TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3171
miRNA Sequence: AGAUGUAUGGAAUCUGUAUAUAUC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX83418 2733 2723 2715 2695 1348 944 566 1780 ----
NM_000067chr82680 506 ----1649
NM_000084chrX86988 5930 5799 4831 4821 2181 1170 1041 1217 36958 5529 1032 --
NM_000091chr292871 2822 2799 2788 2687 1825 1784 787 269 ------
NM_000109chrX52627 2531 2211 1633 522 11009 21057 679 --
NM_000141chr104430 421 400 104 21290 918 11216 --
NM_000167chrX31507 740 730 11769 ----
NM_000176chr552947 2685 1550 1520 443 23169 477 43203 2950 789 243 11554
NM_000217chr1254110 3917 3650 1380 1156 34452 3722 466 23942 1535 --
NM_000222chr482147 2048 2023 1614 1600 1533 203 88 11895 1705 --
NM_000232chr462773 1190 724 690 55 33 --22086 179 --
NM_000237chr841755 1726 1703 1678 1623 --11682
NM_000252chrX7970 438 358 306 297 279 155 --11269 --
NM_000259chr15106302 5780 5644 5607 5158 3956 2102 2089 885 451 22239 2163 32192 85 33 --
NM_000267chr1773117 3105 2929 2411 2309 1176 864 13230 2688 428 --
NM_000297chr431908 1700 450 ----21800 1257
NM_000314chr10133053 2938 2543 2417 2408 2398 2389 2347 1985 1280 487 478 330 1971 1158 --
NM_000332chr696843 4998 2434 2203 1813 1262 1103 689 654 --36141 4859 2007 --
NM_000337chr5105817 5201 4054 2641 2620 2590 1099 197 183 173 --36228 4721 202 --
NM_000338chr1561154 1053 925 750 734 42 --3912 135 23 --
NM_000390chrX133381 3361 3011 2992 2978 2839 2750 2743 2587 2210 2159 827 296 12106 ----
NM_000393chr261996 1964 1496 632 530 131 1118 1800 --
NM_000408chr273468 3144 2682 1283 576 381 257 12896 2920 891 --
NM_000428chr1482540 2327 2281 1924 1897 1798 707 415 11944 22188 745 --
NM_000436chr581631 1617 1529 1492 1424 1386 477 262 --11556 11238
NM_000448chr1183087 2971 2810 2187 922 769 578 538 22769 610 12955 --
NM_000459chr97804 686 311 256 153 108 98 ----1908
NM_000489chrX63432 3130 2500 1253 1133 375 ------
NM_000544chr6_cox_hap173423 3341 3175 3147 830 486 259 --1301 --
NM_000555chrX127857 7468 7229 6955 6903 6644 6595 2821 2400 2350 1701 1486 26917 6017 ----
NM_000599chr294639 4258 3865 978 848 801 754 665 116 --24291 119 --
NM_000618chr12146592 6530 6392 6108 5270 4969 4905 4139 2399 2281 955 623 313 267 36612 6266 4490 21945 280 22551 868
NM_000618chr12146592 6530 6392 6108 5270 4969 4905 4139 2399 2281 955 623 313 267 36612 6266 4490 21945 280 22551 868
NM_000633chr1873910 2069 1817 1569 808 604 65 1238 24524 1822 --
NM_000673chr44837 638 326 227 1605 1840 --
NM_000685chr35816 810 797 784 121 ----1749
NM_000685chr35816 810 797 784 121 ----1749
NM_000719chr1286052 5358 4673 2669 2502 1904 1521 870 25837 5180 35955 5352 4889 --
NM_000724chr104769 615 606 396 ----1625
NM_000782chr2051200 1093 1012 287 168 11139 11169 --
NM_000793chr1494019 3956 1529 1212 1204 1186 1170 874 313 34773 1411 359 21786 305 --
NM_000806chr571492 1469 1425 638 590 459 344 --11821 --
NM_000809chr4199268 8641 8139 7727 7719 7677 7370 6753 6318 6303 6157 5959 3568 2919 2869 1923 1915 936 816 26619 2607 37542 7434 7015 27735 2330
NM_000813chr5115589 5493 5443 4911 3920 3457 3437 3427 1500 837 673 ------
NM_000814chr15123323 2605 1499 1023 1008 861 592 292 250 158 135 115 --1259 --
NM_000817chr271011 947 935 780 247 231 217 ------
NM_000831chr1124948 4582 4557 4540 4521 4474 2437 2204 2190 2141 1884 1838 ----16255
NM_000880chr87853 803 784 729 220 148 44 --1907 --
NM_000899chr1274382 3942 3010 2995 2759 1185 35 --12799 --
NM_000902chr341064 968 771 228 --12088 1551
NM_000910chr481680 1670 1511 1461 1452 1424 1198 753 --21907 1360 --
NM_000912chr873517 3157 2700 2398 1419 764 502 ----13076
NM_000945chr271818 596 474 360 344 336 314 --1643 12043
NM_000950chrX103192 3149 3106 2723 805 589 287 269 255 201 13572 --1303
NM_001001331chr382617 2591 1989 911 713 699 679 608 1629 1658 --
NM_001001419chr583812 3721 980 931 833 602 163 87 --2651 139 1326
NM_001001420chr583812 3721 980 931 833 602 163 87 --2651 139 1326
NM_001001481chr893181 3171 2973 2793 2555 2308 2186 615 414 33270 2463 856 32917 2774 1121 13187
NM_001001484chr10122199 2174 2142 2072 2021 2004 1779 1630 758 727 588 270 --1648 --
NM_001001556chr1561450 1400 533 376 339 130 21087 122 ----
NM_001001664chr2104076 4069 3500 2966 1356 1152 878 836 776 755 ----12584
NM_001001668chr1973871 3812 3106 1474 1434 231 184 11335 12958 --
NM_001001890chr2184326 3347 3304 2742 1171 855 571 557 23492 965 23386 2782 --
NM_001001974chr1082316 2286 2037 1884 1828 1742 1605 886 11801 ----
NM_001002257chr273113 2973 2571 2168 810 207 75 --23576 2327 --
NM_001002860chr14144526 4504 3592 3456 3385 2836 1723 1560 1361 1307 713 306 197 139 1334 14592 13538
NM_001003652chr18178595 8328 8006 7949 7511 7437 6944 6538 6103 6046 5327 2725 1966 1511 956 491 484 38609 5361 3288 25497 358 28119 495
NM_001003674chr18175905 5460 5287 5268 5162 5009 4790 4766 4631 4493 2720 2017 1042 1032 938 806 411 1792 ----
NM_001003675chr18175905 5460 5287 5268 5162 5009 4790 4766 4631 4493 2720 2017 1042 1032 938 806 411 1792 ----
NM_001003679chr162160 2052 1750 1633 1417 80 ----11484
NM_001003681chr2251552 155 121 114 59 12038 1730 11869
NM_001003712chr1273967 3568 3346 3228 1626 673 395 33290 2678 691 33783 1480 580 --
NM_001004317chr683728 3276 1136 1003 323 300 266 163 --14042 --
NM_001004329chr124598 583 307 277 ----11053
NM_001005375chrY31672 296 51 ----11628
NM_001005386chr242349 2290 2103 2046 --12317 11574
NM_001005404chr1794445 3288 3173 3107 1535 1519 1416 1070 1045 23434 3400 ----
NM_001005473chr595377 5305 4762 4264 4026 2277 1964 1801 448 1552 22010 1991 1571
NM_001005753chr241755 1595 1509 1467 --31447 877 217 2836 191
NM_001006600chr562250 2112 817 807 308 89 1129 1741 --
NM_001007023chr1494019 3956 1529 1212 1204 1186 1170 874 313 34773 1411 359 21786 305 --
NM_001007097chr9104215 3291 3246 3168 1699 1675 1207 1146 847 568 11685 13368 --
NM_001007246chr2141614 588 580 544 ----1646
NM_001007466chr684725 4195 3933 3558 3464 1086 860 462 11197 ----
NM_001008392chr392944 2922 2451 2444 2438 2432 2426 2408 214 --1849 --
NM_001008564chr1371907 1504 813 500 459 336 88 31523 325 247 ----
NM_001008756chr362011 1738 1013 931 871 847 ----1750
NM_001008925chr4113508 3479 3260 3136 2706 2672 2498 1366 1058 273 101 13092 1460 13293
NM_001009554chr494484 3932 3250 3241 3130 3022 921 607 24 1881 ----
NM_001009554chr494484 3932 3250 3241 3130 3022 921 607 24 1881 ----
NM_001009899chr3126402 6042 4871 1810 1727 1665 1159 771 737 598 240 78 --14387 --
NM_001010861chr142723 2431 2329 2136 12080 2615 408 --
NM_001010888chrX64288 3127 1695 984 862 152 1120 1761 --
NM_001010891chr5136821 6660 6645 6484 5987 5860 4904 2306 1812 969 950 903 751 46352 1838 1784 1773 --25866 5048
NM_001010986chrX62435 2410 1939 1900 916 435 ----1482
NM_001011513chr444038 3399 3091 2795 23752 2638 14062 --
NM_001011537chr342331 1767 902 662 22257 2225 12022 12001
NM_001011666chr7116522 6450 6387 5714 5462 4840 4565 3977 2593 2159 1101 ----15820
NM_001012393chr11115128 4667 4073 3960 3816 3538 1370 662 556 476 430 13666 13563 --
NM_001012755chrX94979 4228 4065 4054 3959 1732 1708 1625 458 14092 34470 3193 3167 --
NM_001012761chr592656 2648 661 325 284 149 92 73 58 12240 ----
NM_001013438chr31254 1191 1689 1355
NM_001013439chr31100 137 1535 1201
NM_001013620chr12248050 7412 7317 6257 6134 6115 5898 5873 5857 5843 5833 5815 5455 5129 3229 3185 2813 2386 1768 1439 737 586 553 139 1124 38122 7536 5608 11277
NM_001014380chr1374968 4730 2173 1132 1041 960 687 --11287 13873
NM_001014797chr10128213 8202 7262 6600 6315 5707 5035 2850 2415 608 443 408 ------
NM_001015880chr1071614 1359 1308 345 176 152 98 --21636 232 1408
NM_001017440chr788212 8128 8076 5729 2571 1496 1051 813 --12048 15865
NM_001017923chr1421190 1140 --2418 246 11355
NM_001017992chr571481 616 531 503 410 265 29 11540 1981 1100
NM_001018065chr9115664 5340 5188 4955 4208 3786 2154 1833 1817 1416 1217 14441 25022 3795 --
NM_001018066chr9115664 5340 5188 4955 4208 3786 2154 1833 1817 1416 1217 14441 25022 3795 --
NM_001018067chr1114919 4620 4418 3362 1740 1147 996 717 598 299 258 ------
NM_001018068chr1114919 4620 4418 3362 1740 1147 996 717 598 299 258 ------
NM_001018069chr1114919 4620 4418 3362 1740 1147 996 717 598 299 258 ------
NM_001018074chr552947 2685 1550 1520 443 23169 477 43203 2950 789 243 11554
NM_001018075chr552947 2685 1550 1520 443 23169 477 43203 2950 789 243 11554
NM_001018076chr552947 2685 1550 1520 443 23169 477 43203 2950 789 243 11554
NM_001018077chr552947 2685 1550 1520 443 23169 477 43203 2950 789 243 11554
NM_001018090chr15102837 2082 1903 1816 1782 1081 996 968 462 232 31056 833 48 11833 12294
NM_001018091chr15102947 2192 2013 1926 1892 1191 1106 1078 572 342 31166 943 158 11943 12404
NM_001018102chr15102837 2082 1903 1816 1782 1081 996 968 462 232 31056 833 48 11833 12294
NM_001024094chr552947 2685 1550 1520 443 23169 477 43203 2950 789 243 11554
NM_001024660chr331410 597 525 1416 1487 11148
NM_001024847chr362446 2323 1953 355 337 317 12413 1330 --
NM_001024956chr11105249 5152 4876 3725 1048 819 785 638 337 101 34098 3898 511 34795 4538 1017 24573 537
NM_001025076chr1076058 5631 5391 1536 1081 593 527 16218 24315 4005 --
NM_001025077chr10137416 6989 6749 5004 4804 4720 2894 2439 1951 1885 804 796 558 17576 25673 5363 --
NM_001025079chr343966 2747 1502 1285 --22616 1305 12733
NM_001025108chr2124085 3903 3720 3704 3678 3660 3245 3177 1393 1299 871 674 24203 3962 13709 --
NM_001025252chr862725 1023 584 541 201 74 32792 723 660 --12627
NM_001025253chr862725 1023 584 541 201 74 32792 723 660 --12627
NM_001025366chr691836 1612 1588 1556 422 411 380 365 353 --31875 1542 358 --
NM_001025366chr691836 1612 1588 1556 422 411 380 365 353 --31875 1542 358 --
NM_001025367chr691836 1612 1588 1556 422 411 380 365 353 --31875 1542 358 --
NM_001025367chr691836 1612 1588 1556 422 411 380 365 353 --31875 1542 358 --
NM_001025368chr691836 1612 1588 1556 422 411 380 365 353 --31875 1542 358 --
NM_001025368chr691836 1612 1588 1556 422 411 380 365 353 --31875 1542 358 --
NM_001025369chr691852 1628 1604 1572 438 427 396 381 369 --31891 1558 374 --
NM_001025369chr691852 1628 1604 1572 438 427 396 381 369 --31891 1558 374 --
NM_001025370chr691836 1612 1588 1556 422 411 380 365 353 --31875 1542 358 --
NM_001025370chr691836 1612 1588 1556 422 411 380 365 353 --31875 1542 358 --
NM_001025580chrX103811 3732 1648 1595 1531 1437 1397 1297 629 237 13866 11442 --
NM_001025780chr931484 1298 359 11571 2572 541 --
NM_001029875chr572862 2362 919 809 678 543 362 --22793 2568 --
NM_001030055chr14114203 3708 3548 1867 1565 912 810 766 435 119 57 2274 160 ----
NM_001031684chr251277 383 334 325 284 21329 46 --1485
NM_001031700chr46988 482 169 116 42 34 --1532 --
NM_001031732chr453547 3205 1385 1099 737 23052 2633 33247 3199 676 13694
NM_001031812chr562030 1931 1602 1521 939 157 1684 ----
