TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3175
miRNA Sequence: CGGGGAGAGAACGCAGUGACGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr51271 --161 --
NM_000020chr1271977 1939 1878 1558 502 444 216 22210 1914 32126 1880 233 2552 236
NM_000024chr52507 446 --1437 --
NM_000037chr8102455 2194 2168 2076 1659 789 758 610 597 430 21824 553 32516 1967 922 --
NM_000044chrX183 ----124
NM_000053chr1331305 487 117 1295 1535 --
NM_000063chr62280 234 --1101 --
NM_000068chr1941182 578 114 73 1632 ----
NM_000075chr123230 105 45 1188 ----
NM_000080chr176833 826 628 227 92 22 --1610 --
NM_000081chr12431 285 --1321 --
NM_000084chrX105856 5562 5370 4815 4224 1997 1454 1208 818 723 36601 5009 2220 35865 5415 5413 --
NM_000088chr1761217 1187 1161 393 160 27 31267 868 407 41289 1174 1172 48 21129 421
NM_000090chr22772 618 --1812 --
NM_000092chr253958 3071 3015 987 103 33123 993 849 --1884
NM_000093chr942127 2114 1906 541 --3968 414 107 22191 728
NM_000109chrX1848 ------
NM_000110chr1----11046 --
NM_000125chr6104023 3333 3160 1557 1450 1440 1229 835 585 85 --32712 900 238 1774
NM_000127chr8159 ----165
NM_000129chr641420 1178 974 481 1382 --1211
NM_000138chr1542423 1847 1782 988 --167 --
NM_000141chr1021036 498 1943 1183 --
NM_000163chr552000 1941 1835 1729 138 1723 ----
NM_000166chrX4599 250 135 123 --167 --
NM_000167chrX2686 337 ------
NM_000168chr7123238 2830 2490 2431 2171 2154 2111 972 767 593 443 201 12815 22330 769 12641
NM_000170chr9279 42 --1478 145
NM_000175chr194191 57 36 25 ------
NM_000176chr553458 3387 3269 3083 633 13519 ----
NM_000183chr21100 ------
NM_000188chr104695 488 191 43 2208 32 ----
NM_000192chr121363 1300 2570 311 --
NM_000202chrX143296 3254 2761 2693 2673 2532 2521 2493 2483 1562 1526 1025 232 39 23940 2420 22613 2452 --
NM_000210chr2165 --1770 --
NM_000212chr174901 741 638 290 --21967 547 11928
NM_000216chrX43176 789 315 114 --13824 23152 1435
NM_000217chr12134187 4177 3819 3690 3679 3661 3453 2104 1854 1782 1615 1603 1002 1318 55223 4936 3655 3353 641 11960
NM_000221chr24620 319 288 210 2306 149 2229 63 --
NM_000232chr442672 2394 2194 1154 12247 ----
NM_000233chr21735 ------
NM_000237chr821520 1205 --2713 711 --
NM_000238chr73155 128 63 ------
NM_000259chr15166371 5743 5439 5024 4884 4545 4160 2483 2426 2416 2248 1933 1012 906 406 113 14627 11915 24548 145
NM_000264chr9113360 3342 2216 2073 1212 1174 1087 902 896 820 285 --1822 --
NM_000266chrX2202 113 --1253 --
NM_000267chr1763475 2935 2748 1121 385 63 11133 32590 883 81 12142
NM_000268chr22143682 3473 3467 2876 2605 1383 1304 979 838 436 282 253 199 38 22640 1016 1785 1130
NM_000271chr182578 223 ------
NM_000276chrX52171 1957 1447 855 463 1784 12130 1355
NM_000278chr1082002 1659 1597 1541 908 839 750 255 1770 132224 2007 2005 1713 1662 1642 1640 1627 1625 1611 1609 863 562 21892 1716
NM_000280chr11----1688 --
NM_000281chr103319 98 28 1308 ----
NM_000284chrX21712 1563 --1283 11287
NM_000304chr172412 386 ------
NM_000310chr151243 991 984 505 46 ------
NM_000314chr1042690 2424 921 281 ------
NM_000318chr852746 1869 661 546 124 ------
NM_000319chr123990 249 68 --1371 171
NM_000321chr134454 260 78 53 --11280 --
NM_000322chr671594 1433 1077 370 236 127 97 11162 2129 67 --
NM_000330chrX31524 735 437 21993 195 11509 --
NM_000332chr6106211 6168 6127 5952 5912 5480 2428 1164 442 33 --45677 2869 662 35 26513 611
NM_000333chr331125 165 104 1450 1396 --
NM_000334chr17132105 2086 1904 1848 1793 1784 1749 701 673 412 272 116 53 1601 52088 2033 1938 1869 1800 1415
NM_000335chr331771 1534 655 --2847 734 --
NM_000345chr42182 126 --1868 --
NM_000346chr1741965 1919 359 143 --11947 --
NM_000353chr162977 249 2180 68 1201 2418 147
NM_000361chr2061814 559 448 440 194 109 2552 50 1572 --
NM_000362chr22143422 3406 3007 2678 2268 2216 1433 1424 1393 1248 822 387 50 29 22692 646 51215 824 415 400 371 170
NM_000367chr622120 477 11505 --11569
NM_000368chr994693 4357 4100 3722 1037 930 376 286 196 44244 3811 1159 1133 2716 293 24369 1914
NM_000369chr1411934 11455 11784 21638 1400
NM_000378chr111322 283 73 ----
NM_000389chr651479 1378 980 532 277 61387 1140 382 336 263 126 1289 --
NM_000390chrX33051 2478 936 ------
NM_000393chr21363 --21935 743 --
NM_000394chr216431 419 328 91 81 26 ------
NM_000399chr104938 330 195 169 --2104 102 --
NM_000404chr32136 59 ------
NM_000411chr2183067 2814 2450 2243 2043 1304 666 252 --1254 --
NM_000412chr31263 ------
NM_000421chr17----1127 --
NM_000423chr123394 44 29 ----1173
NM_000425chrX2712 210 161 1589 --
NM_000430chr1753307 3096 3061 3040 24 13619 --23433 840
NM_000435chr198997 867 716 647 281 261 179 75 1635 4747 284 266 251 --
NM_000439chr592272 2058 1830 1614 1567 813 763 736 43 ----1138
NM_000442chr1731127 514 213 ------
NM_000445chr83769 233 90 --1772 2308 227
NM_000448chr1162708 2668 2497 1011 70 44 --21013 390 --
NM_000449chr111058 --2943 116 21358 538
NM_000450chr151464 683 325 268 77 --2327 79 --
NM_000452chr1381968 1890 1819 1770 1517 1312 730 261 ------
NM_000458chr175744 679 630 224 194 1846 1632 --
NM_000461chr394361 3340 3307 2965 1154 1139 878 791 524 34136 3586 1314 14280 --
NM_000462chr152408 167 --11287 --
NM_000476chr951378 1052 431 299 280 2272 22 ----
NM_000478chr14663 647 213 158 296 50 1172 1494
NM_000484chr211200 --1294 --
NM_000488chr1127 ------
NM_000489chrX103065 3045 2917 2825 2477 1098 795 777 172 123 --1798 --
NM_000493chr61151 ------
NM_000500chr68507 428 416 379 318 156 68 41 --1372 --
NM_000503chr831716 1505 1327 21387 1304 ----
NM_000505chr5123 ------
NM_000522chr75990 911 838 217 138 ------
NM_000523chr22136 90 --2269 141 1868
NM_000530chr15848 305 280 268 244 1341 1359 --
NM_000533chrX91831 1382 762 756 475 309 174 162 70 1257 21612 176 --
NM_000544chr6_cox_hap1133284 3123 3106 2745 2475 2428 2288 1290 1151 1004 998 745 73 33085 1330 1190 12445 1921
NM_000546chr1721121 858 123 31133 52 50 --
NM_000555chrX177629 7546 7124 6995 6668 6107 5664 5608 5576 5033 5020 3137 3024 2573 2405 1959 340 22691 497 97652 7003 6997 5628 5626 4935 2777 2702 177 36979 3087 712
NM_000557chr203350 190 22 1392 ----
NM_000567chr13890 768 132 3907 410 165 --2964 899
NM_000578chr261716 1632 1389 1311 1298 677 --1465 --
NM_000594chr6136 2733 25 ----
NM_000598chr741508 1353 1256 398 ------
NM_000599chr2154050 3980 3532 3246 2856 1450 1169 1121 1022 830 611 551 496 68 23 52876 1680 1459 1229 773 84316 4314 4103 3469 2994 639 613 566 33484 3190 642
NM_000602chr74599 311 244 170 2541 198 21016 617 11181
NM_000609chr10172992 2795 2730 2706 2615 2357 2347 2208 1267 1215 1085 984 888 854 454 288 83 --12080 --
NM_000612chr11123680 3551 2896 2356 700 321 259 167 150 123 95 51 33617 694 500 63629 3553 2903 629 522 169 12745
NM_000615chr1132902 1844 187 --22419 893 11847
NM_000618chr1295787 5399 4787 4658 2613 2383 2331 2026 498 1534 46347 5642 4223 131 35645 4661 2619
NM_000618chr1295787 5399 4787 4658 2613 2383 2331 2026 498 1534 46347 5642 4223 131 35645 4661 2619
NM_000620chr1282135 1907 1431 720 410 338 252 126 42079 2071 1403 828 31894 1868 505 --
NM_000621chr1311285 ------
NM_000633chr1854824 3183 1669 1046 561 ----13380
NM_000635chr1961399 1051 601 446 291 22 --21580 448 --
NM_000660chr193231 209 195 --2219 217 --
NM_000665chr71170 ------
NM_000668chr451363 1169 1145 43 21 ------
NM_000679chr52517 26 ------
NM_000684chr102810 435 139 1317 --
NM_000687chr20157 --159 --
NM_000689chr92346 48 ------
NM_000693chr1551574 1429 252 160 92 ----1424
NM_000700chr9------1198
NM_000719chr12206459 6306 6192 6062 5672 5618 5329 5199 5001 4826 4473 4441 4420 4229 2631 2136 1908 790 308 251 66431 5781 5109 4483 4460 1854 36316 5706 5201 34448 2508 409
NM_000721chr1162683 2655 2525 2330 2119 2082 1891 1834 1815 1737 1675 524 434 299 190 35 1313 1436 --
NM_000723chr1781346 1295 1283 432 368 361 274 257 21101 677 3449 276 107 11641
NM_000725chr122639 263 1332 2941 265 1642
NM_000726chr231348 1063 315 ------
NM_000738chr111783 2916 113 1903 --
NM_000757chr16892 784 735 329 320 79 2884 218 2300 37 1895
NM_000767chr1961424 1069 1003 326 126 79 21565 342 11397 --
NM_000773chr101120 ------
NM_000791chr54972 731 39 33 2954 129 ----
NM_000795chr113932 108 42 2155 35 1924 --
NM_000800chr541345 411 389 358 1670 ----
NM_000801chr2051065 997 964 942 28 --2201 191 --
NM_000806chr521628 1282 ------
NM_000809chr4148838 8213 7532 6854 6829 6340 5694 3551 3198 2645 1630 1541 756 375 26068 5909 47656 5763 3605 579 43582 3201 2588 1183
NM_000810chr15--2392 83 ----
NM_000811chr52674 283 1176 ----
NM_000813chr544330 2131 1630 369 31169 363 42 ----
NM_000814chr1543939 3595 3398 3382 23641 3141 23254 956 13942
NM_000817chr241062 294 240 42 ------
NM_000818chr103527 475 400 ------
NM_000826chr42164 96 --1960 11863
NM_000827chr562002 1920 1841 1804 1613 429 62168 1600 631 558 452 45 --11835
NM_000831chr1104422 4104 4018 3976 1768 1622 1156 374 295 265 85577 5406 5007 3843 1185 1070 988 197 35534 5532 297 --
NM_000833chr1641283 1122 595 171 11172 11267 21389 1012
NM_000834chr121404 --61298 898 216 208 190 188 --
NM_000836chr197933 854 725 698 654 628 366 4994 939 793 742 ----
NM_000837chr83407 92 85 1383 1365 1134
NM_000838chr642589 1093 627 46 1586 1565 --
NM_000842chr111680 1657 ----
NM_000849chr153109 2987 2231 2143 202 23017 211 ----
NM_000855chr112338 26 ------
NM_000864chr11794 --2960 823 --
NM_000868chrX52526 841 300 288 255 --1257 --
NM_000870chr561010 654 630 422 233 223 11309 2999 560 1240
NM_000875chr15186003 5956 4778 4615 4417 4373 4326 2156 1726 1578 1405 1396 1336 972 845 812 333 316 1860 95874 5843 2607 1338 957 611 338 336 326 36450 1584 297
NM_000876chr61448 --2380 378 --
NM_000883chr74621 528 484 69 1517 --1629
NM_000883chr74621 528 484 69 1517 --1629
NM_000891chr1763631 3600 3335 2860 2276 586 ------
NM_000899chr122813 608 ------
NM_000901chr4138 1209 ----
NM_000902chr352913 2823 2077 1068 698 42899 2388 2304 1139 ----
NM_000917chr10124 ------
NM_000919chr52464 58 ------
NM_000922chr1131047 422 163 ------
NM_000924chr1281353 1269 1143 1132 1019 470 367 77 3977 321 169 --21135 867
NM_000933chr2021651 314 ------
NM_000935chr331067 1020 954 ------
NM_000945chr241704 1387 542 178 11318 ----
NM_000960chr194499 491 222 135 1269 ----
NM_000964chr1781336 1181 957 943 461 411 357 127 21002 389 11263 --
NM_000965chr311287 2162 31 ----
NM_000966chr1271025 988 936 672 191 104 63 2770 300 21042 743 2746 107
NM_000983chr13528 373 129 ------
NM_000984chr171437 ------
NM_001001132chr2141368 1337 1289 1277 --41370 1032 542 299 --
NM_001001323chr1222651 171 ----12875
NM_001001331chr362217 1930 1905 899 355 252 11876 --12313
NM_001001395chr1222658 2236 11889 12559 1964
NM_001001396chr1103825 3459 3318 3262 3200 1685 1324 767 617 241 53882 3428 1784 1369 837 63544 3070 1755 949 861 604 33985 2913 1516
NM_001001433chr2092828 2696 2555 2388 1143 1070 153 147 42 1546 12648 --
NM_001001481chr843419 3151 2615 2232 ------
NM_001001484chr1022423 958 11711 --2500 300
NM_001001502chr51108 ----193
NM_001001523chr181261 846 424 349 244 86 52 27 ----21205 30
NM_001001549chr742150 2004 1792 206 1604 --12023
NM_001001550chr742150 2004 1792 206 1604 --12023
NM_001001555chr742150 2004 1792 206 1604 --12023
NM_001001557chr832227 1679 277 21591 172 11521 --
NM_001001664chr262647 1212 1203 1113 361 45 ----12564
NM_001001684chr1742351 1793 789 509 1226 --1329
NM_001001701chr442185 2137 1486 1437 --1635 --
NM_001001740chr1--1201 196 199
NM_001001740chr1--1201 196 199
NM_001001890chr2174168 2999 2982 2838 2824 2786 973 --53994 2943 2856 2813 2799 14088
NM_001001924chr851489 1430 1386 1354 464 --21483 1388 --
NM_001001925chr851489 1430 1386 1354 464 --21483 1388 --
NM_001001931chr851489 1430 1386 1354 464 --21483 1388 --
NM_001001936chr1021143 909 ----1483
NM_001001938chr9143980 3718 3574 3552 3475 3458 3439 3348 3188 1440 1287 1030 290 275 12615 11092 13801
NM_001001974chr1012139 ------
NM_001001995chrX1549 ------
NM_001002009chr71180 1193 129 --
NM_001002010chr71180 1193 129 --
NM_001002026chr372283 1716 931 371 336 329 297 1669 12285 2524 452
NM_001002032chr172595 61 ------
NM_001002233chr831824 1586 775 --52126 1863 1449 1447 115 --
NM_001002243chr2152 ------
NM_001002252chr12187 --130 --
NM_001002257chr263159 2871 622 474 455 325 1667 12480 --
NM_001002265chr102684 156 --1663 --
NM_001002266chr102684 156 --1663 --
NM_001002269chr91434 ------
NM_001002296chr81434 183 ----
NM_001002762chr10132636 2574 2510 2376 2301 2258 2035 1185 825 656 516 262 249 22591 243 22037 1187 12149
NM_001002814chr863795 3670 3628 3614 2668 775 1987 41449 1447 909 115 --
NM_001002838chrX5693 669 611 101 77 1344 --1442
NM_001002860chr1464287 4048 2922 1863 1498 516 21548 1195 21500 552 --
NM_001002909chr1771716 1592 1488 374 317 223 206 12073 1344 --
NM_001002919chr21127 ------
NM_001003406chr2253216 3133 2853 2327 698 22657 1304 52934 2860 1255 1253 453 11227
NM_001003652chr18148495 8303 8174 8040 7643 7402 7384 6845 6295 5565 2818 2364 2222 205 11674 ----
NM_001003674chr18115909 5619 5468 5455 4685 4304 2816 2662 2311 1138 449 42295 2259 1432 1117 24706 1140 --
NM_001003675chr18115909 5619 5468 5455 4685 4304 2816 2662 2311 1138 449 42295 2259 1432 1117 24706 1140 --
NM_001003676chr115642 362 349 337 151 1377 3644 364 261 1800
NM_001003681chr2231489 1388 260 --11569 11578
NM_001003682chr131364 1183 411 1477 1536 11251
NM_001003694chr34588 577 566 431 --248 46 --
NM_001003698chr661698 1670 1635 1491 1236 749 ------
NM_001003699chr661698 1670 1635 1491 1236 749 ------
NM_001003712chr1231585 1531 1118 ------
NM_001003760chr673232 2524 1113 1090 672 410 286 --1527 --
NM_001003792chr32447 417 ------
NM_001003793chr32447 417 ------
NM_001003796chr225885 224 191 38 27 ------
NM_001003799chr72580 242 1252 --1562
NM_001003800chr963558 1484 1248 1177 1107 350 32833 1141 189 31328 1224 574 11513
NM_001003809chr184343 77 61 46 --179 --
NM_001003810chr41619 --1257 --
NM_001003940chr15113612 3586 3026 2764 2571 2511 2384 1512 1428 1173 137 --73855 2398 2391 1257 1255 1247 1031 --
NM_001003942chr15113612 3586 3026 2764 2571 2511 2384 1512 1428 1173 137 --73855 2398 2391 1257 1255 1247 1031 --
NM_001003943chr15113616 3590 3030 2768 2575 2515 2388 1516 1432 1177 141 --73859 2402 2395 1261 1259 1251 1035 --
NM_001004065chr963644 2858 1560 558 438 424 12561 --1519
NM_001004106chr52803 396 1952 182 --
NM_001004127chr133787 761 368 1638 1692 1849
NM_001004317chr651642 1223 908 570 355 --23742 625 --
NM_001004342chr1235561 5354 5055 4761 4620 4504 3892 1998 1872 1477 1413 1240 882 847 833 783 768 760 746 732 722 670 609 55554 4163 1249 457 262 85816 1906 1480 1415 1316 815 737 703 11433
NM_001004354chr97807 801 762 756 361 180 59 2785 220 5863 861 823 817 770 1920
NM_001004356chr441547 1067 1048 221 --21367 1268 --
NM_001004358chr441547 1067 1048 221 --21367 1268 --
NM_001004419chr1284070 4027 3576 1533 1250 559 490 272 34357 4041 3585 34370 4364 4334 24317 1332
NM_001004439chr1571020 922 508 463 281 152 131 2944 514 ----
NM_001005209chr2199 --1681 1102
NM_001005217chr42759 74 ------
NM_001005271chr1771088 1080 717 353 262 197 149 5859 739 343 304 95 ----
NM_001005273chr1771088 1080 717 353 262 197 149 5859 739 343 304 95 ----
NM_001005290chr13389 367 108 ------
NM_001005336chr93155 107 90 ------
NM_001005354chr124572 519 47 22 2421 102 1521 --
NM_001005366chr121883 --2772 770 --
NM_001005375chrY11182 --11397 --
NM_001005377chr19156 ------
NM_001005386chr23515 204 101 1813 ----
NM_001005404chr17114287 4266 3667 3503 3011 1336 1277 644 542 224 177 --22845 1566 23375 62
NM_001005463chr1032089 1047 715 12435 21842 863 --
NM_001005473chr5106305 5698 5640 5463 4334 2436 2301 371 197 83 24837 1340 15843 25674 4923
NM_001005502chr12125037 4920 4421 3472 3417 1234 1173 1159 1143 967 951 118 11975 23443 1704 1955
NM_001005505chr361168 1139 259 101 78 56 --11249 --
NM_001005609chrX113568 3464 3444 3352 2566 2487 1542 1404 1323 413 36 32418 1423 140 23849 3027 23634 604
NM_001005611chrX2361 150 ------
NM_001005743chr142249 85 --31177 368 255 --
NM_001005744chr142249 85 --31177 368 255 --
NM_001005745chr142249 85 --31177 368 255 --
NM_001005746chr231348 1063 315 ------
NM_001005747chr231348 1063 315 ------
NM_001005753chr242063 1861 513 36 1666 11705 --
NM_001005782chr22217 28 ------
NM_001005845chr831700 51 39 ------
NM_001005849chr171561 1143 1135 --
NM_001005910chr33544 79 61 --1499 --
NM_001005911chr33544 79 61 --1499 --
NM_001005920chr1641003 995 821 273 11090 ----
NM_001006115chr382353 2250 2019 1126 874 831 718 685 51933 627 417 209 36 32128 1750 407 1918
NM_001006600chr52431 378 ------
NM_001006605chr141178 1117 946 111 ----1909
NM_001006605chr141178 1117 946 111 ----1909
NM_001006612chrX1382 ------
NM_001006613chrX1382 ------
NM_001006614chrX1382 ------
NM_001006617chr921316 998 ------
NM_001006619chr921316 998 ------
NM_001006620chr921316 998 ------
NM_001006621chr921316 998 ------
NM_001006636chr21820 ------
NM_001006657chr282989 2964 2839 2457 2254 2053 245 235 12373 22841 2422 12000
NM_001006665chr12765 168 2174 60 ----
NM_001006933chrX158 ------
NM_001006946chr281647 1460 1392 1226 612 298 87 59 1108 --1301
NM_001007024chr1763519 3460 3041 957 549 536 11671 73736 3117 477 460 443 437 430 3847 450 257
NM_001007025chr1763519 3460 3041 957 549 536 11671 73736 3117 477 460 443 437 430 3847 450 257
NM_001007026chr122390 63 2537 442 ----
NM_001007067chr841011 880 344 84 ------
NM_001007068chr841011 880 344 84 ------
NM_001007069chr841011 880 344 84 ------
NM_001007070chr841011 880 344 84 ------
NM_001007097chr984531 4201 4077 4022 3873 3822 3513 1958 13647 43827 3825 3504 3094 13697
NM_001007098chr12300 117 ------
NM_001007102chr611135 ------
NM_001007156chr1591762 1685 1222 748 680 431 399 228 199 21725 1700 2423 169 21688 1644
NM_001007226chr1731420 1300 1028 ------
NM_001007227chr1731420 1300 1028 ------
NM_001007228chr1731420 1300 1028 ------
NM_001007229chr1731420 1300 1028 ------
NM_001007230chr1731420 1300 1028 ------
NM_001007237chr13589 461 49 11788 21940 51 --
NM_001007246chr2131272 1194 750 ------
NM_001007259chr21126 ------
NM_001007267chr23705 133 81 ------
NM_001007271chr1031071 167 26 1700 --1376
NM_001007277chr1131118 253 182 --2778 429 --
NM_001007466chr6125154 4790 3866 3665 3147 1964 1896 1806 1630 1108 1055 841 21136 604 21185 479 21844 1477
NM_001007471chr9----172 156
NM_001007544chr11427 --2351 77 1354
NM_001007553chr11444 --21114 78 --
NM_001007559chr1831725 1433 74 ------
NM_001007565chr31276 ------
NM_001007794chr12641 583 ------
NM_001008220chr5133905 3786 3607 3315 3255 2663 1032 883 559 552 306 167 154 2594 314 41034 156 143 124 2886 235
NM_001008222chrX51184 1058 999 937 501 --51016 1011 1006 1001 300 --
NM_001008225chr71578 ------
NM_001008239chr1893715 3510 2753 2504 786 699 661 216 143 33220 2899 594 62528 2506 1009 791 789 148 11392
NM_001008272chr31226 --2290 94 --
NM_001008273chr31226 --2290 94 --
NM_001008388chr43209 107 92 ------
NM_001008392chr383411 3378 2879 1347 1279 800 318 77 12640 ----
NM_001008407chr751502 1335 653 556 21 11451 ----
NM_001008495chr821736 505 ------
NM_001008529chr1711220 11296 1444 --
NM_001008541chr1022256 1773 1709 194 --
NM_001008541chr1022256 1773 1709 194 --
NM_001008564chr1331448 851 121 ------
NM_001008566chr221369 1443 ----
NM_001008660chr1121441 114 ------
NM_001008701chr19172975 2963 2839 2829 2750 2742 2480 2285 2027 2021 848 720 689 528 434 316 201 22939 891 5880 878 817 617 318 32868 2505 113
NM_001008726chr1451692 1663 1650 1619 1543 11608 11529 --
NM_001008738chr542161 1909 1054 89 22359 2349 ----
NM_001008744chr1421031 85 ----11251
NM_001008777chr171232 ------
NM_001008925chr423272 863 --21148 603 --
NM_001008938chr111174 ------
NM_001009184chr83407 92 85 1383 1365 1134
NM_001009185chr52704 568 ------
NM_001009552chr81501 ------
NM_001009554chr473420 1870 1763 1754 1583 1505 534 1658 --1176
NM_001009554chr473420 1870 1763 1754 1583 1505 534 1658 --1176
NM_001009555chr421330 1246 ----11439
NM_001009566chr151412 1117 166 121 60 --61119 1074 1072 1067 1065 293 --
NM_001009571chr751495 1488 1355 1197 1115 11638 11558 --
NM_001009880chr22114811 4372 4332 3999 3642 1731 1564 1499 1252 1088 938 1506 84546 3588 1943 1805 1569 1567 887 191 --
NM_001009899chr3106267 5948 5738 5293 4434 1979 1552 1435 871 687 --14406 15024
NM_001009955chr12160 120 --1113 --
NM_001009955chr12160 120 --1113 --
NM_001009958chr7--270 36 ----
NM_001009993chr274362 4327 3661 3029 1661 1463 1303 13193 34111 3736 2841 21606 1036
NM_001009996chr31199 ------
NM_001010861chr142485 820 715 173 11775 1153 --
NM_001010862chrX63100 2649 2602 2151 734 201 --42875 2494 414 96 12610
NM_001010888chrX64103 4094 3740 3642 1580 1408 14495 34081 3745 3743 --
NM_001010891chr576955 6444 5635 5549 5188 5054 2605 ------
NM_001010895chr94455 376 182 49 1640 1457 --
NM_001010898chr1143712 3435 3372 3216 2456 2442 1327 1169 1106 954 663 342 141 28 83386 3096 2798 964 823 776 294 170 73721 3719 1003 803 350 348 30 1692
NM_001010908chr101645 ------
NM_001010911chr1041055 943 719 212 --11069 --
NM_001010924chr102994 457 --1333 --
NM_001010926chr1279 55 ------
NM_001010934chr7132 ------
NM_001011513chr483948 3119 2943 2863 2855 2777 1112 1057 --1933 --
NM_001011553chr71765 ------
NM_001011645chrX183 ----124
NM_001011658chrX41810 1393 689 358 ------
NM_001011663chr10--1290 ----
NM_001011666chr7146094 5999 5866 5045 4784 4759 4514 4493 1965 1791 1574 680 573 491 45957 1264 638 102 22467 575 14449
NM_001011705chr131286 --1271 --
NM_001011708chr262761 2561 2020 1156 1120 1104 --22793 1128 --
NM_001011713chr1411004 ------
NM_001012264chr146784 773 764 736 691 242 3748 392 227 1634 --
NM_001012267chr941455 542 479 471 11832 11977 --
NM_001012300chr123228 222 31 1216 144 --
NM_001012329chr192093 1664 1555 659 493 343 331 108 102 --42155 2095 1735 1584 --
NM_001012338chr15141 --363 48 46 --
NM_001012393chr11104338 4184 4163 3211 2045 1817 1492 1350 887 276 13218 31014 957 294 2960 297
NM_001012398chr161896 ----1962
NM_001012415chr9----2730 217 --
NM_001012420chr1542350 1885 572 70 ------
NM_001012421chr91870 1641 ----
NM_001012423chr1542350 1885 572 70 ------
NM_001012426chr6203076 2874 2648 2394 1243 1188 1175 1112 1083 961 943 916 907 795 707 456 324 309 279 42 93025 2997 2466 2449 1363 1061 495 260 249 41333 963 797 67 33292 1179 327
NM_001012427chr6203076 2874 2648 2394 1243 1188 1175 1112 1083 961 943 916 907 795 707 456 324 309 279 42 93025 2997 2466 2449 1363 1061 495 260 249 41333 963 797 67 33292 1179 327
NM_001012512chr181208 ------
NM_001012513chr182219 28 ------
NM_001012514chr26955 906 177 156 76 70 1139 --1129
NM_001012516chr26955 906 177 156 76 70 1139 --1129
NM_001012643chr195561 224 128 100 37 2380 372 --140
