TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3174
miRNA Sequence: UAGUGAGUUAGAGAUGCAGAGCC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr52455 136 --1459 --
NM_000016chr12678 580 ------
NM_000032chrX242 23 ------
NM_000038chr53474 380 170 ------
NM_000051chr1162677 2317 1275 674 243 201 --12188 --
NM_000052chrX52903 2689 1074 827 70 1225 12836 1977
NM_000063chr62263 251 ------
NM_000081chr121634 1526 ------
NM_000084chrX136964 6586 6578 6085 5839 5771 5401 5034 2519 2503 1843 1705 1478 --11085 15663
NM_000089chr71694 ------
NM_000090chr22702 340 ------
NM_000092chr2113797 3572 3109 1480 1060 1022 983 947 833 571 92 13964 11550 14048
NM_000094chr3----1213 --
NM_000097chr32845 214 ------
NM_000104chr252524 1090 617 330 37 23067 2278 11874 --
NM_000109chrX42514 1943 916 629 12636 ----
NM_000110chr11262 --11037 --
NM_000115chr1372576 1763 945 835 315 286 147 2900 620 ----
NM_000125chr653959 3441 1535 1489 938 --23594 3234 --
NM_000134chr451553 411 386 352 344 11417 ----
NM_000135chr162689 347 --1696 --
NM_000138chr1532387 2294 1016 --11745 --
NM_000139chr1162429 2252 2189 965 472 30 --1586 --
NM_000153chr1411449 --11099 --
NM_000161chr1431615 795 478 --11698 --
NM_000163chr531888 1533 851 12200 11575 12309
NM_000176chr532846 1327 561 11104 --11569
NM_000192chr123562 350 289 ------
NM_000210chr24741 539 456 182 1777 ----
NM_000214chr2021681 1135 ------
NM_000216chrX71377 1210 1055 1024 852 372 283 --23548 2909 14065
NM_000217chr1294524 4417 4064 3729 3549 1785 1777 986 82 ------
NM_000222chr441505 1400 1359 1353 ------
NM_000223chr172460 140 ------
NM_000231chr131614 ------
NM_000240chrX71751 1631 676 469 267 222 27 ------
NM_000245chr761903 1819 587 545 487 54 11679 1410 --
NM_000248chr341205 1129 250 67 13067 11025 --
NM_000252chrX11386 ------
NM_000259chr1571624 1368 1336 1058 763 538 215 26252 898 --11341
NM_000264chr952879 2553 2497 2069 946 12452 ----
NM_000267chr1723045 2967 150 23282 2755 --
NM_000271chr181249 1520 ----
NM_000276chrX12136 --1535 --
NM_000284chrX31638 775 525 11727 ----
NM_000297chr421860 1441 ------
NM_000304chr171428 --1730 --
NM_000313chr331093 1063 193 ------
NM_000314chr1043296 3089 2429 984 11063 ----
NM_000317chr111319 ------
NM_000321chr1321470 483 11599 1711 11488
NM_000325chr4--1204 ----
NM_000330chrX32117 618 287 ------
NM_000332chr6155880 5734 5689 5007 4988 2833 2597 2559 2356 2066 1396 1188 1167 910 452 12538 25111 1479 15639
NM_000335chr361908 902 697 566 497 396 ------
NM_000337chr5115786 5443 5240 5234 1712 1581 1280 1069 878 713 679 25630 5609 36187 1926 1846 --
NM_000346chr1731958 1911 1771 ------
NM_000353chr1651119 793 470 454 182 ----1229
NM_000359chr141157 ------
NM_000362chr2253611 2878 2419 983 25 --12423 --
NM_000368chr963806 3590 3579 3218 1059 223 13087 13423 --
NM_000378chr1121251 208 186 1989 --
NM_000387chr3124 1747 ----
NM_000393chr261316 718 601 468 181 56 ------
NM_000408chr232773 811 233 --22767 1354 --
NM_000421chr173348 318 267 ------
NM_000430chr1753637 3495 2635 1020 387 --1686 --
NM_000435chr193651 299 271 ------
NM_000439chr542121 930 831 488 --32099 534 500 12004
NM_000441chr732185 2015 1572 11616 190 --
NM_000448chr1142420 2323 2040 935 --11192 --
NM_000449chr151048 964 605 461 81 ------
NM_000459chr93936 650 37 --1319 --
NM_000461chr364633 4155 1424 1125 756 266 ------
NM_000462chr152710 281 ------
NM_000478chr13613 512 154 --2521 517 --
NM_000480chr1141633 579 171 150 ------
NM_000484chr21--152 --1117
NM_000486chr1243264 2309 1163 521 12100 1735 --
NM_000489chrX12158 --12936 --
NM_000495chrX21075 76 --1855 --
NM_000503chr831813 1694 536 ------
NM_000508chr41706 1827 ----
NM_000516chr201237 ------
NM_000522chr7----1822 11161
NM_000527chr1912474 --1624 --
NM_000533chrX3752 652 114 ------
NM_000551chr31107 1159 ----
NM_000555chrX107846 4978 3042 2901 2413 2190 2178 1329 512 505 15451 22590 405 --
NM_000585chr41461 1474 2222 213 --
NM_000586chr41185 ------
NM_000589chr5163 ------
NM_000594chr6----2714 245 --
NM_000596chr71416 --1164 --
NM_000598chr761233 1087 1037 485 309 202 ------
NM_000599chr284063 3214 3170 3104 1454 1090 876 100 --23650 90 --
NM_000602chr711198 --11218 --
NM_000609chr1062909 2654 2381 1222 1148 493 --12804 --
NM_000612chr1141488 1460 860 696 ------
NM_000615chr1162961 2820 2661 951 528 130 --1230 --
NM_000618chr12106326 6105 5993 5985 5815 5647 5363 5258 4280 1227 12177 36463 5895 1731 --
NM_000618chr12106326 6105 5993 5985 5815 5647 5363 5258 4280 1227 12177 36463 5895 1731 --
NM_000619chr122195 93 --1532 --
NM_000627chr21683 ------
NM_000633chr1874808 4694 4529 3388 3203 1037 595 143 1488 --
NM_000637chr82429 392 --177 --
NM_000639chr13333 281 166 --1557 --
NM_000663chr1662825 2143 1986 715 254 82 ------
NM_000668chr431154 509 430 ------
NM_000681chr102354 29 11317 1887 --
NM_000686chrX31270 532 52 --1390 --
NM_000693chr1541732 500 171 156 ------
NM_000719chr12136488 4298 2604 2495 2449 2362 2244 2051 1994 855 551 400 75 14705 45509 5376 4136 1682 --
NM_000724chr1031479 1281 749 ------
NM_000726chr241246 999 595 291 --11442 --
NM_000767chr1981408 1103 985 611 554 460 415 291 ------
NM_000780chr82846 109 ------
NM_000782chr2021256 91 --1251 --
NM_000793chr1473985 3299 3248 1322 737 340 99 1163 --14793
NM_000800chr51154 --11609 --
NM_000807chr41169 ------
NM_000808chrX------2776 419
NM_000811chr52693 541 ----1730
NM_000813chr554316 3947 3877 1276 472 15356 ----
NM_000814chr1553226 794 773 705 476 --1512 11455
NM_000816chr51431 --2452 37 --
NM_000817chr241197 1170 444 142 --21103 312 --
NM_000826chr422212 1702 11798 ----
NM_000827chr531888 971 433 1386 ----
NM_000829chr1192191 2097 2067 1945 1653 907 880 774 216 1754 1554 --
NM_000831chr185607 5163 4162 3996 1164 1016 904 278 ------
NM_000838chr6----31864 1022 867 --
NM_000844chr32433 178 ------
NM_000845chr7----176 --
NM_000860chr451303 1165 668 623 389 --11673 --
NM_000868chrX32206 1706 713 --12335 --
NM_000872chr10----1585 --
NM_000875chr15117029 6044 5002 2807 2794 2628 1695 1349 759 299 88 --15503 15568
NM_000891chr1733428 2906 878 ------
NM_000899chr1243731 3509 627 273 --12890 14036
NM_000901chr452449 2174 2087 549 102 --22354 2232 --
NM_000902chr342612 2252 2098 220 --21131 537 --
NM_000917chr102693 158 1327 ----
NM_000922chr1141013 322 262 249 ------
NM_000933chr202710 609 --134 --
NM_000935chr32974 123 ------
NM_000944chr421538 402 ----12262
NM_000945chr22661 450 ------
NM_000950chrX63550 3152 2372 852 378 182 ------
NM_000956chr1421109 975 1754 ----
NM_000957chr11518 ------
NM_000958chr52169 116 2860 417 ----
NM_000961chr20103816 3284 2855 2813 1097 988 891 564 324 257 --23579 3201 --
NM_000965chr341204 1144 175 164 ------
NM_000983chr151649 1345 1232 465 376 --21565 146 --
NM_001001132chr2131272 1200 172 --1152 --
NM_001001323chr122208 49 --23191 2910 --
NM_001001331chr372732 2648 2522 597 550 197 89 --12582 --
NM_001001342chr1031269 960 291 11383 1502 --
NM_001001395chr1252761 2362 2294 2118 789 1490 22804 407 --
NM_001001396chr174498 3852 3598 2861 1246 782 451 --13631 --
NM_001001433chr2022099 701 --22938 2565 --
NM_001001481chr812121 --32963 2948 440 --
NM_001001484chr1041906 1736 534 21 ------
NM_001001549chr752222 2106 1914 1868 466 --1794 --
NM_001001550chr752222 2106 1914 1868 466 --1794 --
NM_001001552chr1--1318 ----
NM_001001555chr752222 2106 1914 1868 466 --1794 --
NM_001001556chr1511314 11301 1251 --
NM_001001664chr253931 3919 2566 1208 41 13761 21463 199 --
NM_001001665chr232171 590 348 --1437 --
NM_001001668chr1943912 3770 2632 507 11559 ----
NM_001001711chr113986 934 71 ------
NM_001001791chr1041535 682 466 87 --173 --
NM_001001872chr141247 ------
NM_001001877chrY----138 --
NM_001001890chr2183738 2708 1657 1451 1210 1004 461 152 12768 13692 --
NM_001001924chr851776 1749 1635 1288 770 ------
NM_001001925chr851776 1749 1635 1288 770 ------
NM_001001931chr851776 1749 1635 1288 770 ------
NM_001001971chr1021160 252 ------
NM_001001974chr1032014 466 255 ------
NM_001001992chr212294 93 ------
NM_001001994chrX1127 1503 1158 --
NM_001001995chrX2402 117 11277 1668 --
NM_001001996chrX1127 1503 1158 --
NM_001002000chr142455 121 1379 ----
NM_001002002chr142455 121 1379 ----
NM_001002233chr852224 1816 1602 1364 42 --11779 1855
NM_001002243chr21341 ------
NM_001002244chr17------1139
NM_001002255chr61357 ------
NM_001002257chr263511 2716 2506 1251 403 106 --22217 1420 12734
NM_001002258chr271988 1913 1772 1375 658 167 63 ------
NM_001002259chr121130 2282 219 ----
NM_001002265chr102768 650 --1567 --
NM_001002266chr102768 650 --1567 --
NM_001002295chr103451 223 159 ------
NM_001002296chr821192 266 --21315 144 --
NM_001002811chr131613 1415 417 1197 ----
NM_001002812chr131613 1415 417 1197 ----
NM_001002812chr131613 1415 417 1197 ----
NM_001002814chr843938 3154 1364 42 ----1855
NM_001002838chrX61670 1248 654 495 223 106 ------
NM_001002843chr1531229 263 168 ------
NM_001002860chr1454633 1746 1543 842 70 23862 3847 11753 --
NM_001002906chrY2507 403 ------
NM_001002909chr1732183 1934 1812 --12010 --
NM_001002914chr1741255 1223 1207 170 ------
NM_001003652chr18108627 8194 7804 7639 6514 5740 3070 2461 2306 1869 37136 6355 2211 11481 --
NM_001003674chr1896863 6724 6443 5716 4932 2716 2510 2286 751 26014 1017 ----
NM_001003675chr1896863 6724 6443 5716 4932 2716 2510 2286 751 26014 1017 ----
NM_001003688chr411231 --11142 --
NM_001003694chr32483 60 --197 --
NM_001003698chr631496 233 160 ------
NM_001003699chr631496 233 160 ------
NM_001003712chr1253760 3690 2767 2491 681 ------
NM_001003800chr941435 1021 681 184 ----13184
NM_001003810chr41326 1181 ----
NM_001003940chr1553453 3113 2830 1487 561 1522 ----
NM_001003942chr1553453 3113 2830 1487 561 1522 ----
NM_001003943chr1553457 3117 2834 1491 565 1526 12344 --
NM_001003945chr951894 1552 1222 180 119 ----1575
NM_001004065chr963498 3344 2882 2595 2517 591 13986 22966 744 --
NM_001004304chr1262666 2294 2193 2178 861 593 ------
NM_001004317chr664457 4386 4301 4285 2765 744 23663 3366 --13627
NM_001004323chr7137 ------
NM_001004329chr1211207 --1374 --
NM_001004342chr195524 4945 4134 1579 1056 788 612 188 43 169 24138 896 --
NM_001004360chr231414 333 322 ------
NM_001004440chr11494 --155 --
NM_001005207chr171227 ------
NM_001005266chr151490 1562 ----
NM_001005267chr151490 1562 ----
NM_001005268chr151490 1562 ----
NM_001005269chr151490 1562 ----
NM_001005271chr1711061 ------
NM_001005273chr1711061 ------
NM_001005335chr191225 ------
NM_001005353chr111074 --1494 --
NM_001005353chr111074 --1494 --
NM_001005366chr122796 691 --1615 --
NM_001005377chr191289 ------
NM_001005386chr21295 --171 --
NM_001005404chr1754511 4047 3491 1596 725 --11483 --
NM_001005463chr1072491 2445 2401 2216 1898 428 416 12515 11042 --
NM_001005473chr5106469 5932 5850 5326 5080 4130 1851 1342 383 45 ----1467
NM_001005474chr311609 31456 655 133 136 21648 1412
NM_001005476chr23713 697 681 ------
NM_001005505chr331862 629 105 11636 ----
NM_001005611chrX1486 ------
NM_001005743chr1421259 388 1105 ----
NM_001005744chr1421259 388 1105 ----
NM_001005745chr1421259 388 1105 ----
NM_001005746chr241246 999 595 291 --11442 --
NM_001005747chr241246 999 595 291 --11442 --
NM_001005781chr21103 ------
NM_001005782chr21364 1145 ----
NM_001005861chr33828 398 50 --1262 --
NM_001005910chr32504 234 ------
NM_001005911chr32504 234 ------
NM_001006600chr52537 55 --31926 1840 1679 --
NM_001006610chr16--11023 ----
NM_001006612chrX1145 ------
NM_001006613chrX1145 ------
NM_001006614chrX1145 ------
NM_001006617chr931147 1113 116 ------
NM_001006619chr931147 1113 116 ------
NM_001006620chr931147 1113 116 ------
NM_001006621chr931147 1113 116 ------
NM_001006623chr252317 2092 1960 1929 233 --11638 --
NM_001006634chr161124 ------
NM_001006636chr22687 311 ------
NM_001006641chr941510 1473 258 71 --132 --
NM_001006642chr941510 1473 258 71 --132 --
NM_001006643chr941510 1473 258 71 --132 --
NM_001006657chr263158 2537 2417 2314 1162 609 1115 ----
NM_001006658chr15717 527 232 196 29 ------
NM_001006665chr1----1222 --
NM_001006684chrX1141 ------
NM_001006932chr673229 3206 2806 914 886 191 51 ------
NM_001006945chr12478 161 ------
NM_001007023chr1473985 3299 3248 1322 737 340 99 1163 --14793
NM_001007067chr81148 --1721 --
NM_001007068chr81148 --1721 --
NM_001007069chr81148 --1721 --
NM_001007070chr81148 --1721 --
NM_001007088chrX2824 60 ------
NM_001007098chr11181 ------
NM_001007102chr621114 227 ------
NM_001007237chr132535 2025 286 ------
NM_001007255chr12290 40 ------
NM_001007257chr111182 --1426 --
NM_001007271chr10122 --1319 --
NM_001007466chr644495 3383 1917 713 ------
NM_001007471chr9----2881 647 --
NM_001007527chr51515 ----1520
NM_001007565chr31324 ------
NM_001008220chr521013 668 ------
NM_001008222chrX31116 911 341 ------
NM_001008225chr71248 ------
NM_001008239chr1822396 127 --13383 --
NM_001008391chr112448 193 ------
NM_001008392chr311079 --21409 681 --
NM_001008401chr1921507 307 ------
NM_001008407chr721727 401 ------
NM_001008495chr842278 1648 658 598 3794 517 66 11719 --
NM_001008529chr175524 514 459 433 427 --1925 --
NM_001008541chr1032022 1973 567 --21709 40 --
NM_001008541chr1032022 1973 567 --21709 40 --
NM_001008564chr131525 ----1289
NM_001008566chr223519 504 383 ------
NM_001008567chr9132 ------
NM_001008660chr1121591 62 1989 ----
NM_001008701chr1921248 865 ------
NM_001008723chr10137 1398 ----
NM_001008738chr541874 1831 1087 982 ----1833
NM_001008744chr1421142 975 --1204 --
NM_001008783chr62885 840 ------
NM_001008801chr19131972 1942 1531 1397 740 671 645 587 555 406 378 318 234 ----1337
NM_001008895chr1321282 433 --11432 --
NM_001008925chr442648 1266 607 168 13235 11093 13360
NM_001009185chr52688 502 ------
NM_001009552chr81387 ------
NM_001009554chr484685 4653 4290 4082 3008 1716 1366 510 --13032 --
NM_001009554chr484685 4653 4290 4082 3008 1716 1366 510 --13032 --
NM_001009555chr431531 653 293 --140 --
NM_001009880chr2274538 4266 3907 3553 1401 979 950 14681 1906 --
NM_001009899chr386151 6067 5823 5375 5284 2045 1399 978 ------
NM_001009909chr1152451 2408 1015 993 187 --12747 --
NM_001009960chr762525 1110 469 395 314 144 --1979 --
NM_001009993chr214400 ----13943
NM_001010000chr1893347 3130 3028 2808 2719 2484 1383 1257 769 21081 790 ----
NM_001010853chr661292 1118 875 579 537 265 ----11038
NM_001010861chr13590 216 24 --32501 1981 295 --
NM_001010862chrX43306 2442 314 190 12831 22695 343 --
NM_001010867chr186003 5906 5345 5169 4712 4380 2052 455 15211 ----
NM_001010888chrX84181 3419 3320 3085 2809 1469 483 441 24548 158 11724 11392
NM_001010895chr921840 1455 --11705 --
NM_001010898chr193540 3490 3098 1079 1053 443 336 225 137 --22555 1102 --
NM_001010934chr741129 285 267 55 ------
NM_001010984chr11975 11798 32150 1954 297 --
NM_001010986chrX42417 2249 589 395 ------
NM_001011513chr453944 2888 1154 926 540 13011 ----
NM_001011537chr32668 100 --11714 --
NM_001011546chr20192 --1629 --
NM_001011553chr72990 616 1645 ----
NM_001011663chr102892 116 1852 ----
NM_001011666chr775990 5646 5288 1627 1327 770 436 45849 5662 1969 512 12065 11088
NM_001011708chr252660 2619 2145 944 782 1191 12837 --
NM_001011713chr1441124 1050 1021 129 ------
NM_001011720chr831372 1254 170 ------
NM_001011885chr1511459 ------
NM_001012267chr91467 11530 11827 --
NM_001012279chr61152 ------
NM_001012329chr142066 1926 1591 696 ------
NM_001012393chr1154350 4334 3368 1835 758 13552 1620 21221 970
NM_001012410chr31129 ----152
NM_001012420chr1552355 2327 577 199 189 ------
NM_001012423chr1552355 2327 577 199 189 ------
NM_001012478chr19--1624 ----
NM_001012506chr3161 1119 ----
NM_001012512chr181276 ------
NM_001012513chr181287 ------
NM_001012732chr441104 978 353 151 195 ----
NM_001012751chr1031706 716 429 --1234 --
NM_001012753chr1971022 938 911 500 416 148 64 --1233 --
NM_001012755chrX94761 4351 3471 1254 943 498 476 331 68 --44784 1755 1601 120 --
NM_001012968chrX51762 582 546 540 464 11023 ----
NM_001012974chr6132 ------
NM_001012989chrX--1565 1176 --
NM_001013031chr1033130 2471 950 --23002 92 12793
NM_001013398chr761233 1087 1037 485 309 202 ------
NM_001013415chr421353 237 --11568 --
NM_001013615chr161165 1053 1033 1011 978 285 ------
NM_001013620chr12137630 7496 7030 6846 6245 2895 2852 2273 1678 1467 1149 985 582 26420 651 --17128
NM_001013635chr122364 96 ------
NM_001013690chr1232425 959 368 1339 ----
NM_001013693chr152777 2766 2321 1933 317 --12770 --
NM_001013693chr152777 2766 2321 1933 317 --12770 --
NM_001013699chr122572 124 ------
NM_001013842chr8----2266 262 --
NM_001014435chr161457 ------
NM_001014796chr12168 62 ------
NM_001014796chr12168 62 ------
NM_001014797chr10107725 7683 7166 5892 5676 5567 2208 2159 1149 986 --17004 --
NM_001014812chr152395 86 ------
NM_001014972chr2------125
NM_001015045chr441868 971 804 330 ------
NM_001015877chrX52110 2053 1145 573 67 1170 ----
NM_001015881chrX----1957 --
NM_001017371chr21149 ------
NM_001017395chr373187 3061 2767 2724 2564 550 71 13145 13507 --
NM_001017396chr261590 1548 879 800 463 85 --1489 --
NM_001017405chr41684 ------
NM_001017415chr11652 --2526 182 --
NM_001017416chr11652 --2526 182 --
NM_001017440chr7168108 7992 7943 7017 6003 5167 5047 3104 3020 3012 2912 1984 1683 895 612 35 17972 25517 1197 15522
NM_001017923chr1441607 1388 1272 1157 1447 ----
NM_001017926chr821412 619 ------
NM_001017962chr102693 158 1327 ----
NM_001017969chr91214 --1218 --
NM_001017992chr51940 2430 351 ----
NM_001018054chr131297 1241 328 ------
NM_001018064chr941593 1488 479 106 --1531 --
NM_001018067chr174720 2155 2071 576 453 353 122 1691 11853 --
NM_001018068chr174720 2155 2071 576 453 353 122 1691 11853 --
NM_001018069chr174720 2155 2071 576 453 353 122 1691 11853 --
NM_001018074chr532846 1327 561 11104 --11569
NM_001018075chr532846 1327 561 11104 --11569
NM_001018076chr532846 1327 561 11104 --11569
NM_001018077chr532846 1327 561 11104 --11569
NM_001018100chr151697 ------
NM_001018108chr1571914 1904 681 645 591 243 90 ------
NM_001018159chr161126 ------
NM_001018160chr161126 ------
NM_001020658chr15453 406 302 42 27 11278 ----
NM_001020658chr15453 406 302 42 27 11278 ----
NM_001020818chr1941751 681 603 311 --1354 --
NM_001020819chr1941751 681 603 311 --1354 --
NM_001020820chr1941751 681 603 311 --1354 --
NM_001020821chr1941751 681 603 311 --1354 --
NM_001022chr19134 ------
NM_001023567chr154330 199 189 111 --11860 --
NM_001023587chr33921 110 94 ------
NM_001024071chr142637 163 --1720 --
