TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3170
miRNA Sequence: CUGGGGUUCUGAGACAGACAGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000020chr1272226 2179 2167 909 781 429 390 --2382 327 11815
NM_000037chr8102491 2483 2247 2226 2033 1764 1599 904 866 60 --2437 69 --
NM_000038chr521494 269 21951 275 ----
NM_000052chrX43304 1227 1083 437 12302 11235 --
NM_000074chrX2682 602 1142 2236 103 --
NM_000081chr1------142
NM_000084chrX66769 4533 2501 1841 1813 1555 15792 12530 --
NM_000090chr2----143 124
NM_000093chr9122093 2045 1812 1629 493 461 300 249 231 159 43 34 ------
NM_000109chrX31941 445 101 ------
NM_000112chr525398 4257 --21992 1304 --
NM_000125chr684214 3948 3902 3581 3129 3102 1169 35 --11663 --
NM_000168chr752812 2802 2195 2061 276 23257 2932 11031 1175
NM_000176chr533363 3156 246 32991 2797 2537 ----
NM_000192chr121988 11408 195 1975
NM_000216chrX21352 337 1344 12862 23061 884
NM_000217chr1275026 4730 3677 3525 791 571 419 24082 1816 24760 31 --
NM_000243chr1661013 995 987 844 688 680 --1327 --
NM_000245chr752020 1670 747 721 596 --1394 --
NM_000252chrX31434 1008 226 ------
NM_000259chr1555295 4876 1286 1149 403 15362 21206 1071 --
NM_000264chr963275 1210 1082 469 256 45 1870 1931 --
NM_000267chr1753449 2858 2423 1150 58 --1471 --
NM_000276chrX51502 891 457 331 148 11982 ----
NM_000278chr10132169 2139 1774 828 542 430 327 238 154 145 133 122 68 --1925 --
NM_000297chr421935 1437 ----1536
NM_000304chr1721053 426 --1372 1101
NM_000314chr1033247 2050 152 23209 2673 13272 --
NM_000330chrX2551 63 32011 1958 805 --11407
NM_000332chr665687 4673 4627 2116 803 787 ----14931
NM_000335chr392083 1709 1577 1545 1522 559 415 265 128 --21730 897 --
NM_000353chr165952 944 840 802 468 ------
NM_000361chr2082143 2120 1898 1316 660 622 606 464 --1541 --
NM_000362chr2273489 3133 1236 378 333 183 23 23178 2797 --12704
NM_000368chr984353 4341 4324 3739 1610 1242 911 215 13939 23272 1870 --
NM_000376chr12162696 2664 2562 2519 2348 2262 2085 1162 1061 970 506 479 208 171 113 97 22891 1279 32458 2156 2007 --
NM_000379chr221473 374 11399 11308 1330
NM_000408chr252536 2496 2248 1195 1141 --22191 520 --
NM_000430chr1753032 2548 1259 1168 69 ------
NM_000435chr197988 949 724 714 640 118 43 --1730 --
NM_000448chr1153011 2409 2350 2259 2231 ------
NM_000451chrX71496 1488 650 327 295 122 51 --32099 516 81 --
NM_000476chr9111407 1309 1281 1267 1260 950 464 259 251 40 34 11137 ----
NM_000486chr12112349 2268 2249 2238 2068 1198 935 916 845 359 67 22260 717 32752 2616 2420 --
NM_000492chr73595 284 67 ----11475
NM_000522chr721263 262 1855 1227 --
NM_000544chr6_cox_hap153113 3082 2248 965 794 --2861 676 1849
NM_000555chrX97565 7323 6941 5838 5762 2164 2153 2011 1124 13032 --11929
NM_000599chr2174067 4042 3634 3611 3476 3404 3217 3075 1402 1327 1309 965 597 541 76 54 47 1808 23713 3684 --
NM_000609chr1082906 2854 2365 1073 1056 363 101 25 12037 22818 1233 --
NM_000610chr1162303 2050 2005 591 493 428 ------
NM_000612chr11133777 3700 3525 3270 3197 2892 2630 2452 2327 587 373 340 315 13431 13807 13850
NM_000615chr1152363 2353 1989 1167 835 1323 22609 502 --
NM_000618chr12106017 5979 5957 5515 5372 5111 4175 2416 2050 1770 56205 5173 2495 2346 1319 15256 16092
NM_000618chr12106017 5979 5957 5515 5372 5111 4175 2416 2050 1770 56205 5173 2495 2346 1319 15256 16092
NM_000620chr1272106 1983 1939 1810 821 592 76 11734 1648 11887
NM_000633chr1854591 3180 1459 832 285 13347 --13563
NM_000719chr12146603 6022 5763 5669 5655 5306 5266 5257 4697 2654 2310 835 333 301 35909 5388 469 46532 6001 4466 4296 15772
NM_000725chr1291011 999 357 285 203 180 117 108 60 --1130 --
NM_000813chr524657 3677 11961 35214 4221 3843 25183 2250
NM_000814chr1543138 2827 2671 669 11649 23954 3205 --
NM_000817chr23442 65 54 --1373 --
NM_000826chr4187 ----12471
NM_000827chr552111 2008 588 449 266 157 151 --
NM_000831chr1225994 5964 5882 5811 5730 5448 5402 5282 5071 4931 4857 4722 4610 3896 2136 1282 985 935 794 580 492 23 11235 35817 5412 1879 --
NM_000833chr1611374 21164 579 1587 --
NM_000838chr652657 1880 1867 927 693 1512 ----
NM_000859chr531372 1134 423 ------
NM_000875chr15186410 6307 5964 5849 5063 4318 2626 2397 2108 2013 1987 1859 942 877 865 427 222 105 21978 1354 76456 6425 6042 2715 2502 1024 965 16330
NM_000899chr1224344 637 1721 11621 --
NM_000912chr852958 2713 2256 2248 438 22765 1409 22849 2810 --
NM_000926chr1178966 8869 7847 7279 7117 3521 396 37512 6579 2016 39282 9033 1647 27154 2146
NM_000961chr2093772 3435 3293 1495 556 539 341 59 49 --31410 1354 1275 1844
NM_001001323chr1232741 2389 2366 22830 2335 1155 --
NM_001001344chrX62409 2243 1649 1000 979 862 --22091 1960 --
NM_001001389chr1162303 2050 2005 591 493 428 ------
NM_001001390chr1162303 2050 2005 591 493 428 ------
NM_001001391chr1162303 2050 2005 591 493 428 ------
NM_001001392chr1162349 2096 2051 637 539 474 ------
NM_001001396chr1134214 3887 3596 3500 3079 1699 1665 968 833 589 416 340 190 --2507 30 --
NM_001001419chr531543 1401 235 11222 34722 1325 1130 35247 4742 1727
NM_001001420chr531543 1401 235 11222 34722 1325 1130 35247 4742 1727
NM_001001433chr2063047 2591 2542 2319 1023 979 --32234 2183 2112 --
NM_001001481chr833018 2427 392 21106 500 1960 --
NM_001001484chr1021999 1739 --12310 --
NM_001001664chr243755 1200 1170 500 ------
NM_001001685chr1792893 2574 2250 1897 1108 756 642 623 520 1912 12815 --
NM_001001890chr2184081 4074 3912 1493 1433 971 757 271 21215 1051 12846 --
NM_001001924chr8--165 --1835
NM_001001925chr8--165 --1835
NM_001001928chr22188021 7884 7737 7290 7033 6885 6342 5893 5284 2972 2799 2450 2228 1213 1024 837 695 373 16494 41968 1541 752 619 27839 343
NM_001001931chr8--165 --1835
NM_001002006chr23736 600 161 ------
NM_001002257chr253579 2499 1012 518 401 13078 --12245
NM_001002296chr8121 2397 135 11277 --
NM_001002762chr1082736 2287 2091 2004 1862 353 286 64 --21873 450 --
NM_001002814chr883735 3347 2506 1358 1259 1002 984 770 23414 1399 31174 1118 1039 --
NM_001002838chrX31812 1323 666 11197 ----
NM_001002840chr74696 616 186 122 --1755 --
NM_001002860chr1444124 3247 741 44 --33844 1435 932 --
NM_001002909chr1761622 1401 667 645 528 311 ------
NM_001003407chr1043940 3885 3093 52 34105 3602 1324 21562 542 23431 1084
NM_001003408chr1043940 3885 3093 52 34105 3602 1324 21562 542 23431 1084
NM_001003760chr663218 2571 914 690 566 66 31015 864 635 ----
NM_001003800chr983191 1424 1366 838 745 604 467 196 147 1904 --
NM_001003927chr17------172
NM_001003940chr15153769 3643 3437 3248 3033 2597 1446 999 992 965 874 731 658 630 582 --23572 3134 12838
NM_001003942chr15153769 3643 3437 3248 3033 2597 1446 999 992 965 874 731 658 630 582 --23572 3134 12838
NM_001003943chr15153773 3647 3441 3252 3037 2601 1450 1003 996 969 878 735 662 634 586 --23576 3138 12842
NM_001004065chr913502 13114 63261 3229 2987 2427 479 237 --
NM_001004304chr1293004 2703 2648 2197 2129 2066 325 160 88 12895 22637 168 --
NM_001004317chr654283 4207 3235 1220 51 13557 23082 704 1988
NM_001004342chr1105559 4979 4863 3840 3753 2359 2294 1917 1405 1109 11707 25593 416 --
NM_001004419chr1274403 4303 4046 1145 626 615 439 23980 3820 33591 1620 129 193
NM_001004426chr227574 561 548 477 232 49 26 1567 1185 --
NM_001005386chr221704 442 11657 179 --
NM_001005404chr1782898 2857 2782 1183 1027 979 527 310 21601 821 --11789
NM_001005502chr12125102 5044 4893 4750 3861 3838 1533 945 723 651 517 57 11018 103747 3687 3608 1911 1448 1389 1310 607 438 109 23188 74
NM_001005505chr391611 1589 1262 644 591 497 384 70 35 ------
NM_001005609chrX113290 3083 2673 2386 2353 823 609 368 149 123 67 23268 396 23366 215 21415 285
NM_001005781chr21152 ----190
NM_001006636chr23781 319 184 1198 ----
NM_001006932chr693132 2707 2681 2581 2126 1024 448 152 58 12773 12631 --
NM_001007094chr1064436 3814 3395 2970 1562 1420 13872 21342 469 --
NM_001007097chr984694 4482 4144 3899 3656 1335 1110 349 24298 239 43599 3593 1839 306 --
NM_001007156chr1551858 1828 1532 718 478 ------
NM_001007226chr1761411 1022 532 286 201 136 --1947 --
NM_001007227chr1761411 1022 532 286 201 136 --1947 --
NM_001007228chr1761411 1022 532 286 201 136 --1947 --
NM_001007229chr1761411 1022 532 286 201 136 --1947 --
NM_001007230chr1761411 1022 532 286 201 136 --1947 --
NM_001007237chr142533 2096 745 358 --22450 688 1797
NM_001007246chr2141917 1771 1742 657 ------
NM_001007269chr196688 402 222 200 86 47 1762 1239 --
NM_001007270chr196688 402 222 200 86 47 1762 1239 --
NM_001007559chr1851848 1840 1698 626 55 ------
NM_001008220chr5203869 3743 3668 3448 3348 3152 3032 2993 2625 2486 2467 918 891 718 599 401 291 195 175 27 --32568 683 102 23493 955
NM_001008392chr393418 3143 2683 2388 1155 1129 905 350 43 22365 1416 --1899
NM_001008408chr7116429 6001 5746 5465 5044 4157 2530 2356 1689 655 82 --25693 2406 21031 243
NM_001008539chr894875 4722 4698 1511 1316 1188 1067 223 185 2943 122 15187 11733
NM_001008564chr1341560 779 754 91 --3669 613 538 --
NM_001008660chr112271 254 129 ----
NM_001008738chr552925 2024 1920 1883 948 ------
NM_001008801chr1951708 1540 714 658 44 --11940 --
NM_001008860chr153643 530 193 2705 569 1710 --
NM_001008892chr153643 530 193 2705 569 1710 --
NM_001008894chr153643 530 193 2705 569 1710 --
NM_001009554chr463714 1885 1752 1276 550 340 13299 ----
NM_001009554chr463714 1885 1752 1276 550 340 13299 ----
NM_001009899chr335817 5461 2197 14311 22331 1647 --
NM_001009909chr1122610 2602 --1185 13047
NM_001009955chr14434 417 139 128 1426 ----
NM_001009955chr14434 417 139 128 1426 ----
NM_001009959chr262199 2092 1748 1054 434 60 --1155 1182
NM_001009960chr752771 2551 1923 885 160 --21838 1782 --
NM_001010000chr1832806 2380 1264 ------
NM_001010862chrX43338 1137 371 312 --12017 32895 928 664
NM_001010867chr1216408 6115 5895 5763 5398 4613 4471 4089 2272 2131 2061 1849 1457 1425 947 874 583 351 221 180 161 --34528 1536 1077 --
NM_001010887chr91581 --21824 1502 11703
NM_001010888chrX84090 3547 3434 3251 1416 634 492 140 --1354 --
NM_001010986chrX32091 717 500 1975 1650 --
NM_001011666chr744728 4454 741 316 14460 11302 --
NM_001011708chr232397 384 230 1236 12755 12159
NM_001012329chr192329 2278 2126 975 797 131 120 95 85 1790 21979 1823 --
NM_001012393chr1174643 4022 3519 3207 1356 731 605 ----23774 3755
NM_001012426chr6162774 2766 2497 2478 1369 1095 1089 974 852 563 500 243 203 82 60 37 --22402 75 --
NM_001012427chr6162774 2766 2497 2478 1369 1095 1089 974 852 563 500 243 203 82 60 37 --22402 75 --
NM_001012643chr197549 460 231 186 93 82 32 ------
NM_001012753chr1941267 1099 995 205 --6955 871 433 247 165 81 --
NM_001012755chrX104764 4616 4439 3156 3141 1404 1263 938 356 206 --23492 1412 2954 394
NM_001012756chr1982692 2684 2565 2416 2114 789 509 189 ----12191
NM_001013031chr1063356 2575 2469 897 440 394 1711 22923 734 1828
NM_001013693chr182638 2618 2369 2285 1878 1858 454 439 22759 858 1120 12295
NM_001013693chr182638 2618 2369 2285 1878 1858 454 439 22759 858 1120 12295
NM_001013839chr1782416 2020 1591 800 617 460 384 149 22549 1679 12367 --
NM_001014283chr1341753 1430 625 134 --1882 11926
NM_001014380chr1345150 4748 2182 840 14111 24927 1578 --
NM_001014797chr1067885 7714 7657 7531 6890 2913 25554 1763 22395 2389 --
NM_001015877chrX42293 2139 1229 249 ------
NM_001017368chr1772429 2365 1858 1792 927 766 362 11918 12264 --
NM_001017392chr1941369 1339 998 305 --41259 1201 1122 902 --
NM_001017395chr383681 2721 2445 2247 1371 1046 702 425 23363 1209 --13369
NM_001017524chr1141485 595 206 71 155 21271 334 --
NM_001017535chr12162696 2664 2562 2519 2348 2262 2085 1162 1061 970 506 479 208 171 113 97 22891 1279 32458 2156 2007 --
NM_001017923chr1421615 444 31393 1052 283 1141 --
NM_001017970chr1441765 1709 317 94 --1617 32663 2347 2303
NM_001018037chr921317 420 1921 ----
NM_001018050chr22123424 3339 2869 2612 2519 2478 2372 2314 1240 1232 508 25 23191 1088 ----
NM_001018052chr22123424 3339 2869 2612 2519 2478 2372 2314 1240 1232 508 25 23191 1088 ----
NM_001018064chr941596 1562 1444 397 --11463 --
NM_001018065chr9115745 5715 5642 3727 3655 2219 2024 1226 756 520 203 --25925 4171 23666 1740
NM_001018066chr9115745 5715 5642 3727 3655 2219 2024 1226 756 520 203 --25925 4171 23666 1740
NM_001018074chr533363 3156 246 32991 2797 2537 ----
NM_001018075chr533363 3156 246 32991 2797 2537 ----
NM_001018076chr533363 3156 246 32991 2797 2537 ----
NM_001018077chr533363 3156 246 32991 2797 2537 ----
NM_001018089chr1552484 1528 1316 1008 554 23560 2567 ----
NM_001018108chr1552186 1872 1608 849 24 2744 248 11758 --
NM_001018111chr783542 3301 3225 688 565 291 128 105 23693 56 1465 --
NM_001020818chr1981821 1347 1268 652 639 395 362 37 --11236 --
NM_001020819chr1981821 1347 1268 652 639 395 362 37 --11236 --
NM_001020820chr1981821 1347 1268 652 639 395 362 37 --11236 --
NM_001020821chr1981821 1347 1268 652 639 395 362 37 --11236 --
NM_001024071chr143362 287 171 1371 ----
NM_001024094chr533363 3156 246 32991 2797 2537 ----
NM_001024226chr161081 982 910 896 751 465 --11051 --
NM_001024227chr161081 982 910 896 751 465 --11051 --
NM_001024228chr161081 982 910 896 751 465 --11051 --
NM_001024401chr16112591 2559 2330 2219 2174 1796 1079 1070 460 436 183 --32786 2778 2657 --
NM_001024455chrX92616 2354 2248 1841 997 466 368 342 80 1436 ----
NM_001024593chr102854 383 2950 888 1104 --
NM_001024647chr12157695 7336 6959 6901 6369 6328 5585 5407 5382 5241 4965 1085 621 568 29 17277 55509 5297 5163 2204 2116 16482
NM_001024660chr331042 490 136 21154 181 ----
NM_001024847chr331977 868 775 22090 1615 31776 805 429 1719
NM_001025076chr10115044 4197 4155 4016 1955 1743 1438 1407 1185 215 149 14774 11374 12193
NM_001025077chr1096402 5555 5513 5374 2796 2765 2543 1573 1507 36132 1179 536 22732 1025 --
NM_001025079chr343658 2953 725 715 --23703 2932 --
NM_001025108chr253673 2946 2805 1429 80 --2716 250 --
NM_001025266chr364745 4081 1660 653 255 103 ------
NM_001025616chr43681 182 45 --21785 1275 --
NM_001025780chr951387 1143 1135 993 494 ------
NM_001029858chr673212 2916 2482 1272 781 684 235 12583 32829 2794 403 --
NM_001029861chr196864 806 378 246 168 51 --1117 --
NM_001029863chr642142 240 150 32 2466 160 ----
NM_001029864chr2081956 1006 827 733 658 512 305 178 12438 11566 --
NM_001029997chr193298 242 203 ------
NM_001030007chr1673794 3729 3691 2750 2642 887 31 11053 ----
NM_001031679chr12103530 3165 2802 2535 2460 2383 1100 947 922 703 --21187 780 --
NM_001031680chr1132437 2160 2109 2096 970 683 469 447 427 419 300 252 207 141 ----
NM_001031690chr782851 2838 1933 1918 747 722 492 463 ------
NM_001031695chr22125170 4991 4920 4595 4421 3607 3469 1726 1307 734 161 34 12051 15157 13440
NM_001031740chr141660 1307 1175 628 --31746 1440 27 --
NM_001031804chr16114083 3984 3592 3502 1387 1314 1203 564 341 203 102 13106 14287 --
NM_001032289chrX6789 722 266 115 65 47 ------
NM_001032296chr1372169 1131 462 388 311 123 92 1690 1361 12320
NM_001032363chr182251 2109 1908 1900 1762 1390 611 338 --32033 876 126 --
NM_001032363chr182251 2109 1908 1900 1762 1390 611 338 --32033 876 126 --
NM_001032380chr1011775 --1756 21526 600
NM_001033044chr141545 1450 47 29 153 21769 1322 --
NM_001033045chr273722 3330 3305 3162 1606 597 97 23711 303 64200 3086 512 454 375 21 --
NM_001033047chr442254 2228 626 26 --11064 1171
NM_001033056chr141545 1450 47 29 153 21769 1322 --
NM_001033081chr171560 1390 1259 605 539 121 58 --11349 --
NM_001033082chr171560 1390 1259 605 539 121 58 --11349 --
NM_001033117chr3104738 4162 3464 1878 1709 876 797 780 766 520 1998 33596 936 187 1245
NM_001033518chr762777 1826 1756 1129 523 281 --1154 22489 1121
NM_001033519chr762777 1826 1756 1129 523 281 --1154 22489 1121
NM_001033520chr762777 1826 1756 1129 523 281 --1154 22489 1121
NM_001033551chr17174101 4043 3777 3671 3650 3478 3379 3243 3202 2832 2594 2533 2524 1271 1241 1095 50 --1287 --
NM_001033723chr862360 2331 2270 961 630 591 ----1997
NM_001034841chr1654913 4798 4629 4621 1061 25420 5286 12146 --
