TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3161
miRNA Sequence: CUGAUAAGAACAGAGGCCCAGAU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000016chr12589 557 1193 2731 132 --
NM_000038chr541358 704 297 179 2785 348 --11612
NM_000043chr103964 115 107 --11078 --
NM_000051chr1153559 2382 1135 1065 688 22634 2468 1774 --
NM_000052chrX93471 2819 2337 2188 2181 1370 572 530 139 --135 --
NM_000084chrX127009 6493 5925 5591 5454 5264 2686 2174 1961 1895 727 559 --12206 --
NM_000088chr171176 ------
NM_000091chr262889 2661 1902 1855 962 876 12651 12023 --
NM_000092chr274323 4314 4257 3713 3705 2818 229 --13464 --
NM_000108chr731892 720 230 ------
NM_000110chr141110 1041 974 433 ------
NM_000112chr5145510 5260 5012 4988 4833 4717 4580 4270 4250 3873 1526 1399 873 756 25424 3590 ----
NM_000138chr1532445 617 548 12046 1227 1683
NM_000151chr1741815 504 327 166 11882 ----
NM_000168chr752875 2031 1103 864 754 11060 --12893
NM_000176chr533653 2466 232 23629 2602 --22420 753
NM_000216chrX83649 3502 3351 2830 2743 794 778 498 21470 1123 13580 --
NM_000217chr1274201 3316 2067 1661 1106 1023 831 21012 224 --15386
NM_000232chr432924 2594 2588 22022 186 ----
NM_000237chr841944 1821 1713 687 11567 ----
NM_000248chr31940 1127 --12829
NM_000253chr421052 820 11006 ----
NM_000259chr1585681 5674 4386 4283 2158 1683 1358 953 56141 5930 2267 1826 1027 --21765 698
NM_000280chr1121002 407 ------
NM_000314chr1063302 3252 2266 2077 1157 991 2884 609 ----
NM_000321chr1331330 1103 524 1390 ----
NM_000330chrX72238 1951 1926 1829 1646 1583 190 --12177 --
NM_000332chr6127097 6817 6107 5374 5293 4565 2746 2460 2377 1848 1578 1145 11861 2130 40 --
NM_000333chr32995 238 ------
NM_000337chr555319 4795 4276 2650 1446 26179 4091 --15949
NM_000346chr1731289 757 524 11313 ----
NM_000361chr2041466 847 733 547 --1473 --
NM_000390chrX33190 3120 2081 12496 --22851 2168
NM_000397chrX51962 1768 914 796 493 12340 22219 561 --
NM_000399chr102793 336 --1916 --
NM_000408chr263114 3073 876 867 537 310 52449 1321 982 470 402 ----
NM_000430chr1773776 3427 2860 2647 1463 557 409 32617 1471 336 --1137
NM_000461chr364226 3793 3408 1801 1480 899 --13943 14286
NM_000480chr1171644 1637 1404 1184 1169 1085 237 ------
NM_000492chr721509 348 ----11533
NM_000495chrX31088 1038 443 ------
NM_000503chr871802 1530 1451 1442 1360 1229 479 21223 1167 ----
NM_000509chr42166 43 ------
NM_000544chr6_cox_hap1113299 3119 2943 2697 2493 2453 2234 2176 691 651 422 ------
NM_000555chrX87294 5569 5236 5085 3147 1531 1333 1285 16441 15635 --
NM_000610chr1163025 2765 2186 636 567 549 12273 ----
NM_000615chr1132544 1162 598 --11926 12251
NM_000618chr12126452 6292 6115 6045 4916 4635 4066 2646 2075 1927 419 391 26423 234 25187 1497 --
NM_000618chr12126452 6292 6115 6045 4916 4635 4066 2646 2075 1927 419 391 26423 234 25187 1497 --
NM_000633chr18105231 4902 4375 3990 3844 3641 3444 1912 1738 70 35020 3915 242 33732 3458 1495 --
NM_000718chr9164 ------
NM_000724chr1011840 --1601 --
NM_000726chr211331 11424 --11361
NM_000780chr861219 1153 1055 916 787 284 ------
NM_000793chr1485085 5067 4781 4460 3389 880 117 25 ------
NM_000800chr521624 1613 ------
NM_000801chr2021097 431 ------
NM_000809chr4208911 8875 8676 8420 8000 7849 7480 7233 6962 6906 6389 6291 6143 5758 5719 3145 1508 1404 780 408 39250 8955 2426 49054 8616 8186 1957 --
NM_000813chr565562 5347 3714 3703 1936 334 --1810 12182
NM_000814chr1583970 3630 3403 3087 2950 1645 974 414 14226 ----
NM_000818chr102514 340 ------
NM_000833chr1641382 1349 1118 23 ------
NM_000838chr662550 2379 2363 871 750 293 22760 1740 ----
NM_000855chr111317 ------
NM_000859chr531377 675 605 1446 ----
NM_000861chr342438 1014 856 481 12600 1639 --
NM_000868chrX52573 2459 745 584 216 32640 2631 2533 --1936
NM_000875chr15116133 5447 5212 4906 4716 2634 2619 2197 778 506 395 ------
NM_000877chr263083 2900 2704 1014 661 116 1145 ----
NM_000891chr17113691 3685 3593 3399 3191 2847 2709 2481 2375 854 308 12780 ----
NM_000899chr1243660 3118 1223 124 ------
NM_000902chr383196 3094 2491 2167 2044 1983 1086 789 23017 764 ----
NM_000926chr11159258 8757 8160 7892 7685 7355 3769 2773 2225 2167 1974 1394 1371 979 272 58953 7481 6983 3409 3230 18879 1898
NM_000933chr2021706 435 ----11567
NM_000935chr361158 1126 1016 981 506 345 1378 ----
NM_000963chr141771 1723 1639 984 42384 787 608 471 11785 --
NM_000983chr1169 11392 ----
NM_001001323chr1263211 3154 2795 595 383 109 --12940 --
NM_001001331chr342704 2174 773 451 12574 12485 --
NM_001001389chr1163025 2765 2186 636 567 549 12273 ----
NM_001001390chr1163025 2765 2186 636 567 549 12273 ----
NM_001001391chr1163025 2765 2186 636 567 549 12273 ----
NM_001001392chr1163071 2811 2232 682 613 595 12319 ----
NM_001001395chr1272195 2152 2142 1802 1766 585 49 22551 199 ----
NM_001001419chr585063 4930 4549 4032 3700 1102 923 110 54276 3428 3401 1636 306 14124 --
NM_001001420chr585063 4930 4549 4032 3700 1102 923 110 54276 3428 3401 1636 306 14124 --
NM_001001481chr883360 3142 2981 2786 2486 1210 1087 204 12467 ----
NM_001001664chr284146 3858 3849 3827 3237 2654 1330 231 --1274 --
NM_001001669chr532496 570 517 12211 ----
NM_001001890chr2133688 2971 485 ----1509
NM_001001974chr1082149 2130 1866 1651 871 755 558 416 ----1347
NM_001002244chr171119 ------
NM_001002245chr171154 ------
NM_001002246chr171154 ------
NM_001002247chr171154 ------
NM_001002248chr171154 ------
NM_001002249chr171154 ------
NM_001002255chr62325 295 ------
NM_001002843chr1531093 1052 373 1154 ----
NM_001003652chr18168448 7707 7653 7633 6679 6234 5999 5491 3246 2778 2179 1873 1462 1012 933 251 38426 8392 285 1699 --
NM_001003674chr18126751 6684 6451 6113 6106 5954 5366 4526 2097 1709 1050 406 ------
NM_001003675chr18126751 6684 6451 6113 6106 5954 5366 4526 2097 1709 1050 406 ------
NM_001003688chr42791 410 ------
NM_001003712chr1293655 3363 2810 2707 1110 904 796 436 156 2194 83 22990 2862 13554
NM_001003760chr642835 1347 813 806 22615 1207 ----
NM_001004317chr684476 4241 3717 3693 3481 2743 1290 960 ------
NM_001004346chr421199 502 ------
NM_001004419chr1294506 4468 4106 3528 2850 1834 1472 555 540 13487 13417 --
NM_001005375chrY81540 705 698 625 537 344 234 217 ------
NM_001005463chr1062636 2562 1734 944 616 572 ------
NM_001005473chr565874 5342 5181 4534 4278 2320 34576 2639 1619 11873 14520
NM_001005746chr211331 11424 --11361
NM_001005747chr211331 11424 --11361
NM_001005753chr252228 1549 591 551 222 ------
NM_001005782chr21784 ------
NM_001005845chr861473 769 725 629 74 56 11592 ----
NM_001005849chr171441 ------
NM_001006600chr542296 1930 629 400 21765 1597 1722 --
NM_001006605chr11892 ------
NM_001006605chr11892 ------
NM_001007023chr1485085 5067 4781 4460 3389 880 117 25 ------
NM_001007067chr831043 851 196 ------
NM_001007068chr831043 851 196 ------
NM_001007069chr831043 851 196 ------
NM_001007070chr831043 851 196 ------
NM_001007075chr441065 980 908 99 146 1403 --
NM_001007097chr964783 1363 1305 1102 113 94 2600 386 13297 --
NM_001007156chr1511666 ------
NM_001007214chr11208 1552 1466 1182
NM_001007245chr72615 83 1175 ----
NM_001007256chr1------1103
NM_001007466chr6115158 5134 5019 4768 4174 3819 3648 3259 2044 1988 281 43355 1399 1349 891 --13671
NM_001007471chr93769 669 639 ------
NM_001007553chr141160 1121 1109 110 ------
NM_001008226chr1571790 1611 1244 613 350 293 278 1358 ----
NM_001008239chr1863390 2400 501 465 248 77 13027 11417 --
NM_001008491chr252021 1685 1417 584 374 12064 ----
NM_001008492chr252021 1685 1417 584 374 12064 ----
NM_001008528chr1721252 594 ------
NM_001008541chr1041543 669 538 507 ------
NM_001008541chr1041543 669 538 507 ------
NM_001008564chr1352246 2211 1949 1930 1853 11839 ----
NM_001008660chr1141558 1433 639 315 21425 561 --11580
NM_001008723chr10------1369
NM_001008925chr473052 2436 1371 1123 1043 841 254 13448 1360 --
NM_001009894chr1221235 23 31431 627 163 --11288
NM_001009958chr71618 ------
NM_001009993chr273979 3823 3529 3314 1822 1777 1227 ------
NM_001010000chr1843532 2644 1261 926 12771 12880 12440
NM_001010853chr653297 3113 2752 2301 2166 22313 2002 ----
NM_001010861chr132586 2364 1985 --1806 --
NM_001010888chrX74347 4117 3153 2959 1779 1413 957 11238 ----
NM_001010891chr554896 1590 1150 805 152 1380 15116 24813 1267
NM_001010895chr961788 1710 1411 1367 1276 493 41677 1501 1343 112 ----
NM_001011513chr483999 3846 3356 3233 3000 485 445 198 2884 405 ----
NM_001011553chr7199 1244 ----
NM_001011666chr766363 5088 4958 4714 2053 139 24071 2086 25598 306 --
NM_001011708chr242929 2505 1170 1164 1808 ----
NM_001011713chr1421244 306 ------
NM_001011720chr841155 1043 571 89 ------
NM_001012393chr1184997 4970 4511 4133 3786 1813 855 501 34018 916 800 --14876
NM_001012420chr1522648 823 12947 ----
NM_001012446chr9177 ------
NM_001012732chr431170 1157 39 21278 1117 1164 11289
NM_001013031chr1063142 2986 2206 971 772 350 23537 3298 ----
NM_001013399chr6--1319 --11114
NM_001013406chr731489 1410 1211 ----11440
NM_001013415chr431036 1026 530 ------
NM_001013437chr182334 30 ------
NM_001013620chr12218439 8298 8029 7420 7345 7198 7184 5750 5339 3300 2858 2584 2200 2174 1845 1787 1673 1544 1456 1270 958 26874 309 --25264 3324
NM_001013659chr1974928 4067 2018 1119 354 290 72 24551 2064 1373 --
NM_001013703chr151478 ------
NM_001014380chr13105590 4942 4777 4715 4612 4244 3969 3918 3654 1175 25802 1705 --14842
NM_001014434chr14314 75 64 49 ------
NM_001014797chr1078181 8029 7415 7052 7028 726 394 31515 576 427 ----
NM_001015045chr422297 819 12490 ----
NM_001015880chr1041727 1713 599 391 ------
NM_001015882chr941088 445 303 246 --1705 --
NM_001017371chr251348 1141 506 433 345 ----1499
NM_001017969chr93551 412 75 ------
NM_001017992chr571456 1447 1296 1070 1045 1011 69 31169 972 328 ----
NM_001017995chr523850 78 14198 --13149
NM_001017999chr192344 2087 1697 907 841 826 696 680 293 --11509 --
NM_001017999chr192344 2087 1697 907 841 826 696 680 293 --11509 --
NM_001018000chr192344 2087 1697 907 841 826 696 680 293 --11509 --
NM_001018000chr192344 2087 1697 907 841 826 696 680 293 --11509 --
NM_001018001chr192344 2087 1697 907 841 826 696 680 293 --11509 --
NM_001018064chr981966 1568 1321 667 629 563 546 491 ------
NM_001018065chr975978 5486 4975 1855 1557 1105 568 24950 1969 ----
NM_001018066chr975978 5486 4975 1855 1557 1105 568 24950 1969 ----
NM_001018067chr175146 4383 3422 2113 1426 810 143 43399 1589 666 492 --11313
NM_001018068chr175146 4383 3422 2113 1426 810 143 43399 1589 666 492 --11313
NM_001018069chr175146 4383 3422 2113 1426 810 143 43399 1589 666 492 --11313
NM_001018074chr533653 2466 232 23629 2602 --22420 753
NM_001018075chr533653 2466 232 23629 2602 --22420 753
NM_001018076chr533653 2466 232 23629 2602 --22420 753
NM_001018077chr533653 2466 232 23629 2602 --22420 753
NM_001024071chr143706 692 157 11008 1809 1219
NM_001024094chr533653 2466 232 23629 2602 --22420 753
NM_001024226chr111037 ------
NM_001024227chr111037 ------
NM_001024228chr111037 ------
NM_001024647chr12167714 7499 6735 6445 5759 4948 4860 4842 4836 4816 2330 1181 689 618 455 177 ------
NM_001024660chr321672 1047 11293 ----
NM_001024668chr122927 353 ------
NM_001024847chr382479 2432 2254 2188 1854 988 684 201 1279 ----
NM_001024947chr51899 21082 316 --11109
NM_001024956chr1185866 4343 3813 2094 1401 1386 957 736 44945 4787 3691 364 ----
NM_001025068chr351808 1771 543 474 380 21792 352 ----
NM_001025069chr351808 1771 543 474 380 21792 352 ----
NM_001025072chr362849 2476 2179 2157 587 425 1953 ----
NM_001025073chr362849 2476 2179 2157 587 425 1953 ----
NM_001025076chr10105832 5348 5298 4912 3877 2502 2070 1166 337 284 24787 4569 15841 --
NM_001025077chr10107190 6706 6656 6270 5235 2524 1695 1642 1047 926 26145 5927 17199 --
NM_001025079chr393868 3771 3576 3147 2786 1615 1064 733 128 24059 3613 ----
NM_001025108chr264115 3610 3317 3217 925 97 1664 ----
NM_001025233chr1231120 790 329 11888 12727 --
NM_001025252chr8103123 3078 3006 2805 2483 1283 730 709 594 293 22750 1265 --167
NM_001025253chr8103123 3078 3006 2805 2483 1283 730 709 594 293 22750 1265 --167
NM_001025356chr1232119 1114 683 42967 1090 889 46 1208 --
NM_001025366chr651758 1732 1443 1369 1235 ------
NM_001025366chr651758 1732 1443 1369 1235 ------
NM_001025367chr651758 1732 1443 1369 1235 ------
NM_001025367chr651758 1732 1443 1369 1235 ------
NM_001025368chr651758 1732 1443 1369 1235 ------
NM_001025368chr651758 1732 1443 1369 1235 ------
NM_001025369chr651774 1748 1459 1385 1251 ------
NM_001025369chr651774 1748 1459 1385 1251 ------
NM_001025370chr651758 1732 1443 1369 1235 ------
NM_001025370chr651758 1732 1443 1369 1235 ------
NM_001025389chr1171644 1637 1404 1184 1169 1085 237 ------
NM_001025390chr1171644 1637 1404 1184 1169 1085 237 ------
NM_001025580chrX64296 3354 1205 722 703 202 --22874 680 --
NM_001025616chr43539 398 388 1488 11767 --
NM_001029858chr642536 326 305 290 ------
NM_001029860chr8143 ------
NM_001029875chr561886 1009 953 805 396 129 12101 1121 --
NM_001029998chr421436 399 1992 --1466
NM_001030007chr1632932 1042 28 21405 879 ----
NM_001030055chr1494753 4054 3602 3401 1771 1587 695 259 149 23284 3022 --13304
NM_001031628chr12127 --162 --
NM_001031695chr2275331 4843 4384 4120 3797 1968 314 35276 1491 868 ----
NM_001031700chr472469 2322 2020 2010 1001 310 281 1878 --12164
NM_001031710chr721093 697 ------
NM_001031722chr61174 --1120 --
NM_001031804chr1644364 3450 3400 893 22955 1444 --11231
NM_001031812chr552258 2095 1659 1466 727 1217 21954 1584 --
NM_001032280chr61530 11712 ----
NM_001032380chr1041926 1582 471 148 --11644 21728 750
NM_001032394chr672320 1970 1773 802 698 323 98 --12535 --
NM_001032999chr2065298 5249 3796 1846 1137 917 --14251 --
NM_001033002chr17194 ------
NM_001033025chr131238 188 95 ------
NM_001033047chr432591 575 84 ----12281
NM_001033756chr651692 1666 1377 1303 1169 ------