NM_001024094chr532846 1327 561 11104 --11569
NM_001024226chr131086 812 23 --1264 --
NM_001024227chr131086 812 23 --1264 --
NM_001024228chr131086 812 23 --1264 --
NM_001024372chr842095 2026 1528 580 12248 ----
NM_001024463chr153448 337 121 1158 1217 --
NM_001024649chr552226 1917 1152 644 451 12387 ----
NM_001024660chr32340 94 11068 ----
NM_001024808chr1232803 2601 528 --1722 --
NM_001024847chr342369 2176 1930 976 12315 ----
NM_001024855chr32657 273 ------
NM_001024912chr1931443 627 152 --21362 466 --
NM_001024934chr61651 ------
NM_001024935chr61651 ------
NM_001024936chr61651 ------
NM_001024937chr172639 118 ------
NM_001024947chr51409 --2925 708 --
NM_001024948chr1--1120 ----
NM_001025068chr331571 1485 664 ------
NM_001025069chr331571 1485 664 ------
NM_001025076chr1085426 5184 4018 3839 1672 688 575 30 25900 585 25836 5534 --
NM_001025077chr10106784 6542 5376 5197 5048 3030 2046 1933 435 30 27258 1943 37194 6892 532 --
NM_001025079chr352592 1481 942 707 603 --191 --
NM_001025081chr1821090 1023 1540 11027 --
NM_001025090chr1821090 1023 1540 11027 --
NM_001025092chr1821090 1023 1540 11027 --
NM_001025101chr1821090 1023 1540 11027 --
NM_001025105chr541402 482 430 372 --11438 --
NM_001025108chr263414 3162 1493 1083 699 331 12920 23076 1616 --
NM_001025232chr121130 ------
NM_001025233chr1221758 395 --12414 --
NM_001025252chr853157 2206 1196 1041 914 ----1265
NM_001025253chr853157 2206 1196 1041 914 ----1265
NM_001025266chr3124747 4538 3784 3742 3213 3081 3002 1927 785 634 544 269 13874 44784 4780 1241 219 --
NM_001025356chr1282766 2078 1972 1933 1058 802 505 397 11003 ----
NM_001025366chr61470 ------
NM_001025366chr61470 ------
NM_001025367chr61470 ------
NM_001025367chr61470 ------
NM_001025368chr61470 ------
NM_001025368chr61470 ------
NM_001025369chr61486 ------
NM_001025369chr61486 ------
NM_001025370chr61470 ------
NM_001025370chr61470 ------
NM_001025389chr1141633 579 171 150 ------
NM_001025390chr1141633 579 171 150 ------
NM_001025580chrX2992 593 --21413 560 --
NM_001025603chr151048 964 605 461 81 ------
NM_001025780chr921348 431 1477 11272 --
NM_001029858chr642943 1288 1263 1221 --2423 36 --
NM_001029863chr623172 2580 12737 13057 --
NM_001029864chr2042455 753 320 278 1632 ----
NM_001029875chr552796 2540 2215 1096 958 11122 22733 537 --
NM_001029884chr652363 2341 1893 725 255 12601 ----
NM_001029998chr421389 579 ------
NM_001030001chr143315 298 77 ------
NM_001030006chr1782702 2620 2358 2232 767 663 337 249 --11684 --
NM_001030007chr1632474 1334 21 1447 22676 363 --
NM_001030055chr1454599 4095 3329 349 104 34556 3981 1309 2705 153 --
NM_001030272chr11178 1156 ----
NM_001030273chr11178 1156 ----
NM_001031665chr192351 141 1289 ----
NM_001031677chr53475 400 369 ------
NM_001031679chr1263303 3174 2788 2398 690 526 ------
NM_001031684chr21139 ------
NM_001031690chr742158 1935 950 423 --12411 --
NM_001031695chr2254674 4426 1763 1288 1045 2737 164 ----
NM_001031738chr23450 438 120 ------
NM_001031740chr121733 1427 --1435 11216
NM_001031746chr102391 92 --11045 --
NM_001031804chr1654302 4243 2912 574 425 23169 2741 1874 --
NM_001031812chr5135 --2923 103 --
NM_001032279chr111376 ------
NM_001032280chr611253 11690 11543 --
NM_001032282chr821283 978 --11071 --
NM_001032380chr1041414 1234 215 175 --1779 --
NM_001032393chrX1231 ------
NM_001032394chr642166 623 484 71 --12544 --
NM_001032410chr212294 93 ------
NM_001032730chr11686 --186 --
NM_001032999chr20105125 4768 3834 3305 1947 1909 1433 1391 1291 714 ------
NM_001033047chr431920 479 469 --1528 --
NM_001033057chr321842 773 --11846 --
NM_001033059chr612010 1383 1589 --
NM_001033081chr12541 206 1288 ----
NM_001033082chr12541 206 1288 ----
NM_001033088chr151335 ------
NM_001033117chr374144 4107 3033 1716 1562 167 42 ------
NM_001033503chr5143 ------
NM_001033507chr111696 --11500 --
NM_001033518chr7102767 2502 2418 2346 2297 2005 1080 779 287 183 --1721 --
NM_001033519chr7102767 2502 2418 2346 2297 2005 1080 779 287 183 --1721 --
NM_001033520chr7102767 2502 2418 2346 2297 2005 1080 779 287 183 --1721 --
NM_001033551chr1783344 3043 1352 1199 803 496 481 375 13183 ----
NM_001033554chr171201 ------
NM_001033557chr211108 ------
NM_001033566chr173390 349 340 1762 ----
NM_001033568chr173390 349 340 1762 ----
NM_001033578chr841858 1714 611 103 --12304 --
NM_001033602chr1341042 796 577 274 12166 ----
NM_001033723chr821710 203 --1452 --
NM_001033756chr61404 ------
NM_001033756chr61404 ------
NM_001034845chr421013 526 ------
NM_001034852chr141147 ------
NM_001034915chr821230 220 11515 ----
NM_001034954chr1022862 542 ------
NM_001034955chr1022862 542 ------
NM_001034956chr1022862 542 ------
NM_001034957chr1022862 542 ------
NM_001035chr121035 355 1472 ----
NM_001035003chr4----31037 352 225 --
NM_001035004chr4----31037 352 225 --
NM_001035254chr931885 1626 696 --1412 --
NM_001035260chr1031338 1268 1091 ------
NM_001035511chr1----21744 644 --
NM_001035512chr1147 --21851 751 --
NM_001035513chr1147 --21851 751 --
NM_001035521chr22706 580 ------
NM_001037164chr731792 790 689 --21316 817 --
NM_001037290chr114949 869 675 207 ----1372
NM_001037317chr13590 216 24 --32501 1981 295 --
NM_001037324chr32517 312 --1217 --
NM_001037331chr182374 111 ------
NM_001037334chr1842287 1893 482 113 --12387 --
NM_001037339chr141649 1448 566 374 --1342 --
NM_001037340chr141649 1448 566 374 --1342 --
NM_001037341chr141649 1448 566 374 --1342 --
NM_001037341chr141649 1448 566 374 --1342 --
NM_001037553chr2184555 4482 3821 3409 3186 970 625 580 --11960 11969
NM_001037582chr451103 579 537 274 232 ------
NM_001037954chr1183232 2347 1188 977 880 495 431 56 --23102 3079 --
NM_001037967chrX242 23 ------
NM_001037969chrX242 23 ------
NM_001038702chr562543 2246 1891 1776 281 145 --1850 12571
NM_001038707chr112179 11799 ----
NM_001038707chr112179 11799 ----
NM_001039199chr2024676 3479 12019 21076 513 --
NM_001039348chr23927 838 117 1886 --1335
NM_001039349chr23927 838 117 1886 --1335
NM_001039350chr731593 564 189 ------
NM_001039457chr1131 ------
NM_001039538chr263253 2596 1300 1155 849 359 22247 365 ----
NM_001039570chr2254696 4118 3904 2854 1086 ------
NM_001039571chr2254696 4118 3904 2854 1086 ------
NM_001039573chr172461 24 --1395 --
NM_001039580chr484697 3543 3443 3205 1830 1222 1017 685 --11834 --
NM_001039590chrX43360 1444 880 304 11207 1133 --
NM_001039591chrX43360 1444 880 304 11207 1133 --
NM_001039618chr1185692 5482 5475 4718 4642 4186 1729 66 --24481 4190 --
NM_001039690chr1662387 2224 2207 1966 1947 232 11865 ----
NM_001039693chr241360 1257 551 258 --23334 529 --
NM_001039709chr20105125 4768 3834 3305 1947 1909 1433 1391 1291 714 ------
NM_001039771chr142914 900 ------
NM_001039840chrX116035 6013 4607 2297 1966 1960 1467 1461 393 352 130 1933 1338 --
NM_001039885chr1921096 1018 11034 11103 --
NM_001039888chr15688 625 555 510 69 ------
NM_001039916chr121330 --1917 --
NM_001039917chr121330 --1917 --
NM_001039918chr121330 --1917 --
NM_001039919chr121330 --1917 --
NM_001039920chr121330 --1917 --
NM_001039937chr1333688 1089 844 132 11206 --
NM_001039938chr1351501 1332 465 308 170 ------
NM_001040057chr731105 987 419 ------
NM_001040097chr7----1158 --
NM_001040098chr7----1158 --
NM_001040099chr7----1158 --
NM_001040101chr431597 1051 407 --1103 --
NM_001040110chr751870 1400 609 446 221 ------
NM_001040113chr16--1976 ----
NM_001040142chr23875 576 434 ------
NM_001040143chr23875 576 434 ------
NM_001040144chr1662387 2224 2207 1966 1947 232 11865 ----
NM_001040146chr1662387 2224 2207 1966 1947 232 11865 ----
NM_001040152chr765083 3802 3331 1709 1387 272 --24742 670 --
NM_001040153chr132753 347 ------
NM_001040157chr452622 2385 756 468 230 ------
NM_001040158chr5174 ------
NM_001040181chr32419 143 ------
NM_001040182chr32419 143 ------
NM_001040183chr32419 143 ------
NM_001040199chr32419 143 ------
NM_001040200chr32419 143 ------
NM_001040214chr621966 1731 --1927 22371 888
NM_001040260chr411129 ------
NM_001040261chr411129 ------
NM_001040272chr921534 48 --21955 540 --
NM_001040284chr1675298 4863 2168 1817 1783 1012 307 14694 ----
NM_001040402chr42467 242 ------
NM_001040409chr21283 --3876 644 365 --
NM_001040424chr2142774 2244 477 439 11200 ----
NM_001040429chr1332867 2326 723 23421 2537 ----
NM_001040445chr275061 4627 4474 4463 4217 1962 578 --1764 --
NM_001040446chr532727 759 707 1155 ----
NM_001040450chr1532427 1048 308 --12377 --
NM_001040453chr1532427 1048 308 --12377 --
NM_001040458chr52447 275 --1121 11568
NM_001040665chr794758 3993 2002 1756 1312 1302 1013 295 42 15038 24798 1874 --
NM_001040666chr71460 1740 1500 --
NM_001040697chr111431 --1102 --
NM_001040708chr82832 726 ------
NM_001040709chr162274 2189 1991 893 269 257 22461 2231 12070 --
NM_001040712chr943524 2678 2643 178 ------
NM_001040876chr431452 372 309 --11656 --
NM_001042355chr1675317 5181 5118 4856 3840 1404 982 --14410 13395
NM_001042357chr1021348 24 ------
NM_001042358chr1021348 24 ------
NM_001042360chr1021348 24 ------
NM_001042363chr1021348 24 ------
NM_001042389chr1021348 24 ------
NM_001042390chr1021348 24 ------
NM_001042392chr1021348 24 ------
NM_001042395chr1021348 24 ------
NM_001042403chr121956 ------
NM_001042404chr1------1472
NM_001042412chr1675317 5181 5118 4856 3840 1404 982 --14410 13395
NM_001042413chr953538 2600 1447 1075 262 --13386 --
NM_001042424chr421287 238 --13153 1773
NM_001042425chr611253 11690 11543 --
NM_001042453chrX21581 1092 ------
NM_001042473chr1022125 564 --1529 --
NM_001042476chr1621987 1919 ------
NM_001042492chr1723045 2967 150 23282 2755 --
NM_001042494chr1522577 1373 2435 73 ----
NM_001042495chr1522577 1373 2435 73 ----
NM_001042496chr1522577 1373 2435 73 ----
NM_001042497chr1522577 1373 2435 73 ----
NM_001042510chr821696 1484 --2288 130 --
NM_001042511chr821696 1484 --2288 130 --
NM_001042517chr131931 ------
NM_001042537chrX42411 1858 1776 316 11926 11010 --
NM_001042555chr1274767 4628 3556 3332 3305 1886 652 --11011 --
NM_001042576chr20138 ------
NM_001042599chr267776 7626 5814 5355 5201 4779 14956 47441 7019 2724 2172 --
NM_001042601chr352504 2185 1327 510 233 ------
NM_001042603chr1285339 5320 4795 4701 3667 1477 900 858 ------
NM_001042604chr354660 3438 1828 1785 1342 24271 1388 33339 1307 446 11790
NM_001042635chr14--1124 ----
NM_001042646chr331856 707 568 --11735 11999
NM_001042681chr152474 1876 912 813 347 ------
NM_001042682chr152474 1876 912 813 347 ------
NM_001042682chr152474 1876 912 813 347 ------
NM_001042683chr641302 1235 433 320 ------
NM_001042749chrX11720 --11285 --
NM_001042750chrX11720 --11285 --
NM_001042751chrX11720 --11285 --
NM_001042762chr71911 ------
NM_001043318chr1483774 3763 3619 3609 2676 2634 1181 862 ------
NM_001043351chr141466 844 503 379 1851 ----
NM_001044305chr631636 1347 447 --1495 --
NM_001044385chr242796 1270 823 419 22492 613 22768 2498 --
NM_001044387chr19103534 3489 2818 2718 2693 1618 1124 682 640 613 --21180 965 --
NM_001044388chr19103534 3489 2818 2718 2693 1618 1124 682 640 613 --21180 965 --
NM_001044722chr5135 --2923 103 --
NM_001044723chr5135 --2923 103 --
NM_001046chr542491 2467 2289 2142 ------
NM_001048183chr183660 3533 2964 2662 1181 741 255 154 13426 ----
NM_001049chr1432144 682 284 11501 22148 381 1371
NM_001070chr17134 ------
NM_001071775chr1311221 --21397 212 --
NM_001076chr41120 ------
NM_001076chr41120 ------
NM_001079874chr152121 568 501 482 390 --1532 --
NM_001083620chr422210 1701 11796 ----
NM_001095chr121777 ------
NM_001099678chr395821 5648 4750 1964 1854 1381 866 536 250 45995 5619 4281 80 ----
NM_001100108chr1147931 7495 7006 6868 6699 5918 5857 5831 5820 5427 5264 2538 1299 98 --16770 12725
NM_001113490chrX53661 3290 2395 1179 471 --1928 --
NM_001116chr1652250 2103 2086 835 361 --13087 --
NM_001117chr182751 458 12344 ----
NM_001119chr431519 1407 464 ------
NM_001121chr104549 367 258 174 11571 ----
NM_001122679chr52455 136 --1459 --
NM_001128chr1632474 1334 21 1447 22676 363 --
NM_001140chr172429 189 1555 ----
NM_001146chr842058 1782 756 207 ----1578
NM_001148chr432034 1957 1553 --21717 209 --
NM_001149chr1021329 88 ------
NM_001153chr22940 157 ------
NM_001160chr1252848 2153 943 644 418 11068 ----
NM_001167chrX96665 6072 6028 5537 4635 2380 2098 1923 829 14912 ----
NM_001173chr1454599 4095 3329 349 104 34556 3981 1309 2705 153 --
NM_001178chr11178 1156 ----
NM_001179chr41188 ------
NM_001186chr2142795 2572 950 244 12589 11008 --
NM_001191chr201221 ------
NM_001201chr453383 2833 1540 1350 366 23902 1277 ----
NM_001204chr2127375 6602 4839 2716 2595 2104 1848 1750 1598 1081 1066 676 25600 227 27330 5148 --
NM_001219chr72381 315 12002 ----
NM_001222chr1031800 1579 358 --21228 753 --
NM_001241chr222408 745 22240 774 22401 72 --
NM_001241chr222408 745 22240 774 22401 72 --
NM_001249chr141308 ------
NM_001256chr1712783 ------
NM_001257chr1631219 989 152 11332 ----
NM_001259chr7106314 6088 5345 4988 4537 2365 1611 1547 563 550 --22470 2270 --
NM_001263chr4----1162 --
NM_001271chr1573073 2773 2524 818 458 292 165 1591 1126 --
NM_001273chr12149 ------
NM_001278chr1021205 468 ------
NM_001281chr191136 ----1151
NM_001282chr1782702 2620 2358 2232 767 663 337 249 --11684 --
NM_001289chrX31453 1301 1269 ----1641
NM_001290chr4170 1377 ----
NM_001299chr191500 ------
NM_001304chr1752699 2445 1269 765 152 1636 --1692
NM_001310chr1213106 --11936 --
NM_001315chr621680 35 ------
NM_001331chr1122167 1141 1355 12432 --
NM_001332chr521318 1225 ------
NM_001343chr52171 141 --11730 --
NM_001344chr142171 51 ------
NM_001346chr342410 1009 84 61 ------
NM_001351chr31374 11628 ----
NM_001356chrX31639 622 95 1946 ----
NM_001364chr1174311 4179 3714 3117 3105 924 607 ------
NM_001378chr21144 1389 ----
NM_001380chr103744 424 91 ----11016
NM_001381chr21364 1416 ----
NM_001385chr82299 126 ------
NM_001386chr82768 599 --12003 --
NM_001387chr572961 2850 2279 2083 1943 919 156 --22452 2022 --
NM_001391chr182400 40 ----1934
NM_001400chr11386 ------
NM_001401chr941337 580 414 111 ------
NM_001402chr611273 12036 ----
NM_001406chr172376 121 --21087 695 --
NM_001407chr311063 --1635 --
NM_001408chr141445 215 165 56 ------
NM_001412chrX43535 3335 3157 2482 21427 1254 13498 --
NM_001416chr171338 ------
NM_001419chr1933944 3413 519 --21020 81 --
NM_001420chr191250 ------
NM_001422chr1131124 399 24 1546 ----
NM_001429chr222927 419 ------
NM_001430chr251290 810 172 120 55 ------
NM_001431chr631001 952 383 --1329 --
NM_001438chr142762 2268 1223 360 12986 22301 1107 --
NM_001448chrX31145 314 161 ------
NM_001449chrX31254 436 60 --21140 430 --
NM_001453chr62162 121 1615 ----
NM_001455chr694751 4389 3920 3212 1811 1093 1014 302 199 13474 1915 --
NM_001461chr13546 198 183 --1136 1558
NM_001463chr2--1238 149 --
NM_001466chr171110 ------
NM_001482chr151690 ------
NM_001493chrX1103 ------
NM_001497chr942384 2301 2218 88 ------
NM_001498chr63995 978 272 --1939 --
NM_001521chr22706 580 ------
NM_001527chr684748 4124 4082 2969 1864 1216 941 416 23266 3095 ----
NM_001530chr141206 147 ----
NM_001533chr191225 ------
NM_001542chr132535 2025 286 ------
NM_001543chr554538 3772 3586 1950 306 ------
NM_001546chr6--11402 ----
NM_001554chr11130 --1107 --
NM_001555chrX1208 ----1276
NM_001570chr32506 148 --11444 --
NM_001584chr1131016 80 69 ------
NM_001587chrX12136 --1535 --
NM_001609chr1063997 3539 3193 1444 337 295 --33235 3231 1805 11583
NM_001616chr222189 883 --2679 165 --
NM_001617chr221015 935 ------
NM_001634chr612010 1383 1589 --
NM_001635chr74988 428 198 72 --1202 --
NM_001642chr1121125 415 --2936 419 --
NM_001649chrX42448 2441 1922 630 --1634 --
NM_001655chr1151829 1460 424 382 154 ------
NM_001656chr51434 21830 1662 ----
NM_001658chr131086 812 23 --1264 --
NM_001659chr1252662 2267 2218 2130 826 --42450 2117 2113 855 --
NM_001660chr31779 ------
NM_001663chr1422448 1968 ------
NM_001664chr32927 907 ------
NM_001668chr132115 1601 587 ------
NM_001681chr12----1134 --
NM_001682chr12----22905 2624 --
NM_001683chr372732 2648 2522 597 550 197 89 --12582 --
NM_001684chr184215 3569 3315 2578 1556 963 499 168 --13348 --
NM_001689chr271988 1913 1772 1375 658 167 63 ------
NM_001690chr33956 691 449 12562 ----
NM_001693chr811183 ------
NM_001694chr16156 ------
NM_001695chr873963 3517 2941 1415 1029 600 382 34300 3070 1020 11639 --
NM_001699chr192484 441 --11214 --
NM_001701chr941542 1416 1229 157 ------
NM_001703chr11296 ------
NM_001704chr61484 1157 ----
NM_001709chr1142726 1107 788 748 ------
NM_001718chr621093 173 1160 ----
NM_001726chr11143 ------
NM_001729chr4155 ------
NM_001730chr132650 470 ------
NM_001730chr132650 470 ------
NM_001743chr22223 161 ------
NM_001746chr552226 1917 1152 644 451 12387 ----
NM_001753chr721814 586 --2712 503 --
NM_001754chr2183738 2708 1657 1451 1210 1004 461 152 12768 13692 --
NM_001759chr1265333 4737 2033 1728 1648 790 13819 ----
NM_001777chr352592 1481 942 707 603 --191 --
NM_001788chr72990 616 1645 ----
NM_001789chr321422 1379 ------
NM_001792chr181438 ------
NM_001794chr201245 ------
NM_001795chr1661377 1245 1178 1069 1027 637 ------
NM_001797chr161101 ------
NM_001798chr121119 11137 ----
NM_001801chr52619 528 ------
NM_001802chr163935 113 98 ------
NM_001810chr201184 --1513 --
NM_001812chr4------1310
NM_001819chr202300 67 ----1113
NM_001826chr1299 49 ------
NM_001830chrX113928 3848 3597 3463 3293 2946 2775 1401 781 560 489 11373 ----
NM_001839chr11226 --1558 --
NM_001842chr9--1620 ----
NM_001845chr1321019 96 11197 11360 --
NM_001854chr121380 332 ------
NM_001858chr695053 4226 3155 1970 1821 1407 807 795 351 14753 11009 --
NM_001863chr191106 --1125 --
NM_001880chr21290 ----138
NM_001881chr101513 2370 330 ----
NM_001884chr5178 --1117 --
NM_001892chr541402 482 430 372 --11438 --
NM_001894chr222779 42 ------
NM_001901chr64899 378 61 53 ----130
NM_001918chr1119230 7723 7658 7010 6973 6926 6653 2988 2374 1629 310 ------
NM_001921chr441104 978 353 151 195 ----
NM_001927chr24738 501 133 49 ------
NM_001933chr142917 263 11342 ----
NM_001935chr2----2932 43 --
NM_001936chr731593 564 189 ------
NM_001938chr121395 750 ------
NM_001939chrX53516 3298 3074 2944 1427 12465 13815 --
NM_001941chr1893518 2919 2555 2546 1242 1142 1008 474 127 13958 33907 917 347 --
NM_001950chr161654 ------
NM_001951chr82427 109 ------
NM_001955chr621124 185 ------
NM_001962chr51455 ------
NM_001967chr3135 --1623 --
NM_001968chr41148 ------
NM_001977chr421574 485 1498 ----
NM_001981chr152139 2021 1742 225 218 ------
NM_001991chr1761929 1863 1687 1676 890 60 1550 ----
