TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3160-5p
miRNA Sequence: GGCUUUCUAGUCUCAGCUCUCC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000020chr1262357 2276 2250 2011 1637 1604 22325 2199 72237 2035 1873 1650 1547 593 481 --
NM_000084chrX146893 6633 6459 6366 6226 6057 5739 5132 4525 2698 650 477 464 222 ----26418 5138
NM_000115chr1341739 583 382 189 1228 1213 1519
NM_000125chr683965 3463 3137 2964 1528 1322 680 522 42831 1072 746 618 2828 458 --
NM_000176chr553444 3329 3072 1212 295 12759 32700 976 34 12505
NM_000208chr19134527 4446 4094 3644 3500 3354 3194 1667 1579 1502 941 311 63 23635 1546 --1317
NM_000217chr1294878 4259 4153 4146 3572 3411 1346 1316 241 --11688 24170 842
NM_000248chr342800 1866 1194 421 1807 12304 12321
NM_000259chr15156075 5327 4536 2114 2001 1958 1888 1405 1350 1303 1085 789 430 276 268 23968 391 --26111 100
NM_000332chr6136233 5262 5253 4537 4454 1937 1789 1597 1302 784 580 260 213 35926 5464 948 22342 845 14517
NM_000337chr565957 5935 5327 4392 4172 791 21619 1270 36573 5582 93 --
NM_000351chrX133557 3430 3244 2950 2634 1745 1706 1697 1530 1266 342 211 139 1564 1967 1326
NM_000368chr9154465 4163 3750 3535 3334 3181 1856 1786 1518 1509 1437 1383 986 698 499 13597 34663 3754 627 --
NM_000386chr17----1152 --
NM_000390chrX61284 676 641 358 284 70 ----195
NM_000411chr2193295 2800 2599 2490 2076 1333 1013 679 224 22669 839 22945 1338 --
NM_000533chrX101895 1879 1720 1562 1461 595 562 394 374 134 ----2601 324
NM_000551chr331863 1507 239 --2553 144 2656 345
NM_000599chr2244007 3751 3726 3343 3270 3229 3182 2979 1826 1712 1644 1444 1334 818 719 522 372 352 322 304 296 290 274 266 33420 732 683 ----
NM_000618chr12125723 5008 4773 4669 4338 2290 2042 1847 1652 1124 1036 978 34299 1584 962 54962 2412 2105 1153 739 11042
NM_000618chr12125723 5008 4773 4669 4338 2290 2042 1847 1652 1124 1036 978 34299 1584 962 54962 2412 2105 1153 739 11042
NM_000619chr12--1525 ----
NM_000633chr18175008 4877 4687 4031 3780 3499 3225 1942 1799 1285 1272 1123 1091 915 884 476 443 1713 --13341
NM_000719chr12256614 6594 6576 6399 6389 5877 5824 5456 5311 5132 5103 4499 4382 4286 2325 2294 2182 1785 1158 1141 1047 807 438 236 173 35018 1324 296 --11505
NM_000721chr192398 1878 772 275 237 140 104 91 67 22584 1005 1580 --
NM_000748chr1123434 3217 3201 2812 2744 2656 2564 1286 1022 461 331 91 23535 3092 23936 2895 33042 2418 1250
NM_000793chr14185075 4593 4226 4217 4124 4106 3381 1349 902 895 826 764 722 709 673 366 293 253 --14132 14368
NM_000810chr15--1529 ----
NM_000813chr574784 4230 3821 2217 1329 1131 870 123 21766 319 1798
NM_000814chr1563919 3312 3150 2781 1622 447 33607 2991 2744 1304 23279 899
NM_000829chr1181596 1455 817 802 540 379 358 114 ----11531
NM_000831chr1135482 4991 4981 4738 4500 4324 2414 2401 1653 1249 1053 788 509 55177 4142 3872 2518 50 45077 4719 1197 155 1253
NM_000861chr3102543 2246 2100 945 810 762 289 191 143 68 --32704 981 231 1213
NM_000875chr15106509 6035 5041 2757 2527 2229 1050 407 385 68 --36711 4703 2337 11543
NM_000891chr1793118 2578 2350 1472 1399 957 947 479 149 ----12550
NM_000899chr1263627 1385 960 800 780 739 --11168 2527 306
NM_000901chr462108 2000 952 946 159 61 1819 --11896
NM_000945chr21251 --1701 1305
NM_001001419chr5115183 4212 3990 3748 3166 2014 1883 1705 1676 1472 989 24161 1910 ----
NM_001001420chr5115183 4212 3990 3748 3166 2014 1883 1705 1676 1472 989 24161 1910 ----
NM_001001433chr2072779 2516 1966 1950 1252 826 287 --32962 1138 807 11098
NM_001001556chr1551469 1415 1018 652 152 --11487 11159
NM_001001557chr8101880 1732 1423 637 510 458 369 156 141 79 --31458 564 93 11469
NM_001001664chr263551 3048 2680 990 830 58 ----1708
NM_001001709chr9122882 2434 2362 2331 849 836 696 523 405 341 301 265 1921 11146 11809
NM_001001890chr2183151 2930 2614 1542 1126 612 365 306 24116 297 1907 --
NM_001001938chr9123842 3281 2845 2767 2632 2548 1079 1045 480 447 387 251 12793 33559 3393 469 23414 692
NM_001002269chr9----1178 --
NM_001002762chr10112915 2766 2685 2111 2105 1923 745 734 686 480 111 --32252 446 120 --
NM_001002860chr1474322 4180 4090 867 675 665 169 ----23484 817
NM_001003407chr10124634 4400 4247 3308 3098 1399 1345 1049 807 694 441 30 14891 1131 14313
NM_001003408chr10124634 4400 4247 3308 3098 1399 1345 1049 807 694 441 30 14891 1131 14313
NM_001003652chr18137600 7292 6999 6729 5873 3479 3127 2528 2519 1959 1946 219 106 --48709 5461 3160 863 --
NM_001003674chr18166988 5687 5280 5225 4323 2828 2653 2531 2249 2195 2073 1702 1275 395 44 32 24467 1455 14639 24676 400
NM_001003675chr18166988 5687 5280 5225 4323 2828 2653 2531 2249 2195 2073 1702 1275 395 44 32 24467 1455 14639 24676 400
NM_001003712chr1264011 3378 1373 587 545 34 33086 1330 1263 ----
NM_001003800chr9113655 3271 3117 2866 2799 1088 1081 985 555 504 166 22942 290 --1427
NM_001004065chr9123191 3162 3020 2835 1112 1088 1080 1055 1020 677 213 170 172 121 1379
NM_001004342chr1146126 5547 5376 5163 4994 2399 2247 1216 1086 572 388 359 268 215 45943 4222 1204 1126 33996 2116 496 24855 4177
NM_001004419chr1254543 4086 1421 945 36 31006 789 388 23776 1102 1377
NM_001005404chr1794185 4107 4010 2756 1400 384 376 326 74 53205 1664 1373 866 354 --11174
NM_001005473chr5196476 6070 5909 5817 5523 4955 4005 1207 1197 1158 1070 1050 1018 1002 987 970 957 885 682 12205 140 --
NM_001005526chr2136 ------
NM_001005739chr2--1136 ----
NM_001005781chr21471 ------
NM_001006610chr163257 133 104 ----3931 700 263
NM_001007023chr14185075 4593 4226 4217 4124 4106 3381 1349 902 895 826 764 722 709 673 366 293 253 --14132 14368
NM_001007097chr9114765 4522 4495 3810 3792 3434 2017 1315 1096 1042 27 13243 1932 13796
NM_001007102chr61170 --11040 11382
NM_001007466chr684299 4276 4104 1970 963 943 866 119 1335 1130 15077
NM_001007565chr3--1146 ----
NM_001007794chr13708 534 44 ----2229 50
NM_001008393chr462766 762 749 743 549 248 1157 ----
NM_001008408chr7146133 5817 5109 4850 4332 4298 2468 2452 1950 1912 1386 934 546 346 --24210 1611 15037
NM_001008410chr281722 1607 1593 1440 1429 1409 884 693 42118 1971 1805 476 11709 --
NM_001008567chr9----175 --
NM_001009554chr494524 3785 3537 1296 1195 1075 862 229 186 11693 21858 1162 24414 3524
NM_001009554chr494524 3785 3537 1296 1195 1075 862 229 186 11693 21858 1162 24414 3524
NM_001009880chr22164579 4098 3773 3609 3071 2991 2983 1933 1233 1132 1054 835 602 435 303 256 34167 4127 1095 23248 306 14031
NM_001009899chr395958 4799 4467 4363 4119 4113 2538 145 88 14325 1720 --
NM_001009993chr284072 3957 1361 1148 1046 825 622 613 23718 3005 44241 3960 3920 1079 --
NM_001010852chr6--142 ----
NM_001010861chr162631 2123 1997 1813 907 453 --12027 21701 540
NM_001010888chrX43441 1672 1144 180 ----34044 1786 775
NM_001010891chr5106383 5905 5570 4726 4693 2083 1705 1441 691 103 21506 71 56169 5874 2482 2433 161 --
NM_001010986chrX82107 1843 1753 1634 956 856 578 193 1201 11741 --
NM_001011553chr7------1203
NM_001011663chr10--1761 ----
NM_001011666chr7116252 6101 6039 5946 5794 5606 4573 2490 1220 1075 968 --25682 4473 14363
NM_001011708chr272774 2476 2437 1960 1838 1098 1029 1963 12453 12570
NM_001012393chr1194627 4378 3943 3781 3264 1913 1829 1677 1085 54520 4256 4041 1266 73 33145 1685 1601 11367
NM_001012507chr6126 ------
NM_001012754chr1342129 1381 716 120 1218 11402 11751
NM_001013031chr1053424 2754 2459 2274 604 13066 13154 32930 2743 1188
NM_001013674chr12750 304 ----1114
NM_001014797chr10197399 7362 6931 6843 6718 6648 6631 6322 6273 6115 6009 5979 5176 5071 4974 2107 905 745 399 67636 7518 6167 5458 2374 1290 36778 6744 5383 --
NM_001014972chr2--1159 ----
NM_001017440chr7247633 7477 7457 7309 7300 7154 7147 7023 6458 6139 6086 5915 5446 3188 2931 2812 2607 2593 2475 2404 1674 1128 549 359 36450 3148 2533 88034 7696 7011 6954 6496 6211 5380 727 37315 3169 353
NM_001018067chr165130 5083 4427 3574 1623 793 25076 1105 24289 1231 14914
NM_001018068chr165130 5083 4427 3574 1623 793 25076 1105 24289 1231 14914
NM_001018069chr165130 5083 4427 3574 1623 793 25076 1105 24289 1231 14914
NM_001018074chr553444 3329 3072 1212 295 12759 32700 976 34 12505
NM_001018075chr553444 3329 3072 1212 295 12759 32700 976 34 12505
NM_001018076chr553444 3329 3072 1212 295 12759 32700 976 34 12505
NM_001018077chr553444 3329 3072 1212 295 12759 32700 976 34 12505
NM_001018091chr1591870 933 733 704 677 618 515 266 43 22296 1015 ----
NM_001018111chr7113736 3460 3317 2854 1575 1302 1112 806 534 486 82 1964 32866 2721 1532 12565
NM_001024094chr553444 3329 3072 1212 295 12759 32700 976 34 12505
NM_001024647chr12107581 7145 5884 5495 2902 2142 1976 1699 526 392 11996 1930 21646 605
NM_001024934chr6------1446
NM_001024935chr6------1446
NM_001024936chr6------1446