NM_001033756chr651692 1666 1377 1303 1169 ------
NM_001033925chr1042104 1896 1543 329 1679 ----
NM_001034850chr571700 1377 1317 1027 631 430 248 1496 ----
NM_001034954chr1053019 2655 2243 1240 831 12563 ----
NM_001034955chr1053019 2655 2243 1240 831 12563 ----
NM_001034956chr1053019 2655 2243 1240 831 12563 ----
NM_001034957chr1053019 2655 2243 1240 831 12563 ----
NM_001035512chr171626 756 635 100 73 65 40 ------
NM_001035513chr171626 756 635 100 73 65 40 ------
NM_001037164chr741349 1302 1291 776 1612 ----
NM_001037277chr12333 36 ------
NM_001037278chr12333 36 ------
NM_001037317chr132586 2364 1985 --1806 --
NM_001037334chr1851724 1559 716 615 434 1854 22066 243 --
NM_001037553chr2134533 3809 2068 25167 4695 --1108
NM_001037954chr11103383 2790 2496 2453 2143 2132 1225 966 674 228 23454 1131 ----
NM_001038702chr552501 1768 597 168 37 --22007 1838 1821
NM_001039350chr711516 ------
NM_001039395chr942319 2235 918 291 11990 --1213
NM_001039523chr21346 --1123 199
NM_001039538chr263426 2352 1194 1150 411 273 43161 2492 1325 527 13710 --
NM_001039547chr3197050 6977 6903 6826 6443 6425 6413 6299 5849 3138 2910 2638 1946 1636 1334 830 812 736 172 47043 1551 1508 878 17813 17197
NM_001039569chr262744 2142 1033 947 772 667 2726 185 22400 916 --
NM_001039618chr1175003 4181 4080 3987 1104 514 23 ----14289
NM_001039709chr2065298 5249 3796 1846 1137 917 --14251 --
NM_001039840chrX146055 5801 5562 4221 3848 2267 2201 2009 1454 947 801 626 513 101 44830 3940 3778 1892 26040 2217 15138
NM_001039937chr1374167 3772 3116 1383 864 326 26 --1263 --
NM_001040100chr34972 486 369 57 1951 ----
NM_001040108chr14102589 2326 2285 2251 2127 2076 2029 906 796 272 ------
NM_001040147chr181714 ------
NM_001040152chr754821 4365 4130 3764 1674 23474 3459 --34940 3323 1657
NM_001040202chr482530 2516 2326 2082 1815 1726 1685 1002 1389 ----
NM_001040272chr952394 1903 1823 1777 934 11857 --11791
NM_001040284chr16175975 5931 5678 5223 5196 5107 4776 4618 4503 4430 1951 1431 1332 1307 1103 635 234 14240 11293 23986 1274
NM_001040441chr154872 3707 2066 604 97 ------
NM_001040446chr552448 2268 1046 376 226 ------
NM_001040450chr1532241 1785 749 ----1945
NM_001040453chr1532241 1785 749 ----1945
NM_001040458chr551616 1316 1288 328 266 11557 ----
NM_001040653chr372595 2532 2331 2310 2180 844 694 12009 1328 --
NM_001040665chr774673 3253 1910 1268 1005 437 96 14783 21859 1282 11685
NM_001040708chr81161 ------
NM_001040712chr962756 2376 2338 972 831 313 21257 1115 ----
NM_001042355chr1695241 4640 3910 3383 1912 1346 869 471 59 31006 446 248 24240 1862 11684
NM_001042357chr1061290 1095 1081 390 193 121 11561 ----
NM_001042358chr1061290 1095 1081 390 193 121 11561 ----
NM_001042360chr1061290 1095 1081 390 193 121 11561 ----
NM_001042363chr1061290 1095 1081 390 193 121 11561 ----
NM_001042383chr343414 3080 2841 258 ----1557
NM_001042389chr1061290 1095 1081 390 193 121 11561 ----
NM_001042390chr1061290 1095 1081 390 193 121 11561 ----
NM_001042392chr1061290 1095 1081 390 193 121 11561 ----
NM_001042395chr1061290 1095 1081 390 193 121 11561 ----
NM_001042412chr1695241 4640 3910 3383 1912 1346 869 471 59 31006 446 248 24240 1862 11684
NM_001042425chr61530 11712 ----
NM_001042430chr14146 ------
NM_001042453chrX41692 689 575 162 21300 387 ----
NM_001042473chr1042025 1680 844 388 2599 285 ----
NM_001042510chr841888 1402 695 535 --11361 12182
NM_001042511chr841888 1402 695 535 --11361 12182
NM_001042533chr333017 2973 1271 2793 485 22145 1147 --
NM_001042537chrX22254 912 11977 ----
NM_001042555chr12114779 4635 4542 4429 4408 3028 1811 1756 1039 878 842 44470 1743 978 286 13848 11877
NM_001042599chr2137578 7377 7027 6306 6274 5929 5911 4959 4941 3052 1961 1622 1542 16670 15996 --
NM_001042603chr1284723 4599 4216 4024 3724 1668 1449 643 --23619 1606 --
NM_001042604chr393722 3653 3409 1567 1543 1482 509 492 141 14627 ----
NM_001042646chr341439 1345 1244 353 ------
NM_001042669chr43539 398 388 1488 11767 --
NM_001042681chr112150 ------
NM_001042682chr112150 ------
NM_001042682chr112150 ------
NM_001042683chr641364 1142 738 160 --11206 --
NM_001042749chrX61975 1584 1361 801 721 692 21550 702 ----
NM_001042750chrX61975 1584 1361 801 721 692 21550 702 ----
NM_001042751chrX61975 1584 1361 801 721 692 21550 702 ----
NM_001044305chr63612 483 332 ------
NM_001044722chr552258 2095 1659 1466 727 1217 21954 1584 --
NM_001044723chr552258 2095 1659 1466 727 1217 21954 1584 --
NM_001046chr552538 2000 703 691 459 22749 1065 ----
NM_001070chr171170 ------
NM_001078chr1138 ------
NM_001083621chr164638 3956 1167 1057 1008 649 24738 3756 1642 11607
NM_001099678chr386406 5396 4525 4378 4099 2394 629 91 31313 1234 364 ----
NM_001106chr3169775 8981 8927 8349 7822 7266 7218 3794 3764 3095 1695 1652 1490 163 154 136 38727 6994 170 ----
NM_001116chr1633040 2703 2419 ------
NM_001117chr1832450 2406 428 ------
NM_001121chr105657 638 393 250 23 ------
NM_001122631chr111592 --1578 --
NM_001128chr1632932 1042 28 21405 879 ----
NM_001149chr1041169 906 418 293 ------
NM_001151chr41230 ------
NM_001153chr25706 625 152 98 79 ------
NM_001167chrX66744 6412 5914 5451 5105 1110 --31887 961 38 --
NM_001173chr1494753 4054 3602 3401 1771 1587 695 259 149 23284 3022 --13304
NM_001177chr1262422 2064 1998 1729 562 269 2598 492 ----
NM_001198chr65903 383 372 239 21 12414 ----
NM_001201chr473431 3262 2839 1366 492 418 361 23326 2647 1355 1268
NM_001204chr2156921 6816 6446 6247 6026 5921 2084 2057 1728 1624 1396 1167 1089 820 89 37785 6826 4714 35825 1770 692 --
NM_001219chr741709 1658 1597 1437 1673 --11467
NM_001233chr752225 1987 677 380 54 ------
NM_001241chr262463 2178 1887 1515 672 278 22446 1781 22362 678 --
NM_001241chr262463 2178 1887 1515 672 278 22446 1781 22362 678 --
NM_001253chr6177 1205 ----
NM_001256chr1762910 2151 1184 621 314 59 ------
NM_001259chr7135943 4843 4508 4410 4334 3871 2112 1528 1368 1119 986 831 795 11860 ----
NM_001284chr51583 ------
NM_001304chr17103316 3138 2974 2891 2782 2726 1456 1308 835 497 --11322 --
NM_001310chr1242659 2482 850 486 ------
NM_001333chr9280 57 ------
NM_001343chr551682 1278 1056 395 134 21285 1081 ----
NM_001349chr22411 89 ------
NM_001351chr371514 1162 602 530 248 146 129 ------
NM_001363chrX3226 178 41 ----1695
NM_001383chr171269 ------
NM_001412chrX113203 3053 2938 2829 2303 1326 1193 1114 1090 485 338 13602 ----
NM_001417chr1231790 527 409 --11901 --
NM_001427chr732137 1378 330 --11449 12055
NM_001430chr251935 1654 750 684 179 ----12022
NM_001431chr6------11114
NM_001432chr473763 3745 2621 2614 1533 1458 939 43867 3694 2468 70 ----
NM_001438chr163638 3114 1312 1141 626 273 22295 1088 1790 --
NM_001439chr131238 188 95 ------
NM_001440chr862461 799 770 543 381 160 ------
NM_001448chrX51780 524 448 280 55 21802 569 21178 612 1463
NM_001451chr1621013 449 1419 ----
NM_001490chr951445 1064 1026 693 55 23106 2547 2135 74 --
NM_001527chr6134667 3199 1737 1623 1411 1076 878 860 807 509 503 362 246 33510 1470 326 ----
NM_001540chr7183 ------
NM_001550chr72615 83 1175 ----
NM_001553chr42235 180 ------
NM_001560chrX12526 ----2289 81
NM_001604chr1121002 407 ------
NM_001616chr243203 1153 1077 992 12297 11183 --
NM_001621chr762654 2500 858 760 464 293 23043 1009 1398 --
NM_001621chr762654 2500 858 760 464 293 23043 1009 1398 --
NM_001650chr18113936 3903 3129 3003 2794 1344 894 758 383 345 251 33996 2766 1026 --33381 2568 1307
NM_001658chr111037 ------
NM_001661chr173697 634 284 2581 549 ----
NM_001681chr124672 644 583 289 ------
NM_001682chr1252925 2868 2509 309 97 --12654 --
NM_001683chr342704 2174 773 451 12574 12485 --
NM_001690chr352547 2219 1798 621 218 ----11036
NM_001695chr854252 3811 2724 1695 286 ----13852
NM_001701chr941622 1468 1308 379 --1227 --
NM_001730chr1341521 1299 1073 583 ------
NM_001730chr1341521 1299 1073 583 ------
NM_001742chr721685 1197 --11727 1325
NM_001753chr731837 1665 1482 ------
NM_001754chr2133688 2971 485 ----1509
NM_001755chr1641871 1608 1458 497 21417 645 ----
NM_001759chr1265218 4963 4502 4297 3773 1725 --13876 --
NM_001777chr393868 3771 3576 3147 2786 1615 1064 733 128 24059 3613 ----
NM_001788chr7199 1244 ----
NM_001802chr162739 125 1899 ----
NM_001806chr1932277 2235 1026 ------
NM_001819chr20184 ------
NM_001830chrX103660 3079 1591 1405 1030 972 765 608 427 72 --1992 14010
NM_001839chr13743 109 79 ------
NM_001858chr6124784 4548 4340 4107 3279 2053 1992 1960 1869 1013 616 401 14720 35152 3806 277 --
NM_001891chr42313 32 ------
NM_001894chr2221237 1137 ------
NM_001903chr52868 799 ------
NM_001904chr311012 1220 ----
NM_001918chr1108402 8376 6437 2878 2689 2335 2266 832 729 142 ------
NM_001921chr431170 1157 39 21278 1117 1164 11289
NM_001931chr1141277 961 514 111 172 ----
NM_001935chr23972 878 192 ----135
NM_001936chr711516 ------
NM_001938chr12667 77 21537 404 21178 110 --
NM_001949chr642985 2106 970 45 ------
NM_001951chr81523 ------
NM_001955chr61942 ------
NM_001963chr42577 192 --1233 --
NM_001969chr1472819 2758 1117 741 511 213 57 23968 154 ----
NM_001980chr1272073 1805 1390 835 780 396 26 --22234 1957 --
NM_001981chr141935 800 670 456 ------
NM_001999chr531538 1131 984 ------
NM_002006chr495835 4803 4635 4620 4513 2267 1536 1074 128 32259 1592 547 15743 --
NM_002010chr132226 72 --1444 --
NM_002021chr1------1395
NM_002024chrX42233 1930 513 51 ----12205
NM_002025chrX138157 7864 7482 7422 7151 6939 6143 5734 2993 2094 1140 1085 196 66569 1712 1651 1577 1206 511 28963 2896 --
NM_002033chr1163814 3047 3012 1137 773 44 --11635 --
NM_002035chr1853567 3443 2950 2847 738 1185 ----
NM_002040chr2142721 2344 884 72 11160 --1641
NM_002056chr22864 118 ------
NM_002090chr42619 162 --125 --
NM_002092chr484034 3873 3808 3444 1978 1411 1378 92 ------
NM_002107chr12394 359 ------
NM_002126chr17114140 3856 3614 3570 3483 2937 2755 1344 1246 918 606 11406 ----
NM_002128chr1361018 757 565 554 462 32 22533 1691 ----
NM_002140chr92949 102 1890 11002 --
NM_002158chr263612 3432 3191 2780 964 110 43768 3598 3424 155 --13460
NM_002166chr23690 565 85 ------
NM_002182chr372678 2220 2095 1843 611 593 416 ----12021
NM_002199chr43910 896 849 ------
NM_002203chr573436 3403 2772 2757 1528 974 98 12979 ----
NM_002210chr273222 3165 2595 2513 2215 661 55 31314 878 152 ----
NM_002214chr7165441 5332 4850 4818 4653 4479 4442 4296 3887 1925 1578 1566 914 769 610 257 35602 5137 5016 45460 5314 1197 920 --
NM_002221chr122047 415 ----12023
NM_002223chr1263905 3286 3040 2932 2888 1117 11378 ----
NM_002234chr121767 ------
NM_002245chr1177 ----1140
NM_002264chr3114252 3867 3680 3169 3078 3071 1814 1587 1138 653 402 23803 3286 ----
NM_002267chr1321862 635 ------
NM_002268chr331874 1403 269 --11813 --
NM_002270chr555216 4936 4691 3780 1927 31755 1260 1058 ----
NM_002285chr264115 3610 3317 3217 925 97 1664 ----
NM_002294chrX--2151 121 --1317
NM_002310chr5146600 6588 5627 4708 4671 4457 4402 4354 4228 4008 1970 1811 1486 588 22578 616 14480 --
NM_002312chr132779 405 ------
NM_002336chr1295035 4953 4945 4805 4766 3907 3805 3656 3252 --11221 --
NM_002349chr251671 1558 1532 1318 180 ------
NM_002373chr151378 ------
NM_002374chr263426 2352 1194 1150 411 273 43161 2492 1325 527 13710 --
NM_002381chr241004 988 704 289 --1402 1209
NM_002382chr1411341 ------
NM_002384chr181845 1798 ----
NM_002397chr542055 1827 1608 699 --11650 22144 660
NM_002408chr141298 1288 ----
NM_002448chr42740 273 ------
NM_002478chr111517 ------
NM_002486chr93518 455 59 22543 1978 --11579
NM_002487chr152596 312 ------
NM_002499chr154934 666 655 396 1676 11797 --
NM_002508chr141878 1800 563 516 11261 --11944
NM_002515chr1432042 1949 236 199 ----
NM_002542chr32218 206 ------
NM_002545chr1184997 4970 4511 4133 3786 1813 855 501 34018 916 800 --14876
NM_002546chr83753 629 525 1797 1243 --
NM_002556chr1132126 1977 1854 ------
NM_002569chr15174 ------
NM_002577chr373020 2917 2906 2892 2827 272 71 ------
NM_002581chr9115545 5109 5094 4416 4119 2217 1219 1213 1205 641 281 15438 ----
NM_002615chr171114 ------
NM_002623chr202775 156 1246 ----
NM_002627chr10171 ------
NM_002655chr8114583 4515 4401 2056 1991 1755 1605 954 599 273 230 44270 3493 3219 2076 25015 3699 13814
NM_002656chr64944 288 243 112 1955 --11011
NM_002670chr311302 1520 ----
NM_002677chr862828 2809 907 867 199 33 22168 2010 ----
NM_002703chr421947 1531 11342 --1540
NM_002709chr243624 2221 739 516 33616 1444 1086 ----
NM_002716chr11103339 3168 3060 3016 2490 2346 1403 447 264 224 --33325 971 41 --
NM_002718chr352481 2442 2279 1756 749 22721 996 12581 --
NM_002726chr62331 154 ------
NM_002731chr152734 2658 2577 2080 453 --22265 523 --
NM_002734chr1722049 788 2644 557 ----
NM_002745chr2244309 593 473 104 13679 --24283 766
NM_002748chr154942 811 61 21 ------
NM_002755chr152886 771 --2183 153 --
NM_002806chr142313 46 ------
NM_002833chr1511509 ----1249
NM_002837chr1232963 2904 1198 1120 --14608
NM_002838chr13219 212 199 11172 ----
NM_002839chr962756 2376 2338 972 831 313 21257 1115 ----
NM_002851chr71778 --1195 --
NM_002858chr151354 1012 970 509 239 ------
NM_002874chr932184 2133 911 ------
NM_002886chr395114 4487 4029 3863 3851 3604 3242 1202 833 ------
NM_002906chr1162106 1664 706 639 446 294 11687 12247 --
NM_002924chr11624 1414 ----
NM_002927chr12547 502 ------
NM_002948chr32346 211 1118 1217 --
NM_002956chr1241161 523 485 320 21285 1141 11095 --
NM_002957chr983517 2530 1562 1507 852 185 169 158 1387 ----
NM_002968chr162347 182 ------
NM_002977chr243268 3260 492 388 63082 2382 1340 916 513 99 22539 309 12416
NM_002994chr46753 679 652 607 584 254 1742 ----
NM_003001chr171626 756 635 100 73 65 40 ------
NM_003010chr1772353 2292 2134 2101 903 627 359 22262 2151 --1755
NM_003011chr921162 235 ------
NM_003017chr631215 1003 970 ------
NM_003030chr341910 1547 645 444 11969 ----
NM_003034chr12117319 6718 5982 5723 5207 5140 3173 2846 1893 786 464 47107 3132 643 381 15932 1424