NM_001992chr562190 2042 1708 1581 281 93 ------
NM_001995chr431210 571 535 --11161 --
NM_001999chr511126 --1457 --
NM_002006chr454962 4167 4085 646 26 15326 ----
NM_002009chr1532710 2401 743 --22405 2011 --
NM_002010chr132510 484 ------
NM_002015chr1333221 2058 572 12288 --1278
NM_002023chr121552 203 11248 ----
NM_002024chrX22103 327 ------
NM_002025chrX218914 7941 7926 6520 6383 6337 6224 5972 3557 3123 2891 2336 1952 1707 1589 1473 1384 1361 1090 902 855 37586 6505 1171 66604 6228 5788 2470 1521 85 --
NM_002031chr62272 215 ------
NM_002032chr11------1295
NM_002033chr1163146 2906 2832 2592 670 407 --11202 --
NM_002035chr1893718 3142 3055 2894 1395 1257 1024 777 630 11127 23659 609 --
NM_002037chr6--1155 ----
NM_002040chr2122982 681 --11170 12291
NM_002044chr1511314 11301 1251 --
NM_002046chr12156 ------
NM_002048chr921047 536 ------
NM_002051chr103451 223 159 ------
NM_002063chrX21202 984 ------
NM_002074chr121386 150 ------
NM_002076chr1273253 2670 2124 2073 1281 1186 263 21240 452 ----
NM_002081chr2175 --11190 --
NM_002083chr141122 ------
NM_002086chr1762039 1557 648 233 195 137 11515 11550 --
NM_002091chr181276 ------
NM_002092chr484845 4595 4107 3681 1272 883 837 461 24223 3261 34891 4689 316 --
NM_002094chr161128 ------
NM_002107chr1------1420
NM_002114chr6199 ------
NM_002126chr1763575 3421 1572 807 554 332 --1625 1402
NM_002130chr5----11482 --
NM_002136chr121144 ------
NM_002137chr731790 214 29 ------
NM_002138chr41326 1181 ----
NM_002139chrX2518 427 ------
NM_002140chr9----11200 --
NM_002143chr11776 ------
NM_002146chr1721276 387 ------
NM_002154chr52357 160 ------
NM_002158chr233731 2414 32 ------
NM_002188chr51576 ------
NM_002196chr2011023 ------
NM_002196chr2011023 ------
NM_002199chr4----1238 --
NM_002202chr51334 11090 ----
NM_002205chr122335 54 ------
NM_002211chr1031119 1003 99 ------
NM_002214chr7134636 4486 3676 3536 1919 1665 1574 1234 1190 929 515 167 98 1206 13555 --
NM_002222chr321150 77 11001 ----
NM_002232chr11255 11369 ----
NM_002235chr1241483 1204 1127 66 --179 --
NM_002240chr212228 61 ------
NM_002241chr163057 2847 2175 1931 1053 301 ------
NM_002242chr261783 1765 1728 1692 642 358 1427 11879 --
NM_002245chr1------1498
NM_002247chr1072235 2225 1557 944 838 633 276 --146 --
NM_002253chr421371 1085 ------
NM_002254chr241775 1674 640 560 1942 ----
NM_002264chr3104283 3627 1544 1304 1209 545 425 348 269 124 23431 987 ----
NM_002267chr1322076 1573 ------
NM_002268chr331600 624 538 --1339 --
NM_002270chr554663 4588 4291 1616 304 ------
NM_002271chr1342116 1874 870 631 --1635 --
NM_002272chr123469 71 25 1108 ----
NM_002284chr121544 --1566 --
NM_002285chr263414 3162 1493 1083 699 331 12920 23076 1616 --
NM_002290chr63442 352 163 --1229 21460 436
NM_002293chr162671 2334 2149 806 759 223 --12025 --
NM_002298chr1321116 287 --21554 37 --
NM_002310chr586287 5142 3982 2409 2250 1053 521 47 1122 24140 2147 1900
NM_002312chr132754 671 --146 --
NM_002334chr1121805 68 --12023 --
NM_002336chr1214192 1961 24957 3299 --
NM_002350chr831203 457 44 11146 1396 --
NM_002351chrX31680 1295 1064 ------
NM_002355chr121317 2150 105 ----
NM_002356chr621912 676 --12562 12144
NM_002359chr1724122 945 --21116 429 --
NM_002360chr761882 744 701 471 218 137 ------
NM_002374chr263253 2596 1300 1155 849 359 22247 365 ----
NM_002376chr141570 --1590 --
NM_002381chr231025 342 55 --1698 --
NM_002385chr1821090 1023 1540 11027 --
NM_002387chr584974 4675 4578 3963 1985 1765 1652 605 24033 2071 24685 288 --
NM_002395chr63348 276 188 ------
NM_002397chr532099 506 263 ----1544
NM_002399chr15--11337 ----
NM_002401chr1722508 1994 ----1489
NM_002408chr14----1700 --
NM_002431chr141262 ------
NM_002442chr1221578 1116 ------
NM_002444chrX51894 1809 807 77 68 21493 199 1319 --
NM_002445chr82576 215 144 ----
NM_002465chr122310 94 ------
NM_002473chr2231136 1069 1035 ------
NM_002479chr11197 ------
NM_002480chr1211050 ------
NM_002481chr1116711 6661 5873 5538 2919 1847 1807 1617 977 891 729 --27943 6140 --
NM_002482chr1160 ------
NM_002486chr941667 490 463 103 --1753 --
NM_002487chr154775 754 699 101 ------
NM_002489chr7--1347 ----
NM_002493chr91291 ------
NM_002494chr4162 ------
NM_002499chr1531890 304 54 ------
NM_002505chr661342 1223 1077 302 198 44 ------
NM_002507chr1741953 1681 577 189 ------
NM_002508chr141787 1635 386 148 ------
NM_002515chr1431346 801 436 --22037 1790 1747
NM_002519chr1151406 1117 390 124 41 --2369 181 --
NM_002522chr1783759 3661 2961 2627 2519 1253 380 243 ----13370
NM_002524chr13967 887 198 ------
NM_002526chr641086 655 381 353 ------
NM_002537chr152197 88 11012 ----
NM_002539chr2----1211 --
NM_002545chr1154350 4334 3368 1835 758 13552 1620 21221 970
NM_002546chr8--2305 103 ----
NM_002553chr71393 ------
NM_002556chr112457 332 ------
NM_002569chr15157 ------
NM_002576chr112443 24 ------
NM_002578chrX1420 ------
NM_002581chr964724 2171 1086 964 799 156 12195 ----
NM_002583chr12----1437 --
NM_002586chr631576 543 242 ------
NM_002594chr204687 315 133 58 12316 31966 654 137 --
NM_002595chr1231789 773 722 --11288 --
NM_002600chr141649 1448 566 374 --1342 --
NM_002612chr741499 1463 830 701 1343 ----
NM_002613chr1654209 3448 3345 1451 826 --24681 4435 --
NM_002623chr201189 ------
NM_002628chr331179 435 376 ------
NM_002634chr171842 ------
NM_002641chrX61533 1508 1329 656 493 374 --1629 --
NM_002645chr1172667 2570 2032 1105 1079 827 698 1714 42901 2341 2321 702 --
NM_002646chr112093 --21898 1463 --
NM_002648chr611102 --1140 --
NM_002651chr1----1265 --
NM_002655chr835164 5044 4497 2448 376 21469 219 11711
NM_002657chr2042765 1552 1540 1136 --12751 --
NM_002658chr102821 754 1869 ----
NM_002667chr631191 339 268 ------
NM_002707chr21128 ------
NM_002709chr233576 1369 491 3563 543 411 ----
NM_002710chr1231050 350 184 --11025 --
NM_002711chr71567 1299 ----
NM_002714chr64989 845 260 51 ------
NM_002715chr511311 ------
NM_002716chr1193552 3490 2953 2762 2294 1397 692 612 294 11014 13654 --
NM_002717chr82445 439 ------
NM_002718chr381940 1889 1869 1786 813 720 538 392 1873 --11063
NM_002719chr1432273 2036 583 ------
NM_002729chr101793 1286 ----
NM_002731chr162886 2804 777 730 233 28 --12934 1570
NM_002733chr121411 --147 --
NM_002734chr174766 719 260 51 2924 443 ----
NM_002737chr1746023 4749 4706 854 11530 ----
NM_002738chr1631079 861 336 ------
NM_002740chr322164 31 --11974 --
NM_002745chr2273013 1764 1754 834 805 417 268 --12942 --
NM_002753chr4----1611 --
NM_002755chr151576 ------
NM_002763chr12554 159 ------
NM_002816chr171243 ------
NM_002822chr1251712 587 457 170 132 --11192 1331
NM_002823chr2156 ------
NM_002825chr71586 ------
NM_002829chr921107 467 ------
NM_002830chr2155 ------
NM_002833chr1511348 --11019 --
NM_002834chr1242808 928 476 402 13487 23882 214 11247
NM_002837chr1283953 3851 3630 3052 2826 1661 1218 899 23119 995 64244 3634 3346 1222 391 39 --
NM_002839chr943524 2678 2643 178 ------
NM_002840chr121566 466 ------
NM_002843chr1143447 2140 663 348 11318 ----
NM_002847chr72548 239 --11225 --
NM_002851chr72623 25 ------
NM_002855chr1152864 1305 894 657 389 ------
NM_002858chr1----1550 --
NM_002863chr14137 --165 --
NM_002865chr8----142 --
NM_002866chr191540 ------
NM_002868chr1252321 819 298 268 244 ------
NM_002869chr1141717 402 55 37 ------
NM_002874chr941984 1538 295 57 --1869 --
NM_002890chr51995 --156 --
NM_002891chr15177 ------
NM_002892chr14--1399 ----
NM_002893chrX1277 ------
NM_002906chr1162048 1983 1545 1505 416 106 ------
NM_002912chr63205 179 103 ------
NM_002924chr11476 ------
NM_002938chr421729 1532 --11445 --
NM_002940chr431452 372 309 --11656 --
NM_002941chr331168 246 220 ------
NM_002945chr171725 ------
NM_002953chr1----1222 --
NM_002955chr631496 233 160 ------
NM_002956chr12295 43 --1465 --
NM_002957chr961425 1287 1274 909 725 637 12587 ----
NM_002958chr33828 398 50 --1262 --
NM_002959chr133396 838 702 1332 22846 565 --
NM_002968chr161771 ----11063
NM_002971chr31898 ------
NM_002973chr121154 ------
NM_002977chr242642 2121 685 662 --11199 --
NM_002985chr174835 585 174 28 185 ----
NM_002993chr41435 1718 1439 21025 687
NM_002994chr471939 1318 1205 555 522 460 155 ----11904
NM_002998chr851965 1620 1563 1414 374 --11979 --
NM_003001chr1147 --21851 751 --
NM_003010chr1721804 1499 11523 --1975
NM_003020chr151451 ------
NM_003022chrX31175 909 386 1403 ----
NM_003026chr921315 832 ------
NM_003027chr15149 ------
NM_003028chr963142 2727 1158 750 381 160 ------
NM_003031chr16--11023 ----
NM_003032chr342117 1956 1840 1674 ------
NM_003034chr12107394 6427 5356 5232 4951 2875 2852 1381 1295 1198 23092 1171 22057 965 12938
NM_003042chr331597 1538 367 ------
NM_003043chr343286 1379 858 402 21233 608 ----
NM_003045chr1394229 3667 3373 1742 1713 908 757 256 117 ------
NM_003051chr131298 808 463 ------
NM_003068chr8144 1704 ----
NM_003071chr311796 --1669 11726
NM_003074chr311467 --21898 921 --
NM_003081chr201807 1964 ----
NM_003088chr711067 ------
NM_003094chr121172 912 1171 ----
NM_003096chr21172 ------
NM_003100chr51395 ------
NM_003106chr31195 --1760 --
NM_003107chr622578 1623 ------
NM_003108chr286345 6185 5464 4999 2925 1982 1597 1422 16545 26805 5656 --
NM_003110chr173756 691 314 ------
NM_003111chr21149 ------
NM_003112chr733246 2748 751 ------
NM_003127chr93221 80 29 ------
NM_003128chr22948 362 ----1564
NM_003131chr631894 1710 148 --21913 1909 --
NM_003137chr621619 157 12148 1830 --
NM_003139chr111259 ------
NM_003145chr1--1458 ----
NM_003149chr321506 1278 ------
NM_003150chr1731919 1531 609 ------
NM_003155chr81882 11733 ----
NM_003157chr32951 95 ------
NM_003161chr171474 1560 ----
NM_003162chr22907 721 --1849 --
NM_003179chrX1181 ------
NM_003183chr2------1792
NM_003185chr203396 311 222 ----1363
NM_003188chr61285 --1688 --
NM_003198chr11227 ------
NM_003199chr1865666 3732 2040 1567 1522 896 --13764 --
NM_003202chr541713 1410 755 33 178 ----
NM_003204chr1721214 360 ------
NM_003206chr6----1385 --
NM_003217chr1291948 1584 1577 1449 808 392 341 215 52 11414 --11642
NM_003220chr611253 11690 11543 --
NM_003221chr663395 2857 2763 2724 1627 632 ------
NM_003234chr352108 2089 2070 485 374 1908 ----
NM_003236chr243327 2821 1228 1014 12422 ----
NM_003239chr142414 89 ------
NM_003242chr342369 2176 1930 976 12315 ----
NM_003243chr121190 167 --11176 --
NM_003244chr181345 ------
NM_003246chr1541763 1526 1507 682 ----1394
NM_003250chr171356 ------
NM_003253chr211588 ------
NM_003257chr15----1544 --
NM_003262chr385279 5209 4478 4436 3339 3315 1847 243 11930 23319 435 --
NM_003269chr6----21307 237 --
NM_003286chr203860 315 73 --1307 --
NM_003291chr13----1151 --
NM_003292chr152256 1903 1534 1412 104 ----11453
NM_003298chr375229 5072 4241 3949 2315 1686 641 ----1533
NM_003300chr142198 70 ------
NM_003304chr331068 657 264 --1583 --
NM_003312chr223121 57 22 ------
NM_003315chr17----141 --
NM_003319chr21629 --132 --
NM_003336chrX1408 ------
NM_003337chr5--158 21696 1692 --
NM_003338chr1031892 736 407 ----1474
NM_003340chr43334 299 148 ------
NM_003342chr1753246 3026 519 193 28 --1814 1524
NM_003348chr1211569 1563 1176 --
NM_003350chr82374 47 ------
NM_003352chr21364 1145 ----
NM_003360chr4137 --141 --
NM_003368chr11652 --2526 182 --
NM_003369chr1132577 1838 875 --1626 12464
NM_003371chr93523 169 25 ------
NM_003372chrX1353 --1667 --
NM_003376chr61470 ------
NM_003376chr61470 ------
NM_003385chr2164 ----1852
NM_003387chr252621 2504 1092 701 454 12567 1320 --
NM_003390chr11--11065 --1394
NM_003392chr393294 2770 1547 1476 1303 1249 923 622 420 11161 11673 --
NM_003400chr21689 ----1772
NM_003404chr2041508 1252 495 314 1721 ----
NM_003406chr841793 1520 434 29 --1649 --
NM_003409chr1851476 1014 570 335 199 --21431 116 --
NM_003410chrX32335 809 76 12029 2772 391 --
NM_003412chr323128 2069 --12374 --
NM_003413chrX11377 --11696 --
NM_003418chr3169 ------
NM_003423chr1982201 2159 2072 2046 1735 1025 770 237 --11893 --
NM_003435chr192294 27 ------
NM_003453chr131684 ------
NM_003454chr1661479 1368 1040 573 315 171 1112 ----
NM_003455chr1151549 1194 535 510 240 --1547 --
NM_003458chr363704 3251 2558 1470 961 142 --23273 1562 --
NM_003463chr631344 615 496 ------
NM_003466chr242496 2441 1720 897 ------
NM_003468chr274208 4088 3344 2832 702 216 190 ------
NM_003470chr1631315 725 478 ------
NM_003471chr372114 1884 1477 743 519 491 179 --22175 2161 --
NM_003473chr103832 299 215 ------
NM_003477chr112618 311 ------
NM_003482chr1242449 765 683 403 ------
NM_003483chr1262549 2400 2256 1109 928 747 --1568 --
NM_003485chr1451308 1227 1004 131 86 ------
NM_003486chr1631096 723 432 12652 ----
NM_003488chr171999 --1917 --
NM_003489chr2133180 520 464 --12475 --
NM_003505chr711418 21795 107 11628 --
NM_003507chr221754 510 ------
NM_003528chr181478 1396 1387 1333 693 664 106 26 --1254 --
NM_003558chr92545 509 ------
NM_003564chr13580 564 514 1183 ----
NM_003566chr1263306 3243 2129 810 352 323 ----13070
NM_003567chr12424 68 ------
NM_003574chr1834821 4290 2168 11006 1412 --
NM_003583chr1252972 2680 2428 244 55 --1111 1339
NM_003589chr1321282 433 --11432 --
NM_003590chr213410 1315 32912 762 565 --
NM_003595chr223519 504 383 ------
NM_003601chr41155 ------
NM_003607chr193382 2939 1690 943 891 696 58 47 27 2435 366 ----
NM_003613chr15134 --1141 --
NM_003615chr331138 998 398 1517 ----
NM_003617chr1154960 4811 4396 4326 4257 1834 1763 1535 1503 1330 1206 1167 675 416 142 11135 ----
NM_003618chr2--1897 ----
NM_003628chr23713 697 681 ------
NM_003630chr61679 1596 1726 --
NM_003632chr172597 191 ------
NM_003633chr532255 951 37 12200 ----
NM_003635chr101440 ------
NM_003637chr131178 1048 413 ----11378
NM_003644chr17115999 5131 4909 4637 4549 4543 4075 1988 1234 642 465 21341 797 11550 --
NM_003657chr202727 57 ------
NM_003663chr333377 3071 160 21157 711 ----
NM_003670chr321294 503 142 ----
NM_003671chr963332 3208 2864 1192 1020 494 --12966 --
NM_003676chr13926 240 191 2718 636 2945 863 --
NM_003677chr122504 298 1629 ----
NM_003679chr172457 724 681 507 431 345 267 --23325 521 2456 91
NM_003685chr191173 ------
NM_003688chrX142 ------
NM_003705chr21279 ------
NM_003709chr22307 115 ------
NM_003713chr12695 359 11353 ----
NM_003718chr71522 ------
NM_003722chr332259 2130 290 1952 ----
NM_003737chr111421 ------
NM_003741chr31307 ------
NM_003743chr231457 883 644 --12163 --
NM_003744chr1421259 388 1105 ----
NM_003750chr102990 932 ------
NM_003759chr443807 1271 585 528 13669 ----
NM_003760chr12793 283 ------
NM_003763chr2022099 701 --22938 2565 --
NM_003764chr62607 552 ----2805 588
NM_003766chr171500 ------
NM_003768chr121305 127 ----1105
NM_003772chr112941 30 --1241 --
NM_003774chr12103076 2204 2069 2043 1315 1190 815 687 397 207 12940 11281 --
NM_003778chr31107 ------
NM_003779chr12143 75 ------
NM_003787chr1821106 91 --2368 23 --
NM_003795chr62190 123 ------
NM_003800chr632218 1977 1498 --1871 --
NM_003816chr81401 31411 1349 134 --1522
NM_003818chr20--11019 1104 --
NM_003822chr143096 2165 2122 281 ------
NM_003831chr1831300 735 391 11632 ----
NM_003840chr852241 1550 1430 672 35 1761 ----
NM_003850chr131665 ------
NM_003861chr1442243 1898 838 726 11090 12932 --
NM_003864chr41151 ------
NM_003870chr1531921 154 79 11948 21406 798 --
NM_003872chr212457 --22932 2106 --
NM_003873chr1031858 1672 190 181 ----
NM_003884chr341459 668 532 32 ------
NM_003885chr1742560 2420 637 176 --1418 1708
NM_003887chr222188 1808 11592 ----
NM_003888chr1541178 446 400 105 ------
NM_003895chr212749 187 11811 ----
NM_003899chr1332478 1023 256 21676 856 11713 --
NM_003902chr11315 ------
NM_003905chr161126 ------
NM_003908chr2021099 1064 --1177 --
NM_003913chr673929 3548 3492 2925 1573 388 198 --24334 1185 --
NM_003916chrX21330 1143 ------
NM_003921chr111254 2605 318 ----
NM_003924chr421165 175 ------
NM_003927chr1841037 884 392 303 ------
NM_003930chr721969 650 22396 148 ----
NM_003931chr61651 ------
NM_003932chr2211745 --21304 414 --
NM_003939chr1033200 2844 1524 22682 1059 ----
NM_003941chr72235 157 ----11722
NM_003948chr422088 401 12414 --1757
NM_003951chrX--1389 ----
NM_003958chr642928 970 448 210 23093 254 --11412
NM_003966chr5187821 7584 7489 6866 6236 5622 4952 4906 2977 2130 2017 1981 1850 1392 1351 1248 731 477 12221 37283 1854 860 17409
NM_003968chr3129 --1458 --
NM_003971chr171525 ------
NM_003972chr101146 ------
NM_003983chr1694054 3796 3586 2742 2709 1449 1112 731 140 13233 13775 --
NM_003988chr1021473 820 ------
NM_003992chr151227 ------
NM_003994chr1243731 3509 627 273 --12890 14036
NM_004006chrX42514 1943 916 629 12636 ----
NM_004007chrX42514 1943 916 629 12636 ----
NM_004009chrX42514 1943 916 629 12636 ----
NM_004010chrX42514 1943 916 629 12636 ----
NM_004011chrX42514 1943 916 629 12636 ----
NM_004012chrX42514 1943 916 629 12636 ----
NM_004013chrX42514 1943 916 629 12636 ----
NM_004014chrX42514 1943 916 629 12636 ----
NM_004015chrX42514 1943 916 629 12636 ----
NM_004016chrX42428 1857 830 543 12550 ----
NM_004017chrX42514 1943 916 629 12636 ----
NM_004018chrX42428 1857 830 543 12550 ----
NM_004020chrX42514 1943 916 629 12636 ----
NM_004021chrX42428 1857 830 543 12550 ----
NM_004022chrX42428 1857 830 543 12550 ----
NM_004023chrX42428 1857 830 543 12550 ----
NM_004024chr131399 407 396 ------
NM_004036chr2197 ------
NM_004041chr112685 60 ------
NM_004047chr1131 ------
NM_004061chr51529 ------
NM_004067chr731283 516 378 ------
NM_004073chr1186 ------
NM_004087chr3--11597 ----
NM_004089chrX----1957 --
NM_004093chr1362813 762 579 568 502 494 --1911 --
NM_004094chr1442559 2151 2093 227 22847 233 1923 --
NM_004098chr10----11016 11158
NM_004103chr81754 ------
NM_004105chr23927 838 117 1886 --1335
NM_004112chr1721437 268 --1409 --
NM_004113chr341725 416 381 211 ------
NM_004114chrX1488 1132 ----
NM_004116chr24435 316 114 44 ------
NM_004124chr1433404 3004 99 13031 1576 --
NM_004133chr822035 1661 12706 ----
NM_004136chr1553097 2120 859 791 452 --1106 --
NM_004156chr81387 ------
NM_004161chr2--11517 ----
NM_004170chr951906 1858 1440 431 151 11751 ----
NM_004171chr11129340 8611 7383 6296 6264 6133 6022 3606 3183 2796 2007 220 19634 43794 3230 3110 2619 --
NM_004183chr111739 ------
NM_004185chr13682 551 21 ------
NM_004187chrX21410 510 --11164 --
NM_004200chr1132802 911 865 --11250 1254
NM_004225chr831527 949 88 --11059 11369
NM_004226chr21286 --121 --
NM_004228chr191124 ------
NM_004229chrX21921 1446 --21494 550 --
NM_004232chr1822583 508 12829 ----
NM_004235chr91260 ------
NM_004264chr121157 ------
NM_004268chr113451 408 157 ------