NM_001012644chr20143 126 ----
NM_001012732chr44868 261 158 146 ------
NM_001012751chr1021670 426 1508 11259 --
NM_001012755chrX94670 4597 4411 4385 1638 1440 1290 1008 772 14356 54573 3568 2040 985 45 53230 1378 1144 988 215
NM_001012756chr1942443 2237 981 577 ------
NM_001012968chrX4574 566 529 519 1817 1568 2399 349
NM_001012977chrX121173 1161 1148 1000 523 417 321 207 188 155 131 82 1432 12987 497 489 487 288 209 190 178 160 158 148 146 --
NM_001012989chrX3251 55 35 --1269 --
NM_001013031chr1093127 2416 2404 1105 697 684 480 250 228 --2816 235 22407 866
NM_001013398chr741508 1353 1256 398 ------
NM_001013415chr4257 48 ------
NM_001013438chr311014 ------
NM_001013439chr31860 ------
NM_001013620chr1287976 7603 5910 3209 2931 1733 1593 1020 1754 12338 27542 1552
NM_001013624chr1751026 1019 353 227 30 21153 983 3971 909 52 --
NM_001013635chr1231150 137 27 21125 297 61217 1055 1049 1047 831 290 --
NM_001013642chr141159 907 471 465 31148 266 159 21108 206 --
NM_001013690chr12142460 2398 2362 2181 2121 2046 1906 1807 1741 1636 935 905 876 571 52191 1625 529 487 479 92400 2364 1744 1619 463 410 408 364 335 1375
NM_001013693chr172631 2155 733 429 258 235 206 22454 1974 12241 --
NM_001013693chr172631 2155 733 429 258 235 206 22454 1974 12241 --
NM_001013839chr1782231 2131 1644 568 515 386 350 209 22526 1034 --1176
NM_001013843chr15147 ------
NM_001014434chr13825 188 35 1720 ----
NM_001014435chr16190 1248 2567 512 --
NM_001014443chr13181 173 59 ------
NM_001014797chr10157729 7603 7196 5831 5645 5477 3026 2942 2516 2292 1807 1460 1216 664 510 11059 97731 7447 7236 2770 2353 2342 2258 1633 437 11052
NM_001014809chr42246 135 ----1758
NM_001014831chr194625 520 252 88 1584 ----
NM_001014832chr194625 520 252 88 1584 ----
NM_001014834chr194625 520 252 88 1584 ----
NM_001014835chr194625 520 252 88 1584 ----
NM_001014839chr151036 905 425 406 317 3823 109 96 165 1842
NM_001014841chr151036 905 425 406 317 3823 109 96 165 1842
NM_001015053chr17101237 1228 1124 1058 556 414 238 188 128 106 21244 325 71543 1495 1493 1266 558 520 416 1214
NM_001015508chr82704 629 ------
NM_001015877chrX31139 658 522 ------
NM_001015880chr1041368 1109 495 378 ------
NM_001015881chrX1451 177 1459 1904
NM_001015882chr92795 155 --1789 --
NM_001015887chr341521 1490 1313 621 1203 1442 --
NM_001017368chr17122491 2337 2214 2203 1838 1124 932 885 854 676 337 306 1413 1444 1164
NM_001017371chr21875 --11087 --
NM_001017395chr383078 2779 2487 1434 1048 961 521 417 --23083 3081 1420
NM_001017415chr11118 ------
NM_001017416chr11118 ------
NM_001017424chr151577 579 526 279 273 ------
NM_001017425chr151577 579 526 279 273 ------
NM_001017440chr7237989 7796 7394 7388 6741 6554 6516 6412 5759 5582 5469 2943 2251 2156 2094 1737 1613 1515 1062 884 736 181 69 46922 6646 2548 391 67614 7450 1918 1602 1093 849 47960 7534 2650 1631
NM_001017523chr1281920 1800 1741 1639 1615 1494 46 26 ------
NM_001017916chr1791878 1711 1611 1586 815 772 703 176 166 21666 529 41703 1569 1394 1392 --
NM_001017917chr1791878 1711 1611 1586 815 772 703 176 166 21666 529 41703 1569 1394 1392 --
NM_001017920chr2----1127 --
NM_001017923chr1431410 47 30 ------
NM_001017926chr831729 1682 1571 ------
NM_001017930chrX31428 1069 1036 ------
NM_001017962chr10124 ------
NM_001017973chr5121 ------
NM_001017974chr5121 ------
NM_001017977chr12261 117 ------
NM_001017992chr52107 34 ----1136
NM_001017995chr5134595 3628 3376 3028 2953 1934 1429 1048 937 606 475 371 273 54209 1674 1625 558 318 44231 3131 3050 1484 --
NM_001017999chr132275 2095 1476 11439 4379 369 185 183 --
NM_001017999chr132275 2095 1476 11439 4379 369 185 183 --
NM_001018000chr132275 2095 1476 11439 4379 369 185 183 --
NM_001018000chr132275 2095 1476 11439 4379 369 185 183 --
NM_001018001chr132275 2095 1476 11439 4379 369 185 183 --
NM_001018004chr152530 204 ------
NM_001018005chr15232 22 ------
NM_001018006chr152530 204 ------
NM_001018007chr152530 204 ------
NM_001018020chr152530 204 ------
NM_001018050chr2293015 2765 2752 2693 2614 2603 767 176 154 12739 23253 2695 --
NM_001018052chr2293015 2765 2752 2693 2614 2603 767 176 154 12739 23253 2695 --
NM_001018054chr11480 --11236 --
NM_001018056chr9193 ------
NM_001018057chr1141462 1386 164 93 --2354 120 2108 55
NM_001018064chr94843 780 215 100 241 29 2284 228 --
NM_001018065chr9165908 5853 5686 5039 4896 4609 3963 3873 2260 2121 1670 1424 1075 758 575 372 35699 4336 606 2621 243 --
NM_001018066chr9165908 5853 5686 5039 4896 4609 3963 3873 2260 2121 1670 1424 1075 758 575 372 35699 4336 606 2621 243 --
NM_001018070chr111213 2267 47 2236 31 --
NM_001018072chr1281920 1800 1741 1639 1615 1494 46 26 ------
NM_001018074chr553458 3387 3269 3083 633 13519 ----
NM_001018075chr553458 3387 3269 3083 633 13519 ----
NM_001018076chr553458 3387 3269 3083 633 13519 ----
NM_001018077chr553458 3387 3269 3083 633 13519 ----
NM_001018108chr1572032 1435 734 654 596 337 158 31509 511 217 51828 1820 727 178 176 1907
NM_001018111chr763529 2839 1274 1056 559 149 33237 1486 612 11126 22676 587
NM_001020658chr121412 128 1451 1441 --
NM_001020658chr121412 128 1451 1441 --
NM_001023567chr1541906 1720 458 70 ------
NM_001023587chr341180 373 317 26 ------
NM_001024094chr553458 3387 3269 3083 633 13519 ----
NM_001024218chr14186 ------
NM_001024226chr1127 --2940 938 --
NM_001024227chr1127 --2940 938 --
NM_001024228chr1127 --2940 938 --
NM_001024401chr16142268 2072 2005 1987 1895 1878 1804 1094 1040 913 788 587 448 363 22551 476 102434 2079 2077 2062 2060 2012 2010 1929 778 776 12113
NM_001024460chr641203 1019 429 302 --1986 1269
NM_001024463chr151848 1335 ----
NM_001024647chr12107464 6930 5069 4910 4676 2545 1968 1954 1058 31 26788 5097 37419 6408 111 --
NM_001024649chr532480 1836 858 22224 2181 2915 38 --
NM_001024666chrX1541 --1181 --
NM_001024680chr221456 1155 ----11471
NM_001024807chr193317 47 41 1220 1346 --
NM_001024808chr12102543 2423 2381 2364 1038 983 915 864 731 536 11907 42749 733 538 310 --
NM_001024809chr1781336 1181 957 943 461 411 357 127 21002 389 11263 --
NM_001024858chr14152762 2706 2691 2630 2558 2382 2103 2058 1992 884 681 315 302 238 70 42636 2506 2273 627 62693 2565 2419 2046 886 694 --
NM_001024912chr1981826 599 424 406 302 257 249 180 2474 85 1209 --
NM_001024934chr6--1559 1206 --
NM_001024935chr6--1559 1206 --
NM_001024936chr6--1559 1206 --
NM_001024937chr179711 608 586 565 511 280 246 63 44 3719 644 253 5697 588 184 82 46 1202
NM_001024947chr521118 1004 ------
NM_001024948chr132854 2424 614 1413 ----
NM_001025076chr10115119 4902 4735 3959 2251 2211 2011 1530 1289 168 21 14342 85926 5237 5001 4917 4276 4274 4266 394 15217
NM_001025077chr10166477 6260 6093 5317 4992 2888 2647 1526 1399 1387 1327 270 247 224 163 21 25700 1296 107284 6595 6359 6275 5634 5632 5624 1752 1163 1128 26575 1213
NM_001025079chr3113537 3095 2922 2708 2657 2543 2528 1511 1131 1000 631 1662 1781 --
NM_001025105chr511227 11335 --161
NM_001025108chr262790 1221 1080 881 644 629 31088 710 518 ----
NM_001025205chr34356 113 65 42 2297 30 191 --
NM_001025232chr122143 68 ------
NM_001025233chr1222088 1072 21035 145 1625 12708
NM_001025266chr384486 4399 3959 3820 1956 1687 1607 1246 53968 1833 1348 893 456 51901 1279 1277 489 159 1504
NM_001025366chr671703 1488 1411 1356 605 51 26 11505 41706 1418 1416 607 --
NM_001025366chr671703 1488 1411 1356 605 51 26 11505 41706 1418 1416 607 --
NM_001025367chr671703 1488 1411 1356 605 51 26 11505 41706 1418 1416 607 --
NM_001025367chr671703 1488 1411 1356 605 51 26 11505 41706 1418 1416 607 --
NM_001025368chr671703 1488 1411 1356 605 51 26 11505 41706 1418 1416 607 --
NM_001025368chr671703 1488 1411 1356 605 51 26 11505 41706 1418 1416 607 --
NM_001025369chr681719 1504 1427 1372 1168 621 67 42 11521 41722 1434 1432 623 --
NM_001025369chr681719 1504 1427 1372 1168 621 67 42 11521 41722 1434 1432 623 --
NM_001025370chr671703 1488 1411 1356 605 51 26 11505 41706 1418 1416 607 --
NM_001025370chr671703 1488 1411 1356 605 51 26 11505 41706 1418 1416 607 --
NM_001025579chr1771175 1129 866 819 122 43 21 --2762 479 --
NM_001025580chrX74026 3604 3257 614 392 378 359 13933 23206 333 21389 49
NM_001025595chr421597 138 11637 ----
NM_001025603chr111058 --2943 116 21358 538
NM_001025616chr441732 1642 1564 423 --21734 622 --
NM_001025777chr231379 518 379 1507 ----
NM_001029858chr663349 2909 2120 1299 840 237 12997 12843 12846
NM_001029859chr11102271 1854 1665 920 876 781 461 328 314 136 42307 1746 1575 469 21829 922 --
NM_001029860chr8123 ----187
NM_001029863chr61431 12939 1992 --
NM_001029864chr2042118 2023 1861 370 11880 32450 2448 372 --
NM_001029871chr20171779 1755 1740 1731 1445 1255 675 439 428 381 317 293 281 230 192 158 54 --8338 324 322 219 207 92 77 69 --
NM_001029875chr5112806 2591 2035 1860 1198 1184 1169 1161 1115 552 138 --12593 --
NM_001029882chr1----2182 158 --
NM_001029882chr1----2182 158 --
NM_001029883chr242948 2700 749 517 21988 758 33051 991 751 --
NM_001029976chr8152 285 45 ----
NM_001029998chr42459 286 --11315 11129
NM_001030001chr141327 ------
NM_001030007chr16122836 2820 2714 2545 1449 1061 768 760 545 241 232 185 13088 33631 2822 187 --
NM_001030055chr141833 --11479 --
NM_001030272chr112498 420 ------
NM_001030273chr112498 420 ------
NM_001030287chr12381 88 2804 164 ----
NM_001031677chr53388 345 41 ----1430
NM_001031679chr1273152 2659 2574 2526 2496 2425 2224 12732 32726 358 301 11250
NM_001031680chr172153 1939 746 632 543 363 344 11959 32009 828 659 11920
NM_001031690chr7183068 2759 2738 2731 2257 2251 2100 1998 1223 1171 1135 1065 834 819 435 376 134 67 21988 1180 1942 12341
NM_001031695chr22135201 5146 5095 5077 4923 4720 4503 3475 1609 1562 1220 828 601 35349 4941 3300 105082 5080 4925 4467 3906 3644 1873 950 608 603 24934 4470
NM_001031702chr33771 245 232 --190 --
NM_001031709chr101287 ------
NM_001031720chr41162 ------
NM_001031723chr41314 ------
NM_001031732chr442996 2440 1179 658 12914 --1496
NM_001031738chr2--1206 ----
NM_001031801chr221119 --1146 --
NM_001031804chr1644418 3595 638 595 --34167 3264 446 11149
NM_001031812chr5----2945 559 --
NM_001032221chr971846 1650 1594 1408 1391 671 594 3697 99 58 51504 1496 1494 1464 305 --
NM_001032279chr112339 293 252 42 --1342
NM_001032280chr661521 1475 1180 1112 454 201 1228 31477 1193 1191 --
NM_001032283chr122951 35 ------
NM_001032284chr122951 35 ------
NM_001032288chr204624 577 408 28 11235 1382 --
NM_001032289chrX3171 107 71 1774 2338 336 --
NM_001032293chr17------1120
NM_001032296chr1362845 2174 965 390 187 55 11945 22280 708 1842
NM_001032363chr161877 1789 1533 1483 1466 180 21477 367 ----
NM_001032363chr161877 1789 1533 1483 1466 180 21477 367 ----
NM_001032380chr102527 128 ------
NM_001032393chrX2776 169 ------
NM_001033025chr121231 530 --21251 1224 --
NM_001033044chr171793 1775 1517 1196 352 213 68 11453 161 --
NM_001033047chr462292 2175 1860 1774 1682 429 --51936 1934 78 70 68 --
NM_001033056chr171793 1775 1517 1196 352 213 68 11453 161 --
NM_001033057chr31663 --2665 334 --
NM_001033059chr622004 549 1359 3668 657 650 --
NM_001033081chr13454 190 61 1244 6697 695 456 198 192 67 --
NM_001033082chr13454 190 61 1244 6697 695 456 198 192 67 --
NM_001033085chr21238 ------
NM_001033087chr2082501 2262 2158 2083 1264 894 675 27 11254 ----
NM_001033117chr3174404 4281 4111 4040 3470 1616 1592 1569 1479 1457 1343 1318 544 489 332 321 292 34703 4332 83 34306 4301 3472 --
NM_001033506chr11--1174 ----
NM_001033507chr141613 1504 1488 709 1314 ----
NM_001033551chr17144071 3820 3740 3689 3365 3191 2689 1645 1211 1087 1069 1035 678 576 33625 1436 24 51128 433 431 222 220 21131 597
NM_001033561chr173827 772 334 1317 3832 801 799 --
NM_001033576chr1792562 2297 2007 764 598 215 197 163 69 22041 782 4838 836 776 443 --
NM_001033578chr822167 300 ------
NM_001033602chr1322367 138 22301 507 --12403
NM_001033723chr852481 2465 2196 742 483 --21995 766 1954
NM_001033756chr651637 1422 1345 1290 539 11439 41640 1352 1350 541 --
NM_001033756chr651637 1422 1345 1290 539 11439 41640 1352 1350 541 --
NM_001033952chr112243 27 --1295 --
NM_001034025chr122915 63 1350 ----
NM_001034837chr52625 197 ----1264
NM_001034838chr52625 197 ----1264
NM_001034841chr1683634 1837 1433 1423 1281 1165 376 47 --24455 1734 14213
NM_001034850chr521305 132 ------
NM_001034852chr1472003 1845 1457 1406 1331 759 235 21586 1528 2413 411 11988
NM_001034915chr82550 447 ------
NM_001034954chr1042669 1027 777 435 --1265 --
NM_001034955chr1042669 1027 777 435 --1265 --
NM_001034956chr1042669 1027 777 435 --1265 --
NM_001034957chr1042669 1027 777 435 --1265 --
NM_001035235chr53461 69 36 ------
NM_001035254chr992453 1945 1579 828 730 645 589 143 119 1749 32395 228 79 --
NM_001035260chr101212 ------
NM_001035267chr121282 ------
NM_001035511chr1142141 2127 2111 1862 1766 1405 792 749 716 660 219 167 117 25 --41876 755 721 81 1171
NM_001035512chr1162248 2234 2218 1969 1873 1512 899 856 823 767 326 274 224 132 96 28 --41983 862 828 188 1278
NM_001035513chr1162248 2234 2218 1969 1873 1512 899 856 823 767 326 274 224 132 96 28 --41983 862 828 188 1278
NM_001035521chr24784 666 203 87 2228 133 2737 205 --
NM_001037131chr24845 232 123 102 --1405 --
NM_001037132chr762226 2142 2037 1697 1690 650 ------
NM_001037133chr762226 2142 2037 1697 1690 650 ------
NM_001037164chr7----11787 1204
NM_001037165chr7258366 7531 7087 6561 6449 6251 5897 5780 5615 5544 3478 3278 3241 2864 2454 2127 1823 1427 1068 1043 890 501 285 270 170 26077 2308 48928 2216 1636 255 1276
NM_001037174chr231822 1759 604 1336 ----
NM_001037317chr142485 820 715 173 11775 1153 --
NM_001037332chr592196 2083 585 579 521 494 363 345 169 4559 335 145 126 32171 481 260 --
NM_001037333chr592196 2083 585 579 521 494 363 345 169 4559 335 145 126 32171 481 260 --
NM_001037334chr181626 ------
NM_001037339chr141205 676 632 540 ------
NM_001037340chr141205 676 632 540 ------
NM_001037341chr141205 676 632 540 ------
NM_001037341chr141205 676 632 540 ------
NM_001037553chr2194920 4292 2077 1895 1869 1799 1703 1285 1216 11148 1312 33334 1268 270
NM_001037582chr42615 310 ------
NM_001037631chr21154 ------
NM_001037738chr51291 ------
NM_001037872chr21531 ------
NM_001037954chr1132237 890 44 --23398 1347 --
NM_001038493chr24569 562 343 197 140 2310 209 --
NM_001038640chr153644 256 146 ------
NM_001038702chr542408 2182 1883 787 12229 1789 --
NM_001038707chr1101432 840 747 571 515 441 321 172 163 118 31543 636 434 1453 --
NM_001038707chr1101432 840 747 571 515 441 321 172 163 118 31543 636 434 1453 --
NM_001039029chr1281857 1711 1272 362 317 173 115 100 31526 1510 1401 5797 784 448 155 153 1253
NM_001039199chr2074525 4084 3786 3151 1718 1657 681 --53850 3203 3161 3058 848 --
NM_001039348chr211033 ------
NM_001039349chr211033 ------
NM_001039350chr781282 1100 684 276 238 173 74 64 --180 --
NM_001039459chr741139 883 471 328 1227 1465 --
NM_001039469chr112280 218 --4232 227 125 108 --
NM_001039479chr1481701 1656 971 809 628 376 177 122 1862 11837 11659
NM_001039538chr232913 2716 865 --21032 924 1927
NM_001039548chr11169 ------
NM_001039550chr23749 180 55 --2751 89 --
NM_001039570chr22144386 4154 4036 3979 3951 3420 3346 1837 1824 1101 433 258 136 66 24438 576 44199 3531 105 94 11207
NM_001039571chr22144386 4154 4036 3979 3951 3420 3346 1837 1824 1101 433 258 136 66 24438 576 44199 3531 105 94 11207
NM_001039574chr16914 903 892 685 330 138 --1688 1304
NM_001039577chr193876 3523 3393 3074 1446 1340 1334 876 676 64490 3387 2786 2757 738 79 22875 1286 23765 3527
NM_001039580chr494524 4508 4496 4450 4420 4381 3750 3547 3539 --24527 4511 --
NM_001039582chrX4225 87 75 51 ------
NM_001039583chr224496 219 130 123 ------
NM_001039584chr224496 219 130 123 ------
NM_001039585chr173964 3645 3538 3478 3445 2738 48 13858 21611 1411 11414
NM_001039590chrX63836 3617 3453 3221 3207 2941 --12880 --
NM_001039591chrX63836 3617 3453 3221 3207 2941 --12880 --
NM_001039618chr1155852 4752 2225 203 47 --24633 307 --
NM_001039690chr16112217 2167 2161 2064 1584 1493 490 448 334 256 209 ----11518
NM_001039711chr171048 902 895 746 204 193 170 1161 1828 --
NM_001039712chr171048 902 895 746 204 193 170 1161 1828 --
NM_001039762chr1011949 --21952 282 --
NM_001039771chr1491054 1031 954 946 897 435 323 314 96 --1978 --
NM_001039802chr151311 892 425 368 176 11320 ----
NM_001039840chrX66001 5946 5067 4836 959 82 1890 15925 --
NM_001039877chr193761 660 615 2182 166 2742 247 1152
NM_001039888chr12790 693 ----1796
NM_001039916chr1241019 240 114 89 1848 --11027
NM_001039917chr1241019 240 114 89 1848 --11027
NM_001039918chr1241019 240 114 89 1848 --11027
NM_001039919chr1241019 240 114 89 1848 --11027
NM_001039920chr1241019 240 114 89 1848 --11027
NM_001039937chr1354132 3875 2601 1495 287 ----12863
NM_001039960chr1251418 1383 515 398 80 2456 303 1253 --
NM_001040002chr1771250 1065 362 343 327 117 82 31346 107 89 1205 --
NM_001040020chr741499 1363 489 225 1528 ----
NM_001040057chr731513 1252 206 1985 21254 450 --
NM_001040100chr32358 82 ------
NM_001040110chr761847 1473 1453 697 596 90 11313 1598 11476
NM_001040134chr1951483 1370 1069 257 196 ------
NM_001040144chr16112217 2167 2161 2064 1584 1493 490 448 334 256 209 ----11518
NM_001040146chr16112217 2167 2161 2064 1584 1493 490 448 334 256 209 ----11518
NM_001040151chr11184392 4264 3934 3764 3682 3566 3443 3382 3221 3122 2999 2892 1840 821 774 360 270 110 33833 1120 186 43928 3773 1642 314 23776 3232
NM_001040152chr765096 5021 1855 1794 1384 94 13133 1343 --
NM_001040153chr13199 ------
NM_001040158chr5----1427 --
NM_001040159chr421378 301 --180 --
NM_001040167chr741047 1026 382 96 1735 ----
NM_001040172chr561010 654 630 422 233 223 11309 2999 560 1240
NM_001040173chr561010 654 630 422 233 223 11309 2999 560 1240
NM_001040181chr3------166
NM_001040182chr3------166
NM_001040183chr3------166
NM_001040199chr3------166
NM_001040200chr3------166
NM_001040214chr63345 278 206 12220 ----
NM_001040272chr961658 1516 1453 288 271 136 3838 704 109 42344 460 455 102 --
NM_001040284chr1655257 4347 3694 965 131 --35177 4735 954 --
NM_001040402chr432799 400 110 1868 ----
NM_001040409chr21333 ----1677
NM_001040424chr2152909 2672 931 911 280 12883 12091 1475
NM_001040429chr1323508 2531 ----11210
NM_001040439chr1661363 1351 1121 553 376 235 1348 11123 21429 1312
NM_001040441chr151598 1294 1149 762 61 --41938 1624 1283 1281 13959
NM_001040458chr561685 1505 645 477 439 110 1727 2609 356 --
NM_001040619chr151139 538 128 121 113 31254 614 206 ----
NM_001040624chr862449 2340 2080 2039 1860 528 32351 457 395 1537 1512
NM_001040625chr862449 2340 2080 2039 1860 528 32351 457 395 1537 1512
NM_001040626chr862449 2340 2080 2039 1860 528 32351 457 395 1537 1512
NM_001040627chr862449 2340 2080 2039 1860 528 32351 457 395 1537 1512
NM_001040628chr862449 2340 2080 2039 1860 528 32351 457 395 1537 1512
NM_001040629chr862449 2340 2080 2039 1860 528 32351 457 395 1537 1512
NM_001040630chr862449 2340 2080 2039 1860 528 32351 457 395 1537 1512
NM_001040633chr72773 127 ------
NM_001040697chr111507 ------
NM_001040709chr14817 426 94 77 2916 477 1910 12284
NM_001040712chr932738 2674 988 1431 22530 2528 --
NM_001040715chr1671050 998 814 793 461 455 182 1808 2374 372 --
NM_001042353chr204548 473 411 222 1179 ----
NM_001042361chr1031525 458 179 2257 86 ----
NM_001042364chr1031525 458 179 2257 86 ----
NM_001042365chr1031525 458 179 2257 86 ----
NM_001042387chr1031525 458 179 2257 86 ----
NM_001042388chr183354 273 111 ------
NM_001042393chr1031525 458 179 2257 86 ----
NM_001042396chr1031525 458 179 2257 86 ----
NM_001042397chr1031525 458 179 2257 86 ----
NM_001042404chr161753 1589 1542 390 373 286 21608 503 11323 --
NM_001042413chr993168 2980 2756 1136 1000 521 512 266 200 --34061 1595 1091 11105
NM_001042424chr462834 2744 1273 1074 370 131 2243 150 22291 344 1653
NM_001042425chr661521 1475 1180 1112 454 201 1228 31477 1193 1191 --
NM_001042437chr2------3880 681 155
NM_001042471chr17141 ----122
NM_001042472chr204560 506 231 42 1422 ----
NM_001042481chr1442180 671 496 447 ------
NM_001042486chr2051530 1219 1135 577 468 11562 11224 1417
NM_001042492chr1763475 2935 2748 1121 385 63 11133 32590 883 81 12142
NM_001042494chr1563497 3448 3158 2613 1108 1003 --33640 1250 903 --
NM_001042495chr1563497 3448 3158 2613 1108 1003 --33640 1250 903 --
NM_001042496chr1563497 3448 3158 2613 1108 1003 --33640 1250 903 --
NM_001042497chr1563497 3448 3158 2613 1108 1003 --33640 1250 903 --
NM_001042498chrX5308 244 208 127 100 1911 ----
NM_001042506chrX111183 1157 1107 523 417 321 207 188 155 131 82 1432 12987 497 489 487 288 209 190 178 160 158 148 146 --
NM_001042533chr321087 130 1499 ----
NM_001042539chr169944 938 364 357 272 255 239 162 119 --2987 244 --
NM_001042543chr411013 ------
NM_001042555chr1284132 3198 3127 1856 1235 781 766 534 54146 3540 3191 3043 2985 44774 3033 1846 1212 14170
NM_001042599chr2217621 7062 6789 6733 6484 6443 6187 5978 5766 5738 5473 5443 5160 5041 2600 2526 2161 1911 691 349 79 1114 47591 6717 6328 5512 2540 51
NM_001042601chr332173 661 37 ------
NM_001042603chr1274769 3969 3279 1394 1366 418 236 24371 4180 21789 1546 14848
NM_001042604chr374328 4314 4145 3080 1720 1640 1074 ----13466
NM_001042632chr2092257 1981 1780 1712 1662 1615 533 117 42 21909 887 52317 2315 1929 1903 1664 --
NM_001042633chr2092257 1981 1780 1712 1662 1615 533 117 42 21909 887 52317 2315 1929 1903 1664 --
NM_001042663chr141331 1076 523 235 1348 ----
NM_001042664chr141331 1076 523 235 1348 ----
NM_001042665chr141331 1076 523 235 1348 ----
NM_001042669chr441732 1642 1564 423 --21734 622 --
NM_001042681chr182427 2401 2282 2042 1873 876 569 268 --22155 205 22619 2252
NM_001042682chr182427 2401 2282 2042 1873 876 569 268 --22155 205 22619 2252
NM_001042682chr182427 2401 2282 2042 1873 876 569 268 --22155 205 22619 2252
NM_001042728chr1271025 988 936 672 191 104 63 2770 300 21042 743 2746 107
NM_001042729chr14401 228 197 68 1544 ----
NM_001042747chr14401 228 197 68 1544 ----
NM_001042749chrX21371 440 ------
NM_001042750chrX21371 440 ------
NM_001042751chrX21371 440 ------
NM_001042762chr72879 832 ------
NM_001043318chr14133281 2712 1507 1488 1264 1094 1063 815 808 794 576 502 226 33714 3256 1273 43197 3168 1096 887 --
NM_001043351chr151501 416 141 121 32 21652 422 1177 --
NM_001044305chr641282 1083 224 68 ------
NM_001044385chr293717 3706 3669 3608 3073 2962 1463 414 130 --33806 1332 1206 --
NM_001044722chr5----2945 559 --
NM_001044723chr5----2945 559 --
NM_001046chr542319 849 466 430 ------
NM_001048183chr173735 3718 2698 2574 618 319 250 187 --13773
NM_001069chr61137 ------
NM_001074chr4194 ------
NM_001077628chr12483 183 ----1489
NM_001079874chr151890 1867 439 306 126 ----1271
NM_001080418chr14578 547 539 213 --1541 --
NM_001083620chr42164 96 --1959 11861
