TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3165
miRNA Sequence: AGGUGGAUGCAAUGUGACCUCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000037chr862070 1702 682 674 575 453 32522 2021 1560 11836 --
NM_000038chr532068 474 438 --11846 --
NM_000084chrX21818 1471 14300 27013 4343 12591
NM_000109chrX31938 933 541 32620 1997 597 ----
NM_000112chr513852 1799 14254 25269 3367
NM_000115chr1351763 1063 862 835 286 --12327 --
NM_000163chr522307 1587 21702 898 11745 --
NM_000165chr62653 30 11672 1657 11478
NM_000168chr753295 3102 2107 1259 964 22159 1068 ----
NM_000208chr1953180 1537 1173 832 685 23805 97 11740 13236
NM_000214chr2021562 1213 21393 1161 ----
NM_000216chrX63140 2908 2852 852 372 340 23394 839 11025 --
NM_000217chr1265206 5177 4239 1865 279 195 33854 1963 1791 --24422 988
NM_000227chr181311 1273 132 --
NM_000232chr433002 2597 330 32629 2483 284 ----
NM_000259chr1522397 1368 --1764 11626
NM_000267chr1733422 3294 2754 --23046 2648 --
NM_000314chr1063274 3012 1180 917 756 161 ------
NM_000315chr111289 ----1132
NM_000330chrX72272 2249 2241 2144 1870 720 653 1455 ----
NM_000332chr636153 6130 5667 12215 --12625
NM_000337chr546186 4580 1069 275 --35752 5566 262 15407
NM_000362chr2242793 2411 924 225 12782 13416 --
NM_000408chr233358 923 541 12185 --12608
NM_000428chr1472251 2145 2126 1871 997 834 557 21905 250 2775 302 1376
NM_000448chr1142997 2514 2040 1099 1104 --12422
NM_000461chr343739 1431 756 381 1723 ----
NM_000489chrX23342 457 43273 3197 2570 2360 13317 --
NM_000503chr851836 1694 1525 1389 107 --1537 --
NM_000522chr751159 851 821 812 172 1221 ----
NM_000544chr6_cox_hap163115 2883 2658 2634 854 802 1988 ----
NM_000555chrX115497 4997 4990 3019 2589 2577 2408 2166 1622 714 193 25117 2200 46002 5599 2743 835 --
NM_000599chr274109 3881 3133 1378 1306 956 73 34075 3802 3220 13646 11391
NM_000609chr1082336 2279 1989 1222 1180 1148 675 506 21245 148 --1661
NM_000610chr1162612 2101 2040 925 696 446 --12814 --
NM_000612chr1163745 3619 3294 786 182 82 32849 709 73 ----
NM_000618chr12106462 5376 4326 4228 2109 2078 1258 1093 1027 589 44703 2131 2010 1693 11311 --
NM_000618chr12106462 5376 4326 4228 2109 2078 1258 1093 1027 589 44703 2131 2010 1693 11311 --
NM_000627chr21825 ----1781
NM_000635chr1921350 71 2389 81 ----
NM_000719chr12115508 5375 5268 4971 4141 2351 2266 2105 2002 1681 666 12149 35989 2605 2318 16254
NM_000767chr193611 554 304 --21262 461 --
NM_000780chr81846 1130 --1111
NM_000793chr1464532 3697 3294 748 737 72 14174 ----
NM_000806chr521678 456 ----11935
NM_000813chr523877 3417 25109 1988 11817 11278
NM_000814chr1563643 3536 3248 3056 1534 1371 13199 ----
NM_000827chr572642 2414 1837 572 500 394 201 ------
NM_000829chr112436 373 11747 1775 12126
NM_000833chr1631423 1160 174 1560 11213 --
NM_000838chr682683 2096 2066 1869 1844 1018 866 432 --31860 1117 637 1812
NM_000868chrX32370 1791 476 --11969 12598
NM_000875chr15136665 6412 5863 5772 4627 4603 2720 1856 1692 1329 710 513 84 --36580 4962 2623 --
NM_000901chr432353 556 102 11935 --12451
NM_000926chr11138822 8660 8341 8062 7643 7325 7119 3762 2981 2553 1431 959 275 77718 7697 7387 2502 2284 1401 987 38866 7293 2068 --
NM_000933chr2031589 710 204 1522 ----
NM_000950chrX41459 348 337 175 --23153 513 --
NM_000961chr2053297 2979 1097 285 22 11066 2258 211 --
NM_001001323chr1232591 165 49 22675 1979 1209 --
NM_001001331chr362307 1855 1838 611 223 150 --2460 73 --
NM_001001389chr1162612 2101 2040 925 696 446 --12814 --
NM_001001390chr1162612 2101 2040 925 696 446 --12814 --
NM_001001391chr1162612 2101 2040 925 696 446 --12814 --
NM_001001392chr1162658 2147 2086 971 742 492 --12860 --
NM_001001395chr1242803 2713 2118 1037 ----1579
NM_001001396chr154387 4042 529 420 46 ----1739
NM_001001419chr554925 4190 1965 1736 160 --14980 --
NM_001001420chr554925 4190 1965 1736 160 --14980 --
NM_001001433chr2032937 884 138 31996 1046 571 ----
NM_001001481chr833064 2947 618 ----12123
NM_001001484chr1071741 1718 1537 576 534 69 21 11494 ----
NM_001001668chr1963912 2961 2713 2632 1060 243 23991 2926 23771 32 --
NM_001001938chr913951 21141 983 23537 3429 --
NM_001001971chr1031314 1160 30 ------
NM_001002257chr233016 2924 669 ----1951
NM_001002258chr231586 1442 251 --11989 --
NM_001002814chr853764 3344 3325 845 48 2979 147 --13724
NM_001002843chr15--1349 --1170
NM_001002860chr1434338 1437 414 ----1408
NM_001003652chr1876987 6514 6458 5793 2781 1762 941 25814 2368 11610 --
NM_001003674chr18116906 6764 6724 6391 5811 2598 2518 2043 1823 652 195 34410 2428 1420 ----
NM_001003675chr18116906 6764 6724 6391 5811 2598 2518 2043 1823 652 195 34410 2428 1420 ----
NM_001003712chr1233435 2491 1073 ----12540
NM_001003940chr1583656 3640 2830 2599 2584 895 502 430 1411 --1304
NM_001003942chr1583656 3640 2830 2599 2584 895 502 430 1411 --1304
NM_001003943chr1583660 3644 2834 2603 2588 899 506 434 1415 --1308
NM_001004065chr963540 2962 743 613 552 261 --13182 --
NM_001004317chr653625 3493 2765 930 48 ------
NM_001004329chr1231028 373 317 11364 ----
NM_001004342chr1165974 5905 4764 3817 1681 1458 1340 1326 1105 919 895 798 686 240 175 43 25234 2263 25842 5343 11581
NM_001004419chr1254300 3665 1803 1622 1467 ------
NM_001005463chr1032389 1898 428 --1966 --
NM_001005473chr5126550 6365 5895 5850 5406 5198 5097 4973 4710 506 217 92 --15458 16471
NM_001005502chr1265257 5009 4629 1928 1721 1715 21885 401 11085 13930
NM_001005609chrX63618 3355 3216 3109 2648 971 12453 23038 1399 --
NM_001005753chr282231 2001 1871 1686 1630 1580 850 716 --22236 246 --
NM_001006623chr231982 899 240 --1234 --
NM_001006624chr171924 1661 1243 762 613 404 128 1176 ----
NM_001006945chr11161 ----1480
NM_001007023chr1464532 3697 3294 748 737 72 14174 ----
NM_001007097chr974185 4045 3281 1653 1620 1245 459 --23372 901 --
NM_001007156chr1521851 1272 --11855 1178
NM_001007257chr1--11034 1972 195
NM_001007471chr95880 646 628 546 285 ------
NM_001007553chr11377 --1298 132
NM_001008220chr563549 3539 1151 1000 555 29 --31371 876 186 --
NM_001008239chr1842816 1307 1013 41 ------
NM_001008392chr342465 2207 1332 677 11144 ----
NM_001008401chr1941481 475 391 307 --11406 --
NM_001008491chr242044 1992 1735 114 1755 ----
NM_001008492chr242044 1992 1735 114 1755 ----
NM_001008495chr832116 1401 598 11977 ----
NM_001008738chr531887 831 104 22411 1996 22043 558 --
NM_001008801chr19132161 1710 1656 839 755 671 645 587 555 406 378 318 234 132 11700 1742
NM_001009552chr82409 387 1403 ----
NM_001009554chr474290 3031 3008 1423 1366 1030 592 --24732 3295 14073
NM_001009554chr474290 3031 3008 1423 1366 1030 592 --24732 3295 14073
NM_001009960chr772839 2385 2218 571 395 314 144 ------
NM_001009993chr274430 4408 3988 3524 3467 1501 1469 --1332 --
NM_001010000chr1863535 3120 3088 2685 769 455 33492 646 173 ----
NM_001010861chr152666 1980 859 294 55 ------
NM_001010888chrX84590 4350 3099 1734 1587 1266 607 496 12841 31571 1404 653 --
NM_001010908chr10------1211
NM_001010922chr164065 4004 1593 1307 847 568 23334 2818 ----
NM_001010986chrX22438 2245 --12135 --
NM_001011513chr423716 2771 ----12890
NM_001011553chr73990 858 102 ------
NM_001011666chr7114451 4121 1445 1439 1086 1052 781 621 587 568 532 14207 --12629
NM_001011708chr232836 2094 357 1294 ----
NM_001012393chr1173541 1907 1457 837 559 490 60 53245 2080 1749 630 209 21164 875 --
NM_001012426chr6103112 2141 2104 1192 1181 1117 680 545 497 462 13185 23166 1196 12786
NM_001012427chr6103112 2141 2104 1192 1181 1117 680 545 497 462 13185 23166 1196 12786
NM_001012732chr431031 959 176 --11297 --
NM_001012755chrX74813 4602 3794 1267 1043 940 203 21076 486 11426 15026
NM_001012761chr531938 1763 341 11085 ----
NM_001013031chr1093501 3001 2976 2948 2569 1336 777 660 461 1671 ----
NM_001013620chr12157958 7869 6489 6345 5611 3182 3020 2908 2766 2728 1798 1790 1706 1149 884 27295 7243 13066 38002 1469 1369
NM_001013690chr1292495 2420 2374 916 657 517 489 377 251 11584 ----
NM_001013746chr742229 2051 1804 940 ------
NM_001014380chr1355307 5147 4095 3657 1055 14555 14745 --
NM_001014797chr10117451 7202 5781 2886 2823 2169 2159 1835 1802 1793 84 21753 103 48140 2854 2817 2408 --
NM_001015045chr431868 1693 334 12217 ----
NM_001015053chr172512 165 132 --1455
NM_001015877chrX42110 1142 354 46 ------
NM_001017395chr333013 2432 1222 ----22566 2287
NM_001017440chr7107329 6668 6519 6322 6184 5516 2185 516 492 386 --11687 15049
NM_001018050chr2253187 2748 2406 1308 227 1159 2613 200 --
NM_001018052chr2253187 2748 2406 1308 227 1159 2613 200 --
NM_001018054chr1--11249 --1442
NM_001018065chr985482 5118 4935 4832 4579 4459 3724 61 23828 2189 ----
NM_001018066chr985482 5118 4935 4832 4579 4459 3724 61 23828 2189 ----
NM_001018067chr174278 4050 1950 1450 1000 453 122 1876 ----
