TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3177-3p
miRNA Sequence: UGCACGGCACUGGGGACACGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000021chr141949 --1296 --
NM_000024chr51421 ------
NM_000029chr1--1459 ----
NM_000037chr821023 728 ------
NM_000038chr51466 ------
NM_000044chrX1348 ------
NM_000084chrX56715 4876 2430 1201 787 ------
NM_000109chrX11777 ------
NM_000110chr1125 --1338 1775
NM_000115chr132991 222 ------
NM_000125chr611282 1324 --13897
NM_000135chr1611003 138 ----
NM_000142chr431405 1194 624 ----1235
NM_000163chr532178 1793 1614 ------
NM_000176chr5----12670 --
NM_000188chr10----1714 --
NM_000214chr2021712 64 ------
NM_000217chr12--14596 ----
NM_000258chr3187 --1174 135
NM_000259chr1544808 4774 4217 189 --14855 14591
NM_000262chr2221192 26 11433 1708 --
NM_000264chr93753 309 113 --1613 --
NM_000266chrX----1862 --
NM_000267chr1723248 494 ------
NM_000282chr131219 1101 ----
NM_000291chrX--128 ----
NM_000292chrX190 1472 ----
NM_000296chr162170 28 --2911 294 --
NM_000304chr171971 ------
NM_000310chr131201 524 298 ------
NM_000314chr1042886 2755 1022 209 12964 --13125
NM_000325chr4188 ------
NM_000332chr655856 4555 4492 2792 407 26463 870 ----
NM_000345chr42803 227 ------
NM_000346chr1711657 ------
NM_000368chr954190 4024 3483 1932 1221 1324 ----
NM_000391chr1121602 143 1319 ----
NM_000408chr212505 ------
NM_000411chr2122024 37 1929 12017 12407
NM_000430chr1722552 1233 ------
NM_000449chr11242 ------
NM_000451chrX41465 793 265 109 --1232 --
NM_000458chr17125 ----1839
NM_000461chr343960 3281 3215 1631 ------
NM_000462chr1521816 161 21780 592 ----
NM_000489chrX12393 12681 ----
NM_000555chrX37742 7633 1645 15613 ----
NM_000610chr111708 ------
NM_000615chr1112741 1772 ----
NM_000621chr131210 11194 ----
NM_000633chr1854788 1782 1351 514 353 ------
NM_000679chr53423 387 323 ------
NM_000719chr1245321 2532 1960 1292 45872 1529 1251 1224 15917 14269
NM_000726chr21104 ------
NM_000792chr111017 ------
NM_000793chr1411888 ------
NM_000800chr521659 427 ------
NM_000811chr5----1545 --
NM_000816chr51206 ------
NM_000817chr211204 1819 ----
NM_000824chr41182 ------
NM_000826chr412449 ------
NM_000833chr161998 11399 ----
NM_000834chr1231210 891 47 ------
NM_000841chr63331 285 38 --1788 --
NM_000842chr11152 ------
NM_000868chrX--12308 ----
NM_000876chr61949 ------
NM_000901chr4----2958 703 1329
NM_000917chr102837 365 ------
NM_000918chr172658 299 ------
NM_000942chr15--138 ----
NM_000945chr21534 ------
NM_000958chr5--154 185 --
NM_000965chr311099 ------
NM_001001132chr2111321 11480 11310 --
NM_001001331chr332369 2099 1887 ------
NM_001001342chr1021473 1033 ------
NM_001001389chr111708 ------
NM_001001390chr111708 ------
NM_001001391chr111708 ------
NM_001001392chr111754 ------
NM_001001396chr131743 649 387 ----14480
NM_001001436chr162164 141 ------
NM_001001485chr3153 --182 --
NM_001001502chr51494 --1442 --
NM_001001549chr731063 184 65 ------
NM_001001550chr731063 184 65 ------