NM_001083621chr1114615 4605 4460 4108 3582 3352 3272 958 854 785 558 54497 3820 3394 2876 236 13371 1659
NM_001087chr22323 146 2402 329 ----
NM_001092chr1792191 1841 1566 845 489 474 464 452 423 2623 495 ----
NM_001094chr173578 341 27 --2668 666 --
NM_001095chr1291724 1668 1281 1250 1222 551 519 277 164 51858 468 369 97 75 41272 1224 263 261 --
NM_001096chr171304 --148 --
NM_001100108chr1167470 6817 6754 5850 3006 2483 2426 2200 1614 1562 1230 1209 1097 938 834 707 21574 1224 58240 7852 7472 2151 1153 26444 795
NM_001106chr3138001 7304 3644 3382 3302 3038 2817 2397 2248 1838 508 386 332 27173 7146 39709 2961 499 17478
NM_001113490chrX63479 3374 3230 774 580 572 --156 --
NM_001117chr1872004 1717 759 704 672 652 547 ----32025 762 743
NM_001121chr101171 --11365 --
NM_001122631chr112572 445 1439 ----
NM_001122679chr51271 --161 --
NM_001124chr112563 74 ------
NM_001126chr12935 687 ------
NM_001127chr224874 451 123 73 1709 2985 366 --
NM_001128chr16122836 2820 2714 2545 1449 1061 768 760 545 241 232 185 13088 33631 2822 187 --
NM_001130chr195633 627 334 199 179 1639 ----
NM_001140chr173232 222 193 1116 --1100
NM_001144chr16----1199 --
NM_001146chr821936 1673 --1104 --
NM_001148chr441829 1813 1501 1412 --1321 --
NM_001160chr1252667 2225 680 440 168 ------
NM_001163chr971015 1004 893 812 760 216 38 1333 3158 92 40 --
NM_001167chrX86285 5724 4662 4605 2534 1788 1502 1173 12540 --1402
NM_001173chr141833 --11479 --
NM_001174chrX51966 908 425 270 155 2405 135 1116 --
NM_001175chr123137 75 47 ------
NM_001177chr12----3386 50 48 --
NM_001178chr112498 420 ------
NM_001186chr2152161 702 280 157 39 1850 1645 23220 442
NM_001189chr42981 333 ------
NM_001190chr19--166 1276 --
NM_001191chr2051399 1334 1117 452 331 1574 3945 443 380 1455
NM_001194chr193507 417 256 ------
NM_001198chr652227 2190 2177 552 104 2846 311 4807 805 751 123 1960
NM_001200chr201108 ------
NM_001204chr291797 1732 1323 1300 891 683 608 577 556 14791 35216 1489 686 25373 1188
NM_001206chr972199 2058 1188 908 473 307 151 12349 22782 153 --
NM_001219chr751767 1742 1396 1390 150 11898 21403 641 1906
NM_001221chr41104 --1106 --
NM_001222chr1041804 1612 1417 1261 ------
NM_001232chr15481 448 138 131 110 2935 891 ----
NM_001238chr192335 118 1436 1337 --
NM_001256chr1722155 547 1800 22503 274 --
NM_001257chr163441 223 186 ------
NM_001259chr774625 4516 4186 1938 1127 1025 365 --1922 --
NM_001263chr42432 128 1446 ----
NM_001265chr134336 209 190 89 2323 73 ----
NM_001268chr13----140 --
NM_001270chr511028 ------
NM_001271chr15102998 2990 2778 2521 2225 1278 1109 738 719 683 ----1308
NM_001273chr122383 114 --172 --
NM_001274chr113143 123 63 ------
NM_001275chr141271 ------
NM_001277chr116893 862 809 765 757 750 --1682 --
NM_001278chr10----171 --
NM_001293chr11163 ------
NM_001294chr193375 89 71 ------
NM_001300chr101129 ------
NM_001304chr1762938 2732 2490 1202 170 23 23595 2496 13301 --
NM_001310chr1262984 2487 2442 2339 1971 536 --22101 1240 11063
NM_001313chr42246 135 ----1758
NM_001315chr652170 1936 1891 778 387 168 21893 787 --
NM_001319chr1921079 233 1950 1415 --
NM_001331chr11131961 1860 1033 941 931 742 622 593 299 228 207 201 171 32021 1739 925 42187 1732 1100 501 21749 625
NM_001332chr521375 82 ------
NM_001343chr54644 619 541 268 --2695 693 11213
NM_001351chr3----11371 --
NM_001352chr19134 --136 --
NM_001356chrX22494 238 ------
NM_001358chr41178 ------
NM_001364chr11144469 3781 3759 3706 3341 3263 3221 3173 3121 2937 1549 933 919 854 64036 3712 3194 3071 393 296 44373 3314 3123 856 34302 3320 1921
NM_001365chr174323 162 98 87 ------
NM_001380chr102994 57 2422 41 ----
NM_001383chr172557 253 ------
NM_001386chr8122013 1785 1579 875 822 781 773 349 313 208 174 73 --11603 --
NM_001387chr583066 2623 2122 1037 804 791 674 221 42914 2581 2298 560 22926 1236 --
NM_001389chr213542 446 165 ------
NM_001390chr1883259 2862 2559 2427 1126 1055 984 27 12681 ----
NM_001396chr2152711 745 698 643 240 ------
NM_001397chr182558 2368 2285 2259 2020 1969 512 496 --42022 1825 1039 504 --
NM_001399chrX113568 3464 3444 3352 2566 2487 1542 1404 1323 413 36 32418 1423 140 23849 3027 23634 604
NM_001400chr11464 2484 320 ----
NM_001401chr93500 385 57 ------
NM_001406chr17121476 1305 1128 580 507 499 465 416 408 274 125 52 21149 457 31159 535 440 --
NM_001407chr371653 1546 1505 1316 424 374 277 21443 107 1379 --
NM_001408chr1111296 1264 1122 599 412 402 357 351 210 196 34 4394 363 97 45 41498 1486 1298 1103 31309 1289 405
NM_001412chrX73708 3532 3392 3196 3057 2955 2596 ------
NM_001417chr1271774 1741 1468 1302 522 106 26 --21781 1202 138
NM_001419chr1974009 3147 3055 1866 1749 1743 835 11455 23843 3614 --
NM_001420chr1992941 2831 2813 2555 2512 1227 1154 255 32 22710 411 82582 2580 2557 2530 2525 2523 2148 1207 --
NM_001421chrX91669 1614 1468 1397 1366 1359 1352 1337 1261 1695 31685 1445 1435 --
NM_001427chr781540 831 812 767 738 727 715 687 1838 21727 792 1694
NM_001429chr222904 406 --1236 --
NM_001430chr221516 310 1256 5661 471 301 299 61 --
NM_001432chr443190 3166 2891 1446 --11410 --
NM_001438chr1112280 852 524 476 464 447 430 382 308 269 250 124 1321 1221
NM_001439chr121231 530 --21251 1224 --
NM_001448chrX21545 210 --1504 --
NM_001449chrX3133 118 101 ------
NM_001451chr1631005 976 121 --1504 1124
NM_001453chr621521 384 --31260 368 353 --
NM_001454chr174912 874 378 216 1391 --2267 222
NM_001461chr11214 --1189 --
NM_001478chr128971 959 945 888 795 244 220 130 1376 1973 --
NM_001482chr153720 116 70 ------
NM_001489chr91111 122 ----
NM_001493chrX2211 75 1738 2229 49 --
NM_001494chr101138 ------
NM_001495chr85981 824 301 287 117 1403 41034 923 908 142 --
NM_001497chr922268 486 31976 1114 1106 ----
NM_001518chr72358 349 1808 ----
NM_001520chr165520 226 190 157 24 ------
NM_001521chr24784 666 203 87 2228 133 2737 205 --
NM_001542chr13589 461 49 11788 21940 51 --
NM_001543chr5174722 4441 4216 4003 3471 3422 3358 3265 1804 1602 1569 1394 636 469 448 347 214 33217 1923 1211 53871 3577 1571 1396 706 11285
NM_001555chrX132 2206 190 134 --
NM_001560chrX52550 2418 2169 1707 623 --21763 1747 21766 51
NM_001584chr1131104 1024 875 --11026 --
NM_001587chrX52171 1957 1447 855 463 1784 12130 1355
NM_001604chr11----1688 --
NM_001609chr1094287 4111 3994 3671 3659 3596 2918 1634 26 23467 1779 --24290 3399
NM_001616chr21578 42555 1374 1124 271 1824 1834
NM_001617chr281232 969 440 401 244 58 34 23 --3959 43 41 1425
NM_001619chr1181023 1004 403 268 233 133 107 64 --1976 --
NM_001621chr712536 1406 ----
NM_001621chr712536 1406 ----
NM_001634chr622004 549 1359 3668 657 650 --
NM_001635chr73954 432 400 ------
NM_001650chr1831524 1078 613 2683 619 12697 --
NM_001654chrX1415 1116 1396 --
NM_001655chr1141882 460 300 78 1272 21889 1541 --
NM_001658chr1127 --2940 938 --
NM_001659chr12152629 2578 2539 2500 2210 2077 2016 1996 672 415 388 362 274 155 146 31686 891 84 42511 2506 1816 417 1749
NM_001660chr32645 201 1237 1513 --
NM_001662chr73255 153 108 176 ----
NM_001663chr142541 178 1766 --12697
NM_001664chr32985 222 ----2994 925
NM_001665chr113485 153 38 --2427 425 --
NM_001668chr182267 2108 1520 683 268 148 133 95 --197 1598
NM_001674chr12381 88 2804 164 ----
NM_001677chr1121 ------
NM_001678chr17131775 1699 1327 1188 636 584 485 444 304 205 192 74 26 31233 1207 568 41730 561 498 29 --
NM_001681chr12--2238 127 ----
NM_001682chr1212365 ----12589
NM_001683chr362217 1930 1905 899 355 252 11876 --12313
NM_001684chr193542 3176 3035 2979 2917 1402 1041 484 334 53599 3145 1501 1086 554 63261 2787 1472 666 578 321 33702 2630 1233
NM_001686chr12128 --131 --
NM_001690chr351652 727 542 207 141 --12294 --
NM_001694chr161342 154 1153 --
NM_001695chr874221 3584 2732 1205 769 281 133 ------
NM_001701chr931334 1282 58 --183 11297
NM_001702chr8--1427 1555 --
NM_001703chr1293 45 --195 --
NM_001706chr33233 190 184 ------
NM_001707chr72794 168 ------
NM_001709chr1132705 2547 868 11842 2881 860 --
NM_001717chr1531171 532 262 ----11480
NM_001720chr17875 869 796 645 261 168 144 31807 1442 462 1636 --
NM_001730chr1321514 41 ------
NM_001730chr1321514 41 ------
NM_001731chr123922 276 69 ------
NM_001741chr112243 27 --1295 --
NM_001742chr731525 1205 201 11216 ----
NM_001743chr2----1151 192
NM_001746chr532480 1836 858 22224 2181 2915 38 --
NM_001748chr11941 ------
NM_001754chr2174168 2999 2982 2838 2824 2786 973 --53994 2943 2856 2813 2799 14088
NM_001755chr161348 --11816 --
NM_001759chr12165048 4927 3998 3760 3574 3548 3372 3324 2130 1645 1414 1263 1059 1034 713 508 24027 1420 34938 4936 3374 24120 4095
NM_001760chr66802 732 243 212 112 63 ------
NM_001762chr71108 ------
NM_001773chr1121303 1232 1182 1167 1059 565 248 120 85 77 71 48 1479 11101 --
NM_001777chr3113537 3095 2922 2708 2657 2543 2528 1511 1131 1000 631 1662 1781 --
NM_001781chr122140 90 ------
NM_001783chr196344 262 253 119 82 68 ----1386
NM_001788chr71765 ------
NM_001789chr321595 37 --21466 1464 --
NM_001791chr151311 892 425 368 176 11320 ----
NM_001796chr16161 ------
NM_001798chr122733 40 --2236 42 --
NM_001802chr162784 50 1201 153 --
NM_001805chr14134 ------
NM_001806chr1942724 2528 2469 1056 1299 1551 --
NM_001810chr204803 772 691 125 2555 226 1693 --
NM_001825chr51132 ------
NM_001838chr174915 851 121 34 --1123 1854
NM_001839chr12661 88 --1167 --
NM_001842chr94490 463 433 201 ------
NM_001844chr121321 --1150 --
NM_001852chr12533 490 1591 3604 568 101 --
NM_001854chr11253 ------
NM_001858chr654155 3189 831 804 194 --14991 --
NM_001859chr943072 3002 2799 96 33528 3265 3009 1394 --
NM_001874chr12125037 4920 4421 3472 3417 1234 1173 1159 1143 967 951 118 11975 23443 1704 1955
NM_001885chr11------146
NM_001891chr4124 ------
NM_001892chr511227 11335 --161
NM_001893chr172325 299 1121 ----
NM_001894chr224939 905 830 252 --21094 941 --
NM_001895chr2041019 791 779 54 11053 1278 1364
NM_001903chr53918 727 672 ------
NM_001904chr32694 308 ------
NM_001907chr162281 77 1120 ----
NM_001915chr1791878 1711 1611 1586 815 772 703 176 166 21666 529 41703 1569 1394 1392 --
NM_001920chr121655 ----1658
NM_001921chr44868 261 158 146 ------
NM_001923chr113135 103 60 270 35 1201 --
NM_001924chr1--183 ----
NM_001927chr24693 108 73 56 2683 131 --1513
NM_001932chr172824 60 --2826 654 --
NM_001933chr1441013 317 283 186 --4904 463 188 59 --
NM_001936chr781282 1100 684 276 238 173 74 64 --180 --
NM_001937chr131012 904 85 --1119 --
NM_001938chr121548 44 ------
NM_001940chr122390 63 2537 442 ----
NM_001945chr541100 1002 275 255 --21004 991 --
NM_001949chr6113046 2097 1145 731 399 320 290 247 208 95 22 ----12091
NM_001951chr8----1129 --
NM_001954chr65522 279 216 93 25 2591 271 1178 --
NM_001964chr53333 185 133 1193 ----
NM_001965chr2389 81 65 ------
NM_001970chr175579 236 189 105 63 1537 4595 593 476 244 2479 144
NM_001971chr12--129 ----
NM_001973chr11272 1129 ----
NM_001975chr124791 240 226 119 1824 2766 245 2769 546
NM_001977chr42614 377 1710 2616 48 --
NM_001978chr84828 730 276 218 --3278 173 58 --
NM_001982chr124367 246 207 84 1304 187 2110 73
NM_001995chr4152 --1322 1977
NM_001999chr51121 ------
NM_002006chr495839 5486 1844 1752 1464 1128 831 663 525 1729 25438 199 --
NM_002009chr1522295 1059 ----1871
NM_002010chr13----1190 --
NM_002014chr122472 278 --3574 561 208 151
NM_002015chr1343060 2351 2323 94 --11322 --
NM_002017chr1131414 1238 235 ------
NM_002024chrX21785 880 ------
NM_002025chrX199257 8687 8350 8046 7565 7536 7518 7442 7389 6943 6586 6171 6068 5692 3405 2262 1150 1100 1050 --57547 7545 7529 7527 6815 18787
NM_002026chr2137 --21022 1014 --
NM_002033chr11103303 3035 2628 1257 899 800 595 265 216 73 --21626 1239 2907 340
NM_002035chr18152465 1455 1408 1378 1204 921 912 640 502 494 486 478 470 462 442 ------
NM_002039chr41316 ------
NM_002045chr34352 149 127 37 --157 160
NM_002048chr94223 195 183 160 1122 11068 --
NM_002054chr21410 ------
NM_002056chr22792 184 ------
NM_002062chr6141590 1533 1277 1156 1070 1052 549 510 499 467 323 212 148 22 21564 154 21540 1538 11577
NM_002065chr171793 1775 1517 1196 352 213 68 11453 161 --
NM_002072chr96790 407 392 360 318 33 --1372 --
NM_002077chr982062 1837 1560 1548 1489 844 540 152 ------
NM_002079chr10----1450 --
NM_002080chr162834 222 --1224 --
NM_002082chr52766 359 1915 145 --
NM_002083chr14129 ------
NM_002086chr1762044 2034 1884 1877 375 243 41853 1695 1668 1425 21942 250 11794
NM_002087chr173244 210 80 2119 70 197 --
NM_002091chr181208 ------
NM_002092chr464790 4631 3932 3754 1874 732 13252 24807 4793 22011 881
NM_002094chr161102 --2357 332 1105
NM_002103chr194992 932 752 21 1263 2816 774 --
NM_002105chr114901 749 683 130 137 1685 --
NM_002107chr1162 ------
NM_002111chr4173743 3587 3558 3267 3255 3045 2801 2786 2429 1134 963 933 877 696 542 349 284 13223 33513 536 435 --
NM_002126chr1793590 2780 2577 1081 987 790 378 324 313 33498 2800 344 13803 --
NM_002130chr5--1469 ----
NM_002138chr41619 --1257 --
NM_002139chrX4607 601 447 132 ------
NM_002140chr91320 ------
NM_002141chr7158 185 ----
NM_002145chr172145 71 ------
NM_002146chr174512 412 180 144 ------
NM_002147chr175353 244 165 154 70 1361 6945 802 800 355 307 171 --
NM_002148chr21609 ------
NM_002160chr92251 172 ------
NM_002161chr9136 ------
NM_002167chr12352 73 ------
NM_002181chr24752 682 636 498 1512 2241 119 --
NM_002193chr231864 1821 60 --1564 --
NM_002199chr42225 78 ------
NM_002202chr52816 28 --1773 --
NM_002204chr1761340 1263 1204 235 214 197 11295 --1361
NM_002205chr127942 927 838 770 270 182 116 1846 --1122
NM_002207chr3161 ------
NM_002214chr773526 3483 2062 1469 1409 1269 1073 1334 54671 1895 1045 647 645 13562
NM_002221chr1122887 2869 2667 2632 2524 2290 2248 2230 2206 1160 551 47 3710 588 433 --12890
NM_002222chr311167 ------
NM_002223chr1223066 1327 13224 23944 1329 --
NM_002226chr143883 761 340 ----1720
NM_002227chr13385 262 48 ------
NM_002228chr12942 198 ------
NM_002230chr1751014 827 339 305 47 2868 139 2986 86 1831
NM_002232chr14228 214 207 199 --2147 141 --
NM_002235chr1241469 1293 1252 333 11654 31647 111 109 21059 672
NM_002240chr213170 82 58 --2251 33 --
NM_002241chr1133145 2268 2095 968 940 816 789 606 435 390 227 116 48 21070 199 22342 2192 12089
NM_002247chr1052241 1840 1572 800 81 --191 152
NM_002249chr1----2446 61 --
NM_002250chr19------136
NM_002253chr41207 --1996 --
NM_002254chr282242 2045 2037 1821 1726 512 409 294 3842 649 534 22054 884 --
NM_002264chr3144798 4464 4408 4230 4135 3704 3121 1265 1258 1237 902 615 485 310 1346 11020 --
NM_002265chr1721052 49 ----1307
NM_002267chr133254 225 26 ------
NM_002268chr321622 763 --1756 --
NM_002270chr553441 1982 1408 573 492 --14041 14211
NM_002271chr133835 628 537 1640 1782 --
NM_002283chr123771 288 159 1554 ----
NM_002285chr262790 1221 1080 881 644 629 31088 710 518 ----
NM_002286chr12154 ------
NM_002293chr1122708 2618 2163 1776 1110 969 497 486 349 248 217 102 1379 12413 --
NM_002296chr131651 1566 1119 ------
NM_002309chr22103002 2875 2489 2442 2287 2245 2055 1131 1125 847 22923 2819 62731 2729 2595 2383 727 715 --
NM_002310chr575420 4677 2464 2404 1840 1815 1360 --42258 1886 1884 505 25446 1976
NM_002315chr111106 ------
NM_002319chr76813 746 322 189 33 21 --1302 --
NM_002333chr1941005 982 822 438 21267 1078 2258 256 --
NM_002334chr1171989 1960 1606 685 310 106 40 11752 11516 21311 318
NM_002336chr1254961 4820 1231 939 746 1864 --12037
NM_002350chr811158 ----1295
NM_002355chr1251372 1109 570 166 28 ------
NM_002356chr621945 254 1183 2177 42 --
NM_002359chr17123939 3893 3757 3322 3073 3006 2759 1613 1253 1120 119 99 --53470 3045 2826 124 107 13827
NM_002361chr192290 73 ------
NM_002373chr1581321 1287 1271 924 489 332 269 36 41313 979 166 22 --1505
NM_002374chr232913 2716 865 --21032 924 1927
NM_002375chr3111704 623 534 341 292 226 182 166 63 43 25 41759 1579 658 351 6625 541 369 70 55 33 --
NM_002382chr1441308 491 345 178 21041 184 2942 119 --
NM_002383chr168767 761 300 187 180 95 78 62 --5810 370 350 302 67 1329
NM_002387chr574222 4130 1268 921 873 300 292 --54569 753 417 294 210 --
NM_002390chr171103 1565 ----
NM_002397chr5----1781 --
NM_002399chr1511019 1122 ----
NM_002403chr1------181
NM_002404chr177873 863 335 239 196 63 32 1229 1689 --
NM_002406chr59933 858 767 704 408 371 300 170 93 --2834 357 --
NM_002430chr22102113 2059 994 842 730 723 453 61 42 23 22202 307 51935 1741 1729 826 44 --
NM_002442chr12111567 1293 1126 1113 609 453 309 242 191 146 105 1344 41574 1329 1295 437 11729
NM_002451chr923262 1199 23435 3333 33297 3241 278 13558
NM_002465chr123201 45 30 ------
NM_002473chr227446 417 206 150 116 81 54 2277 60 1995 184
NM_002480chr1211417 ------
NM_002486chr91271 ----1707
NM_002495chr5193 ------
NM_002499chr153871 215 175 21996 1645 11635 --
NM_002500chr21424 ------
NM_002501chr19284057 3899 3890 3871 3688 3653 3531 3240 3208 3200 3098 3060 3007 2987 2553 1603 1595 1559 1545 1494 1408 1391 1335 1224 876 571 550 357 --104120 3920 2973 1393 1215 870 618 552 187 185 --
NM_002505chr62541 70 1396 --11272
NM_002506chr1242 22 156 ----
NM_002507chr17111907 1825 1600 1530 1486 1396 1279 1269 480 288 119 41748 1586 796 239 ----
NM_002508chr171954 1679 1620 1226 360 304 143 31271 539 156 21572 1570 --
NM_002509chr205694 608 294 217 173 1828 2683 296 --
NM_002515chr1441740 1639 1606 1273 11375 ----
NM_002516chr192236 106 1208 561 54 46 36 34 --
NM_002518chr211169 ------
NM_002519chr1121059 974 ------
NM_002520chr51104 ------
NM_002522chr17122885 2846 2760 2623 2581 2536 1340 1236 976 875 672 226 2844 836 33047 83 81 191
NM_002524chr14847 263 237 72 2196 134 1958 --
NM_002526chr61427 --1580 --
NM_002530chr15141 --363 48 46 --
NM_002537chr153791 379 85 1920 ----
NM_002542chr3261 41 253 30 2211 64 167
NM_002544chr17137 ------
NM_002545chr11104338 4184 4163 3211 2045 1817 1492 1350 887 276 13218 31014 957 294 2960 297
NM_002546chr81237 --1171 --
NM_002547chrX113979 3943 3936 3920 2899 947 743 513 265 193 140 --1340 11292
NM_002553chr7--1402 ----
NM_002556chr1151989 1454 821 339 111 11951 21772 303 1733
NM_002558chr1741120 354 299 100 189 1302 11027
NM_002569chr1541405 1279 986 354 31183 437 130 ----
NM_002570chr1521183 229 1876 2403 370 1123
NM_002576chr1151123 329 291 105 90 1128 ----
NM_002577chr373714 3504 1626 1541 1529 1488 988 --83124 1531 1495 906 896 809 793 411 1781
NM_002578chrX2325 155 --131 --
NM_002579chr1951483 1370 1069 257 196 ------
NM_002581chr9105569 5062 3683 2151 1588 1476 1443 1229 808 434 32271 962 97 23767 1479 --
NM_002585chr12308 132 --2261 72 --
NM_002586chr661645 1288 395 386 318 239 2402 133 81571 1163 376 323 321 306 216 214 31574 1300 1104
NM_002588chr5161718 1668 1652 1486 1396 1300 717 483 390 356 322 314 175 131 59 38 21365 364 1502 2647 41
NM_002594chr2032428 1594 21 2808 38 1310 --
NM_002595chr12------1414
NM_002599chr1161058 912 364 325 287 21 ------
NM_002600chr141205 676 632 540 ------
NM_002601chr22196 181 --1327 --
NM_002605chr1521202 356 1864 ----
NM_002607chr721117 1011 --2891 131 --
NM_002608chr2281517 1398 1343 1243 621 339 142 94 21494 1360 41511 564 263 188 --
NM_002609chr571712 486 354 267 248 61 37 --5554 440 438 322 320 --
NM_002610chr242894 2362 2314 391 --12286 --
NM_002613chr16154687 4055 3674 3422 3256 2116 2104 2018 2009 1908 1520 1455 1291 1034 533 41950 1684 1370 972 84671 3925 3354 1865 1863 1419 1417 548 14396
NM_002616chr173370 116 50 1386 1373 --
NM_002622chr54686 633 622 24 1163 2218 85 --
NM_002628chr341143 462 449 385 ------
NM_002630chr6234 28 ------
NM_002632chr142132 112 1784 1573 --
NM_002636chr6289 43 1429 169 1338
NM_002641chrX2781 601 ------
NM_002644chr181535 1444 1423 410 398 380 92 22 21674 152 ----
NM_002645chr113925 752 638 1906 ----
NM_002646chr1112174 1882 1808 1738 1498 1352 856 498 183 78 63 32156 2149 1859 2798 65 --
NM_002648chr661073 985 428 219 73 24 1196 ----
NM_002649chr721140 475 --1144 --
NM_002650chr22176 ------
NM_002651chr15896 837 335 321 212 3652 560 48 1867 --
NM_002653chr53930 286 139 2848 149 ----
NM_002655chr821153 566 ----13915
NM_002657chr20153417 3212 3205 3184 3165 2865 2646 2519 2466 1463 1300 1144 851 616 287 53610 2477 1347 1033 293 43657 2373 2371 802 23244 1547
NM_002668chrX3148 44 22 165 1338 --
NM_002669chr4122 ------
NM_002670chr331540 1461 1250 ------
NM_002698chr19132792 2606 2351 2340 2112 1133 1066 1032 754 314 216 187 178 21934 1199 162600 2378 2342 2331 2329 2322 2308 2303 2301 2284 2282 2265 2263 1142 1016 189 22381 1035
NM_002699chr171365 1088 1078 954 427 385 158 21142 347 3530 500 429 --
NM_002705chr163262 81 46 1294 183 --
NM_002707chr21153 --1155 --
NM_002709chr253207 3201 1034 507 443 13084 ----
NM_002713chr131111 283 121 --1886 --
NM_002714chr63973 850 91 --1983 1100
NM_002715chr52914 440 ------
NM_002716chr11143625 3494 3449 3400 2835 2777 2495 2280 2236 1450 1432 723 253 193 --33522 3508 3496 1407
NM_002717chr83652 491 467 ------
NM_002718chr352693 1865 1640 650 181 --12569 1217
NM_002719chr1442120 1760 613 317 1181 --11707
NM_002721chr91356 --1200 --
NM_002725chr1194291 4265 3799 3583 1759 1665 1317 1193 1111 1031 997 513 463 415 301 251 114 100 82 23345 1298 64402 1195 306 304 89 87 --
NM_002726chr62171 52 192 ----
NM_002730chr1981193 1163 1131 1111 974 235 225 194 --31250 1165 925 21269 249
NM_002731chr152961 774 678 660 276 --1257 --
NM_002734chr1751979 1537 1527 74 22 --2915 31 137
NM_002742chr141661 ------
NM_002745chr2244457 4022 1312 322 24012 1324 1388 34173 507 61
NM_002746chr165594 495 426 248 58 1208 2191 147 --
NM_002747chr184647 507 467 82 21782 677 21509 563 --
NM_002748chr151275 11107 ----
NM_002752chr51400 ------
NM_002753chr41823 --2299 49 --
NM_002763chr11156 1143 ----
NM_002764chrX3887 803 628 --155 --
NM_002772chr213527 389 41 ------
NM_002775chr103132 44 31 ------
NM_002776chr19101937 1647 1630 1452 706 696 325 176 105 83 189 2160 107 --
NM_002791chr142111 103 ------
NM_002821chr63249 236 159 1507 3560 547 310 --
NM_002823chr2168 1158 ----
NM_002824chr123461 311 93 1161 1382 1138
NM_002827chr2021371 321 21717 389 2730 157 1420
NM_002829chr94876 852 823 32 --1273 --
NM_002833chr15101426 1202 1116 366 356 349 325 312 153 121 ----1416
NM_002836chr203534 438 417 --2426 424 --
NM_002837chr1274534 3916 2943 2919 955 616 603 --1608 --
NM_002839chr932738 2674 988 1431 22530 2528 --
NM_002840chr151377 1220 667 595 61 --1371 --
NM_002843chr1162885 2216 1141 745 701 493 11118 53270 2423 2218 738 256 --
NM_002844chr6----1369 --
NM_002847chr751506 1000 635 545 120 21371 1335 11092 --
NM_002850chr1961215 973 944 393 361 197 1310 31058 966 795 --
NM_002855chr11133552 3280 3005 2670 2560 2259 1341 898 813 454 351 193 50 52640 2285 433 211 40 41035 829 255 199 21410 574
NM_002859chr12121819 1442 1351 1242 1191 599 540 463 414 333 218 202 51339 639 246 237 33 11713 1221
NM_002865chr8162 --164 --