NM_001034915chr8168 --1366 11174
NM_001035254chr9101839 1733 1634 1577 636 624 612 606 415 130 --11961 --
NM_001037290chr112747 232 2680 88 1187 --
NM_001037334chr1832427 510 111 1778 ----
NM_001038493chr231214 369 318 --11391 2169 66
NM_001038707chr182077 837 559 372 270 186 109 37 ------
NM_001038707chr182077 837 559 372 270 186 109 37 ------
NM_001039199chr2094791 3713 1715 1505 805 768 529 357 184 13172 94325 3737 3628 3571 2016 1643 1364 1287 234 34383 3493 479
NM_001039467chr205628 498 458 235 24 --2478 192 --
NM_001039479chr1472016 1624 1578 1527 961 374 167 ------
NM_001039538chr242959 2842 2809 1005 11468 ----
NM_001039547chr3117648 7480 5957 5443 5286 5239 5107 2835 2693 2158 1208 25271 210 77062 5586 5507 5365 5332 2215 2085 15801
NM_001039570chr22154252 4005 3877 3801 3279 3174 3125 3014 2930 2872 1600 1008 640 132 63 33696 1651 1347 51458 1381 923 867 788 --
NM_001039571chr22154252 4005 3877 3801 3279 3174 3125 3014 2930 2872 1600 1008 640 132 63 33696 1651 1347 51458 1381 923 867 788 --
NM_001039577chr194375 4344 4217 4124 3593 3127 3106 1558 1211 1868 1862 --
NM_001039590chrX53626 2959 2606 1389 1043 --11069 --
NM_001039591chrX53626 2959 2606 1389 1043 --11069 --
NM_001039690chr1682215 933 662 574 509 378 187 37 2809 384 3432 390 309 22253 631
NM_001039762chr1021773 1463 1628 --11972
NM_001039840chrX65232 4641 4597 1684 545 388 34233 3857 1712 ----
NM_001039877chr196885 702 658 571 345 160 ----1838
NM_001039888chr11582 ----2780 529
NM_001039916chr122334 302 ----2785 419
NM_001039917chr122334 302 ----2785 419
NM_001039918chr122334 302 ----2785 419
NM_001039919chr122334 302 ----2785 419
NM_001039920chr122334 302 ----2785 419
NM_001040002chr1741162 1059 999 39 21352 62 21338 67 1535
NM_001040144chr1682215 933 662 574 509 378 187 37 2809 384 3432 390 309 22253 631
NM_001040146chr1682215 933 662 574 509 378 187 37 2809 384 3432 390 309 22253 631
NM_001040151chr11134578 4347 4023 4003 3762 3582 3140 1246 1220 1078 615 101 55 31229 294 93 43354 3012 262 192 13552
NM_001040152chr784992 4759 4751 1812 1478 942 572 240 43410 917 741 385 35037 4852 1743 --
NM_001040214chr632032 426 343 --21815 593 1609
NM_001040280chr651651 1554 263 148 122 11197 ----
NM_001040402chr433221 2566 2340 --22596 880 12307
NM_001040429chr1333426 3072 2242 --1415 --
NM_001040441chr1125281 5256 5114 4955 4726 4701 3487 1904 1879 1050 1025 883 15287 115171 5035 5001 4617 4561 3733 1794 1739 1661 1324 940 1808
NM_001040458chr52320 312 21670 1266 ----
NM_001040624chr862643 2405 2031 1726 972 392 --1192 --
NM_001040625chr862643 2405 2031 1726 972 392 --1192 --
NM_001040626chr862643 2405 2031 1726 972 392 --1192 --
NM_001040627chr862643 2405 2031 1726 972 392 --1192 --
NM_001040628chr862643 2405 2031 1726 972 392 --1192 --
NM_001040629chr862643 2405 2031 1726 972 392 --1192 --
NM_001040630chr862643 2405 2031 1726 972 392 --1192 --
NM_001040712chr943343 3283 2672 2274 1261 11121 --
NM_001042404chr141332 751 363 116 --11992 --
NM_001042413chr973166 3131 755 714 510 309 298 2879 387 1873 1368
NM_001042473chr1031987 1436 48 --32123 1715 1444 --
NM_001042486chr2051567 1419 1318 1239 291 --1607 11206
NM_001042492chr1753449 2858 2423 1150 58 --1471 --
NM_001042494chr1583520 3481 2737 2586 2450 2435 2345 1521 --22745 1386 1780
NM_001042495chr1583520 3481 2737 2586 2450 2435 2345 1521 --22745 1386 1780
NM_001042496chr1583520 3481 2737 2586 2450 2435 2345 1521 --22745 1386 1780
NM_001042497chr1583520 3481 2737 2586 2450 2435 2345 1521 --22745 1386 1780
NM_001042498chrX6926 859 403 252 202 184 ------
NM_001042555chr1223505 90 13077 --14808
NM_001042599chr2107793 7431 7136 6553 6538 5599 5024 4953 4840 1954 36531 1761 90 11123 15336
NM_001042603chr1264863 3260 1800 1377 616 566 54813 4389 4137 984 603 11331 14171
NM_001042604chr321749 1716 1227 11764 11881
NM_001042646chr381626 1521 728 448 356 337 230 140 ------
NM_001042669chr43681 182 45 --21785 1275 --
NM_001042681chr132477 2310 2296 22260 1624 136 --
NM_001042682chr132477 2310 2296 22260 1624 136 --
NM_001042682chr132477 2310 2296 22260 1624 136 --
NM_001042683chr631614 1256 543 ----1669
NM_001043318chr14123528 3409 2843 2835 2685 2535 1453 1424 1395 742 279 30 21647 925 33663 1414 931 --
NM_001043351chr142177 1617 1475 370 --1501 --
NM_001044305chr6--31339 572 370 1364 11270
NM_001044385chr243606 1486 940 878 1962 --13183
NM_001048183chr1163416 3015 2838 2820 2812 2704 2671 2514 2489 2347 1417 1272 1121 1066 951 459 --2833 754 32405 1195 697
NM_001083620chr4187 ----12469
NM_001092chr1762277 2222 208 107 91 42 --42543 2118 2028 189 12037
NM_001095chr1281623 1512 1350 1289 716 668 245 177 1413 41750 775 544 538 21701 691
NM_001100108chr1107843 7649 7060 7041 6432 6294 5659 2788 2646 127 --77917 7361 6212 6159 6080 5517 5440 --
NM_001106chr3138370 8106 7438 7369 7362 7285 7122 7003 3256 1462 1203 1145 1117 39736 7234 1447 67135 6693 6180 2636 1920 82 18919
NM_001113490chrX103588 3465 3147 2862 2806 2728 2497 2455 595 475 ------
NM_001116chr1662741 2370 2332 2238 2198 1029 21062 1039 22761 208 --
NM_001128chr1673794 3729 3691 2750 2642 887 31 11053 ----
NM_001135chr152235 65 1689 2140 114 --
NM_001167chrX126259 6119 5826 5282 4517 4491 4467 4266 2076 1932 1519 802 35710 2647 2085 46041 5966 4181 4126 --
NM_001174chrX101975 1573 906 724 710 661 581 527 474 132 189 ----
NM_001191chr2091413 1406 1172 1046 952 375 314 198 189 --1935 --
NM_001198chr621670 548 21929 1720 186 1153
NM_001200chr201958 --2273 82 --
NM_001204chr2107391 5445 5128 5098 5073 4813 2464 2009 1501 602 15152 55768 5158 4928 4852 2983 --
NM_001218chr1572546 2095 1910 1830 842 176 51 187 ----
NM_001248chr32337 208 --11018 --
NM_001284chr51548 ----1476
NM_001329chr102609 389 11493 11372 --
NM_001331chr1161831 1020 691 663 308 160 11802 12013 22553 2282
NM_001346chr382789 2677 2461 1795 1738 711 328 277 22863 2502 ----
NM_001356chrX1236 1259 --12384
NM_001364chr1184717 3799 3702 3076 1511 497 301 254 13682 31665 605 381 12945
NM_001387chr5102769 2577 2548 2461 2334 2312 2226 2097 2069 1941 1967 12938 --
NM_001390chr1863566 2858 2332 2251 586 180 1671 23300 2462 --
NM_001399chrX113290 3083 2673 2386 2353 823 609 368 149 123 67 23268 396 23366 215 21415 285
NM_001406chr1771722 1254 698 628 550 180 115 21572 1288 ----
NM_001407chr361563 1455 1306 339 122 68 188 21524 362 --
NM_001408chr181671 1273 1110 1048 659 229 194 169 11351 ----
NM_001419chr19103806 3665 3627 3584 3487 3191 1452 1077 800 313 13597 44305 1877 699 182 --
NM_001420chr19142928 2826 2550 2458 1215 1144 1132 1105 862 457 393 234 215 129 --1109 --
NM_001423chr1251519 707 679 300 175 --21256 324 1140
NM_001427chr741766 713 617 292 2516 496 ----
NM_001430chr251757 1514 1372 1304 1269 --11902 1600
NM_001431chr631150 928 44 ------
NM_001438chr112610 --12983 13609
NM_001453chr62307 108 ----134
NM_001465chr5--11585 --2776 131
NM_001493chrX6771 706 678 495 101 30 --2663 130 --
NM_001498chr621238 942 11040 ----
NM_001542chr142533 2096 745 358 --22450 688 1797
NM_001543chr5144341 4181 3554 3457 3030 1846 1525 1384 1239 911 902 687 621 50 --33647 1613 1105 --
NM_001587chrX51502 891 457 331 148 11982 ----
NM_001616chr273448 3306 3257 2518 1097 595 575 --23460 849 --
NM_001621chr742219 2209 2079 454 --22003 699 11943
NM_001621chr742219 2209 2079 454 --22003 699 11943
NM_001642chr1131296 1247 56 --1288 --
NM_001650chr1853592 2985 2558 876 490 12721 23302 1368 --
NM_001655chr1182132 1470 679 666 600 574 433 103 ------
NM_001658chr161081 982 910 896 751 465 --11051 --
NM_001659chr1292357 2067 2004 1680 1078 649 188 64 29 12587 31772 1707 1057 --
NM_001663chr1422193 669 ----12418
NM_001678chr1771679 1642 1599 1476 1399 747 413 186 1212 --
NM_001682chr1232455 2103 2080 22544 2049 ----
NM_001684chr1123931 3604 3313 3217 2796 1416 1382 685 550 306 133 57 --1224 --
NM_001709chr1122382 754 ----22074 1039
NM_001748chr12977 231 2781 92 11022 --
NM_001754chr2184081 4074 3912 1493 1433 971 757 271 21215 1051 12846 --
NM_001759chr12104919 4627 4380 3954 3932 3793 3716 2056 1989 224 --13647 --
NM_001777chr343658 2953 725 715 --23703 2932 --
NM_001789chr331319 547 480 11477 11289 --
NM_001821chr143508 1619 969 851 --11686 --
NM_001830chrX63840 2796 1507 1491 1332 1041 23035 78 22976 203 --
NM_001845chr1341131 524 483 94 --2293 72 --
NM_001855chr92736 729 2257 151 1237 1658
NM_001858chr635019 938 73 --25090 3175 --
NM_001859chr963836 3811 3314 1258 759 191 --63726 3670 785 674 618 538 12438
NM_001874chr12125102 5044 4893 4750 3861 3838 1533 945 723 651 517 57 11018 103747 3687 3608 1911 1448 1389 1310 607 438 109 23188 74
NM_001918chr1248680 8529 8506 8325 8143 7155 7123 7020 6982 6867 6679 6621 6478 6073 5766 5650 5640 5629 3111 3084 2603 1870 1588 543 37734 7132 6938 87384 2464 1721 1642 1509 458 323 55 --
NM_001939chrX43178 731 211 100 3919 498 399 23352 1490 --
NM_001945chr551447 1319 1150 1126 1072 --21310 269 --
NM_001980chr1251854 853 613 589 441 11483 ----
NM_001982chr122443 101 --2818 214 11101
NM_001991chr1792119 1986 1770 1731 1717 1590 1574 420 111 ------
NM_002006chr41552 1941 12015 1996
NM_002015chr1352769 2359 2234 137 92 12798 22892 2227 12899
NM_002023chr161599 1215 1058 500 361 35 1553 2651 261 --
NM_002025chrX88798 8660 8588 7806 7714 7374 6642 475 11818 32222 742 79 28001 1257
NM_002035chr1863382 3001 2728 1282 888 654 --23232 3155 12530
NM_002061chr161947 1806 1715 1497 1472 190 --41863 1729 1332 1255 --
NM_002065chr141545 1450 47 29 153 21769 1322 --
NM_002077chr951831 1824 1545 275 257 --2446 173 --
NM_002081chr2121624 1520 1510 1488 1248 1213 583 557 458 315 254 79 --1154 --
NM_002092chr484727 4604 4372 4215 4037 3628 3544 911 23947 1417 13335 --
NM_002126chr1723583 613 13637 1663 --
NM_002254chr2102328 1857 1773 1440 901 839 430 398 391 57 --3600 558 527 --
NM_002264chr393605 3368 1934 1712 1007 891 497 245 170 34882 4817 4303 23925 1207 11614
NM_002270chr544754 1782 1654 254 1618 1144 1139
NM_002271chr1332114 1811 1566 ----137
NM_002285chr253673 2946 2805 1429 80 --2716 250 --
NM_002290chr61975 ----11179
NM_002293chr182799 2337 2073 1118 1030 931 375 94 ------
NM_002309chr2262465 2376 1973 1021 389 152 42929 2169 466 129 ----
NM_002310chr574806 4397 2444 1960 1928 1855 320 26108 4951 16323 --
NM_002313chr1043940 3885 3093 52 34105 3602 1324 21562 542 23431 1084
NM_002332chr124701 553 285 70 1503 2521 509 1516
NM_002349chr2--3419 211 187 ----
NM_002356chr622456 192 11995 ----
NM_002359chr1784034 3772 2957 2815 1503 929 167 147 23067 243 1442 --
NM_002373chr1561126 1087 907 548 329 265 21145 893 1364 --
NM_002374chr242959 2842 2809 1005 11468 ----
NM_002381chr2------1691
NM_002387chr594726 3409 1886 1774 1496 1034 879 335 153 33194 2047 144 15125 --
NM_002390chr1771442 1414 641 621 280 124 116 11294 ----
NM_002397chr531786 1692 1676 2858 496 21775 874 --
NM_002399chr154223 160 139 131 21238 287 1262 --
NM_002401chr17102369 2040 1992 1844 1726 1717 1009 946 289 199 22069 2049 12229 --
NM_002407chr11------1132
NM_002430chr2292308 2209 2173 1989 1982 1027 574 256 77 --32165 1822 1719 1201
NM_002442chr12121597 1179 1173 1165 1140 1102 658 415 287 144 82 28 --21356 525 --
NM_002445chr831605 564 227 2389 219 ----
NM_002467chr8----191 1373
NM_002481chr1137677 7665 6470 4849 2320 2295 1401 965 766 621 435 294 193 32040 364 201 33051 2401 2076 47860 5496 5060 2362
NM_002501chr19243713 3662 3635 3557 3380 3374 3257 3013 2792 1456 1402 1333 1053 977 928 795 757 711 689 665 365 213 202 119 --2467 138 --
NM_002507chr17151893 1883 1845 1412 783 504 487 476 462 384 311 244 133 61 30 21656 148 11553 --
NM_002508chr191817 1611 661 572 336 316 284 238 218 --11588 31722 1479 132
NM_002515chr1461530 1319 787 756 46 34 ------
NM_002518chr22130 94 ----1830
NM_002522chr17133695 2909 2613 2478 1188 1179 1164 964 810 715 378 238 170 11540 2477 199 --
NM_002545chr1174643 4022 3519 3207 1356 731 605 ----23774 3755
NM_002546chr82292 46 ----1184
NM_002577chr373982 2709 2566 1241 994 322 191 ------
NM_002581chr9105327 5183 4722 4330 4226 2265 1534 1082 993 758 3692 660 215 34026 1815 697 --
NM_002586chr671482 1111 1007 550 407 336 295 ----182
NM_002588chr5101709 1646 1093 528 369 347 312 292 219 97 1375 21451 1128 --
NM_002609chr581685 1669 1498 1349 1234 1220 478 349 21441 153 ----
NM_002610chr262821 1255 914 849 828 162 --11042 --
NM_002612chr73238 117 80 ------
NM_002628chr31172 1828 --148
NM_002645chr1122940 919 ----21230 255
NM_002651chr11256 --2912 88 174
NM_002655chr834274 3601 957 --21338 296 1626
NM_002657chr20143769 3629 3404 3203 3049 2913 2643 2425 1131 967 595 420 308 61 --33702 1505 201 1196
NM_002698chr19152961 2869 2804 2721 1980 1904 1204 1063 746 739 707 628 252 112 42 1521 32758 803 670 12105
NM_002715chr52824 812 ----179
NM_002718chr372452 2192 2168 1952 985 647 199 --12124 --
NM_002726chr61346 --1468 142
NM_002730chr1991274 1231 933 423 406 264 256 128 95 --2382 315 1893
NM_002736chr722037 236 1891 11714 --
NM_002737chr17216620 5794 5345 5333 5249 4908 4900 4758 4104 4037 2576 2544 2366 2273 1811 1412 527 361 296 267 35 12619 26317 631 36456 2673 74
NM_002745chr2234225 468 73 13616 24197 914 13254
NM_002776chr1981792 1328 807 648 614 587 170 129 --31357 1243 368 --
NM_002827chr2081689 1341 1329 1105 394 359 335 308 ------
NM_002828chr18--194 1846 1193
NM_002833chr1531415 1389 309 11466 11407 --
NM_002838chr1--21201 474 1984 127
NM_002839chr943343 3283 2672 2274 1261 11121 --
NM_002847chr761602 1581 1207 659 38 31 ------
NM_002855chr11193462 3429 3307 3276 3249 3078 2829 2689 1433 1395 1082 975 892 851 268 134 127 85 45 22459 995 ----
NM_002858chr1----1373 1865
NM_002859chr1291704 1637 1557 1523 1454 1219 314 273 113 ------
NM_002886chr343277 1995 1759 1103 --1608 14276
NM_002892chr1431429 59 51 ------
NM_002941chr331584 1414 609 --2414 194 --
NM_002959chr194319 3931 3410 3256 2721 929 559 369 180 1525 3945 387 338 --
NM_002996chr1661954 787 450 320 283 226 --1481 2290 233
NM_003016chr17------2530 41
NM_003028chr9113733 3071 3014 2891 2622 2529 1514 1027 799 418 213 --13691 --
NM_003034chr1297023 6585 6577 6436 5225 4989 2349 938 514 163 16653 --
NM_003043chr3123938 3513 3440 3262 3032 3013 1600 1572 1389 1135 656 605 13192 1753 --
NM_003045chr13134178 4117 3675 3567 3556 3292 1253 1098 860 499 296 70 36 1403 44345 3780 434 153 --
NM_003046chr894875 4722 4698 1511 1316 1188 1067 223 185 2943 122 15187 11733
NM_003074chr331832 1662 22 --21976 626 --
NM_003088chr791180 938 871 723 419 302 104 65 52 --2899 129 --
NM_003099chr15145961 5801 5330 5146 4680 4345 1930 1863 1817 1284 1249 565 111 76 22114 1259 25792 2606 25453 5285
NM_003106chr311074 1829 2184 140 --
NM_003108chr296850 6820 6697 6536 2755 1342 1252 936 893 27260 2410 ----
NM_003112chr713121 --22833 829 --
NM_003128chr242300 1927 1767 759 --1984 --
NM_003131chr6151897 1872 1724 1706 1699 1691 1574 1419 878 814 416 323 262 215 151 ------
NM_003155chr832432 1017 370 32188 1049 168 126 --
NM_003161chr1722991 2249 23470 575 ----
NM_003173chrX51351 1338 1104 226 173 1402 41399 423 326 201 --
NM_003178chr351661 1516 733 431 402 --12202 --
NM_003179chrX101461 1413 1391 1373 1273 1106 904 237 184 82 --1461 --
NM_003199chr1855623 5114 3965 1765 97 ------
NM_003200chr1992129 1920 1784 1667 763 746 100 75 55 --11464 11944
NM_003202chr551643 1501 1321 1255 446 --31558 1423 140 --
NM_003214chr641085 990 279 145 11028 11270 --
NM_003216chr22102963 2863 2780 973 927 894 462 405 70 40 --12543 --
NM_003221chr694099 4090 3866 3597 3253 3031 2878 2678 483 11223 12816 --
NM_003234chr322317 114 11539 1622 --
NM_003236chr293322 3237 3009 2676 2524 2339 674 492 168 1580 ----
NM_003242chr331977 868 775 22090 1615 31776 805 429 1719
NM_003247chr631969 1458 59 --31988 750 487 1154
NM_003253chr212412 319 ----1201
NM_003262chr355112 5079 4631 4487 3664 ----1372
NM_003281chr1205356 5116 5089 4855 4546 4337 3824 1779 1650 1637 1594 1419 1355 1315 1277 1052 792 645 260 201 24202 2142 33986 2161 1679 11909