NM_001025076chr10116103 5684 5501 5447 5441 5268 5108 4616 2313 2232 760 21368 369 11421 --
NM_001025077chr10127461 7042 6859 6805 6799 6626 6466 5974 4939 2118 674 118 42726 1727 418 83 34944 2779 820 --
NM_001025100chr1893099 2967 2723 2669 1508 832 458 285 67 33471 1392 1147 2940 290 23037 2654
NM_001025108chr273438 3345 2664 1525 1052 775 289 --13117 13111
NM_001025203chr21----135 --
NM_001025204chr21----135 --
NM_001025580chrX74264 4230 3240 1475 846 786 687 --21553 418 1852
NM_001029884chr662725 2498 2452 2197 420 262 --31801 1691 350 12124
NM_001030055chr141527 13789 --11673
NM_001031679chr1253136 2838 1348 883 494 1665 12513 33255 1352 1148
NM_001031695chr22125461 3662 3550 3543 3455 1986 1910 1435 1106 1009 348 142 33519 3433 1573 24825 1945 11066
NM_001032283chr12------1973
NM_001032284chr12------1973
NM_001034852chr1482057 1824 1670 1338 690 324 222 213 --21837 1774 11932
NM_001037317chr162631 2123 1997 1813 907 453 --12027 21701 540
NM_001039538chr2153604 3398 3019 2858 2535 2505 1409 1385 1261 627 509 449 334 313 203 1903 13010 --
NM_001039547chr3107929 7770 5773 5469 3055 3031 1719 1036 698 455 22377 1525 37236 5796 5743 --
NM_001039577chr1124089 3936 3825 3663 3425 2962 1418 1412 1385 1102 304 87 24401 1601 23498 1362 --
NM_001039840chrX95747 4520 1610 1533 1348 1202 1087 1044 1023 15656 ----
NM_001039937chr13103953 3814 3762 3652 3399 3226 2832 1456 1268 1060 --23511 2748 11186
NM_001040057chr7----136 --
NM_001040102chr1082628 2018 1831 1816 1636 552 290 78 31709 1684 519 --1449
NM_001040103chr1082628 2018 1831 1816 1636 552 290 78 31709 1684 519 --1449
NM_001040108chr1483250 3136 3035 2880 2503 2345 2181 239 21297 789 12925 164
NM_001040152chr7104520 4494 4457 4436 4113 4071 3942 3900 1689 1012 21355 224 64864 4157 3637 3316 1847 1663 --
NM_001040214chr63408 301 292 2902 264 --22286 909
NM_001040429chr1372595 2350 930 485 325 259 99 11226 12930 12964
NM_001040441chr121224 204 1987 34832 1808 1215 23784 1371
NM_001040712chr943137 2563 1285 465 --33299 2267 490 1797
NM_001042355chr16125377 5172 4904 4739 4625 4432 3745 3516 2130 1288 1219 426 2299 36 25079 4388 1206
NM_001042412chr16125377 5172 4904 4739 4625 4432 3745 3516 2130 1288 1219 426 2299 36 25079 4388 1206
NM_001042555chr1264683 4253 1580 1517 772 627 24789 401 21151 576 11906
NM_001042599chr2127726 6965 6571 2734 2427 1417 1348 943 820 262 191 177 36749 6357 1155 11874 12712
NM_001042601chr372579 2414 2296 2157 2034 1275 945 43024 2116 1112 161 --12655
NM_001042749chrX2712 668 11749 21255 455 1227
NM_001042750chrX2712 668 11749 21255 455 1227
NM_001042751chrX2712 668 11749 21255 455 1227
NM_001044385chr293799 3462 3402 1589 1354 908 854 386 246 11247 11419 --
NM_001048183chr153688 2539 2298 1052 497 22553 531 1596 11021
NM_001049chr14111976 1930 1578 783 579 564 225 203 176 80 74 12234 12312 --
NM_001066chr182147 2077 1759 1732 1599 821 233 199 1599 --21636 1578
NM_001100108chr1167727 7597 7315 6901 6561 6399 2824 2294 1987 1801 1789 1636 1582 1446 646 629 1283 23263 442 --
NM_001106chr3149540 8905 7492 6815 6777 6587 6240 3591 3513 3358 3025 1938 1713 1560 13457 69122 8472 6750 6682 3727 803 13521
NM_001113490chrX113310 3028 2734 2535 2410 2226 1299 976 548 409 402 11215 --1466
NM_001146chr811974 32361 917 31 --12096
NM_001167chrX74712 1769 1715 738 627 578 458 ----2993 907
NM_001173chr141527 13789 --11673
NM_001174chrX72226 1747 822 781 601 289 263 2869 397 124 11606
NM_001191chr2091457 1357 1300 1011 976 970 961 387 363 ------
NM_001204chr2127717 7610 7359 6898 6116 5505 5189 2924 2480 1249 850 734 25945 2490 14722 12937
NM_001206chr962703 2209 1923 1240 968 114 1261 22806 1094 12224
NM_001256chr1752940 2538 906 859 300 1287 21919 1881 --
NM_001284chr51159 ------
NM_001315chr662199 2105 1906 1847 1558 48 --2628 451 11711
NM_001345chr121207 ------
NM_001346chr392695 2255 2052 1814 956 785 604 593 33 2938 134 --139
NM_001349chr2----179 2568 509
NM_001364chr1193746 3062 1400 1310 844 490 475 289 213 11752 --23468 686
NM_001387chr582652 1158 1138 1077 757 295 80 21 12479 12264 1578
NM_001402chr631832 681 141 11916 1574 11882
NM_001426chr23190 134 126 --1139 182
NM_001427chr731623 1418 552 21833 602 11426 11922
NM_001610chr11----1740 --
NM_001714chr12----1145 --
NM_001718chr621166 141 21036 77 1970 11204
NM_001721chrX--173 ----
NM_001731chr12----1723 --
NM_001754chr2183151 2930 2614 1542 1126 612 365 306 24116 297 1907 --
NM_001788chr7------1203
NM_001806chr1972833 2256 1085 990 919 359 85 ----32075 665 478
NM_001819chr20------1103
NM_001885chr11----139 --
NM_001939chrX103723 3545 3190 3045 2970 2337 1506 903 378 187 1690 21091 910 13394
NM_001941chr1843384 1552 1281 695 11149 2698 405 22933 1511
NM_001945chr581296 1279 1215 1188 947 389 377 82 1383 --2415 221
NM_001969chr1463962 3551 2645 2553 844 657 13763 11129 1498
NM_001987chr1271448 1358 1102 951 930 598 471 --33954 872 109 13326
NM_002009chr1562731 1792 660 567 186 109 11122 --11829
NM_002025chrX118775 8447 7991 7108 6619 6115 3381 2918 883 873 683 48411 6037 3495 328 28833 2816 15918
NM_002044chr1551469 1415 1018 652 152 --11487 11159
NM_002130chr52579 166 ----2416 339
NM_002158chr233561 2806 1366 11353 1564 13822
NM_002202chr5----141 1321
NM_002221chr152680 2639 987 442 208 --1669 3993 767 333
NM_002222chr3--11208 --1257
NM_002223chr1283647 3199 3005 1242 921 792 492 243 --43833 3759 1519 212 --
NM_002264chr354731 4075 4058 1790 724 24714 1056 --24760 4373
NM_002270chr575570 4024 2103 1740 1558 1173 382 2923 902 ----
NM_002285chr273438 3345 2664 1525 1052 775 289 --13117 13111
NM_002313chr10124634 4400 4247 3308 3098 1399 1345 1049 807 694 441 30 14891 1131 14313
NM_002336chr1274732 3975 3604 1839 1536 388 94 1577 --34020 3991 1484
NM_002358chr41656 1435 ----
NM_002359chr1763366 1108 731 512 325 310 --23885 1071 1876
NM_002374chr2153604 3398 3019 2858 2535 2505 1409 1385 1261 627 509 449 334 313 203 1903 13010 --
NM_002381chr21842 ------
NM_002387chr5134968 4428 4318 3854 3719 3580 3295 3201 1611 1214 105 98 67 --13259 --
NM_002395chr641290 1084 552 469 ----11003
NM_002397chr531928 1579 388 --11889 31584 849 392
NM_002451chr9153758 3628 3593 3281 3014 2679 2437 1260 1128 931 783 537 350 137 88 ------
NM_002481chr1207922 7461 7295 7280 7058 6735 6212 5821 5801 5010 3047 2707 2625 1744 1496 1244 1128 1111 1093 26 22926 1101 35768 2849 2721 35954 5762 5272
NM_002487chr15----1300 --
NM_002505chr661331 1114 1069 978 964 493 21152 378 11252 1992
NM_002522chr1783977 3107 2867 2663 1453 1021 955 928 33090 757 641 1195 11459
NM_002545chr1194627 4378 3943 3781 3264 1913 1829 1677 1085 54520 4256 4041 1266 73 33145 1685 1601 11367
NM_002581chr9185263 5162 4686 4530 4452 3439 3429 1687 1636 1531 1356 1306 1092 1052 626 467 403 149 --11360 14717
NM_002594chr2021560 598 1464 1576 22176 612
NM_002612chr751417 1322 794 646 306 31436 1333 621 --21340 1297
NM_002698chr19142915 2840 2490 2480 2075 2054 2001 1851 1100 906 894 772 463 421 12990 --12170
NM_002725chr164047 3614 3222 973 879 43 --1398 23719 747
NM_002734chr173495 205 135 --11662 12179
NM_002736chr712030 --11626 22062 287
NM_002737chr17156472 5728 5380 5156 4606 4370 2570 2563 2482 2464 2283 1683 1320 1208 448 46676 6275 2113 997 22135 440 21870 279
NM_002745chr2284358 3780 3669 1818 999 694 433 377 14491 13557 11027
NM_002748chr1511048 ------
NM_002806chr141270 ----1297
NM_002834chr1293204 2728 2672 2641 2586 1458 1437 1401 116 11579 32606 1224 84 1292
NM_002839chr943137 2563 1285 465 --33299 2267 490 1797
NM_002845chr18----1141 --
NM_002869chr11------22111 1813
NM_002873chr5--1470 ----
NM_002886chr3105134 4920 3872 3384 3231 3165 1915 527 489 381 11817 55049 4060 3684 1680 739 --
NM_002924chr1----1437 --
NM_002941chr3----1399 --
NM_002977chr283227 3168 2558 2406 1257 147 74 39 22600 115 --12496
NM_003010chr172761 214 ----32073 868 46
NM_003031chr163257 133 104 ----3931 700 263
NM_003034chr12158080 7445 6783 6138 5861 5841 5787 4957 2408 2309 1826 1608 1597 1189 120 17294 27235 1955 26158 5855
NM_003043chr3103541 3224 2687 1552 1463 931 814 632 582 548 13343 53975 3696 1442 839 443 23795 3728
NM_003048chr252297 1903 748 595 486 1543 22300 1024 11094
NM_003108chr2107001 6937 5157 5044 4633 2710 2685 2236 442 61 ----25896 2716
NM_003133chr131077 775 38 1979 3187 157 64 180
NM_003161chr1762918 2408 981 828 352 100 1456 1614 22497 1420
NM_003189chr152900 2749 1265 768 144 22117 761 1737 --
NM_003281chr1145216 5108 5020 5013 4805 4384 4288 4079 4033 3959 3772 1880 453 427 21833 1084 --11791
NM_003292chr122037 1662 12140 --11432
NM_003298chr3115988 5299 4986 4310 4157 2423 2371 2126 1993 1790 1462 25618 5029 25217 4384 1574
NM_003319chr2----1304 --