NM_003045chr1394730 4519 4403 4064 3169 3101 1882 1855 344 34710 4647 4464 ----
NM_003074chr33526 415 403 ------
NM_003091chr201237 ------
NM_003099chr15146568 5929 4707 4175 2571 2561 2110 1874 1860 1832 1579 1516 1500 848 12038 ----
NM_003108chr2106409 6340 5764 5448 5441 5219 5194 4777 459 285 15187 --14444
NM_003111chr251348 1141 506 433 345 ----1499
NM_003112chr793116 2928 2819 2798 2508 2284 2250 593 351 12988 ----
NM_003114chr84721 552 179 136 ------
NM_003155chr822755 1006 ------
NM_003161chr1723305 2521 12379 13518 1261
NM_003179chrX1160 ------
NM_003204chr1721759 106 --11110 --
NM_003220chr61530 11712 ----
NM_003221chr674049 3667 3606 2918 1672 863 358 12936 ----
NM_003234chr372152 2133 2001 1758 942 891 790 ------
NM_003242chr382479 2432 2254 2188 1854 988 684 201 1279 ----
NM_003246chr1542008 1817 1326 309 ------
NM_003262chr385163 4331 3912 3840 3798 1651 1034 210 21427 261 23923 775 --
NM_003270chrX2868 774 1819 --1910
NM_003290chr1931244 1148 228 ------
NM_003291chr132699 139 2736 122 ----
NM_003292chr151495 861 826 389 152 41968 122 66 40 ----
NM_003298chr334400 3819 132 26179 5116 1727 1436
NM_003304chr321010 478 11537 ----
NM_003305chr43341 159 113 ------
NM_003309chr631802 1388 294 ----11578
NM_003338chr1051792 1605 547 228 197 21968 1622 --11475
NM_003352chr21784 ------
NM_003359chr41981 11201 ----
NM_003374chr52576 258 ------
NM_003376chr651758 1732 1443 1369 1235 ------
NM_003376chr651758 1732 1443 1369 1235 ------
NM_003387chr232512 2030 327 1349 11107 --
NM_003392chr353876 3533 2863 182 45 23680 168 ----
NM_003404chr2022077 821 ------
NM_003410chrX82696 903 682 654 501 477 426 126 --12021 --
NM_003411chrY61360 1329 661 655 617 464 11393 ----
NM_003412chr382735 2345 2324 2295 903 880 376 306 ----1995
NM_003442chr113861 704 259 1882 ----
NM_003452chr94955 919 764 215 ------
NM_003453chr132225 67 ----1661
NM_003463chr682499 2292 2255 1313 1278 1208 1105 951 --2929 237 1320
NM_003468chr264043 3858 3006 1122 1092 1054 14273 ----
NM_003471chr351872 1702 704 650 209 2894 477 12329 --
NM_003472chr63550 369 139 21259 953 --11519
NM_003473chr10187 ------
NM_003478chr1122807 893 42872 2069 914 254 ----
NM_003489chr2143350 2591 778 346 12092 1473 --
NM_003505chr741730 1384 1375 1304 11701 ----
NM_003507chr222030 1633 21538 1352 --1480
NM_003566chr12103441 2349 2307 2135 1384 1071 912 854 578 401 13370 1191 --
NM_003574chr1885141 4854 4512 2146 1517 641 513 358 --14799 14582
NM_003590chr273242 2941 1604 1400 1236 486 200 23998 2468 23189 1206 --
NM_003601chr41192 ------
NM_003603chr452131 1631 1593 851 88 ------
NM_003613chr151497 ------
NM_003617chr184917 4881 3869 3802 3351 993 974 173 1225 14418 --
NM_003620chr174989 748 392 141 1428 --1369
NM_003629chr153447 2894 2235 1033 55 --13376 --
NM_003644chr1786599 5561 5205 3987 2548 1690 372 214 21958 828 --11590
NM_003654chr111778 ----181
NM_003663chr393365 3292 3246 2734 2726 982 854 605 172 ------
NM_003670chr321421 1029 ------
NM_003672chr191919 1609 1557 1547 1302 664 629 619 299 ----1510
NM_003692chr93820 92 47 1985 ----
NM_003701chr132983 973 ----1741
NM_003718chr7134 ------
NM_003722chr372660 1951 1846 889 469 432 108 12605 1626 --
NM_003743chr23864 309 282 ------
NM_003749chr1332299 711 557 22205 1770 ----
NM_003758chr1551569 1267 1131 1091 507 ----1396
NM_003758chr1551569 1267 1131 1091 507 ----1396
NM_003759chr464038 2727 957 860 785 536 44062 3333 869 665 --12990
NM_003774chr1273222 3147 2403 1307 1162 997 211 42243 908 238 94 12497 --
NM_003784chr181714 ------
NM_003787chr1851659 1587 1389 1324 1154 --1527 --
NM_003798chr9175 ------
NM_003822chr173120 2963 2624 2095 2063 1283 824 12105 --22899 381
NM_003872chr242636 645 518 311 ------
NM_003873chr1032387 1798 1007 12181 ----
NM_003877chr122646 288 ------
NM_003895chr2121897 279 21993 1550 ----
NM_003909chr852327 2162 1964 820 272 1331 11139 --
NM_003913chr684024 3765 3301 3266 2657 1492 1407 1189 63606 3509 2947 2775 1447 69 14364 1768
NM_003932chr2271864 1544 1422 1233 483 466 391 ------
NM_003948chr432428 1631 906 ------
NM_003956chr102119 105 ------
NM_003977chr111106 ------
NM_003994chr1243660 3118 1223 124 ------
NM_004028chr18113936 3903 3129 3003 2794 1344 894 758 383 345 251 33996 2766 1026 --33381 2568 1307
NM_004081chrY81540 705 698 625 537 344 234 217 ------
NM_004093chr1332810 2158 1270 31258 1152 919 21141 439 --
NM_004094chr1492967 2455 1854 1070 725 709 670 487 180 --1444 --
NM_004109chr1172233 1998 1782 435 340 153 54 12396 ----
NM_004113chr32588 295 21562 740 22022 347 --
NM_004124chr1463231 3142 2781 2736 404 72 ----1412
NM_004133chr852514 1829 967 927 668 1303 11698 11726
NM_004136chr15103308 2954 2670 2655 2623 1021 543 527 272 110 ------
NM_004161chr221065 607 ------
NM_004170chr961808 1723 1383 1288 686 504 --11354 --
NM_004171chr11128985 8650 8287 5962 3280 2941 2896 2666 1686 1081 552 230 --16253 --
NM_004172chr531309 464 443 ----11389
NM_004203chr16137 ------
NM_004225chr82573 453 --1982 --
NM_004229chrX41779 1633 1608 1540 31813 1697 625 --22060 1993
NM_004236chr151170 ------
NM_004261chr11889 ----142
NM_004274chr1442168 2130 130 117 1772 11266 --
NM_004281chr102373 98 ------
NM_004329chr102894 484 11298 1161 --
NM_004330chr152772 220 ------
NM_004337chr872066 2031 870 687 655 302 274 1634 ----
NM_004338chr18126751 6684 6451 6113 6106 5954 5366 4526 2097 1709 1050 406 ------
NM_004342chr742315 1622 590 150 --11429 --
NM_004354chr43817 331 165 1677 ----
NM_004365chr52343 100 ------
NM_004370chr631823 1737 1721 12078 183 --
NM_004382chr1711051 ------
NM_004384chr552258 2095 1659 1466 727 1217 21954 1584 --
NM_004397chr1154315 3808 3187 574 446 23944 3615 1440 1351
NM_004404chr252021 1685 1417 584 374 12064 ----
NM_004405chr241031 978 763 45 ------
NM_004415chr62757 174 161 1628 --
NM_004432chr942268 1916 929 573 ------
NM_004438chr262947 2771 2381 2246 728 707 13188 ----
NM_004441chr311303 ------
NM_004447chr124987 855 274 109 1179 ----
NM_004458chrX72167 1865 1769 934 481 375 234 32694 1727 146 ----
NM_004459chr1741641 1484 782 441 1716 21602 502 1213
NM_004464chr4104081 3876 3383 3014 2765 1727 1397 1107 899 471 22918 1216 11122 13293
NM_004482chr24937 929 131 111 ------
NM_004490chr2------123
NM_004500chr1451560 706 130 56 28 21303 290 --1652
NM_004501chr173628 3502 1332 1160 387 290 260 33954 1135 335 --1776
NM_004504chr222788 1856 32508 2168 765 1828 1868
NM_004505chr1741969 1315 287 109 11792 ----
NM_004514chr172958 670 13097 ----
NM_004529chr931062 1013 412 --1392 --
NM_004586chrX85032 4978 4923 4738 1908 1371 1110 768 1544 11933 --
NM_004598chr553256 2754 2534 767 382 2610 518 ----
NM_004612chr9164084 3923 3685 3595 3520 3344 3186 1790 1630 1616 1110 1094 887 738 601 514 1255 21512 377 --
NM_004622chr22487 466 ------
NM_004657chr251525 1308 1273 420 348 ------
NM_004670chr1041727 1713 599 391 ------
NM_004703chr1741035 541 396 70 21719 1633 12201 --
NM_004709chrX31662 1305 487 ------
NM_004725chr1041348 1285 1091 73 11016 1586 --
NM_004726chrX72211 2025 1821 821 220 199 37 11524 182 --
NM_004738chr203748 719 66 1243 ----
NM_004745chr876898 5883 5769 5581 4644 2731 1422 16991 12036 --
NM_004748chr15124211 4057 3722 2988 2831 1672 1438 1149 543 418 198 129 23524 1411 ----
NM_004772chr51457 ------
NM_004775chr1862409 2390 2257 2174 1752 924 ------
NM_004788chr1141690 1097 715 436 12343 1221 12712
NM_004789chr91328 ------
NM_004795chr1331715 1709 1691 11682 --21813 1463
NM_004800chr13187 ------
NM_004801chr24629 255 71 49 ----11451
NM_004808chr1053229 1267 1225 1184 1145 23303 3295 ----
NM_004815chr1154709 4209 4068 3971 3965 3772 3523 3460 3218 1658 1129 528 464 397 142 33826 1336 946 ----
NM_004827chr441686 1626 305 28 31936 1384 259 11861 --
NM_004837chr12333 36 ------
NM_004857chr14114581 3917 3385 3354 3287 3212 1826 1162 1070 422 98 14799 ----
NM_004863chr1485100 4634 3635 1886 1845 1048 617 493 11078 ----
NM_004866chr5124892 3971 3881 3767 3404 3131 1784 1768 1619 1430 534 156 12005 1162 --
NM_004869chr1831299 1246 1172 31771 1619 431 --2411 172
NM_004891chr21208 ------
NM_004896chr103605 398 133 1979 11241 --
NM_004904chr766363 5088 4958 4714 2053 139 24071 2086 25598 306 --
NM_004905chr11785 ----1134
NM_004912chr731489 1410 1211 ----11440
NM_004926chr1471741 1229 1164 542 392 285 202 --11137 11175
NM_004929chr851364 1118 442 397 355 ------
NM_004932chr531732 1442 68 --21654 1526 --
NM_004938chr92456 401 ------
NM_004944chr3------123
NM_004947chr332356 2230 1701 ------
NM_004956chr753807 3734 3468 2940 366 14067 23741 3717 --
NM_004967chr43500 445 168 ------
NM_004985chr12144497 4142 3578 3364 3006 1672 1454 1079 745 504 370 295 145 72 33776 3567 1678 1971 --
NM_004992chrX98529 7478 7002 6820 3149 2718 2687 2013 1339 18434 --12109
NM_004992chrX98529 7478 7002 6820 3149 2718 2687 2013 1339 18434 --12109
NM_004993chr1411489 ----21079 423
NM_004999chr633180 1415 875 43487 2793 1438 126 14374 --
NM_005023chr531468 516 506 11180 1322 --
NM_005056chr1284967 4843 4460 4268 3968 1912 1693 887 --23863 1850 --
NM_005065chr1495259 4377 4350 4179 3404 1369 1338 615 604 --12142 --
NM_005079chr8103123 3078 3006 2805 2483 1283 730 709 594 293 22750 1265 --167
NM_005080chr222729 632 --1668 --
NM_005093chr2065298 5249 3796 1846 1137 917 --14251 --
NM_005121chr1783314 2959 2804 2758 2671 2456 1079 444 22644 2425 1119 --
NM_005126chr351686 1435 878 677 646 21779 322 1406 --
NM_005128chr21------1679
NM_005151chr1851724 1559 716 615 434 1854 22066 243 --
NM_005156chr964247 3631 791 752 529 276 64440 4012 1662 1223 797 442 21061 1049 --
NM_005171chr1221194 932 1958 ----
NM_005180chr1041249 1136 422 382 ------
NM_005181chr81676 1750 ----
NM_005188chr11127933 7855 7463 7447 5465 2733 2411 2169 1834 1125 191 52 18265 ----
NM_005190chr6--1319 --11114
NM_005233chr352505 2109 893 736 516 12174 1496 --
NM_005235chr2137578 7377 7027 6306 6274 5929 5911 4959 4941 3052 1961 1622 1542 16670 15996 --
NM_005239chr2161914 1781 1588 1386 465 137 ------
NM_005254chr1521402 974 ----11414
NM_005256chr111239 ----1801
NM_005259chr21607 ------
NM_005263chr131230 984 457 ------
NM_005271chr103842 358 266 11246 ----
NM_005339chr4104315 3918 3843 3783 3640 3011 1649 1444 1234 744 11559 --1577
NM_005359chr18125426 5386 5351 5230 4072 4022 4013 3977 1833 1771 323 103 25890 5671 36133 198 33 1244
NM_005375chr631185 294 223 ------
NM_005378chr21685 ------
NM_005381chr21388 ------
NM_005385chr32266 29 ------
NM_005388chr961671 1597 1565 1326 1273 115 11064 ----
NM_005392chr971792 1751 1643 1567 1553 1197 265 11447 ----
NM_005402chr771693 1140 453 345 230 209 25 --11683 --
NM_005412chr121346 ------
NM_005433chr1841701 469 292 197 12814 --12200
NM_005436chr1094078 3981 3258 1379 963 711 682 153 101 11439 13208 --
NM_005445chr101280 ------
NM_005450chr17------1241
NM_005475chr1263250 2859 2768 729 628 210 --12128 11045
NM_005497chr1796135 3997 3929 3862 1933 1281 1226 1080 674 26154 5036 --11017
NM_005501chr17156 ------
NM_005502chr932903 951 498 ----12590
NM_005504chr12136577 5370 5027 4695 4440 4267 4245 2539 2362 2206 1588 808 434 26627 5544 24782 1104 14224
NM_005509chr561470 627 495 405 286 30 --11775 --
NM_005513chr331490 1292 524 --11163 1547
NM_005522chr751287 540 389 357 79 ------
NM_005537chr132361 53 --1962 11065
NM_005565chr52516 128 ------
NM_005566chr112446 81 ------
NM_005575chr52813 201 ------
NM_005578chr3124816 4705 4372 4175 3198 1956 1867 1606 1300 1009 906 663 13785 13379 33748 3467 1345
NM_005584chr132586 31 ----153
NM_005587chr151950 ------
NM_005596chr965347 4351 1897 1680 1580 636 1651 ----
NM_005598chr111244 ------
NM_005602chr31912 1281 ----
NM_005625chr831043 851 196 ------
NM_005638chrX61650 1487 604 546 169 158 21525 1255 ----
NM_005665chr194465 4455 3254 3040 1939 800 171 159 48 34664 3767 417 ----
NM_005668chr584605 4570 3958 3900 3373 3304 2826 1767 43864 1631 1467 1192 1402 --
NM_005688chr32255 109 ------
NM_005711chr531065 947 201 ------
NM_005713chr5131 ------
NM_005715chr652709 2603 2314 1867 29 --32258 324 251 --
NM_005725chr121822 801 ------
NM_005738chr741349 1302 1291 776 1612 ----
NM_005748chr1272638 902 891 877 735 637 607 43001 2904 2403 524 --11004
NM_005754chr54949 865 811 386 11240 ----
NM_005759chr294521 4460 4238 3612 3554 3419 1888 1817 1387 34346 2988 1052 13083 11727
NM_005776chr142743 134 ----1729
NM_005779chr563675 2968 2543 2524 2499 582 12228 ----
NM_005788chr114802 718 670 271 ------
NM_005795chr282577 2063 2052 1919 884 463 392 208 ----1752
NM_005802chr93778 544 239 --1841 --
NM_005807chr13659 512 166 174 ----
NM_005822chr652080 784 744 534 41 2128 68 --1244
NM_005826chr12245 222 ------
NM_005840chrX97688 6840 5441 5228 5204 5115 2378 1195 243 22211 767 12549 --
NM_005851chr111383 ------
NM_005857chr141407 1170 998 224 --11208 --
NM_005859chr551563 1299 1007 563 224 1387 ----
NM_005871chr103437 192 54 11087 ----
NM_005880chr1651285 1093 1049 298 261 ----185
NM_005895chr1233201 1562 450 14028 1901 150
NM_005896chr22804 129 ------
NM_005898chr1193086 2826 2484 2416 1226 881 155 109 78 --11260 --
NM_005899chr1741207 1118 433 88 ------
NM_005900chr42791 410 ------
NM_005901chr18168448 7707 7653 7633 6679 6234 5999 5491 3246 2778 2179 1873 1462 1012 933 251 38426 8392 285 1699 --
NM_005903chr585063 4930 4549 4032 3700 1102 923 110 54276 3428 3401 1636 306 14124 --
NM_005907chr631631 1081 146 1192 1179 --
NM_005917chr21163 ------
NM_005924chr72920 807 1113 --1178
NM_005935chr494765 3409 3338 3287 3206 1789 1719 1462 1410 14848 ----
NM_005955chr155558 4368 3599 550 272 14334 1936 --
NM_005962chr1041543 669 538 507 ------
NM_005962chr1041543 669 538 507 ------
NM_005986chr1352832 2554 2493 1801 267 ----1119
NM_005989chr741573 1521 1018 615 2471 221 ----
NM_005999chr15479 259 252 186 66 21353 1172 ----
NM_006037chr294779 4101 3947 3926 3866 3857 481 428 29 23376 1085 ----