NM_004272chr531530 614 161 ------
NM_004274chr1433025 2846 37 ------
NM_004277chr611053 1663 21404 470 --
NM_004293chr963816 3452 3190 2984 2705 2538 11213 42424 1413 243 142 --
NM_004296chr1483936 3917 3609 3111 2462 369 361 295 --11382 23682 272
NM_004302chr1232965 2734 649 --1155 --
NM_004308chr1161878 1764 1571 1418 206 166 --11777 --
NM_004311chr1042971 2840 2558 607 ------
NM_004316chr1241127 1109 954 270 ------
NM_004319chr152645 1989 497 474 371 ------
NM_004326chr111211 ----188
NM_004329chr10--1116 ----
NM_004330chr151162 2961 820 1911 --
NM_004338chr1896863 6724 6443 5716 4932 2716 2510 2286 751 26014 1017 ----
NM_004342chr732311 2224 1540 ------
NM_004349chr82965 918 1334 ----
NM_004359chr192473 197 136 ----
NM_004370chr632158 1412 596 ------
NM_004379chr231526 1503 486 --11391 11401
NM_004380chr1642118 1937 1728 312 --1858 --
NM_004384chr5135 --2923 103 --
NM_004385chr52688 490 ------
NM_004386chr1961899 1672 1630 1448 357 283 ------
NM_004389chr2------1877
NM_004392chr1342428 2002 677 410 22194 1682 ----
NM_004397chr1143772 3322 2913 2863 ----1646
NM_004405chr24844 676 150 51 ------
NM_004411chr72755 191 ------
NM_004416chr122959 293 ------
NM_004423chr382558 2488 2419 1716 1101 366 357 297 --12237 --
NM_004425chr1------170
NM_004429chrX----1407 --
NM_004430chr822189 373 ------
NM_004432chr942331 2253 1830 946 ------
NM_004437chr172909 2626 1371 1169 1160 237 180 --12293 --
NM_004438chr242943 2634 2438 418 32794 1222 531 12209 --
NM_004440chr6--11880 ----
NM_004441chr311219 --11231 --
NM_004442chr151071 646 479 101 21 --11500 --
NM_004444chr7165 1628 ----
NM_004446chr1137 ------
NM_004447chr1241175 442 420 232 --1327 --
NM_004449chr21138 1179 ----
NM_004450chr141308 ------
NM_004454chr332109 2046 1939 ------
NM_004457chr2--11147 2415 214 --
NM_004458chrX22159 1684 ------
NM_004459chr1721450 436 ------
NM_004464chr484199 3765 3035 1584 916 540 464 107 13479 1577 --
NM_004468chr12545 243 ------
NM_004480chr141233 --1629 --
NM_004481chr11270 --12336 --
NM_004482chr22338 330 --1843 1792
NM_004484chrX1311 ------
NM_004500chr1451911 1552 389 181 111 ----11538
NM_004501chr163778 3361 3050 3009 2799 2664 ------
NM_004504chr232649 2237 84 --12496 --
NM_004505chr1721814 1361 ------
NM_004516chr19196 ------
NM_004519chr8156 --160 --
NM_004528chr1292 29 ------
NM_004529chr921055 531 ------
NM_004540chr211725 --1567 --
NM_004543chr2136 ------
NM_004549chr1161260 1050 307 287 199 30 ------
NM_004560chr91336 ------
NM_004561chr1141681 644 189 161 ------
NM_004575chr441327 1041 628 75 ------
NM_004580chr1541805 1390 617 431 ------
NM_004586chrX73963 3955 1793 1497 1454 686 163 14458 14101 --
NM_004587chr20138 ------
NM_004588chr1153831 2958 1464 1144 77 --21574 1079 --
NM_004593chr31923 ------
NM_004598chr563010 2681 2454 2175 2083 1327 12711 12718 --
NM_004600chr131379 460 134 151 ----
NM_004612chr933897 597 84 11318 ----
NM_004620chr112547 482 ----1140
NM_004626chr111147 ------
NM_004630chr1111108 ------
NM_004631chr131297 1241 328 ------
NM_004634chr32483 60 --197 --
NM_004637chr33982 504 354 ------
NM_004642chr121128 ------
NM_004643chr141815 --1234 --
NM_004645chr172642 121 ----1763
NM_004650chrX41831 1207 572 450 1713 11200 11678
NM_004654chrY21405 396 1349 1132 --
NM_004655chr171366 1508 ----
NM_004660chrY3648 618 365 2917 596 --1333
NM_004663chr1521586 1207 1208 11267 --
NM_004664chr12----1227 --
NM_004673chr111109 --11175 --
NM_004677chrY2507 403 ------
NM_004686chr851175 671 387 232 217 21110 642 21704 258 --
NM_004687chr1721839 1461 ------
NM_004689chr141383 ------
NM_004690chr61531 ------
NM_004703chr1762417 2268 1752 582 131 47 --11919 --
NM_004717chr711492 ------
NM_004719chr1222455 786 ----22590 692
NM_004722chr71198 ------
NM_004726chrX65671 5577 4939 4476 1900 155 25461 4096 1643 --
NM_004729chrX32213 2070 69 ------
NM_004730chr542070 1566 663 586 ------
NM_004734chr1333244 2811 99 ------
NM_004736chr131411 708 162 1626 ----
NM_004737chr2231094 1030 294 1147 155 --
NM_004738chr2042250 1867 1040 634 ------
NM_004740chr17167 151 1274 --
NM_004741chr101564 11570 150 1327
NM_004744chr422492 152 --33581 3577 3419 1678
NM_004745chr8146689 6612 6595 6242 6096 5990 4840 4278 2767 2346 1675 797 236 111 11419 46463 6041 2383 2239 --
NM_004748chr1573284 1553 1334 945 773 579 414 22820 1276 23715 325 --
NM_004755chr143341 156 102 ------
NM_004757chr42485 94 ------
NM_004760chr752466 727 539 430 112 11615 1306 1503
NM_004768chr131095 337 142 ------
NM_004772chr541549 1205 334 306 --1498 --
NM_004774chr1762836 2816 2229 1228 1208 891 --32393 1110 375 --
NM_004775chr181904 11493 --1466
NM_004776chr2083296 3126 2681 2444 2423 1117 1009 172 --33037 905 705 --
NM_004779chr53402 279 48 --11195 --
NM_004781chr161749 1720 1653 1398 1097 511 ------
NM_004781chr161749 1720 1653 1398 1097 511 ------
NM_004788chr1132769 2294 1722 --1962 --
NM_004791chr134713 703 521 82 ------
NM_004796chr1441793 944 718 376 12010 ----
NM_004798chr2023137 1123 --22529 1320 --
NM_004801chr211175 ----11195
NM_004805chr251268 1084 538 290 169 ------
NM_004808chr1052920 2753 2145 2102 730 --42850 2757 2480 689 --
NM_004815chr174809 4664 4200 4050 1944 1493 200 11029 24700 3908 --
NM_004816chr92592 416 ------
NM_004822chr1733772 3194 1597 --13401 --
NM_004824chr63951 387 101 ------
NM_004831chr191914 ------
NM_004834chr273237 2557 1240 1192 1152 970 200 ------
NM_004840chrX41937 917 826 81 ------
NM_004842chr641729 1707 1423 1192 ------
NM_004850chr22280 128 --1620 --
NM_004856chr15----1566 --
NM_004857chr1484344 4118 3708 1550 1508 945 649 75 14701 23477 3416 --
NM_004859chr1752906 2882 2389 1202 647 --1235 --
NM_004860chr172561 37 ------
NM_004863chr1475222 4674 4478 1574 1530 588 405 --3762 445 227 --
NM_004866chr574732 4112 3661 3074 1862 1097 121 23522 1537 13350 --
NM_004867chrX197 1601 ----
NM_004869chr181122 ----11344
NM_004884chr1531749 1724 701 ------
NM_004893chr5174 ------
NM_004896chr1031253 1183 1006 ------
NM_004898chr462602 2515 2336 2075 878 726 ------
NM_004902chr201170 ------
NM_004904chr775990 5646 5288 1627 1327 770 436 45849 5662 1969 512 12065 11088
NM_004906chr6----1493 --
NM_004922chr103999 265 210 ------
NM_004924chr192815 788 ------
NM_004926chr1431650 521 253 ------
NM_004929chr82486 139 1531 ----
NM_004932chr531649 672 440 1587 ----
NM_004936chr942884 429 208 135 1742 ----
NM_004946chr53492 340 121 ------
NM_004947chr321738 158 ------
NM_004956chr754546 3051 1834 1556 883 11608 24522 4271 --
NM_004961chrX11220 1477 1188 --
NM_004968chr7127 1595 ----
NM_004976chr1154717 4127 630 602 172 --1922 --
NM_004978chr11490 11183 ----
NM_004985chr1243951 3660 3141 1147 14224 --11574
NM_004992chrX78269 5702 3084 2555 1892 1696 1260 27933 2240 15515 --
NM_004992chrX78269 5702 3084 2555 1892 1696 1260 27933 2240 15515 --
NM_004996chr1611727 ------
NM_004998chr152860 340 --2969 831 1710
NM_004999chr634440 3845 2825 1228 ----
NM_005006chr21931 1721 ----
NM_005009chr16----2296 104 --
NM_005011chr751870 1400 609 446 221 ------
NM_005012chr11136 ------
NM_005014chr93707 616 27 --1177 --
NM_005017chr31260 ------
NM_005023chr531188 409 131 11261 ----
NM_005028chr1042230 1528 821 94 --21793 161 --
NM_005052chr171348 ------
NM_005056chr1285583 5564 5039 4945 3911 1721 1144 1102 ------
NM_005057chr151699 1271 660 466 31 11860 1265 --
NM_005065chr1475128 3788 3779 1994 1968 1731 1197 --24324 4159 15185
NM_005067chr32818 742 ----1986
NM_005068chr641277 923 557 368 ------
NM_005070chr2--1221 ----
NM_005077chr91361 ------
NM_005079chr853157 2206 1196 1041 914 ----1265
NM_005093chr20105125 4768 3834 3305 1947 1909 1433 1391 1291 714 ------
NM_005094chr91456 --1156 --
NM_005095chr151700 1602 1467 616 545 ------
NM_005103chr11125 1267 ----
NM_005109chr331964 317 306 --1227 --
NM_005114chr43469 261 140 --1558 --
NM_005117chr11127 --1317 --
NM_005119chr121213 258 ------
NM_005121chr1721499 763 12918 --12499
NM_005124chr6----1253 --
NM_005133chr111376 ------
NM_005135chr1522577 1373 2435 73 ----
NM_005151chr1842287 1893 482 113 --12387 --
NM_005153chr161307 --162 --
NM_005154chr151198 ------
NM_005156chr964666 4565 4467 1898 607 486 --32075 1015 361 --
NM_005168chr231198 1099 137 ------
NM_005178chr19289 30 ------
NM_005181chr82781 83 1726 ----
NM_005182chr161457 ------
NM_005197chr14105631 5264 5111 3906 2447 1832 699 465 226 30 --24245 1617 15639
NM_005202chr132156 1640 629 11727 ----
NM_005203chr102344 70 ------
NM_005204chr101207 --1283 --
NM_005207chr2263568 2643 2450 937 602 298 --11336 22876 1312
NM_005215chr182622 242 ------
NM_005220chr1741476 1468 1454 571 ------
NM_005222chr74870 373 261 138 ------
NM_005227chr11544 --1449 --
NM_005229chrX21136 100 1162 ----
NM_005230chr12------130
NM_005233chr352105 1897 1710 909 798 12557 12424 --
NM_005235chr267776 7626 5814 5355 5201 4779 14956 47441 7019 2724 2172 --
NM_005238chr1143066 2965 745 380 --2873 110 --
NM_005241chr331394 1283 115 ------
NM_005242chr511323 --1313 --
NM_005249chr141868 ------
NM_005254chr1511180 ------
NM_005256chr113948 882 366 --2952 857 --
NM_005259chr2----11199 --
NM_005264chr101908 ------
NM_005271chr101984 31039 802 26 --1106
NM_005276chr1221720 122 ------
NM_005276chr1221720 122 ------
NM_005277chr421627 676 --1249 --
NM_005278chrX1127 1503 1158 --
NM_005302chr71429 ------
NM_005311chr752222 2106 1914 1868 466 --1794 --
NM_005316chr111337 ------
NM_005324chr1761748 786 698 573 453 127 11858 ----
NM_005328chr81252 1293 ----
NM_005329chr1632245 2104 930 ------
NM_005334chrX21624 123 11701 ----
NM_005336chr221491 1433 --12331 --
NM_005342chrX3980 890 271 195 11892 --
NM_005359chr18106150 4839 4508 2378 2150 1864 1845 898 409 87 ----14427
NM_005369chrX156 ------
NM_005374chr1772403 2193 2145 2043 1680 677 26 --11769 --
NM_005375chr61384 --11153 --
NM_005382chr81361 ------
NM_005384chr92106 84 ------
NM_005386chr202719 596 ------
NM_005387chr111242 ------
NM_005388chr941419 603 189 31 --11644 --
NM_005398chr1041460 1428 1000 903 --11026 --
NM_005399chr174064 4026 3995 2734 1212 565 455 --23087 1186 --
NM_005400chr222189 1240 12766 2721 227 --
NM_005402chr71651 --11518 --
NM_005406chr1841477 561 540 358 ------
NM_005407chr141210 ------
NM_005410chr51546 ------
NM_005418chr111574 ------
NM_005433chr1842712 2668 1125 679 ------
NM_005435chr72549 471 ------
NM_005436chr1053064 2768 1156 775 37 2422 128 12883 11309
NM_005442chr31599 ------
NM_005455chr11180 --11574 --
NM_005458chr952195 2173 1615 757 619 --11916 --
NM_005465chr141599 1572 1320 25 1253 ----
NM_005475chr1233048 1178 347 --12258 --
NM_005493chr63658 562 21 ------
NM_005497chr17115624 4840 4586 4239 4056 4008 3988 1682 1122 634 55 24891 1815 46062 4634 4558 698 14768
NM_005502chr993074 2239 2182 2145 1271 547 419 340 303 --12758 1424
NM_005504chr1276073 5939 5180 4250 2049 300 214 26378 5234 15836 --
NM_005506chr472897 2434 2049 2008 1105 437 379 --22572 1116 --
NM_005509chr53395 383 371 ------
NM_005511chr92900 425 ------
NM_005517chr131222 939 552 ------
NM_005520chr52297 234 ------
NM_005523chr72988 257 --11202 --
NM_005541chr241193 383 249 163 ------
NM_005542chr72667 181 ------
NM_005544chr2297 64 ------
NM_005552chr14----1598 --
NM_005566chr11127 ------
NM_005574chr11272 37 ------
NM_005575chr52216 21 ------
NM_005578chr364264 1856 1363 504 383 305 --34643 2001 264 --
NM_005585chr151316 ------
NM_005587chr151192 ----1869
NM_005591chr1122168 156 1880 1414 --
NM_005595chr13718 659 277 141 ----
NM_005596chr932178 320 258 15232 15064 22575 2228
NM_005598chr13658 326 55 --11149 --
NM_005599chr1--21131 144 ----
NM_005604chr6--11791 ----
NM_005607chr82662 103 ------
NM_005610chr1----1319 --
NM_005611chr1611235 ------
NM_005613chr151965 1763 1602 1484 632 11982 ----
NM_005625chr81148 --1721 --
NM_005627chr61868 ------
NM_005638chrX31765 653 124 ------
NM_005639chr122723 562 11597 11783 --
NM_005647chrX63427 3373 2741 2352 825 817 --13235 12468
NM_005651chr41289 ------
NM_005655chr821283 978 --11071 --
NM_005665chr154617 4461 3823 1618 566 ------
NM_005668chr594646 4357 3221 1748 1259 754 728 686 281 ------
NM_005669chr552398 2295 1904 1500 156 --1741 --
NM_005685chr7127 ------
NM_005688chr31148 ------
NM_005708chr132340 103 --157 --
NM_005709chr113431 278 26 1443 ----
NM_005711chr541018 706 389 254 ------
NM_005715chr622404 2303 11795 ----
NM_005717chr11398 ------
NM_005721chr2----11011 --
NM_005722chr21295 --171 --
NM_005724chr151156 ------
NM_005725chr131517 986 73 1155 ----
NM_005730chr1243634 3118 2995 2318 12894 ----
NM_005734chr11----1150 --
NM_005738chr731792 790 689 --21316 817 --
NM_005739chr1542298 2282 669 48 41792 932 539 495 1391 --
NM_005746chr742631 865 656 599 --11852 --
NM_005748chr1253455 3155 2645 2563 276 12267 13102 --
NM_005754chr52276 197 ------
NM_005756chrX1438 11369 195 --
NM_005759chr243931 3747 3706 3149 34285 3868 944 21089 601 --
NM_005760chr2137 ------
NM_005776chr141751 ------
NM_005779chr542492 1471 900 840 13621 1479 --
NM_005785chr12----11733 --
NM_005786chr181428 ------
NM_005788chr112584 144 ------
NM_005795chr242900 2422 338 24 --22732 622 --
NM_005797chr1121442 298 2250 201 ----
NM_005801chr171200 ------
NM_005808chr311079 --21409 681 --
NM_005813chr252657 2151 423 289 271 --11789 --
NM_005819chr173442 2832 2190 1040 346 315 89 1915 ----
NM_005822chr62525 442 12128 --1610
NM_005839chr12886 660 ------
NM_005840chrX87340 5234 5077 2910 2786 2143 836 641 --46763 5949 2075 1854 --
NM_005841chr421104 140 ------
NM_005843chr241929 1812 626 252 --1333 1287
NM_005852chr1711061 ------
NM_005853chr16------1569
NM_005859chr521378 526 ------
NM_005863chr103575 561 339 ------
NM_005868chr742534 1711 576 553 11529 21656 195 --
NM_005871chr10--1189 ----
NM_005875chr32278 129 ------
NM_005880chr1611257 ------
NM_005882chr41684 ------
NM_005893chr9141 ------
NM_005898chr1122521 1188 22366 2334 ----
NM_005899chr1721138 192 ------
NM_005900chr411231 --11142 --
NM_005901chr18108627 8194 7804 7639 6514 5740 3070 2461 2306 1869 37136 6355 2211 11481 --
NM_005904chr1831176 1063 326 ------
NM_005909chr533799 3152 2706 --13474 --
NM_005920chr152826 2812 1134 251 197 13864 22464 2460 --
NM_005930chr14144 --1669 --
NM_005933chr1192710 2606 2305 2209 2051 1868 716 531 152 ------
NM_005935chr494559 4444 4262 3855 3329 2102 1224 1207 1007 1697 --11493
NM_005938chrX1225 ------
NM_005941chr82835 175 13610 23819 2994 --
NM_005943chr621126 309 11176 ----
NM_005955chr195445 4652 3719 1917 1818 1423 1238 643 145 ------
NM_005962chr1032022 1973 567 --21709 40 --
NM_005962chr1032022 1973 567 --21709 40 --
NM_005964chr171490 ------
NM_005966chr252255 1768 1695 230 95 ------
NM_005977chr131933 ------
NM_005986chr1382801 2792 2219 1780 1052 474 371 168 --22856 1961 --
NM_005994chr172895 705 ------
NM_006000chr2------126
NM_006003chr19----1178 --
NM_006007chr963698 3544 3452 1761 1502 1134 --1713 --
NM_006011chr1574169 3516 2742 2650 619 482 31 ------
NM_006015chr12492 220 ------
NM_006016chr612047 --150 --
NM_006022chr136895 410 402 332 163 104 --1841 --
NM_006024chr71361 ------
NM_006030chr331862 629 105 11636 ----
NM_006036chr242336 924 160 55 ------
NM_006037chr2104851 4773 4673 4557 4368 4256 4139 4027 3550 468 --11182 --
NM_006038chr2052089 1956 737 352 159 ------
NM_006041chr17------1124
NM_006047chr2042577 2505 1407 466 --3596 354 165 --
NM_006055chr243044 2974 1271 404 11000 128 23207 2210
NM_006060chr763368 3009 1214 1025 822 71 24160 1101 23479 709 --
NM_006061chr61478 1313 1482 --
NM_006070chr31324 ------
NM_006076chr732408 2398 962 12061 ----
NM_006079chr64586 295 219 89 ------
NM_006080chr732502 268 234 --13002 12362
NM_006089chrX41803 1686 1328 1285 1449 ----
NM_006094chr821929 819 --1904 --
NM_006095chr474009 3391 3158 1499 1113 468 126 ------
NM_006106chr1123401 1071 ------
NM_006113chr152121 568 501 482 390 --1532 --
NM_006136chr71889 ------
NM_006139chr262834 2623 692 519 325 243 12677 12627 --
NM_006141chr1632632 2072 628 11822 1389 --
NM_006154chr1572430 1956 1894 635 611 547 506 12281 12410 --
NM_006156chr14163 ------
NM_006158chr8--11687 --1322
NM_006162chr1831571 1334 129 ------
NM_006164chr21189 ------
NM_006166chr1232202 1776 1615 ------
NM_006167chr822087 146 --1679 --
NM_006178chr173128 78 70 ------
NM_006180chr941593 1488 479 106 --1531 --
NM_006182chr12168 62 ------
NM_006191chr122719 622 ------
NM_006194chr1431352 158 134 ------
NM_006195chr93933 909 382 ----1915
NM_006197chr822259 648 ------
NM_006203chr575020 2173 1226 902 594 301 93 --14848 14078
NM_006206chr422813 2232 1748 1634 --
NM_006211chr81278 ------
NM_006224chr171138 --12416 --
NM_006226chr2155 --2883 407 --
NM_006237chr1362216 2155 2029 1794 385 133 ------
NM_006241chr31908 --11993 --
NM_006244chr114541 470 422 146 ------
NM_006245chr61355 ------
NM_006246chr141980 ------
NM_006251chr542929 2856 564 256 1690 ----
NM_006256chr142617 1919 182 33 12271 1861 --
NM_006258chr1041576 1536 1098 157 11064 ----
NM_006264chr41569 ------
NM_006265chr8------137
NM_006267chr221212 365 11870 1450 --
NM_006268chr111348 1995 21134 269 --
NM_006275chr2032233 1602 266 --12534 --
NM_006279chr13781 599 188 ------
NM_006281chr811196 --21060 190 --
NM_006281chr811196 --21060 190 --
NM_006283chr844932 3953 1600 1296 --23407 3329 --
NM_006298chr652750 1353 1091 963 650 ----23232 2960
NM_006306chrX44457 1770 1499 974 11310 41604 1370 533 529 1859
NM_006310chr1721149 151 ------
NM_006313chr1231679 1431 1376 ------
NM_006315chr454310 1043 791 664 146 --44445 971 648 348 --
NM_006317chr5----1819 --
NM_006320chr441041 731 89 49 1141 1186 --
NM_006321chr352242 1583 710 509 172 ------
NM_006325chr12--189 ----
NM_006329chr14135 ------
NM_006335chr11198 --1384 --
NM_006350chr51134 ------
NM_006352chr131510 1321 1285 1157 ----
NM_006357chr2149 ------
NM_006359chrX42411 1858 1776 316 11926 11010 --
NM_006361chr1732002 1689 731 ------
NM_006364chr1421317 353 --21021 306 1492
NM_006367chr13981 811 142 ------
NM_006372chr62531 53 ------
NM_006373chr1711344 --11270 --
NM_006375chrX21641 1441 --11928 --
NM_006378chr911084 ------
NM_006379chr71255 11625 1741 11580
NM_006380chr1773511 3026 2847 2822 1365 971 516 32988 2945 1216 13959 --
NM_006382chr172287 56 ------
NM_006386chr221869 1462 1175 --
NM_006392chr20195 ------
NM_006393chr1023798 610 --11526 13780
NM_006411chr62933 382 --1782 --
NM_006420chr2053026 2907 1355 1332 1304 ------
NM_006421chr83313 245 139 ------
NM_006422chr12170 ------