NM_003320chr11144274 4268 4139 3904 3308 3218 2983 2916 1540 1413 1004 460 327 196 11718 2543 525 33927 3178 355
NM_003385chr2--1697 ----
NM_003392chr363958 3795 3504 2646 697 332 33977 3852 2985 23004 1656 156
NM_003404chr20----1418 --
NM_003410chrX52463 2378 1059 1034 537 1375 --22929 1008
NM_003411chrY11205 1346 --1640
NM_003412chr373067 2653 2356 2151 1180 528 160 --12124 1166
NM_003468chr263598 1140 786 153 129 32 12684 33363 1684 1409 --
NM_003478chr1163116 3005 1331 713 376 81 --158 11191
NM_003558chr91462 ------
NM_003574chr1875486 4234 4223 3646 947 759 739 --35252 4934 3806 --
NM_003590chr253723 3524 3026 1093 707 12881 13612 1713
NM_003607chr1113982 3523 1548 1516 1466 1211 708 683 622 407 98 --21639 713 --
NM_003617chr184335 4237 3822 3705 3696 3687 1566 187 14219 13881 13950
NM_003630chr6----1632 --
NM_003644chr17136617 6568 6226 6167 5893 5001 4586 2267 1310 580 450 339 138 26183 5915 45476 4780 805 122 --
NM_003672chr141649 1583 1234 23 2791 79 2541 530 11851
NM_003704chr4----1545 --
NM_003763chr2072779 2516 1966 1950 1252 826 287 --32962 1138 807 11098
NM_003772chr1141086 441 363 303 ----11068
NM_003795chr6------1480
NM_003872chr282962 2865 2573 2313 2300 1086 718 161 1955 12257 11943
NM_003913chr664237 3894 1596 1386 961 897 33392 2837 1401 13899 1114
NM_003931chr6------1446
NM_003934chr9----1367 --
NM_003939chr10113997 3572 3492 2905 2603 1434 1415 1263 1129 1031 727 11618 23497 715 --
NM_003958chr683689 3526 3344 3057 3040 2921 1590 1372 1394 2578 140 13338
NM_003983chr1694239 4155 3367 3163 3149 3033 1332 1268 484 33408 1381 34 --11682
NM_003994chr1263627 1385 960 800 780 739 --11168 2527 306
NM_003996chr6----122 --
NM_004050chr1482788 2513 2156 806 646 406 324 126 148 32650 2357 693 1386
NM_004077chr1231196 1115 21 --243 35 --
NM_004090chr17123409 3377 3290 3046 2445 2160 1393 1345 964 958 702 273 ------
NM_004093chr13102847 2672 2452 986 937 794 739 721 210 75 11166 31187 787 704 11015
NM_004096chr1061940 1878 1743 1455 318 233 --31629 753 539 1841
NM_004171chr11149104 8582 8321 6728 6396 3620 3570 3560 3403 2631 2405 1189 1096 734 28739 1153 57894 7627 6524 6472 984 1780
NM_004232chr1883503 2954 2730 2570 2473 2438 1531 1028 --12866 12877
NM_004253chr91832 ------
NM_004293chr993394 3043 2937 2844 2821 2412 334 261 163 23065 1083 179 13699
NM_004296chr1493870 3630 3411 3391 2905 2500 1108 178 117 1426 13009 2723 592
NM_004329chr101352 ----1885
NM_004331chr862468 2291 1995 1899 1890 1656 22199 1681 --21842 969
NM_004338chr18166988 5687 5280 5225 4323 2828 2653 2531 2249 2195 2073 1702 1275 395 44 32 24467 1455 14639 24676 400
NM_004385chr51698 2209 163 --1216
NM_004397chr11133636 3435 3395 3091 2693 1630 1286 804 301 292 282 270 175 --21655 1297 31290 1180 1155
NM_004412chr1064870 2087 1718 1397 1002 53 26028 1238 21534 789 15859
NM_004468chr11407 ------
NM_004491chr19104229 3579 3472 3163 3112 2728 1468 741 728 607 --33568 2949 1439 14072
NM_004520chr5182 ------
NM_004586chrX104665 4565 4424 3504 3475 2157 1969 1897 1767 860 23762 3561 32162 763 745 12099
NM_004612chr974850 4781 1740 1180 1035 695 100 34318 1503 1334 31747 1227 388 --
NM_004645chr17148 ------
NM_004705chr111208 ------
NM_004719chr12--22080 226 1437 --
NM_004745chr8146231 5983 5915 5783 5493 5340 5134 4980 4876 4701 747 733 599 472 11859 --15474
NM_004747chr10--180 ----
NM_004763chr213823 814 771 762 715 706 435 426 379 370 323 314 38 ------
NM_004774chr1782910 2139 1135 675 259 233 208 153 13101 1238 12414
NM_004798chr2062830 2514 2346 1412 908 76 31363 1089 261 12644 22794 1010
NM_004815chr174654 4194 3878 3715 2982 1475 1048 1958 34718 3504 581 13089
NM_004823chr19101591 1574 1561 1535 1529 1514 1503 1451 1209 1201 ------
NM_004834chr252853 2305 2135 2097 924 1295 --22388 455
NM_004849chr631527 1096 393 ----1432
NM_004857chr1484550 4493 4274 1819 1449 1139 291 204 24679 1858 14278 14497
NM_004891chr2----1165 --
NM_004898chr461783 615 323 86 77 36 11015 --1589
NM_004904chr7116252 6101 6039 5946 5794 5606 4573 2490 1220 1075 968 --25682 4473 14363
NM_004939chr2138 ------
NM_004956chr764051 3945 3825 3613 3349 1385 34308 3424 1536 1228 14117
NM_004958chr1----190 --
NM_004990chr12----122 --
NM_004992chrX118153 8109 7504 7297 6234 3227 2696 2596 2575 2005 625 48400 5225 1622 1031 12635 26325 1473
NM_004992chrX118153 8109 7504 7297 6234 3227 2696 2596 2575 2005 625 48400 5225 1622 1031 12635 26325 1473
NM_005065chr14125017 3979 3838 3618 3368 2103 1909 1705 1573 1083 446 41 --21690 1158 1123
NM_005077chr9----1177 --
NM_005086chr1261755 1602 1343 721 258 84 11413 11532 2203 30
NM_005094chr91192 ------
NM_005116chr2073089 1443 1230 1129 1079 1056 644 ----22930 1538
NM_005125chr111147 ------
NM_005188chr11148151 7699 7590 7306 6680 6163 5902 2529 2103 1992 1064 469 244 72 46355 6314 5373 5233 21076 294 15605
NM_005197chr14135972 5951 5129 4333 4297 3973 3764 2105 1987 1905 962 868 567 36070 5699 476 21969 1038 34958 2037 389
NM_005235chr2127726 6965 6571 2734 2427 1417 1348 943 820 262 191 177 36749 6357 1155 11874 12712
NM_005238chr1192763 2690 1237 1022 786 284 265 243 175 --12529 11344
NM_005254chr1521094 43 1895 --1515
NM_005277chr4192 ------
NM_005308chr101391 --1544 --
NM_005339chr443909 2981 1404 1049 --13298 13486
NM_005397chr7113736 3460 3317 2854 1575 1302 1112 806 534 486 82 1964 32866 2721 1532 12565
NM_005399chr1124197 3675 3196 1244 861 785 697 325 236 225 169 87 1922 ----
NM_005400chr272448 2199 2130 1897 844 352 40 12425 22852 189 1358
NM_005433chr1832550 1037 995 22319 621 21031 731 --
NM_005436chr1084050 3914 3889 3871 3864 3188 2866 2497 11036 32967 2598 506 1830
NM_005465chr131455 576 367 1731 11746 2787 564
NM_005497chr1796144 2387 2332 2312 1438 1358 1304 590 171 35336 1476 574 25117 1060 1860
NM_005502chr92891 559 32716 2060 32 1519 11198
NM_005504chr12166299 6106 5852 5303 5279 5039 4679 4077 2218 1719 1597 1523 1328 1015 586 385 --34738 4204 444 --
NM_005542chr751369 1347 1314 513 34 21656 28 ----
NM_005596chr9106406 5620 5509 4905 4621 2340 520 227 209 180 --14631 --
NM_005604chr682203 1784 1599 650 469 312 296 269 2863 165 ----
NM_005626chr11401 ------
NM_005639chr1231842 1643 412 --1167 2741 660
NM_005647chrX83440 2967 2192 1160 986 614 330 264 22885 1314 11072 1936
NM_005665chr164644 3302 3296 3274 1578 872 --13834 --
NM_005694chr3------1121
NM_005719chr12----1164 --
NM_005759chr243100 1102 655 62 13123 24247 1577 --
NM_005828chr17114950 4928 4379 4349 4104 3997 3317 2037 1491 1249 1094 --34797 4331 774 --
NM_005840chrX197644 7475 7414 7371 6931 6754 6748 6533 6379 6357 6339 6122 6076 5754 5532 5418 5304 1231 390 14878 36036 1732 1379 --
NM_005843chr221673 27 11467 21724 1198 11499
NM_005901chr18137600 7292 6999 6729 5873 3479 3127 2528 2519 1959 1946 219 106 --48709 5461 3160 863 --
NM_005903chr5115183 4212 3990 3748 3166 2014 1883 1705 1676 1472 989 24161 1910 ----
NM_005909chr5144047 3884 3021 948 703 469 459 437 419 399 379 348 340 320 34213 3785 358 1329 2632 473
NM_005910chr17133057 2907 2901 2814 2642 2537 1181 852 760 647 354 339 49 11316 31518 1500 602 2784 576
NM_005935chr494828 4499 1828 1070 897 710 413 367 53 24989 621 23377 3246 --
NM_005937chr17163981 3723 3509 3460 3068 2657 2646 2607 1379 889 579 486 433 237 144 101 32847 2824 591 --1304
NM_005966chr23671 261 160 12094 4946 765 525 472 --
NM_006061chr63331 286 36 ----11324
NM_006070chr3--1146 ----
NM_006090chr13708 534 44 ----2229 50
NM_006095chr484111 3987 3628 3113 2763 1809 104 46 14214 23376 593 13209
NM_006141chr16142627 2576 2190 2085 2042 1887 1042 965 498 473 444 431 294 178 1404 1422 --
NM_006162chr1881595 1580 1521 1506 543 280 230 215 1221 11100 --
NM_006203chr595286 5201 5195 4247 2184 1723 1647 375 291 25463 2147 25135 5113 14071
NM_006212chr1105242 5234 4567 3415 2098 1811 1570 1142 1024 553 11958 --22069 932
NM_006241chr31582 --11502 22012 1862
NM_006252chr197620 7026 6653 6123 2374 2022 1139 969 576 12009 12707 --
NM_006256chr152642 2494 910 364 302 ----32089 2056 1949
NM_006258chr1031251 444 78 --11256 11404
NM_006283chr8103692 3543 3127 3074 1930 1445 1259 590 476 204 11800 --11115
NM_006306chrX105787 5751 5706 4857 4747 3575 1874 1127 1052 411 35777 3804 1861 45486 5301 4144 441 --
NM_006317chr51314 ------
NM_006375chrX31672 1177 514 31797 1168 428 21612 62 1684
NM_006393chr1063894 3495 1339 1090 499 147 --23403 2926 14310
NM_006454chr473030 1976 1070 1026 411 395 117 22617 422 11116 12493
NM_006471chr18----1270 --
NM_006521chrX61097 1055 387 242 226 42 --1233 --
NM_006544chr14106089 5857 5016 4626 4541 4495 3971 2387 1583 1172 --55113 5042 1644 1612 1557 34644 312 84
NM_006546chr17135398 5201 4724 4508 4473 4072 2357 1952 1903 1509 649 357 144 --45291 4859 1968 1826 --