NM_003286chr201431 ----1851
NM_003304chr311295 ----1545
NM_003342chr1733244 765 493 ------
NM_003347chr2292015 1982 1933 1782 908 537 425 65 42 12216 1623 --
NM_003369chr1172493 2163 1848 889 575 564 71 1750 21828 904 --
NM_003370chr193560 493 130 --2633 285 1145
NM_003371chr991833 1586 827 711 656 541 432 104 50 --1238 12085
NM_003373chr1031866 775 34 1248 1575 1399
NM_003387chr242923 1100 816 289 --1546 --
NM_003392chr353599 2833 1737 509 25 1298 1918 13739
NM_003404chr2051966 1751 1544 1354 696 ------
NM_003410chrX32153 2026 248 --12215 1929
NM_003412chr383036 2618 2189 2067 1972 110 98 80 12877 22172 31 22566 290
NM_003421chr1064436 3814 3395 2970 1562 1420 13872 21342 469 --
NM_003439chr793157 3100 2490 2349 2194 1067 850 736 196 --42569 2514 2406 2270 1710
NM_003442chr112273 173 1869 ----
NM_003455chr113390 263 169 11519 11349 11525
NM_003458chr3103532 2648 1495 1478 1378 908 797 341 328 126 23495 2674 11097 --
NM_003459chr2123 1469 4165 159 153 47 --
NM_003463chr63991 638 160 --1406 --
NM_003466chr2102453 2359 2234 2132 1980 686 558 523 284 61 12411 21750 742 --
NM_003468chr233951 3323 236 --33279 3210 553 --
NM_003469chr2122 143 --154
NM_003482chr12112548 2406 2398 2037 1023 763 734 681 663 130 47 21721 746 1996 1440
NM_003483chr1232547 206 28 31114 475 463 12398 --
NM_003507chr252023 1636 1452 395 31 ----11848
NM_003528chr151592 1394 1265 1164 336 155 1416 --
NM_003557chr151306 309 277 241 72 21340 53 1597 --
NM_003559chr17113880 3842 3815 3731 3624 3574 3323 2868 2819 822 786 --2807 218 11545
NM_003560chr227574 561 548 477 232 49 26 1567 1185 --
NM_003563chr1761411 1022 532 286 201 136 --1947 --
NM_003566chr1241135 765 666 221 --22428 1320 12580
NM_003574chr18105451 5170 1924 1882 1748 1687 1569 914 708 345 --33685 653 406 --
NM_003576chr1372169 1131 462 388 311 123 92 1690 1361 12320
NM_003583chr1233322 869 383 13145 23176 1222 11178
NM_003590chr243408 2683 944 900 --11484 --
NM_003607chr133776 2816 1709 --11322 11250
NM_003615chr332865 2575 2553 --13598 --
NM_003617chr174884 4076 3749 3255 1949 1777 55 14266 21121 126 --
NM_003637chr141228 1116 435 182 --21109 972 --
NM_003644chr17186502 6457 6450 6343 6188 5485 5350 5334 5262 5093 4199 4157 2532 1276 1230 835 640 232 16138 16219 2659 344
NM_003651chr121447 ----1372
NM_003663chr333075 2280 158 --11154 --
NM_003671chr923181 1196 --11344 1871
NM_003677chr1262299 1951 1637 679 655 513 --12093 --
NM_003679chr193409 3253 2702 2498 2251 2115 874 848 732 ------
NM_003735chr5101709 1646 1093 528 369 347 312 292 219 97 1375 21451 1128 --
NM_003736chr5101709 1646 1093 528 369 347 312 292 219 97 1375 21451 1128 --
NM_003743chr221447 394 22015 484 32200 1648 489 --
NM_003758chr153572 135 45 ------
NM_003758chr153572 135 45 ------
NM_003759chr453666 3216 1163 771 343 --152 --
NM_003760chr11109 ----1645
NM_003762chr121358 1223 ------
NM_003763chr2063047 2591 2542 2319 1023 979 --32234 2183 2112 --
NM_003825chr1541261 977 581 416 11212 ----
NM_003872chr252320 2215 1100 947 521 --22690 583 --
NM_003899chr1372524 1640 1580 1038 395 353 254 1676 ----
NM_003930chr771948 1938 978 953 819 764 90 ------
NM_003939chr1063817 3047 2742 2551 1583 272 13954 1812 1528
NM_003941chr73447 357 155 ----1851
NM_003947chr31314 176 1945 2921 915
NM_003948chr452340 915 740 610 222 180 ----
NM_003958chr683853 3289 3224 1201 979 738 665 376 33726 2955 1013 23505 2743 --
NM_003966chr5157700 7325 6947 6670 4901 4884 3117 2545 2496 2477 1068 880 619 57 33 --27622 2285 --
NM_003983chr1664421 4139 3989 3606 3354 1550 --23929 1127 21090 186
NM_003987chr10132169 2139 1774 828 542 430 327 238 154 145 133 122 68 --1925 --
NM_003988chr10132246 2216 1851 905 619 507 404 315 231 222 210 199 145 ------
NM_003994chr1224344 637 1721 11621 --
NM_004006chrX31941 445 101 ------
NM_004007chrX31941 445 101 ------
NM_004009chrX31941 445 101 ------
NM_004010chrX31941 445 101 ------
NM_004011chrX31941 445 101 ------
NM_004012chrX31941 445 101 ------
NM_004013chrX31941 445 101 ------
NM_004014chrX31941 445 101 ------
NM_004015chrX31941 445 101 ------
NM_004017chrX31941 445 101 ------
NM_004020chrX31941 445 101 ------
NM_004024chr15533 423 320 302 149 --2578 467 --
NM_004028chr1853592 2985 2558 876 490 12721 23302 1368 --
NM_004050chr1432031 1099 603 --32555 2276 1073 --
NM_004055chr1171853 1615 1383 910 731 602 408 1240 1531 --
NM_004079chr182808 2398 1893 1875 1867 1092 603 390 --3306 249 170 1869
NM_004090chr1752941 2374 2210 661 376 22289 404 22561 852 --
NM_004096chr1031845 1717 465 ----12156
NM_004112chr1781757 1722 1385 1378 1199 701 595 345 21395 1309 21702 1444 --
NM_004124chr1413493 1751 12200 --
NM_004157chr33903 802 654 1243 ----
NM_004171chr11149346 9222 9077 9025 7271 6894 6567 6498 6131 6032 2171 474 364 35 26846 1671 48731 6597 1776 1221 --
NM_004183chr112578 260 --1156 1539
NM_004187chrX61400 1064 1050 403 182 38 1164 --1996
NM_004200chr11152941 2934 2624 2541 2349 2304 2233 2148 1000 979 963 942 394 308 87 11999 23026 177 --
NM_004227chr782619 2283 1981 1177 931 856 746 622 --140 --
NM_004230chr19102182 1953 1798 958 903 895 744 227 108 66 11807 32251 1529 1454 --
NM_004232chr18------1362
NM_004233chr651651 1554 263 148 122 11197 ----
NM_004247chr17271 49 ----1272
NM_004273chr1085034 4737 4481 3856 1677 893 750 156 34403 3842 1771 54990 4891 3928 3694 1572 --
NM_004296chr14114006 3822 3256 3053 2678 2446 1610 971 288 265 41 --32787 911 598 --
NM_004308chr11101834 1660 1400 1393 1304 734 668 293 82 25 1437 41771 1587 487 285 --
NM_004311chr10103051 2998 2832 2499 2314 2156 1175 696 670 149 12019 ----
NM_004316chr1221145 379 1262 1181 --
NM_004319chr172880 2625 1199 908 620 443 107 ------
NM_004321chr293460 3454 3165 3120 2265 597 442 119 84 1757 22256 1162 11339
NM_004342chr731792 1546 129 ------
NM_004349chr841018 902 459 331 --11040 --
NM_004350chr1132437 2160 2109 2096 970 683 469 447 427 419 300 252 207 141 ----
NM_004360chr1681822 1527 1440 1296 768 681 575 24 ------
NM_004363chr1931245 332 308 --31101 1024 167 --
NM_004371chr141164 1139 599 378 1122 21055 299 --
NM_004379chr241775 1760 385 253 --31674 1618 1539 --
NM_004380chr1632198 2122 2111 11908 12403 22541 2497
NM_004391chr3101916 1868 1481 1409 1290 1274 576 411 225 86 ----180
NM_004393chr352032 1978 1859 1845 673 1860 12114 1175
NM_004397chr1123733 3390 13160 13446 34341 748 314
NM_004414chr2111439 --1120 11542
NM_004417chr5244 33 1440 ----
NM_004420chr11112379 2367 2161 2051 1513 974 767 600 585 417 301 12256 1780 --
NM_004423chr3202750 2698 2338 1945 1807 931 903 889 848 715 682 471 457 331 312 256 233 207 187 39 12562 31729 723 431 --
NM_004430chr841029 790 371 351 1613 1902 --
NM_004437chr153547 2860 1380 760 292 2994 23 22939 1148 1331
NM_004438chr283341 2668 2109 1120 1012 808 647 45 12712 22198 640 --
NM_004440chr661782 1478 1410 1232 278 154 ------
NM_004442chr161277 698 537 365 53 38 11370 --1616
NM_004457chr2----192 1292
NM_004458chrX31900 888 56 ------
NM_004463chrX6221 126 104 72 33 26 1502 1439 --
NM_004464chr454029 3643 3386 1013 614 ------
NM_004481chr1102169 2130 1998 1941 1888 1005 552 429 388 108 --11747 --
NM_004491chr19123312 3203 1490 1356 1334 1179 996 708 645 411 286 134 21400 758 ----
NM_004494chr15943 936 525 93 25 2142 106 ----
NM_004496chr141425 ----2225 113
NM_004500chr1441378 751 681 31 ------
NM_004501chr143993 1115 1102 482 13923 2891 207 --
NM_004514chr1752744 2606 2482 985 478 ------
NM_004516chr1921255 431 2914 43 --159
NM_004527chr1741162 1059 999 39 21352 62 21338 67 1535
NM_004560chr96959 666 339 60 48 37 --11028 --
NM_004561chr1171501 1215 642 482 364 125 91 --11517 137
NM_004565chr13716 302 291 --6594 507 223 217 211 205 1502
NM_004571chr21113151 2883 2733 2552 2520 2496 1229 1118 983 566 289 --13253 --
NM_004586chrX54613 1731 1458 1209 830 13351 34028 1589 1510 14604
NM_004598chr552997 2411 1292 1012 916 180 12805 21245 331
NM_004612chr964708 4465 3895 3319 535 82 14021 23618 3169 --
NM_004613chr2071390 1347 1222 524 99 93 32 258 46 21540 560 --
NM_004615chrX4831 697 298 135 1277 1271 --
NM_004630chr1121020 270 --169 1981
NM_004637chr361220 1201 1024 492 485 154 --2219 134 11068
NM_004673chr121265 449 --11424 --
NM_004694chr173550 99 90 ------
NM_004703chr1722372 342 1330 1224 11695
NM_004717chr71596 21201 1018 21331 1159 --
NM_004726chrX23552 1909 12060 25199 1149 15267
NM_004736chr131562 662 71 1152 21784 880 --
NM_004745chr8136099 6029 5569 4508 4375 2399 2310 1910 1796 1687 1590 1538 411 11466 46035 4637 4257 649 --
NM_004747chr1041055 525 408 389 --1569 1466
NM_004772chr53985 294 236 ------
NM_004774chr1772209 2179 2165 1157 1060 605 169 ------
NM_004781chr13627 480 39 1168 ----
NM_004781chr13627 480 39 1168 ----
NM_004798chr2073251 2931 2866 2855 577 539 186 --33267 2375 475 1726
NM_004804chr262774 2307 2282 1787 549 65 21713 370 12608 12064
NM_004807chr2152674 2397 2228 2015 1695 1669 1051 943 680 599 568 524 480 473 457 22106 99 1949 --
NM_004808chr1063242 3153 2932 2623 2303 960 12694 33069 820 743 12156
NM_004822chr17133984 2894 2836 2665 2577 2508 1429 1379 910 747 647 392 270 23454 2900 12498 --
NM_004824chr641174 1013 507 446 1589 ----
NM_004834chr233067 968 125 23242 204 ----
NM_004836chr22296 179 ----125
NM_004845chrX74141 3756 3193 1056 1012 503 422 43427 2611 1177 911 1662 --
NM_004857chr1421710 882 13602 43989 797 741 662 --
NM_004859chr1732497 2191 763 --12258 --
NM_004863chr1454906 4373 4208 785 298 25348 5173 54820 4764 4295 1679 1622 14686
NM_004866chr544555 4373 4348 1076 11880 24202 4125 --
NM_004884chr1571446 1137 562 515 506 459 169 3693 542 358 ----
NM_004898chr442797 2529 470 457 11823 12489 12877
NM_004904chr744728 4454 741 316 14460 11302 --
NM_004922chr104760 740 102 52 1683 --1909
NM_004926chr1491612 693 487 227 141 124 83 58 33 --21858 174 --
NM_004947chr392338 2185 2128 1961 1741 746 739 672 56 11801 31620 757 84 --
NM_004956chr724456 3575 ----1483
NM_004976chr11195059 4989 4971 4804 4510 4389 4232 4140 3762 3750 3298 3216 1815 1666 1413 1386 609 81 74 44965 1780 1392 890 31944 1295 170 --
NM_004978chr171529 1290 1224 1194 521 360 77 --1538 11696
NM_004992chrX218513 7970 7882 7741 7312 6152 6099 5274 5180 2963 2663 2543 2504 2489 1994 1981 1755 1694 1501 576 550 27368 3286 11398 1588
NM_004992chrX218513 7970 7882 7741 7312 6152 6099 5274 5180 2963 2663 2543 2504 2489 1994 1981 1755 1694 1501 576 550 27368 3286 11398 1588
NM_004995chr145432 413 398 263 102 1562 2447 288 --
NM_004999chr644077 3991 3934 1315 11263 13858 --
NM_005028chr1092186 1560 766 734 717 701 641 602 113 ------
NM_005036chr22188021 7884 7737 7290 7033 6885 6342 5893 5284 2972 2799 2450 2228 1213 1024 837 695 373 16494 41968 1541 752 619 27839 343
NM_005056chr1265107 3504 2044 1621 860 810 55057 4633 4381 1228 847 11575 14415
NM_005063chr1063018 3000 2746 2724 2527 602 23470 2761 22425 653 --
NM_005065chr1454692 4195 3308 1458 755 13612 15316 --
NM_005095chr111703 21644 762 1142 12003
NM_005119chr131304 929 425 ----183
NM_005121chr1733605 491 164 ------
NM_005126chr321768 557 ----11994
NM_005135chr1583520 3481 2737 2586 2450 2435 2345 1521 --22745 1386 1780
NM_005151chr1832427 510 111 1778 ----
NM_005155chr66656 471 216 168 98 29 ------
NM_005156chr964703 4664 4598 3493 1924 1901 ------
NM_005187chr1631416 1408 1358 11389 21380 46 11395
NM_005188chr1187667 7214 6713 6361 5798 5297 5071 626 25309 823 26530 3104 --
NM_005197chr14125498 4979 4940 4723 2147 1703 1697 1138 632 507 454 424 --11997 --
NM_005202chr1101795 1593 809 620 548 325 317 262 234 76 --11435 --
NM_005207chr2253324 2606 1106 996 794 12445 23412 1330 1475
NM_005220chr1761112 946 248 192 107 36 ----1911
NM_005222chr74782 768 368 21 ------
NM_005233chr322344 999 2869 467 ----
NM_005235chr2107793 7431 7136 6553 6538 5599 5024 4953 4840 1954 36531 1761 90 11123 15336
NM_005238chr1152797 2685 2495 720 27 1762 ----
NM_005241chr341106 482 372 307 ------
NM_005254chr1541281 1273 1220 431 ------
NM_005276chr1271611 1486 1257 615 574 491 39 1484 1286 --
NM_005276chr1271611 1486 1257 615 574 491 39 1484 1286 --
NM_005312chr9112630 2592 2324 2173 2040 1693 1675 979 721 615 349 --2932 834 --
NM_005338chr7133716 3691 3116 2902 2877 2624 1630 1529 1511 1289 1137 902 340 11441 63868 3606 3550 3471 2545 1251 --
NM_005342chrX52693 914 907 755 435 ------
NM_005347chr961363 1338 1325 543 515 108 31659 1470 1369 11202 --
NM_005359chr1854506 2300 2159 1843 666 24905 2309 ----
NM_005374chr1762318 2148 1516 411 98 78 12302 12350 1834
NM_005386chr207705 615 360 327 267 204 153 1621 1676 --
NM_005397chr783542 3301 3225 688 565 291 128 105 23693 56 1465 --
NM_005399chr193499 3266 1533 1126 676 612 601 552 542 13311 1248 12984
NM_005431chr752133 1397 444 335 130 1453 11977 --
NM_005433chr1812535 11744 1127 --
NM_005440chr1773241 3037 2943 2524 628 504 431 12564 32316 1043 966 --
NM_005465chr141665 1265 185 112 --11625 --
NM_005475chr1282715 2626 2595 2556 2455 1129 1054 579 --1693 --
NM_005497chr17115875 5715 5374 5232 4917 4424 2085 2007 1724 1251 879 --55289 5154 4386 4329 4252 15497
NM_005502chr942577 2234 1140 1110 13030 12683 --
NM_005504chr1276431 6310 6225 4710 2047 2037 801 21998 985 26004 1094 12261
NM_005506chr462720 2464 2224 2058 251 69 ------
NM_005511chr931068 784 776 --1210 --
NM_005542chr741558 1222 1203 728 ------
NM_005565chr54461 404 175 103 ------
NM_005578chr331945 290 258 --13117 13854
NM_005596chr955797 4886 4638 1627 339 25906 4704 16203 --
NM_005598chr181619 1516 1383 1186 1061 1040 649 379 ------
NM_005603chr1851533 1416 454 313 139 1698 3607 369 235 --
NM_005604chr6------11576
NM_005637chr1851848 1840 1698 626 55 ------
NM_005647chrX83028 3020 2589 2331 1270 1134 725 402 12981 --1519
NM_005665chr133071 718 575 24798 4117 23326 3318 1727
NM_005668chr554635 4119 3260 993 757 --1360 --
NM_005722chr221704 442 11657 179 --
NM_005730chr12143360 3133 2606 2573 2382 2352 2332 2300 1266 1042 479 401 277 31 1358 11425 --
NM_005742chr2------1703
NM_005746chr732481 2400 580 1788 ----
NM_005759chr264481 3773 1706 874 435 80 14206 24808 416 --
NM_005779chr553419 3324 989 629 262 --1838 12281
NM_005789chr1771583 1506 1343 717 685 535 218 --1251 --
NM_005801chr173791 316 147 --190 --
NM_005808chr393418 3143 2683 2388 1155 1129 905 350 43 22365 1416 --1899
NM_005819chr152350 2188 323 166 140 --22581 239 13113
NM_005828chr17134634 4598 4070 3985 3904 3203 1923 1311 1268 1129 619 163 57 --1956 --
NM_005840chrX137582 6871 6466 6284 6040 5642 5141 4838 2578 2300 1748 457 195 22607 2563 37608 7574 2133 --
NM_005859chr52582 163 ----1140
NM_005873chr205628 498 458 235 24 --2478 192 --
NM_005885chr511245 1236 --11097
NM_005895chr1273088 2634 1620 1200 832 493 35 21607 779 11341 --
NM_005898chr1153118 2970 1974 1192 132 ------
NM_005899chr1731360 590 395 1459 11247 --
NM_005903chr531543 1401 235 11222 34722 1325 1130 35247 4742 1727
NM_005906chr62668 302 --122 --
NM_005909chr554028 3263 2695 760 237 1886 11130 --
NM_005910chr17103456 3183 2733 2592 1646 1469 1342 1289 1114 926 --23951 2617 --
NM_005911chr241147 1069 942 925 ------
NM_005920chr1133665 3482 3415 3270 3263 3205 3029 1559 1260 1189 826 393 94 --12383 22475 464
NM_005923chr6------1245
NM_005933chr1163045 2702 2409 2201 863 461 ----22725 416
NM_005937chr17133900 3518 3447 3403 3136 1225 1093 1056 927 620 492 181 25 23934 987 32722 1132 606 --
NM_005941chr843508 1013 884 819 --12911 --
NM_005955chr1105369 5190 4352 4320 3883 2214 2064 1926 1829 151 --13545 15259
NM_005966chr222279 57 --1877 --
NM_006016chr631751 1713 876 ------
NM_006030chr391611 1589 1262 644 591 497 384 70 35 ------
NM_006047chr20--12997 --1674
NM_006048chr13920 493 442 --1119 --
NM_006061chr62392 320 ----1925
NM_006080chr722762 1149 ----125
NM_006089chrX31461 1453 1337 ----1387
NM_006091chr15161685 1678 1639 1605 1538 624 505 339 236 220 206 173 164 157 124 80 --11576 --
NM_006094chr842385 2075 1717 681 11744 ----