NM_001018068chr174278 4050 1950 1450 1000 453 122 1876 ----
NM_001018069chr174278 4050 1950 1450 1000 453 122 1876 ----
NM_001018108chr1531931 1610 1503 ----11885
NM_001024380chr842381 1620 686 377 --12255 --
NM_001024381chr842381 1620 686 377 --12255 --
NM_001024596chr1953094 2431 2415 1356 1136 --33138 2439 2435 --
NM_001024649chr572211 1887 1152 1112 861 755 451 12184 ----
NM_001024688chr832152 798 50 2669 308 11949 --
NM_001024808chr1282730 2177 2082 1981 1091 1012 386 26 12817 ----
NM_001025076chr1085835 5025 4726 4296 4194 4075 1445 703 15401 15670 --
NM_001025077chr1097193 6383 6084 5654 5552 5433 2803 2061 1014 26759 554 37028 1196 436 --
NM_001025079chr343099 928 707 90 21575 421 ----
NM_001025108chr254132 3071 1615 1605 1555 1957 ----
NM_001025233chr1251774 1758 617 543 395 --11068 --
NM_001025266chr3114779 4741 4030 3909 3750 1927 1488 1407 1240 634 96 23336 1777 23953 1817 14540
NM_001025356chr1272766 2359 2338 1185 667 598 505 1930 ----
NM_001025580chrX53791 3407 2706 1122 559 ------
NM_001025616chr451749 1674 715 347 147 ------
NM_001029858chr673004 2373 1288 1276 1152 490 422 12832 1189 --
NM_001029863chr662193 2000 932 805 747 37 ------
NM_001030007chr1641334 345 260 191 1970 ----
NM_001030055chr1444095 3102 152 104 14036 ----
NM_001031679chr1272380 2207 1291 1225 949 658 162 12856 ----
NM_001031685chr11201 ----1164
NM_001031690chr752883 2734 837 638 29 --1951 --
NM_001031732chr453543 3202 2629 2606 198 ----1189
NM_001031804chr1673871 3553 2997 2968 718 568 425 --12905 --
NM_001032380chr101134 --11693 21914 54
NM_001032394chr632543 2221 494 2883 33 ----
NM_001033025chr161556 1141 971 572 155 98 11170 ----
NM_001033047chr452437 2251 527 301 247 ------
NM_001033117chr374807 3999 1711 1335 816 793 527 11946 ----
NM_001033551chr1753935 3647 2547 1416 332 1600 24040 4036 --
NM_001033723chr852343 1710 799 752 661 22135 964 12260 --
NM_001034915chr8--3388 379 369 ----
NM_001035chr111119 1375 --1986
NM_001037317chr152666 1980 859 294 55 ------
NM_001037332chr552561 2005 621 303 292 1546 ----
NM_001037333chr552561 2005 621 303 292 1546 ----
NM_001039350chr751783 1519 1368 703 635 11569 --11595
NM_001039538chr263466 2700 849 751 723 647 23149 1073 --1322
NM_001039570chr2274235 4126 3790 3591 1074 753 414 ------
NM_001039571chr2274235 4126 3790 3591 1074 753 414 ------
NM_001039580chr463551 3243 1510 1230 912 651 13574 ----
NM_001039590chrX41444 450 312 132 33946 3129 27 ----
NM_001039591chrX41444 450 312 132 33946 3129 27 ----
NM_001039618chr1175962 4480 4295 1690 432 86 26 --1300 --
NM_001039840chrX55666 4748 4142 1669 1583 ------
NM_001039937chr1333619 1145 130 2508 147 13099 --
NM_001040142chr241891 875 579 434 ------
NM_001040143chr241891 875 579 434 ------
NM_001040152chr783648 1729 1395 1132 1050 669 591 263 33583 1483 1109 --14372
NM_001040181chr3--21080 853 --1145
NM_001040182chr3--21080 853 --1145
NM_001040183chr3--21080 853 --1145
NM_001040199chr3--21080 853 --1145
NM_001040200chr3--21080 853 --1145
NM_001040214chr662196 1995 1602 894 877 196 12069 ----
NM_001040272chr941950 146 140 27 11670 ----
NM_001040284chr1631783 1198 648 14676 ----
NM_001040402chr442198 1297 862 304 1627 12693 --
NM_001040429chr132723 162 11268 12551 11350
NM_001040441chr185400 5283 4361 2111 1533 758 316 162 24729 3403 --1360
NM_001040445chr275403 4627 4204 3480 1193 763 664 --15730 --
NM_001040661chr731045 267 260 21077 438 ----
NM_001040665chr764758 4588 3765 1873 1554 1302 14124 ----
NM_001040709chr152225 2069 1566 905 541 32158 780 602 --1578
NM_001040712chr983310 2699 1174 949 907 738 178 49 --23320 1147 --
NM_001042404chr141832 1788 1713 753 ------
NM_001042413chr961625 1107 932 875 472 356 --11072 --
NM_001042440chr51201 --11868 11428
NM_001042441chr51201 --11868 11428
NM_001042442chr51201 --11868 11428
NM_001042443chr51201 --11868 11428
NM_001042444chr51201 --11868 11428
NM_001042445chr51201 --11868 11428
NM_001042446chr51201 --11868 11428
NM_001042453chrX21510 221 1538 ----
NM_001042481chr1452545 2512 2377 1793 99 --22364 2323 11990
NM_001042492chr1733422 3294 2754 --23046 2648 --
NM_001042543chr431527 1442 484 11432 ----
NM_001042555chr1224654 3305 ----11606
NM_001042599chr2116902 6107 5824 5355 2533 2458 1757 1056 1018 859 86 25521 2310 56063 1946 1942 1938 1934 --
NM_001042601chr353002 2444 1327 515 413 ------
NM_001042603chr1275329 4650 1374 1286 1116 900 465 --23728 83 --
NM_001042604chr331746 761 41 13825 145 --
NM_001042669chr451749 1674 715 347 147 ------
NM_001042681chr152479 2285 2168 1672 152 2866 378 --12129
NM_001042682chr152479 2285 2168 1672 152 2866 378 --12129
NM_001042682chr152479 2285 2168 1672 152 2866 378 --12129
NM_001042683chr621856 1388 ----1435
NM_001042724chr191132 1147 1181 --
NM_001043318chr1463454 2853 2689 1442 744 101 23359 2540 23291 3277 --
NM_001043351chr141479 709 400 52 21591 128 11637 --
NM_001046chr541863 1129 433 361 --11907 --
NM_001083621chr174185 3177 1575 1105 565 273 77 11740 ----
NM_001100108chr157847 6655 6405 5123 2651 13123 --16670
NM_001106chr3129504 9225 9036 8642 8556 7289 6182 2116 1870 1360 1142 418 --12152 27748 6468
NM_001113490chrX22264 927 12600 13642 13389
NM_001116chr1653086 2792 2633 784 175 1588 --1548
NM_001121chr1021372 549 ----1260
NM_001128chr1641334 345 260 191 1970 ----
NM_001146chr831852 1782 233 ----11739
NM_001148chr471553 1405 490 471 461 284 208 --12035 --
NM_001149chr1031443 1329 402 --189 --
NM_001157chr104578 207 137 89 --1109 --
NM_001167chrX65002 4894 2238 1936 1444 199 35675 4840 2050 12095 --
NM_001173chr1444095 3102 152 104 14036 ----
NM_001174chrX42120 1931 1419 80 ------
NM_001186chr2192761 2572 2295 2165 1007 982 896 353 214 1730 ----
NM_001196chr226896 491 293 271 243 181 ------
NM_001198chr631980 1592 893 --12237 --
NM_001204chr267329 6935 6250 5100 3075 414 12445 ----
NM_001222chr1051459 1303 760 337 265 11699 ----
NM_001241chr232400 1932 1710 1688 ----
NM_001241chr232400 1932 1710 1688 ----
NM_001259chr776152 4988 4537 4389 2145 1510 1315 --11114 1565
NM_001286chr162792 2584 2249 781 742 710 1283 ----
NM_001304chr1773838 3634 3589 3350 1481 922 582 13153 ----
NM_001310chr1283106 2912 1893 1143 1025 740 605 199 1138 ----
NM_001315chr641965 1429 826 256 ------
NM_001331chr1131849 665 21 1155 11761 --
NM_001380chr1021014 842 1830 ----
NM_001386chr852002 1573 934 895 23 21770 909 1204 --
NM_001387chr562451 2143 2035 1209 1054 677 12180 12612 --
NM_001390chr1853302 3187 3020 2906 718 32812 2465 2335 12805 --
NM_001399chrX63618 3355 3216 3109 2648 971 12453 23038 1399 --
NM_001406chr1751618 1340 630 471 149 11603 ----
NM_001412chrX43223 3169 1419 27 ----11298
NM_001417chr1241221 460 395 40 ------
NM_001438chr153683 803 602 510 264 23192 199 ----
NM_001439chr161556 1141 971 572 155 98 11170 ----
NM_001453chr61222 ----1123
NM_001460chr133264 2847 54 22504 416 1614 --
NM_001461chr15556 195 135 104 46 ------
NM_001609chr1033866 3234 1724 --1202 13541
NM_001616chr263520 3206 2497 2189 678 660 11052 ----
NM_001621chr73701 565 124 ------
NM_001621chr73701 565 124 ------
NM_001626chr1952534 2480 1276 282 230 --23551 3213 --
NM_001642chr1151286 1261 935 905 418 ------
NM_001659chr1272449 2172 2116 1009 751 172 120 1723 ----
NM_001678chr1761808 1681 1464 1319 1228 570 --21166 300 --
NM_001683chr362307 1855 1838 611 223 150 --2460 73 --
NM_001689chr231586 1442 251 --11989 --
NM_001695chr843829 3301 1216 1177 ----13965
NM_001701chr921408 1340 31255 448 251 11261 --
NM_001709chr11--12127 --12728
NM_001746chr572211 1887 1152 1112 861 755 451 12184 ----
NM_001750chr51201 --11868 11428
NM_001759chr1264460 3506 3473 2033 1728 1422 13527 11719 --
NM_001777chr343099 928 707 90 21575 421 ----
NM_001788chr73990 858 102 ------
NM_001859chr973014 2879 2741 1474 1069 787 310 1274 --13359
NM_001874chr1265257 5009 4629 1928 1721 1715 21885 401 11085 13930
NM_001918chr1107727 7658 7152 6731 5606 2520 2256 1426 1332 991 16378 --12715
NM_001921chr431031 959 176 --11297 --
NM_001936chr751783 1519 1368 703 635 11569 --11595
NM_001938chr111208 1694 --11397
NM_001939chrX93583 2944 1399 1106 700 425 408 93 73 ------
NM_001945chr52543 91 2931 262 ----
NM_001951chr82551 213 --131 --
NM_001968chr43323 249 115 1209 ----
NM_001981chr132284 1573 341 1562 1219 --
NM_002006chr455573 5428 4279 4167 3918 21509 380 45359 1078 643 639 --
NM_002024chrX22103 462 ----21935 329
NM_002025chrX168487 7926 7808 6552 6216 6186 5881 5783 2822 2332 1509 1318 1090 902 81 43 37576 249 50 36521 3558 1362 18926
NM_002035chr1852443 1433 901 881 167 ------
NM_002092chr455020 4767 4608 4234 680 ----1463
NM_002126chr1764019 3287 2946 2802 634 400 1657 --11574
NM_002158chr242859 2397 2323 1172 ------
NM_002214chr755342 4023 3551 2127 929 --24822 1403 11310
