 525 148 131 --11495 --
NM_022173chr21344 ------
NM_022337chr111629 --1502 --
NM_022343chr951285 1200 493 468 158 ------
NM_022351chr833355 2845 2765 23685 3168 11346 1180
NM_022366chr11377 ------
NM_022373chr71917 ------
NM_022374chr2--1496 ----
NM_022444chr721290 104 ----11491
NM_022459chr13105404 4890 4609 4281 2543 2457 1929 1694 982 686 25755 1331 1178 22295 92
NM_022461chr32889 198 ------
NM_022462chr1993513 3474 2974 2576 2348 756 715 658 616 --11230 2953 204
NM_022465chr1262705 2496 2460 2068 586 471 --1508 12009
NM_022467chr191379 ------
NM_022473chr1583432 3419 3331 1084 886 450 356 151 --23584 1572 --
NM_022476chr1621036 363 1415 ----
NM_022477chr2051625 1586 546 261 227 ------
NM_022485chr3140 --1330 --
NM_022494chr102368 319 ------
NM_022497chr363678 3671 3448 3363 957 237 --1470 --
NM_022552chr21957 --1901 --
NM_022571chr14--122 ----
NM_022572chr241342 1170 1126 344 ------
NM_022574chr751731 1365 860 696 592 ------
NM_022650chr52884 62 --1625 --
NM_022652chr123916 461 68 --1442 --
NM_022658chr121152 ------
NM_022659chr81171 ------
NM_022716chr11459 11944 ----
NM_022719chr2253616 3251 1091 1048 642 1675 ----
NM_022725chr1151698 1692 1627 1310 308 ------
NM_022733chr121167 1083 ------
NM_022735chr11511 21510 1334 11562 --
NM_022739chr1731050 445 227 ----1913
NM_022744chr164965 810 378 84 ----1975
NM_022753chr122732 967 12325 --12291
NM_022763chr352092 1260 762 537 123 ----2950 557
NM_022780chr221655 564 --1594 --
NM_022781chr963143 2703 2295 2058 892 232 22538 1305 11117 --
NM_022782chr122377 291 ------
NM_022818chr1621054 434 --1194 188
NM_022824chr531526 1216 774 1688 ----
NM_022828chr541692 1468 1437 313 ------
NM_022831chr161529 1493 1350 695 481 63 ------
NM_022833chr9----21101 68 --
NM_022841chr1521843 953 --22734 166 --
NM_022843chr1351293 1157 364 263 85 ------
NM_022844chr161637 1865 ----
NM_022845chr162824 428 11738 ----
NM_022893chr21439 ------
NM_022894chr231173 308 253 ------
NM_022898chr1463927 3467 3306 3061 1839 739 14055 ----
NM_022909chr51525 ------
NM_022910chr1611445 2398 62 ----
NM_022912chr222089 1067 1893 ----
NM_022917chr9--1253 11012 1918
NM_022918chr1121527 106 1863 ----
NM_023009chr11223 ------
NM_023010chrX----1811 --
NM_023016chr232549 2517 634 ------
NM_023019chr2----1126 --
NM_023033chr122495 198 ------
NM_023079chr1731194 1177 320 ------
NM_023105chr841793 866 749 39 --12223 1165
NM_023106chr841793 866 749 39 --12223 1165
NM_023110chr841793 866 749 39 --12223 1165
NM_023111chr841793 866 749 39 --12223 1165
NM_023112chr1452957 1062 409 245 69 ------
NM_023927chr5--1146 21224 536 --
NM_023929chr821004 238 12061 ----
NM_024007chr532932 801 529 23069 2991 --1566
NM_024017chr1751622 1264 1226 339 33 1402 ----
NM_024019chr41373 ------
NM_024046chr3--11040 --11001
NM_024057chr121127 ------
NM_024061chr72225 66 1149 1218 --
NM_024076chr1952244 2049 955 261 198 32031 553 230 11644 --
NM_024082chrX2458 150 ------
NM_024090chr421830 744 2137 30 21401 1372 --
NM_024106chr19--153 ----
NM_024122chrX131 ------
NM_024165chr62234 22 ------