NM_001032394chr6102701 2620 2596 2487 1954 530 507 392 301 239 --22029 853 --
NM_001032395chr6102568 2487 2463 2354 1821 397 374 259 168 106 --21896 720 --
NM_001033057chr381987 1952 1936 1684 1639 219 165 139 --22139 2065 --
NM_001033059chr62446 162 1172 --11325
NM_001033117chr36443 417 387 373 358 341 11056 1434 --
NM_001033756chr691770 1546 1522 1490 356 345 314 299 287 --31809 1476 292 --
NM_001033756chr691770 1546 1522 1490 356 345 314 299 287 --31809 1476 292 --
NM_001033910chr162125 831 817 797 527 167 --11451 --
NM_001034850chr541239 1044 409 158 ----1162
NM_001035260chr1051370 1191 600 366 201 --1275 1370
NM_001037317chr142723 2431 2329 2136 12080 2615 408 --
NM_001037535chrX41256 434 272 123 --1437 11151
NM_001037536chrX41256 434 272 123 --1437 11151
NM_001037540chrX41256 434 272 123 --1437 11151
NM_001037954chr1133315 3047 1234 --13171 1357
NM_001038628chr32420 391 ----21172 666
NM_001039091chrX31093 405 354 31333 1312 1261 21142 967 --
NM_001039348chr2299 93 --21029 84 --
NM_001039349chr2299 93 --21029 84 --
NM_001039538chr283137 2752 2361 1108 783 644 326 167 1553 --1945
NM_001039547chr3157829 6818 6807 6351 5024 4974 4922 1663 1540 1413 1250 529 439 319 221 ----12761
NM_001039580chr4124590 4583 4563 4079 3396 1272 1102 1073 1032 446 237 96 ----14710
NM_001039585chr172821 2805 1193 885 743 436 91 --13039 13562
NM_001039590chrX73702 3363 2904 2771 2460 836 165 --13503 --
NM_001039591chrX73702 3363 2904 2771 2460 836 165 --13503 --
NM_001039618chr1195831 5119 3797 3784 1983 1823 1321 1031 882 35581 2233 1665 14149 --
NM_001039693chr2124035 3845 3792 3756 2684 1397 888 754 676 449 265 250 23837 1299 12818 23297 89
NM_001039840chrX75398 5385 4874 4669 3819 2158 241 11357 35880 4996 3822 --
NM_001039916chr124964 907 893 885 ------
NM_001039917chr124964 907 893 885 ------
NM_001039918chr124964 907 893 885 ------
NM_001039919chr124964 907 893 885 ------
NM_001039920chr124964 907 893 885 ------
NM_001039937chr1383632 3023 2905 1469 1096 929 444 96 23623 2565 --1402
NM_001040020chr761255 1152 621 326 318 261 --1564 --
NM_001040142chr292140 1520 866 815 793 785 777 546 517 ------
NM_001040143chr292140 1520 866 815 793 785 777 546 517 ------
NM_001040152chr754622 4479 4052 3716 3192 --24168 3434 --
NM_001040157chr482919 2765 2274 2249 1880 410 353 45 --12376 12370
NM_001040159chr491483 1109 1040 1013 428 338 220 113 33 21283 550 ----
NM_001040202chr462396 2076 1889 1663 534 44 ------
NM_001040214chr692181 2006 1972 1910 1841 1771 575 552 105 --21663 432 --
NM_001040284chr16105517 4391 4210 3913 2110 1594 652 506 481 299 --23611 1644 --
NM_001040441chr144933 4348 3501 44 --25494 3504 --
NM_001040665chr7164847 4391 4361 4129 3885 3784 3725 3238 3160 1653 1244 1166 651 638 620 432 --43488 3463 443 380 --
NM_001040712chr983534 3404 2891 2601 2238 934 893 761 22447 2299 1904 11330
NM_001042355chr16115417 5387 4697 3956 3297 1907 1829 1594 1441 1134 54 14159 ----
NM_001042404chr161981 1954 1844 1785 701 588 1166 --21928 673
NM_001042412chr16115417 5387 4697 3956 3297 1907 1829 1594 1441 1134 54 14159 ----
NM_001042413chr964141 3522 3226 2625 1120 644 12902 11155 13563
NM_001042481chr14122542 2515 2495 2427 2344 1051 985 910 898 891 741 565 ------
NM_001042492chr1773117 3105 2929 2411 2309 1176 864 13230 2688 428 --
NM_001042533chr363147 2655 2180 669 419 39 ------
NM_001042550chr971265 631 577 471 260 220 161 22052 1841 ----
NM_001042555chr1284349 4005 3745 3529 3265 2905 370 135 --34191 4010 3701 12917
NM_001042599chr2127851 7669 6925 6075 5872 4799 2855 2685 2619 1599 1183 874 36194 2274 733 17009 16931
NM_001042601chr353238 3070 2694 857 349 158 1448 --
NM_001042603chr12134443 4406 4331 3641 1234 1226 1214 1186 875 789 769 171 79 --1309 --
NM_001042604chr374692 4549 4537 4047 1287 1170 60 --24102 3707 11000
NM_001044385chr253998 3017 927 347 82 2652 522 --1351
NM_001044722chr562030 1931 1602 1521 939 157 1684 ----
NM_001044723chr562030 1931 1602 1521 939 157 1684 ----
NM_001046chr552830 2816 2481 2395 2378 22784 2134 22405 366 --
NM_001049chr14112340 2190 2067 2049 1970 1660 1650 1633 1611 1534 625 ------
NM_001099678chr3196464 6428 6311 5379 5300 4437 2581 2377 2158 1975 1810 1575 1552 1240 999 454 445 436 420 11824 14641 14224
NM_001106chr3159392 9323 8851 8713 8524 7848 6886 6854 6262 5935 3002 1760 1597 1495 1217 28891 5949 28854 949 13885
NM_001113490chrX53176 2526 719 702 679 1747 32361 672 286 --
NM_001117chr184475 244 231 218 ------
NM_001148chr432207 1561 1545 --22154 1581 --
NM_001160chr1252712 2699 1823 289 250 12731 12805 --
NM_001167chrX76449 5209 4999 4963 1450 718 129 26330 1655 --15492
NM_001173chr14114203 3708 3548 1867 1565 912 810 766 435 119 57 2274 160 ----
NM_001177chr1262444 2116 875 808 616 246 139 ----
NM_001198chr691546 890 650 532 258 232 223 197 79 11535 1214 21923 1775
NM_001200chr206890 393 253 174 167 28 ------
NM_001204chr2117669 7459 7213 6633 6605 6299 2961 2883 2139 2097 455 67440 5773 5639 2524 1405 41 25937 952 12497
NM_001219chr782305 1730 1668 1647 1639 829 538 447 --21685 810 --
NM_001256chr1742958 2598 2441 2348 --12432 --
NM_001259chr7104564 4076 4057 4041 3909 1896 1854 1413 1145 719 14526 24556 1482 --
NM_001270chr531151 836 359 --1949 149
NM_001289chrX51637 1606 1175 417 289 --31665 1212 1148 --
NM_001304chr1763119 2635 2557 2333 1478 816 13066 11357 13400
NM_001310chr1272679 2513 1116 864 832 635 582 13091 2813 587 --
NM_001338chr213165 138 55 --11098 1103
NM_001356chrX52274 1934 1601 1541 698 1104 1707 --
NM_001364chr1194114 4084 3906 3556 3347 1687 1019 722 56 --24057 1915 --
NM_001390chr1863370 3122 2757 2248 533 310 23141 2383 --11432
NM_001412chrX93458 3300 2434 1107 894 851 777 275 22 ------
NM_001415chrX1228 --124 2646 274
NM_001427chr761802 1586 1557 1535 1526 1304 12114 11487 1150
NM_001438chr183570 2748 2739 2726 2650 2258 1274 775 --12753 --
NM_001440chr852777 428 410 388 318 ------
NM_001460chr152528 2305 1079 854 278 22886 2754 22678 1148 --
NM_001465chr572107 1756 1560 1385 828 634 462 1209 ----
NM_001621chr763063 2766 2486 1117 252 115 ----12995
NM_001621chr763063 2766 2486 1117 252 115 ----12995
NM_001634chr62446 162 1172 --11325
NM_001650chr1864117 4072 1249 1146 498 239 1566 23807 3711 --
NM_001678chr1721863 1853 ----11867
NM_001683chr382617 2591 1989 911 713 699 679 608 1629 1658 --
NM_001695chr883904 3476 1373 1268 1059 744 303 180 ------
NM_001709chr11102924 2911 2874 2631 2088 639 444 405 224 59 --1663 12491
NM_001754chr2184326 3347 3304 2742 1171 855 571 557 23492 965 23386 2782 --
NM_001777chr343966 2747 1502 1285 --22616 1305 12733
NM_001821chr1114823 4802 4732 4286 3727 3546 3402 3352 3163 273 104 --1539 --
NM_001858chr6125139 4884 3645 3261 1915 1885 1838 1268 1047 993 530 306 --11581 13919
NM_001918chr169108 8742 8308 3402 3145 2683 17502 12695 --
NM_001938chr171865 1847 1762 1706 518 499 163 --21531 95 --
NM_001942chr1821405 378 --11872 11492
NM_001981chr162382 2359 2004 1991 1611 968 --22289 249 --
NM_001987chr1273285 2755 2691 1644 857 420 407 24325 4038 23664 410 11324
NM_002006chr4125389 4948 4454 4369 3915 3879 3745 2063 1776 1085 716 212 25082 4194 45539 4504 4265 2250 1337
NM_002015chr1383271 2916 2876 2694 2532 1243 935 527 12210 12319 12520
NM_002025chrX149287 9089 8563 8073 7234 6846 6480 6081 3447 2329 1513 820 382 233 38398 7285 3348 21941 1725 --
NM_002031chr63573 275 203 ----1682
NM_002035chr1863592 3464 3101 3038 1386 1082 13630 --1111
NM_002040chr21112591 2242 2201 2025 1983 1203 1098 1074 558 180 119 --13045 --
NM_002044chr1561450 1400 533 376 339 130 21087 122 ----
NM_002056chr23757 554 179 ----1127
NM_002069chr74663 286 53 26 21215 711 1112 --
NM_002092chr484753 4128 4078 3905 1547 1406 1280 907 23385 2036 11792 --
NM_002126chr1771566 1510 1503 1098 925 840 140 12599 13889 --
NM_002158chr2103450 3402 2940 2763 2735 1450 1436 1384 969 193 12616 13226 --
NM_002161chr93382 320 64 ----1324
NM_002203chr593976 3885 3848 3820 3615 3497 3479 2653 278 ------
NM_002210chr2113119 3089 2624 2470 1387 932 915 665 547 445 26 13414 1185 --
NM_002214chr785482 5387 5125 5065 4017 3779 588 249 15254 25188 4179 15689
NM_002222chr371241 1200 1140 1120 865 168 93 --3969 388 108 --
NM_002223chr1233993 843 829 1220 1201 1238
NM_002239chr25471 453 415 316 278 ----1983
NM_002247chr10102111 2069 2057 2043 2021 2011 1967 1905 1601 922 ------
NM_002264chr355041 4904 3654 3386 3304 23454 273 45046 4051 3735 1661 --
NM_002270chr5185644 5614 5135 5004 4850 4802 4783 4696 4232 4093 3848 3677 3570 2087 1520 1072 878 316 23495 937 24718 3597 --
NM_002285chr2124085 3903 3720 3704 3678 3660 3245 3177 1393 1299 871 674 24203 3962 13709 --
NM_002310chr596629 6618 6570 6264 4918 4561 2086 1716 306 46411 4857 3994 65 55672 5169 5023 4601 1776 15463
NM_002336chr12124698 4609 4601 4593 4225 4148 3166 1591 1300 1089 432 181 --14621 23078 1067
NM_002374chr283137 2752 2361 1108 783 644 326 167 1553 --1945
NM_002401chr1732457 1565 1536 12531 --11569
NM_002449chr551235 873 367 347 267 --1291 --
NM_002451chr9103775 3501 2487 1019 791 700 529 513 477 240 --13815 1431
NM_002460chr663440 3252 2383 1384 956 470 ----13754
NM_002500chr291090 1033 1004 992 835 527 386 376 130 ------
NM_002514chr871157 1033 1023 852 741 432 149 ------
NM_002545chr11115128 4667 4073 3960 3816 3538 1370 662 556 476 430 13666 13563 --
NM_002581chr9145687 5407 4983 4967 4957 4941 4921 4278 3734 3585 2177 1830 347 312 44285 1919 1710 753 1868 --
NM_002594chr2072254 2240 2230 1882 1872 1860 1837 32289 2060 1647 ----
NM_002641chrX41951 1523 1396 775 2434 129 1448 --
NM_002645chr1193099 2995 1102 910 875 735 688 266 53 12614 22961 2357 --
NM_002655chr8195310 5152 5023 4558 3792 3745 3726 3520 3415 2128 2110 2070 1896 1537 1459 1324 1272 1031 813 34812 4536 1120 21666 1350 23302 1821
NM_002670chr371435 1354 628 540 395 218 118 ------
NM_002709chr273539 3452 3022 2591 979 250 58 1568 12942 --
NM_002718chr362575 2374 2226 1077 884 591 --22564 1820 1861
NM_002734chr1771643 1438 849 753 634 407 128 12022 ----
NM_002736chr791989 1926 1535 1427 703 620 585 279 124 11859 1726 --
NM_002745chr2243184 1649 1622 632 13429 24534 3322 --
NM_002765chrX31093 405 354 31333 1312 1261 21142 967 --
NM_002839chr983534 3404 2891 2601 2238 934 893 761 22447 2299 1904 11330
NM_002892chr1441579 1403 1220 110 11487 --11353
NM_002906chr1162369 1813 1660 1594 336 21 22079 1930 2883 85 --
NM_002959chr193906 3876 3862 3806 3788 3387 3169 3041 1041 1691 --11220
NM_002994chr491899 1891 1810 1801 1794 1786 1779 784 598 ------
NM_003034chr12157825 6891 6795 6726 6697 5572 5323 5255 3231 2952 2869 2478 1587 1124 989 27429 1848 35162 2130 1077 12259
NM_003045chr1374969 4737 4545 4038 3054 733 717 15025 13977 --
NM_003099chr15116453 6357 5719 2622 2164 1952 1855 1595 828 277 180 --31825 1627 88 --
NM_003108chr2167298 7010 6579 6364 6283 5739 5594 5132 4941 4840 4707 2148 1711 1139 959 925 14948 1682 --