NM_006099chr13602 315 187 1575 169 --
NM_006133chr11182324 2293 2234 2227 2207 2169 2011 1986 1747 1697 884 866 820 573 204 174 162 98 ------
NM_006134chr2131644 1269 597 11258 2434 355 1489
NM_006136chr7------1321
NM_006167chr832344 1860 1795 --2714 340 --
NM_006180chr941596 1562 1444 397 --11463 --
NM_006195chr91386 ----1356
NM_006226chr2--11162 --11080
NM_006238chr671791 1753 1551 735 639 590 450 132 22025 741 --
NM_006251chr53739 716 573 --33385 3105 2942 --
NM_006252chr197361 6624 6477 6322 6241 4967 2537 1912 985 26823 1426 46581 5174 5024 4889 22393 1980
NM_006267chr221210 707 21401 285 ----
NM_006282chr20114738 4330 4034 3257 3114 1876 1592 1571 1257 542 25 --43924 3860 530 254 --
NM_006283chr854794 3554 1554 617 345 11185 44148 3823 1622 182 11331
NM_006298chr672973 1203 1168 1089 1021 657 622 ------
NM_006306chrX145945 5025 4945 4819 4695 4054 3844 1268 1063 1045 1031 1016 945 488 24588 2038 11307 11221
NM_006310chr173943 829 157 ------
NM_006313chr1231636 673 257 ------
NM_006315chr494306 4225 3066 3035 1667 1390 1178 702 234 11787 ----
NM_006325chr12186 ----1774
NM_006361chr1781951 1928 1840 1739 1570 588 424 212 --31656 1322 195 --
NM_006371chr3134876 4654 3723 3633 3464 3288 961 923 733 291 193 128 89 23662 1378 13916 15178
NM_006380chr1754185 3520 3006 2788 129 21751 1357 ----
NM_006386chr22125 --1367 22033 1788
NM_006393chr1043151 3059 1473 273 2375 43 ----
NM_006411chr69936 819 714 704 403 363 230 188 88 1414 ----
NM_006420chr2033453 2298 921 --1307 --
NM_006424chr491884 1858 1448 1431 1328 558 487 219 193 11344 ----
NM_006454chr4122934 2881 2767 2718 2663 2641 2410 2147 1951 782 387 322 1375 ----
NM_006460chr1761573 1548 1530 1164 295 122 11283 11455 --
NM_006464chr264400 4199 4043 1469 1053 351 14654 23370 3293 13512
NM_006465chr15102342 2258 2041 1762 1660 1493 939 586 402 74 --1743 --
NM_006475chr13------139
NM_006482chr1233322 869 383 13145 23176 1222 11178
NM_006489chr1461530 1319 787 756 46 34 ------
NM_006517chrX81978 1916 1787 1753 1445 925 265 50 ----1907
NM_006524chr721006 89 --61045 716 380 296 212 128 --
NM_006538chr2103651 3624 3559 3440 3427 3216 2954 1331 1235 430 13145 21529 754 --
NM_006546chr17166609 5917 5905 5504 4344 4276 2667 1865 1657 1357 1127 1025 956 308 285 164 34931 1640 1000 65550 4989 4728 4286 2026 1691 25280 180
NM_006548chr341326 1311 295 221 --1166 1509
NM_006555chr771816 1507 1449 395 299 254 62 11625 11879 --
NM_006561chr10115044 4197 4155 4016 1955 1743 1438 1407 1185 215 149 14774 11374 12193
NM_006572chr1753520 3322 2486 270 257 --1992 13370
NM_006595chr1131704 1639 1491 ------
NM_006599chr1687747 7492 6812 6260 5802 2586 1322 1190 --27647 5330 12681
NM_006601chr12------1813
NM_006606chr2042047 2021 466 183 131 23088 1231 --
NM_006609chr252256 1946 1939 1058 541 11093 ----
NM_006614chr311201 32554 266 38 --13325
NM_006620chr643816 1866 1038 50 --24515 4101 1961
NM_006628chr15104001 3664 3656 3514 3368 3260 3223 1603 1117 745 --13244 --
NM_006646chr1332014 1175 85 --12696 13083
NM_006650chr5203869 3743 3668 3448 3348 3152 3032 2993 2625 2486 2467 918 891 718 599 401 291 195 175 27 --32568 683 102 23493 955
NM_006654chr1223505 90 13077 --14808
NM_006675chr12153150 3016 2478 2339 2332 2301 2249 1065 1030 911 387 287 129 97 27 11371 ----
NM_006717chr953421 3407 3234 484 194 1316 ----
NM_006720chr1043940 3885 3093 52 34105 3602 1324 21562 542 23431 1084
NM_006729chrX85452 4169 3738 1935 1504 802 543 421 15313 23678 2110 14027
NM_006732chr1992083 2040 2031 2024 1514 1365 747 580 532 2779 737 ----
NM_006736chr251580 552 465 458 150 --21456 1230 1109
NM_006750chr16117833 7537 6640 5983 5929 2711 2354 2231 2169 2040 1220 56851 6417 2178 617 55 25841 1713 12698
NM_006761chr174758 547 68 53 ------
NM_006763chr141972 1580 1429 327 170 ----
NM_006766chr842519 890 652 616 ------
NM_006772chr6131658 1529 1414 1185 555 486 444 430 277 267 250 233 45 11596 11713 --
NM_006775chr651964 1039 810 299 272 1305 ----
NM_006814chr2031016 921 24 22400 817 22454 608 --
NM_006827chr1463292 2706 2122 1294 558 36 32992 2715 799 ----
NM_006828chr61152 ----1113
NM_006856chr1261150 774 725 328 294 202 --1793 --
NM_006875chrX5795 592 342 311 48 1606 ----
NM_006888chr1483204 3008 2695 2259 1021 1010 530 478 --12373 --
NM_006922chr252489 2421 2305 907 475 --12540 --
NM_006924chr1724479 2907 43079 1556 1436 495 23503 229 --
NM_006927chr16102072 2020 1966 1868 1783 1751 820 648 536 290 --11935 --
NM_006931chr1261802 1621 1549 134 125 69 1146 31859 1735 361 --
NM_006940chr1231917 1840 155 11881 ----
NM_006941chr2281132 1057 890 719 296 174 74 36 --2844 199 --
NM_006943chr2083038 2496 1009 756 262 218 192 95 1178 ----
NM_006950chrX10897 628 608 590 355 263 203 86 39 28 --2677 223 2921 22
NM_006981chr932692 2048 307 --1893 --
NM_006988chr215804 440 340 247 218 ------
NM_006990chr13859 747 444 ----32009 286 68
NM_006991chr33958 389 28 --3303 248 169 --
NM_007006chr1641411 1330 521 494 1412 ----
NM_007007chr1244341 1520 1488 474 ------
NM_007008chr21598 ----1732
NM_007011chr15155629 5487 4955 4915 4429 4391 4216 2713 2129 1978 1662 1579 1471 712 106 --25544 5410 --
NM_007030chr5144534 4307 4249 4237 4215 1750 1719 1111 1041 1007 993 442 209 112 --23441 1550 1411
NM_007042chr332466 2036 467 12274 1991 1652
NM_007050chr20177598 7419 7135 6711 6211 6079 5589 5310 5150 3240 2811 2755 1377 1156 819 478 53 27680 116 47698 2696 1866 1590 17789
NM_007064chr331042 490 136 21154 181 ----
NM_007067chr1751529 1333 1116 324 53 --132 --
NM_007084chr134615 442 435 427 ------
NM_007106chr13----32617 958 826 --
NM_007114chr31811 --32527 1308 1226 --
NM_007124chr611607 1532 --11745
NM_007125chrY31251 948 333 ------
NM_007146chr1722267 684 ----1340
NM_007166chr112271 254 129 ----
NM_007172chr2272981 2973 2505 2242 801 584 557 --1873 1273
NM_007203chr913502 13114 63261 3229 2987 2427 479 237 --
NM_007236chr1571920 1704 1696 1587 1554 985 198 --173 1132
NM_007249chr13179405 9018 8855 8803 6634 6027 6010 3197 2313 2197 1099 807 416 404 171 110 73 --21800 1520 --
NM_007271chr631570 755 547 11180 ----
NM_007275chr37968 928 461 401 237 105 49 2874 772 ----
NM_007353chr762282 1031 749 611 588 39 --1533 12826
NM_007359chr1761482 1172 663 546 512 155 ----1273
NM_007361chr14--3659 172 53 ----
NM_007365chr162006 533 442 433 425 96 --21716 1700 --
NM_007375chr122588 2430 12703 1396 --
NM_012082chr8------1823
NM_012089chr12476 288 11177 ----
NM_012095chr1043450 2524 945 315 1418 53160 3104 3025 2948 2203 --
NM_012102chr132477 2310 2296 22260 1624 136 --
NM_012104chr1193472 2795 2640 2446 1144 936 702 683 105 33429 2787 248 ----
NM_012104chr1193472 2795 2640 2446 1144 936 702 683 105 33429 2787 248 ----
NM_012121chr1791719 1698 1306 642 543 511 500 78 60 --21682 337 --
NM_012129chr71557 ----12493
NM_012134chr161614 1568 1487 750 362 83 21271 516 1368 --
NM_012137chr142806 836 735 619 12037 21149 266 --
NM_012156chr2043378 2619 748 339 12405 ----
NM_012164chr9126360 6007 5936 5475 4871 2567 2436 2428 2286 2048 1805 64 --36314 2156 1756 --
NM_012193chr11155417 5213 5035 4794 4450 4231 4155 4147 4006 3329 2132 2103 882 398 126 1152 34496 3375 2091 --
NM_012199chr1134586 4255 3069 2864 1827 1329 893 878 692 658 253 228 21 11413 2207 50 1973
NM_012214chr285572 5538 5213 4116 3913 1846 1506 1363 14351 21421 1287 --
NM_012229chr1011240 1404 41266 1152 1097 1018 21294 1288
NM_012232chr1792181 2074 1843 1663 850 240 194 178 25 --2779 134 --
NM_012239chr1141485 595 206 71 155 21271 334 --
NM_012244chr1491564 1524 1189 713 590 542 456 218 197 11437 --11182
NM_012245chr142443 116 1342 --145
NM_012262chr174316 3874 3806 1327 1267 832 233 ------
NM_012282chrX5849 750 678 227 83 1642 ----
NM_012287chr354148 1463 1455 1126 40 13815 2978 725 --
NM_012288chr6184890 4723 4664 4651 4624 4454 4407 4365 4261 4100 3703 3523 3506 1820 1662 1603 1386 984 13516 55427 4470 1518 1465 1058 --
NM_012296chr1193410 3299 2712 2687 2649 2458 1019 366 154 12797 1878 --
NM_012300chr531879 1655 918 ----1800
NM_012308chr1182598 2478 2084 1936 994 739 648 392 11852 31021 555 500 1946
NM_012309chr1174617 3825 1417 1384 548 421 176 --21196 102 --
NM_012316chr1125233 4884 4859 4574 4467 3949 3823 3661 2197 1859 922 840 13570 75033 4774 4717 4641 4190 3633 2130 --
NM_012334chr584527 3866 3646 3130 3085 3059 809 424 11161 14103 --
NM_012408chr203136 118 31 --1737 1362
NM_012412chr72777 21 ----2884 845
NM_012434chr611221 21037 426 --159
NM_013227chr152235 65 1689 2140 114 --
NM_013249chr112433 421 --2178 56 1104
NM_013255chr768752 8393 3519 2761 2516 2039 47260 6433 1583 170 36587 2603 175 38106 6582 5708
NM_013269chr1274330 4230 3973 1072 553 542 366 23907 3747 33518 1547 56 --
NM_013279chr1182283 2207 1766 1532 926 824 469 393 --11667 11797
NM_013281chr202528 70 --11357 --
NM_013293chr72632 515 ----1241
NM_013309chr1562349 965 255 140 92 22 1500 ----
NM_013341chr232397 384 230 1236 12755 12159
NM_013357chr82701 329 --1631 --
NM_013372chr153933 277 109 23364 2323 21011 44 --
NM_013374chr362860 2512 2488 2028 156 56 --11151 --
NM_013403chr196885 702 658 571 345 160 ----1838
NM_013411chr182563 2097 2080 1727 1063 653 348 43 --1368 --
NM_013446chr781356 1217 933 508 427 333 153 38 --1107 --
NM_013449chr1282923 2602 863 851 471 358 146 115 1900 --11818
NM_013951chr2102453 2359 2234 2132 1980 686 558 523 284 61 12411 21750 742 --
NM_013952chr2102530 2436 2311 2209 2057 763 635 600 361 138 12488 21827 819 --
NM_013953chr2102530 2436 2311 2209 2057 763 635 600 361 138 12488 21827 819 --
NM_013992chr2102530 2436 2311 2209 2057 763 635 600 361 138 12488 21827 819 --
NM_013999chr1741199 1096 1036 76 21389 99 21375 104 1572
NM_014000chr1031866 775 34 1248 1575 1399
NM_014011chr222157 1819 --12563 12247
NM_014021chr152783 2205 2192 1282 1242 12147 12125 --
NM_014030chr179998 466 366 289 167 77 65 39 31 2337 85 ----
NM_014048chr1643812 1435 1419 1133 24606 381 13430 14726
NM_014089chr1341560 779 754 91 --3669 613 538 --
NM_014112chr844457 2015 1103 902 13439 1459 --
NM_014155chr1195572 5193 2681 2233 1472 1334 1082 236 80 1891 34842 1573 969 --
NM_014190chr491732 1547 1165 503 493 313 198 175 140 1751 3534 187 149 --
NM_014210chr17------172
NM_014211chr541499 663 352 317 --11708 --
NM_014216chr1491278 1200 1184 1144 1133 584 550 523 93 ----21583 1075
NM_014232chr1791642 1611 1598 1236 1208 1149 546 88 49 ----2566 305
NM_014232chr1791642 1611 1598 1236 1208 1149 546 88 49 ----2566 305
NM_014240chr363483 3371 2902 1659 1176 405 12575 43836 3702 3674 1284 --
NM_014252chr133312 162 136 ------
NM_014278chr4------1316
NM_014299chr1951896 1778 1353 320 103 2423 370 1840 --
NM_014309chr22125160 4981 4910 4585 4411 3597 3459 1716 1297 724 151 24 12041 15147 13430
NM_014323chr223998 769 366 2331 137 1131 --
NM_014393chr822295 2056 --1768 --
NM_014396chr731630 1605 1559 11834 31520 1466 1387 --
NM_014423chr521890 932 14230 14319 1553
NM_014444chr153654 165 71 --2711 576 --
NM_014456chr1041538 1276 1248 221 --31594 1460 406 --
NM_014571chr1142581 2301 2294 2062 1973 1177 1129 929 903 826 524 401 288 178 126 22615 2568 12112
NM_014584chr1421272 1053 11489 ----
NM_014591chr1091276 1265 1183 1068 1054 837 362 213 67 --21169 51 --
NM_014607chr222052 1820 11864 --1229
NM_014613chr582871 2277 2254 1146 813 775 391 31 12999 ----
NM_014630chr15103293 2886 2659 1247 947 841 827 703 626 249 12751 3326 300 166 1277
NM_014636chr9104275 4151 3273 1743 1402 1217 1195 976 248 152 21114 410 13846 23025 462
NM_014646chr1882862 2800 2470 2360 1115 859 555 80 --2772 665 --
NM_014647chr1652149 1978 1526 1496 101 ------
NM_014661chr10173878 3535 3484 3419 2907 2765 2711 2598 2584 2537 2518 2390 1234 1193 776 604 49 11080 13311 13215
NM_014665chr8143396 3309 3275 2952 2738 2560 2396 890 854 760 673 488 172 72 1145 12275 --
NM_014677chr821120 74 ----1365
NM_014686chr1982004 1941 1687 988 410 118 97 72 ------
NM_014690chr782851 2838 1933 1918 747 722 492 463 ------
NM_014721chr677138 5690 5117 5091 2848 838 522 27118 4821 14910 --
NM_014726chr1791232 1117 1024 987 974 904 485 374 108 ------
NM_014730chr1295236 5215 5043 3625 3534 2034 1775 906 828 --24596 1114 --
NM_014730chr1295236 5215 5043 3625 3534 2034 1775 906 828 --24596 1114 --
NM_014737chr20103932 3517 2992 2586 1547 1089 185 106 57 31 ----11276
NM_014741chr1152103 1755 1471 1363 43 ----1604
NM_014742chr20121688 1462 1375 1279 1263 1193 1097 678 418 392 112 90 ------
NM_014743chr452872 910 863 724 449 --22453 771 --
NM_014746chr2114043 3400 3342 3334 3265 1667 1611 1131 180 109 60 --22668 863 --
NM_014747chr1215539 5505 5229 5027 4767 4607 4461 3717 2319 2137 2113 1633 1343 1243 1043 928 821 716 136 96 55 --21865 559 --
NM_014755chr263503 3490 2680 870 56 37 11493 --12631
NM_014757chr582305 2038 1811 1748 772 743 381 205 11598 1314 --
NM_014762chr181788 1699 861 698 594 268 115 104 --11832 21997 1581
NM_014766chr773210 2845 2746 1283 1224 1196 573 13566 ----
NM_014767chr10133660 3195 3073 2853 2839 2697 2499 1487 1339 1225 1053 474 423 --11325 --
NM_014774chr172987 2865 2520 2356 2315 680 65 ----1740
NM_014812chr141332 751 363 116 --11992 --
NM_014819chr53756 607 477 --12458 1924
NM_014820chr332068 1797 1362 ----163
NM_014824chr1121900 241 --11390 11788
NM_014826chr133776 2816 1709 --11322 11250
NM_014828chr1452372 1725 992 977 853 --12191 --
NM_014830chr12143749 3664 3261 3191 3102 2631 2593 2575 1437 1362 1344 969 657 297 ------
NM_014836chr1011775 --1756 21526 600
NM_014841chr6--1856 --1393
NM_014844chr14164059 3899 3653 3617 3607 3255 2639 1538 1392 1099 800 728 706 676 646 624 --32808 1644 404 13343
NM_014850chr3104738 4162 3464 1878 1709 876 797 780 766 520 1998 33596 936 187 1245
NM_014873chr174203 3932 1951 1587 1431 1423 591 --2521 498 --
NM_014876chr2261933 791 651 524 236 34 1800 52281 2173 2117 494 432 --
NM_014877chr1797498 6134 5983 4947 2786 2292 2172 2077 1604 --17130 17571
NM_014891chr791553 1485 1439 1342 614 515 402 117 100 --41509 1399 1265 1158 11146
NM_014897chr1753285 2708 2684 2542 329 ------
NM_014901chr5102019 1616 1580 1438 636 583 490 353 170 31 21597 506 31509 603 478 --
NM_014902chr2051567 1419 1318 1239 291 --1607 11206
NM_014903chr1252174 1518 490 428 395 1264 --12329
NM_014904chr1063534 3166 1614 1501 1173 523 ------
NM_014906chr1763258 2874 2510 480 289 251 --23801 3012 --
NM_014909chr1492932 2889 2766 2657 980 849 176 142 26 1584 12645 --
NM_014912chr1042932 2850 587 534 12198 12560 --
NM_014923chr1332008 1589 946 ------
NM_014935chr1103770 2966 2951 2864 2571 1259 1250 925 345 188 --33866 2938 502 --
NM_014945chr562032 1471 1277 640 613 404 1281 ----
NM_014946chr232853 1925 1022 1232 ----
NM_014948chr2092346 2152 1951 1731 457 359 290 142 95 --52000 1810 1694 951 271 12168
NM_014961chr441367 728 524 494 ----11736
NM_014962chr2032826 760 403 --22365 431 --
NM_014964chr1772222 2214 1744 1560 1544 572 392 12172 1300 1154
NM_014969chr12465 137 2916 275 ----
NM_014982chr1424522 659 ----11393
NM_014988chr432668 2382 1064 12508 22158 2026 178
NM_014991chr462605 2358 2172 788 573 41 ------
NM_014994chr15152281 2246 2167 1994 1783 1688 1525 922 803 772 669 294 222 207 57 11835 21743 1610 --
NM_015000chr1221898 674 --12451 --
NM_015001chr14900 722 107 23 ------
NM_015008chr383681 2721 2445 2247 1371 1046 702 425 23363 1209 --13369
NM_015025chr242151 1920 1883 774 --1808 --
NM_015032chr1352553 1167 792 670 146 ------
NM_015033chr9102554 2228 2199 1281 1249 1186 1178 1036 562 261 --2909 112 --
NM_015039chr193374 3307 3101 3081 1385 1165 669 124 51 --13394 --
NM_015040chr213446 --21177 165 21235 834
NM_015042chr15174136 4055 3892 3772 3289 3279 3256 3203 3158 2947 1160 1023 866 838 400 377 188 1677 11698 --
NM_015049chr243124 2696 716 633 12783 --12648
NM_015052chr741378 1049 923 391 11257 1458 --
NM_015064chr12123663 3642 3280 3118 2633 2317 2249 1285 155 131 112 51 43217 3168 2408 478 33563 3428 1453 13509
NM_015068chr763844 3611 3603 1522 664 330 1945 43889 3704 952 595 --