NM_006047chr2032933 2438 753 23005 2408 11276 33560 2181 286
NM_006055chr2103228 3146 2990 2684 2559 2491 979 299 165 139 22812 2533 ----
NM_006089chrX51595 1238 697 581 118 ------
NM_006094chr872436 2363 2314 1762 1689 625 252 21875 657 ----
NM_006095chr464371 4182 2786 1658 1152 59 24513 4406 13167 --
NM_006106chr1143194 2416 894 158 12807 --13322
NM_006133chr1112441 ------
NM_006154chr1572560 1973 1960 1090 958 518 162 11818 --12688
NM_006155chr252021 1685 1417 584 374 12064 ----
NM_006166chr1272308 1954 1684 521 439 320 290 1513 12529 --
NM_006180chr981966 1568 1321 667 629 563 546 491 ------
NM_006195chr94957 264 215 117 1279 11154 --
NM_006196chr21124 ------
NM_006197chr871923 1887 1689 697 658 577 304 2592 549 --11912
NM_006203chr571933 1782 1663 1656 1359 1312 879 1605 --11339
NM_006212chr1105079 4384 4108 3544 3511 3438 3401 2131 1420 1105 --173 --
NM_006224chr1711692 ------
NM_006226chr21164 1504 1481 137
NM_006252chr1147046 6845 5583 5326 5226 3016 1409 1359 1166 897 680 651 172 64 16493 ----
NM_006256chr162752 2316 1725 944 592 569 2687 623 11009 --
NM_006275chr2061740 895 668 503 366 28 12161 ----
NM_006277chr23712 538 216 ------
NM_006282chr2054368 4289 4236 4120 1895 --13932 --
NM_006283chr864941 3678 3311 1680 289 73 14214 ----
NM_006292chr11160 1166 ----
NM_006298chr653383 3227 2673 2121 1373 12481 1277 --
NM_006300chr193910 508 372 22362 1745 --22401 1547
NM_006301chr122610 502 ------
NM_006313chr1231566 521 132 11351 ----
NM_006333chr22468 248 ----1108
NM_006350chr5194 ------
NM_006359chrX22254 912 11977 ----
NM_006364chr143942 433 75 ------
NM_006366chr641307 1042 488 465 11217 ----
NM_006371chr3105140 4343 4325 3821 3510 3325 2029 745 589 536 --14250 --
NM_006379chr772289 1731 818 801 718 627 376 31983 1554 1536 ----
NM_006380chr1743372 1223 799 773 34091 4054 1605 1363 --
NM_006393chr1064046 3620 3543 3226 1787 1760 13028 ----
NM_006415chr91172 --11131 --
NM_006420chr2073196 3051 2486 2123 892 488 385 12869 32266 2157 1184 --
NM_006430chr22489 197 ------
NM_006434chr1053019 2655 2243 1240 831 12563 ----
NM_006457chr483999 3846 3356 3233 3000 485 445 198 2884 405 ----
NM_006489chr1432042 1949 236 199 ----
NM_006504chr1022798 520 ------
NM_006516chr121082 245 ------
NM_006534chr2063349 2918 2564 2460 2326 2087 12352 ----
NM_006538chr293519 3292 3257 3225 2882 2651 1665 1315 91 1871 13192 12677
NM_006540chr821477 441 ------
NM_006544chr1494441 4434 3739 2189 1892 1376 755 701 286 46007 5377 4804 4480 ----
NM_006546chr1766435 5568 5155 2374 1249 492 22234 1332 12636 --
NM_006549chr1252900 2868 2657 2504 556 1786 ----
NM_006558chr81359 ------
NM_006561chr10105832 5348 5298 4912 3877 2502 2070 1166 337 284 24787 4569 15841 --
NM_006570chr91352 ------
NM_006575chr143577 474 373 1480 ----
NM_006582chr1165 ------
NM_006587chr441680 499 346 196 2606 286 ----
NM_006599chr16127399 6903 6712 5495 5292 5044 2403 1522 1008 336 272 74 22923 2425 27623 1185 --
NM_006602chr202188 170 ----1707
NM_006603chrX61975 1584 1361 801 721 692 21550 702 ----
NM_006609chr282850 2674 2608 2288 2006 1983 1878 1189 12149 --1803
NM_006614chr342791 2784 519 53 13023 --1483
NM_006620chr694785 4291 4266 3798 3763 1297 1095 880 779 24510 73 ----
NM_006621chr1------1310
NM_006628chr1564033 3198 1681 1423 357 63 24638 3267 ----
NM_006646chr1333098 3016 1965 --12120 --
NM_006654chr12114779 4635 4542 4429 4408 3028 1811 1756 1039 878 842 44470 1743 978 286 13848 11877
NM_006667chrX1442 ------
NM_006699chr132463 2091 725 --1445 --
NM_006713chr51563 3191 182 156 --1792
NM_006717chr953383 3089 2524 1089 326 ------
NM_006718chr64944 288 243 112 1955 --11011
NM_006722chr31940 1127 --12829
NM_006729chrX135655 5434 4991 4726 4274 3783 3440 2037 1294 1172 1033 566 201 44252 3763 3481 1974 21901 617 --
NM_006731chr9105738 3993 3894 2148 2030 1741 1730 1436 990 606 21004 81 2630 623 --
NM_006750chr1687051 6927 6645 6344 6279 5497 885 613 46636 6175 2377 1825 17495 --
NM_006756chr851409 1317 1006 541 491 1362 ----
NM_006766chr832356 564 399 1577 1546 --
NM_006775chr692933 2917 2682 2647 2534 2100 2080 1162 125 33114 2365 1075 --22561 1985
NM_006788chr182336 241 ------
NM_006790chr51146 ------
NM_006791chr151495 ------
NM_006811chr203892 770 186 11031 ----
NM_006814chr2052642 2634 2113 1784 788 2532 360 1153 --
NM_006832chr144360 206 107 99 ------
NM_006838chr1281886 1871 1420 1378 1281 673 523 119 --11822 --
NM_006857chr23336 251 133 1839 ----
NM_006873chr252894 2496 958 614 541 ----137
NM_006874chr421123 417 ------
NM_006884chr341910 1547 645 444 11969 ----
NM_006885chr1694173 4156 3670 3324 2584 1323 1075 1048 193 ------
NM_006912chr152463 2284 709 213 23 21834 180 11808 --
NM_006915chrX62542 2467 1702 802 395 297 42434 2408 2021 891 22188 269 --
NM_006918chr1185866 4343 3813 2094 1401 1386 957 736 44945 4787 3691 364 ----
NM_006922chr252523 2021 1741 931 216 ------
NM_006924chr1794409 3705 3189 1247 1179 750 685 507 339 23316 442 ----
NM_006937chr171441 ------
NM_006940chr1231381 1161 684 ------
NM_006948chr2182315 1816 1667 821 489 405 57 35 ------
NM_006981chr912650 33020 2298 648 --12683
NM_006982chr12152 ----1288
NM_006999chr5--11717 11488 1205
NM_007006chr1673552 2439 2304 729 470 101 38 13200 32618 2188 1094 --
NM_007007chr1274817 3280 3203 1676 1559 259 66 24681 3516 ----
NM_007011chr1555988 5769 2256 1806 1166 26766 2069 ----
NM_007017chr52850 617 1681 ----
NM_007036chr52940 837 ------
NM_007038chr2161887 1672 1160 1110 1104 1049 34244 2222 115 25790 307 --
NM_007040chr19------11036
NM_007064chr321672 1047 11293 ----
NM_007106chr1342738 2455 1860 881 12610 ----
NM_007107chr352323 1884 1553 334 327 1224 1906 --
NM_007114chr393104 2580 2415 2353 2085 1144 998 277 270 1501 --13043
NM_007124chr641678 507 492 280 ------
NM_007129chr131882 ------
NM_007146chr1772674 2417 2260 1936 609 490 106 12323 1187 --
NM_007158chr141160 1121 1109 110 ------
NM_007166chr1141558 1433 639 315 21425 561 --11580
NM_007172chr2263262 2910 2340 2247 2194 703 1262 1777 --
NM_007173chr1162329 1565 933 756 75 47 12145 ----
NM_007175chr853105 2505 2371 518 273 33684 3569 2879 ----
NM_007187chr132331 65 ----11073
NM_007192chr145989 945 913 460 323 ------
NM_007195chr1893578 3556 3355 3141 3093 2639 2483 2461 847 23333 66 ----
NM_007212chr142047 1837 1406 594 11654 ----
NM_007231chrX42332 2252 889 65 1370 1191 2994 985
NM_007246chr42766 370 ----1298
NM_007249chr13128954 8027 7400 6698 5776 5704 3770 3753 3519 3311 2772 1902 39443 9034 6429 26872 602 --
NM_007276chr72365 223 ------
NM_007282chr32161 101 1696 ----
NM_007287chr383196 3094 2491 2167 2044 1983 1086 789 23017 764 ----
NM_007288chr383196 3094 2491 2167 2044 1983 1086 789 23017 764 ----
NM_007289chr383196 3094 2491 2167 2044 1983 1086 789 23017 764 ----
NM_007294chr171301 ------
NM_007295chr171301 ------
NM_007296chr171301 ------
NM_007297chr171301 ------
NM_007298chr171301 ------
NM_007299chr171301 ------
NM_007300chr171301 ------
NM_007302chr171301 ------
NM_007303chr171301 ------
NM_007304chr171301 ------
NM_007305chr171301 ------
NM_007308chr42588 292 1673 ----
NM_007345chr1832092 1626 119 ------
NM_007347chr1593164 3011 2045 1116 1007 695 592 110 59 ------
NM_007351chr451086 1055 331 267 59 ------
NM_007353chr732861 2772 2536 23043 2550 --12123
NM_007358chr161897 1786 1435 1301 343 175 --11521 --
NM_007373chr1041835 445 398 59 1285 ----
NM_007375chr152279 1797 695 488 304 32658 2307 1096 --22571 318
NM_012081chr583412 2733 1352 1276 1241 957 310 43 1967 ----
NM_012082chr81790 ------
NM_012090chr141233 820 338 134 ------
NM_012096chr353684 3670 3542 686 118 23229 769 ----
NM_012099chr1971259 1177 1053 1008 382 338 140 11038 ----
NM_012102chr112150 ------
NM_012115chr64552 203 135 95 ------
NM_012120chr652288 1174 895 524 203 12156 1928 --
NM_012129chr752395 2167 2134 1632 1529 22526 1584 ----
NM_012141chr1374167 3772 3116 1383 864 326 26 --1263 --
NM_012154chr81125 ----1250
NM_012158chr1351857 1790 1562 728 142 ------
NM_012160chr6------1393
NM_012161chr431067 742 413 --1818 --
NM_012164chr9117557 7443 7274 6899 5836 5419 4725 2202 1372 810 134 32640 2521 373 15775 --
NM_012180chr42741 212 ------
NM_012183chr11457 ------
NM_012188chr521086 167 ------
NM_012214chr2145201 5072 4933 2532 2056 1947 1256 1146 1068 695 455 397 364 128 --1849 --
NM_012215chr1011775 ------
NM_012219chr342524 1109 458 345 23222 467 ----
NM_012223chr241331 1137 539 153 --1417 --
NM_012224chr451227 1140 1109 186 130 1240 157 1476
NM_012234chr353702 3688 3397 2290 887 23168 1224 --23109 1511
NM_012243chr11372 1959 --1361
NM_012249chr2103190 2899 2592 2375 2298 2281 1393 1256 654 554 ----12470
NM_012252chr7125280 5107 5036 4847 4808 4645 4241 4131 1203 1163 1055 93 13431 11075 --
NM_012257chr731093 801 222 ----1405
NM_012262chr175260 4656 4369 3979 1722 1545 171 ------
NM_012281chr762385 2190 2163 1990 707 418 12182 ----
NM_012287chr3124460 4406 4135 4118 4035 3545 3289 2781 2751 1822 984 530 21563 207 24329 2759 13962
NM_012294chr774041 3733 3233 2959 2659 797 105 23961 3651 21360 1208 --
NM_012308chr1141894 698 689 179 --11960 --
NM_012316chr155200 4037 1582 434 386 --12023 11513
NM_012327chr1861620 1576 1494 555 522 438 --11541 --
NM_012329chr17--1624 --11378
NM_012330chr1011151 ------
NM_012342chr102530 75 ------
NM_012347chr652832 2233 920 312 161 ----1765
NM_012395chr743395 3199 2434 41 1718 --1802
NM_012416chr971094 1022 433 239 179 165 74 ------
NM_012420chr1051593 545 290 93 73 1648 ----
NM_012448chr1742065 1543 955 670 ------
NM_012464chr462701 2271 1920 1827 947 932 22880 356 12632 --
NM_012479chr762600 2525 1938 689 679 285 1822 ----
NM_013231chr1454415 1768 1139 1121 1010 34064 1677 24 13917 13796
NM_013235chr52806 176 ----1910
NM_013237chr5173 ------
NM_013255chr7208690 8683 7955 7833 7740 7284 7245 7018 6357 6007 5553 5490 3074 2973 2802 2609 1507 914 576 270 48251 7728 6828 6746 --27585 2873
NM_013261chr442871 2434 2360 1460 ----32831 1397 942
NM_013269chr1294433 4395 4033 3455 2777 1761 1399 482 467 13414 13344 --
NM_013283chr51205 ------
NM_013309chr1552639 1925 842 402 31 1695 ----
NM_013341chr242929 2505 1170 1164 1808 ----
NM_013354chr831126 465 61 1942 ----
NM_013372chr1552875 2757 2487 1228 1043 ------
NM_013374chr393104 3027 2818 2356 2210 2118 658 649 488 1614 12041 --
NM_013381chr1282174 1829 1686 1496 815 766 571 388 ------
NM_013396chr2141282 603 296 242 ------
NM_013437chr86996 511 365 321 313 54 11284 2524 120 --
NM_013444chrX5832 260 221 196 37 ------
NM_013450chr221107 212 ------
NM_013943chr173261 3144 2752 2266 728 636 386 22154 995 13236 --
NM_013989chr1485085 5067 4781 4460 3389 880 117 25 ------
NM_014011chr231948 947 153 1336 21645 1605 --
NM_014021chr153368 2394 2351 1249 424 32995 1387 975 ----
NM_014028chr6123343 3158 3032 2349 1046 838 819 791 707 658 591 240 11222 --13047
NM_014048chr16115224 4940 4930 4784 4410 3393 1572 1251 1224 1141 114 23924 1193 --22053 235
NM_014055chr121416 1125 ----
NM_014089chr1352246 2211 1949 1930 1853 11839 ----
NM_014106chr1552634 2620 1835 124 43 12278 --11973
NM_014112chr894943 4683 3854 2187 1819 1484 1439 371 114 14857 ----
NM_014141chr795103 4008 2141 1670 1435 1078 982 829 292 24487 3657 ----
NM_014155chr1167443 5365 4713 4692 815 768 35493 1733 1630 --12896
NM_014181chr242861 2618 2112 1839 1912 11923 --
NM_014243chr43433 229 115 22100 1305 ----
NM_014245chr331085 174 166 1212 ----
NM_014258chr20237 28 ------
NM_014267chr114879 809 316 41 ------
NM_014268chr1821236 340 --11167 11027
NM_014294chr821034 560 ------
NM_014309chr2275321 4833 4374 4110 3787 1958 304 35266 1481 858 ----
NM_014313chr13319 248 99 41543 1514 304 240 --11639
NM_014319chr1271996 1956 1844 1815 1671 1309 1213 1265 ----
NM_014320chr62127 48 ------
NM_014368chr922132 524 ------
NM_014372chr161694 1372 1324 777 557 61 21743 436 11462 --
NM_014381chr14102589 2326 2285 2251 2127 2076 2029 906 796 272 ------
NM_014393chr832277 1472 178 ------
NM_014399chr71117 1415 --1891
NM_014415chr351557 637 553 353 262 ------
NM_014423chr555222 2100 1818 561 440 44266 3621 3565 846 ----
NM_014458chr13248 215 100 11034 ----
NM_014494chr1621782 521 1575 ----
NM_014504chr741584 1333 764 189 12148 ----
NM_014517chr351788 1718 1691 698 628 --11842 --
NM_014554chr1221458 618 ------
NM_014572chr1361568 1379 484 371 358 271 11819 ----
NM_014574chr142495 461 11006 ----
NM_014585chr261179 806 487 341 324 56 ------
NM_014606chr471440 1344 1163 1151 995 438 378 ------
NM_014608chr151153 ------
NM_014613chr562752 2340 2045 1217 689 110 ------
NM_014616chr373438 2929 2448 1355 1112 817 448 43505 3158 1338 802 ----
NM_014630chr1573171 3144 3011 2976 1324 583 258 11592 22745 2644 --
NM_014647chr1642139 2112 2013 1678 12283 ----
NM_014660chr72804 703 11110 4337 286 171 144 --
NM_014671chr771559 1526 1472 1180 1055 182 165 21309 474 11451 --
NM_014673chr83217 68 53 ------
NM_014682chr882024 1699 1609 489 339 318 220 211 21546 389 11928 --
NM_014683chr1761848 1780 1555 1393 788 189 22134 607 ----
NM_014701chr1573185 2928 1200 935 761 347 226 12291 13125 --
NM_014702chr653415 2481 1327 982 838 12793 --150
NM_014705chr752041 2030 796 457 423 1322 --2390 136
NM_014711chr1662024 1754 1726 1342 736 108 ------
NM_014721chr6107430 6841 6708 6161 5972 5718 2435 2117 1979 1799 25926 2292 14979 1501
NM_014729chr862323 2082 873 813 177 94 11938 ----
NM_014733chr531811 596 504 12101 ----
NM_014739chr673818 3391 3229 2736 2567 1656 1343 33491 3207 346 12857 --
NM_014765chr142674 1987 1045 610 12556 ----
NM_014767chr1013623 ------
NM_014774chr162263 2158 2131 2028 2005 306 ----1530
NM_014787chr152839 2621 2056 1748 1132 --21067 915 --
NM_014803chr1042760 1947 992 817 --12611 --
NM_014810chr143030 2373 760 113 11027 --12452
NM_014819chr522261 2201 --1260 --
NM_014824chr1142010 1617 540 193 11610 --11704
NM_014832chr1331909 1393 773 ----11656
NM_014836chr1041926 1582 471 148 --11644 21728 750