NM_002866chr194495 452 186 48 --4500 39 30 23 1233
NM_002868chr1292407 2313 2234 1993 1908 1677 805 370 233 42162 1498 333 320 82173 2106 1982 913 774 745 415 313 1421
NM_002869chr1162067 1768 1484 858 443 98 11782 1381 --
NM_002874chr91873 --2886 875 --
NM_002880chr33680 658 71 2238 229 ----
NM_002885chr12897 306 3808 149 140 ----
NM_002886chr364594 4150 1872 1863 1299 1253 31132 1120 1093 2270 245 14603
NM_002888chr3143 ------
NM_002890chr5173 ------
NM_002892chr1451316 1224 606 153 147 123 ----
NM_002897chr21213 ------
NM_002903chr172256 25 ------
NM_002904chr62190 83 1184 ----
NM_002906chr113710 411 373 1777 ----
NM_002907chr121423 ------
NM_002912chr6--1306 ----
NM_002918chr1921056 144 --2783 764 1307
NM_002924chr13234 206 161 ------
NM_002926chr421173 844 1108 ----
NM_002930chr18299 87 ------
NM_002933chr14268 30 147 162 --
NM_002938chr461994 1475 1285 594 346 318 --1499 --
NM_002941chr31215 ------
NM_002942chr3--3978 943 477 1273 --
NM_002945chr172856 252 --1132 --
NM_002953chr12765 168 2174 60 ----
NM_002955chr661698 1670 1635 1491 1236 749 ------
NM_002956chr1211212 --31272 1019 167 --
NM_002959chr184117 4058 3069 1434 954 614 90 60 64174 4150 3104 3062 679 548 53490 2914 1588 1586 895 --
NM_002966chr1278 24 ------
NM_002968chr16--1108 ----
NM_002971chr331019 368 76 ------
NM_002973chr12139 ------
NM_002983chr172260 254 ------
NM_002994chr451566 1515 656 142 34 ------
NM_002997chr281647 1460 1392 1226 612 298 87 59 1108 --1301
NM_003001chr1162248 2234 2218 1969 1873 1512 899 856 823 767 326 274 224 132 96 28 --41983 862 828 188 1278
NM_003009chr191102 --1265 --
NM_003010chr1742379 1808 1543 704 21960 1848 31820 1685 935 --
NM_003011chr93587 310 97 --1661 --
NM_003012chr882994 2981 2781 2068 1114 1083 1045 155 11068 --22716 1086
NM_003013chr41127 184 ----
NM_003016chr1731849 1688 297 --31856 771 277 --
NM_003026chr941080 485 465 28 1427 ----
NM_003028chr9173776 3319 3127 2711 2635 2625 2605 2513 2502 2480 2357 1542 1470 987 407 342 234 23386 2390 52921 2627 2373 1065 773 23589 1068
NM_003029chr13558 195 21 1279 --1198
NM_003030chr311343 --21407 114 --
NM_003034chr1277370 6278 5445 5268 5087 632 595 26705 6265 --16021
NM_003035chr1145 --1787 --
NM_003039chr12415 197 2139 45 --1201
NM_003045chr1374944 4524 3415 3176 1609 1541 281 31292 494 79 54866 3120 802 423 339 23062 254
NM_003047chr1141265 1244 1161 1093 1061 903 505 412 305 275 159 110 73 44 51349 328 259 207 190 --1981
NM_003051chr151951 1807 1699 1548 735 ------
NM_003060chr53877 816 408 1510 --1402
NM_003068chr83407 316 86 ------
NM_003070chr93740 715 46 ----1748
NM_003071chr331435 1360 294 --11383 --
NM_003072chr192356 131 ------
NM_003074chr362280 1884 1395 733 161 145 1139 21919 256 --
NM_003075chr122318 67 188 224 22 --
NM_003076chr12121694 1432 1374 1183 679 665 611 504 479 449 240 202 41525 1335 1324 1068 61680 1415 1407 1044 1037 506 1189
NM_003077chr173623 331 224 2648 122 --123
NM_003079chr17--2983 371 1403 --
NM_003081chr202413 178 1151 51156 978 271 269 23 --
NM_003085chr51108 ----193
NM_003091chr203241 211 200 1193 ----
NM_003106chr3----1939 --
NM_003107chr661618 665 528 367 343 210 1927 2674 447 --
NM_003108chr2186552 6502 6311 5644 5061 2918 2814 2776 2660 1962 1865 1854 1816 1806 1767 334 276 28 11835 26369 1038 11879
NM_003110chr176841 697 413 402 199 54 --1850 --
NM_003111chr21875 --11087 --
NM_003112chr711152 ----1277
NM_003118chr531985 44 31 21773 422 32065 746 57 --
NM_003128chr272873 2823 2407 2223 1938 1132 401 11949 11940 1405
NM_003131chr6152205 2107 1959 1924 1768 1430 816 803 674 600 524 505 371 201 191 41970 1918 843 331 5676 666 655 526 209 --
NM_003137chr652085 906 484 95 52 1280 22023 74 --
NM_003139chr118814 765 715 615 233 219 151 52 ----2679 38
NM_003142chr21229 ------
NM_003144chr62617 325 21839 589 2843 352 --
NM_003145chr16369 309 130 107 45 23 ------
NM_003146chr112262 125 153 --181
NM_003150chr1761679 1645 1598 1579 310 131 12202 ----
NM_003155chr862448 2438 2229 1037 283 225 22095 324 32425 2076 275 22329 228
NM_003156chr1181330 1231 1019 995 867 399 375 40 31158 392 248 41180 1178 1147 58 --
NM_003161chr1753463 2395 2193 1261 1200 --12881 --
NM_003164chr115547 436 418 181 113 ------
NM_003165chr971945 1749 1693 1507 1490 770 693 2198 157 51603 1595 1593 1563 404 --
NM_003170chr172198 67 --2551 388 --
NM_003173chrX41205 389 188 58 21049 479 11379 --
NM_003178chr371801 1666 1593 448 404 271 155 --1409 --
NM_003179chrX71384 1220 1207 393 281 247 190 41421 1125 910 69 71446 1363 1200 384 382 375 373 --
NM_003184chr831052 261 109 1235 ----
NM_003185chr203511 490 463 --1492 --
NM_003188chr61832 ------
NM_003189chr172838 2569 2154 2080 1256 925 831 1276 2256 249 1677
NM_003194chr6126 1489 --1373
NM_003199chr1864515 1849 1382 809 716 90 ------
NM_003200chr19122077 2034 2017 1889 1762 1653 1572 932 917 665 227 191 11895 42079 2019 1828 934 21611 1564
NM_003202chr5--4608 517 63 25 1582 21200 117
NM_003203chr242184 243 146 81 ------
NM_003204chr17--11422 11335 --
NM_003205chr1541429 732 569 52 --1846 2303 55
NM_003214chr631193 1008 160 1136 21020 45 --
NM_003216chr22113137 2345 2113 2077 1071 1022 657 531 505 339 62 1780 92337 2258 2086 2042 1313 1116 1073 341 312 33215 471 201
NM_003217chr12111441 763 621 547 325 249 219 210 199 38 21 11681 --11444
NM_003220chr661521 1475 1180 1112 454 201 1228 31477 1193 1191 --
NM_003221chr6103541 3075 2863 2645 1484 1344 647 607 521 493 --53374 3348 3077 2849 305 23764 3384
NM_003223chr166644 622 581 546 286 23 1554 125 --
NM_003224chr204950 857 817 731 ------
NM_003234chr34734 692 325 230 --12145 --
NM_003239chr145847 732 722 698 61 --3838 749 734 --
NM_003246chr153666 220 98 ------
NM_003247chr62636 87 --21528 638 --
NM_003250chr175390 294 176 143 51 ------
NM_003253chr2151535 1290 474 468 397 ------
NM_003255chr17132370 2091 1648 1018 838 643 551 489 340 280 212 150 141 32318 950 761 ----
NM_003257chr15----11062 --
NM_003275chr921484 378 --1536 --
NM_003281chr1194505 4233 4136 3910 3414 3382 2100 2071 1692 1304 998 938 917 894 750 722 703 140 106 75366 5345 5082 3699 1738 685 99 94868 2126 2053 1131 952 884 752 119 108 23512 920
NM_003285chr13558 538 464 --1206 --
NM_003286chr2031097 785 433 --1444 --
NM_003292chr141743 1692 528 178 ------
NM_003298chr3115710 5196 4607 3835 2310 1678 1310 1208 797 778 128 34503 4071 1047 36016 5263 4947 11409
NM_003300chr142329 41 ------
NM_003304chr321014 372 11483 ----
NM_003309chr671749 1646 709 570 506 149 37 11189 2575 573 --
NM_003317chr142543 48 --1183 --
NM_003319chr21685 ------
NM_003322chr63336 278 153 --1343 1156
NM_003324chr1261398 1231 1052 1041 389 64 1915 1391 132
NM_003325chr223526 215 151 ------
NM_003336chrX2161 128 167 1928 --
NM_003337chr511194 1487 ----
NM_003339chr5----31498 1405 111 1628
NM_003340chr43178 136 91 ------
NM_003342chr1792535 2257 2191 2021 1100 966 852 559 484 --12718 1827
NM_003345chr164415 402 196 132 ------
NM_003348chr1271418 1398 1209 592 251 57 35 --2407 269 11429
NM_003349chr204624 577 408 28 11235 1382 --
NM_003352chr22217 28 ------
NM_003359chr42324 207 1189 1916 1919
NM_003363chr32458 452 --1556 --
NM_003367chr194451 204 181 95 160 ----
NM_003368chr11118 ------
NM_003369chr1172581 2389 2294 2043 684 529 501 11950 12618 --
NM_003370chr196589 570 230 161 63 30 1125 2740 218 --
NM_003371chr971711 748 629 621 612 114 76 --1860 --
NM_003372chrX1325 ------
NM_003373chr10101760 1750 1440 1415 1258 735 634 500 389 353 11499 ----
NM_003374chr52800 775 ------
NM_003376chr671703 1488 1411 1356 605 51 26 11505 41706 1418 1416 607 --
NM_003376chr671703 1488 1411 1356 605 51 26 11505 41706 1418 1416 607 --
NM_003381chr61687 140 1633 --
NM_003383chr9193 ------
NM_003385chr22349 272 --1797 --
NM_003387chr272799 1876 941 932 401 373 72 12770 52420 1861 1859 948 85 --
NM_003390chr115803 731 364 311 22 --1826 --
NM_003392chr344056 3936 1312 512 1518 --33418 629 104
NM_003394chr125639 593 542 468 273 --1544 1181
NM_003403chr14275 43 ------
NM_003404chr2031496 1361 591 --11445 --
NM_003405chr222211 61 ------
NM_003406chr831744 1621 139 11889 21679 1650 --
NM_003407chr195577 562 279 221 148 ------
NM_003409chr18----2250 248 --
NM_003410chrX32906 2432 796 --12416 22002 401
NM_003412chr332677 1173 1115 22713 1098 11106 --
NM_003413chrX1288 --1248 --
NM_003439chr722767 1398 --4724 722 598 30 --
NM_003442chr112550 335 ------
NM_003453chr131654 ------
NM_003457chr17------1120
NM_003458chr3164003 3822 3534 3449 3293 3240 3209 2555 975 966 947 933 832 723 447 407 52968 1490 1292 370 333 103849 3833 3831 3813 3557 3451 1303 977 938 936 23738 3212
NM_003459chr2----2118 116 3653 295 141
NM_003463chr642668 2652 919 514 1986 12635 1261
NM_003466chr282345 2303 851 585 504 475 437 134 22380 968 --1478
NM_003468chr283490 1395 1129 1085 1078 1071 956 498 23260 597 ----
NM_003470chr1651871 1735 1723 1268 1163 --41873 1270 542 502 --
NM_003471chr322345 126 11503 ----
NM_003473chr101149 --1182 2152 110
NM_003478chr1153080 2738 2448 1321 934 ----12377
NM_003481chr123497 390 363 --1482 --
NM_003482chr1292758 2511 1118 989 754 555 529 508 391 1728 82649 2647 2491 2474 978 756 200 52 --
NM_003483chr1242190 1041 1025 485 --32778 2068 1058 --
NM_003485chr14181 21271 1225 31096 896 884 --
NM_003487chr17----1179 1203
NM_003489chr2121051 746 --12193 11174
NM_003490chr222846 64 1787 ----
NM_003502chr16--1220 ----
NM_003507chr231943 327 25 --3570 568 106 --
NM_003528chr151737 1447 1353 1337 1324 1273 11339 --
NM_003559chr17143538 3435 3098 2985 2788 2756 2745 2736 2637 2578 1007 994 927 608 23495 418 23540 1129 23101 249
NM_003563chr1731420 1300 1028 ------
NM_003564chr14537 429 233 170 1200 2240 172 --
NM_003566chr1262698 2691 2230 921 362 211 ----12233
NM_003567chr1------144
NM_003575chr761340 1199 1082 975 623 269 ----11036
NM_003576chr1362845 2174 965 390 187 55 11945 22280 708 1842
NM_003583chr1263572 2399 1044 852 777 402 1370 1796 --
NM_003590chr253595 954 655 445 148 --1635 21502 344
NM_003592chr71108 ------
NM_003593chr173599 550 526 1218 --1699
NM_003595chr221369 1443 ----
NM_003603chr411626 --2390 372 --
NM_003607chr1113790 3782 3656 3460 2784 1611 1378 964 53 38 31 64331 3952 3690 1291 1149 1106 23463 71 --
NM_003613chr152646 599 ------
NM_003615chr353719 3003 1516 927 829 --13699 --
NM_003617chr1134547 4502 4288 4245 3808 3636 3099 1959 1626 889 553 211 64 24527 3248 24560 3107 33621 199 85
NM_003620chr171770 ------
NM_003624chr1951202 913 554 547 240 3935 448 383 ----
NM_003629chr142941 1091 628 433 33473 2869 1047 21102 438 --
NM_003631chr103329 179 140 --125 --
NM_003632chr177834 677 355 122 88 59 44 --161 1227
NM_003633chr551594 636 525 409 329 1552 --21759 1027
NM_003634chr225865 240 210 197 27 --4926 855 794 36 11019
NM_003635chr103159 100 41 1429 ----
NM_003637chr151534 402 391 233 31 21218 430 1359 1115
NM_003642chr21238 ------
NM_003644chr17256324 6154 6021 5860 5085 4898 4685 4500 4349 4292 4189 4177 4036 2467 2064 1484 1270 1256 1192 956 737 512 368 353 169 56338 5170 4492 2521 788 75566 2469 2181 2123 1351 713 95 35675 1264 600
NM_003648chr2102637 1936 1777 1654 980 708 678 653 634 379 --2699 697 21871 1720
NM_003654chr112140 90 --1500 --
NM_003655chr174238 228 162 81 --3586 577 540 --
NM_003656chr3160 1126 ----
NM_003657chr20253 32 --167 --
NM_003660chr194755 631 532 65 --3640 539 43 --
NM_003663chr342547 2126 581 274 ------
NM_003664chr52541 136 --2358 183 --
NM_003670chr321092 1051 ----1302
NM_003671chr9113131 2930 2911 2757 2709 2674 2271 1072 948 923 555 --33092 2298 852 --
NM_003672chr121923 1737 ------
NM_003680chr14569 502 90 28 2598 162 1253 --
NM_003685chr193805 767 178 --1792 --
NM_003688chrX1215 ------
NM_003692chr91318 ------
NM_003705chr23855 730 692 ------
NM_003711chr5184 ------
NM_003713chr121174 579 166 ----
NM_003714chr552767 2196 2121 1988 1002 --12369 12460
NM_003716chr3----1719 --
NM_003726chr171106 173 230 23 --
NM_003735chr5161718 1668 1652 1486 1396 1300 717 483 390 356 322 314 175 131 59 38 21365 364 1502 2647 41
NM_003736chr5161718 1668 1652 1486 1396 1300 717 483 390 356 322 314 175 131 59 38 21365 364 1502 2647 41
NM_003737chr11--2146 132 ----
NM_003740chr6--11680 142 --
NM_003741chr32111 84 ------
NM_003743chr242007 1760 870 581 1478 --11602
NM_003744chr142249 85 --31177 368 255 --
NM_003749chr1352313 1847 1594 913 189 --11664 --
NM_003759chr473370 3147 1485 1103 816 281 271 2698 599 23221 2844 13224
NM_003762chr1--11361 1171 --
NM_003763chr2092828 2696 2555 2388 1143 1070 153 147 42 1546 12648 --
NM_003768chr15733 556 324 309 50 11546 21576 1555 1246
NM_003774chr1242340 1056 960 835 ----11269
NM_003779chr15441 408 310 189 137 173 2340 139 159
NM_003783chr11190 ------
NM_003787chr18167 --1621 --
NM_003791chr161239 ------
NM_003794chr31366 ------
NM_003795chr61486 ------
NM_003797chr111171 ------
NM_003800chr651845 1827 1533 922 779 11810 ----
NM_003812chr21271 ------
NM_003819chr11294 --1251 --
NM_003827chr196575 483 458 92 83 31 --1463 1549
NM_003831chr181397 --1127 --
NM_003840chr831896 48 30 ------
NM_003842chr872000 1741 877 505 436 126 32 ------
NM_003850chr132708 245 1504 ----
NM_003861chr1452710 2571 2141 591 143 12346 22030 1051 --
NM_003862chr52338 251 ------
NM_003870chr154673 540 239 149 --42009 1993 1991 1984 --
NM_003872chr282750 2709 2664 2173 1195 1166 874 834 ----11026
NM_003873chr1031833 1002 299 11839 3315 310 308 --
NM_003877chr122929 206 1364 1893 --
NM_003885chr1752649 1693 717 422 115 --42020 2018 128 126 --
NM_003887chr23906 337 231 ------
NM_003888chr15101326 1314 1252 1229 1151 422 415 397 366 276 ----11238
NM_003893chr103461 417 322 ------
NM_003896chr2------3880 681 155
NM_003897chr6--122 ----
NM_003901chr1062716 2695 798 471 168 157 32702 1872 1840 11895 22304 1715
NM_003906chr21----131 --
NM_003908chr2011096 ------
NM_003913chr644173 4050 2674 493 23038 2919 34033 2693 2676 --
NM_003916chrX21360 60 ------
NM_003919chr7175 ------
NM_003922chr15125 --234 32 --
NM_003924chr42630 230 --11378 --
NM_003927chr182446 367 --2776 322 136
NM_003930chr741952 1832 794 93 ------
NM_003931chr6--1559 1206 --
NM_003934chr921167 26 --128 --
NM_003936chr25773 417 380 311 296 1990 6428 399 391 389 290 246 1776
NM_003938chr194988 394 255 76 2928 771 --3760 202 79
NM_003939chr10203990 3821 3807 3426 3418 3280 2948 1528 1496 1394 1337 1007 891 737 666 404 370 313 275 117 --53329 3145 902 480 285 21531 656
NM_003941chr732010 1936 201 ------
NM_003944chr1175 128 ----
NM_003947chr331082 304 199 --1166 1243
NM_003948chr442676 2521 973 692 22368 210 ----
NM_003949chr17122004 1917 1900 1881 1856 1383 1366 1347 293 270 190 24 41600 1264 311 250 51858 1792 1787 1684 574 1580
NM_003955chr1781139 604 535 296 278 152 141 54 --61488 1486 606 540 154 56 --
NM_003958chr693814 3659 3200 3106 3089 884 868 515 71 --13071 33219 3170 1498
NM_003968chr31150 ------
NM_003971chr17158 ----1420
NM_003975chr12327 67 ------
NM_003980chr611370 ------
NM_003983chr16154397 3779 3615 3609 3434 3290 3242 3182 2715 2698 1234 1218 982 453 83 34425 4052 1412 54329 4301 1600 1303 473 --
NM_003987chr1082002 1659 1597 1541 908 839 750 255 1770 132224 2007 2005 1713 1662 1642 1640 1627 1625 1611 1609 863 562 21892 1716
NM_003988chr1072079 1736 1674 1618 916 827 332 1847 132301 2084 2082 1790 1739 1719 1717 1704 1702 1688 1686 940 639 21969 1793
NM_003989chr1091938 1595 1533 1477 874 844 775 686 191 1706 132160 1943 1941 1649 1598 1578 1576 1563 1561 1547 1545 799 498 21828 1652
NM_003990chr1091938 1595 1533 1477 874 844 775 686 191 1706 132160 1943 1941 1649 1598 1578 1576 1563 1561 1547 1545 799 498 21828 1652
NM_003994chr122813 608 ------
NM_003998chr4----1581 --
NM_004006chrX1848 ------
NM_004007chrX1848 ------
NM_004009chrX1848 ------
NM_004010chrX1848 ------
NM_004011chrX1848 ------
NM_004012chrX1848 ------
NM_004013chrX1848 ------
NM_004014chrX1848 ------
NM_004015chrX1848 ------
NM_004016chrX1762 ------
NM_004017chrX1848 ------
NM_004018chrX1762 ------
NM_004020chrX1848 ------
NM_004021chrX1762 ------
NM_004022chrX1762 ------
NM_004023chrX1762 ------
NM_004024chr151048 447 128 121 113 21163 523 ----
NM_004028chr1831524 1078 613 2683 619 12697 --
NM_004035chr1784867 4646 3937 3737 3616 3546 3318 553 13749 14982 --
NM_004036chr2--1123 ----
NM_004050chr1442070 1875 869 595 32562 2470 2006 1613 --
NM_004061chr52524 83 ----1527
NM_004068chr34356 113 65 42 2297 30 191 --
NM_004071chr22271 23 ------
NM_004077chr1241103 1046 474 192 1853 2997 179 --
NM_004080chr741180 440 274 91 11188 1288 11486
NM_004081chrY11182 --11397 --
NM_004082chr22225 111 ------
NM_004083chr12150 ------
NM_004086chr14----1640 --
NM_004087chr331348 617 155 21594 1545 11399 --
NM_004089chrX1451 177 1459 1904
NM_004093chr1382983 2376 1299 597 204 129 60 30 --2416 268 --
NM_004094chr1432942 2036 435 12079 ----
NM_004096chr1091733 1443 1340 791 548 204 197 137 130 21678 210 51540 1511 454 452 190 1696
NM_004097chr24717 362 267 90 --2284 209 --
NM_004098chr101976 --1519 --
NM_004102chr1178 1494 2585 583 --
NM_004103chr810758 742 731 720 698 142 116 86 57 32 1270 1770 2773 145
NM_004105chr211033 ------
NM_004113chr361825 1720 1590 150 39 29 21635 55 123 --
NM_004114chrX3986 927 333 ------
NM_004117chr631929 612 411 3630 146 47 31627 824 60 1541
NM_004124chr1463044 2846 2740 2724 2186 631 ------
NM_004130chr31458 ------
NM_004132chr105904 828 752 202 34 2856 159 1840 --
NM_004134chr51584 ------
NM_004156chr81501 ------
NM_004161chr231035 459 279 ------
NM_004171chr11179664 9097 7814 7771 6586 6569 6513 2164 2048 1768 1706 1166 556 476 330 300 291 33326 1172 38 69034 8655 8243 6427 3525 2807 --
NM_004183chr112810 629 ------
NM_004187chrX71287 1067 1007 981 559 417 352 11097 6459 453 419 364 354 213 1367
NM_004193chr104401 391 363 197 136 ----
NM_004199chr5121 ------
NM_004200chr1183017 2748 2570 2276 2226 2073 1215 244 62341 2218 1209 993 836 389 51065 1063 917 792 781 32903 2587 2294
NM_004203chr16----149 --
NM_004205chr11--150 126 --
NM_004210chr1082126 1867 1636 670 264 233 115 91 --4673 549 243 235 1316
NM_004225chr821289 1120 11199 ----
NM_004227chr752513 2199 1955 950 834 22520 1214 ----
NM_004228chr19--1122 ----
NM_004229chrX31838 1556 590 ------
NM_004230chr1962085 1944 1683 1474 569 452 22351 1833 42336 2103 2090 1946 --
NM_004231chr7247 29 --2208 193 2269 50
NM_004232chr1821513 1317 ----1279
NM_004235chr91580 --173 --
NM_004236chr151375 ------
NM_004252chr172218 80 1226 1154 170
NM_004254chr113353 260 22 --1282 --
NM_004255chr15--122 ----
NM_004263chr271609 1520 1484 1243 724 241 149 --21245 502 1727
NM_004272chr53717 120 48 --1588 --
NM_004274chr14103033 2981 2759 1221 390 329 300 260 158 144 12784 --1304
NM_004277chr631201 551 178 11624 ----
NM_004279chr742234 2192 737 538 22113 1741 --12195
NM_004283chr196876 680 603 122 104 33 ------
NM_004290chr53106 49 40 --1301 --
NM_004293chr963001 2863 2747 2702 1512 28 33466 2989 2438 32865 222 55 --
NM_004296chr14143951 3814 3429 3031 2887 2711 2687 2671 1448 1386 1087 1025 451 365 53399 2767 2748 2470 1589 33224 1089 898 13817
NM_004302chr1262572 2457 1112 858 763 750 32529 2238 1789 52306 860 778 776 477 12463
NM_004308chr11131734 1632 1464 1297 1181 749 636 608 384 322 262 123 55 3742 454 242 2560 125 --
NM_004311chr10102939 2788 2757 2736 2562 2481 2050 2028 1258 1190 --62760 2564 2552 2322 2256 2136 12911
NM_004316chr123899 874 434 ----1902
NM_004319chr1142892 2538 2518 2448 2438 2421 2390 2378 2063 1993 558 547 293 150 1337 52727 2428 2000 1995 683 22564 2526
NM_004321chr283395 3287 3156 3122 2551 481 89 48 22714 1401 23354 2858 1781
NM_004326chr1101153 1143 1036 1011 997 846 840 834 761 357 --2978 764 1784
NM_004330chr151857 ------
NM_004331chr82479 390 --1458 --
NM_004338chr18115909 5619 5468 5455 4685 4304 2816 2662 2311 1138 449 42295 2259 1432 1117 24706 1140 --
NM_004344chrX1109 --196 --
NM_004349chr821113 287 ------
NM_004350chr172153 1939 746 632 543 363 344 11959 32009 828 659 11920
NM_004359chr191492 --2134 105 --
NM_004364chr1961182 1119 1086 488 381 159 --1217 11201
NM_004369chr22484 217 ------
NM_004370chr651827 1773 1459 802 649 1814 --1521
NM_004371chr141264 960 83 41 ----1625
NM_004379chr21654 1264 1200 --
NM_004380chr1651724 1701 518 195 25 ----11017
NM_004384chr5----2945 559 --
NM_004386chr19122135 2031 1829 1505 1460 817 619 510 161 154 44 34 --2805 512 11656
NM_004391chr3182035 1703 1585 1500 1487 1455 1446 1433 1360 1294 805 603 375 327 229 203 103 52 1618 41502 1420 155 153 --
NM_004392chr1362668 2256 1895 1832 1643 557 ------
NM_004393chr362240 1968 1850 1830 1681 737 11802 31852 1816 1544 --
NM_004395chr56599 518 504 304 274 147 1686 ----
NM_004397chr1133752 3038 72 --31354 600 402 13001
NM_004405chr27816 417 380 286 180 107 79 1217 1406 --
NM_004408chr9279 31 ------
NM_004411chr71582 ------
NM_004414chr211624 --1490 11179
NM_004416chr126886 740 684 668 199 23 3764 750 235 21086 691 --
NM_004418chr23546 252 68 1117 ----
NM_004420chr11102418 2131 2021 1887 1803 1642 835 449 441 294 22201 2091 52212 2102 1876 842 427 --
NM_004422chr173342 168 162 ------
NM_004423chr3112589 2456 2347 2142 1096 1008 787 390 371 362 301 2916 249 32595 1010 379 22527 61
NM_004426chr1261573 1316 664 540 519 464 143 --11288
NM_004427chr171037 813 796 444 152 113 40 21158 337 2461 289 1116
NM_004429chrX5317 209 147 79 56 2460 339 1942 --
NM_004430chr8102767 1757 1046 1000 978 954 810 696 207 136 21072 112 5963 622 392 381 31 --
NM_004431chr16726 334 321 203 117 62 ------
NM_004432chr922163 1839 --1394 --
NM_004433chr181576 1486 632 548 536 429 254 197 4542 473 273 189 ----
NM_004436chr12519 38 ------
NM_004437chr173236 2964 2299 2271 1049 791 38 1743 42410 641 634 435 21115 438
NM_004438chr21353 1902 13203 1357
NM_004440chr611725 21788 1776 ----
NM_004441chr381290 1274 465 452 446 428 416 387 ------
NM_004442chr181680 1602 1448 1362 636 468 367 28 31388 1356 1272 31590 1558 1152 1360
NM_004443chr3--3265 232 166 ----
NM_004444chr73345 277 230 2287 39 1551 --
NM_004446chr1132 ------
NM_004451chr111158 2561 538 1160 --
NM_004454chr332033 1508 273 1573 22240 1727 1666
NM_004456chr7126 ------
NM_004458chrX51818 1654 470 379 218 ----11691
NM_004459chr1731546 1526 1260 ------
NM_004463chrX3473 464 77 1412 ----
NM_004468chr15250 163 110 87 28 1222 --1135
NM_004472chr5187 ------
NM_004474chr141033 694 287 47 139 3406 392 378 --
NM_004475chr1771128 1014 959 838 180 154 45 31095 401 354 4464 278 242 163 1480
NM_004480chr14--1634 ----
NM_004484chrX6334 315 306 266 117 50 ------
NM_004487chr351149 1078 428 50 30 ----31152 113 94
NM_004493chrX246 31 ------
NM_004494chr1101239 1195 1183 1172 1012 351 344 135 116 99 3973 957 818 31241 243 118 --
NM_004496chr14----5409 319 310 283 153 --
NM_004497chr192684 540 --1609 --