NM_015070chr1341376 1333 177 126 1354 ----
NM_015071chr5136505 4931 4925 4122 4099 4005 2359 1551 1137 956 948 673 465 35140 4427 2341 15115 --
NM_015075chrX121773 1609 1552 1456 901 829 781 390 377 342 330 88 1481 22040 427 --
NM_015076chr654393 4059 2966 2934 1380 12812 1264 --
NM_015077chr17134548 4377 3696 3540 3470 2873 1739 1655 1445 874 826 761 225 --21584 1272 --
NM_015079chr1582832 2608 2287 2264 1214 724 687 653 22452 2420 ----
NM_015082chr592604 2411 1990 1919 1658 1587 919 810 722 21741 844 22264 715 1987
NM_015090chr1136014 5826 5740 5379 4642 4255 3822 1643 1075 611 196 185 171 31501 1217 284 45992 5367 4955 4365 --
NM_015092chr1653283 2893 1762 640 160 --63223 1618 1541 398 352 211 13988
NM_015093chr61166 1623 --11336
NM_015094chr22224340 4304 4218 4161 4147 4124 4092 3751 3700 3610 3563 3045 2882 2862 2833 1402 1372 1358 788 537 384 226 14196 33951 3463 3272 --
NM_015113chr17111909 1840 1670 1658 1597 703 582 494 428 123 82 --22139 68 --
NM_015115chr433221 2566 2340 --22596 880 12307
NM_015130chr4--1180 --11371
NM_015144chr1642674 1512 977 550 1580 1184 1986
NM_015156chr14103441 3214 3049 2893 2697 1389 779 764 746 296 1710 1305 13341
NM_015170chr831940 336 306 22000 810 1527 --
NM_015176chr131282 1258 1173 --11601 --
NM_015193chr871503 1454 1440 1193 1134 285 249 --31421 1326 1022 11069
NM_015194chr17102074 1543 1517 1428 556 503 392 267 237 123 1494 21855 409 1825
NM_015197chr14143367 3298 2859 2749 2580 2301 2274 1045 860 778 661 654 509 33 1737 22773 2451 --
NM_015199chr382508 2243 2119 2047 1827 941 901 108 ----12608
NM_015200chr442370 2292 1790 1760 12158 ----
NM_015205chr1364461 4182 4119 1838 610 112 33643 1068 157 24258 1381 --
NM_015215chr162930 2508 2489 2246 2141 137 --12203 --
NM_015219chr1782416 2020 1591 800 617 460 384 149 22549 1679 12367 --
NM_015230chr4------168
NM_015245chr632684 327 205 ----11698
NM_015252chr21864 ----1184
NM_015254chr8132893 2477 2326 2155 2146 1099 917 623 598 519 467 427 362 ------
NM_015260chr19121464 1454 1270 1124 986 646 598 575 333 308 134 110 --1229 11068
NM_015267chr1241709 648 367 237 ----21649 289
NM_015278chr652975 685 640 217 180 1979 11337 --
NM_015282chr283048 2442 2265 2069 1960 696 676 285 --12758 --
NM_015284chr181980 793 656 583 250 223 162 97 --21740 469 1243
NM_015285chr1852457 2308 2263 2142 107 ------
NM_015288chr5133832 3825 3692 3016 1209 1159 1096 989 704 452 418 400 322 --13789 --
NM_015291chr172260 1272 725 713 485 417 305 23075 1059 ----
NM_015299chr14124009 3958 3471 3357 3208 3043 3032 2827 968 833 768 183 11069 33436 2449 723 --
NM_015310chr878149 7283 7151 5340 2773 1446 827 16927 22308 1825 --
NM_015315chr5142876 2848 2837 2710 2360 2162 2131 1341 831 657 511 497 392 373 --23113 2230 11254
NM_015317chr212459 12597 22246 402 --
NM_015326chr132686 2175 698 12620 12006 --
NM_015328chr752528 2330 1218 1118 812 22095 994 --144
NM_015329chr19112652 2270 2053 1093 1020 1009 588 521 360 261 193 --11860 12398
NM_015332chr793513 3348 3214 2933 1134 1095 502 259 23 13226 ----
NM_015335chr1211969 --2439 51 1260
NM_015346chr1441418 1322 246 139 ------
NM_015347chr1231142 760 519 22467 475 ----
NM_015349chr682510 1136 995 441 247 50 37 25 144 22048 696 --
NM_015375chr194389 4364 4086 3979 3626 1982 1779 1487 939 13311 44222 1897 1099 797 --
NM_015393chr4103533 3041 3026 2961 2951 2750 1456 1289 1174 736 11425 ----
NM_015397chr931476 1436 263 11611 ----
NM_015401chr128824 751 713 228 169 150 72 59 --1369 --
NM_015435chr8----11000 11214
NM_015455chr534071 3333 2590 ------
NM_015458chr875145 4177 4152 3723 2039 1375 121 24742 3772 33933 1655 1120 24984 1199
NM_015526chr19131330 941 932 907 533 500 369 355 251 190 176 147 116 41257 1087 920 294 21200 1116 51291 1218 997 977 959
NM_015550chr763078 2566 2437 826 747 374 22658 2648 13544 --
NM_015553chr6104751 4488 4248 4240 4114 3900 3346 3294 3280 3173 11249 ----
NM_015557chr1123426 3392 3293 2867 2580 2266 1379 1180 937 832 551 207 11243 23446 1278 --
NM_015564chr583315 2888 2663 2399 2183 1034 611 399 ----11068
NM_015565chr2121495 294 ----32006 1665 1549
NM_015568chr20144199 3982 3851 3794 3588 3149 1725 1584 1532 1127 886 282 164 134 44256 3378 1354 558 ----
NM_015570chr72596 75 --31605 110 39 --
NM_015571chr611932 ----12414
NM_015576chr352883 2840 2631 2495 221 --1402 --
NM_015609chr1112927 2816 2785 2707 2646 2628 2466 2012 1145 1091 719 --32379 824 164 --
NM_015610chr762777 1826 1756 1129 523 281 --1154 22489 1121
NM_015626chr171491 ----158
NM_015686chrX142206 2167 2114 2052 1996 1977 1869 612 604 588 515 410 327 241 32215 2178 156 22521 1804 --
NM_015713chr843203 2689 327 286 13610 ----
NM_015850chr881939 1528 480 389 156 60 47 30 --11810 1609
NM_015852chr772963 1222 1191 1184 767 179 95 --63254 1142 554 470 302 218 --
NM_015879chr1868197 7474 6925 6390 6054 2875 56018 3069 2480 1038 47 25375 80 22109 913
NM_015886chr815697 ----15123
NM_015898chr19162355 2338 2284 2131 2023 1924 1853 1725 893 844 790 644 614 334 324 264 22055 1700 ----
NM_015906chr154804 3497 3196 1320 427 11363 ----
NM_015911chr14654 548 187 108 3438 95 46 ----
NM_015920chr152649 183 ----1489
NM_015955chr2------1111
NM_015994chr142667 255 ----133
NM_015995chr15175210 5191 4646 4514 4253 3691 3620 3600 1690 1438 1334 1225 682 624 506 242 124 23793 1980 14938 --
NM_016003chr762777 1826 1756 1129 523 281 --1154 22489 1121
NM_016018chr812770 1773 1937 --
NM_016021chr632323 1847 449 11858 32794 2272 933 --
NM_016022chr18920 852 709 412 380 248 118 30 --167 --
NM_016045chr2031792 261 34 1576 2352 331 --
NM_016057chr1231173 511 155 1402 2803 498 --
NM_016072chr1232110 1877 1498 11645 --1496
NM_016076chr142859 2537 1978 571 2970 654 22371 120 --
NM_016083chr622953 1270 21249 675 22714 181 --
NM_016099chr8121 2397 135 11277 --
NM_016124chr12545 405 21237 554 11353 --
NM_016131chr252015 1879 1490 810 38 ------
NM_016132chr1553429 849 573 564 119 ----1634
NM_016206chr368623 8255 3160 3078 2738 2587 27462 591 ----
NM_016255chr633191 501 110 1361 12099 --
NM_016257chr182640 2556 2176 2153 420 278 174 97 --2473 220 11335
NM_016260chr2147197 6386 6134 5851 5552 5355 5137 2401 1476 1397 1214 1032 523 25 35304 2430 1853 37035 6186 73 --
NM_016271chr1821467 253 12253 ----
NM_016277chr611410 ----1460
NM_016287chr162002 1714 1368 795 504 282 ------
NM_016297chr282658 2613 2516 2362 1143 853 344 127 --12573 --
NM_016322chr922403 2312 --23191 1203 --
NM_016356chr642606 1953 1945 1811 11980 ----
NM_016376chr17154402 4230 3962 3714 3646 3423 3312 2938 2917 2910 1133 905 349 152 74 14212 --22814 1010
NM_016418chr22153684 3466 3426 3384 3058 3050 2909 2327 1416 802 547 469 380 212 80 1635 23260 2752 --
NM_016436chr2042422 2396 615 406 --42255 2176 2077 2004 --
NM_016485chr621725 259 1241 21999 555 --
NM_016526chr1172481 2384 2009 1923 1565 741 399 12321 22535 493 1641
NM_016530chr1533485 2917 977 --13175 --
NM_016531chr454093 3848 1642 952 256 12636 ----
NM_016577chr3114228 4222 4212 3945 2863 1760 1151 674 621 532 513 --21563 1468 --
NM_016596chr128824 751 713 228 169 150 72 59 --1369 --
NM_016625chr3--1468 --167
NM_016654chr1541281 1273 1220 431 ------
NM_016834chr17103456 3183 2733 2592 1646 1469 1342 1289 1114 926 --23951 2617 --
NM_016835chr17103456 3183 2733 2592 1646 1469 1342 1289 1114 926 --23951 2617 --
NM_016841chr17103456 3183 2733 2592 1646 1469 1342 1289 1114 926 --23951 2617 --
NM_016929chr693417 3406 1651 1566 1512 1449 453 368 60 34427 3230 1831 23918 143 --
NM_016946chr153336 3186 2314 166 112 --52857 886 850 801 731 --
NM_016952chr11104087 3621 3595 3503 2823 2637 2603 649 517 329 1658 24055 4049 --
NM_016953chr2125302 4679 4546 3993 2180 1778 1770 1666 1628 1455 1317 213 15207 22104 583 --
NM_017415chr5104393 4167 4068 3953 3697 2819 1703 1261 1011 988 --11272 11721
NM_017420chr1432763 890 413 --32701 2555 605 160
NM_017437chr1442220 2212 2071 1871 --1818 --
NM_017447chr2143559 2750 1114 321 ------
NM_017449chr161277 698 537 365 53 38 11370 --1616
NM_017540chr5153109 2403 2356 2331 2323 2051 1297 1168 1002 946 661 244 218 206 172 22482 2277 33015 1032 562 --
NM_017592chr1972651 1991 1805 1132 1091 845 640 --22430 895 1824
NM_017596chr1194452 4420 4349 4321 4192 3689 1735 1643 1616 1433 1098 1091 948 612 573 558 515 357 217 54129 3313 2994 2889 1132 34631 3402 3305 31325 1122 406
NM_017599chr1242117 1352 725 132 1718 ----
NM_017633chr633732 3146 1482 22518 429 --1493
NM_017637chr9118903 8267 7997 7140 6828 6717 3352 2627 2139 1322 809 12679 28238 341 --
NM_017638chr15847 822 298 189 156 --3737 681 603 --
NM_017643chr1742416 2332 814 490 --12394 --
NM_017644chr364129 3745 3165 1113 1069 976 --11357 14065
NM_017651chr6----2644 588 11204
NM_017658chr1413869 13464 13862 13622
NM_017660chr19123015 2954 2841 2815 2680 2632 2395 2228 744 635 523 338 2152 114 12108 12410
NM_017662chr961986 1629 407 386 275 24 ------
NM_017666chrX--1659 --11798
NM_017709chr143387 3288 3248 186 ----137
NM_017719chr322415 277 --2913 395 --
NM_017737chr12759 195 1827 ----
NM_017741chr452315 419 333 277 144 1539 1199 12095
NM_017744chr172027 1685 849 613 171 83 76 1708 11739 --
NM_017754chr694651 4062 3303 3137 1098 1090 830 322 205 13500 11841 13710
NM_017769chr1423157 717 ----1248
NM_017772chr6111599 1537 1410 1357 1108 1096 711 471 310 159 84 1337 1687 --
NM_017778chr82548 23 --132 --
NM_017787chr1052303 1088 904 622 323 22928 252 1257 12349
NM_017813chr875740 5527 2172 2164 2020 1720 1332 15791 ----
NM_017831chr18114601 3476 3313 3184 2976 1880 1741 1200 812 787 645 12985 44102 3551 1237 562 11067
NM_017848chrX84495 3975 3182 3072 3059 1530 1342 97 --11487 --
NM_017849chr293134 2743 2499 2355 1237 838 604 463 33 --12507 --
NM_017893chr1071334 1318 1156 343 312 167 104 --11289 --
NM_017902chr10115692 5624 5253 4770 1778 1421 1325 1269 1044 216 173 180 54870 4562 3856 3631 426 --
NM_017907chr114461 392 53 42 197 ----
NM_017911chr2221525 249 --185 --
NM_017919chr9155679 5184 5146 5007 5000 4980 4895 4853 3787 2071 2033 1445 1076 862 355 32085 1366 715 33527 1925 507 --
NM_017955chr1451129 1042 842 835 312 --21238 127 --
NM_017958chr252450 680 615 507 40 --2853 776 --
NM_017982chr141079 860 335 315 1428 --1928
NM_018003chr1521804 1781 12044 31640 1561 66 --
NM_018017chr1052716 2191 1103 465 307 11797 11025 --
NM_018030chr18----11002 1351
NM_018045chr182320 2203 1905 1013 934 441 328 272 12538 1580 1195
NM_018046chr531729 1545 25 ----11357
NM_018070chr14434 417 139 128 1426 ----
NM_018086chr261565 1409 1338 1309 302 77 2744 657 21579 200 11939
NM_018121chr1053038 2102 2055 299 290 ------
NM_018128chr1731289 115 45 1483 31490 1413 1299 11165
NM_018133chr31675 --3291 218 185 --
NM_018155chr323283 3006 --22630 202 13334
NM_018181chr1841657 1424 565 27 ------
NM_018182chr1762290 2221 2155 2086 786 574 ----21913 215
NM_018184chr311905 --2276 100 --
NM_018195chr1132000 1959 496 ----11917
NM_018205chr10102342 2216 2203 2177 1894 1856 1681 471 404 55 11544 ----
NM_018207chr191699 521 465 345 278 267 109 83 26 21668 1572 11349 --
NM_018225chr9114638 4410 3826 2110 2003 1838 1665 1657 1203 611 466 25311 620 24193 974 --
NM_018227chr422228 25 12344 12435 --
NM_018239chr10102342 2216 2203 2177 1894 1856 1681 471 404 55 11544 ----
NM_018241chr42834 57 1251 11058 --
NM_018246chr822153 1771 --22834 2663 --
NM_018247chr633096 3085 2035 ----1707
NM_018254chr151999 1632 673 398 39 ------
NM_018287chr101532 --1860 1523
NM_018293chr332176 689 202 1185 ----
NM_018294chr103767 179 152 --4790 682 626 30 --
NM_018299chr833018 2427 392 21106 500 1960 --
NM_018323chr411442 ----1104
NM_018326chr7154 --1775 2713 192
NM_018327chr2011311 --11410 11518
NM_018332chr1651217 337 295 288 127 21243 90 31076 997 400 --
NM_018340chr1694839 4830 3982 3871 3767 1777 973 785 78 33991 1118 352 41693 1637 1558 293 14242
NM_018351chr1284185 3895 3738 3415 2978 1547 1521 539 --21814 1380 13535
NM_018362chr1132771 2756 1375 13254 1955 --
NM_018375chr1421483 214 --1273 --
NM_018383chr242075 1444 461 137 1217 1129 --
NM_018400chr11134578 4347 4023 4003 3762 3582 3140 1246 1220 1078 615 101 55 31229 294 93 43354 3012 262 192 13552
NM_018403chr343019 616 560 412 13025 33180 2855 33 --
NM_018409chr473173 2907 2825 2075 874 231 43 22963 1144 ----
NM_018416chr1232044 376 168 12488 2414 71 --
NM_018424chr931864 1516 442 ------
NM_018440chr8108264 7983 7914 6413 6388 6243 6007 5543 1316 274 21021 477 36165 3442 1451 --
NM_018445chr153580 50 43 ------
NM_018462chr32613 64 ----1871
NM_018482chr83682 124 64 ------
NM_018489chr152108 464 432 347 309 ----123
NM_018509chr1751620 1302 497 377 78 ------
NM_018553chr1761807 1164 528 497 236 74 ------
NM_018561chr62929 40 --2271 213 1976
NM_018566chr144670 4324 4180 36 ----183
NM_018593chr62728 137 ----1489
NM_018638chr1233490 2006 645 14774 14510 166
NM_018644chr1171987 1676 1471 1424 814 680 389 1622 32106 806 189 --
NM_018660chr862920 1930 1908 1014 799 587 1641 12976 --
NM_018667chr16102292 2160 2000 1125 1062 1033 1014 674 444 201 22079 2010 --1476
NM_018684chrX4252 133 84 40 --31189 1094 96 --
NM_018691chr5------1828
NM_018704chr131761 1388 636 1221 22123 1431 --
NM_018837chr203698 279 229 --1894 1642
NM_018847chr921516 1314 1325 11578 --
NM_018898chr542168 873 291 115 1644 --1866
NM_018899chr542168 873 291 115 1644 --1866
NM_018900chr542168 873 291 115 1644 --1866
NM_018901chr542168 873 291 115 1644 --1866
NM_018902chr542168 873 291 115 1644 --1866
NM_018903chr542168 873 291 115 1644 --1866
NM_018904chr542168 873 291 115 1644 --1866
NM_018905chr542168 873 291 115 1644 --1866
NM_018906chr542168 873 291 115 1644 --1866
NM_018907chr542168 873 291 115 1644 --1866
NM_018908chr542168 873 291 115 1644 --1866
NM_018909chr542168 873 291 115 1644 --1866
NM_018910chr542168 873 291 115 1644 --1866
NM_018911chr542168 873 291 115 1644 --1866
NM_018912chr5101709 1646 1093 528 369 347 312 292 219 97 1375 21451 1128 --
NM_018913chr5101709 1646 1093 528 369 347 312 292 219 97 1375 21451 1128 --
NM_018914chr5101709 1646 1093 528 369 347 312 292 219 97 1375 21451 1128 --
NM_018915chr5101709 1646 1093 528 369 347 312 292 219 97 1375 21451 1128 --
NM_018916chr5101709 1646 1093 528 369 347 312 292 219 97 1375 21451 1128 --
NM_018917chr5101709 1646 1093 528 369 347 312 292 219 97 1375 21451 1128 --
NM_018918chr5101709 1646 1093 528 369 347 312 292 219 97 1375 21451 1128 --
NM_018919chr5101709 1646 1093 528 369 347 312 292 219 97 1375 21451 1128 --
NM_018920chr5101709 1646 1093 528 369 347 312 292 219 97 1375 21451 1128 --
NM_018921chr5101709 1646 1093 528 369 347 312 292 219 97 1375 21451 1128 --
NM_018922chr5101709 1646 1093 528 369 347 312 292 219 97 1375 21451 1128 --
NM_018923chr5101709 1646 1093 528 369 347 312 292 219 97 1375 21451 1128 --
NM_018924chr5101709 1646 1093 528 369 347 312 292 219 97 1375 21451 1128 --
NM_018925chr5101709 1646 1093 528 369 347 312 292 219 97 1375 21451 1128 --
NM_018926chr5101709 1646 1093 528 369 347 312 292 219 97 1375 21451 1128 --
NM_018927chr5101709 1646 1093 528 369 347 312 292 219 97 1375 21451 1128 --
NM_018928chr5101709 1646 1093 528 369 347 312 292 219 97 1375 21451 1128 --
NM_018929chr5101709 1646 1093 528 369 347 312 292 219 97 1375 21451 1128 --
NM_018945chr653352 3335 3021 245 192 --43072 2936 2880 220 --
NM_018976chr1232262 1880 464 --11898 --
NM_018991chr74696 616 186 122 --1755 --
NM_018999chr1043190 3147 1581 568 1611 11101 --
NM_019001chr321749 1716 1227 11764 11881
NM_019027chr442300 1962 545 351 --1802 --
NM_019044chr274215 3474 3072 3039 3032 3008 1586 34481 3210 754 13396 --
NM_019063chr221546 328 1484 11537 11740
NM_019072chr553668 2745 1572 1405 136 ------
NM_019084chr101216 32019 1980 1868 ----
NM_019106chr22123157 3111 3023 3002 2914 2809 2520 2316 2241 2200 2138 486 153 --12661
NM_019114chr952288 1936 1780 859 591 ------
NM_019593chr2033132 2796 597 21281 429 13023 12780
NM_019596chr2162639 2108 717 677 291 253 --4743 587 532 453 --