NM_014838chr2252455 1035 689 610 223 1199 --1902
NM_014839chr132290 891 465 21650 554 ----
NM_014858chr11985 ------
NM_014860chr262660 2526 1637 570 520 307 1988 ----
NM_014870chr164638 3956 1167 1057 1008 649 24738 3756 1642 11607
NM_014873chr174587 4507 3231 1734 822 670 135 14560 ----
NM_014877chr17167616 7530 7353 7293 7247 6584 6222 4777 2528 2455 2408 2352 1324 1169 981 514 37232 2150 1084 22178 1296 --
NM_014883chr422297 819 12490 ----
NM_014885chr4144 ------
NM_014904chr1083908 3716 3213 2693 1557 1486 1344 1201 ----12574
NM_014906chr1753744 3103 997 739 405 34074 4003 1281 ----
NM_014912chr1052321 1360 399 281 139 22711 714 ----
NM_014939chr18----2964 133 2312 261
NM_014946chr243110 3030 2792 789 21098 1018 1950 --
NM_014947chr16910 807 531 432 412 173 1117 ----
NM_014949chr141009 263 226 175 ------
NM_014951chr1062517 2306 2121 1853 1811 189 --11629 --
NM_014961chr452211 1554 1396 742 180 ------
NM_014962chr2042266 1892 908 740 22705 2515 --1219
NM_014964chr1762448 2426 847 781 694 355 ------
NM_014966chr3165 ------
NM_014978chr1041489 733 530 69 --11276 --
NM_014982chr14114972 4687 4561 4444 4387 4330 3891 3799 1096 515 389 ----11892
NM_014991chr442825 1022 962 345 23009 2554 --1299
NM_014997chr71115 2693 301 --1833
NM_015000chr1272670 2520 599 587 225 207 111 32619 2582 902 12133 11197
NM_015001chr11779 11014 --1948
NM_015017chr14930 910 257 116 ----1849
NM_015025chr282683 2467 2458 2288 2281 1725 1061 458 22510 949 1828 --
NM_015026chr12164495 4405 4289 4248 3891 3861 3851 3472 3329 3001 1748 1655 971 706 691 373 33455 3145 596 ----
NM_015032chr1362728 2584 2035 799 789 314 1819 ----
NM_015040chr222615 582 1849 22826 457 12655
NM_015057chr131200 ------
NM_015059chr1523965 2987 13089 11062 --
NM_015068chr763673 3217 2982 2616 1515 526 ----23792 509
NM_015070chr1311493 ----1232
NM_015071chr534997 2447 2423 16005 15003 16236
NM_015076chr664285 3164 1577 728 558 345 ------
NM_015087chr1351991 1679 773 728 642 1906 --12608
NM_015092chr1664473 4436 4044 3770 1289 889 23099 1277 ----
NM_015130chr431275 1149 105 --11054 1300
NM_015132chr731253 796 788 31604 1557 126 11398 --
NM_015137chr842580 2012 2001 361 ------
NM_015138chr1532459 628 247 12287 ----
NM_015144chr1643944 2801 1053 953 33812 729 30 23248 995 11350
NM_015147chr243313 3174 2175 1219 42723 1339 1075 705 --1473
NM_015155chr1042666 2114 278 207 1303 12857 --
NM_015156chr1473366 3223 3191 2794 2464 906 543 33415 2581 880 11325 13685
NM_015170chr832260 2137 2019 ------
NM_015172chr141616 1145 518 510 ------
NM_015173chr431652 1395 590 --11761 --
NM_015192chr203959 588 547 11080 164 --
NM_015197chr14------1195
NM_015206chr1563619 3257 2367 1149 902 554 43586 3296 2868 520 21347 1113 --
NM_015208chr1831470 521 457 1364 ----
NM_015209chr192344 2087 1697 907 841 826 696 680 293 --11509 --
NM_015230chr411752 ----2709 613
NM_015247chr1695241 4640 3910 3383 1912 1346 869 471 59 31006 446 248 24240 1862 11684
NM_015250chr931669 693 330 ------
NM_015265chr242623 2279 860 260 ----11728
NM_015271chr443099 2699 1083 165 22795 499 --11721
NM_015278chr663431 3246 2441 1121 745 240 --11291 --
NM_015291chr173417 2882 2633 2561 2357 291 285 33334 3067 2312 12980 --
NM_015310chr887629 6743 3050 2390 2183 2007 1662 1185 38123 5562 1699 15130 --
NM_015313chr1144541 3999 3458 1714 13738 14084 --
NM_015314chr732439 2271 492 22134 976 1588 11694
NM_015317chr242756 1972 1079 449 2510 69 12116 1784
NM_015323chr64566 547 342 22 21596 1269 11460 --
NM_015326chr132161 1141 273 156 --1816
NM_015336chr1241848 1712 461 312 32033 2018 157 --12382
NM_015339chr202916 277 ------
NM_015349chr682332 2243 2146 1923 1117 1058 477 184 12672 ----
NM_015350chr11535 ----1447
NM_015358chr2121076 867 ------
NM_015365chrX64296 3354 1205 722 703 202 --22874 680 --
NM_015367chr2211530 ------
NM_015375chr134842 4750 3266 --23916 3048 --
NM_015384chr51170 ------
NM_015385chr1053019 2655 2243 1240 831 12563 ----
NM_015393chr483191 2622 2584 2486 1464 1333 501 56 ------
NM_015412chr362849 2476 2179 2157 587 425 1953 ----
NM_015416chr122927 353 ------
NM_015429chr34432 284 168 140 1733 --11095
NM_015431chr163597 3469 1388 1289 744 512 ------
NM_015436chr472871 2255 1190 942 862 660 73 13267 1179 --
NM_015446chr131399 1332 614 21354 63 11377 1234
NM_015457chr112326 213 ------
NM_015458chr8115217 4212 3855 3799 3646 3568 3443 901 888 837 299 25184 575 13474 --
NM_015460chr331950 1310 426 ----1452
NM_015484chr14907 813 686 83 ------
NM_015503chr161733 ------
NM_015508chr341525 1380 993 288 11351 11361 --
NM_015525chr62848 433 ----1230
NM_015548chr65948 173 154 129 41 ------
NM_015550chr743597 3471 2992 1352 11290 ----
NM_015554chr1562439 2325 2125 2068 1791 783 --1878 --
NM_015564chr563589 3285 2863 2254 2231 1121 23269 585 ----
NM_015565chr2162140 2048 1580 721 532 445 21993 610 1710 --
NM_015569chr164663 4583 4472 1599 964 898 11556 ----
NM_015576chr372971 2935 2130 1884 808 414 179 1506 ----
NM_015577chr541741 1717 1604 323 --134 1586
NM_015578chr1951340 542 500 329 109 ------
NM_015601chr10------1707
NM_015609chr122421 355 --13005 --
NM_015626chr1721167 785 ------
NM_015630chr21784 ------
NM_015640chr175146 4383 3422 2113 1426 810 143 43399 1589 666 492 --11313
NM_015676chr141148 ------
NM_015677chr23633 497 199 ------
NM_015678chr1321412 449 ------
NM_015693chr41240 ------
NM_015714chr13345 332 247 1339 ----
NM_015844chr181845 1798 ----
NM_015846chr181845 1798 ----
NM_015847chr181845 1798 ----
NM_015888chr132360 1044 995 23357 3205 1542 1985
NM_015902chr82672 275 ------
NM_015906chr1104519 4123 3439 3222 3005 1835 1729 1135 974 649 33299 3188 411 11182 23422 187
NM_015912chr821765 383 ------
NM_015975chrX21598 333 ------
NM_015986chr1751465 1392 1156 514 314 --1592 --
NM_015990chr441065 980 908 99 146 1403 --
NM_016009chr153776 3631 992 817 372 24893 931 ----
NM_016021chr682714 2588 1948 1080 650 595 381 215 12207 ----
NM_016025chr1632032 1363 457 1217 --11848
NM_016038chr71590 ------
NM_016041chr17166 ------
NM_016072chr1252419 2101 1964 810 673 --1927 --
NM_016079chr252228 1549 591 551 222 ------
NM_016083chr673907 3662 2885 2522 923 737 126 13793 1142 --
NM_016087chr731360 1266 167 ----11605
NM_016096chr841888 1402 695 535 --11361 12182
NM_016101chr1641392 1081 306 124 31046 358 95 1169 --
NM_016107chr521278 994 2300 94 --1320
NM_016120chrX2444 262 ----1277
NM_016125chr171506 ------
NM_016131chr242029 1981 1837 172 1854 11537 1287
NM_016132chr15103451 3390 3238 2675 2572 2241 1122 584 578 324 42372 1092 934 318 ----
NM_016151chr16148 ------
NM_016206chr3138739 8163 7960 7891 7071 6470 6266 6005 5937 2281 1420 975 542 56524 5971 3283 3068 267 26863 324 --
NM_016217chr652585 2513 796 51 43 --33523 3200 3151 13541
NM_016230chr62187 38 1443 1375 1474
NM_016248chr1373966 3615 3108 2517 2511 904 152 --13532 --
NM_016255chr673160 3060 2767 2307 1267 357 170 --12707 --
NM_016257chr173135 3121 3114 3020 1031 826 787 ------
NM_016260chr2137300 5707 5134 4993 4868 2937 2360 951 944 674 223 138 120 --11458 --
NM_016264chr19137 ------
NM_016271chr1892329 2129 2076 945 631 423 346 302 267 --1795 --
NM_016281chr122974 832 ------
NM_016287chr181897 1791 1722 1474 488 332 257 46 ------
NM_016289chr231430 464 73 11691 12316 --
NM_016297chr243510 3320 251 106 33157 2799 1485 ----
NM_016306chr32123 53 ------
NM_016315chr251541 1470 1325 610 61 31681 707 346 ----
NM_016322chr983165 2991 2444 1117 625 605 574 248 1187 12697 --
NM_016338chr541116 979 393 301 ------
NM_016396chr1572975 2539 2479 1931 582 167 122 12265 ----
NM_016441chr252226 2203 1995 1858 1510 42108 1978 1880 650 1966 --
NM_016447chr71199 ------
NM_016472chr1441251 1081 454 110 21280 470 ----
NM_016476chr171154 ------
NM_016486chr11336 ------
NM_016488chr1241309 766 549 260 21932 195 ----
NM_016507chr1753132 2496 2291 2246 297 22136 1192 ----
NM_016522chr111600 1651 ----
NM_016530chr1563792 3754 3347 2745 795 255 12609 1559 --
NM_016531chr443676 3446 772 320 13020 --21083 543
NM_016542chrX41692 689 575 162 21300 387 ----
NM_016562chrX31228 1048 201 ------
NM_016584chr123296 220 189 ------
NM_016587chr72365 223 ------
NM_016588chr63905 682 299 1306 ----
NM_016607chrX41518 1349 474 217 11720 ----
NM_016612chr81448 ------
NM_016613chr472469 2322 2020 2010 1001 310 281 1878 --12164
NM_016628chr102632 607 ------
NM_016653chr231227 809 441 ------
NM_016654chr1521402 974 ----11414
NM_016819chr32525 513 ------
NM_016824chr105657 638 393 250 23 ------
NM_016952chr1164092 3960 3293 2684 732 618 ------
NM_016953chr275950 5606 5506 5496 4910 1230 514 45672 1870 1860 1236 13706 --
NM_016954chrX1571 ----1152
NM_017412chr821215 1052 --11260 --
NM_017420chr1443827 2620 1369 1143 23488 1452 ----
NM_017423chr442164 476 287 173 31655 420 93 1614 11840
NM_017426chr41561 ------
NM_017437chr1421492 57 1630 11708 --
NM_017440chr122518 22 ------
NM_017450chr1711161 ------
NM_017519chr6178 ------
NM_017544chrX3935 294 129 ----1884
NM_017549chr741408 1336 1324 1218 21047 426 ----
NM_017553chr151164 ------
NM_017563chr325121 1778 ------
NM_017567chr21123 ------
NM_017599chr1252016 1633 1491 1478 298 ------
NM_017628chr4104419 4101 4028 3694 3665 3389 2029 1719 1067 379 34678 1031 63 13250 11152
NM_017629chr141385 665 569 553 11304 ----
NM_017633chr663326 2986 2632 1000 888 213 11411 197 --
NM_017634chr831567 1440 1296 --152 --
NM_017635chr1161326 1238 1203 1062 492 184 --1115 --
NM_017637chr9179477 7428 6665 6294 6139 6046 5953 5724 3570 3361 3055 2257 2114 1587 1326 1124 870 37776 6758 1895 15945 --
NM_017640chr61321 ------
NM_017644chr395194 4805 4410 4240 4105 3385 371 365 346 13478 34084 1374 334 --
NM_017645chr972913 2601 2382 2344 1217 1133 316 12529 22622 950 --
NM_017650chr7115039 5000 4912 4524 4516 2342 2065 1748 1631 725 303 23893 1819 ----
NM_017651chr651370 1091 1041 386 353 ------
NM_017658chr1484653 4225 3781 3501 1488 1426 1404 622 14239 --11050
NM_017661chr1531093 1052 373 1154 ----
NM_017668chr16129 ------
NM_017709chr144090 3261 2756 1318 --14335 24257 836
NM_017714chr202669 85 ------
NM_017719chr331589 727 118 12461 12023 --
NM_017724chr34740 729 241 106 ------
NM_017736chr1652376 2275 1980 1152 939 22878 2534 ----
NM_017742chr1821871 1817 11713 ----
NM_017754chr664588 4504 4226 3196 1701 858 24597 4490 24978 4888 --
NM_017768chr12800 286 138 127 --
NM_017769chr1432925 2184 2060 22266 994 --12300
NM_017786chr83713 615 270 --1625 --
NM_017799chr1451933 1704 619 358 199 --21716 1429 --
NM_017813chr875682 5605 5193 4909 1824 237 144 24283 1021 11537 --
NM_017822chr121505 ----1816
NM_017831chr1844689 4618 3341 969 54804 4432 1354 1337 82 24386 1162 --
NM_017848chrX53891 3814 2862 983 275 34520 4114 392 ----
NM_017919chr9115854 5804 5797 5464 5192 4916 3637 1506 1101 830 439 14214 --1669
NM_017925chr921779 1484 21498 1424 --1201
NM_017938chrX71916 1800 1789 1551 765 160 152 ------
NM_017987chr1052006 1877 1793 266 122 1416 --11486
NM_017994chr782797 2323 2047 1902 1122 795 782 661 1813 ----
NM_018004chr31379 ------
NM_018027chr1043062 2897 2728 1296 23301 2155 --13311
NM_018030chr183989 218 88 ------
NM_018046chr561650 1627 1312 345 256 59 21724 240 1262 --
NM_018078chr411076 ------
NM_018084chr233183 535 384 23093 976 ----
NM_018092chr1631288 642 635 21502 1189 --11053
NM_018121chr1072747 2637 2538 2389 644 348 78 12788 12421 1239
NM_018126chr441534 1381 1345 43 ------
NM_018155chr352505 1391 813 802 765 ------
NM_018199chr1451130 850 499 380 363 192 --21088 324
NM_018214chr63515 319 89 ------
NM_018227chr442501 2321 1170 190 ----12170
NM_018243chr453884 3602 3362 1338 474 33284 2869 137 13806 11023
NM_018247chr673168 3093 2711 1968 1233 599 543 32658 2437 562 ----
NM_018265chr131989 225 130 ------
NM_018287chr1021103 226 ------
NM_018299chr883360 3142 2981 2786 2486 1210 1087 204 12467 ----
NM_018315chr431036 1026 530 ------
NM_018318chr122910 211 ------
NM_018326chr72806 66 --1547 --
NM_018332chr16----11370 --
NM_018339chr951566 1349 563 142 55 ------
NM_018351chr1254420 4102 3815 3043 442 21240 195 13522 --
NM_018361chr873883 3694 3381 1232 573 452 374 190 23054 401 13483
NM_018362chr1174051 3617 2885 2862 1526 265 109 14026 2743 127 13883
NM_018364chr1103860 3600 3433 3232 3033 2997 1384 350 340 190 11230 1919 13141
NM_018370chr1242167 456 385 297 ------
NM_018373chr1496481 6325 6088 5009 4985 4648 2072 1909 934 45927 4250 1990 707 16112 --
NM_018374chr7125121 4815 4764 4388 4015 2098 2045 1457 1223 712 563 557 34843 1008 999 24191 3635 --
NM_018375chr1441674 1303 413 91 21936 1519 11247 21493 747
NM_018387chr9175 ------
NM_018403chr354057 3806 3225 978 821 12816 ----
NM_018409chr472772 2577 2412 2230 1267 369 291 22454 587 1657 12600
NM_018416chr1272669 2612 1951 929 571 242 225 ------
NM_018424chr951868 1452 1250 570 273 --2646 173 --
NM_018429chr582657 2350 2142 2102 1881 1030 908 100 1863 ----
NM_018439chr1832449 429 206 22505 1694 1372 --
NM_018440chr888619 7335 6992 5799 3426 3003 2000 677 38378 3168 2899 27755 5442 28686 2337
NM_018444chr872086 1963 1928 906 805 682 239 ------
NM_018462chr34706 677 626 112 ----1258
NM_018469chr1721251 533 ------
NM_018482chr842381 1694 1021 523 --12518 --
NM_018557chr241740 1436 1223 110 ------
NM_018566chr1105073 4635 4111 3758 1707 1151 1092 949 851 703 34249 2012 1503 34380 4343 3734 --
NM_018569chr461323 495 261 133 127 26 ------
NM_018590chr1061748 1541 1528 1215 672 664 11723 ----
NM_018638chr1295084 4898 4863 3958 3768 1473 911 445 296 35185 5031 863 ----
NM_018640chr1272195 2152 2142 1802 1766 585 49 22551 199 ----
NM_018650chr181767 1753 1416 805 562 553 538 497 --11903 --
NM_018657chr31717 ----1724
NM_018686chr121294 ------
NM_018695chr542296 1930 629 400 21765 1597 1722 --
NM_018710chr84908 490 294 82 --1542 --
NM_018841chr153565 2439 982 210 83 11408 --33791 2884 489