NM_024295chr821785 1419 --1588 11843
NM_024301chr1931042 1011 494 21268 1095 ----
NM_024312chr1231222 1030 207 --160 11189
NM_024323chr191107 ------
NM_024324chr221192 ------
NM_024332chrX21709 223 1659 ----
NM_024345chr975151 4842 4166 1211 1091 282 257 --15830 --
NM_024416chr921559 1347 ----11447
NM_024420chr11139 1339 ----
NM_024423chr1854163 3872 3532 1615 1525 1670 ----
NM_024424chr111103 ------
NM_024425chr111103 ------
NM_024426chr111103 ------
NM_024430chr1851793 1668 1639 1191 684 ----11368
NM_024511chr443428 2935 1260 997 11090 --12161
NM_024520chr2------122
NM_024522chr131709 1693 413 ------
NM_024524chr32136 99 ------
NM_024539chrX1385 ------
NM_024548chr361600 641 624 200 188 55 11541 ----
NM_024551chr1242578 2403 1707 344 12241 ----
NM_024551chr1242578 2403 1707 344 12241 ----
NM_024556chr111322 ------
NM_024569chr142936 2892 2527 2285 ------
NM_024581chr6122 ------
NM_024590chr41613 21777 1705 139 --
NM_024595chr11319 --190 --
NM_024607chr863666 3356 3191 2787 1715 50 54118 3259 2993 2913 1639 1805 --
NM_024612chr171752 --1164 --
NM_024624chr221411 643 ------
NM_024631chr112511 240 --135 --
NM_024639chr642890 2337 1957 388 12237 ----
NM_024646chr142866 396 356 118 ------
NM_024665chr3114663 4498 4258 3932 3907 3056 1762 1058 644 527 192 ------
NM_024670chr101415 1254 21379 586 --
NM_024674chr132244 824 288 ----12157
NM_024705chr131222 1797 ----
NM_024713chr1521191 209 ------
NM_024721chr82309 77 ------
NM_024738chr1241764 1527 209 72 11246 ----
NM_024740chr1183921 3758 3308 3089 2803 1078 717 458 --12551 12996
NM_024744chr242537 2261 2160 154 ------
NM_024753chr2----160 --
NM_024755chr152877 626 --1333 --
NM_024761chr945326 4022 396 304 1744 ----
NM_024770chr286536 6470 6401 6280 5133 2646 1495 376 12690 35762 5579 5149 11485
NM_024771chr1121686 163 ------
NM_024785chr23367 46 28 11065 ----
NM_024798chr1562698 2359 1930 1178 888 710 12627 12689 1530
NM_024806chr111226 ------
NM_024808chr132343 114 1699 ----
NM_024817chr15145544 5327 5025 4310 4142 3973 1796 1692 1657 1438 1130 966 894 597 2609 549 24785 4293 12132
NM_024824chr1451671 1640 1514 1496 677 2337 230 ----
NM_024828chr921179 258 ------
NM_024830chr5----11589 --
NM_024834chr102311 305 1427 ----
NM_024847chr161932 1521 ----
NM_024854chr122562 285 --11471 1174
NM_024875chr1021573 45 --11675 --
NM_024884chr1454304 679 482 454 206 ------
NM_024887chr151643 1354 403 370 280 ------
NM_024909chr621099 516 ------
NM_024911chr12152 114 --1608 --
NM_024920chr42642 416 --1399 1562
NM_024939chr1631144 236 148 ------
NM_024945chr921017 123 ------
NM_024947chr3189605 8357 8046 7976 7833 7079 6551 6474 6461 6431 5923 3562 3266 3020 2614 734 681 637 ----17370
NM_024948chr101704 ------
NM_024953chr1222089 500 ------
NM_024969chr22832 765 ------
NM_024971chr91105 ------
NM_024979chr1331580 1440 406 ------
NM_024989chr277346 6388 5032 1795 1577 1476 1178 1787 26176 1545 12247
NM_025052chr2128 ------
NM_025054chr853075 1074 1015 648 212 ----13722
NM_025057chr1431350 939 549 ------
NM_025069chr81166 ------
NM_025074chr442019 1254 406 243 11143 --11226