NM_006434chr1022862 542 ------
NM_006447chr212294 93 ------
NM_006449chr241381 860 452 259 12089 ----
NM_006451chr521036 727 ------
NM_006457chr453944 2888 1154 926 540 13011 ----
NM_006459chr1031597 242 97 ------
NM_006469chr121418 1243 --11173 --
NM_006472chr131206 1155 183 --167 --
NM_006482chr1252972 2680 2428 244 55 --1111 1339
NM_006489chr1431346 801 436 --22037 1790 1747
NM_006492chr11332 ------
NM_006496chr121440 319 11625 11873 --
NM_006497chr172525 156 ------
NM_006517chrX61980 1676 1471 1441 774 751 11448 --1169
NM_006519chr6188 ------
NM_006524chr74912 699 363 176 11095 --1850
NM_006526chr2031409 235 48 --11524 --
NM_006527chr41145 ------
NM_006534chr2021202 803 --11041 --
NM_006537chr15124 --1143 --
NM_006538chr274086 3975 3772 2987 1201 1184 1102 --11215 --
NM_006539chr162518 442 ------
NM_006540chr83244 236 41 ------
NM_006544chr1475777 5626 4517 2137 2037 767 155 --11303 --
NM_006546chr1766569 5832 5812 5557 5166 4969 --26323 5461 --
NM_006547chr742056 1947 1585 1412 1365 11405 --
NM_006548chr331269 671 639 ------
NM_006557chr911682 --11253 11235
NM_006561chr1085426 5184 4018 3839 1672 688 575 30 25900 585 25836 5534 --
NM_006565chr1611082 1953 ----
NM_006566chr183877 374 47 11217 1218 --
NM_006572chr1752620 2482 1331 923 185 12471 22924 2920 --
NM_006575chr1421311 421 11461 ----
NM_006582chr1----180 --
NM_006591chr114654 333 295 69 ----174
NM_006593chr21203 --2247 107 --
NM_006595chr111568 1690 1118 --
NM_006599chr16118250 7536 7419 7324 7231 5303 2296 2273 1430 1219 883 35067 2384 1396 37911 7262 1180 16593
NM_006601chr122912 435 1161 ----
NM_006603chrX11720 --11285 --
NM_006608chr1146 ------
NM_006609chr22446 51 11152 ----
NM_006614chr313235 1417 ----
NM_006618chr131325 476 415 11039 1367 --
NM_006620chr673793 1913 1577 1501 1480 845 807 --24468 1310 --
NM_006621chr171805 1636 1488 624 410 213 85 1139 ----
NM_006625chr11736 ------
NM_006625chr11736 ------
NM_006625chr11736 ------
NM_006628chr1594284 4003 3678 3505 3465 3362 1387 1375 1246 139 1704 24060 89
NM_006636chr21283 --3876 644 365 --
NM_006644chr13--1576 ----
NM_006646chr1331961 1057 307 13034 ----
NM_006648chr91126 ------
NM_006650chr521013 668 ------
NM_006654chr1274767 4628 3556 3332 3305 1886 652 --11011 --
NM_006658chr74838 457 315 89 ------
NM_006675chr1242592 2559 1132 953 --12395 --
NM_006682chr732388 1149 342 11076 ----
NM_006690chr2062029 1789 1775 1666 1488 88 ------
NM_006698chr203545 494 352 1279 ----
NM_006703chr61465 ------
NM_006704chr13138 ------
NM_006706chr52692 537 ------
NM_006717chr932760 2537 2314 ------
NM_006722chr341205 1129 250 67 13067 11025 --
NM_006727chr51119 ------
NM_006729chrX85546 5141 3974 3632 1608 1062 663 523 15108 35651 1448 1183 --
NM_006731chr995716 5024 4040 3778 1581 1138 736 369 157 14592 34795 3550 828 --
NM_006735chr71293 ------
NM_006736chr221254 579 --21345 54 --
NM_006754chr711116 1264 ----
NM_006756chr821489 1396 ------
NM_006761chr174846 751 731 608 ------
NM_006763chr121953 1779 ------
NM_006766chr842215 376 300 234 --12288 --
NM_006772chr621686 283 ------
NM_006775chr612085 ------
NM_006777chrX22240 231 ------
NM_006788chr1871794 1487 742 715 364 87 56 ------
NM_006791chr151406 ------
NM_006803chr831863 588 50 --1838 --
NM_006806chr21--284 57 ----
NM_006807chr1721136 1055 ------
NM_006808chr9----1187 --
NM_006815chr121108 --137 --
NM_006823chr81255 31261 1043 132 ----
NM_006826chr21416 ------
NM_006827chr1443044 2556 1338 1121 --13355 --
NM_006836chr121489 ------
NM_006838chr121331 ------
NM_006846chr5----1146 --
NM_006851chr1252817 2103 173 134 40 ------
NM_006852chr1732759 1904 170 --12328 --
NM_006854chr732024 1546 650 ------
NM_006856chr122795 727 ------
NM_006861chr1251561 1308 739 489 401 ------
NM_006870chr20192 --1629 --
NM_006872chr21118 ------
NM_006873chr273486 3456 3219 3090 2206 714 50 --12273 --
NM_006874chr42439 366 1274 2848 135 --
NM_006875chrX2637 264 ------
NM_006877chr63333 243 234 ------
NM_006885chr1654248 3329 1570 973 517 ----13295
NM_006888chr1432859 1106 61 ------
NM_006896chr72850 74 1454 162 --
NM_006901chr151362 --1479 --
NM_006908chr72500 218 --11370 --
NM_006913chr62376 355 1428 ----
NM_006915chrX32035 1781 1738 ------
NM_006920chr221523 1257 1222 ----
NM_006922chr242330 2159 2017 120 ------
NM_006924chr1764238 4079 3440 2703 1426 1329 13150 ----
NM_006930chr582034 2001 1898 1825 1662 1598 1441 121 --21928 572 --
NM_006931chr1262099 1722 1656 1332 432 368 ------
NM_006940chr1221837 358 ------
NM_006941chr223767 319 150 1814 --11080
NM_006947chr4--1507 11778 --
NM_006948chr2132350 1707 549 1366 ----
NM_006950chrX4893 877 129 67 ------
NM_006956chr751944 581 495 148 133 ------
NM_006962chrX2824 60 ------
NM_006965chr181142 ------
NM_006981chr9--1633 ----
NM_006997chr10196 ------
NM_007005chr92608 148 --2615 111 --
NM_007010chr1731550 1345 563 ------
NM_007011chr15176417 6230 6044 5397 5072 5035 4995 4957 4917 4878 4413 4250 2587 2458 2441 1864 431 11029 21210 665 --
NM_007017chr51755 191 ----
NM_007018chr9153 ------
NM_007023chr2--11105 ----
NM_007029chr8------1114
NM_007034chr11741 --1200 1850
NM_007038chr2175518 5320 4214 4001 2199 873 381 22354 2192 --15195
NM_007047chr652479 1858 1805 617 127 12459 1119 --
NM_007064chr32340 94 11068 ----
NM_007067chr17--11484 21390 504 --
NM_007080chr41120 ------
NM_007084chr1321179 404 ------
NM_007099chr22311 251 --1123 --
NM_007106chr1382708 2540 2450 915 828 788 600 184 12206 ----
NM_007107chr312240 ----1732
NM_007114chr322098 1190 --12309 --
NM_007118chr53586 197 24 --1816 --
NM_007124chr611777 --1675 --
NM_007125chrY----11447 --
NM_007146chr1722748 2163 1990 12404 --
NM_007166chr1121591 62 1989 ----
NM_007174chr1232198 1500 266 --12157 --
NM_007175chr832785 2264 361 12599 33096 3010 347 22790 1040
NM_007203chr963498 3344 2882 2595 2517 591 13986 22966 744 --
NM_007207chr12661 192 ------
NM_007212chr132200 2077 555 ------
NM_007214chr61500 ------
NM_007222chr821412 619 ------
NM_007235chr12180 ------
NM_007236chr1541545 1503 459 89 --22112 463 1226
NM_007246chr411028 ------
NM_007249chr13168325 7150 6317 6090 6050 5923 5711 3777 3533 3265 3238 2141 1818 1476 1053 1043 18630 13483 11076
NM_007260chr1----1310 --
NM_007270chr721051 966 --11522 --
NM_007275chr31447 ------
NM_007278chr17134 1347 ----
NM_007279chr19--1624 ----
NM_007282chr3------2659 186
NM_007285chr16--1411 ----
NM_007287chr342612 2252 2098 220 --21131 537 --
NM_007288chr342612 2252 2098 220 --21131 537 --
NM_007289chr342612 2252 2098 220 --21131 537 --
NM_007308chr43598 566 189 --1518 --
NM_007331chr452543 931 831 402 102 ----11021
NM_007345chr1831475 711 160 1308 ----
NM_007347chr1543084 2297 2032 81 11249 12149 --
NM_007350chr1253473 3420 3222 1694 76 ------
NM_007358chr1126 --11790 --
NM_007372chr171734 --1300 --
NM_007375chr152193 2100 634 549 60 ------
NM_012073chr531196 499 151 ------
NM_012074chr1421142 817 ------
NM_012081chr533593 2287 554 ------
NM_012096chr353597 3547 3433 2416 597 ------
NM_012102chr152474 1876 912 813 347 ------
NM_012104chr1153491 2365 1013 662 56 --12529 --
NM_012104chr1153491 2365 1013 662 56 --12529 --
NM_012105chr211925 --1149 1604
NM_012108chr43187 115 64 ------
NM_012117chr12147 ------
NM_012120chr642488 2276 1093 627 22838 920 12129 --
NM_012123chr61314 ------
NM_012124chr112675 600 ------
NM_012137chr132808 2129 971 12328 2946 283 --
NM_012141chr1333688 1089 844 132 11206 --
NM_012154chr82831 42 ------
NM_012156chr2073338 3016 2576 1111 1062 617 347 1892 ----
NM_012157chr31989 ------
NM_012164chr996373 5761 5049 4949 2574 2277 2240 1707 1252 27545 5749 37172 6106 591 --
NM_012174chr1252262 2250 1038 763 292 1612 11878 --
NM_012175chr113938 680 296 --1381 --
NM_012183chr12442 213 ------
NM_012193chr1194608 4517 4120 3997 1635 1299 1000 870 642 --23510 818 --
NM_012197chr921173 1147 ------
NM_012199chr1104425 4127 4119 3273 1135 942 665 330 314 23 --12972 --
NM_012215chr101143 --21271 168 --
NM_012216chrX----125 --
NM_012218chr1943051 2100 688 285 --33104 2882 39 --
NM_012223chr221327 296 ------
NM_012228chr102406 328 --165 11144
NM_012232chr1741665 1426 369 34 ------
NM_012234chr363580 2413 1434 1145 968 913 --11357 --
NM_012238chr101425 ------
NM_012242chr101225 ------
NM_012243chr11377 --1869 --
NM_012247chr10192 --1778 --
NM_012250chr112986 979 ------
NM_012255chr201152 ------
NM_012257chr72954 396 --1839 --
NM_012261chr201545 ------
NM_012262chr194935 4729 4105 3431 1632 1234 1077 655 397 14279 ----
NM_012264chr2251458 761 488 137 104 ------
NM_012264chr2251458 761 488 137 104 ------
NM_012266chr911081 --2928 53 --
NM_012281chr732169 581 438 1667 ----
NM_012286chrX1180 ------
NM_012288chr6105429 4926 4325 4172 4108 4092 3941 1839 902 251 ----11004
NM_012290chr241684 1416 1367 636 ------
NM_012294chr7103253 3128 2680 2646 2567 2497 1497 1428 858 126 11508 23009 750 --
NM_012297chr42465 186 ----1498
NM_012301chr731424 570 86 ------
NM_012302chr13848 793 491 1434 1787 --
NM_012304chr572503 1746 1607 648 293 149 31 12442 11663 --
NM_012307chr181786 ------
NM_012309chr1143026 481 293 184 14280 ----
NM_012311chr101451 --1455 --
NM_012316chr185411 2238 2169 1462 1286 854 750 198 14173 13700 --
NM_012322chr7----1293 --
NM_012323chr2251554 1235 601 562 409 ------
NM_012325chr2041264 259 155 38 --195 --
NM_012327chr181627 ------
NM_012328chr71103 2273 48 ----
NM_012329chr1731127 545 426 ----1400
NM_012333chr121249 117 ----1245
NM_012334chr5104534 4090 3559 3525 3498 3045 3003 1547 1505 1359 ----13906
NM_012343chr52944 277 ------
NM_012397chr1851751 1718 232 101 59 ------
NM_012410chr16149 ------
NM_012412chr71607 ------
NM_012416chr91362 --11138 --
NM_012417chr17----1593 --
NM_012419chr61619 --1235 --
NM_012421chr11372 ------
NM_012428chr1511016 ------
NM_012433chr2----1271 --
NM_012448chr1752140 1988 1877 248 103 ------
NM_012460chr14169 ------
NM_012463chr1241740 565 461 64 --11818 --
NM_012464chr422403 635 12019 12861 --
NM_012470chr72498 365 ------
NM_012471chrX21988 88 --11949 1753
NM_012477chr2--1185 ----
NM_012479chr732770 512 341 ------
NM_013229chr1252848 2153 943 644 418 11068 ----
NM_013231chr1484370 3754 3691 3529 2902 1731 1299 404 --24212 941 --
NM_013232chr52389 363 ------
NM_013233chr23265 182 100 ------
NM_013236chr223849 437 394 --3976 500 264 --
NM_013238chr1321702 390 --1715 --
NM_013243chr152460 303 ------
NM_013254chr12--1694 ----
NM_013255chr7128378 8225 7697 7035 6928 2605 2578 2360 2173 2124 444 265 --48114 6752 6011 3344 --
NM_013257chr841858 1714 611 103 --12304 --
NM_013261chr433767 3019 2825 --11272 --
NM_013262chr621405 160 ------
NM_013279chr113877 846 114 ------
NM_013281chr201412 ------
NM_013283chr51721 ------
NM_013302chr1664068 4027 3859 3114 1897 360 24345 689 13902 11420
NM_013309chr1522659 1894 11946 ----
NM_013316chr72835 737 ------
NM_013322chr72276 95 21470 1257 ----
NM_013341chr252660 2619 2145 944 782 1191 12837 --
NM_013372chr1573025 2367 2295 1358 1063 288 79 --1559 --
NM_013374chr362828 2794 2048 951 550 338 1517 31984 1139 922 --
NM_013381chr1222118 1514 --1618 --
NM_013390chr931383 1110 253 11520 1572 --
NM_013410chr111074 --1494 --
NM_013411chr152721 2629 2134 1786 614 ------
NM_013423chrX51175 1017 425 381 159 ------
NM_013427chrX51175 1017 425 381 159 ------
NM_013436chr2----2207 198 --
NM_013444chrX31055 316 176 ------
NM_013446chr731370 1089 1034 --1322 --
NM_013449chr1252999 2557 2271 2151 543 ------
NM_013450chr2--11247 ----
NM_013943chr143007 1205 1107 267 13328 21209 319 --
NM_013951chr242496 2441 1720 897 ------
NM_013956chr8125 ------
NM_013957chr8125 ------
NM_013960chr81701 ------
NM_013964chr8125 ------
NM_013989chr1473985 3299 3248 1322 737 340 99 1163 --14793
NM_013999chr1711358 --11515 --
NM_014007chr91440 ----1358
NM_014011chr23636 531 319 --12543 --
NM_014016chr321547 1420 ------
NM_014021chr133431 2594 1353 13022 ----
NM_014023chr1062146 1840 948 877 244 26 ------
NM_014028chr62955 626 22536 324 ----
NM_014030chr17141 ------
NM_014033chr1252338 1614 823 543 205 1328 ----
NM_014034chr621487 989 ------
NM_014039chr1131091 1028 275 1253 11160 --
NM_014048chr1674962 4107 4019 3802 3642 1662 246 24762 1184 ----
NM_014053chr1----1115 --
NM_014057chr981539 1519 1449 1118 1008 536 448 108 --11453 --
NM_014060chrX1111 ------
NM_014089chr131525 ----1289
NM_014106chr1561981 1017 807 640 599 309 11111 ----
NM_014109chr821175 483 --1393 --
NM_014112chr8105426 5251 5239 4621 4417 3344 3326 1865 876 534 ------
NM_014117chr1631880 1082 103 --1645 --
NM_014141chr755230 4595 3890 2114 1324 --24457 4389 --
NM_014154chr341120 1034 630 540 ------
NM_014155chr1176947 2806 2341 2235 1708 1318 1276 27559 1446 1685 --
NM_014171chr2178 --1136 --
NM_014181chr242319 1081 831 124 1900 11043 12138
NM_014182chr122504 308 ------
NM_014189chr431519 1407 464 ------
NM_014190chr431871 1759 1185 ------
NM_014191chr123769 205 41 ------
NM_014223chr12767 496 ------
NM_014232chr1721381 418 ------
NM_014232chr1721381 418 ------
NM_014239chr141326 ------
NM_014240chr383689 3329 3287 3070 2767 2607 1146 679 ------
NM_014243chr42147 110 --1191 --
NM_014253chrX52462 1918 1880 815 380 ------
NM_014263chr1041254 1235 503 90 1170 ----
NM_014264chr41579 --1592 2246 182
NM_014267chr112841 271 1816 ----
NM_014268chr1821384 574 --1920 --
NM_014271chrX1604 ------
NM_014280chr12592 299 --166 --
NM_014283chr1----1569 --
NM_014289chrX71376 1125 1096 961 551 105 80 11427 11100 --
NM_014296chr331195 1040 35 ------
NM_014299chr1932080 1781 596 11864 11928 --
NM_014300chr151326 ------
NM_014309chr2254664 4416 1753 1278 1035 2727 154 ----
NM_014313chr131045 631 63 1464 ----
NM_014316chr1621987 1919 ------
NM_014319chr12----11207 --
NM_014331chr4107248 5030 4996 2657 2604 2470 2370 1761 837 534 36368 828 807 --12796
NM_014332chrX--164 ----
NM_014333chr1142240 2223 1017 768 11025 ----
NM_014342chr1121196 175 --11213 --
NM_014344chr112358 200 --1617 --
NM_014345chr62702 311 --1903 --
NM_014351chr2261079 988 573 487 337 28 ------
NM_014352chr1141516 1124 350 298 ------
NM_014361chr111135 ------
NM_014382chr3--1395 ----
NM_014391chr10136 ------
NM_014392chr431597 1051 407 --1103 --
NM_014393chr871686 957 655 262 168 108 75 11719 ----
NM_014397chr92991 48 --11307 --
NM_014400chr19--1462 ----
NM_014408chr11530 ------
NM_014415chr321553 51 ----1542
NM_014418chr1462036 1901 1740 673 460 337 ----11755
NM_014423chr534871 4624 4309 13833 14211 14196
NM_014431chr1041216 433 316 254 11405 1243 --
NM_014445chr332437 1909 1842 1729 155 --
NM_014469chr112657 565 1782 ----
NM_014472chr101172 ------
NM_014473chr52455 427 1392 ----
NM_014487chr41704 ------
NM_014491chr7------1141
NM_014494chr1642068 1791 734 255 12177 ----
NM_014497chr2------125
NM_014498chr31293 ------
NM_014504chr721660 775 155 1288 --
NM_014507chr221918 ------
NM_014515chr121796 1172 1966 --
NM_014517chr331407 1228 168 --1357 --
NM_014554chr1252231 1814 302 258 145 21938 380 ----
NM_014572chr1361705 1170 702 374 218 125 21676 297 129 --
NM_014574chr141977 1167 ----
NM_014588chr202299 49 ------
NM_014600chr2--11634 2409 309 --
NM_014607chr231999 1743 455 ----11347
NM_014612chr931536 1446 1415 --11068 --
NM_014614chr231276 1153 1026 ----1319
NM_014615chr1652815 629 441 164 81 13320 22541 1421 --
NM_014630chr1552819 2447 1406 1252 863 ------
NM_014636chr953336 2705 1661 1014 111 14334 22941 212 --
NM_014647chr161417 --11874 --
NM_014655chr141737 1611 733 233 1358 12310 --
NM_014659chr153448 337 121 1158 1217 --
NM_014660chr7----1411 --
NM_014667chr332265 1699 247 --2985 943 1888
NM_014670chr221654 313 ----11570
NM_014674chr353822 1342 967 858 332 --22976 2972 --
NM_014676chr15453 406 302 42 27 11278 ----
NM_014677chr811021 ------
NM_014682chr841922 1583 645 550 ------
NM_014683chr1741815 1485 705 413 --11527 --
NM_014686chr1932159 1937 990 ------
NM_014690chr742158 1935 950 423 --12411 --
NM_014693chr32517 312 --1217 --
NM_014701chr1552884 827 728 642 292 --23171 3006 11191
NM_014702chr643180 3162 3111 596 1208 ----
NM_014705chr731306 278 226 1646 197 --
NM_014706chr1241115 806 439 32 ------
NM_014709chr21243 ------
NM_014711chr162488 434 12088 ----
NM_014720chr1011216 --11140 --
NM_014726chr1711418 --161 --
NM_014729chr842108 1994 652 491 --11555 --
NM_014730chr1265274 4225 3555 798 293 171 ------
NM_014730chr1265274 4225 3555 798 293 171 ------
NM_014731chr2051611 1603 1345 1286 401 ------
NM_014735chrX21362 631 --1560 1504
NM_014737chr2074226 4137 4117 3362 1652 887 207 ------
NM_014739chr634243 3794 3044 --12937 --
NM_014743chr473061 2821 2536 2469 2082 983 573 1350 ----
NM_014746chr284073 3684 3183 3055 2658 1613 1141 957 22692 82 ----
NM_014751chr831884 875 379 ------
NM_014755chr254266 4198 3573 3215 646 ------
NM_014759chr821119 441 ------
NM_014764chr12--21059 1027 1970 --
NM_014766chr742493 1074 1057 681 148 1719 --
NM_014767chr1043123 3070 2725 346 ------
NM_014770chr1241129 512 173 86 ------
NM_014774chr152989 2935 777 361 69 --12341 12415
NM_014776chr1242901 1942 1257 960 --1844 13060
NM_014781chr82125 62 ------
NM_014784chr12912 274 ------
NM_014787chr151990 1803 1040 146 130 1777 12146 --
NM_014790chr51143 ------
NM_014791chr9----1264 --
NM_014795chr21989 ------
NM_014810chr163148 3120 3085 2631 765 297 --1769 --
NM_014812chr1------1472
NM_014819chr531709 1002 812 1447 11697 --
NM_014820chr322081 1372 11331 ----
NM_014822chr41104 ------
NM_014826chr193382 2939 1690 943 891 696 58 47 27 2435 366 ----
NM_014828chr1432306 983 941 --1651 --
NM_014829chr532062 1791 946 --22034 348 1406
NM_014830chr1293685 2667 2602 1473 1264 1120 739 399 369 --13124 --
NM_014832chr1321399 469 ------
NM_014835chr2041963 1461 211 180 ------
NM_014836chr1041414 1234 215 175 --1779 --
NM_014838chr2231772 1086 135 12597 32224 1912 1127 --
NM_014840chr1243301 2745 127 65 --33305 2718 2657 --
NM_014841chr61476 --1116 --
NM_014844chr1453496 2744 1101 967 802 12634 1136 --
NM_014850chr374144 4107 3033 1716 1562 167 42 ------
NM_014860chr242286 2095 942 696 --1649 --
NM_014864chr1104224 4062 3241 2707 1753 1248 1205 1087 455 237 ------
NM_014873chr163929 3372 1953 1272 1230 682 13407 13173 --
NM_014876chr223642 599 355 ------
NM_014877chr17107709 6797 5974 5932 5588 3002 2549 2537 2448 124 1869 ----
NM_014883chr441868 971 804 330 ------
NM_014887chr131854 ------
NM_014892chr6187 ------
NM_014897chr1753202 2533 1156 1096 178 ------
NM_014898chr1962446 2097 1868 1826 609 103 ------
NM_014900chr231067 298 31 11118 ----