NM_019885chr271821 1136 1116 1061 907 240 167 --32478 627 147 --
NM_020039chr1281623 1512 1350 1289 716 668 245 177 1413 41750 775 544 538 21701 691
NM_020116chr421839 598 --1659 --
NM_020122chr2105981 4943 4602 4449 4336 3812 3741 2207 1561 266 --44803 4729 4010 3653 11607
NM_020144chr721613 788 --198 1244
NM_020168chr1571157 1109 519 465 421 232 214 --31028 132 126 --
NM_020178chr172997 270 --124 --
NM_020205chr163381 2884 2355 1039 279 194 ----23205 2720
NM_020228chr1142472 758 193 36 ------
NM_020239chr182077 837 559 372 270 186 109 37 ------
NM_020248chr192329 2278 2126 975 797 131 120 95 85 1790 21979 1823 --
NM_020310chr17112604 2528 2509 2471 2010 1845 1821 1132 922 736 105 1710 --12676
NM_020337chr442990 2452 2031 184 --11019 --
NM_020338chr10113589 3459 1359 1291 1175 631 607 559 467 398 47 --33133 2686 2575 --
NM_020342chr242629 1682 837 231 ------
NM_020357chr321282 372 --11366 --
NM_020384chrX101838 1740 1709 1221 542 525 518 361 335 263 162 21531 278 --
NM_020390chr373567 3127 1217 1150 1142 998 950 11818 1101 --
NM_020408chr65954 681 374 363 263 --3711 646 640 --
NM_020440chr152493 2316 907 884 523 --22656 2380 --
NM_020443chr1146526 5964 5814 5580 5556 5515 4309 2568 1879 1666 1509 483 384 309 22598 1397 66258 4914 2415 1187 813 105 16679
NM_020444chr54582 554 351 46 --2210 132 --
NM_020456chr1361860 1852 1710 1493 1483 375 1635 --12223
NM_020466chr664807 3577 1394 792 685 599 --2404 325 14963
NM_020474chr1831874 606 51 --12000 --
NM_020478chr8102491 2483 2247 2226 2033 1764 1599 904 866 60 --2437 69 --
NM_020525chr122142 34 2537 69 1113 --
NM_020532chr21598 ----1732
NM_020638chr1271844 1277 801 755 480 432 207 11656 --1239
NM_020647chr832247 331 94 --21879 300 --
NM_020699chr1104797 4119 3388 1831 1512 1452 954 870 634 25 23884 1900 44932 4745 3762 1000 --
NM_020708chr2092269 2043 1843 1657 988 975 891 332 125 --11581 --
NM_020711chr262199 2092 1748 1054 434 60 --1155 1182
NM_020718chr1695752 5680 5230 2369 2129 1548 1522 523 55 --45538 2019 1297 1282 --
NM_020728chr783143 3088 2858 2363 2355 2038 1038 1025 --22712 2633 --
NM_020738chr23429 262 68 11313 1714 --
NM_020749chr8--165 --1835
NM_020768chr552919 2483 2347 903 53 1326 --12894
NM_020772chr1768056 6524 3445 2724 2442 1102 --26170 2716 --
NM_020774chr1846178 5771 2383 951 --24739 158 --
NM_020782chr1254591 3239 3033 1768 683 ------
NM_020783chr1831679 1597 779 --1713 1297
NM_020787chr172582 506 --135 1970
NM_020795chr1781969 1960 1909 1858 1699 572 542 396 21984 1931 ----
NM_020796chr542436 1156 315 245 ----22713 1877
NM_020802chr1172366 2231 760 489 404 391 105 13020 22790 693 --
NM_020803chr452428 2286 2208 2080 1769 --22453 669 --
NM_020804chr6172562 2537 2500 2243 2170 2150 2115 1787 1680 877 815 469 401 376 351 327 214 --22104 723 --
NM_020805chr186650 596 497 333 322 250 --11398 --
NM_020808chr12243 218 1310 ----
NM_020810chr1463468 3267 3234 2570 2450 102 12860 ----
NM_020813chr1962555 2529 1124 1073 906 43 --1297 --
NM_020826chr1152651 2463 801 397 56 43471 2344 1361 716 23018 2478 --
NM_020830chr223222 963 --12035 --
NM_020845chr12122386 2362 2320 2272 1729 1685 1641 875 639 518 247 56 --3996 457 223 --
NM_020850chr1692831 2511 1165 1022 905 857 589 177 43 1713 12196 --
NM_020856chr1951563 1327 1216 509 474 ------
NM_020870chr441586 770 152 138 --1538 --
NM_020918chr1062941 2737 1176 1010 809 217 1527 --13168
NM_020922chrX31812 1323 666 11197 ----
NM_020927chr1652079 2060 1666 1474 77 11630 1175 --
NM_020935chr243553 3513 1645 58 1878 23271 3185 11183
NM_020939chr6121296 1151 1132 1090 1048 1006 551 542 428 379 150 67 11141 1469 --
NM_020956chr19224757 4597 4401 4261 4001 3864 3771 3703 3187 2923 1874 1796 1718 1640 1415 1063 1038 1023 966 900 336 127 23249 93 --34677 4464 4194
NM_020960chr9124408 4293 4178 3963 3951 3694 3481 3252 1294 581 555 340 24784 1794 ----
NM_021020chr8193360 3142 3056 3036 2956 2826 2819 2638 2631 2369 2321 2238 1292 1227 689 675 552 129 88 33241 1221 373 42691 2381 536 456 11149
NM_021033chr13169 --1926 1748
NM_021038chr343171 2696 2601 2264 --23206 2716 --
NM_021047chr194708 465 457 151 --2104 22 --
NM_021061chr871666 1658 1135 1069 944 860 727 33562 3419 327 24174 134 --
NM_021072chr512058 --1491 21895 616
NM_021079chr1792812 2632 2363 2209 2167 1053 1037 727 99 --2535 62 --
NM_021083chrX73009 2786 2506 2488 1143 184 114 12383 1874 --
NM_021090chr2284722 4146 3787 1933 1032 960 714 471 ------
NM_021097chr232495 829 818 1835 21950 890 --
NM_021116chr7318384 8311 8114 8094 7929 7362 7256 7140 6856 6632 6491 5600 3603 3266 3035 2933 2817 2697 2613 2597 2448 2334 2017 2000 1619 1467 1132 1019 727 357 259 --46345 3592 3333 2941 23327 2681
NM_021120chrX22304 685 12171 22988 2310 13023
NM_021135chr693132 2707 2681 2581 2126 1024 448 152 58 12773 12631 --
NM_021145chr761022 994 863 238 81 58 ------
NM_021189chr12752 349 ----1272
NM_021202chr20112848 2772 2723 2709 1976 1045 801 413 387 86 27 23003 1102 12647 --
NM_021218chr93994 851 297 --2909 773 --
NM_021229chr124481 391 202 71 --1399 --
NM_021249chr1441666 1337 1309 128 ------
NM_021252chr103785 383 156 --21404 144 --
NM_021627chr331023 859 63 --1882 1841
NM_021638chr484927 3487 3333 3315 3071 1892 363 110 13530 14999 --
NM_021647chr463714 1885 1752 1276 550 340 13299 ----
NM_021783chrX52242 738 397 143 120 --22271 821 --
NM_021813chr6145466 5401 4874 4662 4490 4125 4004 1879 1804 1777 1678 1644 1468 1447 1300 25348 341 --
NM_021911chr524657 3677 11961 35214 4221 3843 25183 2250
NM_021912chr1543138 2827 2671 669 11649 23954 3205 --
NM_021914chr143804 590 444 --11628 --
NM_021940chr6--31339 572 370 1364 11270
NM_021945chr693589 3153 2790 2657 1282 1033 1021 413 198 12320 --13212
NM_021949chrX52704 2538 1944 1764 1157 --22386 2255 --
NM_021960chr132341 2055 104 22434 77 11953 --
NM_021961chr1167092 5227 2758 2601 2379 2026 25939 137 32977 2135 99 --
NM_021962chr1762277 2222 208 107 91 42 --42543 2118 2028 189 12037
NM_021964chr376558 6361 5662 5298 5053 4991 620 22060 1722 14775 --
NM_021967chr541012 929 434 267 --11326 --
NM_021977chr642950 2908 2745 323 32534 2465 134 1807 23308 2980
NM_022048chr15115873 4995 4775 4481 4391 1322 1133 556 500 372 361 11377 45544 5232 2510 2431 --
NM_022062chr1181924 1897 1492 1345 1306 1207 292 193 21275 747 1200 1503
NM_022114chr1104339 3303 3160 3094 3078 1282 1076 1001 440 83 33433 3068 166 11122 --
NM_022140chr521537 365 2888 374 --1895
NM_022166chr16105363 5030 4633 4410 4112 2274 1513 1281 982 302 11519 45669 1348 562 76 24493 3916
NM_022171chr381574 1521 1401 1129 1024 624 352 80 --2539 483 1406
NM_022336chr282321 2254 1810 1535 814 627 383 223 --1328 --
NM_022351chr843453 3306 2573 477 ------
NM_022456chr12157695 7336 6959 6901 6369 6328 5585 5407 5382 5241 4965 1085 621 568 29 17277 55509 5297 5163 2204 2116 16482
NM_022458chr72916 344 12151 32206 373 46 --
NM_022459chr1315885 35429 4377 545 11381 --
NM_022462chr19253794 3664 3587 3468 3335 3299 3282 3275 3204 3151 3117 2698 2533 1494 1414 1321 1201 1105 804 772 740 565 285 147 59 42601 1114 601 49 23578 2394 23098 1504
NM_022465chr1292282 1105 900 554 338 236 139 122 34 1861 1386 12471
NM_022469chr1102979 2588 2168 1153 666 642 543 385 205 27 ------
NM_022473chr1564107 3090 1785 1519 1171 870 32933 1049 328 44115 1434 1384 1305 --
NM_022474chr1442758 2425 1784 301 ----11969
NM_022477chr2061419 1324 1316 1174 121 54 ------
NM_022497chr363018 2709 1301 1210 506 84 --33203 991 592 --
NM_022574chr791979 1971 1900 1786 1380 754 692 641 21 --2856 566 --
NM_022648chr2104462 4389 4185 3825 3023 1551 1320 838 540 344 ------
NM_022719chr2293906 3348 2768 2738 1157 889 693 191 74 1880 11277 13811
NM_022744chr1641129 459 209 163 --2880 317 1919
NM_022745chr112390 --1662 12875
NM_022758chr693064 2160 1221 698 674 569 554 117 104 --12922 22573 1130
NM_022771chr1231076 792 45 --1832 --
NM_022781chr963292 3051 2778 2771 1271 669 11217 --1215
NM_022802chr102609 389 11493 11372 --
NM_022832chr432256 898 539 ------
NM_022898chr1474216 3985 3370 1856 791 101 94 24083 136 ----
NM_022977chrX31900 888 56 ------
NM_022978chr541012 929 434 267 --11326 --
NM_023000chr1431429 59 51 ------
NM_023001chr1431429 59 51 ------
NM_023039chr53368 311 87 ------
NM_023071chr122942 800 --21049 724 --
NM_023074chr1931040 978 532 --2490 147 --
NM_023105chr881939 1528 480 389 156 60 47 30 --11810 1609
NM_023106chr881939 1528 480 389 156 60 47 30 --11810 1609
NM_023110chr881939 1528 480 389 156 60 47 30 --11810 1609
NM_023111chr881939 1528 480 389 156 60 47 30 --11810 1609
NM_023923chr1163416 3015 2838 2820 2812 2704 2671 2514 2489 2347 1417 1272 1121 1066 951 459 --2833 754 32405 1195 697
NM_024007chr522604 364 --1935 11926
NM_024046chr361164 1116 1024 921 215 123 ------
NM_024052chr1742600 2354 829 397 12550 22792 448 --
NM_024086chr1773702 3425 3252 1447 966 651 254 --42774 2718 2641 486 --
NM_024095chr1241012 385 191 143 --3570 514 435 --
NM_024103chr19181846 1755 1638 1511 1343 1284 1161 729 714 452 394 343 331 241 161 103 45 28 6514 484 476 302 198 140 3656 589 375 --
NM_024122chrX2234 199 --154 --
NM_024294chr693064 2160 1221 698 674 569 554 117 104 --12922 22573 1130
NM_024312chr1251347 1339 1199 1003 30 ------
NM_024430chr1861529 1521 1378 617 214 116 ------
NM_024511chr442319 2311 2171 395 --23324 2418 --
NM_024513chr3143736 2817 2709 2671 1528 1484 1305 1066 927 581 529 395 186 113 23681 2911 23830 2974 --
NM_024522chr161792 1361 770 543 388 22 31776 1621 531 21607 125 --
NM_024551chr1252131 1903 1581 634 238 42095 697 190 32 --198
NM_024551chr1252131 1903 1581 634 238 42095 697 190 32 --198
NM_024595chr141223 1178 812 772 138 31138 1080 1001 --
NM_024611chr1552484 1528 1316 1008 554 23560 2567 ----
NM_024617chr91365 ----1352
NM_024631chr113433 180 112 ------
NM_024639chr622828 424 2749 189 22962 451 --
NM_024646chr193745 3694 3585 2980 2838 2602 2478 943 306 13046 42895 2762 1575 1305 --
NM_024659chr23781 319 184 1198 ----
NM_024670chr1021621 1543 2535 377 ----
NM_024674chr1133108 3089 2762 2678 2314 2306 2054 2033 1015 963 912 584 245 --32957 2536 2459 1183
NM_024689chrX21571 233 1290 --21555 227
NM_024698chr1161275 401 251 168 92 22 1259 21101 1051 1564
NM_024707chr196688 402 222 200 86 47 1762 1239 --
NM_024715chr541471 1187 479 372 11545 21567 738 --
NM_024721chr842435 1001 553 306 ------
NM_024740chr1143331 3151 3006 2991 13554 ----
NM_024742chr1661467 1359 616 601 491 193 11823 21909 35 --
NM_024751chr451638 1374 1316 1308 228 --1592 --
NM_024770chr276640 5735 5620 5322 5200 2017 749 26324 2441 42077 1942 1054 671 14714
NM_024807chr651833 1326 312 283 45 --3363 338 167 --
NM_024811chr1181712 1666 518 487 151 119 112 87 --21634 188 --
NM_024875chr1061830 1639 1622 1130 432 68 --31654 704 627 --
NM_024884chr14114464 4110 2855 1227 1153 1040 1002 911 792 434 289 13348 1652 11767
NM_024887chr192102 2044 1915 1598 1565 1552 1428 1410 130 --1366 --
NM_024889chr1041602 1192 1108 188 130 11252 --
NM_024915chr872367 2104 1841 1006 885 213 155 12442 275 69 --
NM_024920chr411001 --21173 991 --
NM_024947chr398299 8273 8130 7380 7086 6033 3359 2377 399 28282 7531 --19008
NM_024949chr4104892 4524 4434 4052 4045 4010 3445 3109 1436 311 --24454 4221 --
NM_024989chr266558 3044 3035 2257 2096 1627 26854 5667 ----
NM_025027chr1921015 239 --2150 56 --
NM_025054chr823166 3000 --12692 --
NM_025073chr184502 4163 3941 3848 3618 3601 1591 1381 ----13300
NM_025074chr472853 2479 2041 1988 742 657 158 --42352 927 402 185 --
NM_025099chr1741082 429 124 103 --11180 --
NM_025106chr191890 1836 1739 1345 1327 1214 663 277 246 21257 529 11246 --
NM_025134chr1641604 777 590 72 ------
NM_025160chr153365 3292 1614 1491 1411 --21260 1156 --
NM_025179chr184658 3775 3133 1535 998 421 119 95 11116 --1877
NM_025182chr97957 928 916 863 731 385 193 ------
NM_025191chr142544 921 784 260 --13123 22519 2334
NM_025195chr851524 1232 764 627 228 --123 --
NM_025222chr322559 2525 12248 22360 2281 --
NM_025248chr17143039 3020 2895 2873 2752 2253 2153 2082 2032 549 443 274 153 81 1401 ----
NM_025250chr7212815 2623 2614 2586 2501 2442 2407 2335 2301 2239 1198 966 912 747 662 620 494 388 239 114 26 --42632 2159 1013 1000 --
NM_030576chr17132499 2241 2115 2108 2030 1928 1877 1023 826 662 560 271 259 --32603 967 711 --
NM_030621chr1463481 2924 2593 1363 915 377 ------
NM_030627chr573798 3163 1664 1631 195 77 65 11027 1830 --
NM_030629chr1671459 1302 1222 758 626 363 182 ------
NM_030647chr764896 4413 3913 2369 1896 703 --1797 25437 5351
NM_030648chr474928 4598 4502 4045 2214 2037 1253 --25318 1627 --
NM_030650chr234255 3561 743 --24281 4036 13624
NM_030664chr1021999 1739 --12310 --
NM_030670chr1221502 569 11584 11457 1293
NM_030671chr1221502 569 11584 11457 1293
NM_030674chr1263767 3744 1727 1503 1191 1025 13852 25157 896 --
NM_030758chr2291379 1268 1191 943 494 325 268 261 203 11210 11202 --
NM_030759chr101100 ----1556
NM_030761chr142649 2188 672 655 21780 84 --1167
NM_030767chr9102834 2648 2613 2488 2260 2076 771 678 647 544 22630 2585 2307 271 --
NM_030786chr141788 1325 661 291 ------
NM_030792chr117726 653 577 569 553 196 129 1678 ----
NM_030799chr521971 641 1819 1422 1500
NM_030805chr261285 1163 526 453 211 152 --1949 --
NM_030806chr1239241 9001 8896 8855 8365 8232 7715 7146 6673 6580 6568 6233 5781 3545 3379 3349 3260 2998 1728 1171 719 136 56 38948 7351 1951 36457 3017 1945 29079 7176
NM_030809chr1232365 831 427 12153 2560 381 --
NM_030816chr12747 53 1251 22629 984 --
NM_030817chr1252579 2436 1179 1134 1007 --22788 466 --
NM_030881chr22125 --1367 22033 1788
NM_030915chr252293 1757 690 680 556 11587 1847 --
NM_030918chr195204 4855 4449 4438 4232 4123 4042 2050 966 13963 ----
NM_030922chr153643 530 193 2705 569 1710 --
NM_030964chr5113588 3540 3059 2575 2494 2339 2311 2283 563 518 351 13551 11269 11043
NM_031305chr43681 182 45 --21785 1275 --
NM_031309chr8112229 2141 2051 1820 1553 1487 891 796 752 529 140 21764 206 1283 --
NM_031314chr1441378 751 681 31 ------
NM_031372chr4------1258
NM_031411chr542168 873 291 115 1644 --1866
NM_031417chr1981127 944 881 789 746 732 376 138 1862 --12206
NM_031426chr972497 2392 948 636 528 398 35 1901 22466 2089 --
NM_031427chr1464381 2095 1796 1771 1551 1051 2872 515 75826 5407 4296 4239 4160 1630 271 11115
NM_031435chr1252460 1387 1157 874 822 ------
NM_031444chr22112141 1587 848 706 648 598 573 451 257 48 36 4430 245 237 206 21825 764 --
NM_031463chr1642225 2051 45 35 --12011 11554
NM_031483chr2063333 3286 2979 2802 2367 1285 12444 ----
NM_031844chr143993 1115 1102 482 13923 2891 207 --
NM_031845chr242959 2842 2809 1005 11468 ----
NM_031847chr242959 2842 2809 1005 11468 ----
NM_031849chr542168 873 291 115 1644 --1866
NM_031857chr542168 873 291 115 1644 --1866
NM_031858chr1731360 590 395 1459 11247 --
NM_031860chr542168 873 291 115 1644 --1866
NM_031862chr1731360 590 395 1459 11247 --
NM_031886chr1952116 1726 1703 1618 27 --21973 1896 --
NM_031890chr2293012 2655 2641 2085 2053 1911 1891 108 48 1236 22536 1096 --
NM_031938chr112747 232 2680 88 1187 --
NM_032012chr955001 3536 1677 1339 600 24991 4821 33499 1527 1448 --
NM_032013chr2061419 1324 1316 1174 121 54 ------
NM_032021chr112442 425 --21147 909 --
NM_032041chr862643 2405 2031 1726 972 392 --1192 --
NM_032050chr223998 769 366 2331 137 1131 --
NM_032052chr2241383 1154 920 887 21030 522 1516 --
NM_032088chr5101709 1646 1093 528 369 347 312 292 219 97 1375 21451 1128 --
NM_032092chr5101709 1646 1093 528 369 347 312 292 219 97 1375 21451 1128 --
NM_032105chr1157810 7798 6603 4982 4903 2453 2428 1534 1098 899 754 568 427 326 45 32173 497 334 33184 2534 2209 47993 5629 5193 2495
NM_032116chr1345150 4748 2182 840 14111 24927 1578 --
NM_032121chrX52203 2054 1755 1731 863 --11052 --
NM_032160chr1843690 3342 2651 318 1358 ----
NM_032174chr131244 375 38 --1217 11110
NM_032208chr263642 2703 2258 1237 1093 398 1803 23135 1153 --
NM_032214chr2081057 865 857 466 400 378 202 73 --1348 152