NM_002227chr121176 933 2823 306 --11027
NM_002241chr162056 2037 1053 406 193 112 1508 --13052
NM_002247chr1021834 1633 1169 --11559
NM_002254chr25934 775 536 402 379 ----11676
NM_002264chr354690 3308 1365 1004 263 --43684 3554 1773 611 --
NM_002267chr1311497 1441 --1616
NM_002268chr311702 --1625 1109
NM_002270chr545088 4840 4647 2170 --14589 --
NM_002271chr1342141 870 838 634 1186 ----
NM_002285chr254132 3071 1615 1605 1555 1957 ----
NM_002309chr2293193 3017 2780 2519 2344 2165 2157 335 148 ------
NM_002310chr586325 6287 1852 1190 521 512 264 206 ------
NM_002336chr12104956 4948 4291 4222 4192 3833 3762 1379 692 407 14470 ----
NM_002356chr632561 1754 866 ------
NM_002359chr1773671 3356 3052 2817 1421 428 389 13020 ----
NM_002374chr263466 2700 849 751 723 647 23149 1073 --1322
NM_002381chr23697 342 292 --1800 --
NM_002444chrX42000 1617 571 291 1684 21352 800 --
NM_002481chr1157942 7747 7674 7667 7480 6139 5637 5379 2690 2322 1553 1420 556 360 326 27686 2048 ----
NM_002485chr832152 798 50 2669 308 11949 --
NM_002487chr153775 307 101 ------
NM_002494chr4------164
NM_002499chr151928 1590 --1605
NM_002515chr1441507 1478 745 610 11749 11359 --
NM_002522chr1742693 2495 1240 243 13071 1734 --
NM_002524chr11912 ----1758
NM_002526chr641381 391 353 305 ----1318
NM_002545chr1173541 1907 1457 837 559 490 60 53245 2080 1749 630 209 21164 875 --
NM_002570chr1541255 461 268 53 --246 42 1869
NM_002613chr1674974 4133 3933 3723 2162 1513 963 34215 3296 466 13588 --
NM_002634chr172725 369 --2216 200 --
NM_002645chr1152956 2900 1105 921 900 12063 ----
NM_002655chr8125164 5044 4793 4682 4518 4140 3973 3944 1468 840 356 218 --11228 --
NM_002657chr20113612 3463 3246 2599 1363 1303 1279 890 676 611 358 23506 1350 ----
NM_002662chr32290 33 --21919 536 --
NM_002709chr252697 972 893 519 238 --23096 337 1493
NM_002731chr12568 269 --22172 165 --
NM_002737chr17116174 6070 5616 4762 4242 1566 1085 1047 821 408 335 44874 2090 1657 869 ----
NM_002738chr163458 387 96 --1337 --
NM_002745chr2244132 1226 596 484 --23435 108 --
NM_002760chrY65322 4984 4493 1968 1359 847 15433 15215 --
NM_002776chr1991977 1921 1359 1330 1248 721 605 76 69 ------
NM_002827chr2091719 1303 431 391 222 205 39 28 22 11173 ----
NM_002839chr983310 2699 1174 949 907 738 178 49 --23320 1147 --
NM_002859chr1271666 1660 1559 270 239 174 74 --2493 489 --
NM_002938chr471968 1725 1594 1444 1292 782 428 ------
NM_002956chr1241420 1010 460 210 1899 ----
NM_003017chr6------11302
NM_003026chr94960 870 518 109 1919 11120 --
NM_003034chr12138105 7986 6899 6865 6440 6247 5985 2841 2056 1265 964 950 649 37469 4909 2145 ----
NM_003051chr1------179
NM_003079chr171307 --2847 689 --
NM_003099chr1596431 6173 2413 1672 1255 1152 558 501 64 26288 5754 --12531
NM_003137chr641610 1554 811 46 12005 11800 11572
NM_003161chr1732343 1341 1138 --13247 --
NM_003162chr21848 ----11030
NM_003178chr311485 1455 2588 569 --
NM_003179chrX41237 389 186 92 ----1200
NM_003199chr1855291 1840 1817 1786 1614 --15111 --
NM_003217chr1241747 1449 661 45 11898 1342 --
NM_003221chr6103868 3609 3465 3198 2655 1660 1198 879 475 251 ------
NM_003236chr241344 1091 308 270 11282 12371 1911
NM_003243chr121018 341 21143 259 1168 --
NM_003262chr395209 4834 4604 4491 3475 3318 600 213 110 --14650 15136
NM_003291chr131150 ----1104
NM_003309chr671888 1809 1604 686 512 379 189 ------
NM_003336chrX4889 821 155 124 ------
NM_003340chr451337 1197 447 427 148 ------
NM_003342chr1742894 2481 310 81 12946 ----
NM_003387chr231102 319 22 21866 300 12505 --
NM_003392chr353764 1249 1095 923 420 --21300 1015 --
NM_003404chr2092020 1671 1659 1642 1628 1434 762 581 495 ------
NM_003410chrX42041 1175 437 79 ------
NM_003423chr1942059 1730 1025 770 32326 2278 1815 ----
NM_003455chr113546 510 260 ----11196
NM_003468chr244034 1063 504 352 ------
NM_003483chr1242467 790 102 25 12709 ----
NM_003489chr2173180 2474 2466 1358 1054 1013 464 1863 ----
NM_003590chr263667 3413 3345 2755 1619 1569 1553 ----
NM_003607chr173778 2665 1576 1014 898 166 77 11493 13117 --
NM_003615chr332572 638 506 1858 ----
NM_003617chr184866 3102 1503 1330 1209 688 176 74 14193 ----
NM_003633chr532356 2255 1761 144 ----
NM_003671chr93399 145 114 1559 23209 962 --
NM_003679chr163324 3264 2875 2854 1363 89 13364 12690 --
NM_003680chr1167 2483 32 --172
NM_003681chr2186214 5110 4530 3884 3790 2475 2461 579 14314 1728 15214
NM_003713chr12442 359 ----11487
NM_003743chr252162 1906 644 378 372 1440 ----
NM_003763chr2032937 884 138 31996 1046 571 ----
NM_003774chr1232204 2043 369 1943 ----
NM_003787chr1821392 22 149 ----
NM_003794chr3------1405
NM_003822chr143049 2817 2751 2126 2580 352 ----
NM_003861chr1442931 2435 2328 1898 1382 ----
NM_003872chr272931 2451 2400 2229 2010 742 481 ----12459
NM_003887chr21468 12062 22189 499 --
NM_003888chr1571526 1506 1329 1317 1243 1142 518 11276 ----
NM_003913chr631672 1054 388 --13493 --
NM_004006chrX31938 933 541 32620 1997 597 ----
NM_004007chrX31938 933 541 32620 1997 597 ----
NM_004009chrX31938 933 541 32620 1997 597 ----
NM_004010chrX31938 933 541 32620 1997 597 ----
NM_004011chrX31938 933 541 32620 1997 597 ----
NM_004012chrX31938 933 541 32620 1997 597 ----
NM_004013chrX31938 933 541 32620 1997 597 ----
NM_004014chrX31938 933 541 32620 1997 597 ----
NM_004015chrX31938 933 541 32620 1997 597 ----
NM_004016chrX31852 847 455 32534 1911 511 ----
NM_004017chrX31938 933 541 32620 1997 597 ----
NM_004018chrX31852 847 455 32534 1911 511 ----
NM_004020chrX31938 933 541 32620 1997 597 ----
NM_004021chrX31852 847 455 32534 1911 511 ----
NM_004022chrX31852 847 455 32534 1911 511 ----
NM_004023chrX31852 847 455 32534 1911 511 ----
NM_004035chr1784870 4618 4342 3956 3593 3212 1392 1207 34502 3705 430 24545 3960 --
NM_004093chr1322277 549 22363 1242 12814 12634
NM_004094chr1422593 2073 1954 12938 1864
NM_004136chr1532134 2120 118 --1931 --
NM_004156chr82409 387 1403 ----
NM_004171chr1169340 8887 6852 3715 2024 845 27822 3808 28492 2180 --
NM_004185chr14551 136 91 84 1641 ----
NM_004186chr35930 658 371 320 293 2819 312 ----
NM_004187chrX31316 1163 477 1944 ----
NM_004229chrX31751 1490 1381 --1173 --
NM_004272chr511734 ----11880
NM_004274chr1463083 2871 2609 1261 952 343 42181 366 290 108 ----
NM_004277chr641143 469 277 88 ------
NM_004311chr1032751 1018 93 ----13028
NM_004319chr172461 1196 885 797 774 388 181 22161 1113 157 --
NM_004338chr18116906 6764 6724 6391 5811 2598 2518 2043 1823 652 195 34410 2428 1420 ----
NM_004393chr331643 1493 407 32312 2117 950 ----
NM_004397chr1154104 3861 713 608 197 --11415 --
NM_004404chr242044 1992 1735 114 1755 ----
NM_004411chr72640 177 ----1193
NM_004430chr821845 699 12589 ----
NM_004440chr621522 763 ----1198
NM_004481chr132179 2121 549 1119 1893 --
NM_004482chr23790 638 330 ------
NM_004501chr143505 3050 2956 484 1894 ----
NM_004505chr1721718 1310 --11815 --
NM_004514chr1762860 2617 869 248 221 106 13006 1674 --
NM_004516chr191122 1476 1376 --
NM_004586chrX65385 4211 4100 3963 895 579 --11928 --
NM_004588chr1183444 2702 1396 1195 967 342 185 51 12766 --13833
NM_004631chr1--11249 --1442
NM_004654chrY41405 1029 315 131 ------
NM_004655chr171319 ----11114
NM_004657chr23500 397 193 ------
NM_004663chr1511586 11171 1164 --
NM_004673chr131488 1174 202 ----11344
NM_004686chr841729 1175 343 257 ----1219
NM_004711chr2233112 2398 841 12271 33595 3591 3051 --
NM_004717chr751567 1372 1246 346 290 --1125 --
NM_004719chr1252762 2652 1115 604 199 ------
NM_004738chr2012250 ----144
NM_004745chr8116780 6462 6101 5805 5542 2826 2214 1970 1462 696 168 56727 5255 2635 2510 872 12029 --
NM_004748chr1564039 3284 1553 1326 546 324 ------
NM_004760chr741723 663 501 305 ------
NM_004768chr15947 854 763 460 284 --1783 --
NM_004774chr1762816 2773 2437 2290 1194 1159 ------
NM_004776chr2022362 904 33167 3075 2776 13123 --
NM_004791chr133521 278 254 ----184
NM_004796chr1431884 1793 49 1305 1945 --
NM_004801chr241531 1254 1193 230 ----11266
NM_004815chr1124915 4904 4664 4502 4363 3907 3323 3229 3021 1944 935 741 1491 ----
NM_004834chr232643 2237 2187 1250 --11194
NM_004857chr14104208 3890 3870 3598 3476 3415 1675 1563 1053 945 23774 172 ----
NM_004859chr1742926 2389 2126 234 12500 ----
NM_004862chr1651633 1075 627 559 51 ------
NM_004863chr1475229 5222 4637 4027 526 441 142 ----11449
NM_004884chr1531470 689 404 --21189 1167 --
NM_004904chr7114451 4121 1445 1439 1086 1052 781 621 587 568 532 14207 --12629
NM_004932chr52271 99 1666 21397 566 173
NM_004956chr764521 4208 3216 2827 1644 488 13520 21557 412 11425
NM_004976chr1174819 4779 3350 1485 1104 1098 921 23580 639 ----
NM_004978chr151287 1214 377 357 226 21276 51 ----
NM_004985chr1264162 2786 1779 1579 1389 558 14363 ----
NM_004992chrX97436 6624 5893 5874 3410 2690 2525 1562 1278 --18270 --