NM_006561chr10116103 5684 5501 5447 5441 5268 5108 4616 2313 2232 760 21368 369 11421 --
NM_006572chr1783058 2976 2866 2728 2423 1158 521 170 1675 23540 3445 22898 1075
NM_006603chrX2712 668 11749 21255 455 1227
NM_006620chr6104388 4225 4037 3684 3464 1404 592 577 555 117 --53629 3607 3249 1323 201 --
NM_006633chr51593 ------
NM_006644chr131600 ------
NM_006654chr1264683 4253 1580 1517 772 627 24789 401 21151 576 11906
NM_006720chr10124634 4400 4247 3308 3098 1399 1345 1049 807 694 441 30 14891 1131 14313
NM_006722chr342800 1866 1194 421 1807 12304 12321
NM_006727chr5------136
NM_006729chrX75416 1475 709 578 478 394 90 45477 2257 944 530 ----
NM_006738chr15103987 3565 3132 3091 2830 1750 1394 1156 1142 904 31461 1250 268 2677 470 14191
NM_006744chr101179 ------
NM_006758chr21----135 --
NM_006775chr62336 218 --42039 1154 613 322 12389
NM_006800chrX1189 ----1560
NM_006813chr6--1238 --1953
NM_006823chr841317 926 428 284 ----21066 440
NM_006885chr1663898 3698 3685 1658 1593 1192 1404 --23904 629
NM_006948chr21----183 --
NM_006978chrX----184 --
NM_006981chr972804 2663 2451 2417 2310 1181 835 11101 12848 1128
NM_006991chr3--11002 1131 --
NM_007007chr1284412 4238 4098 3685 3653 3129 2929 481 --34516 4506 1033 --
NM_007011chr15136651 5718 5380 5366 5125 5022 4810 4467 4347 2234 1296 899 44 24601 2569 ----
NM_007038chr2134992 2038 519 11293 32284 1347 93 11963
NM_007050chr20207935 6932 6911 6532 6520 5859 4969 3198 2960 2920 2663 2634 2286 2031 1899 1853 1689 1639 951 555 17292 45336 2002 1839 1388 26971 5449
NM_007073chr684105 3500 3127 2767 1074 898 139 131 11371 13568 --
NM_007114chr311152 23257 1037 198 12147
NM_007200chr15103987 3565 3132 3091 2830 1750 1394 1156 1142 904 31461 1250 268 2677 470 14191
NM_007203chr9123191 3162 3020 2835 1112 1088 1080 1055 1020 677 213 170 172 121 1379
NM_007249chr13197430 6583 6294 6227 3579 3509 3490 2853 2829 2701 2611 2290 2173 1499 1365 1311 1237 781 540 29366 495 22837 1332 1144
NM_007282chr3--2844 245 1933 --
NM_007350chr1284273 4242 3595 3576 3166 1630 967 46 24502 4370 33668 1502 500 --
NM_007361chr141450 ----2598 83
NM_007375chr13931 229 168 1585 32631 847 764 1944
NM_012096chr341197 876 635 65 ----23302 416
NM_012104chr11143655 3587 3145 2952 2929 2885 2821 2344 1358 642 596 587 210 149 22436 965 12743 --
NM_012104chr11143655 3587 3145 2952 2929 2885 2821 2344 1358 642 596 587 210 149 22436 965 12743 --
NM_012124chr11--1263 ----
NM_012137chr172355 1940 1825 795 775 755 415 --32118 1120 858 --
NM_012141chr13103953 3814 3762 3652 3399 3226 2832 1456 1268 1060 --23511 2748 11186
NM_012164chr9117414 7342 7298 6267 5529 1721 1615 1334 1119 678 539 25337 4590 25860 315 12983
NM_012192chr11102262 922 874 727 641 457 290 112 91 24 --2883 190 41832 1807 449 434
NM_012193chr1195099 4916 4286 3624 3531 1711 1705 807 310 11952 14843 14460
NM_012199chr1104217 4170 4095 3575 3442 2849 1740 1243 573 413 13449 3905 431 37 181
NM_012214chr2136286 6095 6010 5520 5123 4280 4189 4159 4110 4067 4016 2196 143 26127 5607 22228 780 15584
NM_012261chr201486 ------
NM_012262chr174767 2042 1695 1626 1462 224 149 24797 1369 14894 24605 3768
NM_012296chr1193708 3687 3462 2949 2601 1161 905 706 614 22774 889 11251 11348
NM_012334chr564117 3710 3303 1898 483 119 --13849 11890
NM_012382chr573537 3411 1495 1254 1134 527 372 11298 23106 460 13318
NM_012412chr7----1651 --
NM_012432chr11349 ------
NM_013231chr1484218 3929 3111 3012 1653 1566 1524 1517 34170 3714 560 1572 23846 2674
NM_013255chr7148857 8542 7919 7664 7532 7402 7309 7297 6174 5627 5392 3376 1849 949 17935 16283 17073
NM_013269chr1244470 4013 1348 872 3933 716 315 23703 1029 1304
NM_013280chr113878 720 96 ----3201 132 90
NM_013281chr201333 ----11000
NM_013341chr272774 2476 2437 1960 1838 1098 1029 1963 12453 12570
NM_013372chr1582997 2071 1294 1165 1098 963 656 49 13161 2822 762 1221
NM_013382chr1472303 2216 1990 1484 889 593 48 161 41641 186 175 89 1685
NM_013989chr14185075 4593 4226 4217 4124 4106 3381 1349 902 895 826 764 722 709 673 366 293 253 --14132 14368
NM_014011chr212230 ----22314 2254
NM_014048chr1684982 4573 4555 4262 2086 1521 513 121 33997 3307 1939 --14563
NM_014112chr8144992 4608 4601 4335 4289 4148 4084 3650 3422 1769 1738 1217 328 202 ----14452
NM_014117chr1661713 1679 817 315 146 39 12681 --12097
NM_014141chr785269 4410 3351 1422 678 626 524 57 33378 2041 1978 14567 --
NM_014153chr16157 ------
NM_014155chr11167475 6722 5884 5753 5711 5692 5617 4768 2599 2583 2412 2135 591 395 308 180 31967 135 75 26401 4591 --
NM_014181chr232755 2018 1137 22920 2397 1153 12498
NM_014309chr22125451 3652 3540 3533 3445 1976 1900 1425 1096 999 338 132 33509 3423 1563 24815 1935 11056
NM_014381chr1483250 3136 3035 2880 2503 2345 2181 239 21297 789 12925 164
NM_014411chr7101932 1887 1682 1570 1384 1313 691 655 648 179 --2640 142 --
NM_014445chr311898 1450 --12116
NM_014497chr2--1159 ----
NM_014575chr31542 ------
NM_014577chr22--1896 1577 --
NM_014615chr1643399 2708 1283 297 22469 1328 11113 13013
NM_014616chr353035 2376 887 420 335 12420 --22287 157
NM_014636chr9104032 3659 3502 2932 2902 1071 747 638 624 378 11641 23083 2649 22823 294
NM_014646chr1883060 2882 2781 2727 1226 625 310 202 73054 2264 2231 1035 950 894 58 ----
NM_014647chr1672195 2091 1940 1594 1417 836 509 21955 1564 2691 340 1316
NM_014721chr6136928 4663 2858 2842 2819 2778 2467 2140 1149 406 196 124 50 --36365 5499 323 24773 4571
NM_014729chr862247 2132 1957 1497 1479 686 22192 1432 11716 --
NM_014730chr12165162 4707 4523 4140 4073 3968 3853 3575 3452 3217 1553 848 562 539 311 43 24588 4008 --1162
NM_014730chr12165162 4707 4523 4140 4073 3968 3853 3575 3452 3217 1553 848 562 539 311 43 24588 4008 --1162
NM_014732chr16205871 5452 4969 4715 4623 4419 4155 4098 4058 3941 3574 3561 2273 2164 2139 2099 939 856 598 555 1902 15777 15460
NM_014739chr683957 3623 3363 3318 2608 1598 558 317 21670 654 11065 13443
NM_014746chr222728 490 13935 21277 611 1949
NM_014747chr1155576 5478 5454 5369 4686 4509 4246 4189 3898 2324 2130 1977 1907 1841 1676 23532 1577 14528 45531 4306 3747 1549
NM_014751chr822026 1949 1130 --11371
NM_014762chr1112602 2485 2381 2154 2093 1820 1609 961 799 537 179 22284 1635 --21774 745
NM_014766chr7113365 3256 2814 2797 2450 1104 1017 946 937 689 562 22662 1441 197 23371 2464
NM_014767chr10113307 3285 2971 2949 2429 2316 2302 1300 1248 1207 97 --11210 22976 2435
NM_014774chr132657 2479 335 1487 1996 22280 464
NM_014819chr541893 799 556 130 --1510 1172
NM_014826chr1113982 3523 1548 1516 1466 1211 708 683 622 407 98 --21639 713 --
NM_014835chr20132307 2136 2124 1929 1881 1633 1626 1604 717 454 425 397 341 11574 ----
NM_014840chr1293087 2846 2275 1231 890 760 740 586 44 1599 22358 1333 1307
NM_014877chr17147377 7016 6661 6511 6342 5768 5700 5538 5415 5110 4820 2324 1929 1263 --26345 2339 --
NM_014879chr32867 24 1438 1466 1889
NM_014898chr1981721 637 457 351 136 119 65 48 ----12129
NM_014906chr1742696 611 551 322 23145 1057 ----
NM_014909chr14173770 3320 2845 1548 1500 1478 1373 1365 1270 1140 674 611 533 503 292 121 83 1510 33323 3135 3024 --
NM_014912chr1083174 2918 2847 2782 2575 2216 416 57 22517 1030 1834 --
NM_014923chr13--1448 12252 1749
NM_014962chr2032403 2308 2208 --1795 22048 485
NM_014982chr14105178 5164 4809 4431 4415 4222 1708 1644 983 64 15220 --11727
NM_015020chr16113334 2961 2733 1535 1440 1109 1054 1008 969 649 466 23543 877 --1564
NM_015026chr1264421 4105 4054 3194 342 75 44689 4008 3731 24 ----
NM_015032chr1372425 1053 1004 730 598 212 33 ------
NM_015035chr2075451 4861 4598 1572 1044 884 125 35001 4837 4101 25618 4571 1561
NM_015039chr1154191 3770 3577 3457 3299 3274 3185 3053 2721 2658 1729 1596 1454 376 298 22700 1751 33613 2852 658 11257
NM_015040chr232507 1375 910 23298 2943 --1398
NM_015042chr1582931 2773 1525 1393 1369 654 546 212 3293 284 139 13209 11018
NM_015049chr292676 2410 2135 2112 1320 384 368 232 173 1191 1425 12060
NM_015051chr993350 3190 3160 2900 2768 2742 2632 2249 115 22783 2262 23274 1080 --
NM_015059chr15113394 3320 3125 2564 2503 1443 1166 936 689 435 252 13579 12567 13504
NM_015068chr7123372 3346 3309 3288 2965 2923 2794 2752 1445 1137 992 541 1207 53716 3009 2489 699 515 11369
NM_015071chr5206065 5933 5388 5348 5338 5218 4602 4594 4485 4357 2590 2353 2128 1861 1825 1804 1317 338 332 247 35282 364 228 12565 26335 5520
NM_015074chr184471 4406 4160 3669 3071 1711 907 706 11958 31846 1719 47 --
NM_015077chr1784368 4282 3569 3442 3099 1529 1230 921 1369 11639 34477 3251 1484
NM_015082chr5102440 2373 2364 2358 887 733 647 541 450 195 1408 22588 1732 --
NM_015092chr1694053 3901 3864 3403 1586 576 447 311 152 23643 233 --11027
NM_015132chr73524 336 186 1347 11434 11842