NM_025083chr1542006 1959 1600 292 --11925 --
NM_025126chr122687 218 ------
NM_025133chr23802 355 131 ------
NM_025134chr1632227 593 114 ------
NM_025146chr322643 2520 --11807 --
NM_025147chr22869 110 ------
NM_025151chr852085 1733 864 536 385 1479 ----
NM_025160chr153432 1232 982 510 493 1744 12953 --
NM_025164chr1131730 1364 29 --21735 784 --
NM_025179chr193544 3353 3076 3006 1870 1812 1656 289 180 --13739 --
NM_025181chr22281 25 ------
NM_025182chr91866 1232 ----
NM_025184chrX1645 --1638 --
NM_025191chr132653 2547 220 1878 ----
NM_025208chr1142425 2117 2085 1944 21996 1871 ----
NM_025214chr1832568 2520 586 ----21782 827
NM_025221chr41169 --195 11138
NM_025222chr332418 1179 985 1423 2353 226 --
NM_025235chr1031698 1426 577 11496 ----
NM_025238chr1521358 244 ------
NM_025246chr3135 ------
NM_025248chr1733217 3025 2118 ------
NM_025250chr732579 624 355 --13028 --
NM_025251chr82428 232 --1274 --
NM_025256chr61246 145 ----
NM_025263chr63456 403 251 ----11293
NM_030576chr1722356 295 --2983 876 --
NM_030621chr1413352 23422 1262 21367 342 --
NM_030623chr211061 ------
NM_030625chr1051929 1616 398 282 252 --12011 --
NM_030627chr534027 3861 2616 ------
NM_030629chr1631326 677 200 ------
NM_030634chr122116 996 --32024 598 165 --
NM_030647chr785455 5067 4425 3973 2158 917 644 366 ------
NM_030648chr451584 1461 1436 1271 189 --14724 --
NM_030650chr253494 2994 850 244 54 1935 22744 445 --
NM_030652chr61280 ------
NM_030661chr731642 1579 1096 ------
NM_030664chr102311 88 22380 1772 11732 --
NM_030665chr172503 496 --11136 --
NM_030670chr1222127 147 --11684 --
NM_030671chr1222127 147 --11684 --
NM_030674chr1234493 950 677 --12020 1394
NM_030758chr2221227 449 1552 ----
NM_030761chr162619 2451 2112 2033 481 279 ------
NM_030762chr1231914 1899 1357 --1583 --
NM_030767chr932515 664 564 --32117 2057 182 --
NM_030786chr11697 11554 ----
NM_030791chr1431845 707 41 ------
NM_030799chr521426 529 1408 ----
NM_030802chr171927 1219 ----
NM_030806chr179214 8016 7876 7417 7259 6436 2899 1799 --18044
NM_030810chr6135 --11533 --
NM_030815chr202836 547 ------
NM_030816chr122854 950 13264 ----
NM_030817chr1233154 3060 70 ----22426 571
NM_030820chr62921 298 1398 ----
NM_030884chr321824 1755 1917 ----
NM_030906chr11--2535 146 1113 --
NM_030914chr91776 1689 ----
NM_030918chr1155233 4978 4882 4618 4492 4225 4147 3731 3645 1288 1224 696 611 549 228 21894 1477 --15070
NM_030920chr111943 ------
NM_030922chr152808 698 1179 1748 1849
NM_030926chr2187 ----1935
NM_030935chr7178 ------
NM_030937chr121133 265 1278 1254 1566
NM_030938chr171725 ------
NM_030939chr611183 ------
NM_030949chr631223 1215 409 ------
NM_030954chr82552 356 ------
NM_030962chr1121517 1008 --1493 --
NM_030964chr573498 3309 2809 2686 2558 570 136 --12597 --
NM_030979chr13--1370 ----
NM_030981chr1111082 ------
NM_031216chr1831673 784 191 1410 ----
NM_031243chr741739 926 263 74 ------
NM_031267chr71108 ------
NM_031272chr174131 108 102 83 ------
NM_031296chr412275 12778 11033 1853
NM_031305chr441338 638 394 330 ------