NM_003112chr753101 2276 1183 1172 1027 42904 2413 1136 604 1579 1251
NM_003128chr232140 1078 894 1592 22833 2627 1697
NM_003155chr872678 2361 2346 765 623 613 408 --12366 --
NM_003161chr1793484 3082 2978 2708 2353 1216 999 861 527 --13044 --
NM_003178chr372284 1894 1702 1632 1475 730 330 ----11820
NM_003199chr18135683 5107 4883 4801 4546 4007 3801 3487 1215 657 645 633 325 11110 21988 1881 --
NM_003221chr653984 2914 1612 937 441 --21579 224 13700
NM_003242chr362446 2323 1953 355 337 317 12413 1330 --
NM_003257chr1591353 1171 1020 951 916 550 462 420 397 ------
NM_003262chr3105274 4883 4740 1786 1627 1170 1010 734 615 389 1292 11179 --
NM_003274chr2172944 2777 1931 1036 861 776 753 ----12797
NM_003298chr396171 6085 5958 5497 4106 4064 4053 1510 359 21923 648 ----
NM_003304chr381591 1566 1499 1453 1200 607 147 89 ------
NM_003338chr1061803 1220 447 258 210 23 --11449 --
NM_003376chr691836 1612 1588 1556 422 411 380 365 353 --31875 1542 358 --
NM_003376chr691836 1612 1588 1556 422 411 380 365 353 --31875 1542 358 --
NM_003387chr272935 2572 2350 1791 573 563 286 11836 1600 --
NM_003392chr3104265 3872 3789 3449 3205 2790 2702 1432 1423 910 1611 21471 346 13135
NM_003410chrX62937 999 876 864 646 273 --31966 407 157 1880
NM_003411chrY81836 1760 1339 1307 1248 609 497 146 --21490 91 11343
NM_003413chrX61951 1313 1254 605 117 106 --145 --
NM_003463chr6123372 3159 3122 3106 3085 2363 2216 1273 1154 510 325 61 22264 707 12347 1536
NM_003468chr294358 4059 3934 3803 3794 3783 1332 410 399 13713 ----
NM_003471chr351938 1912 887 563 341 --1486 --
NM_003478chr1152750 2048 1155 1141 1135 ------
NM_003489chr21163477 3390 3004 2796 2712 2679 2670 2638 2487 1222 1060 619 513 504 330 156 --12463 1236
NM_003505chr731953 1839 1515 --11781 21331 688
NM_003583chr12103747 3588 3567 3085 2851 2729 2519 1527 363 175 11411 12919 --
NM_003590chr273949 3448 2811 2621 1612 968 114 13496 11395 --
NM_003615chr3112930 2830 2736 2450 1549 1183 1013 197 71 35 25 13156 ----
NM_003617chr175028 4889 4042 1921 1668 1459 611 --25031 4412 14623
NM_003622chr126697 525 516 508 494 244 1359 ----
NM_003659chr251205 1126 436 221 162 1212 1103 181
NM_003677chr12152080 1466 368 243 223 215 201 193 175 167 147 117 107 97 79 ------
NM_003743chr282242 2104 2035 1620 1470 893 65 58 --11782 --
NM_003749chr1372261 2144 2059 2028 1570 1512 620 12454 --11704
NM_003759chr484157 3986 1693 1683 1325 1018 797 138 --14086 --
NM_003774chr1252784 2704 2200 698 652 32658 2502 153 ----
NM_003781chr32420 391 ----21172 666
NM_003822chr143113 2748 2357 2308 ----2908 464
NM_003831chr1851636 1598 1501 707 622 ----1586
NM_003895chr2152185 1876 1418 483 472 --22223 510 --
NM_003909chr882967 2940 2921 2817 2511 2448 986 131 32386 817 223 32960 2514 520 --
NM_003913chr634007 3906 122 --33515 2829 812 11260
NM_003941chr762375 2071 1990 1017 409 22 --1494 --
NM_003966chr5107544 7357 7187 7069 5424 5348 2917 2392 1442 1416 26742 6540 1104 --
NM_003972chr10111164 1154 1139 1123 1090 935 923 913 862 544 44 ------
NM_003994chr1274382 3942 3010 2995 2759 1185 35 --12799 --
NM_004006chrX52627 2531 2211 1633 522 11009 21057 679 --
NM_004007chrX52627 2531 2211 1633 522 11009 21057 679 --
NM_004009chrX52627 2531 2211 1633 522 11009 21057 679 --
NM_004010chrX52627 2531 2211 1633 522 11009 21057 679 --
NM_004011chrX52627 2531 2211 1633 522 11009 21057 679 --
NM_004012chrX52627 2531 2211 1633 522 11009 21057 679 --
NM_004013chrX52627 2531 2211 1633 522 11009 21057 679 --
NM_004014chrX52627 2531 2211 1633 522 11009 21057 679 --
NM_004015chrX52627 2531 2211 1633 522 11009 21057 679 --
NM_004016chrX42541 2445 2125 436 1923 2971 593 --
NM_004017chrX52627 2531 2211 1633 522 11009 21057 679 --
NM_004018chrX42541 2445 2125 436 1923 2971 593 --
NM_004020chrX52627 2531 2211 1633 522 11009 21057 679 --
NM_004021chrX42541 2445 2125 436 1923 2971 593 --
NM_004022chrX42541 2445 2125 436 1923 2971 593 --
NM_004023chrX42541 2445 2125 436 1923 2971 593 --
NM_004028chr1864117 4072 1249 1146 498 239 1566 23807 3711 --
NM_004060chr531164 1104 314 ----11252
NM_004081chrY31672 296 51 ----11628
NM_004093chr1382878 2345 2293 2284 2271 2256 2248 1032 22303 563 22296 2274 --
NM_004105chr2299 93 --21029 84 --
NM_004113chr361856 1643 1595 1378 570 491 --11882 --
NM_004124chr1482446 2226 1232 1105 981 912 499 323 ------
NM_004136chr1573225 2808 2627 2036 1133 1034 962 --33092 1121 918 --
NM_004170chr971576 1342 680 662 333 273 103 --1453 --
NM_004171chr11179457 8864 8426 8269 6878 6819 6776 6607 3056 3046 3001 2961 2740 2427 1929 746 642 --69660 8715 7458 7293 2911 2246 13736
NM_004232chr1873805 3591 3244 2845 2684 1241 330 1708 13296 --
NM_004272chr551764 1594 1353 1274 1257 31612 1345 76 ----
NM_004277chr661720 1583 1441 1429 495 406 --1425 --
NM_004329chr1041161 1057 1051 204 1270 11062 11177
NM_004331chr842663 2609 871 782 --11666 22173 689
NM_004338chr18175905 5460 5287 5268 5162 5009 4790 4766 4631 4493 2720 2017 1042 1032 938 806 411 1792 ----
NM_004384chr562030 1931 1602 1521 939 157 1684 ----
NM_004392chr1342472 2085 714 523 22551 1962 11968 --
NM_004397chr1184247 3969 3006 2905 1599 1465 1023 726 --13057 --
NM_004432chr9112382 2354 2130 1960 1865 1801 1573 1501 489 438 30 32432 1882 561 --175
NM_004440chr671991 1363 767 334 311 174 69 --21642 569 --
NM_004458chrX72584 2225 2060 982 967 745 660 1102 ----
NM_004464chr4123994 3904 3850 3577 3199 3181 1668 1652 1404 637 564 343 12663 2940 351 11711
NM_004500chr1462021 1656 1348 798 770 347 12055 1527 --
NM_004501chr1144114 3877 3768 3732 3571 3309 2782 1394 1381 1222 935 255 167 27 ------
NM_004504chr292539 2033 1198 1022 889 786 525 288 51 --1405 --
NM_004523chr1061597 1443 1220 596 515 100 --11026 1106
NM_004586chrX105128 4965 4041 3940 2120 2064 1314 662 512 483 11835 --21405 940
NM_004612chr994380 4336 3887 3224 1800 1403 1370 1131 410 23603 1528 ----
NM_004619chr162125 831 817 797 527 167 --11451 --
NM_004626chr114589 579 569 560 ------
NM_004655chr1761322 1241 1045 536 294 287 1907 11077 --
NM_004657chr281253 1141 1056 988 614 449 440 385 ------
NM_004670chr1071614 1359 1308 345 176 152 98 --21636 232 1408
NM_004686chr891471 1419 1336 1203 1195 579 509 454 398 11291 1325 --
NM_004705chr113620 601 342 ----1117
NM_004713chr143672 547 256 --2530 239 --
NM_004719chr1292527 2414 2119 1930 1892 372 363 249 82 --22437 2260 --
NM_004726chrX85744 5504 5470 4734 2230 851 608 590 21123 421 24611 840 --
NM_004730chr562049 2029 2015 1876 501 338 --11909 --
NM_004745chr8146932 6380 2674 2454 2229 2025 1850 1825 1147 1091 1054 910 408 335 --14671 --
NM_004748chr15104253 4123 3670 3607 1484 1226 1217 1161 384 221 11597 23930 3049 --
NM_004795chr1331854 1528 1503 --1105 11393
NM_004815chr1134912 4740 4287 4274 3173 1242 1105 961 685 513 483 453 319 --31373 726 309 11258
NM_004835chr35816 810 797 784 121 ----1749
NM_004835chr35816 810 797 784 121 ----1749
NM_004842chr661771 1748 1466 1298 720 547 --11405 --
NM_004850chr281168 1104 471 449 417 233 132 120 2696 614 --11501
NM_004857chr1464227 4188 3240 574 500 441 --43875 1050 533 59 --
NM_004866chr585039 4998 3526 3455 3144 1918 1876 1598 1765 54963 3693 3671 1819 1120 14660
NM_004867chrX2501 101 ----2433 278
NM_004887chr581158 1091 1011 923 818 810 189 149 --1343 1334
NM_004896chr1051285 1106 515 281 116 --1190 1285
NM_004904chr7116522 6450 6387 5714 5462 4840 4565 3977 2593 2159 1101 ----15820
NM_004921chr142335 2228 2016 104 22176 1650 ----
NM_004956chr784261 4126 3833 3178 1082 1043 896 593 23091 321 13678 1906
NM_004992chrX98483 8409 6870 5483 5337 2442 2077 2044 1111 --15488 --
NM_004992chrX98483 8409 6870 5483 5337 2442 2077 2044 1111 --15488 --
NM_004999chr654458 3714 3585 403 296 --44218 3520 3402 1424 33046 1766 1154
NM_005054chr261590 1117 268 161 153 135 --21489 1430 --
NM_005056chr12144687 4650 4575 3885 1478 1470 1458 1430 1119 1033 1013 415 323 133 --1553 --
NM_005063chr1043696 2945 2651 1083 --23591 1098 1860
NM_005079chr862725 1023 584 541 201 74 32792 723 660 --12627
NM_005087chr31100 137 1535 1201
NM_005116chr2084346 3489 3323 973 103 97 91 80 --24274 3114 --
NM_005121chr1741223 743 559 432 13167 23308 2398 1812
NM_005126chr382134 1941 842 813 807 193 59 42 --12147 --
NM_005141chr4--2151 54 --182
NM_005156chr953690 1551 1311 534 517 24651 501 ----
NM_005164chr1262577 2166 1764 1669 818 180 1920 1881 --
NM_005171chr1261116 1032 878 476 394 35 1466 --11306
NM_005180chr1061593 1529 1067 465 453 88 1355 ----
NM_005188chr1137076 6643 5831 18016 47120 2248 2228 918 --
NM_005197chr1455714 5323 4679 1750 1252 36225 4603 3775 14841 14690
NM_005230chr124422 237 188 176 ----1529
NM_005233chr372402 2230 2061 1838 1611 804 634 1598 ----
NM_005235chr2127851 7669 6925 6075 5872 4799 2855 2685 2619 1599 1183 874 36194 2274 733 17009 16931
NM_005238chr11103166 3153 3147 3139 3108 2166 1132 1089 1052 954 ------
NM_005259chr261500 1411 946 264 249 157 1547 --11070
NM_005277chr471869 1650 1558 717 476 334 36 1452 --11488
NM_005316chr117807 719 430 283 271 265 241 ------
NM_005339chr484339 3759 2830 1565 1308 1202 1173 1072 2845 392 ----
NM_005342chrX32815 848 222 1736 1395 11731
NM_005359chr1836222 1145 81 34134 1689 347 12064 --
NM_005375chr62786 409 --2817 795 160
NM_005385chr392749 2668 2588 2524 2219 1762 449 368 24 --1584 1797
NM_005399chr174401 4130 3975 3379 2872 808 213 13965 13356 --
NM_005400chr252961 2825 2733 1917 708 --12405 12045
NM_005402chr761583 1535 1192 697 578 226 3632 366 118 --11792
NM_005436chr1074110 3790 3729 3312 1526 1285 236 --1565 11116
NM_005476chr931329 1003 992 11224 21438 906 --
NM_005487chr2251552 155 121 114 59 12038 1730 11869
NM_005494chr7----1469 1456
NM_005497chr1753794 2181 1493 356 232 --24105 2277 --
NM_005502chr973248 2966 2640 2563 2538 2418 937 --12373 12819
NM_005504chr12106029 5953 4882 4765 4401 2179 2106 1751 414 342 --1965 --
NM_005509chr591866 1350 1329 646 588 362 339 229 189 --1417 11842
NM_005578chr374944 4887 4345 3995 3542 1711 1583 --13907 --
NM_005587chr157853 767 726 333 129 103 91 --1116 --
NM_005596chr996414 6357 5794 5388 5161 2050 897 610 405 35863 5052 1145 35960 5562 5494 --
NM_005602chr351105 919 908 296 289 11252 ----
NM_005613chr161751 1685 668 520 468 461 --12036 2491 474
NM_005665chr151399 1102 1046 299 91 24761 1494 24823 465 13351
NM_005668chr5144231 4028 4010 3963 3779 3717 3634 3588 3215 1815 1429 1203 1186 589 23561 3545 12855 --
NM_005722chr242349 2290 2103 2046 --12317 11574
NM_005725chr1112331 2309 2275 2218 2208 2171 2141 1680 542 245 126 --22232 2184 --
NM_005746chr782657 2433 844 487 396 294 176 39 22418 635 1690 186
NM_005752chr1641117 860 846 788 1415 1976 --
NM_005795chr2122844 2793 2608 2351 1926 1907 1211 1171 1001 970 643 368 1710 13002 12112
NM_005808chr392944 2922 2451 2444 2438 2432 2426 2408 214 --1849 --
NM_005840chrX157016 6057 5803 5369 2958 2924 2904 2818 2248 2188 2050 1585 420 264 152 26505 6262 27676 7200 --