NM_001001555chr731063 184 65 ------
NM_001001556chr1521587 64 ------
NM_001001890chr2153976 1444 1425 1244 352 23123 1525 14191 --
NM_001002031chr12151 ------
NM_001002032chr171646 ------
NM_001002033chr171746 ------
NM_001002233chr832019 442 223 11635 ----
NM_001002259chr121230 ------
NM_001002295chr1031089 989 255 ------
NM_001002762chr1031036 404 187 ------
NM_001002860chr1464295 4073 1201 1078 692 24 --12980 --
NM_001003407chr1034924 1864 1249 --35026 1608 521 --
NM_001003408chr1034924 1864 1249 --35026 1608 521 --
NM_001003674chr1887053 6858 5651 5624 5296 4540 2340 1886 14780 ----
NM_001003675chr1887053 6858 5651 5624 5296 4540 2340 1886 14780 ----
NM_001003683chr2--125 ----
NM_001003688chr41766 ------
NM_001003712chr1211419 ------
NM_001003792chr3------1177
NM_001003793chr3------1177
NM_001003800chr923059 1289 13503 ----
NM_001003810chr42855 797 ------
NM_001003940chr1533204 845 446 23592 1238 ----
NM_001003942chr1533204 845 446 23592 1238 ----
NM_001003943chr1533208 849 450 23596 1242 ----
NM_001004127chr131979 ------
NM_001004317chr623044 1809 ------
NM_001004342chr175894 4571 4357 2251 1807 1594 24 ------
NM_001004419chr121938 ----13508
NM_001005158chr3--1173 ----
NM_001005159chr3--1173 ----
NM_001005209chr21262 ------
NM_001005271chr171218 ------
NM_001005273chr171218 ------
NM_001005291chr174468 405 334 137 154 ----
NM_001005353chr12319 69 --11159 --
NM_001005353chr12319 69 --11159 --
NM_001005463chr1012025 ------
NM_001005473chr526490 686 ------
NM_001005505chr321471 452 ------
NM_001005526chr2195 ------
NM_001005609chrX281 28 --2756 660 --
NM_001005732chr21------1604
NM_001005733chr21------1561
NM_001005746chr21104 ------
NM_001005747chr21104 ------
NM_001005909chr3----156 --
NM_001005920chr16153 --1797 --
NM_001006115chr362798 2409 1879 893 472 71 12368 1851 --
NM_001006618chr9260 32 ------
NM_001006623chr221593 106 ------
NM_001006634chr161128 ------
NM_001006636chr21962 ------
NM_001006641chr93562 402 113 ----1391
NM_001006642chr93562 402 113 ----1391
NM_001006643chr93562 402 113 ----1391
NM_001006944chr113728 458 39 --1692 --
NM_001006946chr241589 1379 1310 149 ------
NM_001007023chr1411888 ------
NM_001007024chr1733523 1572 182 --11443 --
NM_001007025chr1733523 1572 182 --11443 --
NM_001007097chr974014 3128 2034 1195 1017 186 35 ------
NM_001007098chr1----198 --
NM_001007099chr1--1217 ----
NM_001007100chr1--1217 ----
NM_001007156chr151216 1291 1382 --
NM_001007226chr172934 505 ------
NM_001007227chr172934 505 ------
NM_001007228chr172934 505 ------
NM_001007229chr172934 505 ------
NM_001007230chr172934 505 ------
NM_001007237chr132642 2525 1803 ------
NM_001007246chr2131698 763 104 ------
NM_001007271chr102724 415 ------
NM_001007277chr113433 396 168 ------
NM_001007466chr624318 382 --13215 21645 48
NM_001007546chr221100 507 --168 --
NM_001007559chr1822020 1907 ------
NM_001007793chr101282 ------
NM_001008392chr332627 1058 105 33308 2344 31 13242 --
NM_001008410chr262062 2043 1696 841 598 375 --11638 --