NM_018847chr961737 1568 1536 1385 416 91 31838 1792 146 ----
NM_018931chr52316 87 ------
NM_018970chr743180 2893 937 851 22752 2133 ----
NM_018976chr1232659 2186 184 2525 290 22257 832 --
NM_018979chr1242620 2235 779 259 21726 226 ----
NM_018992chr1611641 ------
NM_018999chr1054314 3409 3052 1117 1093 --33299 1367 195 --
NM_019000chr571700 1377 1317 1027 631 430 248 1496 ----
NM_019001chr393722 3653 3409 1567 1543 1482 509 492 141 14627 ----
NM_019004chr722425 1863 ------
NM_019010chr173261 149 59 ------
NM_019045chrX1674 1948 ----
NM_019050chr441677 1558 850 354 1507 12178 --
NM_019080chr1361502 1423 1363 554 525 511 ------
NM_019083chr141449 1084 582 346 --11167 --
NM_019084chr1031724 636 379 ----22134 2064
NM_019114chr932154 983 628 1823 --1995
NM_019116chr1633761 3754 1104 ------
NM_019117chrX43269 2494 2135 752 22899 203 22570 406 --
NM_019556chrX3543 420 67 1963 ----
NM_019590chr1021518 470 1490 31459 1181 1164 11390
NM_019592chr92105 45 ------
NM_019595chr23712 538 216 ------
NM_019605chr11690 ------
NM_019903chr105657 638 393 250 23 ------
NM_020061chrX192 ------
NM_020116chr431670 1401 1162 11335 ----
NM_020132chr2134533 3809 2068 25167 4695 --1108
NM_020144chr732121 2005 618 41936 1355 427 203 ----
NM_020151chr271548 702 529 512 211 165 57 21833 554 --1176
NM_020159chr471681 1276 1248 1196 451 428 397 11148 ----
NM_020177chr583335 3273 2832 2506 2349 1235 523 258 12677 ----
NM_020193chr1111266 ------
NM_020204chr14314 75 64 49 ------
NM_020205chr132290 2207 997 33501 2824 1186 ----
NM_020226chr42747 714 1732 ----
NM_020228chr1182281 2016 1818 980 900 457 391 95 1175 ----
NM_020240chr552501 1768 597 168 37 --22007 1838 1821
NM_020245chr6125064 5040 4925 4674 4080 3725 3554 3165 2032 1950 1894 187 43261 1305 1255 797 --13577
NM_020297chr1263027 1216 599 578 564 388 --22828 550 --
NM_020336chr20103888 3667 2955 2653 1491 1470 1239 1077 901 701 --1507 --
NM_020337chr453122 2962 2366 1929 776 ------
NM_020338chr1023600 2849 ------
NM_020341chr2051571 670 653 565 236 ------
NM_020347chr392026 1922 1661 632 437 417 297 102 85 ------
NM_020381chr671910 1529 1455 531 456 301 122 --1208 --
NM_020390chr354378 1580 1383 887 71 44883 1265 502 176 14444 --
NM_020420chrY81540 705 698 625 537 344 234 217 ------
NM_020455chr672320 1970 1773 802 698 323 98 --12535 --
NM_020457chr162586 509 ------
NM_020548chr22191 35 ------
NM_020638chr1231904 1884 328 12101 ----
NM_020647chr831637 832 768 ----11944
NM_020651chr251706 1630 1455 424 417 ------
NM_020654chr331568 1115 156 21368 1032 1602 1397
NM_020661chr1251729 1718 1652 1528 384 11818 ----
NM_020673chr2074781 3072 2549 2331 2064 1718 1315 56381 5545 2809 2627 2350 1643 --
NM_020699chr165409 4444 4173 4000 353 42 ------
NM_020715chr1432092 1588 647 22273 2040 ----
NM_020717chrX94546 4511 4372 4284 4237 3680 3333 1997 839 14666 11714 --
NM_020718chr16116623 6480 5684 5589 4913 2063 1435 1167 422 189 26 --1950 --
NM_020727chr2163978 3867 2727 2448 1566 1261 ------
NM_020728chr772540 2426 1206 1017 694 305 171 42983 2391 865 540 --1439
NM_020732chr6178 ------
NM_020734chr1263046 2643 2245 2077 546 405 ----1484
NM_020739chr15124211 4057 3722 2988 2831 1672 1438 1149 543 418 198 129 23524 1411 ----
NM_020755chr631621 254 44 11577 1143 --
NM_020760chr211992 ----11417
NM_020766chrX94543 4496 3863 3467 3333 1757 1474 899 145 14489 ----
NM_020772chr17128615 7527 7427 6898 6402 6185 6091 5579 5466 2265 1821 1185 27845 5563 27006 1273 25267 2893
NM_020774chr18136024 5878 5477 5011 4719 4588 4361 2389 2101 1308 1291 1054 865 14776 35417 4455 2323 --
NM_020794chr131311 998 209 --11598 --
NM_020800chr331091 929 30 ------
NM_020803chr452020 975 902 172 109 ----11485
NM_020808chr14913 903 856 45 ------
NM_020809chr1162132 2092 1434 192 114 66 ----21455 223
NM_020819chr62300 210 ------
NM_020841chr1293655 3363 2810 2707 1110 904 796 436 156 2194 83 22990 2862 13554
NM_020850chr1652970 2409 2141 491 338 --1412 13279
NM_020853chr1262760 2725 891 530 518 440 --11804 --
NM_020856chr1941342 1227 1030 102 ------
NM_020858chr1522229 33 ------
NM_020859chr493633 3487 2559 1437 1070 805 659 529 226 1836 --23726 3363
NM_020870chr412189 1385 ----
NM_020873chr35715 706 255 247 235 --1229 --
NM_020898chr121235 ------
NM_020918chr1073454 3280 2354 1340 1269 523 482 1288 ----
NM_020921chr1473699 3455 3132 2275 1142 328 126 1531 --22539 520
NM_020935chr274560 4374 4314 1461 1220 851 815 14674 2525 455 13845
NM_020937chr14--2240 157 --1221
NM_020940chr1021898 198 ----1466
NM_020948chr153126 2825 2724 880 628 1499 13574 12748
NM_020952chr93769 669 639 ------
NM_020975chr1051827 1812 1553 1321 475 21972 1712 11883 --
NM_020980chr151668 ------
NM_020981chr21240 ------
NM_020987chr1041169 906 418 293 ------
NM_021032chr32588 295 21562 740 22022 347 --
NM_021033chr1343077 1313 146 124 --23329 3163 --
NM_021035chr202493 88 ------
NM_021038chr343339 3333 2500 2170 --13197 --
NM_021069chr452131 1631 1593 851 88 ------
NM_021083chrX63331 3098 3020 2477 2296 1391 13481 12796 --
NM_021097chr2123055 2856 2582 2555 2504 2398 2253 2021 756 569 493 88 ------
NM_021101chr392442 1988 1695 997 920 723 635 584 184 1626 ----
NM_021116chr7139086 7886 7657 7466 7372 6895 6729 5982 5904 5849 3442 2797 2355 --28582 8488 --
NM_021148chr772188 1826 1714 1695 343 103 39 1214 ----
NM_021159chr421668 475 2650 194 --1392
NM_021183chrX82429 2403 2331 2324 2137 1947 1838 275 2352 243 22528 2285 --
NM_021190chr12453 142 --1472 11191
NM_021204chr43900 719 200 1316 ----
NM_021252chr101266 ------
NM_021255chr1453986 3223 2982 2855 93 22803 31 ----
NM_021619chr941316 1237 1202 447 ------
NM_021622chr1082149 2130 1866 1651 871 755 558 416 ----1347
NM_021637chrX21125 93 --11313 --
NM_021645chr1372208 2016 1945 1880 1691 1499 714 ------
NM_021813chr685678 5609 5603 3576 2137 1593 652 530 33887 3677 2074 ----
NM_021814chr62666 245 --31219 449 274 11538
NM_021818chr1461191 1166 1003 475 306 143 ----11527
NM_021821chr121294 134 ----
NM_021911chr565562 5347 3714 3703 1936 334 --1810 12182
NM_021912chr1583970 3630 3403 3087 2950 1645 974 414 14226 ----
NM_021940chr63612 483 332 ------
NM_021943chr632092 446 57 ------
NM_021960chr162197 2173 1810 940 601 589 12754 ----
NM_021961chr11167526 7193 6436 6382 5931 5682 5432 2956 2838 2534 2106 2049 1791 742 664 506 2933 79 ----
NM_021964chr3156220 6137 6125 5899 5805 5633 4719 4701 4613 4311 2412 1544 1323 1172 200 11858 26486 5441 --
NM_021967chr511018 ------
NM_021970chr43201 89 30 ------
NM_021998chrX31477 1364 592 ------
NM_021999chr132305 285 ------
NM_022041chr1642279 1806 1020 628 ------
NM_022048chr1555686 5680 5672 4688 4453 15553 25274 1415 --
NM_022049chr121471 1223 11807 --11543
NM_022058chr252095 823 518 353 88 1148 ----
NM_022079chr10------1707
NM_022091chr621815 930 11744 ----
NM_022130chr571457 1312 1233 1185 1023 914 572 ------
NM_022133chr871610 1596 1350 721 528 284 199 31602 684 249 ----
NM_022143chr721465 1128 ----1480
NM_022145chr53631 499 178 2663 580 140 --
NM_022166chr1675804 5520 5416 4515 1587 1486 272 15756 15003 11642
NM_022351chr853417 3187 677 145 53 73876 3586 3550 2918 2876 2698 160 ----
NM_022444chr761956 1917 1884 1711 1629 361 21723 1689 11594 --
NM_022456chr12167714 7499 6735 6445 5759 4948 4860 4842 4836 4816 2330 1181 689 618 455 177 ------
NM_022459chr13106126 5119 4845 4433 2409 2117 1207 1030 360 77 32468 2049 1581 ----
NM_022461chr361308 1298 1165 1024 956 40 ------
NM_022465chr1222980 223 1257 ----
NM_022484chr741150 1132 337 50 --1571 --
NM_022648chr294560 3266 2849 2832 1266 1103 663 657 628 1464 ----
NM_022733chr11908 ------
NM_022739chr172915 795 11092 ----
NM_022753chr162833 2770 2729 1839 681 672 ------
NM_022763chr382571 2547 2164 2064 1938 836 530 451 ----12855
NM_022783chr81287 ------
NM_022817chr241953 743 455 445 ------
NM_022828chr531465 415 318 ----11794
NM_022841chr1542464 2263 1840 465 12748 1817 --
NM_022843chr1341206 1041 544 330 ------
NM_022845chr1641825 1562 1412 451 21371 599 ----
NM_022900chr721063 899 ------
NM_022918chr1121712 1496 ------
NM_022977chrX72167 1865 1769 934 481 375 234 32694 1727 146 ----
NM_022978chr511018 ------
NM_023037chr1321080 1067 ------
NM_023074chr192393 53 --21328 888 1872
NM_023076chr1673003 2235 2085 1888 583 194 136 1516 ----
NM_023929chr862554 2067 2049 1942 1055 981 2456 243 ----
NM_023934chrX41627 1480 1462 389 ----1729
NM_024007chr522593 624 ----13036
NM_024017chr171135 ------
NM_024052chr172865 792 ------
NM_024059chr20123 ------
NM_024061chr71618 ------
NM_024345chr985475 4828 4471 4159 2429 2414 1073 535 25679 5445 1288 --
NM_024422chr1841532 1370 256 212 --21538 328 --
NM_024423chr1884150 3001 2724 1693 551 375 244 185 23468 810 ----
NM_024482chr1165 ------
NM_024524chr31127 ----23143 996
NM_024561chr1341356 336 327 137 11274 ----
NM_024594chr561670 1632 1394 1322 81 66 1596 ----
NM_024617chr92911 184 ------
NM_024639chr621135 978 12936 1741 1641
NM_024641chr672652 1911 970 889 847 821 597 42932 2916 2831 29 ----
NM_024646chr174014 3545 3038 1466 859 680 213 13632 13783 --
NM_024665chr344622 4215 1644 186 --22905 1557 --
NM_024674chr113254 ------
NM_024686chr12536 166 ------
NM_024725chr113716 184 96 ------
NM_024740chr11114106 3563 3550 3495 3323 2927 2879 1593 1154 643 476 ------
NM_024744chr282580 2154 1798 885 334 307 264 196 ------
NM_024770chr296658 5503 4525 1901 918 436 406 232 125 34978 4940 4452 ----
NM_024817chr1545940 5870 5766 881 14148 25057 1998 --
NM_024818chr341427 1378 1131 419 ------
NM_024835chr171102 1423 ----
NM_024915chr822775 934 ------
NM_024920chr431033 557 270 --1320 1466
NM_024939chr1621557 163 ----1108
NM_024941chr541202 1018 961 167 ------
NM_024945chr92978 117 21141 932 ----
NM_024947chr3179066 8034 6781 6741 6104 6071 3454 2368 2226 2066 2038 1727 728 519 420 310 95 19000 17913 18862
NM_024949chr434761 3817 1939 44800 1159 1130 1010 35044 3454 1337 11784
NM_024953chr1232726 2492 857 12742 --22153 748
NM_024971chr93769 669 639 ------
NM_024989chr2168004 7883 7635 7385 7182 6863 6827 6354 6123 5970 3250 2547 1836 1821 1439 549 1293 --17123
NM_024991chr1053019 2655 2243 1240 831 12563 ----
NM_024996chr32918 258 ------
NM_025054chr8124091 3509 2935 1609 1588 1579 1358 1113 1085 834 488 447 --14035 --
NM_025073chr174577 4469 2938 1043 971 691 649 54413 4326 4237 3474 751 ----
NM_025126chr122646 228 ----1674
NM_025138chr1311295 ------
NM_025146chr331786 206 36 1292 --12718
NM_025160chr164050 3237 3185 3007 1107 488 24239 2856 13927 --
NM_025180chr343413 3080 2841 258 ----1557
NM_025238chr151150 ----1455
NM_025244chr2184 ----1300
NM_030579chr1673311 3274 3038 2945 1341 1219 595 13442 ----
NM_030621chr1474262 3608 1686 1068 886 743 226 --1803 --
NM_030623chr251668 1604 1498 1473 663 11266 ----
NM_030625chr1052564 2107 947 717 445 ----11656
NM_030627chr593928 3832 3617 3408 1529 1372 1268 816 799 34081 3964 389 --11499
NM_030634chr13990 725 91 ------
NM_030647chr796139 5363 5022 4867 2528 1945 1831 1371 971 24163 327 1257 --
NM_030648chr4105379 5243 5226 3929 3897 3881 1822 721 674 63 --35147 3458 1581 --
NM_030650chr2113556 3368 3329 3288 2837 2653 2644 1392 1294 1253 1233 31369 822 424 --11700
NM_030660chr1411489 ----21079 423
NM_030674chr1285284 4936 4849 2033 1646 1382 1094 350 25707 4499 12189 --
NM_030751chr1071405 1384 1201 626 475 379 364 21707 1218 1370 --
NM_030751chr1071405 1384 1201 626 475 379 364 21707 1218 1370 --
NM_030755chr1463059 2778 2431 2147 1912 120 22943 2248 --12972
NM_030763chrX6933 859 800 751 177 146 179 ----
NM_030774chr1161404 1106 952 364 70 26 11137 ----
NM_030777chr2062505 2386 2348 2163 782 737 12194 1460 --
NM_030786chr11751 ----11351
NM_030791chr1421824 152 1445 11632 --
NM_030806chr153449 3433 1818 1285 778 48717 2470 567 208 15949 12020
NM_030809chr1242436 1734 688 50 12050 22370 2355 12200
NM_030812chr11161 ------
NM_030816chr153623 3491 2681 1412 1184 --1430 --
NM_030885chr351864 1550 743 662 324 11649 ----
NM_030918chr173373 2073 1522 828 480 380 102 1959 ----
NM_030920chr151938 1820 700 516 347 --1148 11856
NM_030939chr62850 165 ------
NM_030963chr61664 ------
NM_030965chr11592 1830 ----
NM_031216chr1862139 1835 867 513 327 253 ------
NM_031262chr92892 45 1833 1945 --
NM_031263chr92949 102 1890 11002 --
NM_031267chr7134 ------
NM_031291chr44610 596 484 228 ------
NM_031296chr4102312 2291 2212 2203 2129 744 591 162 128 122 1571 1723 --
NM_031305chr43539 398 388 1488 11767 --
NM_031314chr1451560 706 130 56 28 21303 290 --1652
NM_031362chr262815 2587 1828 1781 888 802 12577 11949 --
NM_031365chr262951 2723 1964 1917 1024 938 12713 12085 --
NM_031366chr262951 2723 1964 1917 1024 938 12713 12085 --
NM_031427chr14105917 5583 4943 4548 3774 1898 1156 592 157 31 23793 621 ----
NM_031442chrX63124 3032 2043 1286 971 424 12813 --12235
NM_031469chr684101 4086 3980 3688 2615 1274 213 107 ----11183
NM_031483chr2093181 2878 2728 1265 1217 997 252 147 39 21372 593 ----
NM_031844chr173628 3502 1332 1160 387 290 260 33954 1135 335 --1776
NM_031845chr263426 2352 1194 1150 411 273 43161 2492 1325 527 13710 --
NM_031847chr263426 2352 1194 1150 411 273 43161 2492 1325 527 13710 --
NM_031858chr1741207 1118 433 88 ------
NM_031862chr1741207 1118 433 88 ------
NM_031889chr451909 1389 777 517 276 --1447 21399 733
NM_031890chr2253024 2885 978 907 54 --1572 --
NM_031911chr442677 2656 2321 489 1137 --1323
NM_032012chr985028 4711 3977 3718 3708 1288 758 573 25262 3757 14926 1713
NM_032102chr1172546 2500 2393 1183 1107 945 698 2959 729 ----
NM_032116chr13105590 4942 4777 4715 4612 4244 3969 3918 3654 1175 25802 1705 --14842
NM_032145chr651746 1523 595 562 109 173 ----
NM_032160chr18114329 3963 2904 2835 2792 2757 1384 1018 752 466 436 --11126 12948
NM_032182chr1051688 1515 1490 601 534 --1280 --
NM_032199chr1053389 3139 3100 1003 755 1653 43799 3326 2759 1328 --
NM_032208chr263593 3443 2838 1243 904 323 12742 ----