NM_005845chr1341322 1282 587 106 21566 379 11436 --
NM_005901chr18178595 8328 8006 7949 7511 7437 6944 6538 6103 6046 5327 2725 1966 1511 956 491 484 38609 5361 3288 25497 358 28119 495
NM_005903chr583812 3721 980 931 833 602 163 87 --2651 139 1326
NM_005966chr252178 2021 1846 938 431 --1705 12163
NM_005977chr1361013 912 859 727 378 112 1766 ----
NM_006007chr941214 869 547 76 23246 114 33531 823 48 --
NM_006011chr1543227 1037 162 142 --1147 --
NM_006037chr2134501 4309 3640 3630 3616 3604 3180 1668 1591 1240 1221 1150 1135 ------
NM_006038chr2042155 2125 2084 1672 137 11717 --
NM_006080chr782606 2467 2212 1915 1861 1202 446 77 1350 --22555 839
NM_006094chr831924 1839 1572 --1149 2556 291
NM_006095chr494169 3744 2832 2742 2730 1731 1644 1172 997 ------
NM_006106chr11113466 3328 3163 3014 2818 2289 1049 1038 930 642 474 13417 --12299
NM_006154chr15102867 2720 2587 2262 2190 2162 1070 492 428 403 ----12873
NM_006166chr1281791 1748 1653 1626 800 744 723 271 11667 ----
NM_006197chr882273 2021 2000 1877 1849 703 419 48 1652 22276 1631 --
NM_006203chr5125412 5145 5032 4435 4012 3784 3545 3420 1503 1063 555 512 54762 4533 1572 1425 995 11767 35487 3941 1347
NM_006206chr442961 2644 2187 1149 ----12632
NM_006241chr3102415 1812 1796 1634 1488 978 428 182 121 105 ------
NM_006251chr5113064 2789 1358 1320 1296 1236 897 346 329 88 43 ----12905
NM_006252chr1106679 6292 5876 5701 5460 5299 3043 2571 1184 675 22522 760 27227 2794 --
NM_006256chr172247 2166 2115 1094 954 868 781 11079 ----
NM_006282chr2074398 4321 4080 3486 372 300 191 --13703 11836
NM_006306chrX94394 4120 3606 2364 2099 1930 1637 1591 1451 12026 ----
NM_006330chr86489 469 457 387 188 122 2515 310 11403 --
NM_006379chr782166 1784 1610 442 304 246 218 155 1684 ----
NM_006393chr1084578 4171 3440 2893 2864 1802 959 932 14258 ----
NM_006403chr651490 1412 614 307 211 ----11615
NM_006420chr2042149 1294 1270 844 23476 3211 22850 2685 12727
NM_006457chr444038 3399 3091 2795 23752 2638 14062 --
NM_006482chr12103747 3588 3567 3085 2851 2729 2519 1527 363 175 11411 12919 --
NM_006534chr2063219 2872 2831 2796 2757 2744 13316 12149 --
NM_006544chr1496042 5751 4683 4672 4115 2250 1234 1220 422 ----25988 4589
NM_006561chr1076058 5631 5391 1536 1081 593 527 16218 24315 4005 --
NM_006572chr1743257 2591 2340 1250 --33355 1317 1134 --
NM_006599chr16228172 8084 7676 7385 7352 7042 6627 6529 6110 5555 5182 5010 3139 2997 2389 2043 2017 1931 1618 1296 853 748 26730 6607 36426 6145 856 27084 360
NM_006606chr2062699 2435 832 783 605 27 --1593 1868
NM_006614chr3143659 3005 2940 2702 2352 1417 1381 1248 1193 996 899 879 803 618 13495 23416 893 --
NM_006628chr1564411 2826 1240 681 243 152 14495 13213 --
NM_006629chr1852327 2305 1859 1027 72 32561 2209 48 11791 --
NM_006646chr1353028 2861 2854 2114 1920 ------
NM_006654chr1284349 4005 3745 3529 3265 2905 370 135 --34191 4010 3701 12917
NM_006699chr122732 1908 2867 514 --22676 157
NM_006717chr962404 943 822 434 423 406 ------
NM_006729chrX135676 5154 5011 4908 4866 4309 2090 1602 1318 1251 1122 429 52 24058 2262 1463 --
NM_006731chr9125811 5660 4445 4184 3915 2322 1942 1431 1345 883 652 68 24434 1331 13663 24420 1093
NM_006734chr66637 589 511 398 299 125 21593 140 ----
NM_006746chrX41256 434 272 123 --1437 11151
NM_006750chr1688079 8069 7985 6716 6626 6452 6092 5029 18035 11374 15082
NM_006754chr731263 484 110 ----11033
NM_006756chr871453 1276 1225 1055 579 503 367 --1382 --
NM_006775chr662214 1893 1232 968 871 756 ----22972 459
NM_006827chr1451274 1039 1029 995 528 --32469 2433 1212 --
NM_006838chr124589 449 354 274 11330 --11190
NM_006851chr1252035 2013 1057 1039 114 22846 2731 --22865 2172
NM_006885chr1694101 3743 3380 3137 2609 936 548 248 187 --13559 14259
NM_006888chr14103493 3123 3113 2913 2886 2618 2602 965 829 318 ------
NM_006914chr951491 521 504 428 311 11342 --140
NM_006918chr11105249 5152 4876 3725 1048 819 785 638 337 101 34098 3898 511 34795 4538 1017 24573 537
NM_006922chr292552 2432 2409 2390 2116 2074 1590 958 325 11972 21618 804 --
NM_006947chr481787 1745 1727 1709 1459 666 629 611 --11770 --
NM_006956chr752387 2270 1993 720 243 4659 562 84 22 12003 12371
NM_006965chr1831023 480 386 --1375 1333
NM_006981chr923013 2385 12982 --11970
NM_007006chr1653324 2424 2293 842 546 12944 --13067
NM_007007chr1274769 4338 3315 3224 3006 2982 834 14045 24281 274 --
NM_007038chr21145556 5422 5327 5296 5108 4425 4351 4275 1034 952 762 693 449 421 34764 4340 1724 22204 396 --
NM_007050chr20107969 7602 6337 6076 5774 5161 5127 5041 2892 1657 27986 425 ----
NM_007054chr5103965 3946 3672 3160 2621 1501 600 451 432 169 13882 13713 --
NM_007064chr331410 597 525 1416 1487 11148
NM_007073chr6114232 4088 3358 2906 2898 561 513 477 272 246 104 --13199 --
NM_007114chr373282 2821 2404 1137 698 372 320 1477 23139 2889 --
NM_007124chr671910 1872 1261 607 404 396 201 --1275 --
NM_007125chrY51372 991 955 937 499 ------
NM_007137chrX63642 2111 627 499 181 66 15106 25503 105 --
NM_007146chr1762392 2300 881 519 503 481 1111 ----
NM_007157chrX72741 2405 2120 2057 1060 866 399 21960 411 42328 2144 573 296 --
NM_007212chr172287 2196 2138 1659 1609 1481 760 11867 1228 --
NM_007231chrX92500 2093 2079 1556 511 492 284 99 22 12395 1296 --
NM_007249chr13179341 8751 8635 8554 8031 7989 7724 7016 6819 6712 6472 5739 3249 2357 2249 1754 297 48292 8202 3153 2936 --11577
NM_007276chr76826 420 164 92 35 25 1254 ----
NM_007287chr341064 968 771 228 --12088 1551
NM_007288chr341064 968 771 228 --12088 1551
NM_007289chr341064 968 771 228 --12088 1551
NM_007347chr1522133 1031 11065 --2958 264
NM_007350chr1284636 4443 3682 2990 1861 1847 906 863 12882 ----
NM_009585chr35816 810 797 784 121 ----1749
NM_009585chr35816 810 797 784 121 ----1749
NM_012062chr124971 924 844 218 2714 702 --1229
NM_012089chr131534 1369 82 11571 --195
NM_012092chr251595 771 727 688 533 2527 304 2720 112 --
NM_012096chr393651 2820 2763 2493 1339 1043 986 266 133 13364 2837 790 --
NM_012120chr661950 635 501 437 351 163 --11211 --
NM_012124chr112907 819 2604 30 1822 1884
NM_012137chr132211 905 603 ----12535
NM_012141chr1383632 3023 2905 1469 1096 929 444 96 23623 2565 --1402
NM_012158chr1361809 1706 1234 539 355 259 --21599 709 21361 470
NM_012164chr977469 6733 5519 5365 5261 605 266 35270 5206 2092 16983 --
NM_012214chr2166206 5547 5440 5418 5352 4551 1063 951 817 475 429 419 409 296 285 272 13996 1331 14839
NM_012223chr221107 182 --21160 984 --
NM_012234chr373783 3654 3181 712 500 478 77 23330 313 --12800
NM_012249chr243418 3134 2912 437 21128 879 --21426 1410
NM_012250chr113276 234 71 ----1875
NM_012257chr73794 324 243 --3899 385 43 --
NM_012262chr144738 3795 3540 3196 11719 --1257
NM_012287chr3114273 3892 3198 1810 1646 1083 1067 1038 1006 521 142 34503 4484 4196 1351 --
NM_012290chr241633 1531 1453 1232 11081 2455 344 --
NM_012297chr442119 1890 1782 1597 138 --1913
NM_012319chr182872 666 11056 --2799 690
NM_012334chr534596 3502 3311 13598 13513 11624
NM_012347chr682852 2565 2309 2275 2098 852 548 103 ----1397
NM_012382chr5164558 4281 3826 3658 3517 3296 3144 2948 1760 1401 1356 1200 1059 989 754 557 11469 1275 --
NM_012395chr7103335 3160 2963 2679 2630 2104 904 755 633 262 --11020 1373
NM_012399chr2261543 477 362 274 268 189 1797 11654 --
NM_012471chrX41978 1304 1215 757 11760 11223 --
NM_013229chr1252712 2699 1823 289 250 12731 12805 --
NM_013231chr14114399 3857 3649 3289 3145 3040 1671 1160 848 110 87 14317 22790 1275 1820
NM_013255chr7138896 8847 7192 7175 2453 1529 1494 1262 1245 1199 1009 709 242 1589 37213 2631 2333 23125 2955
NM_013261chr452942 1282 1060 497 370 11002 12769 --
NM_013322chr72673 622 11739 2690 79 --
NM_013357chr84731 635 343 311 ----1880
NM_013381chr1281752 1549 688 674 464 359 302 265 12329 1646 --
NM_013417chr93382 320 64 ----1324
NM_013989chr1494019 3956 1529 1212 1204 1186 1170 874 313 34773 1411 359 21786 305 --
NM_013995chrX62261 1854 1834 1688 995 729 --1602 --
NM_014021chr173118 2472 1258 726 632 626 496 --1654 --
NM_014028chr693309 3228 2472 872 751 653 587 495 462 2764 484 ----
NM_014043chr361564 1368 1252 1044 666 390 --11351 --
NM_014048chr1675242 5194 5183 4130 773 353 313 --25164 3636 13979
NM_014089chr1371907 1504 813 500 459 336 88 31523 325 247 ----
NM_014106chr1582678 2447 2350 1177 1059 435 150 71 ------
NM_014112chr8105490 4838 4577 3945 3778 1625 1589 1512 649 316 12026 23805 1896 --
NM_014155chr11147296 7144 6686 6272 6006 2983 2969 2861 2057 1235 1159 1105 634 331 26122 5604 11590 --
NM_014181chr242552 1809 815 361 22903 1061 21973 203 --
NM_014250chr2251552 155 121 114 59 12038 1730 11869
NM_014253chrX92425 2385 2262 1955 981 962 822 682 296 ----1987
NM_014294chr861197 1167 1064 570 134 55 --11453 --
NM_014319chr12101826 1809 1624 1615 1301 746 726 714 688 579 11659 31766 231 115 --
NM_014331chr4247801 7662 7366 7323 7096 6299 6282 5739 5262 2848 2828 2779 2716 2026 1733 1690 1642 1364 1197 1117 866 484 361 135 1888 46450 4993 2029 1050 2597 443
NM_014333chr1152692 1746 1733 1719 572 21799 715 ----
NM_014423chr5145213 5190 5025 4079 4031 4000 3989 3838 3527 2087 1602 1499 754 679 11325 --15299
NM_014445chr342417 2108 1880 783 12441 --1812
NM_014458chr141317 1213 366 27 ----11382
NM_014548chr1551430 1116 1056 400 179 ----1426
NM_014572chr1361615 1300 1232 722 347 282 --11542 11779
NM_014574chr1471500 1326 1123 1029 996 606 256 21548 58 11126 --
NM_014630chr1533518 3382 3376 --23644 3551 --
NM_014635chr271562 1080 232 125 117 108 99 --21461 1398 --
NM_014701chr1553061 2744 2425 752 103 --12786 13272
NM_014702chr673466 3166 2826 2549 959 733 408 13374 13087 --
NM_014707chr772244 1919 1565 589 423 218 107 --21933 116 11620
NM_014721chr6107087 7079 6648 5687 5490 5468 5445 5096 4574 1387 25822 1313 22328 658 --
NM_014725chrX41235 1223 1209 1139 ----11277
NM_014731chr2051758 1748 1740 1476 1330 --11761 --
NM_014739chr694104 3726 3591 3570 3111 3101 1277 464 266 --24026 440 1910
NM_014743chr4102929 2910 2902 2505 1259 1250 804 756 533 296 1336 ----
NM_014752chr1141895 1684 617 549 --31928 1862 478 --
NM_014755chr2124247 4175 4058 3869 3085 2773 1608 1518 1163 1145 614 396 11427 23769 403 --
NM_014787chr142500 2408 2172 2074 11901 --12034
NM_014795chr221060 1052 --1363 2456 393
NM_014803chr1072331 2116 1885 1872 1068 539 491 --1380 --
NM_014812chr161981 1954 1844 1785 701 588 1166 --21928 673
NM_014819chr562378 303 209 107 90 82 2470 365 ----
NM_014820chr372098 2037 1820 693 620 360 135 11876 ----
NM_014829chr562334 2293 1631 1619 1548 795 22231 2207 1788 --
NM_014830chr1233872 2471 918 12914 --23608 2537
NM_014850chr36443 417 387 373 358 341 11056 1434 --
NM_014859chr1751420 1172 1152 1092 33 ----139
NM_014873chr194778 4491 4331 4030 3452 1935 949 200 90 21630 1115 ----
NM_014877chr17127281 6922 6595 5747 4952 2945 2793 1508 1315 1013 874 377 32518 995 268 ----