NM_004992chrX97436 6624 5893 5874 3410 2690 2525 1562 1278 --18270 --
NM_004999chr684317 4299 4105 4079 2825 2755 1603 1521 --1300 --
NM_005028chr1061883 1788 940 855 790 599 --21525 301 11458
NM_005044chrX63841 3503 1139 712 615 117 13988 13734 --
NM_005056chr1275573 4894 1618 1530 1360 1144 709 --23972 327 --
NM_005065chr1485183 4835 4323 4158 4034 3576 1882 541 34795 1844 1355 11988 --
NM_005069chr2161715 1551 1262 511 364 146 ------
NM_005099chr12321 229 21113 968 11013 --
NM_005110chr52665 147 1253 1587 --
NM_005116chr2074135 3365 3105 2999 1665 1282 94 1324 ----
NM_005121chr1722635 2401 11310 11500 13190
NM_005156chr973935 3522 3379 2074 1684 1381 486 ------
NM_005188chr11157266 6793 5717 5642 5627 5044 3082 3058 2620 2389 2150 1719 1388 1257 494 26153 2928 15089 13121
NM_005197chr14116075 5683 5631 5381 5342 4250 4241 2240 1245 451 337 12405 15157 --
NM_005222chr73870 249 225 ------
NM_005235chr2116902 6107 5824 5355 2533 2458 1757 1056 1018 859 86 25521 2310 56063 1946 1942 1938 1934 --
NM_005238chr1132550 839 321 12590 12446 --
NM_005313chr151420 2340 42 1930 --
NM_005347chr961365 1204 631 540 253 105 1315 ----
NM_005359chr1864653 3949 1554 1457 886 253 --32323 2319 410 11838
NM_005373chr141519 598 277 111 --11065 --
NM_005398chr1031403 931 516 197 --1283
NM_005426chr11201 ----1164
NM_005434chr261566 614 501 485 186 119 1300 1658 1109
NM_005436chr1061646 1630 1068 727 602 133 1208 ----
NM_005458chr922212 467 21955 1709 1758 --
NM_005474chr172512 165 132 --1455
NM_005475chr1242848 2642 472 450 11232 2440 194 --
NM_005497chr1775872 4586 4071 1721 1648 697 454 11395 12424 --
NM_005502chr942908 2757 469 422 ------
NM_005509chr5------1385
NM_005542chr741196 755 725 145 11869 ----
NM_005578chr3104955 4835 4642 4213 3972 3930 2000 411 263 255 ------
NM_005591chr1132812 1789 413 --1157 --
NM_005604chr622564 847 ----1380
NM_005647chrX72599 2466 2328 773 675 298 236 23229 3166 12670 --
NM_005652chr164917 460 281 28 --1325 --
NM_005668chr574200 4140 3221 3053 3029 853 741 1224 1897 199
NM_005732chr511434 ----11505
NM_005736chr1031360 43 21 2591 439 ----
NM_005746chr721876 1851 22293 834 ----
NM_005748chr1233083 2435 108 33384 3370 3096 11283 --
NM_005785chr1231756 1647 260 21363 583 ----
NM_005795chr24658 617 386 338 ------
NM_005808chr342465 2207 1332 677 11144 ----
NM_005819chr173332 3059 2535 2407 2294 325 163 --12795 --
NM_005840chrX117657 7597 7091 6868 6298 5077 2910 2584 1853 1588 666 1956 27619 2382 15782
NM_005868chr732194 2064 935 22529 239 ----
NM_005895chr1233229 1117 632 43054 2944 2560 744 ----
NM_005898chr1133007 2798 366 --11189 --
NM_005901chr1876987 6514 6458 5793 2781 1762 941 25814 2368 11610 --
NM_005903chr554925 4190 1965 1736 160 --14980 --
NM_005907chr611534 1476 --1212
NM_005909chr562834 2697 1020 881 840 827 --13800 --
NM_005911chr241504 509 399 242 1209 ----
NM_005933chr1142799 2400 2230 210 22718 2465 12607 --
NM_005935chr464354 4296 2017 1531 548 138 --14560 --
NM_005955chr1115319 4354 4084 3402 1930 1358 1304 1041 162 145 103 43994 1204 480 340 ----
NM_006007chr963842 3711 3452 3076 1092 448 1433 13886 --
NM_006011chr15103801 2938 2900 2774 2633 1532 1289 904 875 482 23390 2978 32812 2743 273 14276
NM_006037chr244846 4805 4027 1025 --14674 --
NM_006047chr2033366 2810 650 ----1758
NM_006080chr763001 2288 1858 593 456 158 21191 140 --1562
NM_006134chr2151641 1431 1161 439 264 ------
NM_006135chr11213 --11423 1433
NM_006155chr242044 1992 1735 114 1755 ----
NM_006195chr931237 1163 95 --1383 --
NM_006197chr841769 700 597 442 ------
NM_006202chr1992007 1933 1414 1403 789 782 431 351 32 ------
NM_006203chr584135 4076 1673 1315 1210 1186 270 178 33985 1552 933 ----
NM_006224chr1762079 2002 1976 770 293 65 12251 ----
NM_006237chr1352029 1946 720 712 147 --12085 --
NM_006241chr321528 857 1651 ----
NM_006251chr51577 12875 --21241 734
NM_006252chr177214 5544 5444 1993 1192 982 217 21698 830 36130 786 86 --
NM_006256chr132528 885 860 ----1262
NM_006275chr2022499 1602 --1834 --
NM_006283chr854863 4756 3328 1397 997 1366 ----
NM_006306chrX95471 5131 4132 2280 1373 1152 637 528 350 --24372 1718 --
NM_006315chr494486 4194 3664 1783 1572 1403 1353 347 146 ------
NM_006321chr352242 1841 1390 856 509 1186 ----
NM_006366chr641198 873 482 327 ------
NM_006367chr131035 887 86 1314 ----
NM_006379chr721578 411 --1256 --
NM_006386chr2241989 1653 830 174 ------
NM_006393chr1053778 3662 3162 1711 1525 --13331 --
NM_006403chr661747 1307 1287 1121 489 252 11168 ----
NM_006457chr423716 2771 ----12890
NM_006474chr171924 1661 1243 762 613 404 128 1176 ----
NM_006489chr1441507 1478 745 610 11749 11359 --
NM_006516chr141481 1316 366 304 ------
NM_006524chr73699 363 244 ------
NM_006534chr2042600 606 255 186 21288 124 192 --
NM_006537chr15--1181 --126
NM_006544chr1456024 5777 5626 4026 1302 25089 4261 12063 --
NM_006546chr1755615 5493 2453 2363 674 11155 15572 --
NM_006548chr311269 1270 3640 276 264 --
NM_006549chr1262707 2469 2456 2426 2042 1821 --12430 --
NM_006557chr951230 1224 493 263 194 ------
NM_006561chr1085835 5025 4726 4296 4194 4075 1445 703 15401 15670 --
NM_006599chr1697910 7231 6715 6404 5708 1770 1764 1179 872 37459 2227 2118 ----
NM_006609chr22658 29 22111 550 152 --
NM_006614chr362977 2962 2446 806 668 34 13073 11198 --
NM_006621chr141549 1496 605 28 --11806 11769
NM_006628chr1573998 3979 3362 952 703 87 66 33630 3582 1877 24687 3675 --
NM_006631chr193620 549 133 ----1533
NM_006646chr1352871 2090 1233 1112 427 1998 11058 --
NM_006650chr563549 3539 1151 1000 555 29 --31371 876 186 --
NM_006654chr1224654 3305 ----11606
NM_006690chr2062007 1785 932 579 348 270 12225 21965 26 --
NM_006699chr11908 12294 --1892
NM_006706chr5------1694
NM_006717chr9--13159 1400 1968
NM_006726chr431268 910 336 2257 71 ----
NM_006729chrX105582 4574 3911 3786 3720 3632 1045 761 540 523 --24916 4188 --
NM_006750chr16127557 7375 6670 6396 5519 4995 2923 2044 1943 1728 177 51 37527 2143 522 12188 15605
NM_006777chrX32082 1935 1106 21913 1006 ----
NM_006803chr822040 530 32119 739 647 --11698
NM_006814chr2042606 721 267 183 32394 251 230 11977 12365
NM_006815chr1241278 1231 108 36 ------
NM_006827chr1443354 2785 2568 829 12680 21122 935 --
NM_006838chr123581 407 122 21165 645 ----
NM_006851chr1252330 1949 1836 870 43 ----11973
NM_006885chr1693537 3515 3411 3387 3293 3042 1088 1061 410 --13504 --
NM_006912chr122160 414 1233 1647 --
NM_006914chr941453 1347 385 137 ------
NM_006915chrX32035 1954 1682 12179 21794 1000 --
NM_006922chr23835 788 328 21652 1599 --12161
NM_006930chr541927 1898 1441 550 --22002 651 11513
NM_006936chr21130 ----21272 108
NM_006940chr1241447 1397 567 558 --11619 1648
NM_006965chr1821105 1045 --1120 --
NM_006996chr11356 11210 --11448
NM_007011chr1586187 6020 4360 2587 2004 985 949 664 ------
NM_007038chr2175343 5193 4865 2333 445 354 78 ------
NM_007050chr20118023 7595 7416 6648 6239 5124 5077 2102 1845 669 648 17642 27724 6143 16130
NM_007067chr1741566 1389 516 503 ------
NM_007114chr342998 2596 2418 630 12810 --12261
NM_007144chr174964 74 51 42 11180 ----
NM_007146chr1752403 2163 1939 744 425 ------
NM_007150chrX32162 568 286 1843 ----
NM_007157chrX62830 2167 2153 555 466 430 ------
NM_007158chr11377 --1298 132
NM_007172chr22103326 2828 2184 1210 1101 939 782 554 353 50 --12546 --
NM_007175chr863558 3009 1180 1038 763 706 --1144 12266
NM_007195chr1833044 1409 1249 23624 1361 12611 1551
NM_007203chr963540 2962 743 613 552 261 --13182 --
NM_007236chr1542428 220 81 75 31670 345 67 1284 12473
NM_007249chr1358102 7670 7030 3482 3238 56983 6637 3359 2665 1514 46202 6051 5708 3253 --
NM_007292chr1784870 4618 4342 3956 3593 3212 1392 1207 34502 3705 430 24545 3960 --
NM_007308chr43517 248 50 1130 ----
NM_007347chr1553084 2254 1123 652 543 32182 1141 29 --22933 891
NM_007350chr1264324 3332 3082 2910 1623 105 ----23992 1373
NM_012072chr2074014 3552 3244 3128 1084 927 741 33859 992 354 ----
NM_012073chr5172 1456 133 11198
NM_012081chr573648 3336 3177 2986 554 347 258 13248 1604 --
NM_012090chr1--21135 947 2824 33 --
NM_012102chr152479 2285 2168 1672 152 2866 378 --12129
NM_012129chr722143 554 21973 759 1966 --
NM_012134chr141886 1718 1596 1260 11460 1359 --
NM_012141chr1333619 1145 130 2508 147 13099 --
NM_012153chr1152043 1823 1779 422 267 12430 1957 --
NM_012157chr34616 389 307 169 178 ----
NM_012164chr986228 2290 1997 1822 1707 1038 865 327 56289 6031 2402 519 494 12447 --
NM_012193chr1165032 4894 2168 2093 1000 817 13810 ----
NM_012214chr255474 3986 2331 913 136 11841 12434 --
NM_012218chr1993103 2944 2407 2388 2004 767 285 119 26 12700 ----
NM_012228chr1061142 1087 1028 821 732 64 1712 ----
NM_012229chr1041268 1160 967 270 11368 ----
NM_012234chr3113580 3098 1499 1150 1040 946 656 525 401 263 58 13086 ----