NM_001008495chr812172 12291 ----
NM_001008660chr1111059 ------
NM_001008701chr1912590 22103 1067 ----
NM_001008709chr112262 21 --1277 --
NM_001008738chr512091 ------
NM_001009554chr454776 3315 1630 1236 1109 13719 ----
NM_001009554chr454776 3315 1630 1236 1109 13719 ----
NM_001009566chr1----21305 140 --
NM_001009944chr162170 28 --2911 294 --
NM_001009955chr11516 ------
NM_001009955chr11516 ------
NM_001009959chr232624 1973 492 ------
NM_001009993chr243241 2909 1631 1159 14145 24214 4128 133
NM_001010853chr612655 ------
NM_001010857chr1----1114 --
NM_001010861chr112780 ------
NM_001010867chr1116451 5590 5515 2219 1884 1691 1187 1085 459 392 237 --1609 --
NM_001010888chrX33941 3448 611 ------
NM_001010924chr101105 11204 --1146
NM_001010934chr7--1106 ----
NM_001011537chr32501 349 ----12254
NM_001011545chr211211 ------
NM_001011553chr71393 ------
NM_001011554chr20--1619 ----
NM_001011645chrX1348 ------
NM_001011658chrX32024 1440 537 ------
NM_001011666chr734612 1741 453 14240 11713 --
NM_001012329chr152374 2056 2037 1958 1844 --11849 --
NM_001012512chr181184 ------
NM_001012513chr181195 ------
NM_001012642chr1542047 2036 707 634 --197 --
NM_001012643chr191132 ----1453
NM_001012755chrX63531 3520 1784 1696 538 511 ------
NM_001012761chr512738 ------
NM_001012977chrX31153 949 256 ------
NM_001013031chr1041234 1006 928 271 22939 155 ----
NM_001013415chr411119 ------
NM_001013690chr1221867 504 21783 1763 --1203
NM_001013693chr161165 1085 935 700 462 221 --12356 --
NM_001013693chr161165 1085 935 700 462 221 --12356 --
NM_001013839chr175876 694 299 186 137 --22090 1630 12187
NM_001013843chr152303 275 ------
NM_001014380chr1365860 5663 4089 923 805 358 ------
NM_001014431chr142153 57 ------
NM_001014432chr142153 57 ------
NM_001014797chr1077433 6462 6243 6076 5572 2967 2270 17212 11828 15440
NM_001014812chr151433 ------
NM_001014839chr12681 415 ----11078
NM_001014841chr12681 415 ----11078
NM_001015045chr422469 445 ------
NM_001015053chr1731456 1146 608 --197 --
NM_001017395chr323428 2880 ------
NM_001017440chr747756 7159 5750 753 26339 2419 155 --
NM_001017916chr1731605 576 220 ------
NM_001017917chr1731605 576 220 ------
NM_001017923chr14--1171 ----
NM_001017962chr102837 365 ------
NM_001017999chr14460 424 229 42 1940 21764 88 --
NM_001017999chr14460 424 229 42 1940 21764 88 --
NM_001018000chr14460 424 229 42 1940 21764 88 --
NM_001018000chr14460 424 229 42 1940 21764 88 --
NM_001018001chr14460 424 229 42 1940 21764 88 --
NM_001018005chr151139 ------
NM_001018054chr121179 23 ------
NM_001018067chr154293 3826 3320 1960 505 --13483 --
NM_001018068chr154293 3826 3320 1960 505 --13483 --
NM_001018069chr154293 3826 3320 1960 505 --13483 --
NM_001018074chr5----12670 --
NM_001018075chr5----12670 --
NM_001018076chr5----12670 --
NM_001018077chr5----12670 --
NM_001018090chr1512664 ------
NM_001018091chr1512774 ------
NM_001018102chr1512664 ------
NM_001018108chr1531445 832 777 ----12114
NM_001020658chr1--11056 ----