NM_031314chr1471948 1848 1419 1274 416 403 332 1473 ----
NM_031411chr522049 387 2707 465 22088 1603 11870
NM_031412chr1211208 --11200 --
NM_031417chr1951832 1802 1131 379 42 1608 ----
NM_031419chr3143 ------
NM_031426chr932396 2338 1906 12000 12614 1769
NM_031427chr1475758 4003 1428 991 692 339 253 ----1449
NM_031435chr1232335 1403 996 1294 11014 --
NM_031438chr551675 1220 442 432 422 11926 ----
NM_031442chrX42708 2525 164 118 --13163 --
NM_031459chr141647 572 515 414 1174 132 --
NM_031461chr821825 177 1435 11743 --
NM_031468chr797908 7620 6806 6362 5971 5320 741 659 585 23011 34 67580 7491 5163 1623 446 173 17570
NM_031469chr652860 939 870 513 497 --1821 --
NM_031483chr2031098 1017 661 12847 ----
NM_031492chr111512 --1403 --
NM_031845chr253379 2347 1451 709 701 12244 ----
NM_031847chr253379 2347 1451 709 701 12244 ----
NM_031849chr522049 387 2707 465 22088 1603 11870
NM_031857chr522049 387 2707 465 22088 1603 11870
NM_031860chr522049 387 2707 465 22088 1603 11870
NM_031891chr18----1148 --
NM_031908chr511339 21130 287 ----
NM_031935chr13748 695 104 ------
NM_031936chr11121 ------
NM_031940chr812032 --32517 950 837 --
NM_031942chr211183 ------
NM_031989chr122303 117 ------
NM_031990chr192437 127 1192 ----
NM_031991chr192437 127 1192 ----
NM_031992chr741713 525 148 131 --11495 --
NM_032012chr985222 4090 1975 1565 1332 1091 585 198 --11060 160
NM_032013chr2051625 1586 546 261 227 ------
NM_032017chr131629 1447 406 ------
NM_032041chr842730 2717 2099 611 --21875 152 --
NM_032050chr2211001 ------
NM_032052chr2221386 1008 --11040 --
NM_032088chr551701 1495 381 206 54 ------
NM_032092chr551701 1495 381 206 54 ------
NM_032102chr1143130 2150 1163 616 ------
NM_032116chr1385852 5431 5153 4807 4258 3992 1452 1409 13742 35395 3759 981 25201 2316
NM_032121chrX52683 1079 757 708 447 12773 ----
NM_032128chr41923 ------
NM_032153chr322594 938 12212 ----
NM_032181chr2189 1199 ----
NM_032186chr11987 ------
NM_032189chr1385081 4459 4381 4171 3830 1840 912 630 --14895 34292 3932 163
NM_032199chr1032495 766 612 ------
NM_032208chr253589 1156 877 697 157 13012 ----
NM_032211chr1031030 322 246 --1429 153
NM_032221chr2021843 1807 1241 ----
NM_032227chrX171 ------
NM_032228chr1153506 2367 1418 1192 615 1202 ----
NM_032233chr143842 812 325 --1314 --
NM_032236chr1----1921 --
NM_032239chr421347 1248 ------
NM_032242chr393151 2701 2388 2252 2205 2146 428 373 165 --13023 --
NM_032256chr121272 ------
NM_032268chr1622598 371 22779 2062 --1679
NM_032271chr1631423 1390 384 ----11524
NM_032272chr84471 386 35 25 ------
NM_032283chr141867 1729 666 410 --1655 --
NM_032288chr321680 579 --22403 2170 --
NM_032289chr551569 1290 704 396 100 ------
NM_032294chr1731545 1152 420 11435 ----
NM_032303chr921345 1268 11829 21308 326 --
NM_032320chr11--1577 ----
NM_032321chr263254 2756 2545 1239 799 253 --12804 --
NM_032327chr10175 ------
NM_032329chr294270 3978 3878 3382 946 886 661 651 604 --1486 --
NM_032352chr14------1501
NM_032364chr12------1177
NM_032368chr1172 ------
NM_032373chr1065604 5447 2272 978 260 149 --13709 --
NM_032376chr173658 628 549 1157 ----