NM_012249chr243148 2301 1164 1003 ------
NM_012252chr743458 673 554 392 --1236 --
NM_012262chr144837 3571 3190 53 11786 13888 --
NM_012264chr2241892 1727 1612 466 22067 1712 1489 --
NM_012264chr2241892 1727 1612 466 22067 1712 1489 --
NM_012266chr95454 321 262 84 58 ----1771
NM_012288chr685678 5338 4451 4126 4097 1268 902 365 ------
NM_012294chr753783 3142 3008 572 126 13820 11338 12569
NM_012296chr1173156 3037 3021 2910 2896 2834 245 23963 318 21483 94 --
NM_012297chr452315 2167 759 255 186 ----12384
NM_012301chr751993 1505 1458 547 105 --1584 --
NM_012306chr12103494 2666 2388 2265 2232 2170 1104 843 784 130 --1769 --
NM_012309chr1174634 4528 4157 3026 1414 624 152 14179 1978 --
NM_012316chr1105218 4915 4886 4604 4446 4114 3549 1984 1539 146 ----13717
NM_012347chr621110 412 1508 ----
NM_012382chr5114497 4408 4392 4231 4048 3709 3367 1729 1353 1150 1138 34185 4152 3405 ----
NM_012384chr2031644 896 251 12002 12053 --
NM_012463chr1241556 577 461 96 1690 1735 --
NM_012464chr432906 576 467 ------
NM_012465chr1063445 3151 2288 803 695 636 ----12781
NM_012479chr7--12393 --1809
NM_013230chrY41617 1309 710 110 --1671 --
NM_013231chr1494211 4000 3510 3481 1433 1404 1377 1259 940 ------
NM_013243chr153460 326 315 1427 ----
NM_013261chr443677 3163 2317 919 --32526 2391 1363 --
NM_013269chr1254227 3592 1730 1549 1394 ------
NM_013341chr232836 2094 357 1294 ----
NM_013372chr1533360 2703 558 11075 1490 --
NM_013423chrX41082 893 381 139 ------
NM_013427chrX41082 893 381 139 ------
NM_013434chr261625 1513 1303 617 57 40 11494 --11984
NM_013434chr261625 1513 1303 617 57 40 11494 --11984
NM_013960chr83738 572 117 1261 1702 --
NM_013989chr1464532 3697 3294 748 737 72 14174 ----
NM_014033chr1272338 2133 1927 823 764 522 218 11855 2544 373 1890
NM_014048chr1684994 4741 4374 4242 3802 3217 1416 403 11172 11040 24589 1369
NM_014056chr342038 1727 1487 268 11839 11423 11924
NM_014112chr844552 1207 740 285 11584 --15253
NM_014155chr1126870 5029 26921 1398 ----
NM_014166chr1341183 1025 815 335 ------
NM_014231chr1252074 1695 1494 692 39 22161 122 1786 --
NM_014240chr363512 3342 3070 2748 2589 489 23457 1189 ----
NM_014289chrX51267 1187 461 105 80 ------
NM_014331chr487369 4996 2647 2370 2168 1619 1189 958 --15124 15032
NM_014333chr1152727 1958 994 565 366 --1998 --
NM_014361chr111345 ----1169
NM_014368chr941566 1339 533 92 21965 120 2450 109 --
NM_014372chr131610 1380 1327 --11755 --
NM_014376chr552561 2005 621 303 292 1546 ----
NM_014418chr1461881 1753 1420 706 332 299 11390 11913 --
NM_014423chr564744 4674 4309 4210 3881 1678 ------
NM_014426chr203640 586 466 ------
NM_014445chr312140 1793 --11844
NM_014455chr14359 340 185 167 ------
NM_014494chr1631803 198 123 1802 ----
NM_014572chr1361527 702 487 374 361 285 1145 ----
NM_014613chr562660 1988 1923 1889 313 299 32712 2025 396 22977 2196 --
NM_014616chr331325 713 34 --12222 --
NM_014636chr954006 3907 3336 1530 616 1165 1179 --
NM_014655chr142309 1558 1522 310 11565 ----
NM_014683chr1741815 1478 791 705 --1414 --
NM_014690chr752883 2734 837 638 29 --1951 --
NM_014701chr1562884 1356 1189 957 517 369 1474 ----
NM_014702chr623298 1145 1123 1484 --
NM_014707chr742185 1858 296 93 --1180 --
NM_014721chr677252 6877 6232 5742 5672 1215 923 46910 6557 2638 572 ----
NM_014726chr1751140 989 497 406 122 --21130 1021 --
NM_014729chr821927 26 153 11822 --
NM_014730chr1235207 5040 1506 ----1176
NM_014730chr1235207 5040 1506 ----1176
NM_014731chr20175 11768 11604 11288
NM_014742chr2021094 389 21484 640 21340 359 11556
NM_014747chr195188 3985 3861 1588 1063 823 522 473 418 --24764 2181 --
NM_014755chr224198 246 ----11253
NM_014760chr351831 1526 1478 1298 634 --11801 --
NM_014766chr753763 901 718 678 152 ------
NM_014767chr1093594 3107 1063 457 435 378 346 253 110 23175 570 11090 --
NM_014772chr1883057 2629 2387 1389 1378 1223 677 586 ------
NM_014774chr163143 2802 2113 1178 820 573 ------
NM_014787chr152706 2145 1806 286 253 ------
NM_014810chr122431 1090 1783 1194 --
NM_014812chr141832 1788 1713 753 ------
NM_014820chr341408 1364 636 602 ----12083
NM_014826chr173778 2665 1576 1014 898 166 77 11493 13117 --
NM_014830chr1242602 1258 607 556 1291 13682 --
NM_014832chr1351623 715 640 528 319 ------
NM_014836chr101134 --11693 21914 54
NM_014839chr122227 56 1108 ----
NM_014848chr1552532 1760 581 504 61 --12509 12335
NM_014850chr374807 3999 1711 1335 816 793 527 11946 ----
NM_014860chr242401 2251 654 626 1708 12096 1948
NM_014870chr174185 3177 1575 1105 565 273 77 11740 ----
NM_014872chr932345 2213 2045 --22076 1792 --
NM_014873chr154315 3968 3172 583 161 33269 1397 422 ----
NM_014876chr223655 382 375 --11949 --
NM_014877chr17107066 6123 6099 5987 5741 4944 2492 1702 1450 604 22670 1219 12067 26445 609
NM_014880chr252790 2540 2276 2091 2046 --12436 --
NM_014883chr431868 1693 334 12217 ----
NM_014904chr1033445 3269 1229 --11181 13721
NM_014906chr17103566 3506 3448 3260 3087 2886 2528 1634 802 107 ------
NM_014912chr1023064 236 --12399 --
NM_014920chr641058 1051 619 73 --11235 --
NM_014932chr32774 235 2715 399 ----
NM_014938chr1282414 2115 1706 817 748 730 451 419 11774 ----
NM_014953chr1353814 3714 3356 3167 996 --1478 1231
NM_014964chr17--11693 11490 1538
NM_014982chr1484888 2004 1762 1507 1443 1031 187 163 23523 901 13701 --
NM_014988chr422028 1026 --22665 1882 --
NM_014989chr621378 272 2507 489 11592 --
NM_014991chr422671 663 --42652 2648 2568 1145 --
NM_014994chr1551531 794 620 456 450 ------
NM_015000chr1233030 2242 561 1677 ----
NM_015002chr1251502 838 787 332 197 1120 11690 --
NM_015008chr333013 2432 1222 ----22566 2287
NM_015020chr1643272 1490 1296 959 1303 1348 --
NM_015026chr1253854 3767 3092 1791 1662 14672 ----
NM_015027chr1621361 256 1287 ----
NM_015033chr983289 2427 2225 1151 1040 770 723 324 12449 11197 --
NM_015039chr1114157 3105 2880 1517 1292 1157 1100 940 673 83 39 13242 ----
NM_015040chr233438 929 388 199 ----
NM_015042chr1554256 3856 2790 1751 920 2165 127 13874 --
NM_015044chr1672934 2867 2812 2681 2289 791 492 23238 661 1392 --
NM_015049chr222585 2457 12367 --1529
NM_015051chr922867 238 ----12722
NM_015064chr1213124 32722 1090 158 --12493
NM_015068chr762500 1297 1164 1058 581 247 22435 335 --13224
NM_015071chr596133 5589 4577 2434 2321 1441 462 430 43 --21087 699 --
NM_015076chr644361 2931 2820 787 --22977 1581 --
NM_015077chr17104706 4452 4123 4034 1679 1462 1306 1181 479 44 ------
NM_015086chr1241437 959 611 50 --21324 39 --
NM_015092chr1654373 3970 2849 717 359 13266 --21263 49
NM_015107chrX71594 1561 936 819 441 212 154 --12218 --
NM_015115chr442198 1297 862 304 1627 12693 --
NM_015132chr721271 135 --11257 1174
NM_015137chr83860 375 272 11668 11802 --
NM_015138chr1532699 2415 250 ----12209
NM_015144chr1673594 2796 1008 789 588 395 253 23602 857 13627 --
NM_015155chr1052956 1271 1043 877 531 22897 2292 ----
NM_015156chr1453802 2851 2797 207 150 ------
NM_015192chr2052991 2942 2360 150 121 ------
NM_015199chr342116 2091 898 77 --12543 --
NM_015206chr1543126 2875 1546 1300 --22708 177 --
NM_015225chr962571 2082 2003 590 453 97 --32495 333 62 --
NM_015230chr431370 749 448 21486 1267 ----
NM_015231chr111243 ----1651
NM_015236chr421436 1269 ----1497
NM_015267chr1241761 856 229 201 --2847 277 --
NM_015271chr454034 3390 3147 1562 183 33174 1588 658 ----
NM_015291chr142592 2283 1146 345 11210 23265 719 --
NM_015310chr8137734 6746 6572 6521 6067 2708 2460 2078 1989 1965 1071 883 369 27794 6817 --1858
NM_015313chr1144215 4195 3415 212 33665 3397 1650 ----
NM_015328chr752679 2673 2481 2291 756 159 ----
NM_015338chr20--2394 347 --1617
NM_015345chr672751 1091 965 720 704 692 360 22678 2637 ----
NM_015359chr842778 2464 408 77 22862 2595 ----
NM_015361chr23696 197 177 ------
NM_015365chrX53791 3407 2706 1122 559 ------
NM_015382chr14--1119 --189
NM_015387chr242037 1920 705 86 1764 --1184
NM_015393chr473803 2821 1291 1117 989 934 448 11383 23593 1421 --
NM_015436chr443177 2488 2470 2182 --11334 --
NM_015455chr573462 2710 936 761 467 268 32 13354 13568 --
NM_015458chr8125119 4782 4340 4310 4215 4179 2035 1710 1554 484 322 49 --25163 4334 --
NM_015550chr783554 3512 2973 2778 2583 2461 1158 1006 ------
NM_015554chr1552557 2435 2257 1919 716 ------
NM_015564chr553317 3103 2423 1204 396 32873 2345 2311 13277 --
NM_015568chr2073537 2973 2650 1195 1178 913 630 23494 1202 --14005
NM_015569chr174708 3518 1857 1368 1295 1002 921 44520 4049 1428 440 23808 798 1327
NM_015575chr261120 1111 1093 302 171 57 11274 ----
NM_015576chr31966 2216 128 1812 --
NM_015640chr174278 4050 1950 1450 1000 453 122 1876 ----
NM_015678chr131573 3662 640 117 11423 --
NM_015691chrX42648 2628 547 331 --21980 35 12653
NM_015850chr881812 1740 937 379 190 179 153 32 ------