NM_032221chr2041448 1399 502 46 11940 ----
NM_032228chr1173503 3380 2815 2304 2268 1170 966 33550 1360 90 ----
NM_032312chr21740 ------
NM_032320chr113651 533 522 ------
NM_032321chr283225 2828 2672 2644 2355 2105 2084 346 32986 2898 479 22910 2800 --
NM_032334chr8186 ------
NM_032352chr145503 367 335 309 187 1162 21230 35 11184
NM_032373chr1095226 4446 4221 2361 2065 1918 1907 1161 146 45928 5549 4581 3742 12102 --
NM_032408chr71854 1399 ----
NM_032410chr82900 90 ------
NM_032439chr1031534 455 75 ----1660
NM_032445chr1562310 1934 778 453 309 116 22014 726 --11736
NM_032446chr543850 3479 1227 255 33590 1054 1047 12455 --
NM_032449chr142457 2445 1003 810 --11929 --
NM_032457chr4103781 3770 2504 2390 1386 1240 1203 1105 655 489 23399 812 13909 --
NM_032466chr871635 1301 1281 1103 1045 658 386 ----1548
NM_032468chr861635 1301 1281 1103 658 386 ----1548
NM_032482chr1972686 2501 2478 969 276 243 209 ------
NM_032491chr1221277 88 --1462 --
NM_032499chr1561755 1684 711 386 299 229 ----11721
NM_032505chr392483 1825 1802 1778 1711 1020 535 210 53 11754 ----
NM_032521chr2053168 3151 2686 2344 1973 22143 139 --12912
NM_032547chr431264 1085 295 --21066 566 --
NM_032622chr43584 501 70 --176 --
NM_032623chr42283 99 ------
NM_032682chr363611 3471 3001 2274 729 466 13123 ----
NM_032689chr193514 122 59 ------
NM_032765chr52350 172 ------
NM_032778chr333017 2973 1271 2793 485 22145 1147 --
NM_032787chr32146 53 ------
NM_032804chr1041746 827 725 429 22043 1983 12377 --
NM_032838chr1971068 1044 847 507 342 125 62 ------
NM_032871chr111667 ------
NM_032873chr1153397 2995 859 482 430 11294 13322 --
NM_032883chr202784 599 ------
NM_032900chr1073847 3353 1209 1145 757 629 557 2721 118 11167 --
NM_032905chr1041278 1137 961 236 ------
NM_032968chrX113657 3596 3587 3578 3307 3187 842 596 385 300 85 12985 1251 14260
NM_032969chrX113657 3596 3587 3578 3307 3187 842 596 385 300 85 12985 1251 14260
NM_032973chrY123649 3592 3583 3574 3302 3182 1389 842 596 385 300 85 12980 1251 14252
NM_032982chr762360 2324 2071 913 666 374 ------
NM_033012chr132983 973 ----1741
NM_033020chr1104519 4123 3439 3222 3005 1835 1729 1135 974 649 33299 3188 411 11182 23422 187
NM_033030chr25565 550 512 276 42 ----1355
NM_033044chr141233 820 338 134 ------
NM_033056chr102694 617 ------
NM_033062chr171252 132 ----
NM_033089chr2031507 83 42 ------
NM_033103chr1921177 234 ------
NM_033107chr751656 1363 1334 579 528 21560 188 ----
NM_033132chr1372354 2183 2163 1680 1454 891 651 --22084 1537 --
NM_033136chr521805 1794 ------
NM_033137chr521805 1794 ------
NM_033138chr742315 1622 590 150 --11429 --
NM_033139chr742315 1622 590 150 --11429 --
NM_033140chr742315 1622 590 150 --11429 --
NM_033143chr494412 4207 3714 3345 3096 1728 1438 1230 802 23249 1547 11453 13624
NM_033157chr742315 1622 590 150 --11429 --
NM_033181chr673907 3662 2885 2522 923 737 126 13793 1142 --
NM_033211chr541911 1505 1282 797 1666 ----
NM_033224chr787686 7119 6287 5623 5578 1766 1759 1720 13054 26624 5684 13065
NM_033261chr105544 430 370 184 158 ------
NM_033281chr52693 22 1269 --2832 221
NM_033326chr1152371 2264 2020 933 267 167 11762 --
NM_033360chr12144618 4263 3699 3485 3127 1793 1575 1200 866 625 491 416 266 193 33897 3688 1799 11092 --
NM_033380chrX31088 1038 443 ------
NM_033381chrX31088 1038 443 ------
NM_033389chr17104804 3854 3690 3298 2942 1197 1152 1112 622 212 24675 272 11835 --
NM_033393chr452794 1060 906 758 642 --11960 --
NM_033394chr261549 1501 1129 1092 626 606 ------
NM_033425chr11103383 2790 2496 2453 2143 2132 1225 966 674 228 23454 1131 ----
NM_033429chr1552804 2575 2497 2491 434 22345 213 12440 11091
NM_033480chr652832 2233 920 312 161 ----1765
NM_033481chr652832 2233 920 312 161 ----1765
NM_033505chr2106140 6119 6013 4486 1514 1502 1016 970 675 592 14839 26619 2636 --
NM_033535chr431067 742 413 --1818 --
NM_033632chr431036 1026 530 ------
NM_033656chr21135772 4908 4788 3862 3660 3641 1484 1369 1219 1199 1118 1009 636 75251 4422 4354 3897 1691 361 300 --15659
NM_052832chr862343 1884 1169 922 350 29 --12379 --
NM_052885chr12124347 4172 4079 3442 1983 1963 1266 1152 1136 1104 473 331 23550 1699 ----
NM_052905chr231179 713 654 11768 --1291
NM_052907chr1254190 2983 700 455 392 43858 3667 1466 853 11667 --
NM_052911chr185920 234 199 169 91 ------
NM_052917chr293134 2852 2627 2337 2325 1023 387 328 160 13411 22975 2598 --
NM_052918chr1063341 3185 2405 1170 971 549 23736 3497 --160
NM_052926chrX1902 ------
NM_052927chr532243 862 837 11634 1331 --
NM_052937chr882571 2196 2140 1870 1780 988 976 415 22617 680 12084 --
NM_052958chr81660 1274 ----
NM_052962chr681773 1742 1644 534 429 160 148 81 1541 11457 --
NM_052965chr131057 300 76 11144 1446 21121 950
NM_053001chr81376 ------
NM_053023chr1163274 3009 2229 2221 852 455 1858 ----
NM_053025chr361719 1548 1447 703 302 114 --1579 --
NM_053026chr361719 1548 1447 703 302 114 --1579 --
NM_053027chr361719 1548 1447 703 302 114 --1579 --
NM_053028chr361719 1548 1447 703 302 114 --1579 --
NM_053031chr361719 1548 1447 703 302 114 --1579 --
NM_053032chr361719 1548 1447 703 302 114 --1579 --
NM_053064chr1432451 2361 995 11979 ----
NM_053281chrX294 52 ------
NM_057168chr731360 1266 167 ----11605
NM_057175chr452672 1917 250 145 62 11829 12571 --
NM_057749chr841177 518 338 315 11048 ----
NM_058241chr252363 2078 1787 572 178 22346 1681 22262 578 --
NM_058241chr252363 2078 1787 572 178 22346 1681 22262 578 --
NM_078481chr191551 ------
NM_080546chr952236 1411 603 435 195 1203 ----
NM_080552chr201599 ------
NM_080597chr183989 218 88 ------
NM_080617chr2031048 990 265 2881 835 ----
NM_080626chr121287 ------
NM_080645chr631823 1737 1721 12078 183 --
NM_080651chr8187 ------
NM_080672chr202569 413 ------
NM_080682chr1138 ------
NM_080832chrX91573 1554 1431 1412 1259 1168 464 309 190 ------
NM_080867chr14104744 3915 3898 3596 3479 3434 1979 1891 1625 724 14186 13306 11898
NM_080872chr873801 3318 3307 2569 1363 678 406 --21343 840 1742
NM_080874chr441912 1893 1351 172 11298 21747 1622 21853 752
NM_080921chr13219 212 199 11172 ----
NM_080927chr393230 2926 2852 2439 1359 941 532 309 63 23040 2641 ----
NM_100264chr102632 607 ------
NM_100486chr102632 607 ------
NM_130391chr962756 2376 2338 972 831 313 21257 1115 ----
NM_130392chr962756 2376 2338 972 831 313 21257 1115 ----
NM_130393chr962756 2376 2338 972 831 313 21257 1115 ----
NM_130434chr1511218 ----1893
NM_130435chr1022798 520 ------
NM_130439chr1041543 669 538 507 ------
NM_130439chr1041543 669 538 507 ------
NM_130466chr1211629 11903 ----
NM_130797chr711516 ------
NM_130808chr32396 330 ------
NM_130809chr542741 931 509 111 33041 629 359 ----
NM_133334chr4115715 5275 5170 4700 4181 3860 2489 2059 1054 891 549 25449 4224 12189 --
NM_133369chr51973 ------
NM_133493chr6104628 4493 4350 4093 3907 3577 3407 1460 1139 353 24658 3434 12908 --
NM_133496chr174169 3369 3317 2935 1179 1126 99 33533 1794 1518 ----
NM_133507chr12171 --1304 --
NM_133646chr2105322 4830 4783 4260 3686 3522 3399 1774 1321 62 11333 --24131 151
NM_134265chr1721167 785 ------
NM_138288chr1441990 737 681 520 1590 ----
NM_138292chr1153559 2382 1135 1065 688 22634 2468 1774 --
NM_138340chr181627 ------
NM_138391chr11285 ------
NM_138444chr1354726 4606 4316 1390 74 14163 --11379
NM_138459chr633517 2741 1369 23034 123 1875 23138 1350
NM_138468chr2156098 6026 5633 5455 5425 4183 4031 2001 1894 1752 1723 1315 975 951 334 25794 659 ----
NM_138473chr12105073 5027 4933 4330 4202 3945 3796 1453 532 416 24309 1258 ----
NM_138492chr541055 571 401 36 ------
NM_138615chr3165 ------
NM_138621chr293519 3292 3257 3225 2882 2651 1665 1315 91 1871 13192 12677
NM_138694chr663213 2722 2331 2282 2272 450 33016 841 333 ----
NM_138713chr16127399 6903 6712 5495 5292 5044 2403 1522 1008 336 272 74 22923 2425 27623 1185 --
NM_138714chr16127399 6903 6712 5495 5292 5044 2403 1522 1008 336 272 74 22923 2425 27623 1185 --
NM_138731chr14123963 3229 3191 2787 1699 1596 1365 841 834 704 249 193 54202 3253 3114 3070 3063 13218 11416
NM_138735chr23255 71 49 ----11433
NM_138959chr186265 5643 5637 5544 4591 4385 4265 1242 22588 26 15480 --
NM_138966chr182547 114 ------
NM_139136chr123702 695 51 ------
NM_139159chr1921279 168 ------
NM_139167chr82464 410 ------
NM_139182chr411752 ----2709 613
NM_139283chr1232239 1711 984 ------
NM_139319chr1251846 1826 490 455 255 --11489 --
NM_139323chr2022077 821 ------
NM_144567chr152708 2492 2240 1129 453 22225 2128 1565 12399
NM_144571chr476675 6150 4563 1853 1639 832 702 12345 --15062
NM_144578chr1485270 4754 4299 3407 2157 1441 582 543 65308 5008 3887 3784 1887 1838 ----
NM_144583chr22597 44 ------
NM_144599chr15105540 5352 5163 4110 3488 2128 2000 1735 1304 668 25508 682 ----
NM_144600chr1641615 1264 178 57 143 1167 11284
NM_144628chr2053062 2948 2233 2148 736 186 11958 --
NM_144658chrX1335 ------
NM_144660chr101170 ------
NM_144710chr2197 21091 51 11444 --
NM_144723chr53356 337 313 --1840 --
NM_144732chr19------11036
NM_144766chr12547 502 ------
NM_144770chr2181048 816 306 258 250 210 129 100 1794 ----
NM_144775chr1764632 4320 4268 3820 1932 1636 ----14925
NM_144777chr13163 ------
NM_144778chr1332099 1705 324 ------
NM_144949chr231948 947 153 1336 21645 1605 --
NM_144973chr1244628 2033 1495 70 25061 1543 --15025
NM_144978chr23109 94 39 ------
NM_145000chr52469 235 ----1591
NM_145010chr1071956 780 716 628 401 365 334 1808 ----
NM_145037chr33604 384 194 11108 --11126
NM_145055chr1863390 2400 501 465 248 77 13027 11417 --
NM_145112chr1411341 ------
NM_145113chr1411613 ------
NM_145165chr1452781 2716 2318 128 74 ------
NM_145207chr4105274 5259 5063 5036 5004 4386 1524 1499 1315 529 11678 ----
NM_145259chr286970 6845 5954 5909 5786 2446 2382 818 26880 1629 12427 11887
NM_145267chr6160 ------
NM_145284chrX62169 1972 1840 952 604 131 1797 ----
NM_145301chr171596 ------
NM_145307chr1084492 4237 4028 3055 3042 1636 1337 812 34073 3401 3106 ----
NM_145320chr743597 3471 2992 1352 11290 ----
NM_145321chr743597 3471 2992 1352 11290 ----
NM_145322chr743597 3471 2992 1352 11290 ----
NM_145330chr21134 ------
NM_145698chr1042025 1680 844 388 2599 285 ----
NM_145909chr651031 323 269 197 153 --147 --
NM_147156chr1021452 995 ------
NM_147166chr72705 570 ----1626
NM_147188chr1551436 1428 589 521 504 ------
NM_147233chr23864 309 282 ------
NM_148921chr1762448 2426 847 781 694 355 ------
NM_148955chr15146568 5929 4707 4175 2571 2561 2110 1874 1860 1832 1579 1516 1500 848 12038 ----
NM_152221chr2221237 1137 ------
NM_152222chr111667 ------
NM_152261chr1252400 1006 483 211 100 ------
NM_152265chr11359 ------
NM_152271chr821160 1002 ----11103
NM_152272chr841368 442 412 126 ------
NM_152275chr241974 108 96 60 22110 1990 --1774
NM_152278chrX2614 169 138 --2494 142
NM_152305chr332160 2048 1916 --21489 132 11775
NM_152347chr172124 78 ------
NM_152366chr1------1103
NM_152373chr1------3550 55 34
NM_152407chr532858 2748 815 5937 872 848 235 64 1731 --
NM_152409chr553580 3195 2635 2434 540 12360 ----
NM_152420chr92688 120 ------
NM_152424chrX74404 4389 3859 1821 1339 1118 560 13515 23773 2950 --
NM_152440chr1221087 789 ------
NM_152450chr1541560 642 478 266 ------
NM_152464chr171788 ------
NM_152487chr131232 1116 512 1965 ----
NM_152493chr1------11435
NM_152519chr252161 1691 1677 1472 220 11548 ----
NM_152520chr231151 803 221 ------
NM_152522chr23856 423 127 ------
NM_152551chr63801 304 221 13072 2147 117 --
NM_152556chr742172 1035 654 455 12577 ----
NM_152594chr1561892 838 688 538 463 352 ------
NM_152603chr194596 499 466 179 1117 ----
NM_152605chr1931410 1328 1267 31173 1131 1050 ----
NM_152608chr182472 2444 2181 2041 1988 1022 1006 453 22230 312 1143 --
NM_152622chr522441 880 42624 2549 833 150 12890 --
NM_152624chr596794 6319 6289 5691 5389 5062 4890 4853 2290 36959 1518 419 16234 --
NM_152641chr1252182 576 385 248 115 1238 ----
NM_152653chr33574 199 94 2715 110 ----
NM_152678chr342619 2460 2188 640 21097 611 12212 --
NM_152716chr1131576 1553 313 ------
NM_152723chr1141027 991 154 92 2277 172 ----
NM_152725chr10199 ----1139
NM_152745chr72966 845 11019 --2948 121
NM_152756chr563158 3099 3016 1386 1134 678 12958 --24344 3587
NM_152758chr862414 2287 1916 1131 887 601 ----12473
NM_152787chrX43165 3154 1295 332 31181 1171 784 --13810
NM_152826chr15146568 5929 4707 4175 2571 2561 2110 1874 1860 1832 1579 1516 1500 848 12038 ----
NM_152835chr172641 2588 2054 1148 1092 557 174 42869 2752 2226 2147 ----
NM_152836chr871610 1596 1350 721 528 284 199 31602 684 249 ----
NM_152837chr871610 1596 1350 721 528 284 199 31602 684 249 ----
NM_152838chr2032933 2438 753 23005 2408 11276 33560 2181 286
NM_152871chr103964 115 107 --11078 --
NM_152872chr1031284 435 427 --11398 --
NM_152902chr151934 1830 1421 246 74 --1626 --
NM_152903chr1332689 2192 1960 ------
NM_152924chr1555988 5769 2256 1806 1166 26766 2069 ----
NM_152989chr1231381 1161 684 ------
NM_152999chr774673 3253 1910 1268 1005 437 96 14783 21859 1282 11685
NM_153035chr122069 535 11144 --11973
NM_153042chr621577 430 ------
NM_153181chr182547 114 ------
NM_153182chr333017 2973 1271 2793 485 22145 1147 --
NM_153184chr321884 1572 11815 21520 378 1104
NM_153188chr555216 4936 4691 3780 1927 31755 1260 1058 ----
NM_153226chr1021120 494 --1949 --
NM_153235chr662259 2193 1820 564 375 62 22347 174 1474 --
NM_153252chrX1354 ------
NM_153262chr143099 2280 2117 2109 ------
NM_153331chr3------1496
NM_153332chr872503 2407 2278 1041 428 308 188 32843 892 370 1121 12247
NM_153357chr17144 ------
NM_153365chr452772 2410 845 311 116 32601 888 626 12359 --
NM_153374chr152335 197 ------
NM_153456chr13125957 4838 4714 3895 3885 2457 1728 1398 1296 1127 761 152 26253 3930 14462 14852
NM_153616chr1522229 33 ------
NM_153617chr1522229 33 ------
NM_153618chr1522229 33 ------
NM_153619chr1543467 2538 1271 910 ------
NM_153645chr2263262 2910 2340 2247 2194 703 1262 1777 --