NM_015144chr1673608 3454 3332 2703 2571 1276 1187 23510 2724 23696 1585 --
NM_015200chr452217 1895 941 210 31 12198 --21800 375
NM_015206chr1562552 2449 1336 1019 636 302 33702 1510 1240 --1154
NM_015225chr962883 2729 2152 2012 573 432 --22772 146 1243
NM_015247chr16125377 5172 4904 4739 4625 4432 3745 3516 2130 1288 1219 426 2299 36 25079 4388 1206
NM_015264chr22164579 4098 3773 3609 3071 2991 2983 1933 1233 1132 1054 835 602 435 303 256 34167 4127 1095 23248 306 14031
NM_015268chr31513 ----1185
NM_015271chr4103769 3519 3476 3306 2971 2736 2651 884 878 102 33850 1648 1051 2943 818 11019
NM_015282chr242090 2062 2028 1060 ----2344 185
NM_015299chr14103221 2962 2759 2676 734 659 644 356 346 131 11224 13538 1512
NM_015310chr8198415 7658 7115 6846 6686 6557 6076 5675 3182 2056 1389 1379 1373 1047 722 713 689 683 21 47852 1107 634 588 46887 6777 1751 1527 13256
NM_015313chr1183531 3179 1009 953 669 525 507 91 31227 841 370 24482 3535 13075
NM_015315chr5123259 3021 2818 2284 1351 1078 704 683 591 255 81 35 --52987 2357 2266 474 432 22972 851
NM_015328chr7102371 2224 1028 916 844 740 528 234 212 72 12363 22376 809 --
NM_015335chr1262640 1714 1045 988 575 278 ----1893
NM_015347chr123994 886 325 --42480 540 395 328 12437
NM_015352chr2083081 2441 1527 1417 1211 1113 345 329 23860 3095 22990 2965 12646
NM_015365chrX74264 4230 3240 1475 846 786 687 --21553 418 1852
NM_015375chr194424 3813 3706 3611 3234 1736 1635 1610 1169 --24041 3466 13695
NM_015384chr5----1129 --
NM_015393chr4103764 2851 2514 1215 862 805 593 422 305 271 22759 552 --1465
NM_015409chr1292667 2475 2026 1708 802 537 490 311 111 12537 12314 --
NM_015553chr694851 3188 3142 2027 1915 1875 1483 583 418 21964 937 34639 3179 1461 14704
NM_015569chr184639 4262 3858 3773 3541 821 732 518 34256 1453 49 ----
NM_015609chr1122854 2209 1938 1809 1070 1025 852 803 570 297 249 243 11199 --1927
NM_015626chr171418 ----2943 855
NM_015640chr165130 5083 4427 3574 1623 793 25076 1105 24289 1231 14914
NM_015651chr961529 677 591 559 488 95 --21929 579 3637 478 100
NM_015886chr8125029 3874 3688 3662 2186 2015 1678 1536 1140 984 974 71 --22052 1682 21048 861
NM_015906chr174815 4413 3852 3745 1634 855 192 14233 14173 --
NM_015984chr11201 ----1488
NM_016083chr673571 2850 1460 1400 1369 816 758 --1209 1822
NM_016141chr31165 --186 2640 238
NM_016206chr3118644 8331 7830 7164 5861 3544 2846 2436 1260 330 108 46886 2256 2196 1459 48502 6826 3335 820 1161
NM_016217chr653573 3364 532 446 299 1593 13376 1702
NM_016255chr662967 2958 2843 2233 1121 530 2305 139 12388 1905
NM_016257chr1153342 3333 3305 2903 2624 2232 2218 1220 930 754 707 646 635 581 34 ----12238
NM_016260chr2106026 5146 3009 2645 2574 1407 1128 372 196 183 11643 11355 12835
NM_016356chr662756 2594 898 687 364 148 1399 --31071 592 334
NM_016396chr1542700 1864 682 157 13011 1908 --
NM_016448chr151796 1632 1254 1215 408 1376 31459 666 116 --
NM_016516chr2--1136 ----
NM_016577chr384334 4316 3840 3683 3096 1746 989 797 13597 21271 1253 21783 1752
NM_016578chr11--1614 ----
NM_016599chr421202 410 2964 954 --11369
NM_016621chr1161606 1018 840 822 126 92 24245 383 34203 4182 3224 14067
NM_016654chr1521094 43 1895 --1515
NM_016834chr17133057 2907 2901 2814 2642 2537 1181 852 760 647 354 339 49 11316 31518 1500 602 2784 576
NM_016835chr17133057 2907 2901 2814 2642 2537 1181 852 760 647 354 339 49 11316 31518 1500 602 2784 576
NM_016841chr17133057 2907 2901 2814 2642 2537 1181 852 760 647 354 339 49 11316 31518 1500 602 2784 576
NM_016929chr6123843 3535 2988 2798 1751 1562 1204 583 470 438 285 35 22906 2885 53552 3089 1792 1209 887 23833 1723
NM_017447chr212785 735 11338 179 34097 1457 1039
NM_017516chr11------11092
NM_017544chrX3726 688 658 --1693 2649 634
NM_017628chr484474 4348 4158 3989 3427 1905 1859 1481 --24596 1392 14451
NM_017633chr6103580 3424 3275 3019 2906 1258 786 369 252 30 --22909 713 --
NM_017637chr9228806 8542 8300 7892 7677 7616 7607 7019 6927 6429 6347 5871 3710 3374 2572 2325 1644 1635 1592 1527 1466 228 27661 1603 27901 7853 --
NM_017650chr795433 4641 4472 2130 1294 1102 750 627 497 14480 14446 24218 427
NM_017709chr184141 3989 3961 3098 1407 1206 626 435 13473 11391 32708 1489 234
NM_017712chr19126282 6026 5561 4958 4487 4046 3990 2456 1611 1220 795 121 35453 2524 1633 --36345 5012 4933
NM_017776chrX51366 444 401 95 66 125 1431 1196
NM_017801chr342262 2160 1829 788 2814 115 1884 1135
NM_017847chr162134 1725 1686 1677 547 233 11942 11407 11820
NM_017848chrX74653 4583 3479 1666 1558 1542 32 --13843 14170
NM_017902chr10115321 5047 5018 3741 2282 1956 1907 643 619 598 445 --12120 13761
NM_018030chr181177 1830 ----
NM_018036chr14113558 3436 3382 1577 1554 1237 1200 724 709 315 257 21373 429 2562 78 13993
NM_018085chr1197882 7286 7247 6607 5893 5726 5683 5101 3068 2742 2519 2335 1892 1475 1165 990 967 365 318 22580 1381 37971 3073 829 15126
NM_018086chr251944 631 291 196 181 21436 675 --1214
NM_018167chr143945 933 42 1254 --3857 287 96
NM_018234chr281722 1607 1593 1440 1429 1409 884 693 42118 1971 1805 476 11709 --
NM_018241chr42985 121 ----1669
NM_018263chr2102614 2322 2314 2260 2226 2066 897 621 420 173 --31964 406 377 12355
NM_018313chr332478 1006 481 ----32292 2228 942
NM_018327chr2041735 1492 1346 42 21874 591 --21249 731
NM_018362chr1152579 1414 1016 933 343 1649 --13017
NM_018364chr153608 3272 2740 1037 461 ----1574
NM_018371chr8158 --1130 1449
NM_018429chr532568 2147 438 --12536 22889 1106
NM_018440chr8138333 7464 7126 6946 6070 3130 3075 2672 2102 1728 1407 308 172 27612 2352 46081 5383 2406 872 13301
NM_018452chr6_random83430 2906 2394 1417 1309 591 501 40 23588 2982 22876 809 12750
NM_018566chr134518 465 358 --33861 2043 50 2440 333
NM_018660chr8102794 2483 2158 1240 1119 1063 679 402 339 97 11052 22050 228 32775 2180 847
NM_018682chr7--1643 ----
NM_018683chr20----11681 --
NM_018685chr71924 ------
NM_018898chr5--1488 2921 131 11879
NM_018899chr5--1488 2921 131 11879
NM_018900chr5--1488 2921 131 11879
NM_018901chr5--1488 2921 131 11879
NM_018902chr5--1488 2921 131 11879
NM_018903chr5--1488 2921 131 11879
NM_018904chr5--1488 2921 131 11879
NM_018905chr5--1488 2921 131 11879
NM_018906chr5--1488 2921 131 11879
NM_018907chr5--1488 2921 131 11879
NM_018908chr5--1488 2921 131 11879
NM_018909chr5--1488 2921 131 11879
NM_018910chr5--1488 2921 131 11879
NM_018911chr5--1488 2921 131 11879
NM_018945chr653243 3182 2372 994 286 12338 12950 1475
NM_018947chr774952 4522 3883 1660 1653 1638 1442 11396 14802 13191
NM_018999chr1094633 4215 3625 1356 1271 943 859 830 287 1514 44218 3738 1828 49 177
NM_019027chr492258 2196 2187 2174 1607 690 519 104 71 ------
NM_019044chr2144031 4020 3445 3299 2897 1077 1043 999 908 860 644 389 97 85 42921 1887 1523 809 14541 23316 515
NM_019072chr541315 473 416 397 --13113 2661 600
NM_019106chr2262829 2215 977 966 541 175 --42154 982 188 180 42614 1086 591 555
NM_019555chr341631 554 478 465 2109 26 1525 11362
NM_019590chr1031293 276 255 1562 --11410
NM_020141chr171848 1802 1780 1587 921 553 404 --21644 197 1684
NM_020144chr731550 299 40 ----2744 625
NM_020150chr1052013 1992 1754 237 91 11634 32231 350 328 --
NM_020177chr52861 360 1647 --12513
NM_020180chr18--31061 860 205 ----
NM_020182chr2083342 3275 3156 2855 2550 918 753 82 21175 251 53091 2942 1209 542 183 --
NM_020189chr8--143 ----
NM_020205chr143455 3105 617 540 ----2990 311
NM_020245chr684205 4182 4010 1876 869 849 772 25 1241 136 14983
NM_020337chr4103201 3005 2647 2599 2219 2037 2023 1268 1250 866 --13176 --
NM_020403chr13--1313 1320 --
NM_020432chr722310 67 ----11585
NM_020440chr1143375 3261 3110 2661 2558 2365 2138 1229 831 809 797 499 410 351 21102 673 1444 --
NM_020443chr1166830 6246 5754 5561 5182 5083 5026 4610 2364 1876 1748 1177 753 623 391 185 26791 1131 66833 6314 4405 2780 649 428 --
NM_020449chrX1239 ------
NM_020466chr661585 1579 1366 1328 943 506 33380 3297 1168 14534 1123
NM_020647chr862128 1900 1803 1442 934 149 1255 --21739 1728
NM_020665chrX1139 ------
NM_020696chr3--136 1103 --
NM_020699chr1185437 5375 4880 4571 4537 4293 4231 4188 4137 1974 1779 1662 1650 1509 1114 775 712 619 22163 115 --23381 1710
NM_020717chrX165006 4969 4609 4181 3715 3438 1962 1910 1494 1269 1210 1054 956 579 292 185 44892 4014 962 511 23044 443 14080
NM_020718chr16166261 5968 5478 4826 4630 2596 2578 2469 1809 1400 1042 982 771 628 387 381 26367 2639 1795 14242
NM_020727chr2173215 2699 2628 1595 1319 680 430 --12573 11433
NM_020734chr1273230 2695 2220 2140 202 136 102 13070 --13110
NM_020766chrX94112 4019 3883 1819 1664 1588 963 918 25 13932 21669 861 --
NM_020772chr1798511 7378 7334 7201 7089 6327 5998 1114 390 37499 2043 190 12499 11548
NM_020774chr1885830 4917 4681 4670 4521 1194 539 261 31585 1512 583 15696 --