NM_004499chr51150 --1133 --
NM_004500chr1462029 1924 1905 1479 367 86 1137 21926 88 1122
NM_004501chr163545 3302 2652 975 848 348 --21550 1250 13589
NM_004503chr125330 217 204 170 58 148 5257 60 39 31 29 --
NM_004504chr222888 2826 13021 --22761 57
NM_004514chr1772847 2806 2086 1881 1197 889 334 32682 2615 1061 22320 994 --
NM_004521chr10195 ------
NM_004525chr231316 1257 112 1574 11259 --
NM_004527chr1771250 1065 362 343 327 117 82 31346 107 89 1205 --
NM_004529chr91340 ----1238
NM_004530chr165887 328 218 202 167 2753 34 ----
NM_004537chr1221155 55 ------
NM_004543chr21147 172 ----
NM_004555chr16278 48 --1179 --
NM_004556chr61353 141 1891 --
NM_004574chr17143 --133 --
NM_004575chr411198 11474 256 54 --
NM_004576chr51103 1159 ----
NM_004578chr11771 --1842 --
NM_004583chr177540 526 490 286 277 262 34 ----1252
NM_004586chrX55154 5136 4516 3378 2171 --21950 1875 24056 673
NM_004588chr11223710 3672 3607 3465 3453 3244 3216 3205 3196 3099 3093 3057 2972 1098 1083 941 736 458 423 182 151 92 12763 44075 2946 2646 40 --
NM_004594chr166974 596 316 302 189 53 1814 ----
NM_004598chr572119 1331 1176 1098 1049 633 589 12399 22923 486 --
NM_004602chr202564 283 --1339 11303
NM_004603chr761115 1050 973 915 134 115 2922 389 2975 343 --
NM_004606chrX2308 33 ----166
NM_004608chr16146 1309 ----
NM_004609chr202489 395 ------
NM_004612chr974646 4576 4342 1697 830 216 25 1150 --14202
NM_004615chrX2788 120 --1126 1753
NM_004620chr111148 ------
NM_004630chr1191055 1034 941 892 862 310 282 272 213 11061 1258 2285 261
NM_004631chr11480 --11236 --
NM_004634chr34588 577 566 431 --248 46 --
NM_004637chr351286 1236 164 107 72 --31001 444 79 31176 1164 865
NM_004639chr61101 ------
NM_004643chr143740 632 289 ------
NM_004654chrY2996 405 ------
NM_004655chr1711207 --1393 --
NM_004658chr12286 79 ------
NM_004660chrY21494 120 --1234 --
NM_004663chr1531167 414 45 ------
NM_004670chr1041368 1109 495 378 ------
NM_004673chr13993 571 478 11486 ----
NM_004674chr82112 86 1609 --1178
NM_004684chr4140 ------
NM_004685chr13------12322
NM_004686chr861779 1383 726 351 329 308 ----1639
NM_004687chr1721343 276 --2391 389 --
NM_004690chr6----1609 --
NM_004698chr14183 149 70 25 --127 --
NM_004705chr112624 189 ------
NM_004714chr193332 79 44 --182 --
NM_004716chr116786 742 712 587 280 39 1331 1804 --
NM_004717chr771384 569 373 352 108 72 54 --1111 --
NM_004723chr12923 421 --2858 239 --
NM_004725chr10--158 11419 --
NM_004726chrX64629 4258 2223 1737 1228 236 14171 11678 11361
NM_004730chr52590 529 ------
NM_004731chr1221426 283 ------
NM_004734chr1382900 2376 1275 923 264 91 73 30 165 1167 --
NM_004736chr131857 864 129 --22131 1418 --
NM_004739chr113670 541 67 ------
NM_004742chr331675 1484 432 --31257 1244 44 --
NM_004744chr41318 ------
NM_004745chr8216920 6673 6223 6136 6091 5173 4904 4624 4282 2019 1883 1479 625 535 512 487 420 279 123 42 22 45728 2199 1680 610 21667 88 25910 1946
NM_004746chr184343 77 61 46 --179 --
NM_004750chr19127 1275 ----
NM_004759chr1132102 2022 1981 1975 1918 1574 1511 725 452 416 407 356 226 --52024 1777 1329 730 431 --
NM_004762chr1781858 1570 1481 1287 760 593 235 55 11237 1521 --
NM_004772chr541401 1369 987 280 --11406 --
NM_004774chr1763130 2373 2148 2097 1170 1028 --22853 342 --
NM_004779chr53881 490 240 --3242 216 73 --
NM_004783chr161121 2221 134 2484 243 --
NM_004784chr41125 ------
NM_004788chr1171694 914 354 332 288 195 68 ------
NM_004789chr9----2365 363 --
NM_004792chr2170 ------
NM_004796chr141184 ----12452
NM_004798chr20163216 3133 3008 2924 2580 2310 1325 1147 982 821 627 374 327 316 292 105 --4342 337 335 310 --
NM_004807chr2112303 1968 1775 1683 907 892 616 548 485 412 284 22253 691 12167 --
NM_004808chr1032540 2285 1210 12844 ----
NM_004814chr12192 96 ------
NM_004815chr134428 4382 3887 24552 4107 34356 4061 3991 1285
NM_004818chr121571 1132 ----
NM_004821chr56783 656 612 601 587 321 ------
NM_004822chr17133729 3714 2879 2649 1602 1572 1489 1400 585 551 303 170 104 23072 1448 1530 13704
NM_004824chr641292 440 393 69 ------
NM_004830chr61945 ----1179
NM_004831chr195778 760 723 426 157 --1169 --
NM_004834chr242987 2734 2530 1346 --32867 144 142 --
NM_004841chr13979 920 47 1883 31152 922 193 --
NM_004845chrX114103 3273 3205 2920 2842 1084 877 846 834 169 160 21661 507 33912 3719 1633 --
NM_004849chr6----11681 --
NM_004850chr271457 1132 267 244 152 145 47 1522 ----
NM_004857chr1444379 3594 1703 543 --23454 1014 11228
NM_004859chr1722407 767 1530 22602 253 21942 611
NM_004860chr173371 188 24 1235 1228 --
NM_004863chr1475019 3323 1873 650 600 332 32 2450 421 23736 34 1717
NM_004871chr1763519 3460 3041 957 549 536 11671 73736 3117 477 460 443 437 430 3847 450 257
NM_004872chr1--153 ----
NM_004879chr113996 131 60 --2656 307 --
NM_004884chr1571665 1653 1578 1571 622 568 226 2661 107 21671 570 --
NM_004887chr52886 234 1936 ----
NM_004890chr171242 --1262 --
NM_004893chr5----1427 --
NM_004896chr101127 ------
NM_004897chr102264 145 --1932 --
NM_004898chr452548 2167 627 475 463 --22277 477 --
NM_004902chr20------1177
NM_004904chr7146094 5999 5866 5045 4784 4759 4514 4493 1965 1791 1574 680 573 491 45957 1264 638 102 22467 575 14449
NM_004911chr71519 ------
NM_004922chr103901 341 109 1968 1846 --
NM_004924chr194993 900 345 190 1376 3842 158 156 --
NM_004925chr91246 1119 --122
NM_004926chr1461459 549 531 516 233 156 2574 90 4681 559 162 131 174
NM_004929chr821412 291 ------
NM_004930chr16590 529 273 176 92 76 --2148 146 1222
NM_004936chr952448 1915 364 348 52 --12131 12043
NM_004947chr3102095 2082 788 719 666 552 426 379 278 207 12088 12582 22591 691
NM_004952chr19872 844 700 669 324 304 285 162 103 2724 72 1326 --
NM_004956chr743041 2889 876 631 13570 23463 442 13214
NM_004961chrX5552 520 342 239 169 4305 128 42 34 41406 557 555 171 --
NM_004965chr21----140 --
NM_004966chr101361 --1736 --
NM_004968chr74632 456 250 49 ------
NM_004969chr10150 ------
NM_004972chr91743 ------
NM_004973chr621677 1600 1631 ----
NM_004976chr11184863 4840 4721 4677 3883 3594 3569 3561 3308 3230 3169 1749 1736 1503 1473 1332 911 410 84829 4646 4338 4316 4155 1827 1254 568 74764 3603 3601 2008 1356 1312 847 23577 2011
NM_004977chr197568 452 385 225 193 156 77 1501 1143 1388
NM_004978chr181577 1566 1555 1348 1271 1259 523 385 --31351 1117 504 1182
NM_004979chrX4794 391 309 285 --31058 1011 813 --
NM_004985chr1231802 581 551 --34102 4100 852 1584
NM_004991chr31129 1355 ----
NM_004992chrX438085 7975 7910 7792 7688 7659 7460 7076 7049 6972 6785 6536 6353 6312 5975 5925 5912 5823 5776 5318 5279 3098 3079 3061 3005 2976 2814 2619 1816 1808 1537 1490 1309 1284 1268 954 934 448 438 429 323 92 64 47888 7798 7784 6009 96174 5380 5281 3419 3070 2568 1509 1223 343 17692
NM_004992chrX438085 7975 7910 7792 7688 7659 7460 7076 7049 6972 6785 6536 6353 6312 5975 5925 5912 5823 5776 5318 5279 3098 3079 3061 3005 2976 2814 2619 1816 1808 1537 1490 1309 1284 1268 954 934 448 438 429 323 92 64 47888 7798 7784 6009 96174 5380 5281 3419 3070 2568 1509 1223 343 17692
NM_004993chr1441367 993 593 180 --1506 --
NM_004999chr684513 3223 3172 1607 1594 1385 1333 1299 --11244 13697
NM_005008chr225885 224 191 38 27 ------
NM_005010chr762226 2142 2037 1697 1690 650 ------
NM_005011chr761847 1473 1453 697 596 90 11313 1598 11476
NM_005017chr3129 ------
NM_005020chr77599 235 175 161 87 81 72 ------
NM_005022chr171163 258 33 ----
NM_005023chr51119 11428 ----
NM_005026chr161555 1444 1309 791 461 274 2506 439 1312 1332
NM_005027chr1991114 1031 978 910 248 223 193 161 139 1288 21116 184 1227
NM_005028chr1052166 1903 1465 618 182 --11663 1621
NM_005032chrX4820 284 189 183 --3721 258 256 --
NM_005045chr73707 154 29 152 ----
NM_005052chr171283 --1237 --
NM_005055chr113157 142 30 ------
NM_005056chr1275013 4213 3523 1638 1610 662 480 24615 4424 22033 1790 15092
NM_005057chr161746 671 644 590 370 186 --21748 480 1486
NM_005060chr181261 846 424 349 244 86 52 27 ----21205 30
NM_005063chr1083762 3245 2988 2680 1391 1130 267 213 23362 1202 2992 679 11424
NM_005065chr1445237 2033 1450 635 24540 3574 11859 --
NM_005066chr1------1766
NM_005078chr1571742 1473 1170 1154 411 292 222 41710 1654 1522 503 31177 1148 328 --
NM_005080chr223831 654 230 --1741 2355 281
NM_005086chr1251450 1292 621 495 406 1420 ----
NM_005087chr31860 ------
NM_005095chr11874 --22213 1835 1897
NM_005096chrX91104 1084 1014 894 881 814 435 225 170 --21019 449 --
NM_005099chr151335 1027 879 520 132 ------
NM_005105chr151910 1764 1527 759 685 --21804 744 --
NM_005109chr372136 2038 986 380 247 163 141 ----1633
NM_005114chr4----1516 --
NM_005116chr20144606 4228 3858 3239 1622 1486 1470 1429 563 520 444 376 269 188 34193 2900 1712 21003 383 --
NM_005119chr131306 1167 166 --41285 1208 1169 404 --
NM_005121chr1722994 1337 23477 1464 22388 1523 --
NM_005122chr1--123 ----
NM_005126chr312208 --2311 198 --
NM_005128chr211511 1469 ----
NM_005133chr112339 293 252 42 --1342
NM_005134chr183354 273 111 ------
NM_005135chr1563497 3448 3158 2613 1108 1003 --33640 1250 903 --
NM_005146chr113352 72 54 --2309 225 --
NM_005147chr162868 452 21025 993 --1175
NM_005151chr181626 ------
NM_005155chr65512 260 209 183 31 ------
NM_005156chr984957 4705 4575 4102 3513 198 167 22 13528 14559 24732 3703
NM_005161chr11132191 2015 1909 1589 1520 1497 738 694 466 368 329 142 41 21964 1397 31646 484 390 21980 1649
NM_005166chr193317 47 41 1220 1346 --
NM_005168chr241522 1418 1376 401 ------
NM_005180chr101364 ------
NM_005182chr16190 1248 2567 512 --
NM_005184chr19141347 1308 1187 431 328 310 245 232 213 192 175 79 66 43 21322 281 51281 1158 1147 330 182 1196
NM_005187chr16111653 1644 1615 1439 1431 1373 1343 1308 598 383 165 11499 51321 1319 525 360 358 --
NM_005188chr11217582 7467 7262 6913 6897 6783 6648 6637 6538 6494 6034 5721 5587 3079 2981 2832 2365 1683 1374 1290 546 36716 6621 932 87880 7367 5723 5713 5490 5458 3132 3095 47753 2276 1144 618
NM_005197chr14116195 5503 5081 4993 4946 4379 4276 3820 3787 2237 1739 45493 4548 3832 2440 25505 4998 16159
NM_005202chr171597 623 430 421 397 360 34 2350 320 61803 896 887 723 201 149 --
NM_005203chr10----1164 --
NM_005206chr171415 2904 76 ----
NM_005207chr224680 290 78 53 12747 ----
NM_005214chr21117 ------
NM_005215chr181476 ------
NM_005219chr561749 1626 1612 624 149 132 130 3490 366 287 --
NM_005220chr1781432 1252 1097 315 267 195 121 109 --41305 1130 470 115 --
NM_005225chr2031134 903 119 2955 796 21142 121 --
NM_005229chrX5993 941 929 879 243 21232 346 5807 805 797 336 169 2358 56
NM_005232chr7175 188 ----
NM_005233chr362186 2003 1001 885 853 727 --1172 --
NM_005234chr191313 --1110 1113
NM_005235chr2217621 7062 6789 6733 6484 6443 6187 5978 5766 5738 5473 5443 5160 5041 2600 2526 2161 1911 691 349 79 1114 47591 6717 6328 5512 2540 51
NM_005238chr1173037 2890 2806 2659 2579 2546 2477 ------
NM_005239chr2122039 175 ------
NM_005240chr15709 620 598 547 218 1589 1803 --
NM_005241chr32557 296 ------
NM_005242chr52205 146 ------
NM_005245chr41208 ------
NM_005248chr14401 228 197 68 1544 ----
NM_005252chr141198 --185 --
NM_005254chr151454 ----1982
NM_005257chr1821175 143 11357 ----
NM_005259chr22991 299 --149 --
NM_005261chr81345 --1103 --
NM_005263chr16961 257 148 95 78 56 2871 325 1372 --
NM_005264chr101733 --1953 --
NM_005273chr7198 ------
NM_005274chr1126 ------
NM_005275chr6--1120 125 --
NM_005276chr1251521 1263 639 632 588 51750 1725 1662 1497 237 1626 1708
NM_005276chr1251521 1263 639 632 588 51750 1725 1662 1497 237 1626 1708
NM_005277chr42663 170 1322 ----
NM_005296chrX2842 39 ------
NM_005311chr742150 2004 1792 206 1604 --12023
NM_005312chr9112658 2269 2141 1853 1005 964 900 662 540 381 322 32194 949 388 62580 1951 1858 1856 299 297 --
NM_005313chr1541124 1006 874 38 ------
NM_005316chr112951 944 ------
NM_005328chr82700 590 ------
NM_005333chrX4922 768 239 210 1795 --167
NM_005335chr34374 276 117 35 2301 70 1278 --
NM_005336chr2132169 1924 1852 1737 1458 867 475 432 418 410 404 170 121 127 32080 1798 114 --
NM_005337chr121338 ------
NM_005339chr431594 1031 603 --34352 4308 3636 11681
NM_005342chrX62767 2681 2012 1930 138 22 22180 939 22654 2122 22853 269
NM_005347chr91550 --11650 --
NM_005349chr41567 --2487 144 --
NM_005354chr194581 549 160 113 137 1254 --
NM_005359chr1886360 6345 5346 5057 4289 2200 2186 1445 11469 34615 4305 746 --
NM_005370chr1921248 526 --11250 --
NM_005374chr1792374 2129 2081 1788 1781 1774 1535 658 425 3842 733 373 22264 389 --
NM_005376chr14777 260 241 90 2443 386 ----
NM_005378chr22758 214 ------
NM_005381chr22124 21 ------
NM_005382chr8186 1163 ----
NM_005385chr362710 2503 2167 2080 899 181 --12170 --
NM_005386chr204880 734 583 575 2594 199 --1816
NM_005387chr111237 ------
NM_005389chr62681 26 --1674 --
NM_005392chr941818 1727 1185 493 --1115 1131
NM_005397chr763529 2839 1274 1056 559 149 33237 1486 612 11126 22676 587
NM_005398chr1031432 265 42 --11434 --
NM_005399chr1104010 3453 1585 1514 1447 1428 1317 867 703 577 1406 43580 2793 2791 45 --
NM_005400chr242762 2676 419 163 1292 198 --
NM_005401chr12230 81 --1190 --
NM_005402chr711749 ------
NM_005406chr18--11312 ----
NM_005407chr1481580 1393 1385 1283 1245 408 299 273 2266 208 5311 306 304 292 202 11509
NM_005409chr41197 ------
NM_005410chr5--126 ----
NM_005412chr123489 398 43 --2424 141 --
NM_005413chr25431 363 73 52 23 --197 --
NM_005417chr2061752 1271 754 260 249 102 21810 370 21431 251 --
NM_005430chr1271041 947 923 236 115 48 35 3804 669 168 6852 824 815 386 141 37 1855
NM_005433chr1822751 2166 11123 --2322 161
NM_005435chr72546 384 ------
NM_005436chr1082810 2567 2506 1636 862 609 416 324 ------
NM_005437chr1031041 389 119 11282 ----
NM_005438chr112248 21 --150 --
NM_005439chr124388 195 171 131 --4496 463 461 133 --
NM_005453chr65475 227 191 106 87 --2458 456 --
NM_005458chr951795 950 906 247 30 21802 1624 --11671
NM_005461chr2041477 1227 737 47 ----1289
NM_005465chr121635 356 --1796 --
NM_005474chr17101237 1228 1124 1058 556 414 238 188 128 106 21244 325 71543 1495 1493 1266 558 520 416 1214
NM_005475chr12103075 2604 2409 2287 2203 2150 1300 1202 433 206 --12994 --
NM_005476chr911199 --1148 2169 32
NM_005477chr1552285 1903 861 744 52 11589 3797 42 40 31047 800 748
NM_005477chr1552285 1903 861 744 52 11589 3797 42 40 31047 800 748
NM_005487chr2231489 1388 260 --11569 11578
NM_005494chr71663 ------
NM_005501chr1761153 1076 1017 389 48 27 11108 --1174
NM_005502chr91455 ----12143
NM_005505chr12289 80 ----1282
NM_005507chr113443 423 327 2334 204 3452 445 176 --
NM_005509chr51324 ------
NM_005512chr11111920 1555 1481 1286 1267 1259 740 720 578 348 168 21997 1347 1742 11763
NM_005515chr73623 185 59 ------
NM_005517chr12387 227 --1357 --
NM_005522chr741434 378 108 38 11027 1380 --
NM_005523chr751501 1491 1095 602 352 1409 ----
NM_005524chr32325 23 135 151 --
NM_005527chr63267 157 53 ------
NM_005536chr8------140
NM_005542chr7--1277 21712 195 --
NM_005544chr22914 118 ------
NM_005563chr12617 83 ----128
NM_005566chr112433 370 ------
NM_005569chr2241119 1078 499 309 1146 ----
NM_005576chr152118 56 --233 31 --
NM_005581chr194390 338 126 91 --3112 105 98 --
NM_005584chr132573 110 --1252 --
NM_005596chr974942 2500 2465 2282 2189 1800 812 24139 2203 1995 1850
NM_005599chr131037 337 155 1296 21047 483 --
NM_005602chr341158 853 478 228 11276 21146 167 1160
NM_005604chr65744 261 64 43 37 1677 21967 124 1585
NM_005605chr82295 213 ------
NM_005609chr111256 1240 ----
NM_005610chr1134 1898 ----
NM_005611chr163920 528 204 ------
NM_005614chr73909 134 67 --1671 --
NM_005618chr6----1145 --
NM_005625chr841011 880 344 84 ------
NM_005626chr11111 ------
NM_005627chr63942 313 212 ----1179
NM_005634chrX1539 134 ----
NM_005637chr1831725 1433 74 ------
NM_005638chrX21654 688 ------
NM_005639chr12------11709
NM_005644chr11366 --1354 --
NM_005652chr1651169 1015 309 192 173 --11199 --
NM_005656chr2151462 291 193 176 63 21420 461 --1196
NM_005660chrX2163 39 ------
NM_005662chr81116 1137 ----
NM_005665chr123843 3612 14370 ----
NM_005667chr21347 ------
NM_005668chr554121 3849 1391 881 764 ------
NM_005669chr542288 2063 1757 333 --1335 --
NM_005677chr371341 1060 934 515 472 407 285 1244 11510 --
NM_005678chr154885 806 762 128 --1945 --
NM_005686chr191548 1244 1209 1138 1074 636 415 284 171 --3338 286 32 21454 1429
NM_005688chr311048 1889 21061 1059 --
NM_005697chr152152 35 --2184 154 --
NM_005698chr12230 104 ------
NM_005700chr11--1359 ----
NM_005704chr13747 700 146 ----11031
NM_005708chr132157 145 ------
NM_005715chr631772 1006 213 --3429 267 34 --
NM_005716chr193473 422 179 2535 228 1549 --
NM_005717chr12476 104 ------
NM_005722chr23515 204 101 1813 ----
NM_005725chr172356 1826 1806 1561 668 549 65 --11564 1552
NM_005730chr1293404 3288 2743 2354 1458 1357 1292 1180 46 43499 2960 2595 2513 53459 3204 1084 732 344 2656 327
NM_005731chr23357 273 264 ------
NM_005736chr1021535 27 1269 11422 --
NM_005737chr262739 2718 999 787 524 466 --11834 22810 385
NM_005738chr7----11787 1204
NM_005746chr732698 2524 2335 ------
NM_005748chr1233425 1247 1237 23441 3362 ----
NM_005754chr51159 --2173 165 1325
NM_005759chr284169 3636 1799 1115 1000 660 561 452 1142 53801 3296 3024 1272 359 148
NM_005766chr1351032 1014 418 352 128 1118 1282 --
NM_005768chr121519 --3542 508 53 1545
NM_005776chr142584 537 ------
NM_005777chr3135 ------
NM_005779chr523631 2418 13637 3770 269 29 1733
NM_005782chr17155 --146 --
NM_005786chr18------11121
NM_005789chr17112173 2064 1951 1539 1517 1510 1337 794 439 343 208 31578 710 520 52148 1918 314 312 304 41921 1897 1804 1421
NM_005796chr16268 37 ----150
NM_005801chr172327 58 1320 3754 68 66 --
NM_005807chr11224 --1229 --
NM_005808chr383411 3378 2879 1347 1279 800 318 77 12640 ----
NM_005811chr123118 86 25 --197 --
NM_005813chr241998 1909 1621 993 12020 --1305
NM_005814chr19949 935 540 523 283 91 72 66 50 21096 350 1130 11123
NM_005819chr183435 3193 2935 1273 1090 468 390 159 22485 815 23459 1348 11351
NM_005822chr65821 721 708 276 170 --3373 54 35 --
NM_005828chr17144750 4030 3967 3778 3668 1970 1927 1854 1678 736 561 530 446 250 44593 4280 3883 205 94154 3755 3731 1785 1320 1318 1101 583 236 --
NM_005832chr32974 258 ------
NM_005839chr11803 ------
NM_005840chrX166877 6561 6468 6189 5404 2154 2097 1829 1714 1095 1078 660 585 573 201 34 36296 4841 328 86524 6414 917 592 531 500 498 465 --
NM_005842chr131533 ------
NM_005843chr221940 89 --21327 458 --
NM_005851chr112349 294 1283 2320 64 --
NM_005852chr1771088 1080 717 353 262 197 149 5859 739 343 304 95 ----
NM_005859chr521109 342 11337 ----
NM_005862chr3--11019 ----
NM_005864chr142568 27 --3284 163 112 2499 287
NM_005871chr1031020 882 279 ------
NM_005876chr2----1744 1704
NM_005877chr2242045 161 51 43 ----1175
NM_005880chr161243 11591 ----
NM_005883chr1962943 2855 2543 2204 963 295 --133 22219 966
NM_005884chr194625 520 252 88 1584 ----
NM_005885chr571563 1263 1074 87 76 60 29 --1169 --
NM_005892chr171288 ------
NM_005895chr12153838 3708 3627 3216 2966 2741 2673 2523 1534 1276 1086 771 655 613 401 11356 23629 1299 12981
NM_005896chr21811 1634 1651 --
NM_005898chr1132762 1065 417 --194 --
NM_005901chr18148495 8303 8174 8040 7643 7402 7384 6845 6295 5565 2818 2364 2222 205 11674 ----
NM_005904chr182979 593 --2598 473 --
NM_005907chr61353 11204 ----
NM_005909chr554258 4088 3527 3322 2713 23927 2704 --13409
NM_005910chr17113686 3548 3222 3203 3004 2879 2850 2767 907 865 106 53781 3667 3577 2836 1126 43071 1509 1423 315 --
NM_005911chr241183 944 495 483 ----2345 22
NM_005920chr1203706 3507 3156 3141 3085 3053 2716 2521 2419 1490 1463 1267 1164 1152 1130 978 831 82 67 31 63286 3148 2514 1502 873 837 73595 3590 3588 3493 3226 2437 2374 23510 1155
NM_005922chr62373 143 ------
NM_005924chr72981 836 ------
NM_005927chr53923 469 313 ------
NM_005928chr154509 156 145 27 --1520 --
NM_005933chr11142912 2765 2416 2241 1951 1854 811 758 728 720 696 504 380 225 12708 32248 1082 735 --
NM_005934chr19142249 2129 2044 1970 1781 1704 938 925 546 503 243 169 158 72 31789 1651 719 52394 1783 1726 741 171 --
NM_005935chr483720 3564 2122 2106 1723 1157 885 815 --13926 1652
NM_005938chrX31317 1289 1044 183 11082 1278
NM_005941chr853591 3546 3322 839 576 ----1861
NM_005943chr641145 211 160 61 31263 36 28 21318 1245 --
NM_005955chr1134359 4343 3985 3972 3872 3369 2174 2097 1702 1622 1378 905 772 34245 2180 1935 ----
NM_005962chr1022256 1773 1709 194 --
NM_005962chr1022256 1773 1709 194 --
NM_005964chr174998 485 450 179 2433 131 21392 1048 --
NM_005966chr211976 --22318 1656 --
NM_005967chr122457 116 2125 68 3636 557 273 --
NM_005982chr14--1233 1194 1203
NM_005984chr221441 1101 1477 --
NM_005985chr202663 567 3206 55 26 ----
NM_005996chr121140 --21537 345 --
NM_006007chr974469 4150 3870 3734 2793 520 211 12959 14136 --
NM_006015chr15914 355 224 174 156 --4161 159 146 129 --
NM_006020chr1451125 488 455 381 264 --11306 --
NM_006022chr132965 347 2400 323 4425 420 418 350 --
NM_006030chr361168 1139 259 101 78 56 --11249 --
NM_006034chr11132384 2376 2036 1806 1788 1750 853 785 762 735 687 178 65 2516 501 --21791 421
NM_006035chr1431076 390 263 11132 ----
NM_006036chr241961 1576 848 292 --2850 427 1180
NM_006037chr264105 4046 3767 3246 3125 69 13337 23093 1919 --
NM_006038chr2072219 1824 1613 863 705 486 258 4687 571 563 547 --1252
NM_006039chr174731 415 384 218 ----2421 313
NM_006040chr1641394 1091 1067 510 21246 575 2922 113 1456
NM_006043chr165766 655 255 112 48 1487 2648 81 --
NM_006047chr2063205 2747 2531 2516 1316 633 --12749 --
NM_006048chr121212 499 11085 2429 422 --
NM_006054chr1151420 1012 486 151 141 ------
NM_006055chr232449 2419 223 ------
NM_006062chr271230 1103 1075 937 885 458 250 2772 89 3365 318 59 1111
NM_006067chr162773 225 ------
NM_006068chr41281 1269 ----
NM_006070chr31276 ------
NM_006071chr223273 247 38 ------
NM_006079chr62290 229 ------
NM_006089chrX31363 1345 208 ------
NM_006090chr12641 583 ------
NM_006091chr1571552 1408 1289 671 280 251 226 51752 1673 636 608 570 61715 564 494 367 67 36 --
NM_006094chr832224 932 808 ----12109
NM_006095chr424271 2841 21776 1696 13975 11180
NM_006096chr861562 1260 402 267 239 55 21289 178 1269 --
NM_006099chr13724 684 587 1817 --1688
NM_006106chr1162895 2632 2504 995 918 153 --11246 --
NM_006108chr1162306 1705 1621 879 730 217 1408 --1494
NM_006113chr151890 1867 439 306 126 ----1271
NM_006129chr83533 384 97 1187 199 --
NM_006133chr1191937 1730 1607 1589 1571 975 964 702 371 11657 12158 12362
NM_006134chr2151465 599 321 269 65 --31470 1188 1186 11119
NM_006135chr131251 1095 1042 --1495 --
NM_006136chr71467 ----1370
NM_006142chr11487 --191 --
NM_006147chr1291 21 ------
NM_006148chr17152956 2872 2575 2266 2256 971 925 890 766 612 539 223 196 179 129 72213 977 936 557 417 408 343 52651 2599 542 318 316 2782 545