NM_015852chr732539 2291 789 ----13248
NM_015866chr1--11034 1972 195
NM_015891chr641366 742 512 42 ------
NM_015906chr134463 4347 3485 11241 13374 24213 2993
NM_015975chrX41687 719 495 358 11659 ----
NM_016009chr144439 4207 3760 777 24873 4687 ----
NM_016018chr842798 799 112 62 ------
NM_016023chr822101 1728 160 ----
NM_016025chr1621410 1312 11939 11887 --
NM_016040chr132456 1981 1050 ------
NM_016061chr22182 58 21550 1065 121 --
NM_016076chr152819 2780 966 666 603 12795 1221 --
NM_016079chr282231 2001 1871 1686 1630 1580 850 716 --22236 246 --
NM_016083chr643394 2727 2606 1267 --13111 --
NM_016125chr17------1144
NM_016131chr211753 11892 --133
NM_016206chr3118338 8257 7774 7470 7214 6275 3080 2325 2148 1917 1610 57802 7582 6973 3204 2289 12155 --
NM_016220chr742229 2051 1804 940 ------
NM_016231chr1741582 1275 1120 46 ------
NM_016248chr1343369 3323 2972 1118 21408 1025 13715 --
NM_016257chr133075 1418 456 1152 13440 --
NM_016260chr215027 1272 22394 318 --
NM_016261chr172773 93 1125 ----
NM_016287chr121906 799 21318 507 11361 --
NM_016320chr115845 446 314 147 39 --2849 112 --
NM_016376chr1784240 3175 3120 3008 2907 2856 840 346 ----11336
NM_016418chr2293713 3422 2913 1420 1207 1034 1003 395 144 12412 ----
NM_016422chr1142520 2426 557 101 --12255 --
NM_016436chr2032424 758 612 --12500 --
NM_016472chr143977 502 229 11273 ----
NM_016507chr1742599 660 235 51 1561 143 --
NM_016513chr641058 1051 619 73 --11235 --
NM_016529chr132823 783 1303 11019 --
NM_016531chr434038 2863 886 --23273 2838 --
NM_016542chrX21510 221 1538 ----
NM_016603chr541543 799 765 225 12194 --11746
NM_016605chr582758 2680 2353 2049 1691 998 827 620 ------
NM_016621chr1144263 3381 3119 885 1510 ----
NM_016652chr202432 244 21797 90 11337 --
NM_016824chr1021372 549 ----1260
NM_016929chr663933 2946 1827 1482 377 224 23206 786 ----
NM_016946chr143506 3190 2627 499 33302 2288 1454 23345 2331 --
NM_016952chr1152933 2895 2617 678 521 22925 2492 23231 668 --
NM_017415chr543100 2781 1382 1002 --11602 --
NM_017425chr11------150
NM_017519chr631211 428 127 1397 ----
NM_017522chr1--11249 --1442
NM_017551chr1032497 1985 825 22447 2091 ----
NM_017563chr374782 4031 3875 1751 936 668 466 ------
NM_017580chr102499 445 1856 1459 --
NM_017582chr121601 545 11572 --11831
NM_017596chr183756 3457 2975 2877 512 500 372 343 14033 ----
NM_017628chr495152 3762 3278 1566 1502 1282 1132 1109 923 13756 14395 24153 1420
NM_017629chr131357 430 333 1111 ----
NM_017634chr851699 1453 1303 782 68 ------
NM_017637chr9128354 8181 7994 6852 6728 6488 6212 5917 3043 2265 2064 920 --1521 17768
NM_017645chr942488 2307 2292 707 11138 ----
NM_017650chr735693 4255 4141 21522 1257 11404 --
NM_017651chr62649 451 --11491 1119
NM_017661chr15--1349 --1170
NM_017697chr8--3388 379 369 ----
NM_017709chr143978 3611 3274 246 ------
NM_017737chr11584 ----1821
NM_017742chr1831324 549 423 1761 1499 --
NM_017744chr131941 680 350 2976 875 ----
NM_017754chr653810 3779 1467 842 319 31927 1034 156 24926 1307 11509
NM_017769chr1432481 923 719 --12713 --
NM_017779chr11500 22459 2394 12638 --
NM_017811chr932894 2876 100 22226 237 ----
NM_017813chr845524 5387 4890 1573 24969 591 12183 --
NM_017826chr133813 96 21 ----1509
NM_017848chrX73761 3348 3000 1217 1146 759 139 22975 22 1488 --
NM_017849chr252639 2007 727 246 189 12473 12518 --
NM_017866chr83927 751 417 1806 --1192
NM_017902chr10145385 5129 4386 4275 4210 3771 1894 1484 1251 1006 970 885 175 48 --25689 1266 --
NM_017919chr9115239 5162 5082 4967 4951 4484 4469 2081 2045 1259 787 25413 4048 13533 --
NM_017990chr1693493 3359 2977 1239 1150 295 209 190 80 --1558 --
NM_017994chr752961 2917 2868 788 460 1327 12362 --
NM_018030chr184801 732 137 34 --21098 993 --
NM_018045chr152918 2752 2634 764 511 1796 11241 --
NM_018048chr1271848 1730 1504 581 520 400 312 ------
NM_018061chr13700 664 183 --11508 --
NM_018084chr243306 634 387 275 13071 ----
NM_018086chr281562 1516 1509 1406 1340 1315 1299 1171 11573 ----
NM_018112chr911038 1951 149 --
NM_018121chr1023000 555 ----13091
NM_018178chr151661 1292 668 278 203 ------
NM_018181chr1841426 446 141 34 11660 --11431
NM_018182chr1762209 2185 2142 401 263 236 --1820 11429
NM_018192chr361023 945 693 662 420 266 --1860 --
NM_018211chr132045 709 243 31890 722 201 --1588
NM_018243chr453859 3633 3409 2529 1202 --134 --
NM_018260chr194399 315 231 205 --11326 --
NM_018299chr833064 2947 618 ----12123
NM_018312chr1141912 1870 1823 422 ----1865
NM_018327chr2041412 1308 444 394 21314 521 ----
NM_018351chr1284089 3794 3555 3527 2986 1594 1549 536 13591 13208 1759
NM_018362chr1143365 2768 1185 478 23248 1087 --22924 1578
NM_018364chr163301 1182 973 952 689 324 --13685 --
NM_018372chr11161 ----1480
NM_018374chr744672 4165 3263 167 15069 ----
NM_018394chr331569 1522 401 11273 ----
NM_018403chr363765 3021 2762 2747 1600 966 11028 --13192
NM_018440chr878452 7887 6415 5768 5367 2938 1909 16477 37980 7969 929 17974
NM_018482chr851581 1012 1003 575 28 22139 177 ----
NM_018489chr12230 99 --1914 --
NM_018590chr1041310 486 430 270 ------
NM_018638chr1243495 1998 1686 562 ------
NM_018640chr1242803 2713 2118 1037 ----1579
NM_018650chr132207 1696 718 1402 ----
NM_018667chr1632362 261 72 1582 1848 --
NM_018704chr131907 1573 767 2138 37 ----
NM_018717chr482908 2842 1003 822 705 182 158 23 ------
NM_018947chr764719 4103 3867 1999 1743 1344 14246 1409 --
NM_018970chr753183 2688 2381 645 151 12294 --1493
NM_018976chr1262492 2334 2190 1155 75 32 ------
NM_018999chr1064674 4422 3261 1598 527 360 1310 1994 --
NM_019001chr331746 761 41 13825 145 --
NM_019004chr741866 1784 1608 83 ----1536
NM_019006chr15------1722
NM_019008chr2253570 3158 2847 1028 600 11513 --11372
NM_019027chr441684 1671 244 87 11910 ----
NM_019074chr153751 627 367 2839 639 ----
NM_019098chr831859 426 338 --1742 11705
NM_019106chr2273258 3210 2967 2177 832 687 617 ------
NM_019116chr1653301 3138 2946 2764 2414 1167 ----
NM_019895chr3--21080 853 --1145
NM_019903chr1021372 549 ----1260
NM_020122chr255733 5450 2151 613 167 ----15402
NM_020148chr1842258 1920 1914 1024 33124 2208 196 1937 --
NM_020150chr1042005 1443 657 54 ------
NM_020178chr1731013 994 908 1275 1388 --
NM_020336chr2032704 890 857 ----13166
NM_020337chr462724 2188 783 769 742 224 ------
NM_020338chr10103413 2978 2852 2296 2273 1413 1400 763 381 70 33136 2421 1338 12734 --
NM_020348chr1041741 134 126 21 32349 2134 1846 161 --
NM_020384chrX91776 1711 1585 1403 1301 1244 1171 522 337 ------
NM_020390chr334498 4211 3460 33609 1116 953 11161 14250
NM_020440chr183145 3093 2323 2305 1208 714 698 465 ------
NM_020443chr1136962 5818 5582 5574 4964 4397 2139 2046 1382 1361 1047 928 776 26287 466 15975 12717
NM_020455chr632543 2221 494 2883 33 ----
NM_020456chr1332231 846 394 11826 11869 --
NM_020466chr6144894 4682 4581 4098 3479 3444 3086 1862 1798 1791 1415 789 614 608 --21612 1083 --
NM_020475chr862007 1639 619 611 512 390 22459 1958 11773 --
NM_020476chr862007 1639 619 611 512 390 22459 1958 11773 --
NM_020477chr862007 1639 619 611 512 390 22459 1958 11773 --
NM_020478chr862070 1702 682 674 575 453 32522 2021 1560 11836 --
NM_020480chr862007 1639 619 611 512 390 22459 1958 11773 --
NM_020647chr82518 333 ----1686
NM_020704chr742520 2300 1872 872 ----22401 1944
NM_020713chr2043008 602 472 96 --12591 --
NM_020715chr1431778 1743 404 1513 21902 288 --
NM_020717chrX94932 4525 4164 4118 3458 3070 604 199 120 33292 1230 765 2989 466 --
NM_020728chr753074 2455 2073 49 43 ------
NM_020732chr631211 428 127 1397 ----
NM_020734chr1242467 2453 1243 734 11145 11261 --
NM_020739chr1564039 3284 1553 1326 546 324 ------
NM_020766chrX43507 3433 3244 1494 --33373 3069 933 --
NM_020768chr573012 1007 921 879 354 176 159 ------
NM_020770chr13483 427 191 --11159 --
NM_020772chr1766857 2648 1879 1760 1565 1447 --1401 --
NM_020778chr1554250 3139 1787 1070 27 13281 11912 --
NM_020796chr5122944 2918 2827 2669 2401 2071 1192 1163 854 811 714 409 ------
NM_020802chr1143231 1354 1188 320 ------
NM_020804chr64978 504 353 324 2437 276 ----
NM_020809chr112407 24 22102 1400 11926 --
NM_020830chr2123 22179 46 --11057
NM_020841chr1233435 2491 1073 ----12540
NM_020850chr163854 111 36 11082 --1847
NM_020858chr1532232 1503 943 12024 22048 405 --
NM_020859chr473327 3264 3148 3010 2889 694 346 --13521 --
NM_020888chr132001 1263 215 21477 1368 21633 481 --
NM_020899chr1741917 1021 908 257 128 ----
NM_020935chr283427 3285 3016 2961 1647 1362 1223 536 --33946 1871 427 --
NM_020940chr1021175 71 32753 1911 52 ----
NM_020948chr143269 3019 2812 246 12242 33494 3490 1367 --
NM_020952chr95880 646 628 546 285 ------
NM_020964chr18144728 3611 3563 3454 3318 3154 3045 1022 811 726 626 346 264 240 24297 3700 ----
NM_020977chr471553 1405 490 471 461 284 208 --12035 --