NM_014903chr122821 486 170 ----
NM_014904chr1043442 3378 2829 1439 13124 23446 255 11115
NM_014905chr241541 1510 464 32 ------
NM_014906chr1754029 3883 2938 1607 196 21452 1430 23449 2887 --
NM_014909chr1483925 3907 3715 3526 3399 2896 2668 158 ------
NM_014912chr102438 236 --23065 976 --
NM_014917chr11853 ------
NM_014918chr1541541 1324 650 608 11604 ----
NM_014920chr672837 2801 2782 1443 1259 1054 854 1494 1620 --
NM_014921chr1921248 865 ------
NM_014923chr1331953 620 477 --1914 --
NM_014924chr1433045 2505 1119 12764 ----
NM_014926chr32786 769 ------
NM_014932chr331989 774 235 11778 --189
NM_014933chr41148 190 ----
NM_014935chr142776 2402 568 235 1289 ----
NM_014936chr632041 1109 929 ------
NM_014938chr1222178 226 --22408 2164 --
NM_014939chr181616 --11347 --
NM_014942chr621940 1745 12169 --11717
NM_014945chr531885 1475 172 ------
NM_014946chr211228 --12719 --
NM_014947chr12983 793 --1164 --
NM_014949chr11732 1422 ----
NM_014961chr41502 1555 ----
NM_014962chr2032150 2011 810 ----12142
NM_014977chr141214 ------
NM_014982chr1475276 4888 3700 1991 1289 1031 705 --11751 --
NM_014988chr442112 960 581 29 12562 ----
NM_014989chr621895 338 1668 ----
NM_014990chr1411159 1518 ----
NM_014991chr462480 2462 538 338 321 293 ------
NM_014992chr142282 265 135 ----
NM_014994chr152674 194 ------
NM_014996chr32965 419 --1976 --
NM_014997chr752834 2793 702 236 174 22733 2614 12854 --
NM_014999chr1231246 304 262 11581 11349 --
NM_015000chr1252242 2214 2126 738 663 --1562 --
NM_015002chr1221761 783 --1333 --
NM_015008chr373187 3061 2767 2724 2564 550 71 13145 13507 --
NM_015009chr31752 1193 ----
NM_015020chr1643728 3645 3345 2696 --11491 13814
NM_015023chr161771 1389 1234 1162 650 608 ------
NM_015024chr821306 1039 ----1177
NM_015025chr262707 1942 1719 1674 1015 68 ------
NM_015026chr12103613 3067 1297 1214 1097 875 847 659 136 87 --13093 --
NM_015027chr1651978 1453 740 256 115 ------
NM_015032chr1322691 135 ------
NM_015040chr232299 1085 929 --23443 744 --
NM_015042chr1583941 3873 3713 2808 2698 1458 1085 638 ------
NM_015044chr1663000 2881 2540 2325 2090 728 --12290 --
NM_015045chr101472 ------
NM_015050chr61189 1945 2519 364 --
NM_015051chr943230 2752 408 299 ------
NM_015057chr131127 1646 ----
NM_015064chr1293415 2943 2483 2322 1410 1041 918 534 487 --23291 152 --
NM_015068chr753935 2654 1164 561 239 11108 13594 --
NM_015070chr1311489 11096 1635 --
NM_015071chr595853 5406 4913 4577 2484 1757 1242 1086 160 --46044 5590 1442 296 12436
NM_015074chr1124575 4231 3856 3692 3475 1967 1723 1524 1089 1018 60 24 --13646 --
NM_015075chrX42076 1825 836 773 ------
NM_015076chr663605 2807 1739 1686 1385 109 11711 14000 --
NM_015077chr1774452 3680 3329 1777 1652 856 506 ------
NM_015082chr542529 2192 1736 363 22464 901 3585 555 111 --
NM_015085chr1723516 1360 --22662 1028 --
NM_015087chr1352367 2182 1031 1015 583 --22063 1995 12072
NM_015091chr141275 ------
NM_015092chr1664407 3575 1528 668 240 116 --44411 3971 718 611 --
NM_015094chr2294622 4370 4220 3544 2908 1298 1129 511 292 --13692 --
NM_015097chr321668 1587 --2839 746 1101
NM_015100chr131258 502 147 --1231 --
NM_015101chr122281 1954 22492 278 11897 --
NM_015102chr12351 101 ------
NM_015107chrX32217 629 132 1187 ----
NM_015113chr1731787 1733 70 ------
NM_015115chr42467 242 ------
NM_015125chr191561 ------
NM_015129chrX51767 1680 1445 326 134 --1244 --
NM_015132chr751540 1526 1271 770 156 ------
NM_015137chr852246 2142 1902 701 262 ----12479
NM_015138chr1532587 1957 1130 1758 --1739
NM_015141chr372403 2186 1075 580 564 384 229 --1942 --
NM_015143chr42241 37 11094 ----
NM_015144chr1663535 1240 1008 748 321 210 --12861 --
NM_015153chr6----1557 --
NM_015155chr1053202 2392 2121 1036 671 --11044 --
NM_015156chr1473187 3119 3106 3042 2790 2553 569 ------
NM_015158chr94533 330 303 102 ------
NM_015161chr1641435 502 145 114 ----1228
NM_015162chr152424 389 --1442 --
NM_015163chr1471867 1677 1559 1447 1426 1330 1245 --2578 356 --
NM_015170chr831942 774 308 ------
NM_015176chr12606 382 --1694 --
NM_015180chr14--1888 ----
NM_015184chr3------182
NM_015185chrX22317 2206 12217 1396 --
NM_015191chr1142668 1750 1711 418 --12099 --
NM_015192chr2022942 2209 ------
NM_015198chr73972 836 303 --21234 403 --
NM_015199chr322922 77 --12341 --
NM_015200chr462311 1603 1030 715 104 74 ------
NM_015208chr1833195 1006 88 --1863 --
NM_015213chr11141 --1116 --
NM_015215chr172132 2005 1090 817 710 554 545 ------
NM_015216chr5182 --11508 --
NM_015231chr114799 318 311 243 ------
NM_015233chr1341042 796 577 274 12166 ----
NM_015236chr42495 482 21469 989 21270 287 --
NM_015247chr1675317 5181 5118 4856 3840 1404 982 --14410 13395
NM_015250chr9------11486
NM_015252chr22801 341 --173 --
NM_015256chr52688 502 ------
NM_015264chr2274538 4266 3907 3553 1401 979 950 14681 1906 --
NM_015265chr222325 1879 ------
NM_015267chr121276 1809 159 --
NM_015268chr33517 483 84 ------
NM_015271chr431641 672 456 --12849 13392
NM_015275chr1252119 2061 1899 734 584 ------
NM_015277chr182468 358 ------
NM_015282chr262966 2267 2248 2154 2127 163 12628 ----
NM_015284chr131317 762 409 --1726 --
NM_015285chr1822340 1792 ------
NM_015286chr1532173 1585 869 --12375 --
NM_015288chr543804 3313 2808 2479 --22784 503 --
NM_015294chr1741117 1079 896 271 1736 ----
NM_015299chr1473921 3404 3296 2741 1391 725 86 1792 ----
NM_015308chr112694 151 ------
NM_015310chr8148156 7172 7079 6977 6572 5512 3045 2708 1948 1827 1211 904 829 481 13006 27735 5292 --
NM_015315chr533222 2516 1184 ------
NM_015316chr1441057 441 333 112 11161 11238 --
NM_015317chr252785 2224 697 548 379 --12483 --
NM_015327chr12318 103 ------
NM_015328chr743016 979 331 118 22502 2038 ----
NM_015335chr121655 11007 ----
NM_015336chr1232596 651 249 ------
NM_015339chr203350 241 81 ------
NM_015344chr831541 134 56 ------
NM_015345chr642767 2332 2225 737 1765 ----
NM_015346chr1421468 1327 --11743 --
NM_015347chr1232173 1985 800 --12693 --
NM_015349chr642895 2498 2460 2133 --22836 253 1396
NM_015355chr172733 162 ------
NM_015361chr21649 ------
NM_015365chrX2992 593 --21413 560 --
NM_015375chr1103743 3557 3497 3370 707 640 378 316 199 24 ----186
NM_015382chr142687 306 ------
NM_015385chr1022862 542 ------
NM_015387chr241911 716 197 182 12019 11915 12039
NM_015393chr433592 1497 1138 11145 ----
NM_015396chr3170 ------
NM_015397chr93558 337 330 ------
NM_015429chr311069 --1974 --
NM_015435chr81542 --11190 --
NM_015436chr442467 1333 1085 426 13054 1912 13179
NM_015443chr17----1299 131
NM_015446chr161704 1661 1316 1027 338 329 ------
NM_015449chr11508 1586 ----
NM_015455chr573986 3738 3462 3383 3168 1516 1145 11646 33031 1639 33 --
NM_015458chr8105162 4765 4750 4687 4517 3469 1755 1254 563 77 --24208 1614 25121 169
NM_015463chr21781 ------
NM_015464chr72260 95 ----129
NM_015475chr23989 368 176 ------
NM_015477chr1531042 104 65 ------
NM_015484chr12761 119 ------
NM_015488chr241435 1306 687 370 ------
NM_015493chr1972175 1421 724 690 671 635 96 ------
NM_015508chr321031 259 --31044 422 187 --
NM_015514chr142417 173 1582 ----
NM_015520chr322540 1774 --12544 --
NM_015525chr6----11068 --
NM_015526chr1931440 1425 1098 ------
NM_015528chr171171 ------
NM_015534chr13836 771 111 ------
NM_015535chr283725 3683 3142 2946 1658 1630 948 28 ----1253
NM_015541chr331281 135 92 ------
NM_015542chr101285 ------
NM_015548chr61959 --21005 707 --
NM_015553chr655047 4105 3426 257 177 11495 21148 617 --
NM_015554chr1542650 2450 347 244 ------
NM_015557chr122855 36 --13179 --
NM_015564chr553508 2647 1204 240 200 1691 ----
NM_015568chr2064003 3363 3126 1512 604 244 23320 482 22651 914 --
NM_015569chr184330 4104 3918 1522 1295 1107 797 624 24418 339 34060 1369 922 --
NM_015571chr62901 222 188 22651 2055 --
NM_015575chr262864 2328 2319 2312 1310 283 13337 176 --
NM_015576chr352462 1977 472 170 114 --1963 --
NM_015601chr101108 ------
NM_015609chr122890 398 2911 365 1118 1615
NM_015610chr7102767 2502 2418 2346 2297 2005 1080 779 287 183 --1721 --
NM_015627chr111265 ------
NM_015634chr101180 1559 ----
NM_015640chr174720 2155 2071 576 453 353 122 1691 11853 --
NM_015645chr11132 ------
NM_015657chr2----1662 --
NM_015660chr72266 224 ----130
NM_015678chr1341462 1079 573 542 --11312 --
NM_015680chr22469 89 --1167 --
NM_015686chrX42169 1779 346 207 ------
NM_015691chrX52787 2273 2077 1936 658 --2548 332 --
NM_015695chr641900 614 452 236 ------
NM_015716chr172639 118 ------
NM_015723chr71240 --1730 --
NM_015832chr181158 ------
NM_015845chr182251 203 ------
NM_015852chr762970 2539 2291 1188 1107 789 6940 604 520 436 352 100 --1688
NM_015859chr141173 ------
NM_015866chr111182 --1426 --
NM_015878chr811425 --11374 --
NM_015879chr18168585 8193 7975 7684 7258 6340 5259 2985 2827 2496 1699 1622 1537 1347 495 303 12130 ----
NM_015885chr112614 270 ------
NM_015886chr884694 3888 2169 1784 1487 798 685 275 1721 15151 --
NM_015892chr1042201 556 415 87 --1521 --
NM_015902chr81616 --1319 --
NM_015904chr22225 169 ------
NM_015906chr194463 4211 3413 3090 1874 1231 964 614 545 44516 4473 3313 1054 ----
NM_015912chr832314 1729 324 ------
NM_015913chr12140 110 ------
NM_015955chr2------1175
NM_015957chr111356 ------
NM_015974chr13133 ------
NM_015984chr11546 ------
NM_015987chr12----126 --
NM_015994chr144696 221 109 55 ------
NM_015995chr1533591 443 304 24932 4366 ----
NM_015999chr11277 ------
NM_016002chr11216 1710 ----
NM_016003chr7102767 2502 2418 2346 2297 2005 1080 779 287 183 --1721 --
NM_016009chr164800 4573 4567 4448 3077 1551 33337 908 241 21648 367 --
NM_016018chr842786 1852 609 579 1677 1113 --
NM_016021chr643053 2796 2413 503 1221 22814 2001 --
NM_016022chr12759 309 ------
NM_016023chr8----12102 --
NM_016025chr1641958 1890 1275 721 11230 31742 1313 306 --
NM_016032chrX31116 911 341 ------
NM_016040chr142621 2365 1111 152 12303 11051 1681
NM_016041chr171391 ------
NM_016059chr6------1250
NM_016061chr23421 62 42 ------
NM_016070chr17132 --144 --
NM_016072chr1231711 1593 815 --125 --
NM_016073chr1511009 ------
NM_016076chr133162 2243 1076 --32820 1049 717 --
NM_016083chr622874 2788 1349 12607 22704 2675
NM_016087chr751256 698 546 453 229 --11669 --
NM_016090chr11----1428 --
NM_016096chr821696 1484 --2288 130 --
NM_016099chr821192 266 --21315 144 --
NM_016103chr5143 ------
NM_016107chr521233 329 ------
NM_016125chr171142 ------
NM_016129chr4--162 ----
NM_016131chr241798 1711 1504 955 12299 1470 --
NM_016132chr1543251 2864 1344 1018 23023 2812 13255 --
NM_016133chr21471 ------
NM_016144chr5--146 1653 --
NM_016152chr341204 1144 175 164 ------
NM_016166chr15187 ------
NM_016169chr1032279 2245 1083 11047 13231 --
NM_016172chr92397 88 ------
NM_016201chr32589 504 1432 1121 --
NM_016206chr337841 7457 7301 13279 26276 2210 11922
NM_016211chr41148 190 ----
NM_016216chr32101 58 --2585 560 --
NM_016221chr552212 1568 819 613 228 21701 352 ----
NM_016227chr1----1569 --
NM_016231chr171262 1576 11583 --
NM_016248chr1353860 3449 2975 1566 1347 --13481 --
NM_016252chr21927 ------
NM_016255chr683217 2784 2702 2316 1163 959 764 410 ------
NM_016257chr173198 3081 2196 2170 2160 1240 1203 12598 11073 --
NM_016258chr1199 ------
NM_016260chr287037 6649 6335 5866 5370 746 317 66 21884 1057 35386 2157 1871 --
NM_016263chr1943073 2863 783 322 1154 ----
NM_016269chr4125 ------
NM_016272chr223186 118 112 ------
NM_016275chr332769 930 910 1917 ----
NM_016277chr631377 1046 1023 --1611 --
NM_016281chr1271027 750 238 164 128 122 106 ----1364
NM_016284chr16145 1781 ----
NM_016287chr141411 1364 786 643 1576 ----
NM_016289chr231931 1919 794 11567 ----
NM_016300chr3----197 --
NM_016303chrX1145 ------
NM_016308chr131662 1287 220 --11435 --
NM_016320chr11139 ------
NM_016322chr992997 2565 2529 2426 1055 344 94 75 26 --13146 --
NM_016328chr7127 ------
NM_016334chr1------1406
NM_016338chr521032 847 1231 ----
NM_016340chr5197 ------
NM_016352chr741163 1143 930 319 --11101 --
NM_016356chr632602 1803 768 --32682 2537 190 --
NM_016374chr121079 275 --1340 --
NM_016374chr121079 275 --1340 --
NM_016376chr1793377 3348 2953 2752 1181 911 706 221 62 1210 14325 --
NM_016377chr641729 1707 1423 1192 ------
NM_016382chr1----11040 --
NM_016396chr1542624 889 881 422 ------
NM_016422chr111771 --12513 12746
NM_016424chr1731351 709 54 ------
NM_016436chr2082163 2006 834 681 551 485 282 21 ------
NM_016441chr231480 851 134 ------
NM_016442chr512110 1677 ----
NM_016448chr131789 1620 274 1496 ----
NM_016451chr11153 ------
NM_016472chr142511 229 --21527 503 --
NM_016475chr1441148 931 381 161 --11117 --
NM_016485chr6----1894 --
NM_016494chr2--160 ----
NM_016507chr1783061 2000 849 843 835 641 167 145 --1317 --
NM_016513chr672837 2801 2782 1443 1259 1054 854 1494 1620 --
NM_016519chr42554 487 ------
NM_016530chr1563759 3605 2919 929 713 339 12828 13366 --
NM_016531chr444046 3829 3272 39 13600 13868 --
NM_016542chrX21581 1092 ------
NM_016544chr283450 1587 1559 1058 357 299 259 98 --33148 3072 593 11532
NM_016548chr951551 1413 1081 1019 453 ------
NM_016577chr324375 3577 --11406 --
NM_016582chr11131 ------
NM_016588chr62714 121 --141 --
NM_016591chr51216 ------
NM_016603chr531368 661 114 1365 ----
NM_016604chr531257 313 44 ------
NM_016605chr532581 1056 144 1326 ----
NM_016607chrX21556 222 --1470 --
NM_016612chr82663 161 ------
NM_016620chr141420 960 505 239 1934 ----
NM_016623chr8193 ------
NM_016625chr31125 ------
NM_016631chr212729 668 --1346 --
NM_016641chr1651417 1334 1253 1173 107 ------
NM_016645chr151335 ------
NM_016651chr141847 ----1800
NM_016654chr1511180 ------
NM_016821chr31449 --1507 --
NM_016824chr104549 367 258 174 11571 ----
NM_016829chr33808 245 135 ------
NM_016831chr152279 1987 1785 351 176 ------
NM_016930chr421037 45 ------
NM_016936chr1642096 1864 1461 554 --177 --
NM_016946chr133177 718 41 --12628 --
NM_016953chr275863 5585 4222 2091 1620 1576 224 24520 3879 26009 316 --
NM_017412chr8187 --1282 --
NM_017420chr1432509 742 203 11121 ----
NM_017423chr422185 1510 --1763 --
NM_017426chr42467 46 ------
NM_017431chr21702 ------
NM_017439chr7158 150 ----
NM_017440chr12160 ------
NM_017449chr151071 646 479 101 21 --11500 --
NM_017455chr1511016 ------
NM_017457chr191124 ------
NM_017483chr221015 935 ------
NM_017519chr6------1129
NM_017522chr131297 1241 328 ------
NM_017545chr201445 ------
NM_017551chr1032204 2172 94 --1408 --
NM_017559chr17--1276 ----
NM_017563chr3115708 5238 4897 4836 3988 3862 2531 2174 1289 636 492 11216 41963 1752 1473 937 --
NM_017569chr13--1263 ----
NM_017577chr341225 671 316 196 11068 ----
NM_017582chr141732 474 211 103 11355 ----
NM_017583chr1141433 1400 1256 179 --1294 11781
NM_017593chr41501 ------
NM_017602chrX3383 172 135 ------
NM_017610chr1541837 1606 81 35 ------
NM_017612chr121191 1168 ----
NM_017628chr484394 4151 3617 3238 2117 923 633 101 14777 13767 --
NM_017629chr141730 1360 1226 752 11928 ----
NM_017633chr653341 3198 2686 2407 425 ------
NM_017634chr851655 1358 740 721 633 --21700 210 --
NM_017635chr1141609 1083 615 110 ------
NM_017637chr9108900 8640 8191 8093 7954 7575 7491 2805 520 206 19013 43430 2065 1305 921 --
NM_017640chr6----1878 --
NM_017641chr121238 --1371 182
NM_017643chr1722149 1987 ----13111
NM_017644chr343390 1674 879 329 11072 25111 4878 --
NM_017645chr932488 2269 973 21117 374 ----
NM_017650chr775934 5645 5181 4042 2106 986 269 --14256 --
NM_017657chr21341 ------
NM_017658chr1434027 3795 3430 --23830 1476 --
NM_017661chr1531229 263 168 ------
NM_017664chr13--1184 ----
NM_017668chr162847 636 ------
NM_017672chr152856 277 ------
NM_017676chr511813 --1218 --
NM_017691chr15------1448
NM_017693chr1341491 1304 539 461 --1304 --
NM_017694chr231506 1388 205 --11617 1136
NM_017714chr201284 ------
NM_017719chr342505 2077 1967 59 --12193 11556
NM_017730chr31705 ------
NM_017736chr1642893 2099 2093 778 11142 --12853
NM_017737chr11819 ------
NM_017739chr11413 --1480 --
NM_017744chr142478 2147 361 265 1905 32274 1838 681 --
NM_017746chr9139 ------
NM_017749chr112943 649 ------
NM_017753chr92915 873 --1350 --
NM_017754chr6114925 4477 3821 3779 1828 1507 1306 1244 1054 1023 168 --43954 3729 738 129 --
NM_017766chr14489 372 176 87 ------
NM_017768chr11832 --1167 --
NM_017772chr631380 1368 117 ------
NM_017776chrX41413 538 307 223 1457 ----
NM_017778chr831011 475 259 ------
NM_017779chr132570 995 951 ------
NM_017780chr82254 67 ------
NM_017784chr35469 395 380 356 288 --189 --
NM_017787chr1021943 1041 --32500 2359 239 --
NM_017798chr20--1989 ----
NM_017799chr1421809 1729 11666 ----
NM_017811chr942164 508 287 100 12629 ----
NM_017812chr72735 721 ----1740
NM_017813chr874794 3535 2011 1968 1722 419 334 25472 852 ----
NM_017816chr4152 ------
NM_017824chr103688 604 418 ------
NM_017826chr135760 561 507 209 21 ------
NM_017831chr1874527 4403 4342 3538 1495 1039 1024 --34598 4244 1733 --
NM_017836chr31436 130 ----
NM_017845chr41256 ------
NM_017848chrX94661 3782 3726 3667 3247 3192 1217 512 499 11200 23316 760 1388
NM_017849chr262947 2346 2302 403 246 94 12995 12008 --
NM_017851chr152896 207 ------
NM_017864chr81215 ------
NM_017866chr82927 706 --2763 439 --
NM_017873chr962712 2676 2236 1151 736 466 ------
NM_017880chr21288 ------
NM_017887chr1----1396 --
NM_017896chr2042531 2519 1041 85 --1236 --
NM_017902chr1084759 4352 2255 2005 1484 1248 1118 992 45583 3816 2231 2091 --11253
NM_017905chr131473 ------
NM_017910chr22269 262 ------
NM_017919chr985783 5162 2254 2215 2192 1890 1403 1259 13561 33699 1372 1066 15207
NM_017933chr22573 265 11183 21548 636 --
NM_017935chr42243 25 1166 ----
NM_017938chrX51854 1835 546 321 210 11494 ----
NM_017944chr1152866 2753 1897 445 425 158 ----
NM_017945chr331278 362 77 ------
NM_017957chr1721585 1494 ------
NM_017974chr221226 289 1525 1452 --
NM_017987chr1021912 1899 ----1228
NM_017988chr12----1703 --
NM_017990chr16124271 3962 3719 3674 3621 3424 3153 3016 1607 959 563 241 --1210 --
NM_017994chr752751 2643 2361 2179 833 --22962 2691 --
NM_018014chr221271 979 ------
NM_018017chr1052440 2356 1815 1012 356 ------
NM_018019chr1721065 509 --1486 --
NM_018027chr1051231 944 855 167 157 11112 12174 --
NM_018030chr183842 732 118 ------
NM_018045chr152861 2607 1240 663 181 2937 637 ----
NM_018047chr52845 820 ------
NM_018054chr161124 ------
NM_018061chr121629 1507 11765 1701 --
NM_018064chr62312 231 ------
NM_018084chr223306 3223 1299 2951 816 21191 252
NM_018085chr1108036 7782 7577 6871 6473 6115 5250 1628 162 64 17113 27680 6885 --
NM_018086chr241556 1367 1279 255 ----11173