NM_006153chr31244 ------
NM_006156chr142216 95 ------
NM_006157chr111273 ------
NM_006158chr82570 38 --1627 21656 630
NM_006160chr17131442 1233 1039 626 459 339 330 297 281 232 211 190 134 --4395 270 240 214 1217
NM_006161chr5134 188 128 --
NM_006162chr182677 641 2206 27 ----
NM_006166chr1222550 2206 --12592 --
NM_006167chr83941 854 481 146 22033 2031 12173
NM_006176chr116723 686 595 272 147 74 1629 1300 1603
NM_006177chr1451015 933 846 743 209 1436 --2791 765
NM_006178chr1761288 1174 1059 993 508 156 21502 233 31396 1177 995 --
NM_006180chr94843 780 215 100 241 29 2284 228 --
NM_006185chr114659 478 228 90 1555 --1231
NM_006186chr211051 ------
NM_006191chr122641 151 3204 140 49 2789 120 --
NM_006195chr951397 1268 1260 990 514 ------
NM_006197chr831834 1581 456 --1217 2248 141
NM_006201chrX21092 1027 --2823 80 1868
NM_006202chr19171884 1824 1687 1648 1448 798 778 618 597 409 376 366 69 56 48 36 26 21393 787 51287 1285 602 164 157 11890
NM_006203chr553981 3792 1617 1123 504 --25437 1272 --
NM_006206chr432237 713 448 1916 12239 --
NM_006211chr8143 ------
NM_006216chr2----1448 --
NM_006224chr17102522 2408 1965 1911 863 734 499 308 273 224 32377 2144 768 1871 21633 277
NM_006226chr211360 ------
NM_006228chr81178 --2289 122 --
NM_006237chr1372115 1648 1509 855 703 697 80 2769 592 22148 548 --
NM_006239chr41298 1553 170 --
NM_006241chr332421 1525 905 ----22393 621
NM_006243chr12731 362 ------
NM_006245chr62333 200 2277 78 4389 387 375 343 1180
NM_006246chr142518 470 ------
NM_006247chr194404 324 197 138 1452 ----
NM_006251chr563185 1165 600 496 484 453 1747 13172 --
NM_006252chr1107496 7460 6544 6325 6254 5345 2561 1541 977 663 15812 26178 2641 16328
NM_006255chr14--2768 82 ----
NM_006256chr1--1180 ----
NM_006258chr101558 ------
NM_006265chr83966 482 467 --11389 --
NM_006268chr1171105 867 369 245 84 77 22 1254 3981 49 47 --
NM_006275chr2042376 1729 190 62 --1192 --
NM_006277chr21180 ------
NM_006279chr11734 --1935 --
NM_006282chr2084729 4715 3141 1538 1518 761 545 318 1403 13410 23428 105
NM_006283chr8114891 4371 4012 3858 3012 1075 891 846 554 347 322 1759 64418 4029 4014 1863 893 243 --
NM_006292chr11153 ------
NM_006293chr153865 662 174 ------
NM_006300chr1931809 284 218 ------
NM_006305chr15165 --167 --
NM_006306chrX135923 5914 5881 4611 4574 4553 4454 3948 1528 1465 269 82 50 34473 4401 972 ----
NM_006312chr123869 362 88 ------
NM_006313chr1221223 593 ------
NM_006317chr55785 640 604 359 77 1610 7128 117 115 103 101 90 47 --
NM_006320chr42947 53 ----1392
NM_006321chr361846 1647 1524 1420 840 51 --1235 --
NM_006327chr102268 80 ------
NM_006328chr111627 2583 139 1233 2591 257
NM_006330chr83649 616 65 ----1154
NM_006333chr2--1155 144 --
NM_006334chr91315 ------
NM_006336chr971420 1386 1347 1336 1125 1060 534 11429 21349 1232 --
NM_006337chr123228 222 31 1216 144 --
NM_006347chr1129 ------
NM_006350chr52255 245 ------
NM_006352chr141946 1557 1289 1277 --21291 336 --
NM_006358chr222373 363 1455 3871 375 76 1415
NM_006361chr1771745 1693 1311 1293 747 569 417 21939 124 21386 767 --
NM_006364chr14----1819 --
NM_006367chr13963 824 31 --1783 --
NM_006369chr12310 287 1316 2359 134 --
NM_006372chr61105 ------
NM_006373chr1761261 1084 554 158 145 111 21342 382 3449 271 147 1452
NM_006374chr22227 162 ------
NM_006375chrX41654 1578 1273 223 ------
NM_006377chr92975 944 31102 314 307 ----
NM_006378chr961339 1024 575 465 351 71 --11243 --
NM_006380chr1753547 3280 1411 405 33 11633 ----
NM_006383chr152489 482 4589 466 192 80 --1236
NM_006386chr2241979 1905 1778 612 22245 631 3640 286 128 22235 792
NM_006389chr11101008 896 878 854 535 505 412 399 230 41 2548 541 1214 --
NM_006390chr1251497 1340 669 661 548 11505 1157 --
NM_006393chr1053659 2834 868 747 628 33587 3233 636 13068 --
NM_006400chr12----176 --
NM_006405chr14160 --235 33 --
NM_006411chr67923 902 874 334 269 93 41 147 3123 103 22 1111
NM_006420chr2022692 344 22703 1034 1690 --
NM_006421chr82264 256 ------
NM_006422chr12----283 23 --
NM_006425chr52479 364 1379 ----
NM_006434chr1042669 1027 777 435 --1265 --
NM_006439chr43509 216 47 ----1357
NM_006440chr222105 50 ------
NM_006449chr272126 2040 1733 1702 1575 1547 1530 21982 1485 ----
NM_006454chr4102859 2843 2422 2336 2141 1985 1941 1078 872 66 52888 2601 2076 555 88 1946 --
NM_006457chr483948 3119 2943 2863 2855 2777 1112 1057 --1933 --
NM_006458chr111136 2284 263 --1346
NM_006459chr1041897 1648 529 119 1515 11535 --
NM_006460chr171174 ------
NM_006464chr2174493 4343 4054 3769 3282 1758 1611 1588 1383 1166 1118 963 450 385 296 168 102 11628 31622 1593 1591 12873
NM_006465chr15102141 1996 1784 1768 1700 1424 777 377 356 34 52188 834 824 752 282 21998 422 32005 1942 804
NM_006469chr121443 290 --2333 292 --
NM_006472chr13280 159 51 --2830 504 --
NM_006482chr1263572 2399 1044 852 777 402 1370 1796 --
NM_006483chr193332 79 44 --182 --
NM_006484chr193332 79 44 --182 --
NM_006488chr24620 319 288 210 2306 149 2229 63 --
NM_006489chr1441740 1639 1606 1273 11375 ----
NM_006494chr193639 122 113 2648 128 1104 --
NM_006496chr11691 --1331 --
NM_006497chr176795 752 648 628 304 281 ------
NM_006500chr115257 109 65 50 22 --1213 --
NM_006509chr19--1338 --1381
NM_006516chr151474 640 532 281 52 21337 524 --1485
NM_006517chrX42158 574 135 30 31790 519 269 61499 1466 627 581 218 40 52076 1973 1469 615 184
NM_006520chrX11730 --1459 --
NM_006521chrX51281 1103 943 380 31 41224 1077 511 194 177 --
NM_006526chr201716 2727 53 ----
NM_006527chr42243 36 ------
NM_006532chr1971773 1460 827 585 424 240 182 1221 31463 587 430 1577
NM_006534chr2063203 2805 2605 2429 2216 562 11178 22129 198 12608
NM_006538chr274077 3630 2931 2924 1016 527 78 23552 3020 33473 2620 312 --
NM_006540chr821373 404 11080 1267 --
NM_006544chr1416121 15392 1211 --
NM_006546chr17216621 6279 6069 6017 6001 5779 5163 4864 4557 4380 4213 4095 2439 2185 1682 1549 1417 958 788 172 64 55539 5515 768 600 278 126218 5960 5953 5951 5795 5216 4390 2505 2142 1419 422 66 22647 749
NM_006547chr731744 328 275 ----11872
NM_006548chr321489 1348 --1287 --
NM_006555chr741961 1716 620 467 --11718 --
NM_006557chr941494 1147 498 487 --11126 11106
NM_006558chr8----1494 --
NM_006559chr1163 ----1140
NM_006561chr10115119 4902 4735 3959 2251 2211 2011 1530 1289 168 21 14342 85926 5237 5001 4917 4276 4274 4266 394 15217
NM_006562chr102113 94 --1293 --
NM_006563chr193125 108 26 1362 ----
NM_006565chr164829 447 438 300 1341 173 1363
NM_006566chr1831013 874 358 ------
NM_006572chr1742994 1259 605 324 13523 12188 13400
NM_006574chr3----166 --
NM_006577chr21953 1343 ----
NM_006589chr11134 --1562 --
NM_006590chr22463 420 ------
NM_006593chr24745 670 281 89 181 3651 649 65 1756
NM_006595chr1121905 1641 11358 21352 439 --
NM_006599chr16128054 7570 7414 7392 7142 6705 6401 5564 2505 1788 1701 1080 --77558 7548 5731 5152 2579 1758 1155 27185 1044
NM_006601chr122315 235 ------
NM_006603chrX21371 440 ------
NM_006608chr1124 --126 --
NM_006609chr242159 1928 199 59 1987 ----
NM_006612chr171454 177 --1377
NM_006614chr342746 2677 2421 1307 --11296 --
NM_006618chr151593 1152 527 429 335 --1431 11485
NM_006621chr141597 1300 480 242 11345 11607 --
NM_006622chr52124 33 ------
NM_006624chr103850 577 170 196 ----
NM_006628chr1543855 3541 1739 47 14247 44236 4220 3193 1176 --
NM_006636chr21333 ----1677
NM_006644chr131570 ------
NM_006646chr1372590 2577 2184 2016 1996 1870 402 1959 --1790
NM_006650chr5133905 3786 3607 3315 3255 2663 1032 883 559 552 306 167 154 2594 314 41034 156 143 124 2886 235
NM_006651chr471475 1300 560 497 203 148 43 --31508 961 562 --
NM_006653chr61135 184 ----
NM_006654chr1284132 3198 3127 1856 1235 781 766 534 54146 3540 3191 3043 2985 44774 3033 1846 1212 14170
NM_006662chr16144 1273 1127 1135
NM_006675chr12123208 2850 2822 2603 2574 2544 2252 1314 1230 1019 628 551 33167 3011 86 42852 2808 1139 985 --
NM_006690chr2092283 2199 1981 1971 1956 1687 936 787 539 32072 2013 244 ----
NM_006693chr73792 344 272 ------
NM_006694chr1----4362 283 273 259 1118
NM_006695chr17183 --1239 199
NM_006698chr2041315 1256 434 387 2415 396 ----
NM_006699chr132723 2360 128 1578 ----
NM_006706chr51296 ------
NM_006708chr61304 --31084 992 130 --
NM_006709chr6156 1237 2107 22 2110 25
NM_006724chr62373 143 ------
NM_006726chr42825 326 ------
NM_006734chr631230 1110 38 11222 ----
NM_006735chr72360 113 ------
NM_006736chr2131759 1510 1435 1190 741 615 606 600 554 543 439 129 116 --21761 529 --
NM_006742chr1661834 1411 1317 780 588 221 42011 1792 810 715 51781 1458 786 441 319 1339
NM_006749chr83185 131 109 --1982 --
NM_006750chr16117999 7520 7158 5339 4890 3164 3152 2067 1998 818 91 53046 2746 606 431 111 43177 1804 579 373 25470 3187
NM_006751chr22826 333 ----1751
NM_006756chr821300 1290 ------
NM_006761chr175735 725 712 701 627 271 48 ----
NM_006763chr171930 1682 1487 1431 860 562 461 31743 1723 204 42004 1605 1302 432 11685
NM_006766chr842628 2620 2102 605 2658 628 42653 1796 1647 371 12588
NM_006769chr12671 152 ------
NM_006772chr6141616 1577 1558 1452 1309 1285 1270 562 457 432 321 119 107 29 41583 1438 592 206 31648 1206 669 21409 678
NM_006775chr652068 2000 1209 813 433 12011 ----
NM_006777chrX2578 547 1197 32872 2691 355 --
NM_006778chr651496 1330 1263 390 23 --125 21319 189
NM_006795chr11101574 1450 1384 1249 1243 1122 541 521 485 265 11372 --11411
NM_006801chr193575 75 21 1119 3518 26 24 1549
NM_006802chr14397 287 70 44 ----1375
NM_006803chr851753 1370 682 119 86 11507 --1787
NM_006805chr521076 104 --3667 191 189 --
NM_006807chr17------1362
NM_006809chr202696 262 2367 121 ----
NM_006811chr202837 45 ------
NM_006814chr2062132 970 400 240 43 32 52434 272 265 181 143 1834 --
NM_006816chr51220 ------
NM_006818chr12178 76 --3250 96 45 199
NM_006819chr114337 273 110 23 ------
NM_006822chr171790 ----136
NM_006823chr841073 868 312 181 ------
NM_006825chr122720 71 --3955 832 723 --
NM_006826chr231249 1104 412 ------
NM_006827chr1453035 2591 2260 966 348 --32870 2238 21 --
NM_006828chr6146 ------
NM_006838chr121685 11713 1219 --
NM_006842chr111140 ------
NM_006852chr17112865 2729 2634 2361 1142 823 723 706 589 451 138 22456 2367 42565 2481 693 596 11997
NM_006854chr732028 680 414 --21557 1542 --
NM_006856chr1241074 1048 1036 765 --31159 1157 873 1371
NM_006861chr1281312 565 376 219 201 164 154 43 21514 389 1495 1115
NM_006873chr252257 1328 1217 598 443 --1601 1365
NM_006874chr411210 11222 ----
NM_006875chrX5885 876 798 768 756 1192 ----
NM_006876chr111533 145 ----
NM_006884chr311343 --21407 114 --
NM_006885chr1672937 2871 2819 1518 1127 1105 156 2971 304 11043 13444
NM_006888chr1463130 3069 3031 2383 1197 997 --127 --
NM_006889chr361057 1003 293 153 133 82 1445 ----
NM_006892chr2061078 572 519 302 253 92 31034 905 369 ----
NM_006892chr2061078 572 519 302 253 92 31034 905 369 ----
NM_006896chr721081 467 11139 ----
NM_006898chr24820 225 171 99 ------
NM_006906chr114168 118 103 92 1774 --1397
NM_006913chr6--2381 348 1338 --
NM_006915chrX41817 1652 991 40 ------
NM_006920chr221956 123 ------
NM_006922chr242599 2360 2307 482 --1661 --
NM_006924chr1774028 2964 1730 1379 1209 989 694 11338 13756 13768
NM_006930chr561870 1859 1848 1780 1232 641 ------
NM_006931chr124353 293 48 23 12059 21575 50 --
NM_006937chr171561 1143 1135 --
NM_006940chr1221404 571 --21598 1251 1556
NM_006941chr2281116 1089 850 802 778 394 326 274 1860 1808 --
NM_006943chr20173304 3040 2901 2841 2814 2622 1033 800 777 740 454 330 308 287 203 162 101 43059 979 672 224 42624 847 375 373 --
NM_006946chr112230 29 1493 ----
NM_006950chrX4865 618 168 103 2731 635 --2689 298
NM_006958chr8152 285 45 ----
NM_006981chr992920 2810 2791 2694 2640 740 654 518 32 ------
NM_006987chr1781307 1125 1033 482 321 249 64 28 1146 3490 484 176 11231
NM_006990chr182082 1965 659 613 450 330 186 128 12493 21876 1782 1189
NM_006996chr111694 1699 ----
NM_006999chr53596 242 26 1232 ----
NM_007005chr921005 386 1153 21034 33 --
NM_007007chr1212950 11102 13250 --
NM_007011chr15175809 5359 4537 4177 2376 1998 1983 1570 1111 646 578 565 357 303 163 76 37 105077 5070 5040 5033 5000 4993 4962 4883 4876 492 56469 5849 1985 1890 84 12680
NM_007013chr81136 --2417 415 --
NM_007015chr131286 --1271 --
NM_007024chr32466 31 ------
NM_007026chr172566 51 170 2475 105 --
NM_007034chr12883 221 ------
NM_007036chr5----1823 --
NM_007038chr2186053 5881 4288 4198 2237 2174 1281 910 --2402 300 23831 914
NM_007039chr1431621 1554 82 12069 12052 --
NM_007040chr1913989 935 910 888 422 362 305 277 266 164 145 127 71 4925 724 391 244 ----
NM_007042chr352542 2314 2297 445 403 --32495 2493 1944 --
NM_007043chr1231473 412 34 ------
NM_007050chr20217777 7283 7144 6864 6804 6666 5749 5733 5046 3230 3136 2790 2732 1616 993 782 752 418 386 371 175 67426 5605 5082 2825 1683 620 23114 1425 12735
NM_007052chrX1123 ------
NM_007054chr543605 3195 2747 877 ------
NM_007067chr1761436 1220 1118 1080 604 247 31572 1535 1281 21294 306 1309
NM_007084chr1361234 1176 603 565 412 75 11240 11199 --
NM_007107chr3--1876 12311 1433
NM_007111chr132874 159 --2623 621 --
NM_007122chr12587 244 ------
NM_007124chr611766 --1219 --
NM_007125chrY----2409 407 --
NM_007126chr91377 ------
NM_007129chr134365 318 290 56 --3375 27 21 --
NM_007144chr172371 25 140 3483 473 471 3486 100 90
NM_007146chr1752788 2667 2637 1098 934 --1937 1382
NM_007158chr11444 --21114 78 --
NM_007159chr331777 85 33 --11779 --
NM_007162chr64471 240 120 68 2512 379 ----
NM_007166chr1121441 114 ------
NM_007170chr12915 784 2275 262 185 1343
NM_007172chr2253141 2283 330 318 186 --2427 188 12294
NM_007174chr1241842 1526 693 223 3950 787 27 --2808 631
NM_007175chr863647 2344 356 148 103 75 ------
NM_007185chr15795 751 341 197 75 --2810 433 154
NM_007191chr121156 ------
NM_007192chr1441114 1003 276 33 ------
NM_007195chr18103620 3196 3132 2949 2893 2656 2346 1272 900 679 --33148 3146 819 --
NM_007197chr123693 400 225 1312 ----
NM_007202chr173772 650 56 --2685 683 --
NM_007203chr963644 2858 1560 558 438 424 12561 --1519
NM_007207chr1--2799 34 1277 --
NM_007212chr14908 626 542 357 --2418 154 2832 258
NM_007214chr61551 --11100 --
NM_007219chr205963 947 925 660 286 --2927 289 --
NM_007221chr11321 1310 --1407
NM_007222chr831729 1682 1571 ------
NM_007232chr206976 719 91 51 37 21 ----1329
NM_007236chr1591891 1581 834 659 444 436 374 100 93 --32394 505 254 --
NM_007245chr164842 769 208 130 4622 367 182 171 ----
NM_007247chr172716 100 ----1835
NM_007249chr13199175 8971 8529 7965 7731 7461 7391 6805 6628 5751 2794 2596 2503 2361 2079 1290 1199 849 395 49408 6671 1385 1324 67880 7411 6862 6213 5758 2673 25824 2822
NM_007270chr731437 1190 88 --11121 1505
NM_007271chr641232 1215 155 126 11174 1638 --
NM_007275chr35916 451 395 329 243 ------
NM_007278chr172101 73 ----1144
NM_007281chr4141 ------
NM_007286chr5122036 2025 2007 1941 816 663 574 475 334 326 287 234 31318 619 293 22038 723 12028
NM_007287chr352913 2823 2077 1068 698 42899 2388 2304 1139 ----
NM_007288chr352913 2823 2077 1068 698 42899 2388 2304 1139 ----
NM_007289chr352913 2823 2077 1068 698 42899 2388 2304 1139 ----
NM_007292chr1784867 4646 3937 3737 3616 3546 3318 553 13749 14982 --
NM_007294chr1731161 386 82 --21277 196 --
NM_007295chr1731161 386 82 --21277 196 --
NM_007296chr1731161 386 82 --21277 196 --
NM_007297chr1731161 386 82 --21277 196 --
NM_007298chr1731161 386 82 --21277 196 --
NM_007299chr1731161 386 82 --21277 196 --
NM_007300chr1731161 386 82 --21277 196 --
NM_007302chr1731161 386 82 --21277 196 --
NM_007303chr1731161 386 82 --21277 196 --
NM_007304chr1731161 386 82 --21277 196 --
NM_007305chr1731161 386 82 --21277 196 --
NM_007308chr42182 126 ------
NM_007320chr191240 ------
NM_007322chr192554 547 2448 383 ----
NM_007327chr991114 953 917 889 830 755 128 33 21 1852 1922 --
NM_007345chr18--1253 1261 1590
NM_007350chr1233618 3552 1617 24322 3191 21733 102 --
NM_007358chr1----11656 11821
NM_007365chr18866 832 707 595 556 377 154 54 41599 1425 589 303 32044 1659 485 41918 1710 731 657
NM_007371chr92640 135 ------
NM_007373chr10----21779 381 11156
NM_007375chr141081 907 429 291 --1493 --
NM_012062chr122810 209 ------
NM_012064chr1231150 334 207 31031 459 217 ----
NM_012069chrX42702 623 230 197 12567 1274 --
NM_012074chr146767 728 240 161 129 108 --1955 --
NM_012081chr51160 32276 695 194 ----
NM_012083chr1041145 1093 541 240 11070 ----
NM_012090chr1--1862 ----
NM_012095chr1063514 2672 2283 2195 1110 448 11086 1320 --
NM_012097chr231822 1759 604 1336 ----
NM_012098chr961389 1191 1011 620 595 333 185 ----
NM_012102chr182427 2401 2282 2042 1873 876 569 268 --22155 205 22619 2252
NM_012104chr1193367 3225 3082 2672 1160 1032 998 432 32 42453 2383 1522 117 31443 1428 1022 13467
NM_012104chr1193367 3225 3082 2672 1160 1032 998 432 32 42453 2383 1522 117 31443 1428 1022 13467
NM_012110chr4169 ------
NM_012120chr622878 950 12010 ----
NM_012134chr1--21241 205 11229 --
NM_012141chr1354132 3875 2601 1495 287 ----12863
NM_012158chr1311529 ------
NM_012161chr411180 ------
NM_012164chr996324 6253 6214 6134 5690 2859 2313 1547 549 14571 35396 2040 1666 26510 6084
NM_012166chr941101 1019 95 89 --31464 445 425 --
NM_012168chr12112 21 195 123 --
NM_012175chr112800 224 ------
NM_012177chr61475 --1132 --
NM_012183chr12446 126 --1142 1129
NM_012188chr521044 901 1742 ----
NM_012193chr11115150 4804 4033 3691 3577 3353 2134 1865 1624 705 682 13605 44995 4902 4632 333 14730
NM_012199chr1134520 4113 3598 3270 2956 2936 1647 1527 1477 1076 782 749 600 33131 1608 1307 54115 4081 3829 1154 672 --
NM_012214chr236158 2518 153 --12421 12424
NM_012219chr3103237 2726 2631 2378 2136 567 388 287 280 186 32793 926 60 22516 1143 12395
NM_012232chr1792033 2026 1892 1848 1621 1455 333 321 64 21809 117 22056 2054 21851 336
NM_012234chr351504 1385 1066 675 438 ------
NM_012238chr1021705 1472 ------
NM_012242chr102528 176 ------
NM_012244chr14141660 1504 1496 1317 1290 1198 1164 555 496 344 289 101 55 37 31369 626 522 31429 1427 28 1577
NM_012247chr10150 ------
NM_012249chr232855 244 40 22459 744 22273 385 --
NM_012250chr11--11108 159 162
NM_012257chr71230 ----1774
NM_012261chr203618 466 36 ----1216
NM_012278chrX1150 ------
NM_012279chr5101876 1595 1586 1361 497 377 278 177 76 51 --31528 808 744 1272
NM_012281chr712151 11763 ----
NM_012282chrX2770 85 2666 37 2772 197 --
NM_012287chr351691 1341 1317 1247 442 44152 3450 1553 766 1553 --
NM_012288chr6154951 4931 4894 4641 4044 3932 3668 2306 2231 1822 1240 536 183 81 73 44791 4745 2263 1864 104896 4643 4523 3880 3878 3637 2020 2009 1257 227 44683 4155 4048 769
NM_012294chr753890 3397 3053 1433 21 ------
NM_012296chr11163426 3377 3362 3191 3091 2916 2846 2628 2488 1526 419 292 192 158 99 83 53433 3005 2963 1498 55 51528 848 396 69 62 --
NM_012297chr431855 805 426 --22084 1837 1167
NM_012300chr562074 701 479 247 212 187 11818 11660 --
NM_012301chr731552 1532 1463 1320 11773 --
NM_012302chr121086 77 ------
NM_012306chr12183543 3422 3409 3377 3305 3168 3125 3064 3049 2921 2346 2297 2270 2261 1159 266 235 63 23520 3318 32410 2405 2275 43308 2300 2230 1181
NM_012307chr181681 ----1176
NM_012308chr11151765 969 872 810 803 795 642 589 575 547 470 191 119 108 68 2353 51 8909 591 577 457 455 196 70 40 --
NM_012309chr11114239 4195 4169 3799 3574 3371 3209 1341 498 316 121 14088 51502 1400 1169 1050 607 23818 600
NM_012311chr10----1585 --
NM_012316chr1194494 4169 3878 3558 2206 2053 1963 1676 1567 1105 1099 982 944 902 754 700 380 243 154 31873 821 748 43794 3690 1641 402 1606
NM_012322chr72108 70 ------
NM_012323chr2241104 1014 988 148 21041 54 --11079
NM_012325chr2021258 71 11108 11260 --
NM_012326chr24705 248 47 36 3777 764 272 ----
NM_012328chr731234 199 42 ------
NM_012329chr1731255 1198 392 ------
NM_012333chr1----21299 1297 --
NM_012334chr553891 3868 3464 3425 1583 --2440 360 --
NM_012340chr203265 192 176 ------
NM_012384chr2072204 2185 1783 786 616 221 48 12032 1557 1514
NM_012395chr783121 2314 2263 1378 1164 1082 310 123 --53003 2356 2328 2294 2109 --
NM_012398chr19122963 2760 2541 2495 2370 2017 978 919 790 730 165 133 12652 22279 735 --
NM_012399chr2251801 1550 1529 1521 129 ------
NM_012402chr114377 317 278 206 --2418 416 --
NM_012406chr1241201 1132 841 342 ----1980
NM_012407chr224496 219 130 123 ------
NM_012410chr162100 41 147 --3485 469 125
NM_012412chr73827 223 26 ------
NM_012416chr91183 --3821 248 99 --
NM_012421chr1--1176 ----
NM_012428chr151145 --289 87 --
NM_012432chr12104 59 ------
NM_012446chr51440 --2146 144 --
NM_012448chr1792161 2057 2041 1839 1828 1675 1022 675 541 11721 62166 2164 691 689 548 242 --
NM_012453chr761415 1147 223 193 169 106 41519 1236 431 52 --21338 138
NM_012456chr11165 145 ----
NM_012461chr147652 585 474 465 251 191 50 1661 1467 --
NM_012463chr1231610 600 149 ------
NM_012464chr442362 2026 2005 1029 12231 --11173
NM_012465chr1063035 2870 2335 641 478 303 1669 1660 --
NM_012473chr223673 265 88 --1217 --
NM_012475chr13181 173 59 ------
NM_012478chr175678 344 325 231 36 1190 4833 408 298 102 --
NM_012479chr752207 1929 719 396 60 31769 943 109 --12189
NM_013229chr1252667 2225 680 440 168 ------
NM_013230chrY11518 137 ----
NM_013231chr1464289 1689 1154 1143 789 700 13439 43303 3238 1533 1201 --
NM_013233chr24968 397 69 57 ------
NM_013243chr152339 312 --1165 --
NM_013245chr167723 646 573 288 261 228 216 165 ----
NM_013246chr113716 682 27 1826 1161 --
NM_013252chr722617 476 --22670 1855 1479
NM_013253chr1141462 1386 164 93 --2354 120 2108 55
NM_013257chr822167 300 ------
NM_013259chr31226 --2290 94 --
NM_013261chr493242 3014 2774 2285 916 747 679 101 64 ------
NM_013269chr1283997 3954 3503 1460 1177 486 417 199 34284 3968 3512 34297 4291 4261 24244 1259
NM_013277chr121930 125 1166 1179
NM_013279chr1152055 2046 904 499 371 32198 1644 1539 72221 2097 2058 1622 613 501 362 --
NM_013281chr201980 ------
NM_013286chr383683 3673 3641 3552 3453 3053 2668 101 33586 3441 2894 22688 1355 13556
NM_013293chr7192 ----176
NM_013305chr183916 868 42 --2117 115 --
NM_013316chr7181 --2801 56 1136
NM_013323chr1771115 1095 964 838 822 259 172 ----1313
NM_013334chr32200 37 ------
NM_013341chr262761 2561 2020 1156 1120 1104 --22793 1128 --
NM_013346chrX170 ------
NM_013354chr82358 318 --41355 376 374 101 --
NM_013357chr8--1204 1868 --
NM_013363chr3162 ------
NM_013368chr192444 200 ------
NM_013372chr1592919 2807 2407 1342 1081 935 474 392 360 2481 228 ----
NM_013373chr223936 830 305 2813 69 ----
NM_013377chr121604 ------
NM_013382chr14102058 2024 1817 1772 1754 1629 1599 874 561 240 141 11774 1829
NM_013388chr22254 72 ------
NM_013392chr23141 106 73 --1165 --
NM_013399chr1661794 1245 291 80 59 24 --1352 --
NM_013403chr193761 660 615 2182 166 2742 247 1152
NM_013417chr9136 ------
NM_013433chr1961930 1346 1332 1255 714 141 21936 1285 31946 1879 477 --