NM_014888chr761255 1152 621 326 318 261 --1564 --
NM_014897chr1763189 2987 2275 756 723 326 22147 493 ----
NM_014901chr552162 2057 1974 1960 1942 ------
NM_014903chr1272420 2247 2046 1663 1631 1618 218 --32232 2171 948 --
NM_014904chr10174043 4018 3846 3767 3760 3648 3435 3011 3002 2635 2563 1166 958 723 528 479 471 --23943 3266 --
NM_014906chr1744024 3319 2882 433 22757 1585 --13868
NM_014920chr673669 3403 3302 1249 872 857 267 23589 3373 23094 668 --
NM_014923chr13122222 2205 2135 2020 1816 1671 905 896 841 606 558 33 ------
NM_014926chr321068 957 --167 1994
NM_014936chr642705 2521 2232 391 --2334 57 --
NM_014946chr252726 2241 2086 1994 1059 --11069 --
NM_014947chr193149 3125 2927 2912 2895 2793 2693 365 351 ------
NM_014953chr1394198 4136 3765 3524 1697 1685 1424 709 109 1768 13673 12809
NM_014962chr2092809 2380 2355 2085 1940 1804 1016 527 245 12757 ----
NM_014982chr14165382 4660 4275 4247 4150 4047 3350 2090 1407 1282 1266 1103 866 784 615 295 15389 21497 270 --
NM_014988chr492835 2723 2613 2485 2118 2092 1721 550 468 ------
NM_014991chr463248 2563 2486 2212 935 316 --12851 --
NM_014997chr792933 2713 2673 2660 2642 2425 2041 964 413 --12333 1129
NM_015000chr1262936 2664 2405 723 683 512 21228 49 ----
NM_015001chr15733 694 684 677 669 ------
NM_015025chr272349 2192 1917 1910 1892 1068 278 --21734 503 --
NM_015026chr1264344 3476 1874 815 618 255 13858 22987 808 12920
NM_015032chr1322761 952 12638 21915 153 11886
NM_015040chr243317 2852 2412 729 13199 12258 --
NM_015042chr1594326 3536 3500 3486 2860 2854 1132 1102 485 13461 13701 --
NM_015055chr1142768 2591 2482 2463 ----12916
NM_015071chr546029 5832 4175 933 15679 16426 1190
NM_015076chr674511 4220 4205 3481 1548 1170 943 --11644 --
NM_015087chr13112704 2420 2141 2125 1727 823 646 362 326 279 186 11960 ----
NM_015092chr1664623 3549 1834 1238 1093 458 --14604 23680 1349
NM_015097chr382372 1847 1818 1619 1562 1515 792 541 11652 ----
NM_015110chr941788 1699 809 802 ------
NM_015137chr8102592 1960 1886 1855 1753 912 878 816 439 169 22328 736 32085 998 430 --
NM_015156chr1463781 3596 2727 2603 515 212 42911 1454 532 88 ----
NM_015192chr20102935 2898 2309 1013 849 694 493 485 395 220 12368 --12701
NM_015199chr352809 1939 1884 1862 662 22664 2447 ----
NM_015208chr1893767 3254 2963 1480 1090 1040 1030 529 373 --12714 1377
NM_015234chr641446 1250 995 931 ----11180
NM_015247chr16115417 5387 4697 3956 3297 1907 1829 1594 1441 1134 54 14159 ----
NM_015265chr242406 1812 882 439 1343 2422 31 --
NM_015271chr4114211 4108 4028 3940 2995 1482 1462 1183 1157 1127 238 14181 12818 --
NM_015272chr1672093 1965 1536 723 578 564 482 --1695 --
NM_015275chr1281922 1828 799 632 480 453 411 385 31546 874 823 ----
NM_015296chr137963 892 866 858 844 810 129 ------
NM_015310chr8118392 8233 8224 8098 7574 6865 6489 6209 6085 2147 80 36635 6429 5330 22194 1099 15804
NM_015313chr1194763 4741 4734 4277 3577 3202 3152 1879 1487 --14728 1907
NM_015315chr552510 1299 1130 274 192 13285 --1294
NM_015328chr772991 2955 2861 2418 2062 1929 897 3561 276 267 32982 2974 2346 --
NM_015335chr1292623 2480 2407 2170 2072 1030 963 784 481 ----11637
NM_015349chr662890 2237 891 877 448 69 12185 12916 --
NM_015355chr1742012 1315 311 43 31979 576 189 ----
NM_015365chrX103811 3732 1648 1595 1531 1437 1397 1297 629 237 13866 11442 --
NM_015375chr173781 3713 1661 1041 1024 1000 598 24626 649 ----
NM_015387chr252121 1724 642 530 511 1845 --159
NM_015431chr121154 293 12361 23551 568 11250
NM_015436chr4103327 3298 3079 2955 2525 2491 2317 1185 877 92 12911 1279 13112
NM_015455chr563232 2660 1502 998 834 828 23471 1429 13410 --
NM_015458chr885338 5045 4532 4245 4222 3670 1231 772 1649 ----
NM_015483chr751169 843 774 159 94 1148 --1163
NM_015520chr382685 2650 2634 2382 2337 917 863 837 --22837 2763 --
NM_015532chr15102837 2082 1903 1816 1782 1081 996 968 462 232 31056 833 48 11833 12294
NM_015548chr671014 986 932 910 653 399 300 1327 1937 --
NM_015564chr52651 67 1846 21175 735 --
NM_015565chr2152070 1641 1402 682 423 137 22112 1799 --
NM_015569chr1164748 4556 4229 4189 4066 3671 3408 3294 3260 3250 3100 1800 999 389 288 133 ------
NM_015570chr741416 575 431 386 11292 11391 21330 497
NM_015571chr662513 1979 1776 1677 684 669 ------
NM_015578chr1941671 1467 219 103 ----1844
NM_015630chr251181 1081 779 368 144 2868 333 1731 --
NM_015640chr1114919 4620 4418 3362 1740 1147 996 717 598 299 258 ------
NM_015678chr1371637 1248 371 260 138 110 93 2436 213 21157 444 --
NM_015852chr7123521 3183 3170 3155 2660 2438 2396 2220 1029 609 525 425 12805 ----
NM_015886chr8245675 5490 5409 5137 4955 4770 4746 4623 4517 4453 4220 3702 3527 3476 1588 1173 919 381 357 351 320 278 92 57 34908 1961 295 21995 259 --
NM_015888chr163144 3119 2610 1154 767 484 11136 13124 1142
NM_015906chr1124378 4353 4312 4117 4060 4003 3756 3363 1694 1086 840 447 ----14729
NM_015912chr882399 2389 2374 2366 2266 1718 1703 774 ------
NM_016018chr862375 2066 2046 1059 829 657 --1924 2833 815
NM_016073chr1551184 1153 732 457 282 2878 137 ----
NM_016076chr163034 3028 2891 2467 2399 693 13142 13215 --
NM_016079chr241755 1595 1509 1467 --31447 877 217 2836 191
NM_016083chr663495 2977 2825 2473 916 540 ----11530
NM_016125chr172388 182 ----1553
NM_016133chr251544 1057 242 145 133 1255 1314 --
NM_016195chr106649 578 128 92 85 58 ------
NM_016206chr3198852 7698 7321 6718 6591 6225 5899 5803 5708 5657 2840 2029 1775 1672 1176 940 663 393 272 28823 7033 15830 12169
NM_016248chr13103740 3574 3438 3238 2936 2626 2572 1164 1115 973 13260 23320 2594 --
NM_016260chr2127413 7358 7114 7094 6814 6739 5956 5607 5154 4916 2108 2061 15989 1654 --
NM_016271chr1851430 918 894 326 22 --41897 1849 1801 1617 --
NM_016275chr3--12393 --11004
NM_016287chr162077 1847 1585 1446 611 592 31520 693 98 ----
NM_016289chr242141 2034 1677 601 11708 12258 --
NM_016300chr32458 21 ----1431
NM_016319chr122784 768 --1777 --
NM_016377chr661771 1748 1466 1298 720 547 --11405 --
NM_016396chr15122848 2733 2402 2119 2044 1994 1093 768 690 522 487 186 12872 1588 --
NM_016441chr232318 658 245 32336 1954 1517 --12027
NM_016507chr1793157 2979 2970 2874 2225 1219 1136 962 277 13036 --22702 1266
NM_016513chr673669 3403 3302 1249 872 857 267 23589 3373 23094 668 --
NM_016531chr4133742 3554 3508 3450 3309 3201 3091 3000 2560 1512 1321 270 94 22867 136 23286 1688 --
NM_016544chr243607 3091 2522 1536 32932 1554 133 11423 12608
NM_016587chr76826 420 164 92 35 25 1254 ----
NM_016613chr482792 2702 988 482 169 116 42 34 --1532 --
NM_016626chr1861720 1667 1510 1275 523 28 1606 1329 --
NM_016649chr201381 --133 1396
NM_016950chr491483 1109 1040 1013 428 338 220 113 33 21283 550 ----
NM_016953chr275979 5724 4776 4745 4228 1418 608 16057 14806 --
NM_017420chr14103867 3378 3289 3053 2386 2377 1131 475 450 118 13643 23481 3456 1645
NM_017423chr492192 2076 1949 1848 1402 565 449 403 230 ------
NM_017447chr21104392 4361 3683 3298 3048 2948 1673 1376 835 598 23794 497 43870 2961 2885 1751 1697
NM_017610chr1521312 821 32041 1573 729 21398 688 --
NM_017628chr4125195 5128 3713 3687 3357 1560 1456 1326 1226 706 341 54 12007 34695 3603 462 --
NM_017633chr683513 2855 1554 1247 1080 1061 1048 1009 --21066 1053 1816
NM_017637chr9119375 8557 8410 6934 5697 3485 3233 1156 1140 802 610 29175 2361 16704 --
NM_017641chr124863 750 226 208 1460 2211 120 --
NM_017644chr3114781 4743 4418 4344 4100 3560 1740 1663 490 439 376 24124 614 13380 1765
NM_017645chr9103115 3095 3061 2997 2498 2449 2437 2387 2304 84 22627 2569 --12699
NM_017650chr755814 5551 5019 4855 4203 25732 4167 14938 --
NM_017651chr621358 1001 31038 276 265 ----
NM_017658chr14134157 4037 3736 3730 3682 3542 1783 1702 1257 1245 1212 993 303 12872 34205 4086 866 --
NM_017666chrX72168 2117 2069 2020 2002 290 164 --12012 --
NM_017719chr362314 1958 994 265 223 155 12166 1268 --
NM_017742chr1861845 1676 1558 622 595 224 --199 --
NM_017752chrX42114 1828 286 122 --32169 1689 125 1143
NM_017768chr12982 188 1875 2257 223 --
NM_017769chr1462733 2376 2068 1276 498 474 22892 2330 12478 --
NM_017813chr8125502 5265 4640 4474 2242 1511 758 749 414 292 255 90 14844 --12314
NM_017824chr1031701 1661 357 11831 --11733
NM_017848chrX93080 1071 1059 1043 1031 1001 990 945 927 13255 ----
NM_017919chr975808 5587 5302 4948 4401 530 149 55052 4907 2000 1694 96 54964 4525 1596 1112 998 --
NM_018027chr1043281 2635 2057 523 22391 2151 22271 667 23045 2859
NM_018046chr561705 1527 1417 672 354 334 --2485 419 --
NM_018121chr1073159 2603 2570 785 743 559 372 --21950 604 --
NM_018126chr431414 405 359 2293 281 21330 127 --
NM_018155chr3103389 3120 3052 2378 2143 1372 938 925 760 748 ------
NM_018157chr12103185 3061 2097 2048 1304 1194 1182 1158 886 531 --21187 616 1905
NM_018227chr473045 2971 2957 2936 2555 1187 821 1584 ----
NM_018293chr372976 2794 2230 2121 2027 1904 448 22622 2257 11176 2538 69
NM_018299chr893181 3171 2973 2793 2555 2308 2186 615 414 33270 2463 856 32917 2774 1121 13187
NM_018313chr361873 955 910 670 473 374 21650 124 ----
NM_018318chr124785 348 323 195 --1929 1615
NM_018323chr461778 1572 1349 542 390 201 21681 363 ----
NM_018339chr961771 1704 1260 539 394 225 ----1625
NM_018351chr1274696 3608 3246 1423 898 468 346 33139 944 623 24020 3082 13305
NM_018362chr11113767 2997 2629 1041 1030 747 687 615 548 323 174 1772 ----
NM_018364chr194090 3322 1613 1515 1414 1271 716 481 473 23180 1341 13671 --
NM_018373chr1476122 4614 1864 518 504 455 237 24435 2259 24262 40 --
NM_018374chr775087 4579 4117 3952 3817 1838 184 44712 4533 4106 1799 ----
NM_018429chr552898 934 509 319 265 32935 1824 62 ----
NM_018439chr1882561 2547 2521 2349 940 305 71 44 42384 2326 929 154 149 --
NM_018444chr852119 1723 458 422 410 --2472 41 --
NM_018482chr861864 1009 865 802 675 251 22277 793 ----
NM_018566chr165084 4435 4259 3512 3356 210 1657 --12030
NM_018569chr411403 ----21506 1382
NM_018638chr1275413 4674 4125 1071 980 582 454 13529 35522 1959 559 --
NM_018650chr162013 1956 655 370 139 35 21467 722 ----
NM_018685chr721145 147 ----1209
NM_018695chr562250 2112 817 807 308 89 1129 1741 --
NM_018710chr881310 864 857 438 388 330 275 235 ------
NM_018841chr183294 3173 2684 2616 2574 2407 2399 462 13218 --23729 3273
NM_018847chr961819 1762 1480 618 602 163 131 11485 --
NM_018948chr13356 287 264 11242 --1274
NM_018970chr721942 813 --42850 2699 910 614 11256
NM_018999chr10114700 4119 3919 3717 3322 1741 1398 1387 905 890 730 14210 --2723 24
NM_019000chr541239 1044 409 158 ----1162
NM_019001chr374692 4549 4537 4047 1287 1170 60 --24102 3707 11000
NM_019022chr18103068 2985 2624 2225 930 811 617 403 349 155 12656 ----
NM_019027chr462583 444 397 312 273 147 --1206 1388
NM_019044chr2124737 4488 4257 3823 3671 3541 3463 3291 3079 1067 793 670 24597 55 --14397
NM_019053chr1061085 921 271 250 195 121 --1292 --
NM_019067chrX64741 4467 4438 1808 1756 1166 23607 3420 34910 4525 775 --
NM_019083chr161345 1016 577 569 290 78 21633 67 11161 11564