NM_020987chr1031443 1329 402 --189 --
NM_020993chr1282730 2177 2082 1981 1091 1012 386 26 12817 ----
NM_021007chr241891 875 579 434 ------
NM_021033chr135902 252 245 104 71 1195 22439 690 --
NM_021061chr894079 3844 3506 1520 1346 833 718 551 24 11632 33978 3817 1677 --
NM_021072chr532276 2007 932 ------
NM_021097chr243060 1210 994 854 11885 ----
NM_021120chrX43188 2349 2301 581 11233 --1284
NM_021159chr441138 506 209 55 185 ----
NM_021183chrX52554 2170 1646 854 233 --1184 --
NM_021202chr2092804 2331 1124 908 318 297 257 232 193 --2855 186 --
NM_021238chr1232036 1971 762 1272 ----
NM_021249chr14--41529 1235 1213 223 ----
NM_021255chr1433596 2891 1451 21213 1012 13590 --
NM_021629chr364810 3505 1990 1190 120 80 ------
NM_021637chrX31041 972 912 1874 ----
NM_021638chr494919 4608 4466 3982 3272 1699 1450 839 316 ------
NM_021647chr474290 3031 3008 1423 1366 1030 592 --24732 3295 14073
NM_021648chr622327 87 --1573 22204 1910
NM_021813chr674664 4380 2205 1465 1275 1079 477 15052 25455 1507 --
NM_021905chr691967 1826 1704 1463 1444 1417 542 499 179 1162 ----
NM_021911chr523877 3417 25109 1988 11817 11278
NM_021912chr1563643 3536 3248 3056 1534 1371 13199 ----
NM_021954chr1332463 1457 1136 13228 12319 --
NM_021961chr11116415 5875 5611 5276 5203 2959 2238 1348 735 694 550 56406 4859 2412 1723 1693 15935 --
NM_021964chr355407 4557 2341 1686 254 22363 623 26340 1762 16345
NM_021977chr652854 2524 1399 998 608 1351 22596 1389 --
NM_021998chrX31401 1311 152 ------
NM_022041chr1632611 1083 444 ------
NM_022048chr1574055 1922 1695 1306 301 237 193 13853 ----
NM_022060chr1461039 509 462 441 429 318 11323 21195 257 --
NM_022062chr1151903 1824 1270 1264 1216 ----21942 580
NM_022140chr532274 497 227 51905 1764 1555 786 567 4931 909 905 384 --
NM_022166chr16125690 5032 5026 4936 4864 4378 4249 4084 2404 1833 1755 1679 45181 4619 4413 1305 25160 2175 --
NM_022169chr1161515 1448 1274 1063 544 465 ------
NM_022171chr361571 1515 1438 1371 1219 336 ----11046
NM_022336chr252256 2097 847 674 244 ------
NM_022351chr873045 2853 2681 1024 584 479 94 --23450 991 --
NM_022458chr741116 313 146 53 ----11160
NM_022459chr13116293 5425 4190 2412 2184 2017 1511 1383 1253 1163 1107 11460 15270 --
NM_022473chr1554176 1164 975 899 745 11745 11703 --
NM_022484chr721312 1124 21303 542 ----
NM_022716chr152731 2591 2329 842 553 22214 583 ----
NM_022745chr142687 2362 664 24 11995 12387 --
NM_022763chr3------1366
NM_022781chr931203 671 64 11093 22955 368 --
NM_022817chr23903 690 86 11512 11557 11665
NM_022824chr54491 473 457 23 --21823 553 --
NM_022832chr432412 1846 26 22259 734 1475 --
NM_022841chr1532355 2049 246 22217 1081 ----
NM_022894chr221186 240 ----11414
NM_022898chr1433547 1834 1519 33373 3173 1263 1326 11117
NM_022901chr921394 724 11167 11210 --
NM_022912chr262842 2781 207 144 125 90 ------
NM_022918chr1152123 1627 613 288 267 ------
NM_023037chr1341083 850 825 214 ------
NM_023039chr53342 308 145 ------
NM_023105chr881812 1740 937 379 190 179 153 32 ------
NM_023106chr881812 1740 937 379 190 179 153 32 ------
NM_023110chr881812 1740 937 379 190 179 153 32 ------
NM_023111chr881812 1740 937 379 190 179 153 32 ------
NM_023929chr8--1399 --1986
NM_024007chr523026 3014 --1266 --
NM_024045chr101165 ----267 22
NM_024345chr975955 5169 4783 4606 4499 2315 1853 --15709 --
NM_024494chr14551 136 91 84 1641 ----
NM_024617chr9150 ----1189
NM_024626chr141321 553 442 53 168 ----
NM_024638chr3102277 2061 1718 1675 1563 888 858 721 493 449 --11954 --
NM_024645chr82129 121 11263 11221 --
NM_024665chr323791 549 31075 209 109 14219 --
NM_024689chrX1317 31751 541 247 --1167
NM_024749chr141777 1592 703 172 --1123 --
NM_024761chr964226 2077 1302 746 379 268 ----14693
NM_024779chr1251350 1332 1170 142 128 ------
NM_024834chr102493 458 ----11720
NM_024884chr1433956 3866 2938 --23983 1164 --
NM_024887chr182087 1572 720 563 538 425 397 53 21593 314 ----
NM_024909chr641114 498 433 381 --21317 264 178
NM_024922chr1651839 1789 1597 583 350 1106 11621 1763
NM_024939chr1681560 1213 1161 449 416 338 159 152 ------
NM_024947chr3128379 8134 7384 6644 5866 3830 3496 2206 1046 918 833 396 28247 7496 49021 8292 7541 2652 --
NM_024953chr1232792 2697 1108 ------
NM_024971chr95880 646 628 546 285 ------
NM_024989chr278026 7433 6537 5973 5485 2261 201 37556 2373 1372 17802 175
NM_025054chr844243 3418 3367 948 13683 11479 --
NM_025057chr1461283 1105 1095 334 322 215 11180 --1498
NM_025138chr133485 282 246 --1359 --
NM_025146chr332207 1963 485 --12211 12389
NM_025164chr1191829 1716 1571 839 653 475 243 233 105 ------
NM_025179chr154360 3707 1982 463 211 13744 --1773
NM_025191chr142541 1257 923 215 ------
NM_025201chr1542104 1923 1601 837 152 --143
NM_025208chr1142306 2140 2035 992 --12328 --
NM_025235chr1041966 1498 1387 28 ------
NM_025248chr1742213 2079 346 78 32828 2714 327 13045 --
NM_030576chr1742383 2209 969 411 --1405 --
NM_030621chr1443963 1273 1156 413 13834 11699 --
NM_030623chr231555 1377 517 --1142 11549
NM_030625chr1052242 2083 994 738 419 12035 12076 --
NM_030627chr51512 --13307 23034 1514
NM_030634chr152073 1891 523 440 205 ------
NM_030647chr744963 2432 1446 1305 15091 12274 --
NM_030648chr475066 4969 4635 4365 3857 1804 558 ------
NM_030650chr274283 3700 3667 3651 3060 2893 327 13890 ----
NM_030664chr1071741 1718 1537 576 534 69 21 11494 ----
NM_030674chr1231937 1883 1159 1966 15639 --
NM_030763chrX4872 775 761 674 ----1707
NM_030767chr952597 2485 2094 1837 1802 --12840 1627
NM_030806chr198362 6440 6408 3166 2270 2112 1709 1591 295 --28212 6626 1900
NM_030816chr142686 2668 2460 2409 ------
NM_030881chr2241989 1653 830 174 ------
NM_030915chr262409 2008 1858 786 549 494 ------
NM_030918chr1114996 4435 4168 3989 3823 1933 1320 1165 1098 847 136 14878 11647 --
NM_030940chr941324 988 424 277 --21418 583 --
NM_030952chr171334 1297 1270 1032 983 916 261 ----11220
NM_030962chr1151597 1326 461 431 154 ------
NM_031268chr1674974 4133 3933 3723 2162 1513 963 34215 3296 466 13588 --
NM_031296chr451698 867 730 244 150 1979 11022 --
NM_031305chr451749 1674 715 347 147 ------
NM_031442chrX52606 2498 543 398 174 12382 ----
NM_031445chr253223 3031 2633 1373 1149 ------
NM_031468chr7107329 6668 6519 6322 6184 5516 2185 516 492 386 --11687 15049
NM_031483chr2021304 536 23168 263 --12500
NM_031844chr143505 3050 2956 484 1894 ----
NM_031845chr263466 2700 849 751 723 647 23149 1073 --1322
NM_031847chr263466 2700 849 751 723 647 23149 1073 --1322
NM_031890chr227782 732 508 427 304 289 61 ------
NM_031940chr842381 1620 686 377 --12255 --
NM_032012chr964534 2046 1983 1266 502 297 ------
NM_032105chr1158075 7880 7807 7800 7613 6272 5770 5512 2823 2455 1686 1553 689 493 459 37819 2181 40 ----
NM_032116chr1355307 5147 4095 3657 1055 14555 14745 --
NM_032124chr1811164 1851 --1458
NM_032153chr362552 2500 2205 2157 1097 1063 ------
NM_032160chr1844037 3694 1688 1607 23806 3350 ----
NM_032189chr1374779 4165 3305 1642 916 698 240 34021 1473 665 ----
NM_032208chr253225 2250 450 406 400 22875 1219 --12622
NM_032271chr1661341 1315 1024 302 257 244 --11516 11159
NM_032325chr1171635 1343 759 673 573 91 24 --1677 --
NM_032373chr1055371 5248 5133 4165 2068 25900 631 25230 282 --
NM_032408chr7--1914 --158
NM_032439chr1041548 1361 373 92 ------
NM_032440chr1051095 1078 559 476 463 ------
NM_032446chr533385 387 65 1774 --33208 3140 787
NM_032457chr443199 2464 1243 1195 1757 --1708
NM_032458chrX42440 684 376 254 ------
NM_032505chr342552 2427 978 708 --1982 --
NM_032547chr4--1392 --11245
NM_032578chr1021554 502 --1265 1488
NM_032582chr1731726 1329 687 11398 11827 --
NM_032594chr142805 364 1150 --1901
NM_032663chr122364 138 --1824 11749
NM_032682chr32781 311 11086 12380 --
NM_032711chr1773671 3356 3052 2817 1421 428 389 13020 ----
NM_032804chr105673 387 276 93 69 --1781 --
NM_032826chr764139 4019 1922 1787 668 325 33717 3685 1209 ----
NM_032828chr1954082 3927 3065 1857 1721 44149 3178 1834 922 74237 3354 3221 1981 1879 1434 374 11079
NM_032837chr1742025 1997 815 290 1689 ----
NM_032859chr1343255 2537 1580 426 --13354 --
NM_032873chr1163592 3359 3003 2848 1042 77 12967 ----
NM_032876chr1411395 ----11570
NM_032932chr17135567 5348 4702 4282 1174 1149 1019 752 698 397 367 348 201 ------
NM_032961chr41473 --1995 1319
NM_032968chrX73532 3147 1692 1179 675 591 134 12659 ----
NM_032969chrX73532 3147 1692 1179 675 591 134 12659 ----
NM_032973chrY63528 3142 1179 675 591 134 12654 ----
NM_032975chr1853302 3187 3020 2906 718 32812 2465 2335 12805 --
NM_032980chr1853302 3187 3020 2906 718 32812 2465 2335 12805 --
NM_032982chr762564 1964 1818 833 434 21 --12364 12186
NM_033020chr134463 4347 3485 11241 13374 24213 2993
NM_033044chr1--21135 947 2824 33 --
NM_033129chr206785 648 621 583 564 474 ------