NM_032377chr191623 ------
NM_032379chr112832 649 ------
NM_032389chr11156 ------
NM_032403chr551701 1495 381 206 54 ------
NM_032408chr741109 1086 929 156 ------
NM_032410chr82841 201 2463 88 ----
NM_032431chr112116 79 --2385 212 --
NM_032433chr1931552 1356 64 ------
NM_032434chr221196 93 --1123 --
NM_032435chr162074 1921 1733 918 615 139 11851 ----
NM_032436chr132323 129 1752 ----
NM_032439chr1021339 506 11121 ----
NM_032440chr1042938 1958 705 63 --11157 --
NM_032442chr171173 ------
NM_032445chr1532169 720 277 11820 12186 --
NM_032457chr433634 3032 2486 ------
NM_032458chrX12250 ------
NM_032466chr851199 611 565 504 286 ------
NM_032468chr851199 611 565 504 286 ------
NM_032482chr1961825 1034 1027 906 758 470 ------
NM_032484chr17127 --1415 --
NM_032499chr1521283 105 ------
NM_032505chr322423 419 ------
NM_032509chr872136 1820 930 830 625 436 232 12352 ----
NM_032510chr1842262 1551 35 29 ----1983
NM_032520chr161233 ------
NM_032521chr2033203 734 555 --1432 12872
NM_032538chr652591 2116 978 124 76 --21930 1071 --
NM_032539chrX3660 584 71 ------
NM_032547chr451415 1330 1170 555 374 ------
NM_032550chr101144 --21089 477 --
NM_032552chr951978 1791 1772 1638 591 --1247 --
NM_032560chr143810 318 221 ------
NM_032574chr2163 ------
NM_032582chr17128 11720 ----
NM_032594chr142696 434 1872 1234 --
NM_032603chr21712 1299 ----
NM_032622chr421192 79 ------
NM_032626chr16--188 ----
NM_032632chr1421806 434 --2540 419 --
NM_032682chr332771 2530 2294 ----12722
NM_032689chr1921658 1356 1112 ----
NM_032711chr1733692 2960 1372 1455 43196 3133 1627 219 1460
NM_032765chr51681 --1918 --
NM_032784chr61101 ------
NM_032801chr1112011 --11977 --
NM_032810chr1021389 57 125 ----
NM_032833chr121637 1035 ----11664
NM_032838chr19--1123 --1853
NM_032840chr124845 773 349 63 --1912 --
NM_032842chr731456 681 235 ----1450
NM_032859chr1372946 1454 844 818 758 645 239 12513 11425 --
NM_032866chr1532949 2534 131 22758 985 ----
NM_032870chr62506 99 ------
NM_032873chr1144585 4130 1289 404 2219 101 14107 --
NM_032884chr11268 ------
NM_032900chr1033529 3116 94 1262 ----
NM_032906chr42651 355 ------
NM_032936chr7--1176 ----
NM_032943chr112832 649 ------
NM_032968chrX34137 3129 498 33882 1103 995 13365 --
NM_032969chrX34137 3129 498 33882 1103 995 13365 --
NM_032973chrY34129 3124 498 33874 1103 995 13360 --
NM_032978chr183882 278 73 --1418 --
NM_032979chr183882 278 73 --1418 --
NM_032981chr183882 278 73 --1418 --
NM_032983chr753085 1155 1061 993 334 --53192 2772 2726 1149 352 12074
NM_032998chr111141 ------
NM_033014chr921559 1347 ----11447
NM_033016chr2231544 1413 441 1221 ----
NM_033020chr134732 3082 894 31629 1179 484 ----
NM_033030chr251457 1157 187 140 73 128 ----
NM_033044chr111056 --11071 --
NM_033056chr101683 ------
NM_033058chr8268 32 ------
NM_033071chr62493 118 ------
NM_033081chr2011205 1925 ----
NM_033082chr12----1178 --
NM_033089chr201497 140 ----
NM_033092chr11190 ------
NM_033102chr141095 444 429 51 ------
NM_033102chr141095 444 429 51 ------
NM_033105chr8------142
NM_033116chr142265 80 ------