NM_013434chr241722 1643 798 441 1250 51940 1743 697 586 451 --
NM_013434chr241722 1643 798 441 1250 51940 1743 697 586 451 --
NM_013436chr21568 ------
NM_013438chr921437 641 --11296 11607
NM_013443chr941103 360 304 109 1354 1987 --
NM_013444chrX71001 233 210 187 180 171 161 ----1227
NM_013446chr731444 185 164 --186 --
NM_013448chr141681 ------
NM_013449chr12142374 2133 2115 1207 1131 709 657 645 629 590 557 532 340 326 62994 866 845 834 749 196 62717 2006 1991 342 177 38 11103
NM_013450chr231047 865 350 ------
NM_013951chr282345 2303 851 585 504 475 437 134 22380 968 --1478
NM_013952chr282422 2380 928 662 581 552 514 211 12457 --1555
NM_013953chr282422 2380 928 662 581 552 514 211 12457 --1555
NM_013992chr282422 2380 928 662 581 552 514 211 12457 --1555
NM_013993chr65522 279 216 93 25 2591 271 1178 --
NM_013994chr65522 279 216 93 25 2591 271 1178 --
NM_013995chrX1356 ------
NM_013999chr1771287 1102 399 380 364 154 119 41383 144 126 25 1242 --
NM_014000chr10101760 1750 1440 1415 1258 735 634 500 389 353 11499 ----
NM_014002chr14630 486 289 116 --3632 479 169 --
NM_014005chr592497 2431 2232 2084 1966 1942 1211 636 394 --1826 --
NM_014007chr91790 ------
NM_014010chr95623 555 509 153 62 138 ----
NM_014015chr163698 160 135 1119 127 --
NM_014021chr152954 2221 1318 1206 129 --23349 138 13352
NM_014023chr101655 11052 ----
NM_014028chr643347 3036 553 515 12732 11286 --
NM_014030chr178990 944 858 803 478 352 226 128 2815 748 51139 1122 869 480 246 11125
NM_014034chr63405 261 58 --1970 --
NM_014038chr72291 126 ------
NM_014057chr931523 1319 435 ----11356
NM_014059chr131345 ------
NM_014079chr36725 716 346 334 267 84 ------
NM_014089chr1331448 851 121 ------
NM_014106chr1542129 2040 938 676 ------
NM_014109chr81452 1413 ----
NM_014110chr131111 283 121 --1886 --
NM_014112chr854764 4327 3513 3335 531 11224 14739 --
NM_014117chr1692363 2321 2265 2241 1967 1943 1782 1056 1035 1749 32271 1037 94 --
NM_014141chr7104848 4603 4225 4200 3929 3902 3634 3496 431 209 11241 24205 4203 13508
NM_014149chr72696 96 1202 1594 --
NM_014155chr11126650 5973 5851 5675 5629 5510 1492 1354 550 403 143 82 12783 35659 5657 1074 22118 116
NM_014157chr16153321 3269 2997 2974 2866 2808 2685 1343 1271 922 864 793 544 137 77 32489 555 278 23177 1434 1630
NM_014166chr13--1837 1809 --
NM_014178chr142243 182 ------
NM_014181chr232328 877 827 ------
NM_014182chr123476 241 129 --2725 243 --
NM_014188chr12302 269 1315 ----
NM_014190chr461711 1359 1333 740 591 62 1106 164 1594
NM_014212chr124899 825 789 387 2948 932 ----
NM_014217chr151577 579 526 279 273 ------
NM_014223chr14725 686 639 509 182 --1512
NM_014225chr194315 147 129 100 1345 1406 1153
NM_014231chr1271803 1711 1699 1604 267 234 71 22029 85 21701 1485 --
NM_014232chr17121253 1030 655 436 422 344 292 284 278 264 96 40 31346 1216 416 51634 1493 424 360 42 --
NM_014232chr17121253 1030 655 436 422 344 292 284 278 264 96 40 31346 1216 416 51634 1493 424 360 42 --
NM_014233chr1792174 1724 1634 1526 1372 526 221 108 47 31712 418 53 2528 76 21782 1362
NM_014234chr6----1172 --
NM_014240chr392780 2760 2666 2640 1157 1140 683 450 414 32869 1599 1379 11052 --
NM_014243chr431955 1538 53 ----159
NM_014248chr22156 ------
NM_014250chr2231489 1388 260 --11569 11578
NM_014251chr72693 310 ----2820 812
NM_014252chr13----1126 --
NM_014253chrX51923 1571 716 632 512 ------
NM_014267chr111785 ------
NM_014270chr19170 ------
NM_014271chrX1589 1609 ----
NM_014275chr56892 873 826 810 782 567 1793 1752 --
NM_014282chr951226 1120 285 190 109 --21122 496 --
NM_014283chr11323 1356 ----
NM_014284chr151036 905 425 406 317 3823 109 96 165 1842
NM_014289chrX51257 1243 1181 1079 121 31067 448 142 1355 --
NM_014292chr22101796 1669 1612 1494 1413 1229 669 499 322 302 21681 1571 61782 1760 1579 549 95 93 --
NM_014293chr22153793 3721 3366 3163 1292 766 659 582 562 540 486 420 277 97 28 53982 3448 1386 1089 73 44006 4001 768 133 33724 3472 2749
NM_014299chr1972041 1758 861 432 384 301 83 153 22046 1760 2714 580
NM_014305chr133283 256 221 ----1259
NM_014309chr22135191 5136 5085 5067 4913 4710 4493 3465 1599 1552 1210 818 591 35339 4931 3290 105072 5070 4915 4457 3896 3634 1863 940 598 593 24924 4460
NM_014319chr1241881 1641 444 69 ------
NM_014323chr221162 1415 ----
NM_014331chr4106197 5856 5843 5311 5160 3006 2697 2503 2346 502 --12176 36462 2234 2179
NM_014332chrX2315 154 ------
NM_014333chr1182661 1988 1004 849 441 395 361 237 --1336 --
NM_014335chr151988 --1999 --
NM_014342chr1141481 1383 510 189 --11322 --
NM_014344chr111698 ----1228
NM_014345chr64953 946 275 172 1395 1179 --
NM_014360chr146630 207 198 118 103 91 ------
NM_014368chr961899 1616 269 231 212 163 --21618 372 11902
NM_014372chr121940 661 1387 1379 --
NM_014376chr592196 2083 585 579 521 494 363 345 169 4559 335 145 126 32171 481 260 --
NM_014388chr1145845 4802 4614 4522 4390 4238 4188 4122 3934 3864 3846 3739 3685 339 23871 2328 14988 15805
NM_014393chr821713 313 --2732 372 --
NM_014400chr196477 456 421 413 345 23 3446 394 124 ----
NM_014405chr17101959 1590 901 632 520 383 262 220 119 34 31945 1862 529 62263 2261 2142 538 536 338 2545 37
NM_014408chr12537 66 --1560 --
NM_014409chr13973 301 106 --3852 850 116 --
NM_014410chr181344 ------
NM_014415chr331469 1384 1219 11164 ----
NM_014417chr191381 --1383 --
NM_014421chr421705 767 11756 12141 11393
NM_014423chr534527 1657 1135 --21003 117 11660
NM_014426chr201252 1668 ----
NM_014431chr1061145 460 368 347 321 112 1423 1362 11598
NM_014437chr1----155 --
NM_014445chr342159 1582 458 32 --12207 --
NM_014447chr421596 138 11636 ----
NM_014452chr641137 382 185 179 ------
NM_014454chr61866 1292 ----
NM_014458chr121105 882 --11275 11282
NM_014469chr11----1295 --
NM_014470chr12142 ------
NM_014494chr1641666 798 390 347 31850 958 318 42075 2051 1910 414 1135
NM_014501chr19252 40 ------
NM_014507chr221268 1916 --1208
NM_014515chr1221075 31 --11077 --
NM_014516chr192196 32 1205 ----
NM_014517chr311630 11267 11458 1166
NM_014521chr261667 1494 623 602 509 157 ----11693
NM_014554chr1261693 1675 1663 1608 1448 1411 --12295 --
NM_014563chrX41810 1393 689 358 ------
NM_014567chr16154 1188 ----
NM_014572chr1321167 516 ------
NM_014573chr1751700 1564 1482 283 170 ----1439
NM_014574chr1421360 1112 ------
NM_014575chr31430 ------
NM_014577chr22----1118 --
NM_014587chr1661508 1252 590 539 267 195 --21473 201 --
NM_014591chr1061046 892 386 347 332 107 41284 1072 944 289 1375 21049 81
NM_014592chr52625 197 ----1264
NM_014601chr1961467 1414 1203 651 462 98 21299 37 21701 127 11470
NM_014604chr174819 538 158 151 1559 1196 --
NM_014607chr22827 724 11957 1515 1620
NM_014612chr911221 11381 ----
NM_014613chr572697 2657 2266 1226 975 436 419 32313 2168 1911 12134 --
NM_014614chr231320 1203 183 1589 --1407
NM_014615chr1673654 3162 2736 1144 1136 589 267 1449 12278 22507 2336
NM_014620chr123193 121 46 --2692 198 1695
NM_014621chr21212 1174 229 27 --
NM_014623chr6----195 --
NM_014630chr1593768 3071 982 973 849 555 531 417 50 63463 3435 3278 2685 931 385 23202 2471 --
NM_014632chr11278 62 195 126 --
NM_014634chr2283623 3516 3201 2665 2593 449 439 26 22742 2444 73579 3212 3207 1109 642 54 52 22417 121
NM_014636chr974123 3437 3136 2735 979 872 839 42879 1101 887 845 53460 2713 1364 1357 981 12716
NM_014637chr831241 560 35 1201 ----
NM_014640chr2--1115 ----
NM_014641chr6121 --1526 --
NM_014646chr1862999 2945 2491 2460 2086 647 3149 97 43 ----
NM_014647chr1652156 1547 712 403 194 11447 ----
NM_014657chr204343 322 282 38 ------
NM_014659chr151848 1335 ----
NM_014660chr71366 ------
NM_014661chr10133894 3854 3751 3295 3237 1427 1397 1272 1251 1181 753 297 215 22384 1206 31253 516 505 11553
NM_014663chr121056 219 1973 ----
NM_014665chr8123690 3501 3290 2860 2371 2345 1217 1161 831 366 184 153 22583 2471 33297 2348 368 22444 706
NM_014666chr5--11259 ----
NM_014667chr342282 1895 1679 684 ----12315
NM_014670chr2293 84 ------
NM_014671chr741613 509 137 104 164 --1579
NM_014674chr373667 3649 3167 2769 2654 1503 1331 12875 43506 3177 640 177 13186
NM_014676chr121412 128 1451 1441 --
NM_014677chr841112 1018 1012 499 --21059 1036 --
NM_014682chr8----1538 1143
NM_014683chr1742194 1887 577 209 --11889 --
NM_014686chr193694 504 414 12179 1416 11853
NM_014690chr7183068 2759 2738 2731 2257 2251 2100 1998 1223 1171 1135 1065 834 819 435 376 134 67 21988 1180 1942 12341
NM_014701chr1533237 1353 374 11366 ----
NM_014702chr693294 3192 3106 3021 2953 2565 1400 161 92 --12462 --
NM_014707chr742288 2260 484 346 11747 ----
NM_014711chr162429 36 ----11776
NM_014712chr163521 179 40 --1413 --
NM_014721chr6137226 6312 5361 5228 5206 5186 4707 2571 2175 1940 1282 882 310 1158 25764 5339 --
NM_014723chr20153203 2925 2796 2701 2637 2582 2312 2003 1278 872 698 427 75 69 62 32964 2363 571 1473 22709 476
NM_014726chr1781251 1239 1224 1152 285 209 186 40 2980 396 2287 154 --
NM_014727chr19--179 ----
NM_014729chr821575 435 --1216 --
NM_014730chr12225060 5050 4868 4761 4446 4197 3949 3743 3732 3650 3540 3445 3430 3420 3322 3242 1925 1511 1474 1311 924 895 33601 2047 1904 44824 4768 815 628 --
NM_014730chr12225060 5050 4868 4761 4446 4197 3949 3743 3732 3650 3540 3445 3430 3420 3322 3242 1925 1511 1474 1311 924 895 33601 2047 1904 44824 4768 815 628 --
NM_014731chr2091802 1442 1352 1334 576 496 274 79 69 1151 4498 481 479 84 11253
NM_014733chr51635 ------
NM_014735chrX41508 1452 766 513 2576 406 31666 1454 1419 --
NM_014739chr642731 2652 1637 331 --44012 2741 1539 1096 --
NM_014743chr452305 1177 1115 593 194 12618 1611 --
NM_014747chr1265416 5383 5143 4918 4539 4438 3982 3967 3958 3783 3770 3732 3684 3651 2163 2106 2049 1226 1024 797 727 719 637 589 484 65 54864 3990 3726 1469 816 24119 3689 34921 2052 1596
NM_014748chr2--1381 1295 --
NM_014751chr842091 847 768 243 --22148 2093 1397
NM_014752chr1141942 1809 208 29 11787 ----
NM_014754chr85826 624 353 159 74 1714 --1793
NM_014755chr2103440 2875 1691 1564 1544 1526 1299 1287 1002 496 11437 24124 3047 11239
NM_014756chr111174 ------
NM_014757chr5112045 1834 1804 1762 1645 1635 1621 944 713 701 618 21909 1722 --1833
NM_014761chr165747 158 150 136 71 11059 ----
NM_014764chr1241228 506 400 354 2980 193 ----
NM_014765chr152077 719 614 543 173 ------
NM_014766chr793522 3476 2838 1254 921 791 398 192 75 31276 579 40 32830 2828 1265 2794 628
NM_014767chr10133446 2841 2745 2712 2562 2370 2252 1331 1283 1165 1039 701 445 11401 33556 2714 491 --
NM_014770chr1271297 1150 1040 993 965 179 92 21103 226 --1186
NM_014771chr163885 383 287 3815 691 349 161 --
NM_014776chr1282642 2383 1987 906 767 542 325 23 12627 31244 1060 769 --
NM_014779chr32305 160 ------
NM_014784chr191114 975 737 431 385 238 202 94 38 --2977 812 --
NM_014786chr114885 823 192 60 2420 379 --2854 63
NM_014795chr21503 ------
NM_014798chr1791790 1510 1401 1288 1278 1266 401 240 195 21745 673 21782 1693 --
NM_014800chr741139 883 471 328 1227 1465 --
NM_014803chr104645 395 364 298 ----12098
NM_014806chr91140 170 ----
NM_014807chr114620 599 52 32 5717 611 584 265 45 1343 --
NM_014810chr143155 2636 1359 541 ----22611 890
NM_014812chr161753 1589 1542 390 373 286 21608 503 11323 --
NM_014819chr53946 776 609 11960 --1274
NM_014820chr311659 --11906 --
NM_014822chr4149 ------
NM_014824chr113597 213 153 1504 ----
NM_014826chr1113790 3782 3656 3460 2784 1611 1378 964 53 38 31 64331 3952 3690 1291 1149 1106 23463 71 --
NM_014829chr552168 2070 1916 714 669 ------
NM_014830chr12103668 3541 3404 2879 2801 2615 2579 2401 1574 927 2305 79 32807 2623 2581 33843 3433 737
NM_014836chr102527 128 ------
NM_014838chr2262701 2667 1940 700 624 168 1129 --11866
NM_014839chr142317 925 882 384 11823 ----
NM_014840chr1262740 2590 2295 2289 832 419 --11262 11148
NM_014841chr62967 131 ----1403
NM_014846chr8------148
NM_014847chr12374 207 --1218 --
NM_014848chr1572685 1934 1841 1803 1131 599 590 --2957 955 1245
NM_014849chr191261 1105 912 884 483 307 232 111 62 5979 894 346 226 105 1281 11174
NM_014850chr3174404 4281 4111 4040 3470 1616 1592 1569 1479 1457 1343 1318 544 489 332 321 292 34703 4332 83 34306 4301 3472 --
NM_014859chr1731290 1265 1182 1300 ----
NM_014870chr1114615 4605 4460 4108 3582 3352 3272 958 854 785 558 54497 3820 3394 2876 236 13371 1659
NM_014871chr122571 31 --133 --
NM_014872chr952069 1931 1624 861 732 22043 1786 11555 --
NM_014873chr151726 1308 1187 1175 474 1855 --11841
NM_014876chr222471 297 31939 691 93 21604 116 11531
NM_014877chr1797367 7002 6010 5620 2554 2050 2017 1439 901 15586 --1959
NM_014887chr132851 719 ----1657
NM_014888chr741499 1363 489 225 1528 ----
NM_014892chr6148 ------
NM_014893chrY12262 22167 1799 1883 11576
NM_014897chr1762569 2311 2081 1100 539 97 23154 906 43080 2299 2293 99 1341
NM_014901chr542027 1888 1585 323 21575 203 41407 753 748 262 --
NM_014902chr2051530 1219 1135 577 468 11562 11224 1417
NM_014903chr1232112 2072 706 ------
NM_014904chr1053185 3168 1253 1234 116 11449 --1755
NM_014905chr22488 278 --1194 --
NM_014906chr1721370 31 43375 1503 296 258 21017 33 --
NM_014909chr14113829 3822 3195 3164 2939 2771 2569 2477 774 412 375 33378 3360 3089 23943 918 23964 3074
NM_014912chr1012604 ------
NM_014913chr184493 420 409 288 ----11183
NM_014914chr24845 232 123 102 --1405 --
NM_014918chr15----11300 --
NM_014920chr683240 2619 2531 2417 1342 1091 52 28 1641 ----
NM_014921chr19172975 2963 2839 2829 2750 2742 2480 2285 2027 2021 848 720 689 528 434 316 201 22939 891 5880 878 817 617 318 32868 2505 113
NM_014923chr1342300 2277 246 240 21716 475 12271 --
NM_014924chr1452239 1969 1950 1099 50 13142 2984 616 13116
NM_014925chr126809 776 756 366 207 183 1765 --1240
NM_014926chr331033 174 78 --3797 745 176 --
NM_014931chr194663 590 52 33 --2126 124 --
NM_014932chr311466 ------
NM_014933chr4--1375 ----
NM_014934chr1332978 2809 106 13231 ----
NM_014935chr163821 3398 2834 1434 1165 917 43777 2372 1352 97 33465 909 861 --
NM_014936chr642722 979 922 719 ------
NM_014938chr1252015 1916 252 223 47 --32017 1682 498 21938 112
NM_014941chr222160 24 ------
NM_014944chr151412 1117 166 121 60 --61119 1074 1072 1067 1065 293 --
NM_014945chr5122008 1852 1253 1236 1225 691 643 617 597 332 325 55 --21287 645 2600 444
NM_014947chr142506 2397 1019 526 --1206 --
NM_014949chr11759 --1764 --
NM_014950chr1441779 658 602 110 ------
NM_014952chr15102035 1983 1799 1622 1481 670 554 447 385 245 1713 11373 --
NM_014961chr41824 1733 --1192
NM_014962chr202405 275 ----32544 952 877
NM_014969chr13821 735 186 1428 ----
NM_014974chr1031434 1412 1307 ------
NM_014977chr143469 218 208 --2407 158 --
NM_014978chr106729 696 412 378 371 245 11202 1299 1235
NM_014982chr1461783 1374 806 664 150 34 --32140 1413 1136 1898
NM_014988chr452185 1133 980 860 815 --11135 --
NM_014989chr642025 1293 733 395 --21357 562 1621
NM_014990chr1431184 374 275 197 1107 --
NM_014991chr4255 46 --1256 --
NM_014992chr141330 --2682 292 --
NM_014994chr1581962 1470 678 660 466 363 178 146 32040 1956 136 3839 783 632 1518
NM_014996chr321047 185 2846 272 3211 148 127 --
NM_014997chr762913 1938 1856 1108 245 179 --22894 1948 --
NM_015000chr1243089 2410 1909 460 --12220 12264
NM_015001chr11906 --1926 136
NM_015002chr1251663 660 342 194 44 --1168 --
NM_015008chr383078 2779 2487 1434 1048 961 521 417 --23083 3081 1420
NM_015020chr1683725 3703 2386 1389 1219 1190 354 212 12798 1610 23300 1135
NM_015023chr1151692 1676 1543 1523 1271 1238 1230 1209 1148 1126 678 612 507 459 263 31716 1437 439 71426 1221 1216 1137 1135 116 91 11455
NM_015024chr831124 908 266 1149 31378 974 268 --
NM_015025chr2----21007 898 12199
NM_015026chr1234742 4480 4442 1865 34542 4468 956 13530
NM_015027chr1641784 794 632 228 2533 380 31504 1239 672 --
NM_015032chr1322555 1948 --1517 11821
NM_015033chr9122697 2689 2676 2423 2156 1063 894 858 507 249 153 132 32223 802 256 --1142
NM_015035chr20116369 5639 5112 5033 4229 4113 4053 2525 1962 1775 224 35845 4249 1486 36035 4086 1630 11390
NM_015039chr1104112 3699 3514 1632 901 588 512 397 282 105 1439 43852 3259 88 63 23702 1430
NM_015042chr15194287 4279 4057 3846 3718 3680 3671 3636 3609 3431 3225 1360 1342 1080 961 880 851 241 196 42709 833 740 342 43662 3442 1491 1433 32895 611 491
NM_015045chr1031505 1434 288 ------
NM_015049chr222765 1122 --22741 497 --
NM_015051chr943378 2808 1263 785 --22850 145 1981
NM_015052chr751214 507 90 76 70 1495 2200 198 --
NM_015057chr13------1185
NM_015063chr1912876 499 446 343 219 208 192 186 140 124 104 80 21271 299 61349 1347 939 384 346 87 --
NM_015064chr1293023 2728 2698 2254 2233 2224 990 822 609 --42700 2256 1321 1098 23112 2613
NM_015068chr753948 3873 707 646 236 ------
NM_015069chr16126 ------
NM_015071chr595497 5272 5167 4153 2293 2286 1476 565 458 35204 4788 1543 32314 792 656 11071
NM_015074chr1103714 3448 3418 3386 3153 3138 3127 1910 1405 149 31680 862 158 54749 4747 1452 561 122 --
NM_015076chr664078 3810 2843 1798 909 214 11390 --1202
NM_015079chr15143030 2774 2731 2546 2436 2309 2266 2178 1195 740 712 461 243 119 --23178 464 1452
NM_015080chr117934 918 911 620 391 97 71 --299 73 --
NM_015082chr562398 1850 678 656 436 134 1316 22094 485 --
NM_015085chr1794118 4068 3638 3476 3343 1218 851 774 613 21224 1022 74051 3791 3396 1698 1391 1016 832 11658
NM_015086chr1261587 1442 1391 1064 1049 556 1562 31372 1004 67 11172
NM_015087chr1332670 2232 2053 ----12254
NM_015090chr1155911 5892 5752 5199 4717 4610 4598 2469 2355 2087 1742 1382 1125 760 597 55724 4307 1560 964 751 2463 385 --
NM_015092chr16124468 4360 4321 3622 3528 3194 2843 2837 1840 990 944 677 1660 23818 2845 13911
NM_015093chr61649 --2524 322 --
NM_015094chr22154333 4321 4153 3942 3476 2958 2866 1806 1589 1312 1117 815 484 245 41 34472 781 221 --24640 3605
NM_015097chr331521 110 30 --32307 1523 1475 1294
NM_015099chr175462 291 246 170 135 2284 146 1172 --
NM_015100chr181566 1349 748 629 615 604 154 131 1635 21719 363 1806
NM_015103chr31252 1859 ----
NM_015107chrX52444 1883 1656 1631 872 1178 --1465
NM_015110chr932006 496 413 ------
NM_015113chr1772051 1882 1719 1603 554 335 106 11955 1734 --
NM_015115chr432799 400 110 1868 ----
NM_015125chr194503 167 155 136 2524 108 2212 81 2452 375
NM_015132chr721784 276 --11768 --
NM_015133chr1661363 1351 1121 553 376 235 1348 11123 21429 1312
NM_015138chr1572782 2599 2111 1010 822 198 186 32327 843 794 1389 2940 813
NM_015143chr441276 1070 559 220 --1566 --
NM_015144chr1693788 3255 3233 1078 957 853 658 552 285 23264 969 13342 22459 823
NM_015150chr33288 127 83 ------
NM_015155chr1033229 594 60 1853 42331 976 905 157 --
NM_015156chr14103633 3361 2626 1566 1064 859 576 353 284 96 1195 2637 628 1324
NM_015157chr1151108 1100 774 443 259 21114 409 1776 1262
NM_015163chr144508 386 180 167 11833 1182 --
NM_015170chr841540 778 768 615 21974 567 1780 --
NM_015171chr164415 146 111 77 ------
NM_015172chr12598 425 --11288 --
NM_015176chr11166 ----11311
NM_015178chr872376 2329 2157 1960 1889 830 66 1819 1714 --
NM_015185chrX82732 2625 2325 2210 2176 845 381 316 12661 72741 2389 961 959 943 559 515 12452
NM_015187chr4------123
NM_015191chr1142730 2025 827 100 --11049 1103
NM_015192chr2042988 2571 1104 58 --193 --
NM_015199chr322194 2171 ------
NM_015200chr442433 1990 1769 242 --2710 236 --
NM_015202chr1631367 1154 585 21534 1052 2611 609 --
NM_015206chr1562799 2712 2614 847 801 616 13885 23051 2645 --
NM_015208chr1843718 2894 1364 505 1797 1843 1943
NM_015209chr132275 2095 1476 11439 4379 369 185 183 --
NM_015213chr113299 263 65 ------
NM_015215chr112852 --13212 --
NM_015219chr1782231 2131 1644 568 515 386 350 209 22526 1034 --1176
NM_015225chr962651 2337 2029 846 553 423 --21934 439 1426
NM_015230chr421798 1592 123 ----
NM_015233chr1322367 138 22301 507 --12403
NM_015234chr631310 207 201 11134 ----
NM_015235chr1042008 1987 769 107 1840 11876 --
NM_015236chr431274 983 201 --1230 --
NM_015239chr9161 ------
NM_015245chr662575 2296 1751 1058 765 129 11843 42262 2060 2041 767 --
NM_015250chr921860 55 1159 1253 --
NM_015252chr23338 323 156 150 2596 25 --
NM_015254chr852491 2248 636 496 151 52449 924 411 216 100 12767 12912
NM_015256chr52704 568 ------
NM_015261chr112388 89 1137 ----
NM_015263chr151360 --1399 --
NM_015264chr22114811 4372 4332 3999 3642 1731 1564 1499 1252 1088 938 1506 84546 3588 1943 1805 1569 1567 887 191 --
NM_015265chr212497 ------
NM_015268chr3195 ------
NM_015270chr1292221 2029 1927 1895 1672 931 394 350 255 41871 1580 514 248 --11543
NM_015271chr411008 --22860 1681 --
NM_015272chr1641930 1605 514 26 21727 34 ----
NM_015282chr2132687 2581 2504 2479 2411 2341 2171 2039 1226 933 663 652 408 ----2666 66
NM_015284chr1102090 2028 1896 1884 1874 1810 1344 833 565 337 31573 414 189 --11935
NM_015285chr1842459 2006 855 248 22495 745 22224 903 --
NM_015286chr152999 245 --21573 104 21623 261
NM_015288chr5113869 3663 3295 2835 2751 2721 2580 1076 991 967 638 11154 23393 2599 --
NM_015289chr1581925 1828 1762 1334 606 571 544 44 21518 106 1598 --
NM_015292chr12136 1283 1267 --
NM_015293chr62280 129 ------
NM_015294chr1711084 ------
NM_015296chr131401 ------
NM_015299chr14103917 3815 3713 3428 3300 3270 1593 918 414 373 23555 3447 33781 3287 375 23749 3303
NM_015305chr1491288 387 289 262 208 139 125 114 32 1765 21981 605 11423
NM_015310chr8157559 7223 7154 6989 6870 6753 6225 5473 2731 2111 1715 1519 1234 1195 983 16588 47156 6598 6227 2491 15476
NM_015313chr1174075 3634 3242 2945 1623 791 230 23543 3474 13344 1233
NM_015314chr732174 433 173 ------
NM_015315chr5103167 3150 2782 2170 2108 649 640 401 207 200 1673 43169 2940 863 550 31334 643 213
NM_015317chr222706 2370 ----12519
NM_015319chr123402 153 111 ------
NM_015321chr19184760 4740 4558 4338 4293 4128 4035 3863 3506 3394 3031 1958 1412 1277 1252 673 279 266 31644 1450 50 24762 4180 --
NM_015326chr1112809 2091 1155 782 729 541 201 178 141 134 64 22785 2690 42298 2073 784 180 32711 2080 666
NM_015327chr151123 480 373 271 55 21215 487 31257 1255 45 --
NM_015328chr772694 2684 1222 1022 622 597 420 42735 2704 360 283 12696 --
NM_015335chr1242158 1847 197 22 1112 41914 1001 999 42 1510
NM_015338chr2071559 1430 769 404 390 239 124 --41852 1516 1264 1262 --
NM_015339chr2021009 300 ------
NM_015344chr831926 854 127 11767 ----
NM_015346chr1461594 1429 607 464 390 150 1532 --11225
NM_015349chr642089 1011 649 103 --42258 2071 1953 546 --
NM_015355chr17--11533 ----
NM_015359chr8102839 2749 2170 929 820 740 528 309 238 221 1490 1825 1224
NM_015361chr24751 718 46 36 ------
NM_015365chrX74026 3604 3257 614 392 378 359 13933 23206 333 21389 49
NM_015367chr22--1510 --11665
NM_015374chr2261446 513 205 199 153 64 2476 236 ----
NM_015375chr184523 3831 3666 3367 1546 1491 1411 43 24048 140 24850 1763 13514
NM_015378chr173018 2989 2656 2322 2184 1825 931 32766 2712 1817 12324 --