NM_019555chr351395 1372 578 114 36 11842 --21433 1401
NM_019593chr2073157 1092 807 784 435 393 254 32265 1044 638 ----
NM_020119chr773959 3604 3375 2823 2795 952 722 ----12578
NM_020122chr295811 5194 4313 2280 1962 1897 149 125 117 --14318 --
NM_020147chr152802 734 ----11045
NM_020159chr441669 1469 345 124 21528 68 --11203
NM_020177chr522046 195 12101 12365 1846
NM_020245chr684631 4101 3839 3464 3370 992 766 368 11103 ----
NM_020297chr12123601 3552 3211 3134 3091 3032 2248 1320 1299 966 378 23 ------
NM_020311chr27677 588 545 537 527 515 141 ------
NM_020337chr473086 3077 3020 2930 1964 354 262 11972 ----
NM_020342chr272202 1874 1716 1045 601 449 54 ----12328
NM_020346chr1161333 1132 1124 1113 1073 377 --31466 1116 490 11087
NM_020390chr3104890 4787 4779 4754 4197 3378 3340 3271 1413 435 22985 1755 34668 4148 3540 --
NM_020420chrY31672 296 51 ----11628
NM_020432chr741844 1799 537 178 2857 124 --11837
NM_020455chr6102701 2620 2596 2487 1954 530 507 392 301 239 --22029 853 --
NM_020466chr664926 4679 3106 1094 1072 841 13564 24891 693 21511 1496
NM_020473chrX41951 1523 1396 775 2434 129 1448 --
NM_020640chr392144 1855 1835 1540 1474 716 479 253 28 1786 41848 1840 1477 146 --
NM_020673chr2042384 1693 578 228 --11914 24934 940
NM_020718chr16126409 6120 5375 4795 4599 4515 4420 4173 1958 1594 1542 291 24067 2103 --15099
NM_020728chr752942 2527 680 415 114 --12044 1324
NM_020734chr1293388 2463 2189 2109 1115 1059 916 845 811 --12845 12708
NM_020739chr15104253 4123 3670 3607 1484 1226 1217 1161 384 221 11597 23930 3049 --
NM_020747chr54245 215 203 189 ------
NM_020760chr282014 1742 1723 1403 697 446 431 293 ------
NM_020766chrX94602 4398 3871 3549 3341 1182 735 354 300 ------
NM_020768chr573227 2781 2682 2287 1158 523 270 --12391 --
NM_020771chr661005 603 544 482 372 313 --21496 1256 --
NM_020772chr17168674 7749 7118 6410 5745 2406 1796 1789 1444 1280 1178 1165 890 724 140 130 26439 5730 15618 --
NM_020774chr1896138 6076 5661 5557 4303 4170 4086 4063 942 21367 783 --25602 422
NM_020787chr1751144 1074 518 338 271 11537 --11155
NM_020819chr661180 1001 827 788 476 240 3335 325 134 ----
NM_020841chr1273967 3568 3346 3228 1626 673 395 33290 2678 691 33783 1480 580 --
NM_020844chr8137220 7016 6999 6480 5619 5415 5319 5143 1954 1923 1898 1356 301 36115 1167 899 36352 6335 2759 27096 6888
NM_020871chrX62532 2407 2336 1708 987 137 1340 ----
NM_020872chr361520 1444 1431 1235 337 81 --21708 455 --
NM_020899chr1762465 2253 2016 1903 1889 554 --21933 1914 --
NM_020918chr1083205 3044 2535 2392 1069 799 558 501 1180 12283 1562
NM_020940chr1092840 2589 2581 2573 1787 1094 965 215 45 32950 2557 2177 1625 --
NM_020948chr172868 2846 2679 2416 1458 697 550 --2647 240 21121 1086
NM_020977chr432207 1561 1545 --22154 1581 --
NM_021007chr292140 1520 866 815 793 785 777 546 517 ------
NM_021032chr361856 1643 1595 1378 570 491 --11882 --
NM_021072chr5122634 2622 2459 2372 2352 2315 2242 2181 2139 446 175 153 --21715 178 --
NM_021111chr941235 1092 1056 261 ----1873
NM_021120chrX72071 1062 571 543 527 503 495 ------
NM_021140chrX71097 975 957 950 932 921 772 --1243 --
NM_021148chr782045 1967 1925 1728 1679 1584 712 507 --22345 1930 --
NM_021205chr162391 1832 1034 810 278 97 1334 ----
NM_021252chr1061784 1681 1384 672 262 242 21439 116 21806 1464 --
NM_021255chr1483772 3227 2828 1448 1420 1414 1122 660 ----1781
NM_021622chr1082316 2286 2037 1884 1828 1742 1605 886 11801 ----
NM_021629chr374313 3108 1414 944 878 674 343 24652 1556 2911 35 1570
NM_021647chr494484 3932 3250 3241 3130 3022 921 607 24 1881 ----
NM_021813chr6105870 5333 5195 4811 4563 3740 455 442 435 426 35510 4118 1197 1474 15575
NM_021911chr5115589 5493 5443 4911 3920 3457 3437 3427 1500 837 673 ------
NM_021912chr15123323 2605 1499 1023 1008 861 592 292 250 158 135 115 --1259 --
NM_021961chr11117298 6339 6169 5855 2420 2115 1302 1213 1166 852 754 11796 36611 1330 1139 --
NM_021964chr3206545 6515 6383 6289 5722 5550 5123 4928 4489 4293 4268 2034 1792 1520 1406 829 720 655 323 220 15507 ----
NM_022058chr271953 1746 1676 1486 657 579 123 ------
NM_022133chr8101866 1369 695 507 412 399 327 303 209 171 ----11411
NM_022351chr8133722 3701 3631 3172 3125 2996 2685 1425 1418 1112 812 295 235 --12942 22549 714
NM_022459chr13145920 4911 4849 4344 4302 3900 1808 1675 1614 839 381 301 269 213 36270 5037 424 15335 --
NM_022473chr1564395 4272 4164 3862 753 261 --23408 1699 --
NM_022716chr1123134 2974 2791 2506 2378 989 976 968 960 947 683 365 1722 43160 2202 1280 386 --
NM_022763chr353190 2610 2600 2123 1271 --23094 3017 --
NM_022781chr953229 3039 2165 1042 951 1647 --1886
NM_022824chr561949 1551 1251 722 427 59 ----1708
NM_022826chr24872 150 124 111 --1101 --
NM_022828chr511593 --11259 2434 369
NM_022893chr242669 2556 502 263 --32215 2137 491 --
NM_022901chr971654 1634 1615 1391 715 403 122 11554 ----
NM_022970chr104430 421 400 104 21290 918 11216 --
NM_022977chrX72584 2225 2060 982 967 745 660 1102 ----
NM_023000chr1441579 1403 1220 110 11487 --11353
NM_023001chr1441579 1403 1220 110 11487 --11353
NM_023016chr282777 2631 2532 2157 2067 1990 434 102 1736 11072 --
NM_023074chr1951140 1024 367 135 119 11353 --1920
NM_023929chr882461 2183 2095 2019 1999 1991 320 96 --12022 --
NM_023934chrX72153 1991 1893 1884 1877 1501 1362 1486 1420 --
NM_024332chrX51823 1418 616 511 393 --21185 597 1172
NM_024345chr995913 5731 4674 4646 4145 3922 2463 2448 2268 14389 15698 --
NM_024423chr1874242 3891 3556 3490 3057 1098 26 23878 190 14012 --
NM_024524chr373169 3092 2849 2667 2309 2039 215 23076 3000 33156 246 171 12762
NM_024548chr361758 1611 1162 1093 355 322 1264 --1638
NM_024583chr24886 860 853 304 21048 388 ----
NM_024590chr431885 559 490 31770 1734 1698 11691 --
NM_024612chr174726 711 246 223 1772 --1437
NM_024613chr861841 1785 1712 1320 750 142 ----1219
NM_024665chr3154734 4474 4114 3634 3627 3284 1895 1614 638 615 586 505 313 133 43 34401 4030 1415 --2905 295
NM_024686chr16452 181 160 133 117 32 ------
NM_024721chr822490 1803 --11862 12699
NM_024725chr116683 317 231 194 102 90 ------
NM_024744chr282591 2182 2122 2000 1697 938 565 141 2540 404 ----
NM_024761chr9105004 4480 4181 4138 3722 3510 3358 1756 1240 1227 21952 1926 13332 15197
NM_024852chr16643 546 529 496 475 439 --2503 480 --
NM_024947chr3179593 9113 9095 7784 6760 6702 3589 2631 2620 2263 1378 1226 960 646 484 355 175 33582 1971 1747 26989 387 --
NM_024953chr1292758 2210 1783 907 881 241 229 158 117 --1784 --
NM_024989chr2208008 7913 7313 7195 6820 6725 6606 6394 5839 5403 5099 5066 2697 2670 2477 2160 1451 691 559 239 27695 1169 17956 27199 6729
NM_025054chr883825 2668 1560 1241 1173 330 246 120 23646 1001 23490 2908 --
NM_025134chr1651791 617 333 304 211 32035 453 87 --1672
NM_025146chr372739 2502 2325 2108 2043 1914 576 12185 12384 --
NM_025160chr162992 2793 1205 604 290 261 --43403 3076 725 437 13397
NM_025208chr1172281 1522 704 389 309 264 240 31977 180 24 1527 --
NM_025222chr381220 1145 1129 1043 951 857 322 146 --31150 1104 540 1868
NM_025235chr1061615 1557 553 528 442 293 11844 11384 --
NM_030621chr1494075 3874 3718 3633 3538 1387 1148 748 728 11693 11226 --
NM_030627chr594116 3204 2742 2573 1363 1094 943 931 591 ------
NM_030647chr7106345 6131 5120 4816 1327 995 925 700 616 567 32117 1173 1139 25518 2520 --
NM_030648chr4125077 4998 4709 4118 3992 3854 3647 3616 2186 941 825 443 33844 663 625 15238 --
NM_030664chr10122199 2174 2142 2072 2021 2004 1779 1630 758 727 588 270 --1648 --
NM_030665chr1781290 1277 1271 1261 1236 1202 957 935 ------
NM_030674chr1285684 5369 5105 4630 2092 1076 880 443 21845 935 1356 --
NM_030755chr1472917 2410 2189 957 685 305 141 2847 549 ----
NM_030791chr148520 454 330 321 295 284 277 61 --2535 313 --
NM_030799chr522203 110 ----12209
NM_030806chr179425 9400 9386 6259 6025 6005 2351 --28736 2306 17810
NM_030816chr1113592 3511 3310 2577 1040 939 361 355 349 326 213 13203 31330 625 343 13610
NM_030962chr1161584 1356 1230 1179 1167 151 ------
NM_031217chr114559 487 440 77 ----1426
NM_031291chr42462 26 --3647 136 77 --
NM_031314chr1462021 1656 1348 798 770 347 12055 1527 --
NM_031362chr282797 2748 2725 2714 2613 1751 713 195 --11132 --
NM_031365chr292933 2884 2861 2850 2749 1887 1846 849 331 ------
NM_031366chr292933 2884 2861 2850 2749 1887 1846 849 331 ------
NM_031418chr1182573 2530 1985 1095 912 580 492 267 12439 22235 958 --
NM_031438chr561721 1596 1373 1210 678 489 --11795 11991
NM_031442chrX83045 2783 2636 2609 442 171 61 55 12505 1871 --
NM_031461chr862134 1656 1598 917 297 128 2833 95 11862 --
NM_031468chr788212 8128 8076 5729 2571 1496 1051 813 --12048 15865
NM_031469chr6133911 3872 3823 3620 3109 2667 947 855 843 780 750 686 31 ----180
NM_031483chr2073248 2691 2339 2186 1261 1185 572 ----1542
NM_031844chr1144114 3877 3768 3732 3571 3309 2782 1394 1381 1222 935 255 167 27 ------
NM_031845chr283137 2752 2361 1108 783 644 326 167 1553 --1945
NM_031847chr283137 2752 2361 1108 783 644 326 167 1553 --1945
NM_031850chr35816 810 797 784 121 ----1749
NM_031850chr35816 810 797 784 121 ----1749
NM_032012chr964628 4616 3745 1299 1010 326 21088 1051 ----
NM_032025chr391770 1759 1745 764 553 297 230 191 184 21270 199 ----
NM_032049chr35816 810 797 784 121 ----1749
NM_032049chr35816 810 797 784 121 ----1749
NM_032116chr1374968 4730 2173 1132 1041 960 687 --11287 13873
NM_032145chr661318 1213 766 531 519 27 ------
NM_032146chr32434 322 --169 192
NM_032153chr382750 2692 2129 1757 847 262 226 117 2578 74 1672 --
NM_032160chr1854276 4188 3310 1120 1025 53723 3436 3397 2861 273 13992 --
NM_032189chr13104664 4408 4401 3671 3301 3183 3124 2014 1919 518 ------
NM_032228chr1152386 1180 698 590 34 --23464 1313 11260
NM_032288chr342331 1767 902 662 22257 2225 12022 12001
NM_032373chr10125675 5490 5420 4596 3620 2198 2135 1747 1603 1171 853 435 14279 ----
NM_032383chr31139 --1278 198
NM_032413chr153338 126 107 --1380 --
NM_032433chr1971630 1573 1242 274 234 198 69 --1239 --
NM_032435chr172200 1987 1888 1868 1699 1587 604 12097 1133 --
NM_032439chr1051370 635 615 604 359 11204 --11662
NM_032440chr1082881 2443 2068 1855 1149 592 403 268 2847 53 ----
NM_032446chr573846 3541 2936 2528 1287 946 779 33859 2946 375 --13746
NM_032457chr483112 2798 2592 2535 1478 1166 1045 782 --1703 13121
NM_032458chrX83307 3090 2747 2643 2592 2096 309 56 12711 ----
NM_032471chr651083 954 940 259 243 --2943 928 --
NM_032510chr1852467 1906 1726 1650 72 ----12502
NM_032521chr2093034 2828 2380 2259 2108 838 417 74 51 13165 11987 --
NM_032558chr961483 1401 1347 1246 989 182 --11386 1209
NM_032560chr142714 184 31072 939 804 1452 --
NM_032682chr323108 3011 --43513 3452 3016 2286 11322
NM_032731chr1731417 1026 172 ----11410
NM_032778chr363147 2655 2180 669 419 39 ------
NM_032859chr13113925 3891 3678 3517 3476 3017 982 927 542 448 161 14002 23568 195 --
NM_032869chr871975 1952 1743 1338 804 412 146 --1106 --