NM_032242chr393174 2968 2571 2259 2060 946 893 738 653 --32929 2143 1261 --
NM_032281chr19142928 2826 2550 2458 1215 1144 1132 1105 862 457 393 234 215 129 --1109 --
NM_032403chr5101709 1646 1093 528 369 347 312 292 219 97 1375 21451 1128 --
NM_032434chr241121 982 601 301 ------
NM_032440chr102386 252 ----11122
NM_032445chr1522179 1825 --11912 1216
NM_032457chr453343 2587 2407 1374 219 ------
NM_032458chrX32623 2469 579 ------
NM_032511chr63373 339 189 ------
NM_032538chr6112793 2571 2200 2177 2037 1763 772 445 337 120 40 32799 2502 650 52629 2349 2095 959 535 --
NM_032569chr1671836 759 531 382 315 46 34 --1563 --
NM_032575chr16131728 1689 1599 1521 1296 1285 700 687 646 504 480 435 171 --2566 112 --
NM_032595chr1791591 1412 1270 588 333 234 133 75 36 ----11132
NM_032603chr23636 540 67 --1565 --
NM_032622chr431145 293 156 ------
NM_032632chr141561 ----1260
NM_032682chr343302 2974 2717 648 1579 1170 123
NM_032711chr1784034 3772 2957 2815 1503 929 167 147 23067 243 1442 --
NM_032741chr69936 819 714 704 403 363 230 188 88 1414 ----
NM_032801chr1141929 1571 634 61 12297 12546 --
NM_032809chr93293 272 107 31052 454 287 1482 --
NM_032818chr9142495 2251 2120 2095 1953 1818 1710 1645 918 799 384 145 95 36 --32010 1875 206 1371
NM_032826chr764611 4377 3382 3360 449 185 --44770 908 852 773 11318
NM_032832chr621282 590 --1653 1123
NM_032833chr142344 1674 1010 153 12318 12171 --
NM_032859chr1343339 2817 1304 1108 12599 23801 967 --
NM_032866chr1552768 2005 745 737 596 12628 --12928
NM_032900chr1083742 3330 3197 2775 1567 1454 1399 1105 --22677 159 --
NM_032975chr1863566 2858 2332 2251 586 180 1671 23300 2462 --
NM_032980chr1863566 2858 2332 2251 586 180 1671 23300 2462 --
NM_033020chr154804 3497 3196 1320 427 11363 ----
NM_033055chr12907 131 1744 ----
NM_033089chr2061265 1057 429 391 332 155 --11231 --
NM_033103chr1941083 947 914 170 11066 ----
NM_033121chr1251264 1229 1136 699 214 ----1309
NM_033129chr20142003 1653 1431 1406 1342 672 616 414 336 307 246 159 127 87 11987 2735 519 --
NM_033133chr17133591 3562 3314 3046 2661 2392 1022 901 819 624 593 382 375 23633 2447 21207 325 2647 291
NM_033136chr561509 1367 1350 689 281 211 11342 21331 557 --
NM_033137chr561509 1367 1350 689 281 211 11342 21331 557 --
NM_033138chr731792 1546 129 ------
NM_033139chr731792 1546 129 ------
NM_033140chr731792 1546 129 ------
NM_033143chr474360 3974 3717 2901 1344 945 136 --1150 --
NM_033157chr731792 1546 129 ------
NM_033181chr622953 1270 21249 675 22714 181 --
NM_033224chr796816 6539 5464 5322 4920 3197 2998 1269 311 27266 6825 57560 5181 5116 1672 1540 --
NM_033253chr23736 600 161 ------
NM_033272chr2122 ----1283
NM_033274chr5123131 3028 2822 2212 1025 854 788 604 337 300 126 72 --1239 12889
NM_033305chr921317 420 1921 ----
NM_033331chr923181 1196 --11344 1871
NM_033389chr1764273 4133 4071 3404 1613 929 34651 4641 674 23024 1483 23075 241
NM_033419chr17101537 1443 1406 1358 1237 1216 1120 229 73 24 21578 1485 21583 1081 --
NM_033421chr2081886 1438 633 600 462 411 111 45 11714 1504 --
NM_033429chr1563306 3076 2187 726 373 340 12405 ----
NM_033449chr561847 1818 1467 346 238 22 --42153 2128 1505 707 12138
NM_033503chr15153769 3643 3437 3248 3033 2597 1446 999 992 965 874 731 658 630 582 --23572 3134 12838
NM_033505chr295615 5285 5260 4435 2430 2282 1662 1302 1132 --45175 5117 5038 877 16685
NM_033542chr2031765 1542 101 1791 1709 --
NM_033551chr5142876 2848 2837 2710 2360 2162 2131 1341 831 657 511 497 392 373 --23113 2230 11254
NM_033637chr1063817 3047 2742 2551 1583 272 13954 1812 1528
NM_033644chr531879 1655 918 ----1800
NM_033645chr531879 1655 918 ----1800
NM_033656chr2174928 1712 1406 1351 1254 712 383 14871 11959 35394 4686 3824
NM_052834chr1852457 2308 2263 2142 107 ------
NM_052846chr2061183 1017 794 56 33 24 1803 ----
NM_052876chr19162611 2507 2309 2270 2175 2129 1977 1880 1785 1667 890 589 435 418 396 267 11898 ----
NM_052879chr122869 775 1160 ----
NM_052880chr2261421 1323 1251 1063 998 480 --1101 --
NM_052898chr841677 1252 253 202 ------
NM_052906chr22234931 4887 4721 4714 4422 4297 3849 3596 3529 3447 1719 1675 1382 1345 1261 1109 994 970 800 661 639 617 415 11871 24475 553 --
NM_052907chr1254044 3364 1369 905 285 32867 1614 938 33733 3354 1700 --
NM_052910chr13102079 1736 1495 1474 1368 413 250 167 95 66 11426 ----
NM_052918chr1073555 2774 2668 1096 639 593 180 1910 23122 933 11027
NM_052937chr821730 174 --22531 560 12512
NM_052938chr13951 844 836 144 1446 --
NM_052948chr196349 324 282 257 104 67 ----193
NM_053016chr997450 7267 7247 6833 5862 3091 1086 716 62 --47333 6610 3153 2730 27578 7372
NM_053023chr1142948 658 633 396 ------
NM_053024chr331035 494 223 11150 --1370
NM_053043chr7116429 6001 5746 5465 5044 4157 2530 2356 1689 655 82 --25693 2406 21031 243
NM_053056chr1183191 2843 2762 2296 2220 635 251 56 42880 2684 726 305 ----
NM_053064chr1433064 856 279 --22634 1231 1568
NM_053279chr872528 2070 1932 1125 758 135 84 1483 1570 --
NM_054025chr1171987 1676 1471 1424 814 680 389 1622 32106 806 189 --
NM_054027chr542257 2114 538 486 --22283 2171 12037
NM_057175chr432485 1891 888 --21807 936 --
NM_057178chr1772429 2365 1858 1792 927 766 362 11918 12264 --
NM_078470chr1062728 2069 1866 834 826 685 1190 12324 --
NM_078471chr1761077 1042 1019 762 497 33 11085 11108 --
NM_078487chr972964 2770 2588 2535 1197 989 673 1736 1933 13030
NM_080491chr1193410 3299 2712 2687 2649 2458 1019 366 154 12797 1878 --
NM_080546chr91629 2653 505 ----
NM_080597chr18----11002 1351
NM_080717chr121988 11408 195 1975
NM_080792chr2052251 2191 1538 658 632 --32164 1414 390 --
NM_080836chr2094010 3476 3409 1855 1533 1341 1272 565 450 13819 2720 687 --
NM_080867chr1483791 3783 3675 3642 3344 1850 1387 1242 ------
NM_080872chr852955 2495 1353 641 243 1375 ----
NM_080921chr1--21201 474 1984 127
NM_130385chr11103241 2713 2664 2568 2240 2221 1060 975 716 105 22230 439 32510 2106 1092 --
NM_130391chr943343 3283 2672 2274 1261 11121 --
NM_130392chr943343 3283 2672 2274 1261 11121 --
NM_130393chr943343 3283 2672 2274 1261 11121 --
NM_130438chr2153165 962 839 248 63 1405 ----
NM_130798chr1541261 977 581 416 11212 ----
NM_130807chr19122294 2073 2019 1810 1800 1734 1676 859 844 682 496 380 --22113 163 --
NM_130830chr3103788 3778 3668 3659 2786 2709 2676 2572 719 409 --33900 3318 2534 --
NM_133170chr20177598 7419 7135 6711 6211 6079 5589 5310 5150 3240 2811 2755 1377 1156 819 478 53 27680 116 47698 2696 1866 1590 17789
NM_133264chr17173567 3397 3388 3329 3288 3115 2958 2854 1042 998 881 759 751 741 602 594 219 23778 133 33953 3240 2494 2928 874
NM_133265chrX103588 3465 3147 2862 2806 2728 2497 2455 595 475 ------
NM_133329chr2------11460
NM_133372chr552925 2024 1920 1883 948 ------
NM_133445chr993017 2829 2793 1194 1087 1004 649 614 446 --23195 272 1998
NM_133476chr122334 302 ----2785 419
NM_133499chrX10967 698 678 660 333 273 156 109 98 77 --3747 640 293 2991 92
NM_133631chr331584 1414 609 --2414 194 --
NM_133646chr265589 5086 4034 3892 1236 396 --23949 3814 --
NM_133647chr1583520 3481 2737 2586 2450 2435 2345 1521 --22745 1386 1780
NM_134265chr171491 ----158
NM_134442chr241775 1760 385 253 --31674 1618 1539 --
NM_138338chr22123424 3339 2869 2612 2519 2478 2372 2314 1240 1232 508 25 23191 1088 ----
NM_138357chr1041446 1141 657 357 ------
NM_138373chr1981821 1347 1268 652 639 395 362 37 --11236 --
NM_138423chr1541578 664 656 489 ------
NM_138426chr73492 160 26 ----11948
NM_138444chr1374765 1729 580 265 247 240 26 ------
NM_138457chr6162774 2766 2497 2478 1369 1095 1089 974 852 563 500 243 203 82 60 37 --22402 75 --
NM_138459chr631344 757 87 ------
NM_138468chr274931 4916 3966 2433 2291 1605 348 --65029 3882 2348 2213 1463 1386 12110
NM_138473chr1284887 4745 4086 3997 3238 1310 282 256 --44648 4318 3897 49 --
NM_138477chr157856 838 737 329 157 49 42 --2653 594 --
NM_138479chr171742 1628 1412 1325 645 559 464 --1368 --
NM_138494chr752771 2551 1923 885 160 --21838 1782 --
NM_138576chr1474216 3985 3370 1856 791 101 94 24083 136 ----
NM_138578chr2091413 1406 1172 1046 952 375 314 198 189 --1935 --
NM_138621chr2103651 3624 3559 3440 3427 3216 2954 1331 1235 430 13145 21529 754 --
NM_138638chr143804 590 444 --11628 --
NM_138713chr1687747 7492 6812 6260 5802 2586 1322 1190 --27647 5330 12681
NM_138714chr1687747 7492 6812 6260 5802 2586 1322 1190 --27647 5330 12681
NM_138717chr66656 471 216 168 98 29 ------
NM_138727chr172027 1685 849 613 171 83 76 1708 11739 --
NM_138728chr172027 1685 849 613 171 83 76 1708 11739 --
NM_138731chr1434273 2590 1340 1121 ----
NM_138771chr7------11160
NM_138799chr242077 1934 1304 391 1303 41992 1762 1383 244 --
NM_138971chr1193472 2795 2640 2446 1144 936 702 683 105 33429 2787 248 ----
NM_138971chr1193472 2795 2640 2446 1144 936 702 683 105 33429 2787 248 ----
NM_138972chr1193472 2795 2640 2446 1144 936 702 683 105 33429 2787 248 ----
NM_138972chr1193472 2795 2640 2446 1144 936 702 683 105 33429 2787 248 ----
NM_138973chr1193472 2795 2640 2446 1144 936 702 683 105 33429 2787 248 ----
NM_138973chr1193472 2795 2640 2446 1144 936 702 683 105 33429 2787 248 ----
NM_139014chr681904 1885 1444 939 511 475 437 108 ------
NM_139155chr10101584 1401 1295 1112 1094 1022 391 331 213 156 ------
NM_139182chr4------168
NM_139207chr1221619 680 --11993 --
NM_139211chr4131 ----1568
NM_139212chr4131 ----1568
NM_139283chr123799 517 460 31794 582 39 ----
NM_139323chr2051966 1751 1544 1354 696 ------
NM_144571chr435355 1960 1815 12012 14830 --
NM_144579chr262724 2438 958 865 770 547 --42915 1984 257 103 1792
NM_144590chr1042602 2258 2073 546 12081 42906 2541 2398 291 --
NM_144628chr2093027 2981 2734 2659 2590 2507 761 357 345 ------
NM_144629chr231095 406 154 ------
NM_144721chr452409 1988 1834 1809 599 22493 1918 32567 2127 1724 --
NM_144723chr55827 348 328 298 269 ------
NM_144778chr131727 --11730 12160
NM_144949chr222157 1819 --12563 12247
NM_144973chr12114789 4714 3966 3958 3789 1892 1660 1534 1086 645 114 14321 23392 1737 14892
NM_144974chr133827 648 315 --1186 --
NM_145013chr1142156 488 387 39 --32929 2116 2068 --
NM_145113chr1441325 1297 607 210 1536 --1239
NM_145117chr1183263 2495 2230 1315 1209 677 132 94 ----12168
NM_145176chr642810 940 329 154 --12962 23162 178
NM_145206chr10112955 2858 2585 2330 2248 2175 2150 1029 935 458 98 12110 32939 712 288 --
NM_145239chr165446 377 302 283 218 122 1854 --
NM_145259chr265373 5250 5047 1656 1621 937 36009 231 98 34510 1397 1166 26762 4936
NM_145263chr451720 1520 755 131 91 11638 ----
NM_145307chr1023193 3139 ----11225
NM_145320chr763078 2566 2437 826 747 374 22658 2648 13544 --
NM_145321chr763078 2566 2437 826 747 374 22658 2648 13544 --
NM_145322chr763078 2566 2437 826 747 374 22658 2648 13544 --
NM_145341chr1041538 1276 1248 221 --31594 1460 406 --
NM_145686chr233067 968 125 23242 204 ----
NM_145687chr233067 968 125 23242 204 ----
NM_145698chr1031987 1436 48 --32123 1715 1444 --
NM_145716chr14434 417 139 128 1426 ----
NM_145733chr227946 900 812 791 309 105 30 ----1450
NM_145799chrX51167 733 496 469 258 12856 1903 --
NM_145808chr72791 23 12620 22188 1046 --
NM_145888chr1981792 1328 807 648 614 587 170 129 --31357 1243 368 --
NM_145891chr161159 ----11319
NM_145892chr161159 ----11319
NM_145893chr161281 ----11441
NM_145912chr22144528 4030 3800 3728 3572 1739 1368 889 580 482 375 155 108 55 21386 179 43827 3563 2917 1120 11392
NM_147150chr913502 13114 63261 3229 2987 2427 479 237 --
NM_147192chr181714 1689 1427 478 424 410 202 148 1246 31604 1479 89 --
NM_147202chr9132229 2193 2170 1771 854 753 617 484 403 395 373 123 70 1833 2801 266 --
NM_147223chr241630 1513 577 137 22198 667 32383 1831 672 --
NM_147233chr221447 394 22015 484 32200 1648 489 --
NM_148921chr1772222 2214 1744 1560 1544 572 392 12172 1300 1154
NM_148955chr15145961 5801 5330 5146 4680 4345 1930 1863 1817 1284 1249 565 111 76 22114 1259 25792 2606 25453 5285
NM_148957chr1352279 2181 1832 659 214 ----32069 1640 192
NM_148960chr191989 1494 1306 625 433 399 330 275 163 31399 643 420 41879 1823 1745 1544 191
NM_152233chr1441666 1337 1309 128 ------
NM_152237chr22151614 1600 1574 1556 1522 1381 1330 1311 1269 1082 702 625 458 432 361 11468 ----
NM_152253chr22153679 3170 2764 2753 1687 1636 1576 1481 1337 1201 901 603 379 272 111 33746 2932 650 43713 1010 878 759 --
NM_152262chr19----3578 247 81 --
NM_152263chr1116061 5777 3752 3728 2383 2357 2248 2215 1662 1231 64 22366 166 85536 4114 4037 1123 1066 987 660 195 35487 5402 4862
NM_152280chr192957 2776 2477 2405 577 455 305 145 25 31171 870 85 32584 808 91 --
NM_152352chr1882764 2739 2585 2557 2536 910 727 44 1716 ----
NM_152371chr1101999 1944 1851 1813 1656 1420 1335 696 207 114 2676 547 1338 --
NM_152384chr2121707 1687 1610 1561 1511 1434 1386 1357 1336 798 729 468 11893 ----
NM_152388chr243606 1486 940 878 1962 --13183
NM_152411chr74914 753 610 264 --1838 --
NM_152420chr9------2589 100
NM_152424chrX174755 4530 4150 4082 3814 3344 3329 1659 1535 1267 1240 1191 800 667 232 127 108 14313 ----
NM_152437chr1272382 2039 540 487 355 101 60 --11842 --
NM_152470chr18113952 3608 3599 3420 3022 2970 2890 1591 1459 922 27 11023 23273 1439 34181 1610 562
NM_152478chr194495 218 204 40 ------
NM_152519chr232107 708 538 ------
NM_152529chr273722 3330 3305 3162 1606 597 97 23711 303 64200 3086 512 454 375 21 --
NM_152542chr42851 685 --3879 765 607 --
NM_152545chr43635 470 256 1486 ----
NM_152546chr551451 1308 1013 212 126 --11230 --
NM_152624chr531235 979 788 15077 24525 1418 16990
NM_152629chr973166 3131 755 714 510 309 298 2879 387 1873 1368
NM_152636chr1132731 2669 2539 --22336 432 --
NM_152641chr1232573 2341 168 ------
NM_152667chr2041172 1038 1005 76 --1152 --
NM_152687chr51377 11074 --1877
NM_152699chr373745 2913 2905 2762 2499 2319 1088 22328 130 11169 --
NM_152733chr6186472 6327 5667 5296 5061 4854 4761 4212 4157 3944 2580 2059 1790 1783 1307 1087 557 267 24683 2427 25538 4689 16349
NM_152739chr72164 99 11091 1137 --
NM_152744chr783164 3115 3025 2832 2601 1301 792 295 ----178
NM_152756chr511492 ----23954 568
NM_152758chr832097 828 782 ------
NM_152826chr15145961 5801 5330 5146 4680 4345 1930 1863 1817 1284 1249 565 111 76 22114 1259 25792 2606 25453 5285
NM_152838chr20--12997 --1674
NM_152860chr1271066 1052 1031 993 592 90 25 21457 577 --1957
NM_152903chr1331836 1811 772 --32064 687 631 --
NM_152924chr15155629 5487 4955 4915 4429 4391 4216 2713 2129 1978 1662 1579 1471 712 106 --25544 5410 --
NM_152989chr1231917 1840 155 11881 ----
NM_153013chr542253 1878 1735 1624 --22234 1983 --
NM_153020chr61155 ----1223
NM_153035chr163241 3099 636 587 480 453 --23156 3021 --
NM_153050chr2284722 4146 3787 1933 1032 960 714 471 ------
NM_153051chr2284722 4146 3787 1933 1032 960 714 471 ------
NM_153184chr31108 --21615 1594 11417
NM_153188chr544754 1782 1654 254 1618 1144 1139
NM_153261chr1611515 11007 2602 300 --
NM_153262chr142911 2363 2352 384 ------
NM_153321chr1721053 426 --1372 1101
NM_153322chr1721053 426 --1372 1101
NM_153350chr16111666 1632 1512 1496 1234 611 222 186 151 102 72 21246 697 31451 1258 503 --
NM_153367chr10173797 3671 3460 3403 3251 2473 1432 1293 1273 1257 1229 1105 1086 714 702 572 467 --33639 1185 745 2561 384
NM_153487chr6214804 4791 4750 4662 4631 4621 4589 4314 3724 3702 3393 3295 3010 1630 1282 1245 819 766 648 469 76 24563 3427 24713 417 --
NM_153607chr522361 1945 13157 --22991 657
NM_153619chr15103530 3341 2880 2702 2294 750 463 433 312 147 --23304 1205 2697 550
NM_153645chr2272981 2973 2505 2242 801 584 557 --1873 1273
NM_153649chr142177 1617 1475 370 --1501 --
NM_153688chr1631896 144 32 --165 11807
NM_153689chr221554 497 1731 ----
NM_153712chr243161 2580 915 864 22641 594 33181 2798 367 --
NM_153810chr10105005 4353 4241 4207 4192 4041 3674 1364 647 485 ------
NM_153812chr13880 732 86 12207 ----
NM_153828chr21598 ----1732
NM_170607chr175987 976 606 249 99 21414 289 1146 11141
NM_170665chr1283917 3662 2941 2832 1682 554 497 154 12999 13480 --