NM_033135chr1142306 2140 2035 992 --12328 --
NM_033143chr494505 4353 4241 4091 3933 1421 1358 907 163 12852 ----
NM_033181chr643394 2727 2606 1267 --13111 --
NM_033201chr1631180 297 71 1813 1418 --
NM_033211chr511899 11866 22028 816 --
NM_033224chr7137550 7301 7261 7134 6270 6083 5801 1999 1254 977 642 459 30 36790 6180 2575 11336 17239
NM_033285chr853577 2873 1574 1381 819 --11478 --
NM_033300chr1--11249 --1442
NM_033315chr1772109 2076 2042 2036 1607 487 400 21892 1661 ----
NM_033331chr93399 145 114 1559 23209 962 --
NM_033360chr1254283 2907 1700 1510 679 14484 ----
NM_033387chr9122366 2118 2102 1807 1718 1011 935 768 570 463 412 103 1832 12570 --
NM_033389chr1764819 4782 3480 1784 1081 783 ------
NM_033429chr1552191 1192 1004 715 589 ----1423
NM_033480chr621110 412 1508 ----
NM_033481chr621110 412 1508 ----
NM_033503chr1583656 3640 2830 2599 2584 895 502 430 1411 --1304
NM_033505chr266066 5647 5287 4545 4281 2193 36341 462 62 14502 --
NM_033512chr832747 2506 263 22825 2443 ----
NM_033624chr1251502 838 787 332 197 1120 11690 --
NM_033626chrX21384 327 11571 --11679
NM_033631chr143680 993 830 54 21521 256 1423 --
NM_033656chr2184937 4732 4531 3753 1999 1898 1181 1043 14259 14673 15777
NM_052832chr85931 761 737 591 521 12531 ----
NM_052864chr442029 1855 749 197 --1732 --
NM_052879chr1253868 3326 2690 2499 1269 12821 23709 2972 --
NM_052896chr152463 2216 2206 2163 351 ------
NM_052900chr8------1304
NM_052904chr631352 1096 580 11143 ----
NM_052905chr231773 1658 617 11700 --1426
NM_052906chr2244516 3118 1582 504 21573 873 ----
NM_052910chr1341365 621 537 365 11989 11999 --
NM_052918chr1083700 3200 3175 3147 2768 976 859 660 1870 ----
NM_053016chr957243 6973 3045 1065 813 35716 2035 47 ----
NM_053023chr1142930 2716 2140 159 ------
NM_053025chr331298 550 327 ------
NM_053026chr331298 550 327 ------
NM_053027chr331298 550 327 ------
NM_053028chr331298 550 327 ------
NM_053031chr331298 550 327 ------
NM_053032chr331298 550 327 ------
NM_053042chr442958 2147 418 334 164 12993 --
NM_053056chr1162002 1107 922 641 401 165 ------
NM_053064chr1461240 797 509 497 180 85 22438 2157 --11048
NM_057175chr42834 626 ----1861
NM_057749chr81116 ----135
NM_058240chr1441211 326 260 134 21108 648 1254 --
NM_058241chr242300 1832 1610 922 1588 ----
NM_058241chr242300 1832 1610 922 1588 ----
NM_078473chr842381 1620 686 377 --12255 --
NM_078476chr641403 1372 1223 643 11197 11564 --
NM_080491chr1173156 3037 3021 2910 2896 2834 245 23963 318 21483 94 --
NM_080597chr184801 732 137 34 --21098 993 --
NM_080664chr1452049 492 379 254 217 --1536 --
NM_080669chr1774618 4312 4303 3889 3876 1571 167 ----1284
NM_080738chr13593 536 475 ----1516
NM_080867chr1484586 4221 3519 3114 1464 1096 980 143 --11926 1516
NM_080872chr894015 2767 1606 1459 1355 1316 1195 643 228 21152 419 22492 672 13062
NM_080927chr331034 965 663 --2536 528 --
NM_130391chr983310 2699 1174 949 907 738 178 49 --23320 1147 --
NM_130392chr983310 2699 1174 949 907 738 178 49 --23320 1147 --
NM_130393chr983310 2699 1174 949 907 738 178 49 --23320 1147 --
NM_130446chr354157 3216 1664 1028 880 31513 1305 457 ----
NM_130797chr751783 1519 1368 703 635 11569 --11595
NM_133170chr20118023 7595 7416 6648 6239 5124 5077 2102 1845 669 648 17642 27724 6143 16130
NM_133264chr1743229 865 373 157 11152 1228 --
NM_133265chrX22264 927 12600 13642 13389
NM_133370chr453543 3202 2629 2606 198 ----1189
NM_133372chr531887 831 104 22411 1996 22043 558 --
NM_133445chr933777 2485 616 2810 294 13524 --
NM_133473chr1921370 206 11627 11672 11791
NM_133478chr242545 2244 2194 72 --12273 --
NM_133482chr511434 ----11505
NM_133496chr154145 3645 3258 2985 917 33930 3097 871 11436 --
NM_133499chrX6749 355 316 192 129 31 1624 ----
NM_133646chr245506 5088 3774 2229 ----15048
NM_138270chrX23342 457 43273 3197 2570 2360 13317 --
NM_138286chr1954323 3471 1192 850 610 --11348 --
NM_138300chr14533 213 104 93 11668 ----
NM_138319chr1541255 461 268 53 --246 42 1869
NM_138338chr2253187 2748 2406 1308 227 1159 2613 200 --
NM_138409chr6166 11359 --174
NM_138457chr6103112 2141 2104 1192 1181 1117 680 545 497 462 13185 23166 1196 12786
NM_138468chr285772 5664 5638 4482 4270 1819 1809 1679 ------
NM_138479chr131981 1555 502 --1329 --
NM_138494chr772839 2385 2218 571 395 314 144 ------
NM_138576chr1433547 1834 1519 33373 3173 1263 1326 11117
NM_138713chr1697910 7231 6715 6404 5708 1770 1764 1179 872 37459 2227 2118 ----
NM_138714chr1697910 7231 6715 6404 5708 1770 1764 1179 872 37459 2227 2118 ----
NM_138727chr131941 680 350 2976 875 ----
NM_138728chr131941 680 350 2976 875 ----
NM_138731chr1431428 1320 697 --1406 11244
NM_138735chr241513 1236 1193 230 ----11248
NM_138771chr731591 1456 30 --134 --
NM_138782chr511700 ----12148
NM_138970chr1431884 1793 49 1305 1945 --
NM_139012chr641965 1429 826 256 ------
NM_139014chr642045 1509 906 336 ------
NM_139132chr115845 446 314 147 39 --2849 112 --
NM_139182chr431370 749 448 21486 1267 ----
NM_139246chr931446 690 353 32137 1755 176 1431 11990
NM_139279chr272550 2323 1400 745 704 600 455 11150 --23130 1105
NM_139283chr1241714 617 413 180 ------
NM_139321chr2043394 737 688 556 --13460 --
NM_139323chr2092020 1671 1659 1642 1628 1434 762 581 495 ------
NM_144567chr142371 1803 656 476 12472 42488 1962 987 559 --
NM_144571chr446141 6132 4719 2675 ----16053
NM_144578chr1435060 3358 1464 --15514 --
NM_144582chr252102 2055 1721 803 716 --11784 --
NM_144599chr1574591 4318 4150 1655 1294 1138 621 23906 1702 ----
NM_144778chr1342593 2540 2199 1086 ------
NM_144963chr842381 2138 791 760 ------
NM_145037chr31236 --3527 433 180 --
NM_145055chr1842816 1307 1013 41 ------
NM_145176chr683255 2765 2506 1172 1076 898 333 275 ------
NM_145206chr1042352 1119 654 210 32169 995 938 ----
NM_198503chr131835 1709 1647 ------
NM_198511chrX2567 197 11244 ----
NM_198595chr494919 4608 4466 3982 3272 1699 1450 839 316 ------
NM_198793chr343095 924 703 86 21571 417 ----
NM_198859chr394933 4595 4211 3684 3293 3265 3259 1557 697 13153 23782 1601 1518
NM_198900chr12157696 7647 7468 7252 6578 6422 2771 2531 2332 1741 1660 1361 667 117 29 47234 5359 4989 4950 16027 --
NM_198990chr7102967 2787 2400 2342 2320 2173 2115 1174 415 97 --12027 --
NM_199000chr792013 1954 1935 1899 1812 1746 1695 823 147 31624 702 552 ----
NM_199132chr19132161 1710 1656 839 755 671 645 587 555 406 378 318 234 132 11700 1742
NM_199160chr941507 1280 474 33 21906 61 2391 50 --
NM_199188chr1253868 3326 2690 2499 1269 12821 23709 2972 --
NM_199190chr1253868 3326 2690 2499 1269 12821 23709 2972 --
NM_199245chr1242480 2101 1900 445 22567 528 1328 --
NM_199320chr452843 1968 1882 775 413 ------
NM_199320chr452843 1968 1882 775 413 ------
NM_199324chr443104 1486 1178 603 22546 744 11322 --
NM_199421chr1484586 4221 3519 3114 1464 1096 980 143 --11926 1516
NM_199482chr242037 1920 705 86 1764 --1184
NM_201266chr272931 2451 2400 2229 2010 742 481 ----12459
NM_201279chr272931 2451 2400 2229 2010 742 481 ----12459
NM_201545chr131337 1070 575 11036 ----
NM_201568chr141830 867 408 293 1138 --1192
NM_201569chr141830 867 408 293 1138 --1192
NM_203327chr2074135 3365 3105 2999 1665 1282 94 1324 ----
NM_203394chr123639 365 115 11850 22449 2128 --
NM_203446chr2162555 2205 2187 785 710 490 11160 ----
NM_203454chr131034 970 909 3932 879 323 ----
NM_203458chr132652 1421 1394 --21058 131 --
NM_203459chr152520 1607 627 256 223 ------
NM_203504chr452315 2167 759 255 186 ----12384
NM_203505chr452315 2167 759 255 186 ----12384
NM_205860chr143049 2817 2751 2126 2580 352 ----
NM_205861chr182087 1572 720 563 538 425 397 53 21593 314 ----
NM_206594chr153683 803 602 510 264 23192 199 ----
NM_206595chr153683 803 602 510 264 23192 199 ----
NM_206853chr653651 3450 3232 794 669 ------
NM_206854chr664912 4711 4493 3275 2055 1930 ------
NM_206855chr665877 5676 5458 4240 4182 313 23952 305 1177 --
NM_206866chr2192761 2572 2295 2165 1007 982 896 353 214 1730 ----
NM_206876chr252697 972 893 519 238 --23096 337 1493
NM_206907chr51577 12875 --21241 734
NM_206909chr8137734 6746 6572 6521 6067 2708 2460 2078 1989 1965 1071 883 369 27794 6817 --1858
NM_206943chr21825 ----1781
NM_206944chr95880 646 628 546 285 ------
NM_206945chr95880 646 628 546 285 ------
NM_206946chr95880 646 628 546 285 ------
NM_206947chr95880 646 628 546 285 ------
NM_207303chr1083748 3630 3084 3062 1098 1024 675 577 13226 33263 3245 880 --
NM_207304chr1352480 2427 2086 1057 973 ------
NM_207344chr1261311 1301 1076 433 378 308 1405 ----
NM_207372chr1022288 1769 ----1104
NM_207406chr4136189 5775 4216 4124 4103 2357 1926 1550 1473 1393 1336 745 147 ------
NM_212464chr1561619 1370 796 761 459 137 11938 ----
NM_212467chr1532196 1947 186 32515 1831 270 --1913
NM_213589chr223520 2223 24585 1893 23751 744 --