NM_032873chr11103306 3042 2930 1792 1580 1480 1167 932 907 743 --11507 11052
NM_032876chr1482081 1768 1742 1448 1392 721 450 301 ------
NM_032968chrX84265 3739 2928 1312 1298 1039 445 228 33012 1183 797 2908 633 --
NM_032969chrX84265 3739 2928 1312 1298 1039 445 228 33012 1183 797 2908 633 --
NM_032973chrY74257 3731 1312 1298 1039 445 228 33007 1183 797 2908 633 --
NM_032975chr1863370 3122 2757 2248 533 310 23141 2383 --11432
NM_032980chr1863370 3122 2757 2248 533 310 23141 2383 --11432
NM_033020chr1124378 4353 4312 4117 4060 4003 3756 3363 1694 1086 840 447 ----14729
NM_033030chr221145 451 ----11444
NM_033083chr373370 3361 2327 866 820 748 729 23105 441 ----
NM_033132chr1382224 1982 1838 1823 1734 338 248 162 --21663 746 --
NM_033135chr1172281 1522 704 389 309 264 240 31977 180 24 1527 --
NM_033143chr4114325 4235 4181 3908 3530 3512 1735 968 895 674 61 12994 21271 682 --
NM_033167chr32420 391 ----21172 666
NM_033168chr32420 391 ----21172 666
NM_033169chr32420 391 ----21172 666
NM_033181chr663495 2977 2825 2473 916 540 ----11530
NM_033224chr777455 6073 2787 2664 1876 1378 816 16469 11110 12728
NM_033225chr882984 2921 2354 2221 2188 2174 2047 236 ------
NM_033276chr12--1357 --1236
NM_033285chr894257 4161 3603 3555 3332 2897 2806 1796 276 24247 612 33005 2809 458 23210 290
NM_033425chr1133315 3047 1234 --13171 1357
NM_033427chr75615 589 334 326 317 ------
NM_033480chr682852 2565 2309 2275 2098 852 548 103 ----1397
NM_033481chr682852 2565 2309 2275 2098 852 548 103 ----1397
NM_033505chr2146542 6096 6088 6062 4934 4846 4332 2495 2404 2271 1067 1049 778 135 --1565 --
NM_033551chr552510 1299 1130 274 192 13285 --1294
NM_033656chr21114668 4618 4155 4090 3632 2030 1663 1642 545 443 102 --44883 4308 2035 2019 --
NM_052832chr8102963 2747 2500 2451 2352 1995 1117 1091 928 413 --1588 12771
NM_052851chr1382207 1770 1531 384 364 351 239 202 --1938 22255 1793
NM_052879chr12124054 4033 3911 3612 3506 3393 2847 2493 1630 241 217 117 --1355 --
NM_052885chr12134869 4762 4654 4237 3975 3869 3369 3192 3038 1560 1240 953 382 33737 862 699 1716 24544 1549
NM_052900chr831734 1154 287 1438 21674 1528 --
NM_052903chr154539 489 50 44 1589 ----
NM_052905chr231739 1487 1199 11193 21163 367 11433
NM_052913chr651100 793 399 265 36 ----1828
NM_052917chr293278 3165 2796 1278 1136 1099 1085 637 538 ----11184
NM_052927chr581828 1765 1626 724 674 644 285 225 ------
NM_052937chr8102629 2582 2213 2116 1994 1016 727 509 493 335 ------
NM_053016chr9138049 7240 6498 6354 5413 5279 2773 2647 1845 1568 1062 1019 444 15041 --16094
NM_053064chr1492934 2707 2518 965 794 744 684 234 136 ------
NM_057175chr482642 1739 1626 1052 1039 633 377 164 --12239 --
NM_058237chr1451014 977 847 705 206 1392 ----
NM_078487chr973200 3160 2789 2624 2305 2174 2164 --1477 --
NM_080546chr961736 1498 447 112 90 48 12157 1598 --
NM_080759chr1342472 2085 714 523 22551 1962 11968 --
NM_080760chr1342472 2085 714 523 22551 1962 11968 --
NM_080764chr2273167 3128 2562 2172 705 151 123 ----182
NM_080927chr363336 3175 2359 2343 2128 78 1329 32522 1047 1031 --
NM_130391chr983534 3404 2891 2601 2238 934 893 761 22447 2299 1904 11330
NM_130392chr983534 3404 2891 2601 2238 934 893 761 22447 2299 1904 11330
NM_130393chr983534 3404 2891 2601 2238 934 893 761 22447 2299 1904 11330
NM_130773chr29961 935 907 891 883 849 715 609 133 ------
NM_130809chr533031 2039 1083 11090 22867 689 --
NM_133170chr20107969 7602 6337 6076 5774 5161 5127 5041 2892 1657 27986 425 ----
NM_133265chrX53176 2526 719 702 679 1747 32361 672 286 --
NM_133334chr496287 2483 2460 2197 2064 1523 1242 1111 463 1683 35892 2348 2007 --
NM_133370chr453547 3205 1385 1099 737 23052 2633 33247 3199 676 13694
NM_133468chr762285 902 625 144 132 122 1161 2334 309 --
NM_133476chr124964 907 893 885 ------
NM_133496chr173607 3585 3357 1725 1317 1100 502 23872 3399 13290 --
NM_133646chr275203 4873 4477 3443 1864 1370 374 15171 15541 --
NM_138270chrX63432 3130 2500 1253 1133 375 ------
NM_138286chr1994014 3822 3000 2704 1740 1435 1030 761 252 21092 885 24173 3582 13271
NM_138333chr972552 2426 1626 807 486 476 267 --22248 239 --
NM_138426chr7102345 2260 2243 1689 897 813 650 630 435 239 2552 317 ----
NM_138459chr693526 2931 2875 2830 2634 2485 766 451 250 --11383 --
NM_138468chr296238 5842 5807 4670 4367 2551 2335 1760 962 ------
NM_138473chr1293447 3362 3338 637 455 445 421 369 112 ------
NM_138554chr9102793 2702 2681 2627 2205 2126 2091 1712 659 621 --22531 638 12198
NM_138633chr661771 1748 1466 1298 720 547 --11405 --
NM_138694chr6123669 3534 3369 3071 2998 2987 2963 2922 2875 870 801 191 --23385 980 --
NM_138713chr16228172 8084 7676 7385 7352 7042 6627 6529 6110 5555 5182 5010 3139 2997 2389 2043 2017 1931 1618 1296 853 748 26730 6607 36426 6145 856 27084 360
NM_138714chr16228172 8084 7676 7385 7352 7042 6627 6529 6110 5555 5182 5010 3139 2997 2389 2043 2017 1931 1618 1296 853 748 26730 6607 36426 6145 856 27084 360
NM_138731chr14194246 4114 3968 3926 3827 3678 3530 3419 3075 1585 1529 1269 1205 893 608 596 432 267 202 --13565 --
NM_138782chr562426 2217 1771 1741 1715 1588 --1376 --
NM_138806chr35817 794 728 361 231 --1708 147
NM_138959chr1106633 6452 6313 4988 2633 2431 2410 1994 57 45 11953 160 --
NM_139283chr1242126 2098 1983 1617 --22012 410 21642 428
NM_139318chr144231 71 46 29 ------
NM_144571chr4146959 6069 5650 5087 4776 4546 4245 4236 1777 1655 1547 693 550 145 11789 36225 4910 4688 --
NM_144578chr14105181 4703 4661 3996 3984 3615 3498 1986 65 45 1171 23525 518 --
NM_144632chr232229 1991 667 22354 2211 12094 12082
NM_144664chr1162478 862 841 779 730 531 2558 477 1735 --
NM_144721chr472714 2599 2001 448 415 394 127 22618 632 ----
NM_144778chr1362557 2293 2277 1712 177 66 ----11990
NM_144973chr1265323 5281 3602 1360 555 435 --13586 25203 4860
NM_145000chr54584 526 172 165 --1651 --
NM_145005chr91174 ----21039 941
NM_145011chr1052065 831 678 160 143 ----1729
NM_145037chr381448 1284 644 416 407 233 176 170 ------
NM_145176chr683493 2903 2635 1406 711 551 492 68 12193 ----
NM_145259chr2127037 6819 6045 5244 2823 2689 2520 2283 1476 1116 1054 264 --55825 5445 4449 2602 505 12172
NM_145263chr461981 806 795 760 575 181 --2954 563 --
NM_145284chrX82561 2528 2366 947 762 729 582 463 42074 973 520 505 1310 12370
NM_145307chr1074661 4440 3713 3534 3084 3018 717 33891 3814 1334 13826 --
NM_145759chr162125 831 817 797 527 167 --11451 --
NM_145808chr773092 3017 2391 2077 1160 1134 734 12507 1762 --
NM_147147chr6114232 4088 3358 2906 2898 561 513 477 272 246 104 --13199 --
NM_147223chr272425 2287 2218 1803 1653 248 241 --11965 --
NM_147233chr282242 2104 2035 1620 1470 893 65 58 --11782 --
NM_148955chr15116453 6357 5719 2622 2164 1952 1855 1595 828 277 180 --31825 1627 88 --
NM_152263chr174756 4486 4459 1969 879 834 599 14626 --1629
NM_152265chr131598 1488 399 11332 --11380
NM_152277chr541685 821 640 329 --11604 1388
NM_152330chr14122542 2515 2495 2427 2344 1051 985 910 898 891 741 565 ------
NM_152332chr1482808 2309 2140 1995 1983 1769 689 627 22648 366 --11787
NM_152388chr253998 3017 927 347 82 2652 522 --1351
NM_152400chr4112090 1992 1941 1912 1753 1733 598 188 140 64 43 12009 --2682 205
NM_152409chr5143562 3326 2911 2757 2580 2477 2445 2234 1426 754 685 515 205 81 ------
NM_152422chr971867 1629 1411 1252 290 188 176 ------
NM_152424chrX63436 1436 437 399 327 198 24522 643 1447 13452
NM_152519chr261397 523 419 387 345 319 --21914 690 12210
NM_152594chr1582250 1908 1780 728 721 616 583 317 --1596 11594
NM_152622chr543437 1255 948 138 11125 22829 2751 --
NM_152624chr5136707 6570 6389 5883 5849 5620 4732 2276 1654 1604 1227 1087 886 26541 921 14622 --
NM_152629chr964141 3522 3226 2625 1120 644 12902 11155 13563
NM_152636chr1163017 3005 2873 1970 787 636 2870 705 12658 --
NM_152641chr1292847 2738 2659 1117 1082 752 565 391 329 --2943 672 --
NM_152721chr182632 621 ----1647
NM_152754chr792920 2825 2550 2394 1527 1274 1225 1105 66 --1804 23580 412
NM_152756chr5103762 3105 1313 1232 781 688 458 139 38 29 21654 1066 14355 12954
NM_152758chr852920 2784 2572 2093 819 21984 1952 21095 270 --
NM_152774chr7102660 2648 2630 2281 778 766 733 503 285 141 11985 12429 12124
NM_152785chr362011 1738 1013 931 871 847 ----1750
NM_152787chrX83933 3604 3418 2977 2825 1359 755 578 12765 23914 2757 --
NM_152826chr15116453 6357 5719 2622 2164 1952 1855 1595 828 277 180 --31825 1627 88 --
NM_152835chr142875 1168 414 406 --1944 11962
NM_152836chr8101866 1369 695 507 412 399 327 303 209 171 ----11411
NM_152837chr8101866 1369 695 507 412 399 327 303 209 171 ----11411
NM_152996chr121525 1519 --11784 11421
NM_152999chr7164847 4391 4361 4129 3885 3784 3725 3238 3160 1653 1244 1166 651 638 620 432 --43488 3463 443 380 --
NM_153182chr363147 2655 2180 669 419 39 ------
NM_153188chr5185644 5614 5135 5004 4850 4802 4783 4696 4232 4093 3848 3677 3570 2087 1520 1072 878 316 23495 937 24718 3597 --
NM_153207chr1273436 1616 1175 1114 217 206 198 23329 3148 ----
NM_153235chr6122162 594 559 551 525 485 454 447 441 429 384 345 --22438 574 --
NM_153262chr1----42628 2530 2266 881 --
NM_153332chr8103025 3007 2946 2772 2402 875 686 531 277 143 33083 2655 1226 ----
NM_153354chr54859 852 843 834 --1994 --
NM_153367chr1073823 3646 3227 3173 3018 2971 2684 11503 ----
NM_153453chr64920 749 735 418 ----2757 672
NM_153456chr1384993 4372 4144 2540 1783 1053 860 231 ------
NM_153607chr5153087 3002 2938 2842 2641 2630 2159 1976 1210 1104 772 677 526 516 120 ------
NM_153705chr1182675 2656 2158 2044 1847 295 233 124 --22398 373 --
NM_153836chr272155 2083 1651 1548 1313 740 539 1454 21460 1316 --
NM_170710chr4153100 2833 2807 2784 2768 2734 2720 2509 2443 2374 1225 759 703 490 165 13025 --13138
NM_170731chr11102924 2911 2874 2631 2088 639 444 405 224 59 --1663 12491
NM_170732chr11102924 2911 2874 2631 2088 639 444 405 224 59 --1663 12491
NM_170733chr11102924 2911 2874 2631 2088 639 444 405 224 59 --1663 12491
NM_170734chr11102924 2911 2874 2631 2088 639 444 405 224 59 --1663 12491
NM_170735chr11102924 2911 2874 2631 2088 639 444 405 224 59 --1663 12491
NM_170780chr35817 794 728 361 231 --1708 147
NM_172070chr271995 1796 1507 1451 686 392 22 12169 21536 410 1123
NM_172071chr1147439 7196 6053 2057 1964 1804 1795 1772 1761 1394 842 622 329 187 17276 11928 --
NM_172127chr4112108 2073 1863 1854 1757 1744 1727 710 199 173 129 --1214 1186
NM_172128chr4112064 2029 1819 1810 1713 1700 1683 666 155 129 85 --1170 1142
NM_172159chr351938 1912 887 563 341 --1486 --
NM_172160chr351938 1912 887 563 341 --1486 --
NM_172193chr1451239 1171 366 358 151 --2297 57 --
NM_172375chr1451165 1005 980 963 939 ------
NM_173084chr372311 2241 2138 1548 355 169 42 21812 1659 --12245
NM_173198chr923013 2385 12982 --11970
NM_173200chr923013 2385 12982 --11970
NM_173214chr16228172 8084 7676 7385 7352 7042 6627 6529 6110 5555 5182 5010 3139 2997 2389 2043 2017 1931 1618 1296 853 748 26730 6607 36426 6145 856 27084 360