NM_018092chr1631598 1366 1140 --21496 194 --
NM_018115chr43680 508 304 ------
NM_018116chr12452 225 --1625 --
NM_018117chr102779 673 ------
NM_018120chr81465 11455 1343 --
NM_018131chr101743 ------
NM_018133chr342165 1406 684 293 1583 1651 11870
NM_018137chr151055 996 966 952 525 1547 2946 903 --
NM_018139chr14------1367
NM_018155chr332441 856 705 12670 11350 1782
NM_018157chr123559 462 354 12348 1128 --
NM_018171chr121652 --1799 --
NM_018181chr1811945 11621 --1448
NM_018182chr1751959 825 772 751 90 11422 1478 --
NM_018184chr31485 ------
NM_018189chr331338 1224 336 --1262 --
NM_018191chr1332088 1732 492 11614 11487 --
NM_018192chr341050 859 840 266 ------
NM_018195chr1132171 2107 52 ------
NM_018200chr1552331 2194 1965 995 725 22622 310 11858 --
NM_018203chr14793 581 245 46 --1249 --
NM_018206chr161157 --1185 --
NM_018208chr121198 259 ------
NM_018211chr131672 871 236 ------
NM_018230chr11527 --1554 --
NM_018240chr12772 86 ------
NM_018241chr41814 ----1969
NM_018243chr433386 1456 33 --1454 --
NM_018244chr20------11239
NM_018246chr852721 2017 1778 883 396 11958 11034 --
NM_018247chr6----1713 --
NM_018254chr132309 1686 730 1171 ----
NM_018260chr1941217 902 231 205 --1297 --
NM_018263chr251840 1833 879 452 238 12423 11818 --
NM_018270chr201601 1646 1605 --
NM_018272chr121209 ------
NM_018279chr1222671 514 22710 981 11204 1707
NM_018286chr173824 166 66 ------
NM_018293chr332951 544 160 ------
NM_018299chr812121 --32963 2948 440 --
NM_018307chr173390 349 340 1762 ----
NM_018312chr1132096 863 517 --1104 --
NM_018313chr321938 859 1642 ----
NM_018315chr421353 237 --11568 --
NM_018319chr1421142 975 --1204 --
NM_018330chr1041682 1589 1065 537 11664 ----
NM_018332chr161129 --11388 --
NM_018339chr941462 1274 1138 417 --129 --
NM_018340chr1674726 4060 3829 1936 827 31 24 24631 1235 ----
NM_018348chr163422 305 229 1132 ----
NM_018351chr1254078 3800 2986 1288 360 13363 34256 4252 1132 --
NM_018360chrX2303 95 ------
NM_018361chr843472 3346 1456 350 14081 1589 --
NM_018362chr1183764 3234 2987 2740 1285 1105 595 410 2983 958 --165
NM_018363chr102812 331 ------
NM_018364chr121182 973 33468 3189 698 1325 --
NM_018371chr821456 319 --21468 976 --
NM_018372chr12478 161 ------
NM_018373chr1475862 5487 5327 1294 967 701 45 --34019 2562 2544 14620
NM_018374chr774932 4186 3918 1815 1807 1286 408 11654 --25083 796
NM_018375chr1421210 328 --2505 75 --
NM_018383chr241799 1307 210 63 ------
NM_018387chr91217 ------
NM_018388chrX11345 3916 399 345 ----
NM_018394chr331616 1009 401 11302 --11062
NM_018403chr383265 2769 1575 1285 966 343 330 178 --23766 127 --
NM_018416chr1242407 1038 594 185 ------
NM_018424chr931564 444 28 1201 ----
NM_018429chr522279 871 12437 12460 1632
NM_018440chr8147251 7112 6862 5911 5833 5739 5367 5276 2331 2171 1892 1672 1269 336 1298 1855 --
NM_018448chr1231231 848 379 11132 ----
NM_018449chr9------1628
NM_018451chr131181 --3757 753 749 1193
NM_018452chr6_random43832 3334 3266 1355 ------
NM_018460chr21115 ------
NM_018466chrX1237 --1566 1673
NM_018469chr1721153 404 ------
NM_018482chr862170 2082 1953 248 212 109 1685 1576 --
NM_018489chr142042 1685 1636 913 ------
NM_018490chr111531 --1456 --
NM_018509chr1741683 1485 1408 1289 --11293 --
NM_018555chr195884 832 583 322 168 11445 ----
NM_018557chr221328 1207 ------
NM_018566chr141686 1611 1513 1223 11359 ----
NM_018569chr411467 ------
NM_018571chr22633 520 --1538 --
NM_018584chr1------1258
NM_018590chr10160 --21311 572 --
NM_018638chr1285494 4695 2150 2043 2016 2003 1710 1435 15529 1563 14397
NM_018640chr1252761 2362 2294 2118 789 1490 22804 407 --
NM_018649chr101433 ------
NM_018650chr142021 1976 1703 911 --22103 1697 --
NM_018667chr1682826 2311 1968 1770 876 702 678 174 ------
NM_018682chr73581 458 142 ------
NM_018685chr731161 1058 247 ----1125
NM_018686chr121230 ------
NM_018688chr84623 192 114 46 ------
NM_018695chr52537 55 --31926 1840 1679 --
NM_018704chr131661 600 189 --2828 326 --
NM_018710chr831286 457 155 ------
NM_018712chr1161102 503 446 363 79 45 ------
NM_018713chr12765 62 1126 ----
NM_018718chr732075 785 529 1657 3639 603 415 --
NM_018834chr51708 ------
NM_018841chr123931 3318 ------
NM_018890chr72500 218 --11370 --
NM_018945chr693543 3510 2790 2666 2638 2528 2265 778 144 ------
NM_018948chr111133 11228 ----
NM_018951chr74962 120 82 30 ------
NM_018970chr722010 1274 --12649 --
NM_018976chr1252492 2264 1077 120 94 ------
NM_018979chr1232277 945 396 ------
NM_018992chr1631343 375 247 ----11583
NM_019001chr354660 3438 1828 1785 1342 24271 1388 33339 1307 446 11790
NM_019004chr72619 358 --2483 84 --
NM_019005chr71100 ------
NM_019006chr151720 ------
NM_019027chr452122 2093 1687 722 87 1160 ----
NM_019035chr422007 1958 ------
NM_019042chr72463 85 ------
NM_019046chr10--1642 ----
NM_019049chr13656 130 88 ------
NM_019050chr432227 2015 438 ------
NM_019053chr103868 316 220 1413 ----
NM_019058chr101163 --1767 --
NM_019063chr231574 464 390 ------
NM_019066chr153378 319 22 ------
NM_019072chr553117 2851 1563 1396 1357 --13320 --
NM_019083chr13645 513 184 1128 ----
NM_019084chr1032307 1928 509 --11769 --
NM_019088chr19186 ------
NM_019094chr1242828 1306 454 377 13200 43379 1264 1115 583 --
NM_019098chr8----11860 1340
NM_019106chr2272486 2304 2238 1019 813 322 224 12630 ----
NM_019113chr19179 ------
NM_019114chr952544 2276 2032 1718 75 ------
NM_019116chr16123331 3170 3164 2906 2792 2603 2575 1451 1371 1211 847 558 --12415 --
NM_019555chr33513 488 439 ------
NM_019556chrX21288 78 --1309 --
NM_019557chr11329 ------
NM_019597chrX1231 ------
NM_019600chr152627 183 ------
NM_019605chr11684 ------
NM_019609chr20--198 ----
NM_019610chr172170 1747 753 721 526 470 435 ------
NM_019843chr221453 ------
NM_019845chr2--171 1274 --
NM_019862chr1611727 ------
NM_019891chr151098 1074 950 466 133 ------
NM_019895chr32419 143 ------
NM_019898chr1611727 ------
NM_019899chr1611727 ------
NM_019900chr1611727 ------
NM_019903chr104549 367 258 174 11571 ----
NM_020039chr121777 ------
NM_020066chr11793 1147 1325 --
NM_020123chr10--1275 ----
NM_020125chr111907 --11995 --
NM_020127chr151758 1706 1654 1304 1262 11144 ----
NM_020132chr2184555 4482 3821 3409 3186 970 625 580 --11960 11969
NM_020134chr22860 315 --1161 --
NM_020140chr12172 ------
NM_020141chr162390 1562 743 567 429 156 1363 --12196
NM_020147chr153847 87 53 ------
NM_020148chr1841950 1920 1914 483 12712 1240 12260
NM_020150chr1092164 1646 1601 754 709 557 498 146 54 --1512 --
NM_020159chr441424 433 362 176 ------
NM_020177chr572910 2354 2226 1326 1280 724 120 ----1808
NM_020178chr1751013 893 309 192 112 --11218 --
NM_020182chr2043179 2225 1269 342 ------
NM_020186chr71470 ----1505
NM_020193chr112918 179 11216 ----
NM_020198chr17151 ------
NM_020200chr1031099 360 98 ------
NM_020208chr362695 2349 1398 1144 781 24 ------
NM_020225chr4132 ------
NM_020226chr43239 183 126 ------
NM_020228chr111300 --1101 --
NM_020239chr112179 11799 ----
NM_020240chr562543 2246 1891 1776 281 145 --1850 12571
NM_020243chr223608 296 193 ------
NM_020245chr644401 3289 1823 619 ------
NM_020246chr72325 249 ------
NM_020248chr142066 1926 1591 696 ------
NM_020251chr112685 60 ------
NM_020309chr192308 50 ------
NM_020336chr20113395 3164 2777 2769 1421 1235 1143 857 442 381 112 ------
NM_020337chr422736 1946 1518 1770 1226
NM_020338chr1063728 3413 3200 2284 1462 1366 ------
NM_020342chr231886 1765 112 --11679 --
NM_020344chr91150 --1166 --
NM_020346chr111294 ------
NM_020357chr3--11406 11508 --
NM_020362chr1----1816 --
NM_020381chr621318 203 1726 1603 --
NM_020382chr123567 492 148 ------
NM_020384chrX31776 1533 421 ------
NM_020386chr31138 ------
NM_020390chr343799 989 947 103 ------
NM_020416chr472609 2194 780 714 436 375 301 --21761 822 --
NM_020423chr11200 2622 128 ----
NM_020424chr164649 638 310 228 ------
NM_020429chr763137 2417 2251 1160 350 317 --21098 978 --
NM_020432chr741543 816 366 166 ------
NM_020440chr122812 2740 ------
NM_020455chr642166 623 484 71 --12544 --
NM_020456chr1332321 1701 846 1378 ----
NM_020457chr161652 ------
NM_020465chr1621517 202 ------
NM_020466chr664136 3444 1415 1359 1276 608 191 13857 1616
NM_020473chrX61533 1508 1329 656 493 374 --1629 --
NM_020474chr1821899 1545 21429 163 ----
NM_020526chr151822 1750 1274 562 292 ------
NM_020640chr311924 12192 ----
NM_020645chr112653 260 ------
NM_020647chr821862 558 2531 419 1519 --
NM_020651chr211589 ------
NM_020654chr32322 80 ----1214
NM_020655chr161153 --1444 --
NM_020682chr101833 ------
NM_020686chr1662825 2143 1986 715 254 82 ------
NM_020689chr2031414 370 171 --11288 --
NM_020697chr831294 508 462 --1225 --
NM_020699chr124578 1225 --15220 --
NM_020704chr752453 2399 1826 613 397 ------
NM_020718chr16116305 6193 6147 5570 5309 4367 2158 2134 1886 1211 428 14253 41890 1878 1741 1162 --
NM_020728chr732620 1999 1156 11011 1783 --
NM_020732chr6------1129
NM_020734chr1253216 2490 2467 2103 1260 --1735 22455 2132
NM_020738chr231281 445 181 ----1228
NM_020739chr1573284 1553 1334 945 773 579 414 22820 1276 23715 325 --
NM_020747chr5----1376 --
NM_020748chr1741578 1487 815 769 11558 --1274
NM_020749chr851776 1749 1635 1288 770 ------
NM_020750chr6195 ------
NM_020752chr1032818 1947 500 --1423 --
NM_020760chr231476 1396 343 ------
NM_020761chr1741619 1611 325 62 11932 1156 --
NM_020762chr122763 382 --1243 --
NM_020765chr11127 ------
NM_020766chrX51299 792 777 763 76 14330 --11496
NM_020768chr543217 2479 968 483 --12103 --
NM_020769chrX2784 149 1640 ----
NM_020770chr121158 1008 --1416 --
NM_020772chr1768225 6715 6554 2634 2606 2357 27246 6527 ----
NM_020773chr441951 1735 493 273 --12521 --
NM_020774chr1865703 5315 4040 1932 1476 228 12373 ----
NM_020776chr1863008 2870 2230 1081 821 305 2474 117 1353 --
NM_020779chr263158 2537 2417 2314 1162 609 1115 ----
NM_020782chr1294372 4318 4066 3990 3776 1698 1363 1223 146 ------
NM_020783chr181320 --1743 --
NM_020791chr173563 460 84 ------
NM_020796chr562944 2663 1087 230 210 160 --1855 --
NM_020800chr321395 977 ------
NM_020802chr1123326 320 --21355 413 --
NM_020807chr16----1265 --
NM_020808chr14791 743 707 134 ----1796
NM_020810chr1453401 1132 1113 641 36 --12441 --
NM_020819chr6138 ----21130 1057
NM_020824chr10------1248
NM_020825chr1643584 3135 2907 1340 ------
NM_020826chr1162711 2653 1260 1142 455 79 13338 12950 --
NM_020830chr261084 792 475 371 171 107 ------
NM_020832chr11503 --1466 --
NM_020839chr321429 1022 11382 ----
NM_020841chr1253760 3690 2767 2491 681 ------
NM_020845chr1231881 459 371 ------
NM_020850chr1652997 2815 2486 2414 1207 --12761 1564
NM_020854chr181548 ------
NM_020856chr1911223 ------
NM_020858chr1542047 1622 404 261 --191 --
NM_020860chr43839 721 324 ------
NM_020861chr63933 503 31 ------
NM_020868chr231414 333 322 ------
NM_020871chrX11989 11634 11672 --
NM_020898chr123166 52 36 ------
NM_020918chr1043187 2823 2289 236 12947 1466 13342
NM_020921chr1472270 1241 1181 983 667 179 22 22817 190 23295 3228 11356
NM_020922chrX61670 1248 654 495 223 106 ------
NM_020925chr131242 491 387 --11339 --
NM_020927chr1652179 1934 1555 1476 610 ------
NM_020935chr274004 3987 3945 2979 2961 494 426 11653 23417 537 --
NM_020940chr1042615 2465 879 749 ------
NM_020947chr1642190 1952 590 175 11829 ----
NM_020952chr9----2881 647 --
NM_020958chr141290 --123 --
NM_020959chr19148 ------
NM_020962chr1572373 2136 1885 933 906 689 631 12166 21687 165 --
NM_020964chr18134574 4430 4181 3904 3441 3251 3068 3045 2958 1184 808 411 283 ----34730 4345 255
NM_020967chr20----157 --
NM_020975chr1031412 731 29 11675 --1340
NM_020977chr432034 1957 1553 --21717 209 --
NM_020987chr1021329 88 ------
NM_020988chr1621112 274 ------
NM_020993chr1232803 2601 528 --1722 --
NM_021007chr23875 576 434 ------
NM_021019chr121183 ------
NM_021032chr341725 416 381 211 ------
NM_021033chr135689 612 369 266 61 1835 ----
NM_021038chr323168 878 --13269 --
NM_021047chr191263 ------
NM_021061chr854161 3916 3136 1507 705 ------
NM_021064chr641225 1183 1137 599 --11484 --
NM_021072chr522401 802 --12277 --
NM_021076chr222541 85 ------
NM_021079chr1733346 2223 729 ------
NM_021088chr261590 1548 879 800 463 85 --1489 --
NM_021097chr233051 2060 96 --12690 --
NM_021101chr332107 1574 1544 1351 ----
NM_021116chr7108848 8537 6858 6798 3245 2975 2548 2191 1445 632 15579 48842 8781 7194 6618 --
NM_021117chr1121539 186 11691 22305 868 11897
NM_021120chrX42812 739 581 216 ------
NM_021131chr921446 305 ------
NM_021133chr161735 1163 542 459 305 85 ------
NM_021135chr673229 3206 2806 914 886 191 51 ------
NM_021136chr14167 ----172
NM_021143chr191177 --1481 --
NM_021144chr9----1102 --
NM_021145chr711080 --1276 --
NM_021148chr752329 1551 904 861 579 11817 ----
NM_021151chr741059 338 307 26 ------
NM_021155chr1951924 1011 640 597 403 22937 2909 22168 386 --
NM_021160chr61162 ------
NM_021161chr142133 65 ------
NM_021167chr752399 2188 1069 639 45 --11998 --
NM_021168chr1651551 1327 1176 442 319 ------
NM_021180chr11785 --1607 --
NM_021183chrX1753 --22171 1910 --
NM_021184chr63753 674 206 ------
NM_021189chr121087 908 ------
NM_021204chr4----186 --
NM_021222chr141346 1279 1068 935 1921 2407 45 --
NM_021224chr92361 32 ------
NM_021229chr122884 347 ------
NM_021237chr31313 1223 ----
NM_021238chr1251497 1471 1318 762 148 22118 415 --11342
NM_021239chr141210 11167 ----
NM_021240chr91175 ------
NM_021255chr1463769 3425 3350 2497 741 390 14065 --1799
NM_021614chr5--1238 ----
NM_021622chr1032014 466 255 ------
NM_021627chr321143 145 --2362 358 11001
NM_021637chrX61376 1062 1051 1026 867 384 ----11043
NM_021638chr484945 4923 4840 4118 3950 3764 3480 3329 1789 14609 --
NM_021639chr13359 236 110 ------
NM_021643chr231454 571 477 --1582 --
NM_021647chr484685 4653 4290 4082 3008 1716 1366 510 --13032 --
NM_021648chr652613 2202 2070 1704 837 --1752 --
NM_021705chr661342 1223 1077 302 198 44 ------
NM_021728chr141111 ------
NM_021813chr695792 4941 4857 4577 3832 1857 1830 1184 537 14171 15758 --
NM_021814chr631665 1352 308 ------
NM_021815chr223013 2161 ------
NM_021905chr682054 1704 1578 1548 1530 1468 284 27 ------
NM_021911chr554316 3947 3877 1276 472 15356 ----
NM_021912chr1553226 794 773 705 476 --1512 11455
NM_021913chr192484 441 --11214 --
NM_021914chr1422237 2004 ------
NM_021931chr203986 786 253 1268 ----
NM_021935chr3157 ------
NM_021940chr631636 1347 447 --1495 --
NM_021942chr42797 149 ------
NM_021943chr652121 655 626 545 442 143 ----
NM_021947chr171364 --11306 --
NM_021949chrX72694 2542 2481 2466 340 109 49 ------
NM_021954chr1342964 2619 2318 1447 13629 23446 2855 --
NM_021959chr66984 900 834 366 267 191 ------
NM_021960chr141915 1080 1017 583 --11112 --
NM_021961chr1196566 6326 6225 5611 2959 1739 1562 1441 873 14597 --1552
NM_021963chrX1766 ------
NM_021964chr374777 4715 2653 2448 2419 2055 359 24031 1204 14024 --
NM_021977chr653687 3244 1399 1388 553 ------
NM_021980chr1061173 945 925 513 307 87 1106 ----
NM_021984chrX11220 1477 1188 --
NM_021987chrX11220 1477 1188 --
NM_021990chrX11220 1477 1188 --
NM_021998chrX1152 168 11496 --
NM_021999chr13--1138 1754 --
NM_022041chr162702 348 --22581 91 11085
NM_022048chr1596256 5419 4815 2418 2105 1786 1692 301 75 --22327 1696 --
NM_022049chr111610 11845 ----
NM_022054chr141843 --1707 --
NM_022059chr174666 355 313 198 ------
NM_022060chr1441299 557 377 64 --1319 --
NM_022062chr1131827 669 284 ------
NM_022067chr144749 612 290 32 ------
NM_022068chr182599 564 ------
NM_022079chr101108 ------
NM_022085chr621150 213 ------
NM_022093chr13856 692 612 --1696 --
NM_022116chr71911 ------
NM_022123chr141565 ------
NM_022130chr541030 919 414 248 ------
NM_022133chr821622 1205 11911 21297 176 --
NM_022137chr141147 ------
NM_022138chr61940 --1123 --
NM_022140chr552232 1982 1570 930 214 11817 2498 231 --
NM_022157chr13140 44 37 ------
NM_022164chr12678 538 ------
NM_022166chr16105793 4635 4601 4564 3868 1962 1904 1679 957 935 11658 15691 --
NM_022169chr1151414 1381 1248 1215 361 ------
NM_022307chr7127 1595 ----
NM_022336chr262235 2029 1525 936 713 424 --2285 249 --
NM_022337chr11139 ------
NM_022351chr853455 3364 1351 494 244 23256 197 23711 2536 12855
NM_022361chr61199 --1420 --
NM_022367chr11636 ------
NM_022373chr71341 --1253 --
NM_022374chr2145 ------
NM_022405chr362695 2349 1398 1144 781 24 ------
NM_022458chr742279 2037 1979 53 ------
NM_022459chr1375064 4592 4151 2296 1672 1442 1163 14832 32413 1387 1254 --
NM_022465chr1241157 1148 624 575 21010 105 ----
NM_022469chr183112 2752 2227 1203 1049 944 702 487 --23133 976 --
NM_022473chr1593593 3198 3013 1706 1292 1208 1164 1096 960 --14177 13515
NM_022474chr141224 --21859 771 --
NM_022475chr42565 199 ------
NM_022484chr74419 212 124 36 --11125 --
NM_022488chr31162 ------
NM_022491chr1283088 1418 1257 1179 1122 1008 930 590 22428 2335 195 1469
NM_022497chr333205 615 521 --13184 --
NM_022552chr221196 1110 ------
NM_022566chr151391 --154 --
NM_022572chr241435 1306 687 370 ------
NM_022574chr742043 1382 491 156 ------
NM_022644chr172199 67 ------
NM_022650chr51995 --156 --
NM_022658chr122251 120 11082 ----
NM_022659chr81147 --137 --
NM_022664chr1------170
NM_022716chr142259 620 544 414 --12732 --
NM_022725chr1151829 1442 711 555 538 --11726 --
NM_022726chr6----1329 --
NM_022728chr7133 ------
NM_022731chr11111 ------
NM_022735chr11208 11337 ----
NM_022744chr1641032 870 471 389 ------
NM_022748chr732131 1838 678 --22279 1020 --
NM_022751chr18--1131 ----
NM_022753chr142667 1111 718 478 ----12421
NM_022756chr141491 1348 1160 194 ------
NM_022758chr653060 2492 2093 980 869 12014 ----
NM_022763chr383003 2736 2155 559 497 427 364 303 1953 ----
NM_022766chr2242633 1783 240 218 ------
NM_022771chr121834 --1323 --
NM_022776chr321319 591 ----1433
NM_022777chr751523 1115 699 382 158 ----11418
NM_022781chr933080 3053 796 --22963 1204 --
NM_022810chrX--1389 ----
NM_022821chr12478 388 ------
NM_022824chr541490 689 457 439 ------
NM_022826chr22985 465 1956 ----
NM_022828chr51719 ------
NM_022831chr141518 544 387 79 ----11179
NM_022832chr452409 1739 1617 474 26 ------
NM_022841chr1532355 989 246 ------
NM_022843chr1321438 1398 ------
NM_022844chr16--1976 ----
NM_022875chr5181 ------
NM_022877chr5181 ------
NM_022893chr222190 26 ------
NM_022894chr241517 1432 536 188 ------
NM_022898chr1464048 3869 1519 1168 697 375 11317 ----
NM_022910chr1621517 202 ------
NM_022912chr262738 2566 2288 1966 1239 894 --12396 1127
NM_022913chr51301 ------
NM_022918chr1121703 559 --11628 --