NM_020778chr15134738 4693 4349 4339 4203 3914 3777 1880 1579 1455 918 881 99 --11568 21585 51
NM_020783chr18--11715 --22352 153
NM_020805chr1871855 1632 616 539 327 298 150 --11874 144
NM_020841chr1264011 3378 1373 587 545 34 33086 1330 1263 ----
NM_020853chr1252385 2223 2117 581 317 21841 146 22415 2235 12767
NM_020917chr1972896 2493 1398 1123 1020 508 112 12544 13283 11255
NM_020937chr14------1270
NM_020948chr1----11238 --
NM_021005chr154757 125 86 37 11160 --1361
NM_021061chr8164384 3938 3856 3645 3396 3237 3205 3110 3076 3045 2865 2836 981 898 429 139 --23480 98 --
NM_021079chr1783122 2967 2748 2519 2468 2031 775 581 --12653 23366 2388
NM_021097chr282783 2614 2447 2244 2185 530 405 237 --22482 2233 12364
NM_021120chrX113159 2863 2746 2665 2281 2135 1165 885 793 761 346 32824 1172 838 23085 2490 22438 481
NM_021137chr1742315 2093 821 353 12374 2390 322 32115 1945 696
NM_021255chr1463891 3816 3082 3033 1289 127 --23090 964 11161
NM_021647chr494524 3785 3537 1296 1195 1075 862 229 186 11693 21858 1162 24414 3524
NM_021705chr661331 1114 1069 978 964 493 21152 378 11252 1992
NM_021813chr6135182 4452 4208 4063 3954 3755 1898 1794 1740 1169 1124 678 222 11601 25273 1268 21744 1481
NM_021911chr574784 4230 3821 2217 1329 1131 870 123 21766 319 1798
NM_021912chr1563919 3312 3150 2781 1622 447 33607 2991 2744 1304 23279 899
NM_021945chr663135 2261 2177 935 666 93 21186 595 11288 23316 1209
NM_021954chr1353268 3248 1321 1029 96 13397 12651 23564 673
NM_021960chr1142718 2563 2544 2448 2017 1931 1863 1767 737 624 479 325 296 250 --31986 714 524 --
NM_021961chr11137507 6485 5724 5706 5469 5462 5063 5001 4616 2218 2131 724 284 26139 4585 25747 1900 --
NM_021963chrX1723 ------
NM_022048chr15166142 6013 5299 4732 2387 1828 1808 1593 1506 1140 906 873 731 449 417 145 --35268 2338 1854 --
NM_022058chr231568 67 36 2554 367 153 --
NM_022137chr1482057 1824 1670 1338 690 324 222 213 --21837 1774 11932
NM_022166chr16175544 5332 5232 5148 4529 4327 3979 2168 2066 2037 1567 1422 1312 740 674 628 139 147 44985 4915 2271 1813 --
NM_022334chr213823 814 771 762 715 706 435 426 379 370 323 314 38 ------
NM_022374chr2--1185 ----
NM_022456chr12107581 7145 5884 5495 2902 2142 1976 1699 526 392 11996 1930 21646 605
NM_022459chr1395230 4946 4481 2070 1746 1349 647 118 61 11718 16094 --
NM_022469chr182701 2558 2083 1303 1256 1244 935 295 23338 2286 23233 1150 13355
NM_022473chr1574214 3911 3373 3164 1582 1115 100 1494 33503 710 108 1643
NM_022648chr2123609 3363 3315 3219 2959 2923 1581 1012 940 334 175 89 34310 3471 519 21448 125 --
NM_022659chr81387 ----163
NM_022719chr2283035 2628 2440 2374 1171 896 863 137 13689 43083 1563 1239 375 11002
NM_022748chr782409 1068 764 731 506 286 193 127 11783 32502 2252 2126 12374
NM_022771chr12164 --1118 --
NM_022781chr953242 3200 3076 1227 869 12868 13012 1976
NM_022826chr2--1267 ----
NM_022828chr531769 355 157 11403 11432 1163
NM_022836chr161576 1233 1206 1196 359 77 --1589 11217
NM_022843chr1321253 1026 --11186 1580
NM_022893chr292909 2797 2703 2456 2145 1226 974 645 460 --12830 --
NM_022898chr1474309 4183 4124 3361 3145 1268 1000 34167 3787 397 33914 3735 3148 13228
NM_023011chr131112 --1302 1165
NM_023923chr153688 2539 2298 1052 497 22553 531 1596 11021
NM_024034chr2051006 932 778 229 213 1690 1222 --
NM_024336chr16------2337 141
NM_024408chr192799 2786 2425 2412 1438 1396 838 722 121 33215 2287 562 --13335
NM_024509chr19----1152 --
NM_024528chrX----148 --
NM_024556chr11------1105
NM_024567chr8----1285 --
NM_024607chr864528 3416 1623 889 273 78 13461 13215 23000 707
NM_024613chr81361 21572 1315 --1155
NM_024639chr6122771 2675 2529 2516 2113 1818 1093 1065 1042 855 608 562 --3308 157 118 --
NM_024646chr193957 2438 1589 1408 557 544 508 483 198 --11045 11533
NM_024665chr3114521 3982 3976 3969 3410 3327 3220 2967 2922 865 281 11290 ----
NM_024721chr812496 11047 --2511 294
NM_024740chr1184177 3943 3598 3433 2749 1390 334 234 22612 1492 --24066 2864
NM_024761chr9105108 4241 4164 3793 3485 1879 1549 828 230 27 24714 3517 25015 276 13635
NM_024770chr2116253 6106 5533 5384 5368 5051 4930 1267 1094 447 421 --24428 4230 25102 427
NM_024817chr15115476 5034 4970 4245 4194 3958 3634 2114 1928 272 190 45223 4525 4385 1701 35791 2201 994 14227
NM_024884chr1464371 3434 3185 1301 373 266 24396 1731 --14535
NM_024947chr3139051 8437 7687 6222 6170 5872 2782 2374 2152 2006 1474 1465 896 --12937 39312 7777 1101
NM_024949chr4124506 4283 3688 3340 3156 3072 1539 1191 962 899 727 221 11519 33971 3274 902 14753
NM_024989chr287053 5200 4974 2816 2022 1806 1521 1192 17520 26287 503 17811
NM_025054chr834122 1514 289 11461 12799 11351
NM_025164chr11102025 1859 1650 1590 1543 1504 804 632 555 224 51993 1597 502 399 256 11876 --
NM_025179chr1174640 4504 4313 4023 3862 3662 3602 3139 3125 3046 1823 1801 1566 1289 1074 597 250 23181 1710 13510 23608 520
NM_025222chr3122875 2638 2613 2118 2088 1993 1912 699 572 556 389 50 --1590 --
NM_030579chr1693411 2807 2673 2532 2436 2271 1172 823 387 22594 1398 125 1926
NM_030647chr7126068 5952 5599 4473 4274 4024 4007 3950 3884 1925 245 204 26285 3831 --34984 4631 913
NM_030648chr4155510 5118 4766 4659 3666 3478 2019 1911 1836 1816 1786 1561 1480 1473 837 25561 1407 24297 1526 --
NM_030650chr243587 3405 507 341 --13391 23770 3573
NM_030670chr12121930 1626 1469 926 906 886 860 852 834 809 743 527 22323 753 11421 --
NM_030671chr12121930 1626 1469 926 906 886 860 852 834 809 743 527 22323 753 11421 --
NM_030674chr12115536 5499 5450 5173 4913 4857 4148 3957 1433 1259 529 --24790 3995 --
NM_030751chr1021475 582 --1329 2657 305
NM_030751chr1021475 582 --1329 2657 305
NM_030790chr16--1131 ----
NM_030806chr1219087 9032 8376 8033 7790 7648 7511 6921 6683 6068 6033 6019 3674 3069 2739 2668 2322 1519 1161 962 921 47910 7370 6117 2727 59366 8985 6175 5851 2655 13289
NM_030817chr12113592 3284 2979 1368 1244 985 762 656 525 424 358 22872 109 --11258
NM_031411chr5--1488 2921 131 11879
NM_031427chr14135732 5343 5110 5095 4772 4674 4635 4575 4516 4447 3997 2116 1888 ----1456
NM_031442chrX82754 1957 1219 1124 1035 818 719 607 --21172 202 --
NM_031468chr7247633 7477 7457 7309 7300 7154 7147 7023 6458 6139 6086 5915 5446 3188 2931 2812 2607 2593 2475 2404 1674 1128 549 359 36450 3148 2533 88034 7696 7011 6954 6496 6211 5380 727 37315 3169 353
NM_031469chr683510 3497 1654 1587 1156 926 440 314 53438 3116 2636 1593 811 --13413
NM_031845chr2153604 3398 3019 2858 2535 2505 1409 1385 1261 627 509 449 334 313 203 1903 13010 --
NM_031847chr2153604 3398 3019 2858 2535 2505 1409 1385 1261 627 509 449 334 313 203 1903 13010 --
NM_031849chr5--1488 2921 131 11879
NM_031857chr5--1488 2921 131 11879
NM_031860chr5--1488 2921 131 11879
NM_032012chr983947 3252 1692 1462 446 159 112 33 34902 3466 1769 --14482
NM_032105chr1208055 7594 7428 7413 7191 6868 6345 5954 5934 5143 3180 2840 2758 1877 1629 1377 1261 1244 1226 159 23059 1234 35901 2982 2854 36087 5895 5405
NM_032119chr5--1291 ----
NM_032153chr3112668 2638 2097 2042 2022 1739 821 558 508 496 373 ------
NM_032154chr10--1761 ----
NM_032217chr4------21422 424
NM_032228chr1142893 1200 957 256 23155 2543 2715 634 12793
NM_032242chr363117 3038 1181 658 491 311 21337 1326 22998 1202 1802
NM_032321chr283033 2553 2489 2482 2317 2274 1292 1083 12636 1792 12505
NM_032438chr61170 --11040 11382
NM_032446chr5113535 3502 3255 3097 2593 1449 1438 1028 668 428 142 1276 1135 12552
NM_032457chr462914 1440 1160 1017 550 515 11493 13349 13620
NM_032491chr121901 ------
NM_032505chr351926 1876 1010 568 98 12527 190 --
NM_032581chr741556 1391 1349 126 168 1498 21485 1357
NM_032582chr1741876 1503 1202 716 ----1477
NM_032632chr142740 515 ----1395
NM_032711chr1763366 1108 731 512 325 310 --23885 1071 1876
NM_032765chr51733 1252 1162 1308
NM_032833chr182556 2262 2254 2243 2190 894 691 280 21978 835 ----
NM_032869chr861812 1467 1407 1376 1310 584 11634 11399 1768
NM_032870chr6167 ------
NM_032873chr11134476 3954 3730 3499 3475 2783 1549 1197 732 503 361 168 22 12792 ----
NM_032884chr1----1335 --
NM_032932chr17155973 5113 4898 4859 4748 4649 2013 1857 1788 1419 1371 1123 793 523 314 24108 2026 35879 5002 1950 11751
NM_033020chr174815 4413 3852 3745 1634 855 192 14233 14173 --
NM_033133chr1772957 2896 2517 1462 824 469 32 --33640 912 653 21434 770
NM_033181chr673571 2850 1460 1400 1369 816 758 --1209 1822
NM_033207chr1082628 2018 1831 1816 1636 552 290 78 31709 1684 519 --1449
NM_033222chr9174 ------
NM_033224chr776151 5956 2948 2609 1325 965 514 11387 25283 2960 26201 6157
NM_033274chr5103336 2736 2602 2483 2458 2452 2331 1331 492 181 --33314 1336 403 11210
NM_033290chrX53292 2793 2600 2368 663 1571 12884 173