NM_170674chr154223 160 139 131 21238 287 1262 --
NM_170677chr154223 160 139 131 21238 287 1262 --
NM_170706chr193374 3307 3101 3081 1385 1165 669 124 51 --13394 --
NM_170731chr1122382 754 ----22074 1039
NM_170732chr1122382 754 ----22074 1039
NM_170733chr1122382 754 ----22074 1039
NM_170734chr1122382 754 ----22074 1039
NM_170735chr1122382 754 ----22074 1039
NM_170751chr641174 1013 507 446 1589 ----
NM_170752chr641174 1013 507 446 1589 ----
NM_170768chr1131679 1591 533 2273 194 ----
NM_170774chr20103932 3517 2992 2586 1547 1089 185 106 57 31 ----11276
NM_172020chr781889 1855 1301 1269 799 658 594 108 ----11735
NM_172071chr1115999 5831 5438 2558 2274 2049 1460 1453 1259 453 164 --27050 1482 15585
NM_172225chr181714 1689 1427 478 424 410 202 148 1246 31604 1479 89 --
NM_172315chr154223 160 139 131 21238 287 1262 --
NM_172316chr154223 160 139 131 21238 287 1262 --
NM_172344chr2------11460
NM_172375chr142813 287 1847 1171 1835
NM_173065chr1123141 3133 2989 2522 2515 1151 1142 1115 716 530 469 67 13622 23288 1316 --
NM_173082chr631351 993 280 ----1406
NM_173156chr151816 1771 1681 687 551 --32012 1623 1596 1727
NM_173191chr1091276 1265 1183 1068 1054 837 362 213 67 --21169 51 --
NM_173192chr1091276 1265 1183 1068 1054 837 362 213 67 --21169 51 --
NM_173193chr1091276 1265 1183 1068 1054 837 362 213 67 --21169 51 --
NM_173194chr1091276 1265 1183 1068 1054 837 362 213 67 --21169 51 --
NM_173195chr1091276 1265 1183 1068 1054 837 362 213 67 --21169 51 --
NM_173198chr932692 2048 307 --1893 --
NM_173200chr932692 2048 307 --1893 --
NM_173214chr1687747 7492 6812 6260 5802 2586 1322 1190 --27647 5330 12681
NM_173354chr2141956 1817 1415 730 1176 1664 --
NM_173470chrX72741 2416 2375 1907 1895 1849 551 11838 ----
NM_173476chr16162296 2283 2169 2013 1858 1543 903 873 862 818 717 676 372 305 99 44 --12204 --
NM_173477chr17111877 1565 1524 1472 792 733 694 554 493 292 95 31936 560 536 21828 210 --
NM_173496chr1022386 2222 ----1231
NM_173511chr262942 2836 911 186 168 44 --11291 11006
NM_173514chr53593 482 451 ------
NM_173576chr1032168 104 56 1126 ----
NM_173582chr1165342 5201 4145 1508 1483 1341 14521 35368 5257 1265 14798
NM_173595chr12195131 4764 4602 3943 3782 3681 3554 3442 2076 2063 1877 1780 1745 1465 1077 586 290 231 204 34029 1295 646 43964 3745 3695 3221 --
NM_173602chr1263394 3303 2959 2461 945 911 ----13408
NM_173642chr178440 8382 7747 7076 2932 2208 1440 25588 1008 21958 111 12370
NM_173683chr83688 173 76 1345 1299 --
NM_173694chrX32157 783 566 11041 1716 --
NM_173825chr362520 2079 1979 1091 846 550 32005 992 459 32408 2118 1894 22863 2768
NM_173833chr871353 1176 1141 426 311 139 106 ------
NM_173854chr192170 2069 2021 1759 1677 664 544 359 83 11972 ----
NM_174911chr863274 2503 1503 965 677 104 ------
NM_174934chr1193214 2872 2354 965 865 842 591 67 35 --12644 --
NM_175623chr12157695 7336 6959 6901 6369 6328 5585 5407 5382 5241 4965 1085 621 568 29 17277 55509 5297 5163 2204 2116 16482
NM_175634chr841018 902 459 331 --11040 --
NM_175635chr841018 902 459 331 --11040 --
NM_175636chr841018 902 459 331 --11040 --
NM_175733chr1152156 1955 1491 738 707 1511 --21877 544
NM_175736chr12177673 6785 6235 6102 5889 5046 4963 4869 3004 2774 2450 2194 2143 1378 1340 1123 120 17685 32935 2224 847 26481 6252
NM_175767chr51421 1266 --1128
NM_175852chr1132878 2840 2739 2728 2448 2211 2178 2138 1935 1878 918 619 372 --11978 --
NM_175861chr1253674 3654 1928 1650 1509 25312 2375 2275 23 25558 2061
NM_175898chr1571417 1398 1251 619 418 158 147 ------
NM_175900chr1681427 1401 1239 1102 713 567 92 61 11129 ----
NM_175921chr554081 3191 3093 1129 137 1839 23872 1248 13077
NM_175931chr1631416 1408 1358 11389 21380 46 11395
NM_176801chr491732 1547 1165 503 493 313 198 175 140 1751 3534 187 149 --
NM_176863chr1771583 1506 1343 717 685 535 218 --1251 --
NM_177424chr111728 1265 --21861 1638
NM_177438chr1463481 2924 2593 1363 915 377 ------
NM_177968chr252144 2002 1845 1620 631 --32059 1926 222 --
NM_177974chr1541578 664 656 489 ------
NM_177996chr2043378 2619 748 339 12405 ----
NM_177999chr9173749 3738 3428 3234 3224 2885 2638 2602 2409 2364 1490 1157 1076 993 905 724 56 1789 32653 2253 319 13309
NM_178010chr1231917 1840 155 11881 ----
NM_178011chr1033203 2776 110 13028 12986 148
NM_178013chr14152481 2316 2305 1913 1899 1170 1003 806 655 604 597 536 416 240 86 32647 2385 1009 22170 1015 --
NM_178037chr12123663 3642 3280 3118 2633 2317 2249 1285 155 131 112 51 43217 3168 2408 478 33563 3428 1453 13509
NM_178038chr12123663 3642 3280 3118 2633 2317 2249 1285 155 131 112 51 43217 3168 2408 478 33563 3428 1453 13509
NM_178126chr1781798 1662 1635 1491 873 659 397 55 1668 ----
NM_178140chr5--22298 951 21693 184 --
NM_178151chrX97565 7323 6941 5838 5762 2164 2153 2011 1124 13032 --11929
NM_178152chrX97565 7323 6941 5838 5762 2164 2153 2011 1124 13032 --11929
NM_178153chrX97565 7323 6941 5838 5762 2164 2153 2011 1124 13032 --11929
NM_178554chr3123069 2948 2501 2315 1451 1401 1348 1170 898 494 452 110 ------
NM_178578chr2031016 921 24 22400 817 22454 608 --
NM_178585chr462605 2358 2172 788 573 41 ------
NM_181351chr1152363 2353 1989 1167 835 1323 22609 502 --
NM_181358chr143420 2970 1696 379 23291 1708 43498 3483 3013 2957 --
NM_181443chr2032826 760 403 --22365 431 --
NM_181486chr121988 11408 195 1975
NM_181489chr3176805 6657 6497 6324 5716 5614 5471 5077 4967 2645 2405 2145 1394 1035 636 457 57 --25529 5395 1134
NM_181521chr16116667 6448 5208 4963 4713 2748 2728 2309 1464 1403 805 37074 6205 726 21318 652 --
NM_181689chr207705 615 360 327 267 204 153 1621 1676 --
NM_181782chr61102 22307 108 31471 1416 82 --
NM_181783chr1241774 1751 333 166 ------
NM_181784chr262479 2403 2166 2059 2015 1053 193 11862 --
NM_181828chr22153684 3466 3426 3384 3058 3050 2909 2327 1416 802 547 469 380 212 80 1635 23260 2752 --
NM_181829chr22153684 3466 3426 3384 3058 3050 2909 2327 1416 802 547 469 380 212 80 1635 23260 2752 --
NM_181830chr22153684 3466 3426 3384 3058 3050 2909 2327 1416 802 547 469 380 212 80 1635 23260 2752 --
NM_181832chr22153699 3481 3441 3399 3073 3065 2924 2342 1431 817 562 484 395 227 95 1650 23275 2767 --
NM_181897chr372452 2192 2168 1952 985 647 199 --12124 --
NM_182485chr462920 2516 1135 1026 384 113 1539 1182 11280
NM_182507chr1271795 1786 1499 930 759 623 34 --2957 24 --
NM_182509chr1451634 1506 1201 1152 443 1649 1312 11080
NM_182511chr1841262 369 147 104 11398 --11375
NM_182515chr1986737 6420 6260 5568 4792 1936 1058 90 26551 457 106660 5745 4707 4652 4573 955 900 823 332 168 15876
NM_182526chr1492980 2680 2572 2364 816 754 659 137 77 12474 22514 2020 --
NM_182551chr253579 2499 1012 518 401 13078 --12245
NM_182569chr173710 625 121 --2569 490 --
NM_182643chr842385 2075 1717 681 11744 ----
NM_182646chr462920 2516 1135 1026 384 113 1539 1182 11280
NM_182663chr192119 1937 1766 1679 1662 1472 570 475 201 1521 1319 --
NM_182664chr192249 2067 1896 1809 1792 1602 700 605 331 1651 2449 114 --
NM_182665chr192119 1937 1766 1679 1662 1472 570 475 201 1521 1319 --
NM_182728chr1491564 1524 1189 713 590 542 456 218 197 11437 --11182
NM_182763chr132330 2044 93 22423 66 11942 --
NM_182767chr121308 11951 11332 --
NM_182830chr1431984 1625 603 --1430 --
NM_182894chr1491663 1488 1467 1112 588 470 278 265 221 --1453 131
NM_182898chr744728 4454 741 316 14460 11302 --
NM_182899chr744728 4454 741 316 14460 11302 --
NM_182907chr621670 548 21929 1720 186 1153
NM_182964chr1183263 2495 2230 1315 1209 677 132 94 ----12168
NM_182970chr20133949 3930 3882 3523 3015 2701 1502 996 914 689 511 453 64 --1815 1810
NM_183006chr2051567 1419 1318 1239 291 --1607 11206
NM_183047chr203136 118 31 --1737 1362
NM_183048chr203136 118 31 --1737 1362
NM_183078chr683759 3195 3130 1107 885 644 571 282 33632 2861 919 23411 2649 --
NM_183227chr611410 ----1460
NM_183376chr1511984 1455 22612 2018 --
NM_183397chr20115096 4898 4799 4586 4502 4369 3250 1957 986 336 267 1322 63597 3422 1872 1816 1737 379 --
NM_183419chr8----11000 11214
NM_194278chr14123528 3409 2843 2835 2685 2535 1453 1424 1395 742 279 30 21647 925 33663 1414 931 --
NM_194282chr432845 2717 569 12265 1824 --
NM_194285chr1153031 2978 2953 2811 76 --22868 2731 1906
NM_194286chr12155567 5340 5084 4746 4428 4087 2433 1892 1566 990 943 724 691 448 412 45949 5491 3787 1255 65013 2457 2007 867 843 794 --
NM_194298chr1031727 604 336 1735 --1688
NM_194313chr95798 521 323 288 137 11602 41607 1499 1443 143 --
NM_194328chr963292 3051 2778 2771 1271 669 11217 --1215
NM_194329chr963292 3051 2778 2771 1271 669 11217 --1215
NM_194330chr963292 3051 2778 2771 1271 669 11217 --1215
NM_194332chr963292 3051 2778 2771 1271 669 11217 --1215
NM_194356chr1241977 736 712 564 21606 137 ----
NM_194434chr18105451 5170 1924 1882 1748 1687 1569 914 708 345 --33685 653 406 --
NM_197941chr552661 2344 2241 1899 611 12728 22741 2644 --
NM_198056chr392083 1709 1577 1545 1522 559 415 265 128 --21730 897 --
NM_198066chr1472628 2447 2368 2342 2239 2095 1192 1526 1762 13073
NM_198074chr15526 515 466 389 261 --11294 --
NM_198081chr632708 2009 391 21902 45 12627 12818
NM_198128chr1821467 253 12253 ----
NM_198147chr175824 787 450 199 21 1393 1896 --
NM_198204chr175987 976 606 249 99 21414 289 1146 11141
NM_198205chr175987 976 606 249 99 21414 289 1146 11141
NM_198225chr1011775 --1756 21526 600
NM_198268chr143420 2970 1696 379 23291 1708 43498 3483 3013 2957 --
NM_198269chr143420 2970 1696 379 23291 1708 43498 3483 3013 2957 --
NM_198270chrX43449 2622 1046 39 ----1649
NM_198271chr331596 1571 710 --52199 2120 1486 1430 1351 --
NM_198273chr531128 1120 400 1596 1703 --
NM_198320chr12125102 5044 4893 4750 3861 3838 1533 945 723 651 517 57 11018 103747 3687 3608 1911 1448 1389 1310 607 438 109 23188 74
NM_198321chr5153109 2403 2356 2331 2323 2051 1297 1168 1002 946 661 244 218 206 172 22482 2277 33015 1032 562 --
NM_198390chr1671459 1302 1222 758 626 363 182 ------
NM_198391chr202528 70 --11357 --
NM_198392chr672302 2135 1616 1524 897 308 171 1323 153 1604
NM_198451chrX----1511 1646
NM_198468chr693892 3382 3015 2934 1404 1290 1108 536 440 --14191 --
NM_198485chr342429 1794 822 186 1830 ----
NM_198491chr162612 591 --2564 44 125
NM_198504chr32832 364 1160 --2314 302
NM_198513chr821662 245 ----11790
NM_198560chr3103776 3702 3508 3136 3058 2915 991 929 71 38 --12801 --
NM_198581chr2156969 6632 6491 6304 6146 5688 5546 5360 5091 5067 5060 4919 2763 2652 1086 56956 6641 5697 2098 1785 --11275
NM_198595chr484927 3487 3333 3315 3071 1892 363 110 13530 14999 --
NM_198597chr104760 740 102 52 1683 --1909
NM_198679chr9112630 2592 2324 2173 2040 1693 1675 979 721 615 349 --2932 834 --
NM_198715chr125753 153 11667 25487 5439 22284 1054
NM_198793chr343654 2949 721 711 --23699 2928 --
NM_198834chr17112309 2110 1998 1649 1516 810 413 396 343 208 179 2684 487 11853 --
NM_198836chr17112309 2110 1998 1649 1516 810 413 396 343 208 179 2684 487 11853 --
NM_198837chr17112309 2110 1998 1649 1516 810 413 396 343 208 179 2684 487 11853 --
NM_198838chr17112309 2110 1998 1649 1516 810 413 396 343 208 179 2684 487 11853 --
NM_198839chr17112309 2110 1998 1649 1516 810 413 396 343 208 179 2684 487 11853 --
NM_198859chr343800 1818 1762 1513 23776 3598 13956 14970
NM_198900chr12177673 6785 6235 6102 5889 5046 4963 4869 3004 2774 2450 2194 2143 1378 1340 1123 120 17685 32935 2224 847 26481 6252
NM_198904chr51374 1413 --11846
NM_198935chr2043006 1996 721 477 12333 21184 1117 --
NM_198993chr17111729 1657 1578 1445 1409 1269 1201 1188 1113 282 90 ------
NM_199072chr752554 2340 705 680 447 11176 1527 1669
NM_199132chr1951708 1540 714 658 44 --11940 --
NM_199188chr122869 775 1160 ----
NM_199190chr122869 775 1160 ----
NM_199262chr1782120 1658 884 797 622 597 471 55 ----12171
NM_199415chr2092346 2152 1951 1731 457 359 290 142 95 --52000 1810 1694 951 271 12168
NM_199421chr1483791 3783 3675 3642 3344 1850 1387 1242 ------
NM_199436chr232853 1925 1022 1232 ----
NM_199437chr1142472 758 193 36 ------
NM_199438chr1142472 758 193 36 ------
NM_199439chr1142472 758 193 36 ------
NM_199454chr1104339 3303 3160 3094 3078 1282 1076 1001 440 83 33433 3068 166 11122 --
NM_199462chr194389 4364 4086 3979 3626 1982 1779 1487 939 13311 44222 1897 1099 797 --
NM_201263chr192036 1911 1640 1500 1294 830 696 494 24 1315 1631 --
NM_201266chr252320 2215 1100 947 521 --22690 583 --
NM_201279chr252320 2215 1100 947 521 --22690 583 --
NM_201432chr17186502 6457 6450 6343 6188 5485 5350 5334 5262 5093 4199 4157 2532 1276 1230 835 640 232 16138 16219 2659 344
NM_201433chr17186502 6457 6450 6343 6188 5485 5350 5334 5262 5093 4199 4157 2532 1276 1230 835 640 232 16138 16219 2659 344
NM_201436chr72777 21 ----2884 845
NM_201516chr72833 77 1578 --2940 901
NM_201517chr72777 21 ----2884 845
NM_201567chr331319 547 480 11477 11289 --
NM_201568chr151816 1771 1681 687 551 --32012 1623 1596 1727
NM_201569chr151816 1771 1681 687 551 --32012 1623 1596 1727
NM_201632chr551643 1501 1321 1255 446 --31558 1423 140 --
NM_201634chr561742 1600 1420 1354 545 69 --41657 1522 1241 239 --
NM_203305chr9101839 1733 1634 1577 636 624 612 606 415 130 --11961 --
NM_203318chr1761077 1042 1019 762 497 33 11085 11108 --
NM_203342chr153547 2860 1380 760 292 2994 23 22939 1148 1331
NM_203343chr153547 2860 1380 760 292 2994 23 22939 1148 1331
NM_203349chr1511590 11423 2828 42 --
NM_203351chr17102369 2040 1992 1844 1726 1717 1009 946 289 199 22069 2049 12229 --
NM_203372chr2----192 1292
NM_203394chr1222399 707 --12009 --
NM_203417chr2111439 --1120 11542
NM_203418chr2111439 --1120 11542
NM_203446chr2132086 990 138 11951 1245 --
NM_203454chr131315 1032 912 ------
NM_205848chr182574 2382 2261 2161 2130 1969 512 242 --22306 1772 --
NM_205861chr192102 2044 1915 1598 1565 1552 1428 1410 130 --1366 --
NM_206594chr112610 --12983 13609
NM_206595chr112610 --12983 13609
NM_206854chr653636 3348 1290 573 81 --14766 --
NM_206855chr664601 4313 2255 1538 1046 285 --15731 --
NM_206907chr53739 716 573 --33385 3105 2942 --
NM_206909chr878149 7283 7151 5340 2773 1446 827 16927 22308 1825 --
NM_206914chr1272043 1472 1430 873 520 282 207 --1568 --
NM_206925chr1572546 2095 1910 1830 842 176 51 187 ----
NM_206933chr132505 2129 28 ----1490
NM_207012chr1043450 2524 945 315 1418 53160 3104 3025 2948 2203 --
NM_207015chr332314 878 704 11593 ----
NM_207033chr204994 219 208 180 21288 339 ----
NM_207034chr204994 219 208 180 21288 339 ----
NM_207043chr121829 921 1373 1869 --
NM_207044chr121829 921 1373 1869 --
NM_207047chr121829 921 1373 1869 --
NM_207111chr782565 2494 2379 2132 2041 2003 348 65 --22182 2067 --
NM_207116chr782565 2494 2379 2132 2041 2003 348 65 --22182 2067 --
NM_207119chr10102342 2216 2203 2177 1894 1856 1681 471 404 55 11544 ----
NM_207292chr343171 2696 2601 2264 --23206 2716 --
NM_207293chr343171 2696 2601 2264 --23206 2716 --
NM_207294chr343171 2696 2601 2264 --23206 2716 --
NM_207295chr343171 2696 2601 2264 --23206 2716 --
NM_207296chr343171 2696 2601 2264 --23206 2716 --
NM_207297chr343196 2721 2626 2289 --23231 2741 --
NM_207304chr131614 --11617 12047
NM_207317chr53439 104 39 --1117 --
NM_207348chr151850 1368 478 258 154 21954 1908 11884 --
NM_207366chr76825 461 423 398 256 144 --3354 313 178 --
NM_207371chr1021098 1090 21275 323 ----
NM_207372chr1082385 2227 2181 1966 912 637 344 181 1818 1588 --
NM_207396chr181769 1754 1246 617 507 474 321 170 --1625 --
NM_207406chr466512 5725 5253 5052 2452 2421 11073 ----
NM_207429chr1152269 1944 1840 166 158 11852 141 1378
NM_207518chr1991274 1231 933 423 406 264 256 128 95 --2382 315 1893
NM_207520chr21598 ----1732
NM_207521chr21598 ----1732
NM_212467chr1562365 2265 1067 611 523 145 22223 1951 1942 --
NM_212558chr974097 3172 2592 1031 524 241 132 12626 13415 --
NM_213589chr284890 4767 4420 4115 3963 3881 1753 1546 11037 ----
NM_213606chr1042044 2019 1876 839 --21800 1732 --
NM_213609chr33784 709 36 ------
NM_213648chr551643 1501 1321 1255 446 --31558 1423 140 --