NM_033118chr201304 --1858 --
NM_033119chr161137 ------
NM_033121chr122294 258 ------
NM_033127chr12615 196 ------
NM_033129chr2071671 1252 766 739 688 463 381 --11808 --
NM_033132chr131663 ------
NM_033133chr1733233 2435 1337 22983 1289 23657 2467 1319
NM_033135chr1142425 2117 2085 1944 21996 1871 ----
NM_033136chr531521 1208 506 1333 ----
NM_033137chr531521 1208 506 1333 ----
NM_033138chr742075 798 598 48 ------
NM_033139chr742075 798 598 48 ------
NM_033140chr742075 798 598 48 ------
NM_033157chr742075 798 598 48 ------
NM_033161chr921760 83 --1632 --
NM_033181chr641467 1198 870 145 ------
NM_033211chr531673 256 110 ------
NM_033224chr797352 5572 4896 3146 2599 2424 1163 1009 535 12440 36846 2675 266 26663 5151
NM_033225chr82618 572 --23069 881 21096 783
NM_033260chr61619 ------
NM_033274chr583294 3255 3032 2281 1268 475 279 170 ------
NM_033281chr5----1177 --
NM_033285chr874343 4269 3664 2746 1563 838 405 23808 592 ----
NM_033290chrX52945 2873 1369 1302 318 --23651 3049 1126
NM_033300chr11984 --11008 --
NM_033315chr172512 459 ------
NM_033326chr1122121 1672 ----12310
NM_033331chr952990 2689 2606 883 209 --11200 --
NM_033360chr1232881 526 247 11250 ----
NM_033375chr1711281 ------
NM_033387chr952452 1878 890 268 159 --12094 --
NM_033389chr1743965 1377 610 299 --13504 --
NM_033393chr432120 803 391 22306 794 22968 2599 --
NM_033421chr201533 --11352 --
NM_033425chr1133014 671 454 11151 33119 3002 2246 --
NM_033427chr71846 ------
NM_033429chr151693 1614 ----
NM_033495chrX21015 783 ----1984
NM_033512chr822466 867 --12890 --
NM_033515chr61101 ------
NM_033540chr311053 ------
NM_033549chr51943 1188 1384 --
NM_033626chrX1515 ----11454
NM_033631chr173749 3188 2898 2394 1436 941 694 13535 41131 482 338 47 --
NM_033632chr421287 255 ------
NM_033637chr1044005 3891 3155 455 --13741 13538
NM_033642chrX11036 ------
NM_033644chr582532 2396 1958 1933 661 632 208 184 ------
NM_033645chr582532 2396 1958 1933 661 632 208 184 ------
NM_033656chr2145560 5480 4527 4396 13971 14792 --
NM_052827chr121758 11134 ----
NM_052832chr832596 718 24 --11902 --
NM_052834chr182952 574 12268 ----
NM_052837chr11227 --151 --
NM_052840chr15----11484 11375
NM_052845chr1243199 3131 883 785 3647 406 132 32927 764 136 --
NM_052847chr1943110 2890 2860 250 13207 --2882 99
NM_052849chr151288 ------
NM_052854chr11------1621
NM_052862chr151376 1072 468 399 367 --1222 --
NM_052879chr1273837 3780 3635 2988 1368 719 329 --11049 --
NM_052885chr1254529 1552 871 484 450 23811 3481 23982 1108 --
NM_052886chr832080 1728 1396 --1517 --
NM_052898chr82686 149 ----11751
NM_052900chr811605 ------
NM_052904chr621077 38 ------
NM_052905chr22687 676 ------
NM_052910chr1342065 1861 1339 231 1701 1178 --
NM_052918chr10122265 1244 1199 1173 1055 892 702 692 597 587 553 341 12359 ----
NM_052927chr5------21653 436
NM_052932chr1122477 2254 1404 11584 --
NM_052936chrX2295 265 --1345 --
NM_052953chr31112 ------
NM_052978chr1461621 1554 1284 1234 683 161 ------
NM_053001chr82161 132 1269 ----
NM_053002chr311204 ------