NM_033387chr982403 2225 903 662 548 530 382 148 22286 1095 12169 1554
NM_033389chr17103064 1568 1548 1521 1456 1298 1255 884 724 180 1708 14116 23566 363
NM_033426chr1442501 2268 598 455 21094 1032 22039 132 12904
NM_033429chr15102999 2746 2562 2372 2199 1043 845 785 391 133 22478 700 32751 2289 525 --
NM_033430chr473694 2726 1379 1327 920 667 556 13784 --33708 2951 2661
NM_033437chr473694 2726 1379 1327 920 667 556 13784 --33708 2951 2661
NM_033505chr2156634 6529 6325 6312 6252 5914 5585 5052 4971 4423 2279 2266 2175 992 438 14670 34581 4116 556 15511
NM_033551chr5123259 3021 2818 2284 1351 1078 704 683 591 255 81 35 --52987 2357 2266 474 432 22972 851
NM_033631chr183504 3417 3127 2989 1277 1097 888 544 2909 631 33071 2788 1167 13618
NM_033637chr10113997 3572 3492 2905 2603 1434 1415 1263 1129 1031 727 11618 23497 715 --
NM_052851chr1341914 1679 90 64 --281 40 11684
NM_052875chr1171978 1442 1397 1330 877 501 241 31577 309 184 12163 1316
NM_052885chr1264092 3507 1721 1022 736 149 14165 23837 3451 1768
NM_052896chr192389 1760 1580 775 765 247 226 72 36 22570 756 21931 252 --
NM_052907chr1284134 3616 3498 3381 3321 1574 1026 155 14008 --23300 3094
NM_052910chr135379 247 220 211 36 1462 2664 264 --
NM_052917chr273105 2442 2085 1201 608 92 27 13122 22938 2900 12237
NM_052918chr1073623 2953 2658 2473 803 138 43 13265 13353 33129 2942 1387
NM_052954chr2172197 1887 1550 714 603 550 81 --1317 1389
NM_053016chr9117415 5922 5847 5350 4960 4834 2200 2185 1730 1178 1094 21591 98 ----
NM_053043chr7146133 5817 5109 4850 4332 4298 2468 2452 1950 1912 1386 934 546 346 --24210 1611 15037
NM_053053chr11955 ------
NM_053281chrX----1341 --
NM_078470chr10102259 2188 2042 1765 1756 1660 943 790 246 45 ----21789 1664
NM_078629chrX1189 ----1560
NM_078630chrX1189 ----1560
NM_080491chr1193708 3687 3462 2949 2601 1161 905 706 614 22774 889 11251 11348
NM_080546chr932263 2211 877 --1797 31930 1445 673
NM_080597chr181177 1830 ----
NM_080669chr17194650 4142 4066 3774 3758 3319 3249 3202 3044 1836 1699 1616 1325 1140 960 518 323 145 75 13644 23452 1357 14293
NM_080748chr20----165 --
NM_080764chr2242989 2342 634 258 1907 21021 885 12132
NM_080867chr1464829 4330 4150 3167 3154 805 --43531 3182 1165 1075 14161
NM_130385chr1173116 2642 2488 2216 563 413 121 52829 2630 2502 2025 213 --12143
NM_130391chr943137 2563 1285 465 --33299 2267 490 1797
NM_130392chr943137 2563 1285 465 --33299 2267 490 1797
NM_130393chr943137 2563 1285 465 --33299 2267 490 1797
NM_133170chr20207935 6932 6911 6532 6520 5859 4969 3198 2960 2920 2663 2634 2286 2031 1899 1853 1689 1639 951 555 17292 45336 2002 1839 1388 26971 5449
NM_133264chr17133931 3802 3558 2977 1201 1027 898 666 522 475 385 300 91 23104 1514 23009 1388 11260
NM_133265chrX113310 3028 2734 2535 2410 2226 1299 976 548 409 402 11215 --1466
NM_133334chr485836 5727 5517 5113 5088 2321 821 510 26104 4676 --25738 1572
NM_133338chr5--1470 ----
NM_133339chr5--1470 ----
NM_133340chr5--1470 ----
NM_133341chr5--1470 ----
NM_133342chr5--1470 ----
NM_133343chr5--1470 ----
NM_133344chr5--1470 ----
NM_133367chr683333 3171 3164 2124 1339 1168 225 142 23121 367 2710 32 1663
NM_133378chr2----1304 --
NM_133432chr2----1304 --
NM_133437chr2----1304 --
NM_133468chr792326 2313 2191 2065 1658 501 482 443 351 12503 --1797
NM_133477chr483075 2994 2746 2373 2239 986 906 389 ----23111 2794
NM_133494chr1--143 ----
NM_133631chr3----1399 --
NM_133646chr2114515 2046 1977 1901 1703 1482 1414 978 922 743 695 24847 4467 21654 97 --
NM_134265chr171418 ----2943 855
NM_138444chr1374287 1639 1072 1028 1019 935 822 24192 1569 2721 545 --
NM_138459chr662749 2523 1142 886 242 44 11455 1891 11216
NM_138468chr296230 6006 5907 5876 4318 1886 1167 523 68 24361 4190 34209 2451 1034 --
NM_138473chr12144243 4183 4173 4093 3875 3867 3842 3489 2069 1674 1402 482 148 89 11409 33812 1657 92 34345 3245 1814
NM_138576chr1474309 4183 4124 3361 3145 1268 1000 34167 3787 397 33914 3735 3148 13228
NM_138578chr2091457 1357 1300 1011 976 970 961 387 363 ------
NM_138694chr673061 2852 1252 1147 714 384 107 23162 2872 21100 818 12590
NM_138957chr22----1166 --
NM_138959chr1196303 6242 5883 5493 4646 4601 4501 4372 4242 2128 2073 1725 1249 1188 1140 843 542 475 51 15596 36347 5734 2404 1168
NM_138971chr11143655 3587 3145 2952 2929 2885 2821 2344 1358 642 596 587 210 149 22436 965 12743 --
NM_138971chr11143655 3587 3145 2952 2929 2885 2821 2344 1358 642 596 587 210 149 22436 965 12743 --
NM_138972chr11143655 3587 3145 2952 2929 2885 2821 2344 1358 642 596 587 210 149 22436 965 12743 --
NM_138972chr11143655 3587 3145 2952 2929 2885 2821 2344 1358 642 596 587 210 149 22436 965 12743 --
NM_138973chr11143655 3587 3145 2952 2929 2885 2821 2344 1358 642 596 587 210 149 22436 965 12743 --
NM_138973chr11143655 3587 3145 2952 2929 2885 2821 2344 1358 642 596 587 210 149 22436 965 12743 --
NM_139012chr662199 2105 1906 1847 1558 48 --2628 451 11711
NM_139014chr662279 2185 1986 1927 1638 128 --2708 531 11791
NM_139057chr1552216 760 696 418 297 32929 714 271 11964 1213
NM_139321chr2093231 3199 1298 1250 1104 1010 935 825 587 33237 1152 988 11049 33166 2777 1177
NM_139323chr20----1418 --
NM_144498chr20132307 2136 2124 1929 1881 1633 1626 1604 717 454 425 397 341 11574 ----
NM_144571chr4136857 6167 6000 5901 5157 4767 4755 4725 4419 2811 2458 1794 1059 12067 16608 --
NM_144578chr1455016 2051 956 792 243 15508 24003 3905 21725 1635
NM_144599chr15115303 4923 4858 4792 4066 3800 3699 1951 1036 583 267 24674 2021 14912 14785
NM_144628chr2082764 2722 2049 833 554 428 364 275 1470 1633 22201 2103
NM_144767chr15103987 3565 3132 3091 2830 1750 1394 1156 1142 904 31461 1250 268 2677 470 14191
NM_144949chr212230 ----22314 2254
NM_145207chr4105176 4868 4833 4805 4578 3584 1902 1647 635 454 24199 3479 11559 14137
NM_145259chr2137141 7072 6638 6078 5228 4589 4375 2613 2397 1092 1086 1068 256 21821 222 --22135 841
NM_145307chr1034394 3665 3116 --11653 22876 1569
NM_145686chr252853 2305 2135 2097 924 1295 --22388 455
NM_145687chr252853 2305 2135 2097 924 1295 --22388 455
NM_147147chr684105 3500 3127 2767 1074 898 139 131 11371 13568 --
NM_147150chr9123191 3162 3020 2835 1112 1088 1080 1055 1020 677 213 170 172 121 1379
NM_147175chrX41763 1544 242 74 11937 ----
NM_152253chr22114207 4003 2852 2806 1651 1444 1255 938 883 683 470 --33542 1554 562 1951
NM_152388chr293799 3462 3402 1589 1354 908 854 386 246 11247 11419 --
NM_152414chr891664 1372 1359 1065 590 572 487 299 46 --1583 --
NM_152422chr941602 1279 1171 599 11370 2488 445 1661
NM_152423chrX2190 110 21014 454 --1424
NM_152455chr15112683 2485 2387 2170 2099 1983 1940 1922 1123 193 25 12477 32629 1829 54 --
NM_152520chr25313 303 146 47 38 --152 --
NM_152556chr742094 1780 867 255 21931 1594 3496 374 179 --
NM_152588chr1251707 1689 368 325 192 11655 11734 11407
NM_152594chr152223 70 1480 --21691 129
NM_152624chr5167311 6883 6473 5797 5406 4719 4559 2903 2519 2340 1675 1525 1437 999 151 144 25765 4949 ----
NM_152678chr362522 2054 1962 445 420 136 12711 --1712
NM_152744chr7113569 3561 2954 2746 2641 975 744 727 342 243 167 --22957 847 1208
NM_152765chr872206 1994 1955 697 313 227 160 1178 --1749
NM_152787chrX93943 3433 3024 2940 1188 1158 239 218 30 ----12800
NM_152789chr7----136 --
NM_152924chr15136651 5718 5380 5366 5125 5022 4810 4467 4347 2234 1296 899 44 24601 2569 ----
NM_153035chr1133170 2747 2658 2575 1080 1054 1024 1011 960 894 499 153 36 42811 2772 2530 2136 22909 243 --
NM_153188chr575570 4024 2103 1740 1558 1173 382 2923 902 ----
NM_153343chr482224 2166 2000 1859 1707 935 563 202 21895 498 --12006
NM_153350chr1671610 1366 1348 1340 1314 601 147 --21457 1333 --
NM_153354chr511002 ----189
NM_153367chr1093212 2978 2767 1344 1137 844 819 450 323 23192 210 13888 1984
NM_153442chr10216437 6409 6365 6315 6054 6038 5962 5701 5636 5531 4618 4374 4049 2514 1756 1508 1482 1292 878 826 52 35385 1408 342 65373 4508 4035 1889 1065 323 11038
NM_153456chr13156100 5802 5165 4975 4832 4788 4663 4583 2274 1369 1142 989 850 441 264 21722 1468 55196 4253 3867 1379 254 12486
NM_153605chr361149 231 80 45 34 22 --185 11121
NM_153607chr522777 1091 13140 --22251 364
NM_153810chr1074792 4234 3447 3286 1218 939 917 --2522 276 33116 1942 965
NM_170672chr261824 1168 725 309 101 89 125 3705 551 73 11668
NM_170706chr1154191 3770 3577 3457 3299 3274 3185 3053 2721 2658 1729 1596 1454 376 298 22700 1751 33613 2852 658 11257
NM_172069chr242129 1750 465 350 --11990 2619 573
NM_172071chr157408 7156 2856 2848 2092 --25154 771 11368
NM_172128chr41498 1555 ----
NM_172387chr1881548 1533 1474 1459 496 233 183 168 1174 11053 --
NM_172388chr1881595 1580 1521 1506 543 280 230 215 1221 11100 --