NM_173362chr51539 --3561 194 126 --
NM_173468chr4135634 5482 5228 4556 4418 4371 2217 2207 1514 781 725 629 577 --11517 --
NM_173511chr272915 2592 1584 931 651 636 447 1684 --1941
NM_173552chr36893 816 703 549 311 101 21806 626 ----
NM_173576chr1061697 1647 1582 614 539 224 2488 349 1413 1134
NM_173582chr11105810 5395 5083 4654 4206 3828 2310 2281 1822 1010 1826 24054 67 --
NM_173642chr159203 7690 5914 5698 3677 17069 27467 1670 --
NM_173644chr206803 685 603 501 401 381 --21590 1465 --
NM_173645chr25370 121 99 88 47 --1128 1179
NM_173698chrX31681 1654 1324 --2308 136 11335
NM_173797chr551365 868 375 262 213 ----166
NM_173808chr1123942 3309 3286 3223 1695 1471 1355 1232 1212 1191 1182 438 21786 187 ----
NM_173822chr241821 1587 1501 188 1334 --22028 1565
NM_173829chr564146 4140 1215 953 158 80 11145 25851 4641 25788 5419
NM_174916chr1552411 2334 2236 1510 926 1132 12153 --
NM_175610chr1591353 1171 1020 951 916 550 462 420 397 ------
NM_175736chr12107792 7163 6184 5936 5570 5427 2614 984 839 809 11202 16802 --
NM_175861chr12135862 5219 5105 4424 4364 3907 2117 1246 1148 933 802 782 634 15803 35507 1768 293 --
NM_175876chr192735 2431 2325 2034 686 597 566 50 29 ------
NM_175907chr1862577 2561 1852 470 454 234 --1961 --
NM_175921chr593887 3033 2770 2633 2619 917 648 436 171 14193 24309 4202 --
NM_176815chr382817 2642 2599 2336 480 389 382 56 2152 66 11828 --
NM_176824chr491347 1306 1191 1077 855 385 331 309 111 ----11310
NM_177422chr16643 546 529 496 475 439 --2503 480 --
NM_177424chr151682 1674 1385 602 546 ----21886 97
NM_177438chr1494075 3874 3718 3633 3538 1387 1148 748 728 11693 11226 --
NM_177452chr1471676 1593 1558 518 510 489 87 --2871 494 --
NM_177966chr351567 1427 1418 632 220 1167 1173 11555
NM_177976chr32434 322 --169 192
NM_177995chr971867 1629 1411 1252 290 188 176 ------
NM_178006chr1382207 1770 1531 384 364 351 239 202 --1938 22255 1793
NM_178007chr1382207 1770 1531 384 364 351 239 202 --1938 22255 1793
NM_178011chr1063178 3168 2094 2076 950 375 11170 13171 1596
NM_178151chrX127857 7468 7229 6955 6903 6644 6595 2821 2400 2350 1701 1486 26917 6017 ----
NM_178152chrX127857 7468 7229 6955 6903 6644 6595 2821 2400 2350 1701 1486 26917 6017 ----
NM_178153chrX127857 7468 7229 6955 6903 6644 6595 2821 2400 2350 1701 1486 26917 6017 ----
NM_178313chr271655 1638 1609 1420 1350 540 501 --1582 11496
NM_178539chr1252021 1755 1525 585 511 11847 21553 588 11948
NM_178585chr463248 2563 2486 2212 935 316 --12851 --
NM_180989chr1342279 2154 1805 1590 11541 2424 85 1673
NM_180991chr582834 2664 2652 2451 2442 2206 777 372 11004 ----
NM_181054chr1451224 1186 1047 820 224 21295 303 1825 --
NM_181265chr4153100 2833 2807 2784 2768 2734 2720 2509 2443 2374 1225 759 703 490 165 13025 --13138
NM_181354chr851565 1264 1210 639 504 ----11609
NM_181443chr2092809 2380 2355 2085 1940 1804 1016 527 245 12757 ----
NM_181453chr271562 1080 232 125 117 108 99 --21461 1398 --
NM_181481chr18175905 5460 5287 5268 5162 5009 4790 4766 4631 4493 2720 2017 1042 1032 938 806 411 1792 ----
NM_181482chr18175905 5460 5287 5268 5162 5009 4790 4766 4631 4493 2720 2017 1042 1032 938 806 411 1792 ----
NM_181483chr18175905 5460 5287 5268 5162 5009 4790 4766 4631 4493 2720 2017 1042 1032 938 806 411 1792 ----
NM_181504chr5154176 3902 3890 3878 3864 3846 3798 3748 3117 3108 3030 2819 2574 1159 714 ------
NM_181523chr5154176 3902 3890 3878 3864 3846 3798 3748 3117 3108 3030 2819 2574 1159 714 ------
NM_181524chr5154176 3902 3890 3878 3864 3846 3798 3748 3117 3108 3030 2819 2574 1159 714 ------
NM_181659chr2063219 2872 2831 2796 2757 2744 13316 12149 --
NM_181659chr2063219 2872 2831 2796 2757 2744 13316 12149 --
NM_181705chr5135494 5252 5225 5213 4676 3591 1760 1425 1233 762 517 381 273 25362 3621 14142 15732
NM_181723chr882310 2199 2163 1838 1744 1516 1475 205 22319 2053 1182 --
NM_181782chr682333 852 750 744 720 464 342 284 11825 3695 687 584 1899
NM_181787chr8183849 3666 3633 3624 3154 3052 1542 1426 1409 1345 1198 958 920 749 641 634 564 554 33873 1369 1303 21500 345 --
NM_181794chr651083 954 940 259 243 --2943 928 --
NM_181795chr651083 954 940 259 243 --2943 928 --
NM_181836chr592604 2516 2265 2240 2088 2035 781 265 138 --22343 934 1519
NM_181861chr1252712 2699 1823 289 250 12731 12805 --
NM_181868chr1252712 2699 1823 289 250 12731 12805 --
NM_181869chr1262797 2784 1908 374 335 66 12816 12890 --
NM_181897chr362575 2374 2226 1077 884 591 --22564 1820 1861
NM_182485chr4113293 3179 2846 2805 2565 884 767 738 476 186 126 --1131 --
NM_182503chr695185 4382 4235 3589 2176 1876 1403 568 96 11229 25618 5552 --
NM_182515chr19136226 5883 5782 5366 2603 2559 2544 2251 2088 1544 1419 1336 699 --16231 36474 6322 4359
NM_182551chr273113 2973 2571 2168 810 207 75 --23576 2327 --
NM_182643chr831924 1839 1572 --1149 2556 291
NM_182645chr64920 749 735 418 ----2757 672
NM_182646chr4113293 3179 2846 2805 2565 884 767 738 476 186 126 --1131 --
NM_182700chr751949 1830 1420 778 99 11394 11262 --
NM_182715chr731263 484 110 ----11033
NM_182758chr15153949 2680 2666 2654 2640 2618 2445 1505 1211 1202 1195 1025 1016 185 164 13334 23408 3169 1824
NM_182762chr796231 5775 5019 4507 4487 4376 3834 1466 838 23908 400 ----
NM_182765chr1062300 2148 2096 1873 937 931 1408 ----
NM_182767chr12101809 1770 1565 1389 1305 817 663 454 230 184 --22132 2069 1363
NM_182896chr3111858 1577 1337 1320 1192 511 480 429 376 237 57 --2631 114 --
NM_182898chr7116522 6450 6387 5714 5462 4840 4565 3977 2593 2159 1101 ----15820
NM_182899chr7116522 6450 6387 5714 5462 4840 4565 3977 2593 2159 1101 ----15820
NM_182907chr691546 890 650 532 258 232 223 197 79 11535 1214 21923 1775
NM_182920chr351445 182 168 146 140 ----11462
NM_182972chr152700 2419 1829 75 63 --4376 149 84 66 --
NM_183043chr1361013 912 859 727 378 112 1766 ----
NM_183044chr1361013 912 859 727 378 112 1766 ----
NM_183050chr682416 2307 1779 1712 1651 871 511 194 --121 --
NM_183380chr671014 986 932 910 653 399 300 1327 1937 --
NM_194247chr293494 1780 1676 1433 1005 841 414 259 96 22804 317 11179 --
NM_194283chr574200 4004 3916 3842 989 158 108 1305 21433 908 13951
NM_194291chr862480 2094 1062 572 377 338 --12842 --
NM_194301chr144417 388 110 94 --1944 11061
NM_194314chr1125531 4623 4394 4240 2186 2044 2030 1957 1882 1801 1367 548 --33520 2234 2069 24123 3827
NM_194328chr953229 3039 2165 1042 951 1647 --1886
NM_194329chr953229 3039 2165 1042 951 1647 --1886
NM_194330chr953229 3039 2165 1042 951 1647 --1886
NM_194332chr953229 3039 2165 1042 951 1647 --1886
NM_197955chr153338 126 107 --1380 --
NM_197970chr221145 451 ----11444
NM_198086chr1482081 1768 1742 1448 1392 721 450 301 ------
NM_198123chr831734 1154 287 1438 21674 1528 --
NM_198124chr831734 1154 287 1438 21674 1528 --
NM_198128chr1851430 918 894 326 22 --41897 1849 1801 1617 --
NM_198181chr1532634 907 344 --1918 12708
NM_198273chr5102117 1182 880 787 715 517 456 285 66 41 12283 32232 2068 490 --
NM_198279chrX41241 995 976 270 --1983 --
NM_198281chr462930 2912 1148 1117 811 322 1708 12585 12365
NM_198400chr15102867 2720 2587 2262 2190 2162 1070 492 428 403 ----12873
NM_198465chrX82848 2772 2733 2336 2253 1844 1130 56 ----12345
NM_198484chr366365 2563 1454 1326 547 62 --45611 1383 811 445 --
NM_198503chr162400 1878 1818 1786 625 92 21642 352 1898 --
NM_198513chr851879 1608 626 601 125 --2744 443 --
NM_198569chr6102568 2487 2463 2354 1821 397 374 259 168 106 --21896 720 --
NM_198581chr2156945 6374 6348 6266 6094 4580 2160 1909 1774 1450 1186 1157 740 695 289 1376 21781 1619 --
NM_198715chr1146336 4363 2472 2449 2367 2134 1780 1380 810 697 689 335 195 99 33843 1098 458 15180 26270 358
NM_198793chr343962 2743 1498 1281 --22612 1301 12729
NM_198900chr12107792 7163 6184 5936 5570 5427 2614 984 839 809 11202 16802 --
NM_198904chr552047 2038 1896 1525 734 --1585 11824
NM_198935chr2073172 2460 2440 2420 2387 1098 661 32861 2360 1036 ----
NM_198956chr751949 1830 1420 778 99 11394 11262 --
NM_198990chr783095 2835 2653 2429 2345 1052 331 323 --13291 11008
NM_199000chr741809 898 726 337 41969 1496 736 76 ----
NM_199188chr12124054 4033 3911 3612 3506 3393 2847 2493 1630 241 217 117 --1355 --
NM_199190chr12124054 4033 3911 3612 3506 3393 2847 2493 1630 241 217 117 --1355 --
NM_199246chr531164 1104 314 ----11252
NM_199324chr483763 3745 3633 3554 3129 2562 1148 808 1828 12848 --
NM_199436chr252726 2241 2086 1994 1059 --11069 --
NM_199462chr173781 3713 1661 1041 1024 1000 598 24626 649 ----
NM_199482chr252121 1724 642 530 511 1845 --159
NM_201437chr871453 1276 1225 1055 579 503 367 --1382 --
NM_201548chr231503 1133 1069 ----1497
NM_201570chr104769 615 606 396 ----1625
NM_201571chr104769 615 606 396 ----1625
NM_201572chr104769 615 606 396 ----1625
NM_201590chr104769 615 606 396 ----1625
NM_201591chr471869 1650 1558 717 476 334 36 1452 --11488
NM_201592chr471869 1650 1558 717 476 334 36 1452 --11488
NM_201593chr104769 615 606 396 ----1625
NM_201596chr104769 615 606 396 ----1625
NM_201597chr104769 615 606 396 ----1625
NM_203282chr1951632 1619 1604 1170 683 --11837 1699
NM_203301chr1491197 1155 659 613 424 417 378 366 128 21566 688 1381 --
NM_203327chr2084346 3489 3323 973 103 97 91 80 --24274 3114 --
NM_203351chr1732457 1565 1536 12531 --11569
NM_203371chr1131442 109 81 21342 206 1134 --
NM_203391chrX31507 740 730 11769 ----
NM_203406chr582619 2374 2361 941 812 660 561 237 22336 2064 --3439 114 41
NM_203447chr93977 900 637 2886 624 1654 --
NM_203459chr132128 1661 997 1936 --1277
NM_203504chr442119 1890 1782 1597 138 --1913
NM_203505chr442119 1890 1782 1597 138 --1913
NM_205860chr143113 2748 2357 2308 ----2908 464
NM_206594chr183570 2748 2739 2726 2650 2258 1274 775 --12753 --
NM_206595chr183570 2748 2739 2726 2650 2258 1274 775 --12753 --
NM_206853chr672999 2972 2832 1493 1442 1238 579 13167 ----
NM_206854chr684260 4233 4093 3709 1840 1080 373 150 14428 1362 --
NM_206855chr6105225 5198 5058 4674 4097 2045 1338 1115 244 223 25393 549 21327 483 --
NM_206876chr273539 3452 3022 2591 979 250 58 1568 12942 --
NM_206907chr5113064 2789 1358 1320 1296 1236 897 346 329 88 43 ----12905
NM_206909chr8118392 8233 8224 8098 7574 6865 6489 6209 6085 2147 80 36635 6429 5330 22194 1099 15804
NM_207015chr382299 2286 2237 913 267 198 192 132 12374 ----
NM_207303chr10124076 4007 3529 3515 1668 1643 1610 1577 1491 1427 1240 325 --13537 --
NM_207304chr1342444 2180 2164 64 ----11877
NM_207366chr752324 2316 1498 671 41 11482 --22002 1504
NM_207406chr476306 5225 4323 3992 2169 1277 225 --25520 1976 --
NM_207578chr11489 1557 --1132
NM_212471chr1771643 1438 849 753 634 407 128 12022 ----
NM_212472chr1771643 1438 849 753 634 407 128 12022 ----
NM_212558chr9114105 3542 3494 2680 1596 1431 1296 1019 858 721 368 13456 21156 861 --
NM_213589chr2155412 5399 5363 4980 3932 3433 1858 1805 1443 1079 790 693 575 190 182 35577 3695 337 14347 --