NM_053016chr997861 7721 7569 7062 6898 6328 4888 1745 1269 12999 27758 2045 --
NM_053023chr1142212 1020 497 251 133 1359 --
NM_053024chr321210 1097 11064 ----
NM_053025chr3--1380 --11765
NM_053026chr3--1380 --11765
NM_053027chr3--1380 --11765
NM_053028chr3--1380 --11765
NM_053031chr3--1380 --11765
NM_053032chr3--1380 --11765
NM_053042chr422184 681 1880 11266 --
NM_053043chr785554 5270 4410 4397 4089 3961 1266 724 ------
NM_053056chr1122054 1946 32868 2704 944 ----
NM_053281chrX185 ------
NM_054013chr5--1705 2843 789 --
NM_054016chr141859 1334 1237 652 12005 ----
NM_054016chr141859 1334 1237 652 12005 ----
NM_054016chr141859 1334 1237 652 12005 ----
NM_054027chr532142 1692 436 --21904 744 --
NM_054035chr173604 363 260 ------
NM_057164chr21213 ------
NM_057165chr21213 ------
NM_057166chr21213 ------
NM_057167chr21213 ------
NM_057169chr1242878 2119 965 386 --1942 --
NM_057170chr1242878 2119 965 386 --1942 --
NM_057175chr442561 1065 641 198 --12618 --
NM_057178chr1752586 2210 2125 2080 73 11110 12089 --
NM_057749chr821108 192 ------
NM_058170chr111400 ------
NM_058237chr143854 756 395 --2908 875 --
NM_058241chr21861 ------
NM_058241chr21861 ------
NM_058243chr19----1710 --
NM_078467chr631476 1346 80 21145 959 11383 --
NM_078473chr812032 --32517 950 837 --
NM_078483chr583372 2903 2604 2530 2491 1522 1121 260 21645 341 1658 --
NM_078487chr963244 3137 2733 2358 1332 1307 ------
NM_078625chr63498 321 134 --21110 1024 --
NM_080544chr31426 11397 ----
NM_080546chr932201 930 511 ------
NM_080591chr942926 2831 2349 2295 --11014 --
NM_080594chr161606 149 --1257
NM_080599chr1021230 1147 ------
NM_080604chr63529 193 170 168 ----
NM_080617chr202999 764 ------
NM_080629chr11397 ------
NM_080630chr11397 ------
NM_080632chrX----1811 --
NM_080645chr661937 1526 779 699 288 204 ------
NM_080669chr1764399 3556 1803 1281 1010 887 13732 31959 610 264 --
NM_080670chr52810 317 1874 ----
NM_080672chr20------186
NM_080676chr2042914 2859 1118 1009 ------
NM_080679chr61942 --165 --
NM_080680chr61942 --165 --
NM_080681chr61942 --165 --
NM_080683chr41525 ------
NM_080684chr41525 ------
NM_080685chr41525 ------
NM_080738chr121937 1745 21895 1695 ----
NM_080744chr72536 444 2683 92 ----
NM_080759chr1332170 1747 1736 11679 ----
NM_080760chr1332170 1747 1736 11679 ----
NM_080862chr3----21035 127 --
NM_080867chr1474127 3908 3286 3251 1564 1442 885 13934 23679 3483 --
NM_080872chr873728 3370 3280 1514 918 562 37 1837 ----
NM_080881chr55585 312 292 175 94 ------
NM_100264chr101349 ------
NM_100486chr101349 ------
NM_130385chr1142993 2561 2438 1208 1283 13148 32111 1073 607
NM_130391chr943347 2522 1333 779 1363 33567 2925 984 --
NM_130392chr943347 2522 1333 779 1363 33567 2925 984 --
NM_130393chr943347 2522 1333 779 1363 33567 2925 984 --
NM_130395chr61154 --1316 --
NM_130434chr15----1410 --
NM_130436chr212569 548 1217 ----
NM_130438chr2151146 1125 573 204 102 1794 ----
NM_130439chr10--1629 ----
NM_130439chr10--1629 ----
NM_130440chr141439 1349 625 58 ------
NM_130443chr112277 126 ------
NM_130459chr961681 1591 1292 1128 292 161 ------
NM_130463chr6134