NM_172389chr1881595 1580 1521 1506 543 280 230 215 1221 11100 --
NM_173078chrX149 ------
NM_173156chr161666 547 334 326 232 29 1341 1654 1852
NM_173198chr972804 2663 2451 2417 2310 1181 835 11101 12848 1128
NM_173200chr972804 2663 2451 2417 2310 1181 835 11101 12848 1128
NM_173468chr485817 4889 2354 2023 1759 1559 882 180 15442 32305 966 290 --
NM_173510chr2272160 2081 2056 798 467 370 89 11811 22682 616 1477
NM_173511chr273806 3414 3375 3085 2978 233 143 --23458 873 --
NM_173531chr1963619 2885 748 462 171 151 21087 378 13293 --
NM_173632chr19102733 2718 2152 603 575 402 318 234 218 150 32414 506 68 2941 648 --
NM_173642chr1188555 8539 7959 7952 7720 7408 7317 7138 7089 6602 6578 6254 3567 3506 3493 3032 2231 2132 36269 5779 373 46410 2339 879 583 --
NM_173694chrX82173 1909 1819 1700 1022 922 644 259 1267 11807 177
NM_173808chr1143755 2934 2909 2902 2893 2881 2861 2836 2768 1563 1546 1016 232 42 21155 688 --13232
NM_173829chr595268 4542 3884 2368 1619 1583 1470 1152 848 --26024 3976 --
NM_173832chr872591 2480 2435 1047 702 458 197 101353 1328 1303 1278 1253 1228 1203 1178 1153 1128 ----
NM_174911chr8103834 3607 3441 3010 2818 2589 461 414 352 176 33405 3090 987 --12593
NM_174938chr9----1389 --
NM_175623chr12107581 7145 5884 5495 2902 2142 1976 1699 526 392 11996 1930 21646 605
NM_175733chr1172103 2033 1908 1454 1398 788 646 1224 31976 1543 1478 21842 1568
NM_175736chr12237575 7383 7044 6772 6494 5756 5750 5064 4916 2940 2904 2669 2498 2441 2288 2237 2166 2118 1769 1545 1220 1021 648 25695 1062 --37364 6223 341
NM_175748chr142538 401 --11786 2655 297
NM_175907chr1882615 1829 953 845 781 731 365 33 --12325 1719
NM_176081chr1064870 2087 1718 1397 1002 53 26028 1238 21534 789 15859
NM_176083chr1064870 2087 1718 1397 1002 53 26028 1238 21534 789 15859
NM_177452chr1462225 2063 2054 1967 1658 671 ----12262
NM_177538chr275556 3104 2317 1891 1822 1379 1244 13204 --13306
NM_177972chr11144274 4268 4139 3904 3308 3218 2983 2916 1540 1413 1004 460 327 196 11718 2543 525 33927 3178 355
NM_177995chr941602 1279 1171 599 11370 2488 445 1661
NM_178006chr1341914 1679 90 64 --281 40 11684
NM_178007chr1341914 1679 90 64 --281 40 11684
NM_178013chr1473101 3056 2945 2726 2713 1028 382 166 21955 433 13107
NM_178424chr5199 1443 ----
NM_180989chr1322357 754 21933 113 32067 1566 219 --
NM_181354chr831428 476 67 --11309 11452
NM_181443chr2032403 2308 2208 --1795 22048 485
NM_181481chr18166988 5687 5280 5225 4323 2828 2653 2531 2249 2195 2073 1702 1275 395 44 32 24467 1455 14639 24676 400
NM_181482chr18166988 5687 5280 5225 4323 2828 2653 2531 2249 2195 2073 1702 1275 395 44 32 24467 1455 14639 24676 400
NM_181483chr18166988 5687 5280 5225 4323 2828 2653 2531 2249 2195 2073 1702 1275 395 44 32 24467 1455 14639 24676 400
NM_181504chr593680 3548 1499 790 534 426 399 388 372 159 2620 610 --
NM_181521chr16167000 6784 6432 5223 5201 5093 4533 2597 2403 2174 1740 1377 1235 578 531 134 25428 2875 46221 2793 2535 1496 24434 1051
NM_181523chr593680 3548 1499 790 534 426 399 388 372 159 2620 610 --
NM_181524chr593680 3548 1499 790 534 426 399 388 372 159 2620 610 --
NM_181571chr104698 411 402 336 126 1416 --
NM_181714chr61404 1565 ----
NM_181839chr841317 926 428 284 ----21066 440
NM_182314chrX31672 1177 514 31797 1168 428 21612 62 1684
NM_182503chr6115561 5368 5117 4638 4358 4304 3623 1066 990 972 64 11258 ----
NM_182537chr3------1296
NM_182718chr104698 411 402 336 126 1416 --
NM_182719chr104698 411 402 336 126 1416 --
NM_182724chr104698 411 402 336 126 1416 --
NM_182725chr104698 411 402 336 126 1416 --
NM_182762chr7145479 4713 4590 4383 2385 1831 1789 1595 1574 1028 800 470 317 150 2480 222 25949 4516 --
NM_182763chr1142707 2552 2533 2437 2006 1920 1852 1756 726 613 468 314 285 239 --31975 703 513 --
NM_182769chr104698 411 402 336 126 1416 --
NM_182770chr104698 411 402 336 126 1416 --
NM_182771chr104698 411 402 336 126 1416 --
NM_182772chr104698 411 402 336 126 1416 --
NM_182850chr104698 411 402 336 126 1416 --
NM_182898chr7116252 6101 6039 5946 5794 5606 4573 2490 1220 1075 968 --25682 4473 14363
NM_182899chr7116252 6101 6039 5946 5794 5606 4573 2490 1220 1075 968 --25682 4473 14363
NM_182915chr281722 1607 1593 1440 1429 1409 884 693 42118 1971 1805 476 11709 --
NM_182931chr7--1643 ----
NM_183004chr1463962 3551 2645 2553 844 657 13763 11129 1498
NM_183060chr104698 411 402 336 126 1416 --
NM_183078chr683595 3432 3250 2963 2946 2827 1496 1278 1300 2484 46 13244
NM_183238chr12123171 3055 2589 1516 1491 1089 628 484 369 324 156 28 2975 859 ----
NM_183376chr1582533 812 688 652 370 310 85 74 21714 125 22036 151 --
NM_183381chr3--2844 245 1933 --
NM_183383chr3--2844 245 1933 --
NM_183384chr3--2844 245 1933 --
NM_194071chr7134993 4627 4300 4031 3990 3879 2130 1816 1782 1432 1065 1059 203 ----22087 168
NM_194285chr1163407 3158 3137 1091 846 117 22474 1012 11237 11289
NM_194317chr242531 2232 2028 2002 21782 1062 22492 2331 21797 1093
NM_194328chr953242 3200 3076 1227 869 12868 13012 1976
NM_194329chr953242 3200 3076 1227 869 12868 13012 1976
NM_194330chr953242 3200 3076 1227 869 12868 13012 1976
NM_194332chr953242 3200 3076 1227 869 12868 13012 1976
NM_194434chr1875486 4234 4223 3646 947 759 739 --35252 4934 3806 --
NM_198158chr342800 1866 1194 421 1807 12304 12321
NM_198159chr342800 1866 1194 421 1807 12304 12321
NM_198177chr342800 1866 1194 421 1807 12304 12321
NM_198178chr342800 1866 1194 421 1807 12304 12321
NM_198273chr562562 2203 536 529 245 98 3757 512 179 ----
NM_198275chr11----184 --
NM_198324chr1231196 1115 21 --243 35 --
NM_198391chr201333 ----11000
NM_198404chr131257 ----1330
NM_198465chrX102962 2653 2449 2370 2175 2119 2069 1973 1160 653 --32277 2124 662 --
NM_198581chr266989 5981 4735 4558 2954 1372 11357 26744 2130 11689
NM_198715chr196183 6099 4699 4267 4096 2384 2358 2076 715 14692 1945 14102
NM_198859chr3115040 4720 4545 4074 4049 3221 1785 1343 1293 1150 1096 34228 1213 897 13822 23725 1177
NM_198889chr4------21422 424
NM_198896chr11------22111 1813
NM_198900chr12237575 7383 7044 6772 6494 5756 5750 5064 4916 2940 2904 2669 2498 2441 2288 2237 2166 2118 1769 1545 1220 1021 648 25695 1062 --37364 6223 341
NM_198920chr6----1217 --
NM_198965chr12--166 ----
NM_198966chr12--166 ----
NM_199000chr771406 831 721 298 204 104 88 --1674 22001 489
NM_199169chr2083342 3275 3156 2855 2550 918 753 82 21175 251 53091 2942 1209 542 183 --
NM_199170chr2083342 3275 3156 2855 2550 918 753 82 21175 251 53091 2942 1209 542 183 --
NM_199171chr2083342 3275 3156 2855 2550 918 753 82 21175 251 53091 2942 1209 542 183 --
NM_199177chr9127 ------
NM_199320chr482045 1953 1854 1137 1087 727 59 23 12858 --1290
NM_199320chr482045 1953 1854 1137 1087 727 59 23 12858 --1290
NM_199421chr1464829 4330 4150 3167 3154 805 --43531 3182 1165 1075 14161
NM_199462chr194424 3813 3706 3611 3234 1736 1635 1610 1169 --24041 3466 13695
NM_199478chrX101895 1879 1720 1562 1461 595 562 394 374 134 ----2601 324
NM_201266chr282962 2865 2573 2313 2300 1086 718 161 1955 12257 11943
NM_201279chr282962 2865 2573 2313 2300 1086 718 161 1955 12257 11943
NM_201348chr164047 3614 3222 973 879 43 --1398 23719 747
NM_201432chr17136617 6568 6226 6167 5893 5001 4586 2267 1310 580 450 339 138 26183 5915 45476 4780 805 122 --
NM_201433chr17136617 6568 6226 6167 5893 5001 4586 2267 1310 580 450 339 138 26183 5915 45476 4780 805 122 --
NM_201435chr12--163 2271 169 2247 70
NM_201436chr7----1651 --
NM_201444chr121207 ------
NM_201445chr121207 ------
NM_201517chr7----1651 --
NM_201554chr121207 ------
NM_201568chr161666 547 334 326 232 29 1341 1654 1852
NM_201569chr161666 547 334 326 232 29 1341 1654 1852
NM_201591chr4192 ------
NM_201592chr4192 ------
NM_203281chrX--173 ----
NM_203327chr2073089 1443 1230 1129 1079 1056 644 ----22930 1538
NM_203350chr121498 372 11354 2669 415 --
NM_203487chr13--1313 1320 --
NM_206909chr8198415 7658 7115 6846 6686 6557 6076 5675 3182 2056 1389 1379 1373 1047 722 713 689 683 21 47852 1107 634 588 46887 6777 1751 1527 13256
NM_207043chr192143 1784 1562 1474 942 901 398 237 139 1666 11773 21798 1594
NM_207044chr192143 1784 1562 1474 942 901 398 237 139 1666 11773 21798 1594
NM_207047chr192143 1784 1562 1474 942 901 398 237 139 1666 11773 21798 1594
NM_207380chr15113290 2965 2830 2810 2762 2681 2636 1460 1329 691 623 12902 22625 1081 23661 2574
NM_207406chr455835 4242 1801 1320 372 35020 4897 2138 12250 25346 632
NM_207411chr8103482 3239 1285 1109 703 578 524 322 110 61 13041 --23641 656
NM_212471chr173495 205 135 --11662 12179
NM_212472chr173495 205 135 --11662 12179
NM_212558chr973776 3734 3246 2735 567 229 83 33078 321 63 21243 234 12775
NM_213589chr295406 4502 2163 1778 1581 1104 378 304 218 14495 1223 1686
NM_213594chr121901 ------