NM_153706chr5122 ----1256
NM_153748chr123702 695 51 ------
NM_153810chr1074127 3766 3696 3140 1554 1200 241 44738 2029 979 642 ----
NM_153825chr451753 1536 1420 566 534 ------
NM_170606chr731637 665 35 ----1465
NM_170665chr12114507 4479 4418 4298 4124 3509 1819 1699 1032 866 326 11705 ----
NM_170719chr1311295 ------
NM_172020chr721577 441 ------
NM_172058chr871802 1530 1451 1442 1360 1229 479 21223 1167 ----
NM_172059chr871802 1530 1451 1442 1360 1229 479 21223 1167 ----
NM_172060chr871802 1530 1451 1442 1360 1229 479 21223 1167 ----
NM_172069chr252290 2134 1594 1585 32 11497 1272 --
NM_172070chr231835 847 547 ------
NM_172071chr1137463 7314 7013 7000 6443 5904 5507 5417 5077 1442 590 536 24 15166 16043 1439
NM_172097chr152616 287 ------
NM_172127chr442023 1705 816 782 --1194 --
NM_172128chr441979 1661 772 738 --1150 --
NM_172159chr351872 1702 704 650 209 2894 477 12329 --
NM_172160chr351872 1702 704 650 209 2894 477 12329 --
NM_172216chr1252900 2868 2657 2504 556 1786 ----
NM_172218chr84721 552 179 136 ------
NM_173082chr641101 588 546 475 ------
NM_173084chr352105 1820 317 94 34 --2928 546 --
NM_173177chr22468 248 ----1108
NM_173198chr912650 33020 2298 648 --12683
NM_173200chr912650 33020 2298 648 --12683
NM_173214chr16127399 6903 6712 5495 5292 5044 2403 1522 1008 336 272 74 22923 2425 27623 1185 --
NM_173354chr2132136 1943 588 ------
NM_173468chr4145695 5474 5185 4537 4479 4467 3955 1922 1804 1480 1371 1222 221 82 35234 1330 1086 ----
NM_173495chrX3823 675 341 --2802 795 32547 320 40
NM_173496chr1062941 2813 2654 1013 689 159 ------
NM_173510chr2292938 2815 2798 2607 2380 2327 2250 807 146 2540 28 --1228
NM_173515chr62645 417 ------
NM_173552chr352306 2178 960 774 529 21561 1002 ----
NM_173576chr103774 202 112 --1335 --
NM_173582chr11136312 5559 4660 4490 4334 4261 4243 2075 1800 1725 1188 943 235 25740 932 24358 311 1693
NM_173595chr1241822 1022 878 781 15319 1853 11708
NM_173602chr1253571 3518 3389 1039 300 ----11448
NM_173607chr1432055 1371 733 52082 1901 686 299 113 ----
NM_173633chr191242 ------
NM_173642chr1128785 7696 7596 7343 7109 5896 5757 2184 2025 1500 1433 1032 29118 7588 37887 2442 846 15627
NM_173644chr2041995 1719 1667 537 --21935 1326 --
NM_173665chr52776 476 ----1193
NM_173670chr531034 306 121 ------
NM_173814chr152589 480 ------
NM_173822chr251680 1450 607 173 105 1733 ----
NM_173829chr5116088 5814 5502 4113 4048 4016 3900 2287 2033 1964 866 34845 3917 1795 ----
NM_173851chr893286 3266 3016 2848 2675 1608 1517 609 129 33305 3082 1107 21599 583 --
NM_174911chr863619 3532 2778 1207 925 469 1773 --13945
NM_175077chr2011395 ------
NM_175623chr12167714 7499 6735 6445 5759 4948 4860 4842 4836 4816 2330 1181 689 618 455 177 ------
NM_175624chr12167809 7594 6830 6540 5854 5043 4955 4937 4931 4911 2425 1276 784 713 550 272 ------
NM_175625chr12167809 7594 6830 6540 5854 5043 4955 4937 4931 4911 2425 1276 784 713 550 272 ------
NM_175736chr1266705 6264 6002 1882 1358 545 16153 --36010 4886 586
NM_175767chr541894 1748 580 310 ------
NM_175839chr201106 ------
NM_175840chr201106 ------
NM_175841chr201106 ------
NM_175842chr201106 ------
NM_175863chr6178 ------
NM_175910chr1942321 2051 1576 820 ------
NM_175920chr52813 201 ------
NM_176787chr1861620 1576 1494 555 522 438 --11541 --
NM_176823chr163743 2626 2589 2503 566 74 1105 11309 1346
NM_177438chr1474262 3608 1686 1068 886 743 226 --1803 --
NM_177531chr86840 778 399 318 240 47 ------
NM_177538chr2128752 8733 8064 7807 6992 5791 5782 3338 3025 3009 2357 2125 18927 15754 13490
NM_177553chr111239 ----1801
NM_177947chrX41518 1349 474 217 11720 ----
NM_177948chrX41518 1349 474 217 11720 ----
NM_177968chr221591 505 ------
NM_177990chr2051571 670 653 565 236 ------
NM_177999chr9------13726
NM_178010chr1231381 1161 684 ------
NM_178011chr10102679 2592 2290 2167 2060 1993 1246 1013 571 548 ------
NM_178123chr221088 765 2873 51 --1810
NM_178151chrX87294 5569 5236 5085 3147 1531 1333 1285 16441 15635 --
NM_178152chrX87294 5569 5236 5085 3147 1531 1333 1285 16441 15635 --
NM_178153chrX87294 5569 5236 5085 3147 1531 1333 1285 16441 15635 --
NM_178161chr104283 135 126 120 1319 ----
NM_178313chr261984 1809 1409 1370 606 195 2392 231 11833 --
NM_178423chr731190 916 83 11103 11023 --
NM_178425chr731190 916 83 11103 11023 --
NM_178498chr11103954 3844 3768 3518 3462 3429 3072 2895 1421 145 ------
NM_178507chr112761 90 ------
NM_178578chr2052642 2634 2113 1784 788 2532 360 1153 --
NM_178584chr2197 21091 51 11444 --
NM_178585chr442825 1022 962 345 23009 2554 --1299
NM_178812chr851534 1437 1400 534 43 11526 --11496
NM_181310chr681906 1875 1777 667 562 293 281 214 1674 11590 --
NM_181351chr1132544 1162 598 --11926 12251
NM_181358chr174169 3628 2887 1621 1197 902 877 23922 854 --11142
NM_181442chr202916 277 ------
NM_181443chr2042266 1892 908 740 22705 2515 --1219
NM_181481chr18126751 6684 6451 6113 6106 5954 5366 4526 2097 1709 1050 406 ------
NM_181482chr18126751 6684 6451 6113 6106 5954 5366 4526 2097 1709 1050 406 ------
NM_181483chr18126751 6684 6451 6113 6106 5954 5366 4526 2097 1709 1050 406 ------
NM_181504chr553608 3382 2829 2566 218 11428 13708 1634
NM_181521chr16107273 7176 6095 5216 2100 1912 1821 1276 294 69 ----15858
NM_181523chr553608 3382 2829 2566 218 11428 13708 1634
NM_181524chr553608 3382 2829 2566 218 11428 13708 1634
NM_181659chr2063349 2918 2564 2460 2326 2087 12352 ----
NM_181659chr2063349 2918 2564 2460 2326 2087 12352 ----
NM_181705chr584824 4389 3628 1359 1266 919 581 377 24116 1395 ----
NM_181714chr621256 63 21827 1413 --1103
NM_181723chr872117 2003 1988 1482 791 785 435 --22282 1872 --
NM_181844chr1731717 531 329 ------
NM_181897chr352481 2442 2279 1756 749 22721 996 12581 --
NM_182485chr483076 3032 2835 2571 556 447 348 137 22655 783 23258 2487 --
NM_182503chr674426 4136 3947 646 635 596 195 ------
NM_182524chr44701 191 152 95 ------
NM_182526chr1422732 729 ------
NM_182641chr1741641 1484 782 441 1716 21602 502 1213
NM_182643chr872436 2363 2314 1762 1689 625 252 21875 657 ----
NM_182646chr483076 3032 2835 2571 556 447 348 137 22655 783 23258 2487 --
NM_182691chr731344 956 437 1397 ----
NM_182692chr731344 956 437 1397 ----
NM_182757chr6113402 2791 2693 2613 2576 2472 2214 1418 748 353 268 12384 ----
NM_182763chr162186 2162 1799 929 590 578 12743 ----
NM_182765chr1042215 1999 285 263 12103 ----
NM_182767chr1221882 1367 --188 --
NM_182796chr51205 ------
NM_182797chr2021726 455 ----11587
NM_182830chr1462251 2191 1602 612 594 188 --21882 721 1345
NM_182898chr766363 5088 4958 4714 2053 139 24071 2086 25598 306 --
NM_182899chr766363 5088 4958 4714 2053 139 24071 2086 25598 306 --
NM_182907chr65903 383 372 239 21 12414 ----
NM_182911chr2184 ----1300
NM_182943chr361158 1126 1016 981 506 345 1378 ----
NM_182948chr152734 2658 2577 2080 453 --22265 523 --
NM_182972chr172803 2753 990 419 347 244 223 1492 ----
NM_182976chr13751 319 257 ------
NM_183004chr1472819 2758 1117 741 511 213 57 23968 154 ----
NM_183075chr452758 2413 1133 726 520 33024 2806 1018 ----
NM_183237chr331147 236 228 1274 ----
NM_183244chr202569 413 ------
NM_183246chr202569 413 ------
NM_183353chrX2444 262 ----1277
NM_183376chr1582640 2542 2201 2112 1802 907 788 672 22629 2553 12103 --
NM_183380chr65948 173 154 129 41 ------
NM_183381chr32161 101 1696 ----
NM_183383chr32161 101 1696 ----
NM_183384chr32161 101 1696 ----
NM_183415chr1211629 11903 ----
NM_194247chr254532 4480 1039 276 54 23731 1134 ----
NM_194271chr122646 228 ----1674
NM_194286chr1265645 5280 4765 2096 1554 111 --25260 1215 --
NM_194291chr862921 1067 580 317 247 145 12467 --11946
NM_194314chr1105256 4704 4313 3725 3592 1778 1347 563 444 273 11708 14196 --
NM_194356chr1282196 1928 1513 958 903 519 149 64 --22357 2080 --
NM_194434chr1885141 4854 4512 2146 1517 641 513 358 --14799 14582
NM_194454chr731489 1410 1211 ----11440
NM_194455chr731489 1410 1211 ----11440
NM_194456chr731489 1410 1211 ----11440
NM_197941chr562963 2575 2196 897 477 340 --32872 2215 31 --
NM_197964chr7169 ------
NM_197968chr132225 67 ----1661
NM_197970chr25565 550 512 276 42 ----1355
NM_197977chr94955 919 764 215 ------
NM_198066chr1442853 663 487 384 22844 23 12758 --
NM_198128chr1892329 2129 2076 945 631 423 346 302 267 --1795 --
NM_198158chr31940 1127 --12829
NM_198159chr31940 1127 --12829
NM_198177chr31940 1127 --12829
NM_198178chr31940 1127 --12829
NM_198217chr132361 53 --1962 11065
NM_198218chr132361 53 --1962 11065
NM_198219chr132361 53 --1962 11065
NM_198225chr1041926 1582 471 148 --11644 21728 750
NM_198240chr1241161 523 485 320 21285 1141 11095 --
NM_198268chr174169 3628 2887 1621 1197 902 877 23922 854 --11142
NM_198269chr174169 3628 2887 1621 1197 902 877 23922 854 --11142
NM_198273chr533183 3136 1982 1329 ----
NM_198281chr483151 2739 2680 2498 1184 635 445 353 ------
NM_198317chr11146 ------
NM_198329chr341427 1378 1131 419 ------
NM_198395chr54949 865 811 386 11240 ----
NM_198399chr351808 1771 543 474 380 21792 352 ----
NM_198400chr1572560 1973 1960 1090 958 518 162 11818 --12688
NM_198401chr831419 530 332 ------
NM_198465chrX42530 1926 866 481 1858 ----
NM_198468chr6174233 4140 3953 3691 3438 3426 3246 3188 1690 1366 1255 1214 947 856 697 368 35 ----14492
NM_198485chr352593 1771 798 764 372 32645 552 256 --1718
NM_198503chr132222 621 587 1309 ----
NM_198507chr53473 166 30 ------
NM_198513chr841750 1549 1543 769 --11496 31945 1805 1251
NM_198581chr2107037 6225 5455 2827 2196 1807 1149 892 539 415 56333 5811 2044 2020 1442 ----
NM_198715chr1166016 5842 5619 5160 5128 4771 4721 4350 4247 4079 3956 2234 2097 1935 1012 607 36325 5457 5329 --14885
NM_198716chr11312 ------
NM_198717chr11312 ------
NM_198793chr393864 3767 3572 3143 2782 1611 1060 729 124 24055 3609 ----
NM_198794chr143577 474 373 1480 ----
NM_198859chr394346 4299 3941 3654 3633 1877 1871 374 319 ------
NM_198900chr1266705 6264 6002 1882 1358 545 16153 --36010 4886 586
NM_198904chr571735 1653 1607 754 620 495 33 21958 1891 12063 --
NM_198990chr732455 2306 2227 --1190 --
NM_199000chr732172 1896 664 1598 --1154
NM_199039chr441065 980 908 99 146 1403 --
NM_199280chr23130 33 27 ------
NM_199320chr432651 2487 1965 12034 12672 --
NM_199320chr432651 2487 1965 12034 12672 --
NM_199351chr12486 422 ------
NM_199355chr1641823 1645 1637 579 21669 1558 ----
NM_199421chr14104744 3915 3898 3596 3479 3434 1979 1891 1625 724 14186 13306 11898
NM_199436chr243110 3030 2792 789 21098 1018 1950 --
NM_199437chr1182281 2016 1818 980 900 457 391 95 1175 ----
NM_199438chr1182281 2016 1818 980 900 457 391 95 1175 ----
NM_199439chr1182281 2016 1818 980 900 457 391 95 1175 ----
NM_199462chr134842 4750 3266 --23916 3048 --
NM_201263chr121783 1305 ------
NM_201266chr242636 645 518 311 ------
NM_201279chr242636 645 518 311 ------
NM_201432chr1786599 5561 5205 3987 2548 1690 372 214 21958 828 --11590
NM_201433chr1786599 5561 5205 3987 2548 1690 372 214 21958 828 --11590
NM_201437chr851409 1317 1006 541 491 1362 ----
NM_201570chr1011840 --1601 --
NM_201571chr1011840 --1601 --
NM_201572chr1011840 --1601 --
NM_201590chr1011840 --1601 --
NM_201593chr1011840 --1601 --
NM_201596chr1011840 --1601 --
NM_201597chr1011840 --1601 --
NM_201624chr14930 910 257 116 ----1849
NM_201995chr112687 90 158 ----
NM_201998chr112752 155 1123 ----
NM_201999chr421123 417 ------
NM_203282chr1951721 1563 1208 524 187 11268 ----
NM_203298chr101161 ------
NM_203301chr1411623 ------
NM_203349chr1542151 1907 500 490 ------
NM_203364chr1141191 1012 352 77 11105 ----
NM_203403chr951243 1214 1064 212 47 11044 ----
NM_203406chr562728 2232 2167 2112 805 740 12697 ----
NM_203446chr2142707 2111 1089 280 32803 2360 2010 ----
NM_203451chr1362323 2003 1851 1575 1569 573 ------
NM_203458chr173804 2781 2563 2548 1063 907 127 13519 --12489
NM_203459chr172288 2156 622 391 314 248 129 22106 100 ----
NM_203463chr274920 4604 3987 3128 1693 1369 409 24095 121 ----
NM_205846chr541055 571 401 36 ------
NM_205860chr173120 2963 2624 2095 2063 1283 824 12105 --22899 381
NM_206594chr163638 3114 1312 1141 626 273 22295 1088 1790 --
NM_206595chr163638 3114 1312 1141 626 273 22295 1088 1790 --
NM_206839chr151495 ------
NM_206853chr673863 3333 2696 1475 1046 850 282 1153 12566 11032
NM_206854chr685124 4594 3957 2111 1543 1230 868 731 11414 13827 --
NM_206855chr6116089 5559 4922 3896 2508 2195 1833 1696 521 343 54 12379 14792 --
NM_206876chr243624 2221 739 516 33616 1444 1086 ----
NM_206909chr887629 6743 3050 2390 2183 2007 1662 1185 38123 5562 1699 15130 --
NM_206933chr182056 1981 1947 709 268 237 105 67 ------
NM_206937chr132779 405 ------
NM_206944chr93769 669 639 ------
NM_206945chr93769 669 639 ------
NM_206946chr93769 669 639 ------
NM_206947chr93769 669 639 ------
NM_207015chr342219 1997 128 89 --1782 --
NM_207170chr14907 813 686 83 ------
NM_207292chr343339 3333 2500 2170 --13197 --
NM_207293chr343339 3333 2500 2170 --13197 --
NM_207294chr343339 3333 2500 2170 --13197 --
NM_207295chr343339 3333 2500 2170 --13197 --
NM_207296chr343339 3333 2500 2170 --13197 --
NM_207297chr343364 3358 2525 2195 --13222 --
NM_207303chr1043916 698 640 462 24184 4028 1233 --
NM_207317chr51408 ------
NM_207325chr194764 748 514 416 32069 1487 1446 11859 --
NM_207337chr123998 981 912 ----140
NM_207361chr13116144 6035 5315 5240 4502 2301 1101 774 476 423 392 35183 962 405 ----
NM_207371chr103559 267 117 ------
NM_207372chr1082452 1874 1858 1846 630 563 545 268 1742 --1860
NM_207391chr193937 853 497 ------
NM_207481chr251430 1399 1049 421 88 21068 35 --1390
NM_207517chr1541906 1750 664 589 11703 --11820
NM_207645chr1121337 253 1235 11030 --
NM_207647chr952446 2310 2150 940 132 1896 ----
NM_212460chr741349 1302 1291 776 1612 ----
NM_212471chr1722049 788 2644 557 ----
NM_212472chr1722049 788 2644 557 ----
NM_213589chr285227 4741 4674 4230 3608 3421 988 371 33796 2106 853 14042 15586
NM_213594chr1221277 88 --1462 --