NM_022977chrX22159 1684 ------
NM_023000chr14--1399 ----
NM_023001chr14--1399 ----
NM_023009chr11506 ------
NM_023012chr12------1664
NM_023037chr133825 374 217 --11084 1270
NM_023039chr51323 --2343 146 --
NM_023071chr1221109 71 ------
NM_023923chr183660 3533 2964 2662 1181 741 255 154 13426 ----
NM_023925chr121130 2282 219 ----
NM_023927chr5----21300 1186 --
NM_023929chr832747 2675 2063 --12135 --
NM_023930chr112833 796 ------
NM_023940chr41971 ------
NM_023948chr7----1158 --
NM_024007chr522128 778 22350 1221 ----
NM_024016chr172564 520 ------
NM_024017chr1751611 1431 437 331 47 ------
NM_024019chr41114 ------
NM_024034chr201978 --178 --
NM_024038chr191230 ------
NM_024046chr351041 949 822 102 70 ------
NM_024052chr1742597 1200 723 121 12856 ----
NM_024055chr54654 632 261 169 ------
NM_024057chr12125 ------
NM_024095chr1231184 422 196 ------
NM_024106chr19255 41 --178 --
NM_024117chr931147 1113 116 ------
NM_024122chrX1239 ------
NM_024293chr23754 631 303 ------
NM_024294chr653060 2492 2093 980 869 12014 ----
NM_024301chr1921096 1018 11034 11103 --
NM_024315chr7123 ------
NM_024341chr19103534 3489 2818 2718 2693 1618 1124 682 640 613 --21180 965 --
NM_024345chr9125955 5908 5850 5708 4783 3948 2456 2315 1692 742 493 307 15509 24607 990 --
NM_024415chr52177 148 ------
NM_024416chr981539 1519 1449 1118 1008 536 448 108 --11453 --
NM_024420chr1----1380 --
NM_024423chr18103732 3133 2769 2760 1456 1356 1222 688 341 76 14172 34121 1131 561 --
NM_024424chr1121251 208 186 1989 --
NM_024425chr1121251 208 186 1989 --
NM_024426chr1121251 208 186 1989 --
NM_024482chr1----180 --
NM_024490chr153622 499 434 ------
NM_024494chr13682 551 21 ------
NM_024496chr141544 ------
NM_024501chr22282 124 ------
NM_024511chr463311 2162 907 386 345 233 --12955 --
NM_024513chr383595 3396 3352 2793 1249 692 575 24 --12830 --
NM_024520chr2186 ------
NM_024522chr161882 1736 616 574 331 104 --1404 --
NM_024524chr332139 675 373 1779 ----
NM_024539chrX------1191
NM_024548chr321712 1217 11454 1295 --
NM_024554chr151437 1386 607 242 179 ------
NM_024556chr11177 ------
NM_024561chr1321224 425 1251 21375 891 11122
NM_024563chr511218 11933 ----
NM_024567chr8--1539 ----
NM_024582chr431090 1023 165 --1916 --
NM_024590chr421778 623 --11348 --
NM_024602chr11691 ------
NM_024607chr8134352 4047 3321 3308 2977 2914 1640 1364 926 406 198 143 57 14318 ----
NM_024610chr31318 ------
NM_024612chr17--11037 ----
NM_024613chr851553 1525 1281 665 537 ------
NM_024617chr9----151 --
NM_024624chr231422 602 449 ------
NM_024631chr112477 196 --152 --
NM_024639chr6112589 844 698 674 568 490 416 350 255 228 185 ----159
NM_024646chr162749 2604 2561 1429 1120 1059 --23333 260 1743
NM_024659chr22687 311 ------
NM_024663chr202362 44 --1482 --
NM_024665chr344570 3990 3351 439 14225 12945 --
NM_024674chr173064 2446 2158 2118 914 768 574 ------
NM_024704chr2031070 808 270 ------
NM_024713chr1531422 1202 367 ------
NM_024719chr13178 ------
NM_024721chr852688 747 584 557 442 12507 ----
NM_024722chr171503 1587 1567 --
NM_024744chr222331 960 1511 ----
NM_024749chr141587 1498 235 122 --1704 1174
NM_024761chr923890 1302 --1157 --
NM_024770chr2115690 5675 5616 5461 4728 4641 2494 2326 1744 1486 1211 --24361 2607 12303
NM_024779chr1221163 633 ----1464
NM_024792chr17----11136 --
NM_024798chr1562628 2386 2333 2216 531 488 ------
NM_024812chr841989 1920 1422 474 12142 ----
NM_024817chr1593893 1977 1566 1316 1031 711 610 585 550 --25374 1419 1646
NM_024824chr1431305 694 417 11677 ----
NM_024828chr9--11519 1122 --
NM_024834chr1051718 1499 1220 493 181 ------
NM_024835chr17138 1156 ----
NM_024837chr1541896 598 115 38 --2337 231 --
NM_024850chr52778 47 ------
NM_024885chrX3714 149 38 ------
NM_024900chr451971 1929 1848 507 476 --1141 --
NM_024900chr451971 1929 1848 507 476 --1141 --
NM_024909chr621118 1093 --11564 --
NM_024913chr711265 21786 1272 ----
NM_024942chr1041436 1347 533 215 11444 11011 --
NM_024944chr212521 464 ------
NM_024947chr378081 7371 7134 6824 3496 1649 1333 1951 ----
NM_024948chr102575 281 ------
NM_024960chr20----2471 75 --
NM_024967chr19251 29 ------
NM_024969chr22751 589 ------
NM_024971chr9----2881 647 --
NM_024989chr2198026 7565 7483 7433 7285 7167 7076 6991 6971 5874 5625 2694 2518 2248 2146 1509 647 370 352 1686 37249 5091 1682 18044
NM_024991chr1022862 542 ------
NM_024993chr221102 644 ------
NM_025004chr111262 --1187 --
NM_025027chr191199 --1829 --
NM_025054chr853026 2748 1200 972 321 13169 ----
NM_025057chr1421262 410 --21106 216 11285
NM_025073chr174676 4655 4427 1136 1105 1050 497 13085 33933 1117 889 --
NM_025074chr43522 160 143 12692 ----
NM_025083chr1541999 1581 1372 571 --1139 --
NM_025106chr11517 --149 --
NM_025112chr3288 63 ------
NM_025113chr1341305 1256 1074 285 ------
NM_025134chr161882 --197 --
NM_025146chr322567 480 ------
NM_025147chr22350 49 --21103 161 --
NM_025151chr852224 1816 1602 1364 42 --11779 1855
NM_025160chr144175 3558 2758 1262 ------
NM_025164chr1132188 1852 1369 --12080 --
NM_025187chr1611094 ------
NM_025191chr142200 918 728 542 13027 12369 --
NM_025195chr84688 520 503 436 --11299 --
NM_025196chr4----135 --
NM_025208chr1132324 1997 617 --32145 2141 752 196
NM_025221chr4----31037 352 225 --
NM_025222chr342268 2065 875 275 ------
NM_025235chr1062273 2249 2220 2112 1874 655 --11458 --
NM_025236chr64719 645 594 94 --177 --
NM_025237chr1761485 1315 1169 1135 1088 406 ------
NM_025244chr21245 2273 251 ----
NM_025246chr3--125 ----
NM_025248chr1772919 2815 1298 614 384 288 42 ------
NM_025250chr752409 2110 707 628 565 12531 ----
NM_030576chr1741010 792 619 364 ------
NM_030579chr1652547 940 245 204 186 --13086 --
NM_030594chr1541297 978 436 278 ------
NM_030621chr1463595 3040 2926 1352 775 239 21265 1124 13964 1784
NM_030625chr1012079 --22088 1644 --
NM_030627chr573306 3080 3032 1273 1118 962 21 12623 1812 --
NM_030629chr1641960 1570 1347 433 ------
NM_030647chr7106272 5828 5194 4703 4499 4226 1631 820 813 152 34887 4182 423 14964 15339
NM_030648chr465459 5017 4543 1901 1128 170 --13636 --
NM_030650chr284023 3489 3238 3173 2961 2754 936 44 --21575 78 --
NM_030664chr1041906 1736 534 21 ------
NM_030670chr121520 11505 ----
NM_030671chr121520 11505 ----
NM_030751chr1031736 1334 685 1110 11670 --
NM_030751chr1031736 1334 685 1110 11670 --
NM_030755chr1462624 2510 2467 669 392 367 ----1674
NM_030759chr103542 234 188 --2196 192 --
NM_030762chr1221283 814 11783 ----
NM_030763chrX2761 705 --1675 --
NM_030766chr1231022 838 242 ------
NM_030786chr131807 1790 1235 1570 21811 1395 --
NM_030799chr541890 1678 1598 409 --1708 --
NM_030802chr175566 254 227 220 125 --1129 --
NM_030803chr221226 289 1525 1452 --
NM_030805chr241211 1205 1120 523 ------
NM_030806chr1148367 8355 8211 8083 7106 6190 3308 3273 1962 1709 1074 730 483 253 --29042 6553 --
NM_030810chr621150 213 ------
NM_030816chr193682 3651 2934 2686 2668 2634 2460 1280 643 --11160 --
NM_030820chr61798 ------
NM_030881chr221869 1462 1175 --
NM_030885chr341980 1912 1811 220 1570 ----
NM_030914chr91691 ------
NM_030916chr1--1838 ----
NM_030918chr175290 5071 4265 1895 1853 1660 861 22024 1312 23824 3684 --
NM_030920chr131866 805 269 11790 ----
NM_030925chr1322067 38 ------
NM_030927chr1011018 ------
NM_030934chr12418 245 1558 ----
NM_030937chr1------11209
NM_030939chr61104 1255 21014 328 --
NM_030940chr931062 485 60 ----11326
NM_030948chr6----179 --
NM_030949chr62588 562 ------
NM_030952chr1----1394 --
NM_030962chr11141 ----11599
NM_030963chr62135 77 ------
NM_030964chr583569 3486 3401 1174 774 759 736 515 13350 --13328
NM_030969chr6128 ------
NM_030978chr91428 ------
NM_031157chr121144 ------
NM_031216chr1811999 1132 ----
NM_031243chr731790 214 29 ------
NM_031262chr9----11143 --
NM_031263chr9----11200 --
NM_031267chr71522 ------
NM_031268chr1654209 3448 3345 1451 826 --24681 4435 --
NM_031284chr152843 356 ------
NM_031296chr452447 2336 854 813 540 11093 --11700
NM_031314chr1451911 1552 389 181 111 ----11538
NM_031369chr41326 1181 ----
NM_031370chr41326 1181 ----
NM_031371chr121079 275 --1340 --
NM_031371chr121079 275 --1340 --
NM_031407chrX2176 120 ------
NM_031412chr1231083 953 913 ------
NM_031418chr1152820 2625 1071 1044 395 --11760 --
NM_031419chr311609 31456 655 133 136 21648 1412
NM_031431chr1321780 1332 ----11256
NM_031435chr1233331 2291 684 11369 ----
NM_031439chr851901 1281 736 539 285 1432 11481 1420
NM_031442chrX32644 1029 804 1637 --176
NM_031445chr283309 3078 2386 1373 1288 1179 849 632 13233 11292 --
NM_031459chr131585 468 159 ------
NM_031468chr7168108 7992 7943 7017 6003 5167 5047 3104 3020 3012 2912 1984 1683 895 612 35 17972 25517 1197 15522
NM_031475chr14796 668 497 264 --1651 --
NM_031476chr1692644 2500 2123 2080 1986 1887 404 387 170 ------
NM_031483chr20103544 3273 3218 2921 2908 2804 489 438 310 137 ------
NM_031844chr163778 3361 3050 3009 2799 2664 ------
NM_031845chr263253 2596 1300 1155 849 359 22247 365 ----
NM_031847chr263253 2596 1300 1155 849 359 22247 365 ----
NM_031858chr1721138 192 ------
NM_031862chr1721138 192 ------
NM_031866chr1021002 426 --1170 --
NM_031890chr2242881 2233 1223 206 23015 1182 12629 --
NM_031892chrX1220 ------
NM_031904chr1132124 1712 812 --12107 --
NM_031911chr442652 1955 1729 1103 --1519 --
NM_031938chr114949 869 675 207 ----1372
NM_031953chr41346 ------
NM_032012chr994978 4224 3762 3314 2121 2014 1435 458 226 14858 --12048
NM_032015chr112663 50 1789 ----
NM_032047chr321545 28 --12109 --
NM_032102chr1122792 198 ------
NM_032104chr1----126 --
NM_032105chr1116844 6794 6006 5671 3052 1980 1940 1750 1110 1024 862 --38076 6273 26 --
NM_032124chr1821178 330 ------
NM_032128chr41380 ----1725
NM_032144chr211573 ----11856
NM_032145chr63673 607 525 ------
NM_032147chr121956 ------
NM_032153chr342500 2157 772 33 21983 649 ----
NM_032154chr102892 116 1852 ----
NM_032156chr121130 2282 219 ----
NM_032160chr1874012 3774 3681 3639 2822 745 40 --13356 --
NM_032172chr71722 --1843 130
NM_032181chr21581 ------
NM_032182chr102365 50 --11317 --
NM_032186chr141420 960 505 239 1934 ----
NM_032195chr211140 ------
NM_032199chr1083321 3229 3131 2384 1057 997 574 50 --22530 253 --
NM_032211chr101950 11217 ----
NM_032217chr4--1140 ----
NM_032221chr2052018 1388 1270 226 73 --1314 --
NM_032228chr1152802 2309 872 560 81 --22318 1298 --
NM_032229chr131916 ----11173
NM_032231chr152271 77 ------
NM_032239chr42991 68 --1551 --
NM_032246chr151175 ------
NM_032268chr1642797 2163 431 67 ----1783
NM_032271chr1631526 1157 292 ------
NM_032281chr191250 ------
NM_032288chr32668 100 --11714 --
NM_032289chr561854 1742 1634 1494 289 248 ------
NM_032291chr11254 21695 1351 21770 491 --
NM_032293chr9----1281 --
NM_032307chr91123 ------
NM_032312chr22328 281 ------
NM_032320chr11162 ------
NM_032345chr122405 110 ------
NM_032352chr142149 98 --11192 --
NM_032364chr122757 179 ------
NM_032368chr1----1232 --
NM_032373chr1074988 4357 4327 1771 1339 281 22 22117 1610 23777 384 --
NM_032379chr112938 90 ------
NM_032408chr72221 56 ------
NM_032411chr21193 ------
NM_032420chr52187 75 --1357 --
NM_032429chr102591 215 ------
NM_032436chr134880 753 237 120 ------
NM_032437chr1121 ------
NM_032438chr621114 227 ------
NM_032439chr1021361 23 ------
NM_032440chr1051867 1186 873 649 463 1612 1560 --
NM_032445chr1542585 1663 903 266 ------
NM_032446chr563138 2970 2464 1483 785 368 11503 ----
NM_032452chr1441016 219 189 154 ------
NM_032457chr442464 1349 706 225 1370 21549 242 --
NM_032458chrX62440 2383 2113 903 397 254 1500 ----
NM_032491chr123881 443 107 ----1198
NM_032499chr153540 448 412 ----1226
NM_032505chr33708 462 38 ------
NM_032510chr1862346 1619 1556 984 503 80 ------
NM_032536chr92715 547 --1630 --
NM_032552chr931312 702 23 ------
NM_032560chr14--1395 ----
NM_032578chr1051514 1175 533 486 403 --11555 --
NM_032582chr1721826 1220 11381 ----
NM_032590chr122968 863 --1787 --
NM_032595chr1721203 1053 ------
NM_032603chr22301 106 ------
NM_032622chr431583 1507 600 1220 21312 1219 --
NM_032632chr141134 --11368 --
NM_032682chr343366 2766 2430 2383 22930 119 2776 312 --
NM_032689chr1931129 1037 289 --11286 --
NM_032711chr1724122 945 --21116 429 --
NM_032737chr1941079 969 567 176 ------
NM_032741chr62933 382 --1782 --
NM_032765chr53709 346 168 ------
NM_032780chr111168 --1885 --
NM_032784chr6129 --1795 --
NM_032801chr1172548 2229 1003 471 315 242 156 11957 1110 --
NM_032804chr1042097 832 780 390 12298 ----
NM_032810chr10----11025 --
NM_032812chr101248 ------
NM_032818chr932342 2211 1862 ------
NM_032826chr7145192 4613 4356 4100 3888 3791 3393 3379 3350 1761 1635 1458 1165 760 1320 25043 4360 --
NM_032828chr19104515 4069 4027 3052 1267 1224 1062 793 751 205 24194 674 ----
NM_032837chr172803 65 --1273 --
NM_032842chr721131 40 1453 --11408
NM_032858chr1--157 ----
NM_032859chr1332515 1290 126 --23259 1581 --
NM_032867chr112543 119 ------
NM_032873chr1194332 3832 3461 3112 2848 1365 1012 314 220 21639 1219 11227 --
NM_032875chr172749 544 --1753 --
NM_032876chr1441998 1810 869 677 1754 ----
NM_032905chr1011041 ------
NM_032906chr41798 ------
NM_032932chr17136109 5599 5587 5165 4958 4500 4254 2214 2190 1232 1174 367 93 --21097 753 --
NM_032943chr112938 90 ------
NM_032947chr531261 1001 165 ------
NM_032961chr431097 994 317 ------
NM_032968chrX23437 2832 --11110 --
NM_032969chrX23437 2832 --11110 --
NM_032971chrY1945 ------
NM_032972chrY1945 ------
NM_032973chrY23433 2827 --11110 --
NM_032978chr182400 40 ----1934
NM_032979chr182400 40 ----1934
NM_032981chr182400 40 ----1934
NM_032995chr221255 110 ------
NM_033014chr981539 1519 1449 1118 1008 536 448 108 --11453 --
NM_033017chr721614 641 ------
NM_033020chr194463 4211 3413 3090 1874 1231 964 614 545 44516 4473 3313 1054 ----
NM_033030chr211164 ------
NM_033055chr1------11089
NM_033081chr2051467 1156 1106 957 336 ------
NM_033083chr353300 2419 2224 702 680 ----12922
NM_033102chr12864 39 ------
NM_033102chr12864 39 ------
NM_033116chr14297 61 ------
NM_033121chr1251830 1700 1687 1292 701 --11771 --
NM_033129chr2031992 648 373 --2176 34 --
NM_033132chr1311747 --12015 --
NM_033133chr17103705 3514 2666 2585 2475 2357 1454 816 577 190 --12297 --
NM_033135chr1132324 1997 617 --32145 2141 752 196
NM_033136chr51335 --11790 1132
NM_033137chr51335 --11790 1132
NM_033138chr732311 2224 1540 ------
NM_033139chr732311 2224 1540 ------
NM_033140chr732311 2224 1540 ------
NM_033143chr474530 4096 3366 1247 871 795 438 13810 1908 --
NM_033157chr732311 2224 1540 ------
NM_033181chr622874 2788 1349 12607 22704 2675
NM_033201chr161246 ------
NM_033211chr542027 1980 815 570 11565 11883 --
NM_033221chr952794 1845 1057 403 58 1694 11061 --
NM_033222chr92937 424 --21384 494 --
NM_033224chr7137981 7826 7219 7034 6664 5914 5829 5801 5603 5103 2995 2985 436 1899 27262 5967 --
NM_033225chr842558 1097 529 511 ------
NM_033228chr5--2400 232 ----
NM_033255chr133201 166 91 ------
NM_033259chr31905 ------
NM_033260chr61521 ------
NM_033280chr181140 ------
NM_033290chrX53523 3460 2681 502 395 1896 ----
NM_033300chr131297 1241 328 ------
NM_033315chr174745 478 466 425 ------
NM_033326chr1152360 2312 2274 377 310 1879 ----
NM_033331chr963332 3208 2864 1192 1020 494 --12966 --
NM_033337chr31283 ----1867
NM_033340chr1021016 91 ----1163
NM_033360chr1244072 3781 3262 1268 14345 --11695
NM_033364chr321897 249 1343 11462 --
NM_033380chrX21075 76 --1855 --
NM_033381chrX21075 76 --1855 --
NM_033387chr952638 700 280 126 31 --32574 2103 69 --
NM_033389chr1764259 3396 3324 3166 1742 316 ------
NM_033394chr241580 1134 378 262 --1331 --
NM_033402chr8------1507
NM_033420chr1911167 ------
NM_033421chr2031471 1345 558 1729 ----
NM_033425chr1183232 2347 1188 977 880 495 431 56 --23102 3079 --
NM_033426chr1452285 2125 1863 124 47 --22960 2747 --
NM_033427chr72835 99 123 ----
NM_033429chr15113279 3073 2656 2400 2238 2214 2032 912 583 328 78 32953 2133 1322 ----
NM_033430chr474160 4077 3719 3353 2844 2807 1168 ----23742 3492
NM_033437chr474160 4077 3719 3353 2844 2807 1168 ----23742 3492
NM_033448chr123565 527 28 ------
NM_033503chr1553453 3113 2830 1487 561 1522 ----
NM_033505chr276184 5385 4545 1539 1260 1059 680 1880 22194 1554 16068
NM_033514chr23491 436 148 ------
NM_033516chr941578 1429 1335 363 ------
NM_033549chr53977 832 763 ------
NM_033551chr533222 2516 1184 ------
NM_033624chr1221761 783 --1333 --
NM_033631chr14705 649 435 428 1415 ----
NM_033632chr421353 237 --11568 --
NM_033637chr1033200 2844 1524 22682 1059 ----
NM_033642chrX1488 1132 ----
NM_033656chr2145865 4672 1720 850 ------
NM_044472chr12645 117 ------
NM_052818chr1311865 22181 1497 1145 --
NM_052827chr121119 11137 ----
NM_052834chr1822340 1792 ------
NM_052840chr1531391 628 562 ------
NM_052845chr1243014 2907 2804 96 --11267 --
NM_052855chr172668 647 ------
NM_052860chr531000 915 770 ------
NM_052862chr111002 --1268 --
NM_052867chr1321464 1027 --11051 --
NM_052879chr1253708 2787 2499 866 30 23205 657 11270 --
NM_052885chr1274449 4304 3382 3329 1205 906 71 --35003 3661 3219 --
NM_052886chr83806 789 38 ------
NM_052896chr121890 351 ------
NM_052897chr121567 ------
NM_052898chr821486 549 ------
NM_052900chr841259 389 224 68 ------
NM_052901chr941510 1473 258 71 --132 --
NM_052905chr211539 --11659 2619 299
NM_052906chr2234369 3118 1986 14609 ----
NM_052907chr123895 706 25 21512 471 ----
NM_052910chr1352115 1770 1433 234 172 11592 ----
NM_052911chr181742 1896 ----
NM_052913chr62899 54 ------
NM_052918chr1043329 2670 2322 1149 --23201 291 12992
NM_052923chr6180 ------
NM_052927chr532074 1791 853 --1271 --
NM_052937chr841799 1050 798 456 ------
NM_052953chr3--1258 ----
NM_052954chr2132143 1714 915 11499 ----
NM_052978chr1411390 ------
NM_053001chr83271 263 121 ------
NM_053002chr33907 479 204 ------
NM_053016chr9148044 7865 7850 7770 7134 3000 2397 1826 813 506 410 144 64 52 22478 2424 22228 317 16477
NM_053024chr321501 197 --1295 --
NM_053025chr311766 11165 ----
NM_053026chr311766 11165 ----
NM_053027chr311766 11165 ----
NM_053028chr311766 11165 ----
NM_053031chr311766 11165 ----
NM_053032chr311766 11165 ----
NM_053046chr191408 ------
NM_053056chr1162869 2705 2558 2229 2002 945 ------
NM_053064chr1422162 1046 1666 11241 --
NM_053275chr12161 ------
NM_053279chr862549 2433 1002 884 743 478 1215 --12586
NM_053281chrX1277 ------
NM_054016chr13503 249 48 1314 11274 --
NM_054016chr13503 249 48 1314 11274 --
NM_054016chr13503 249 48 1314 11274 --
NM_054033chr24564 445 243 173 ------
NM_057159chr941337 580 414 111 ------