NM_015382chr141517 ------
NM_015385chr1042669 1027 777 435 --1265 --
NM_015387chr241925 1744 720 683 11564 --1462
NM_015388chr6134 1250 1279 --
NM_015393chr442972 634 166 142 12561 2676 148 32381 1129 282
NM_015397chr951562 1496 1281 778 293 --1195 1739
NM_015401chr121799 --1257 1724
NM_015415chr11171 ------
NM_015417chr202628 493 1445 ----
NM_015429chr321060 387 1245 ----
NM_015435chr821341 1329 ------
NM_015436chr423091 682 --2967 422 --
NM_015439chr6187 ------
NM_015443chr1761052 1016 967 540 430 324 --1542 --
NM_015444chr3156 --2260 111 --
NM_015446chr1----11577 --
NM_015447chr92689 180 ------
NM_015455chr564101 2801 1532 1079 401 387 ------
NM_015457chr115850 706 228 86 72 123 ----
NM_015460chr362082 1533 1324 724 458 291 --1567 --
NM_015461chr181611 ------
NM_015464chr72828 364 ------
NM_015465chr54660 551 488 204 ------
NM_015470chr281094 1050 1003 951 426 231 122 74 --51115 289 127 62 60 1397
NM_015472chr32122 100 ------
NM_015472chr32122 100 ------
NM_015477chr152323 219 --1984 --
NM_015481chr1281087 1075 929 845 812 314 225 81 41018 419 94 34 51089 1011 931 232 106 --
NM_015488chr2121600 1572 1546 1515 1506 1489 1181 536 406 301 295 33 31430 685 640 21684 1347 1526
NM_015493chr1952089 204 147 136 80 1104 42106 1690 138 61 --
NM_015496chr81205 ------
NM_015503chr16--1542 --1617
NM_015508chr311242 ----11560
NM_015509chr1261538 1155 1139 558 209 166 196 ----
NM_015514chr145534 428 229 121 101 ------
NM_015520chr32529 409 --21032 361 --
NM_015526chr19148 3466 373 313 ----
NM_015527chr164617 523 206 41 1128 3737 594 135 --
NM_015534chr13885 215 96 ------
NM_015535chr2113878 3761 3512 3001 2967 2848 2585 1578 1202 984 209 13435 --11489
NM_015537chr94454 147 80 41 1751 ----
NM_015541chr31576 ------
NM_015542chr10----1962 --
NM_015548chr6------1795
NM_015550chr7113509 2983 2970 2730 2634 2387 2245 861 771 377 39 43572 2640 821 646 12276 --
NM_015553chr674741 4651 4468 4141 4123 3408 848 41692 315 175 122 65054 4628 3606 1489 1241 23 14631
NM_015554chr1522701 2629 32611 1046 754 1951 --
NM_015557chr1103549 3074 2800 2733 2710 1372 1288 1090 1069 228 43296 2780 1425 1345 2700 656 23434 1256
NM_015560chr332665 2303 771 22494 1879 ----
NM_015564chr552954 2666 986 927 549 23252 394 ----
NM_015569chr164598 4501 1929 491 482 401 --11444 23874 622
NM_015570chr73696 224 119 ------
NM_015575chr2113150 3134 2994 2807 2774 2380 2283 804 522 310 31 2626 251 43136 2259 710 398 --
NM_015576chr342716 2260 2241 620 ------
NM_015577chr531321 295 152 11371 1124 1552
NM_015578chr1932094 1768 1372 ------
NM_015589chr141128 --1115 --
NM_015605chr1031525 458 179 2257 86 ----
NM_015609chr192760 2457 2447 2101 1903 866 734 480 181 52603 2505 2172 873 198 1191 11086
NM_015630chr211132 ------
NM_015635chr931727 1609 174 --1880 --
NM_015642chr31216 --1225 --
NM_015649chr195372 289 123 117 76 ------
NM_015651chr962282 2012 1744 524 349 169 42122 543 201 67 11792 --
NM_015652chr102628 484 ------
NM_015670chr171107 160 --197
NM_015680chr23593 573 539 ----1609
NM_015686chrX72420 2385 2232 2221 1763 78 53 1793 22089 403 --
NM_015691chrX72906 2371 2361 1821 1083 818 552 11974 ----
NM_015694chr73143 129 123 --1131 --
NM_015695chr6102153 1887 1851 1723 738 706 618 537 178 98 2762 664 21824 461 31732 445 135
NM_015704chr221128 ------
NM_015711chr196695 669 651 148 34 22 --3684 658 224 2672 270
NM_015716chr179711 608 586 565 511 280 246 63 44 3719 644 253 5697 588 184 82 46 1202
NM_015719chr194579 523 201 150 3597 275 256 1246 --
NM_015726chr1121870 1850 1745 1703 1687 1311 1299 1137 488 453 424 248 --1336 1251
NM_015831chr76914 593 378 351 100 39 1109 1341 --
NM_015850chr862132 1930 1797 352 272 172 41961 1719 188 23 1174 12445
NM_015852chr713460 ------
NM_015855chr113575 198 142 --1144 --
NM_015864chr6--148 ----
NM_015872chr1101790 1774 1756 1725 1703 1452 1409 731 716 432 31161 722 186 11388 11711
NM_015874chr41567 --2487 144 --
NM_015878chr811404 1309 ----
NM_015879chr18218346 8277 8269 7972 7852 7632 7425 7030 6234 5217 2810 2722 2644 2342 2297 1425 940 903 665 518 502 28549 6069 --26218 470
NM_015881chr1141462 1386 164 93 --2354 120 2108 55
NM_015891chr642045 786 516 460 1827 --1463
NM_015892chr1082470 2358 2147 1868 820 728 612 203 --1439 12167
NM_015898chr19162492 2313 2254 1916 1845 1582 1573 899 883 652 629 602 443 247 239 193 32445 2260 1665 62315 2119 1652 885 578 216 21848 591
NM_015904chr21234 2286 242 2696 236 --
NM_015906chr174199 3722 3644 3499 3260 882 431 1762 34507 3661 3350 --
NM_015913chr17659 588 521 510 306 221 215 ----1546
NM_015941chr82307 122 ------
NM_015974chr13128 ------
NM_015980chr521468 1338 11127 11475 --
NM_015981chr5183012 2917 2795 2520 2500 2372 2353 1190 584 549 536 460 421 410 280 224 102 77 32603 2036 1224 32969 423 226 2283 203
NM_015982chr173299 99 92 --1346 --
NM_015987chr12149 182 ----
NM_015994chr141661 ------
NM_015999chr12297 187 2230 36 1299 --
NM_016009chr183953 3810 3713 3322 3121 3113 1935 84 --21738 1736 --
NM_016019chr72384 334 1419 ----
NM_016021chr642386 1894 765 711 22188 452 32165 2074 1905 --
NM_016022chr15875 775 315 270 100 1745 2732 730 1881
NM_016025chr1631407 750 540 1241 22007 1981 --
NM_016032chrX51184 1058 999 937 501 --51016 1011 1006 1001 300 --
NM_016037chr151116 1008 886 867 320 --1164 --
NM_016041chr172388 310 ------
NM_016057chr127994 954 899 523 376 284 158 21126 76 21104 996 11058
NM_016059chr62722 357 --1184 --
NM_016061chr241109 553 37 28 ------
NM_016063chr64776 765 645 91 ----1571
NM_016071chr7295 31 ------
NM_016072chr1211990 --12326 --
NM_016076chr152849 2227 1135 697 109 --1111 1623
NM_016079chr242063 1861 513 36 1666 11705 --
NM_016081chr422013 1467 ------
NM_016083chr633292 1217 77 ------
NM_016084chr17--1214 1108 --
NM_016099chr81434 183 ----
NM_016107chr531182 275 237 ------
NM_016120chrX1349 11223 ----
NM_016129chr4--1325 ----
NM_016131chr231975 758 744 --3947 796 770 --
NM_016132chr1553335 875 520 509 49 --21269 351 --
NM_016133chr211548 --1110 --
NM_016139chr71276 ------
NM_016147chr1171185 947 453 321 269 235 223 2209 24 2271 84 1360
NM_016151chr162364 52 1165 2345 320 --
NM_016152chr311287 2162 31 ----
NM_016156chr1142216 1970 1768 133 12127 12172 --
NM_016162chr124317 226 213 33 --2228 131 1142
NM_016169chr10133262 2811 2791 2638 2477 1303 1175 1127 779 595 498 453 261 32544 417 48 33013 644 642 1731
NM_016192chr21251 ------
NM_016201chr372276 2174 2160 1502 722 716 326 1775 32003 39 37 1107
NM_016203chr72773 127 ------
NM_016206chr3158625 8558 8051 7609 7492 7275 5452 3374 3275 2456 2355 2234 1595 1506 786 --37282 3360 244 11608
NM_016210chr361500 605 431 388 215 68 41365 1219 1143 62 199 --
NM_016211chr4--1375 ----
NM_016223chr112109 59 1258 ----
NM_016224chr662078 1901 742 373 363 41 11989 21788 77 21514 291
NM_016227chr11323 1356 ----
NM_016233chr14904 877 248 151 --1906 --
NM_016240chr8131603 1519 1389 1181 1100 1062 1054 1037 658 648 561 520 150 41492 1088 187 122 11064 --
NM_016243chr12538 254 145 1212 --
NM_016248chr13134001 3465 3248 3225 1404 1344 1335 1319 1311 1299 1292 1262 1239 --61285 1267 1265 1246 1085 625 1554
NM_016250chr143785 175 44 --1235 --
NM_016252chr21944 ------
NM_016255chr642286 1108 1090 495 ------
NM_016256chr16------147
NM_016257chr173001 2881 2441 1368 1022 678 145 22682 1405 22332 438 --
NM_016260chr2136308 6255 6065 5677 5581 5554 4669 2949 2552 2352 1493 1143 564 --36591 5638 5612 11172
NM_016269chr4--1345 1323 --
NM_016271chr1812373 --12118 --
NM_016272chr22142458 1954 1909 1860 1814 1768 1737 883 771 621 571 440 354 347 --32427 1742 791 22566 2435
NM_016277chr621562 236 ------
NM_016279chr5176 ------
NM_016281chr125944 904 884 188 111 2897 83 1979 --
NM_016284chr164953 732 99 89 --1797 --
NM_016287chr172062 1916 1345 822 323 275 109 --21802 1606 1521
NM_016289chr222293 1772 ------
NM_016293chr12122 ------
NM_016298chr362773 2679 2175 2035 1062 88 22685 440 12775 --
NM_016303chrX1382 ------
NM_016316chr21531 ------
NM_016320chr114835 803 360 118 ------
NM_016322chr972894 2798 2639 2357 793 581 323 --2242 213 1384
NM_016333chr164450 194 135 99 --164 --
NM_016338chr52970 27 ------
NM_016340chr531035 931 821 ------
NM_016357chr122917 827 ------
NM_016376chr1763261 3012 2687 711 278 104 43307 3204 1081 45 34222 370 324 22872 281
NM_016396chr1552983 2885 2171 2058 365 --12051 12518
NM_016418chr22143742 3533 3527 2936 2665 1443 1364 1039 898 496 342 313 259 98 32700 2335 1076 1845 1190
NM_016422chr1152819 1056 730 694 173 1165 12196 1109
NM_016424chr1711307 ----11523
NM_016429chr17123 ----144
NM_016436chr2092015 1940 929 813 783 537 418 408 231 11988 ----
NM_016441chr21692 ------
NM_016453chr33671 455 22 ------
NM_016454chr151329 175 ----
NM_016456chr12890 680 --3305 104 83 2686 140
NM_016463chr52119 29 ------
NM_016472chr14--1940 1481 --
NM_016483chr32248 53 --3323 231 223 --
NM_016484chrX4715 555 446 90 --1459 --
NM_016485chr652247 1981 782 641 455 ------
NM_016486chr1----1184 --
NM_016489chr71180 1193 129 --
NM_016506chr112130 40 146 ----
NM_016507chr1783100 2270 2196 2124 858 792 778 195 1558 23067 686 1598
NM_016513chr683240 2619 2531 2417 1342 1091 52 28 1641 ----
NM_016522chr1121473 240 --11541 --
NM_016525chr94857 795 782 604 2713 262 ----
NM_016530chr1572498 1504 1023 746 719 314 186 --13100 --
NM_016531chr463995 1588 1117 519 183 50 134 ----
NM_016532chr1731140 1042 129 --11142 1167
NM_016544chr252852 1252 1150 718 51 21104 88 63799 1442 1220 1218 1167 1160 --
NM_016545chr13882 626 69 1302 ----
NM_016547chr12641 546 --1255 --
NM_016559chr321443 1397 11466 1327 --
NM_016569chr121140 --21537 345 --
NM_016574chr113932 108 42 2155 35 1924 --
NM_016577chr3124072 3742 3285 2966 1493 1476 1349 1281 709 698 395 121 125 34381 4370 1495 44033 3745 2969 1355
NM_016588chr61728 ------
NM_016592chr2041242 1207 334 25 ------
NM_016596chr121799 --1257 1724
NM_016603chr5--2810 223 ----
NM_016604chr54984 510 299 24 3914 502 133 1835 11156
NM_016605chr592764 2535 2348 1898 1865 1754 1682 900 43 52521 2172 1748 724 396 52537 1879 933 911 909 12061
NM_016607chrX2659 295 ------
NM_016618chr22420 22 1156 ----
NM_016620chr121454 973 1365 ----
NM_016621chr11184295 4233 3791 3769 3603 3478 3459 3137 3131 2878 1584 1535 1500 1292 722 714 673 282 54324 4255 4120 3748 1525 54351 3019 1538 767 658 23155 1541
NM_016623chr8----1131 --
NM_016626chr1811169 ------
NM_016628chr103636 626 570 ------
NM_016631chr211745 ------
NM_016652chr2021631 382 --21780 1283 --
NM_016654chr151454 ----1982
NM_016733chr2241119 1078 499 309 1146 ----
NM_016819chr35410 368 348 137 38 4360 195 126 72 2518 371 1374
NM_016824chr101171 --11365 --
NM_016829chr33234 176 164 --3309 307 178 --
NM_016830chr123165 73 61 1391 163 --
NM_016834chr17113686 3548 3222 3203 3004 2879 2850 2767 907 865 106 53781 3667 3577 2836 1126 43071 1509 1423 315 --
NM_016835chr17113686 3548 3222 3203 3004 2879 2850 2767 907 865 106 53781 3667 3577 2836 1126 43071 1509 1423 315 --
NM_016836chr21213 ------
NM_016839chr21213 ------
NM_016841chr17113686 3548 3222 3203 3004 2879 2850 2767 907 865 106 53781 3667 3577 2836 1126 43071 1509 1423 315 --
NM_016929chr6114013 3343 3077 1734 1456 1379 1364 981 383 76 50 33974 1116 188 13992 11065
NM_016931chr11--1300 ----
NM_016936chr1682067 1816 1803 1549 1498 1490 428 61 21824 1754 1575 --
NM_016946chr162212 2199 1439 948 289 186 21269 241 12935 1528
NM_016950chr421378 301 --180 --
NM_016952chr11114020 3752 3623 3612 3574 3523 3068 2885 2707 544 212 21173 315 22905 197 --
NM_016953chr266024 5927 3995 861 715 230 34413 4039 1092 25580 592 15583
NM_017409chr126589 139 89 53 41 23 1517 143 --
NM_017410chr125872 785 503 420 288 41114 1068 955 178 31108 792 790 --
NM_017413chrX142047 1834 1670 1010 947 940 681 675 392 278 240 228 202 156 --42166 1815 968 52 --
NM_017415chr5134563 4218 4208 3514 3134 1792 1285 1253 1063 952 704 189 126 23806 1587 21228 128 32779 1731 1256
NM_017420chr1463192 2870 2787 2710 2459 79 --12471 --
NM_017425chr11176 ------
NM_017432chr19------1442
NM_017437chr1462373 2339 2098 891 613 551 12410 12319 1494
NM_017447chr2194213 3981 3949 3833 3145 1621 791 216 45 ------
NM_017449chr181680 1602 1448 1362 636 468 367 28 31388 1356 1272 31590 1558 1152 1360
NM_017450chr1751198 985 498 199 50 176 --11070
NM_017452chr202564 283 --1339 11303
NM_017453chr202564 283 --1339 11303
NM_017454chr202564 283 --1339 11303
NM_017455chr151145 --289 87 --
NM_017456chr1781858 1570 1481 1287 760 593 235 55 11237 1521 --
NM_017457chr19--1122 ----
NM_017459chr1------181
NM_017481chr11270 47 ------
NM_017482chr251613 1053 977 213 21 21226 1078 ----
NM_017483chr281232 969 440 401 244 58 34 23 --3959 43 41 1425
NM_017488chr261567 1304 579 393 369 358 --41294 378 376 261 --
NM_025027chr1931161 241 110 11146 ----
NM_025047chr31361 ------
NM_025054chr832838 2740 240 ----11631
NM_025057chr141843 1271 1151 --
NM_025058chr13777 131 105 --3606 556 95 2210 146
NM_025061chr193388 315 71 1395 3959 429 317 --
NM_025069chr8139 2132 63 148 --
NM_025076chr22210 168 ------
NM_025080chr1131067 994 740 2904 812 --2896 56
NM_025082chr16123 --172 --
NM_025083chr1551488 1433 628 531 183 21885 496 61831 1822 1498 619 617 413 21834 424
NM_025090chr1761389 1251 1080 998 567 511 --11082 --
NM_025099chr173987 136 68 ----174
NM_025115chr8------141
NM_025129chr193201 160 50 --1162 --
NM_025134chr1641932 1923 1682 556 --11811 --
NM_025140chr124488 452 420 125 1558 ----
NM_025146chr352638 825 509 130 70 22097 1889 1105 --
NM_025151chr831824 1586 775 --52126 1863 1449 1447 115 --
NM_025160chr163300 1657 1564 1460 1291 233 13311 31445 1298 879 --
NM_025164chr1161568 1521 1398 787 357 327 1448 11823 21405 103
NM_025179chr1204722 4599 4483 4436 4218 4204 3975 3649 3485 3315 3187 3057 1815 1479 1246 959 920 560 472 145 13013 44438 4209 3549 457 44694 3265 3061 151
NM_025181chr2----1784 --
NM_025182chr97831 761 744 413 307 221 211 2923 424 1746 --
NM_025184chrX141 --1828 --
NM_025187chr162550 525 11346 --11226
NM_025191chr163112 3043 2808 2291 1066 223 --12968 --
NM_025195chr861851 1303 729 665 216 140 --1649 --
NM_025211chr91271 ------
NM_025222chr362933 2824 1987 1934 1154 928 1130 1466 1981
NM_025224chr2072149 2069 1486 932 452 121 113 22208 1679 22177 1923 11459
NM_025230chr145738 698 437 182 55 --21188 69 1163
NM_025236chr61265 4748 566 309 71 6682 680 673 633 233 231 --
NM_025237chr1751564 1414 989 525 393 2970 22 ----
NM_025248chr17123269 3197 3161 2071 1100 606 555 448 378 370 66 38 3389 145 98 43189 337 311 58 12961
NM_025251chr86471 452 405 340 122 69 1148 2476 392 21049 434
NM_025256chr6156 1237 2107 22 2110 25
NM_025261chr6_qbl_hap2127 2373 156 396 57 55 2143 99
NM_030576chr1771669 910 668 360 298 175 168 32536 2469 254 --1399
NM_030594chr1541327 1214 1016 260 1101 ----
NM_030621chr1443368 3340 2866 1602 --21395 418 11108
NM_030623chr241403 1079 621 33 11426 --11193
NM_030625chr1052667 2275 550 534 475 ------
NM_030627chr543167 1278 889 499 1985 23174 438 --
NM_030629chr1631432 1391 403 11217 31859 1720 1393 --
NM_030634chr1112309 2087 1991 1790 1698 941 915 576 527 327 100 1884 32244 472 183 --
NM_030640chr122869 198 ------
NM_030645chr18970 341 314 302 188 182 121 76 1469 4982 972 95 78 --
NM_030647chr796043 5252 4858 4557 1981 1435 1375 1302 710 33916 1991 723 24755 28 --
NM_030648chr485220 5182 4887 4517 3903 3659 1687 646 14312 ----
NM_030651chr66780 773 699 558 335 43 --1657 --
NM_030652chr61261 ------
NM_030660chr1441367 993 593 180 --1506 --
NM_030661chr781626 1552 1294 249 241 144 119 92 --31395 153 37 --
NM_030664chr1022423 958 11711 --2500 300
NM_030665chr173981 360 303 ------
NM_030670chr1232344 1766 1742 138 21978 501 1143
NM_030671chr1232344 1766 1742 138 21978 501 1143
NM_030674chr12145337 5130 4686 4553 4487 3891 1486 1389 1246 872 762 301 247 68 13879 45111 3868 1302 1292 15603
NM_030755chr1432760 417 309 ------
NM_030759chr101252 ------
NM_030761chr192562 2312 2222 2193 2095 1898 1034 503 70 3709 451 190 12564 12225
NM_030762chr12----1238 --
NM_030763chrX------1842
NM_030774chr1151463 1290 609 337 22 ------
NM_030780chr82600 150 1181 ----
NM_030784chr6--176 ----
NM_030786chr141888 646 279 85 --11724 --
NM_030791chr1411743 ------
NM_030796chr751947 1725 583 497 45 1876 2856 191 --
NM_030802chr173755 681 97 162 ----
NM_030806chr1228847 8703 8323 8069 7879 7670 7434 7384 7182 7099 5825 3496 3268 3157 2051 1879 1642 1027 785 725 444 417 78605 8429 8350 7752 878 438 329 69219 9171 7746 3160 1029 428 58326 3458 3271 2548 2092
NM_030808chr1751089 1043 780 733 36 --1393 --
NM_030809chr1231824 948 656 1616 32463 1739 372 21742 709
NM_030810chr62575 25 11257 11183 --
NM_030815chr201566 1314 ----
NM_030816chr142744 2734 835 733 ------
NM_030881chr2241979 1905 1778 612 22245 631 3640 286 128 22235 792
NM_030884chr3111704 623 534 341 292 226 182 166 63 43 25 41759 1579 658 351 6625 541 369 70 55 33 --
NM_030885chr332181 1626 224 --1495 1562
NM_030912chr108356 318 298 286 192 107 101 35 141 ----
NM_030913chr16526 307 268 261 129 112 --1174 1218
NM_030914chr95920 784 256 224 130 1673 4852 850 108 84 --
NM_030915chr2102195 1880 1819 1810 1759 1751 1705 931 535 62 1797 41930 878 876 775 2954 541
NM_030918chr1245239 5016 4988 4789 4262 4211 4090 3986 3611 3438 2124 1724 1657 1526 1400 1329 1123 836 507 493 161 140 133 40 45077 4982 742 539 54791 4675 4095 4093 97 11403
NM_030920chr152071 1471 820 809 792 --11403 --
NM_030923chr21225 ------
NM_030926chr26955 906 177 156 76 70 1139 --1129
NM_030935chr73338 294 68 --1343 1156
NM_030939chr611068 ----1343
NM_030948chr6--185 ----
NM_030952chr151275 1021 386 333 318 --2907 78 --
NM_030958chr8----1192 1203
NM_030962chr113269 208 119 ------
NM_030964chr593262 2681 2553 1415 1380 1058 802 648 502 51064 508 346 178 126 43563 2408 696 362 --
NM_030978chr9185 ----1401
NM_030981chr1151136 808 359 137 77 2844 131 41021 391 349 83 1818
NM_031212chr103297 117 67 --1119 1240
NM_031216chr1831765 1683 105 21637 87 21509 80 --
NM_031231chr202519 47 --1100 --
NM_031232chr202519 47 --1100 --
NM_031262chr91263 ------
NM_031263chr91320 ------
NM_031266chr51150 --1133 --
NM_031268chr16154687 4055 3674 3422 3256 2116 2104 2018 2009 1908 1520 1455 1291 1034 533 41950 1684 1370 972 84671 3925 3354 1865 1863 1419 1417 548 14396
NM_031289chr122970 54 1945 ----
NM_031300chr5--2146 72 1306 --
NM_031305chr441732 1642 1564 423 --21734 622 --
NM_031309chr8102218 2211 1481 678 665 588 454 344 247 217 41758 746 400 105 1388 11472
NM_031314chr1462029 1924 1905 1479 367 86 1137 21926 88 1122
NM_031369chr41619 --1257 --
NM_031370chr41619 --1257 --
NM_031372chr431664 1368 517 --1474 --
NM_031407chrX----3184 182 149 --
NM_031411chr512059 1286 2263 58 1211
NM_031417chr19112531 1836 958 870 799 706 590 515 383 303 201 1932 2362 310 12098
NM_031418chr1162763 2017 1942 1874 1842 1812 ------
NM_031424chr204548 473 411 222 1179 ----
NM_031426chr9132361 2206 2106 1780 1081 941 930 311 234 226 207 83 44 32196 337 30 32208 1070 218 22167 1073
NM_031427chr14115761 5554 5500 5483 5475 5210 4710 2214 1976 1866 1084 ----21324 172
NM_031433chr117631 569 533 491 431 176 27 1419 5587 574 572 493 446 --
NM_031438chr52254 237 --11338 1509
NM_031439chr891651 1463 1408 1322 1259 382 270 157 41 1189 21543 1230 --
NM_031442chrX22347 329 --1597 --
NM_031445chr2113313 2948 2390 1225 1219 853 712 697 409 252 75 22129 388 11272 --
NM_031450chr113232 65 32 1253 ----
NM_031468chr7237989 7796 7394 7388 6741 6554 6516 6412 5759 5582 5469 2943 2251 2156 2094 1737 1613 1515 1062 884 736 181 69 46922 6646 2548 391 67614 7450 1918 1602 1093 849 47960 7534 2650 1631
NM_031469chr633302 2768 873 ------
NM_031477chr163313 278 66 ------
NM_031478chr162150 23 3572 466 30 1186 --
NM_031483chr201151 --22409 483 12362
NM_031492chr111542 ------
NM_031844chr163545 3302 2652 975 848 348 --21550 1250 13589
NM_031845chr232913 2716 865 --21032 924 1927
NM_031847chr232913 2716 865 --21032 924 1927
NM_031849chr512059 1286 2263 58 1211
NM_031857chr512059 1286 2263 58 1211
NM_031860chr512059 1286 2263 58 1211
NM_031866chr1051044 750 400 323 244 1947 2752 390 --
NM_031886chr1922271 531 32362 1020 37 ----
NM_031890chr22172755 2633 2467 2391 2378 2164 1216 1210 958 947 700 685 655 583 450 224 213 22009 1103 52174 2169 2145 342 215 12253
NM_031891chr181137 ------
NM_031892chrX2858 775 --1181 --
NM_031911chr432328 2299 979 21734 1727 ----
NM_031914chr141693 ------
NM_031922chr61424 ------
NM_031935chr1--1247 ----
NM_031953chr42462 119 ------
NM_031954chr12112291 2251 1050 910 895 823 450 380 97 46 28 22701 927 --1796
NM_031992chr741472 278 263 227 2239 114 11475 --
NM_032012chr974763 4314 1237 900 769 627 510 --13577 11814
NM_032013chr2061421 1201 276 267 151 125 ----1242
NM_032017chr1112094 1711 1599 1379 1360 847 616 448 432 96 41 41337 674 378 344 41866 1381 782 582 21517 1453
NM_032028chr53230 162 128 --2133 131 --
NM_032040chr19134 ------
NM_032041chr862449 2340 2080 2039 1860 528 32351 457 395 1537 1512
NM_032042chr552913 1146 923 474 384 157 62512 2134 2132 611 609 411 1108
NM_032050chr221162 1415 ----
NM_032051chr223645 142 118 1479 1236 --
NM_032052chr223547 164 83 --3289 287 267 1270
NM_032088chr5161718 1668 1652 1486 1396 1300 717 483 390 356 322 314 175 131 59 38 21365 364 1502 2647 41
NM_032092chr5161718 1668 1652 1486 1396 1300 717 483 390 356 322 314 175 131 59 38 21365 364 1502 2647 41
NM_032104chr1130 ------
NM_032105chr1267764 7585 7363 7237 7018 6960 6798 6704 6594 6279 5652 5330 5057 5022 4924 3253 3227 2123 1833 1670 1037 990 845 765 319 30 46631 2861 2112 852 66814 6803 6692 6588 1738 1049 27111 739
NM_032108chr193970 896 177 1984 ----
NM_032109chr58488 461 423 346 316 299 228 190 1250 3244 145 143 1443
NM_032120chr72498 112 ------
NM_032121chrX52057 1910 1797 896 747 1761 22570 590 1228
NM_032144chr251624 1341 710 292 250 11638 2252 231 --
NM_032145chr631908 1312 482 ------
NM_032153chr362804 2729 2370 2148 1927 1089 1722 --12222
NM_032154chr10--1290 ----
NM_032160chr18124233 3717 3345 2689 1527 1469 1314 1290 758 738 320 204 32870 1519 1504 1874 --
NM_032174chr141032 326 320 288 3496 232 147 ----
NM_032181chr2--1243 1747 --
NM_032182chr1021431 1215 --11583 --
NM_032186chr121454 973 1365 ----
NM_032192chr172551 463 153 4709 701 532 92 --
NM_032195chr211194 ------
NM_032199chr1053836 3691 1347 607 215 1434 --13514
NM_032204chr222324 242 177 ----
NM_032208chr263433 3064 2898 1375 617 29 ----1940
NM_032217chr41242 1183 1249 --
NM_032221chr2051782 493 307 298 68 --1614 --
NM_032233chr143690 296 169 ------
NM_032236chr12886 752 ------
NM_032239chr431063 908 286 --1217 --
NM_032242chr3142911 2828 2545 2267 2200 2106 1082 933 918 823 743 670 169 135 22923 881 43059 2834 2163 2151 1926
NM_032246chr154456 112 104 87 156 1106 <