NM_001020658chr1--11056 ----
NM_001020818chr1911318 --1685 --
NM_001020819chr1911318 --1685 --
NM_001020820chr1911318 --1685 --
NM_001020821chr1911318 --1685 --
NM_001020825chr5----1145 --
NM_001023567chr153860 352 181 12423 ----
NM_001024024chr14191 ------
NM_001024070chr14187 ------
NM_001024094chr5----12670 --
NM_001024226chr161074 807 360 322 126 112 --1772 --
NM_001024227chr161074 807 360 322 126 112 --1772 --
NM_001024228chr161074 807 360 322 126 112 --1772 --
NM_001024463chr152288 278 ----1781
NM_001024647chr1247456 6553 1166 167 12078 ----
NM_001024660chr3--2682 101 ----
NM_001024666chrX1642 ------
NM_001024808chr1242623 1144 1056 186 --1726 --
NM_001024847chr32215 133 ------
NM_001024937chr171211 ------
NM_001024948chr123136 2830 11038 ----
NM_001024959chr33729 346 275 ------
NM_001024960chr33729 346 275 ------
NM_001025076chr1035911 5622 1362 13856 ----
NM_001025077chr1057269 6980 4579 2720 1245 15214 ----
NM_001025108chr223428 68 13890 ----
NM_001025266chr333913 3233 710 ------
NM_001025356chr1232397 2213 713 22983 2941 ----
NM_001025366chr61490 ------
NM_001025366chr61490 ------
NM_001025367chr61490 ------
NM_001025367chr61490 ------
NM_001025368chr61490 ------
NM_001025368chr61490 ------
NM_001025369chr61506 ------
NM_001025369chr61506 ------
NM_001025370chr61490 ------
NM_001025370chr61490 ------
NM_001025579chr173770 753 177 1966 ----
NM_001025580chrX14259 ------
NM_001025603chr11242 ------
NM_001025616chr4--11917 1515 --
NM_001025780chr91205 1194 ----
NM_001029858chr633364 3061 582 ------
NM_001029863chr632446 315 63 1222 ----
NM_001029875chr5--12225 ----
NM_001029884chr612456 ------
NM_001029998chr4----11399 --
NM_001030006chr1731005 138 34 --1271 --
NM_001030007chr1613985 1591 --12899
NM_001030055chr1423467 3184 ------
NM_001031685chr1--1243 ----
NM_001031690chr773120 457 281 264 245 228 52 --1333 12588
NM_001031695chr2233691 527 304 --11917 --
NM_001031717chr32160 116 156 ----
NM_001031804chr1623117 541 --13081 --
NM_001032293chr171613 ------
NM_001032296chr1362621 2583 1100 1066 879 166 --11081 --
NM_001032393chrX2674 521 ------
NM_001032999chr2055242 3825 3244 947 391 45289 1817 168 81 14666 11017
NM_001033057chr321624 32 ------
NM_001033059chr61238 ------
NM_001033085chr2154 ------
NM_001033087chr2033235 908 68 ------
NM_001033117chr383975 3519 1780 1219 1174 683 36 26 1135 13453 14249
NM_001033507chr111600 ------
NM_001033551chr1773233 1620 1333 1192 911 371 132 ------
NM_001033561chr17--1691 ----
NM_001033566chr172986 807 ------
NM_001033568chr172986 807 ------
NM_001033581chr1122 ------
NM_001033581chr1122 ------
NM_001033582chr1122 ------
NM_001033723chr8--22756 1705 ----
NM_001033756chr61424 --1729 --
NM_001033756chr61424 --1729 --
NM_001033925chr1021987 1469 ------
NM_001034850chr511543 ------
NM_001034852chr1421540 425 2747 102 11474 --
NM_001034954chr1011009 ----1613
NM_001034955chr1011009 ----1613
NM_001034956chr1011009 ----1613
NM_001034957chr1011009 ----1613
NM_001035chr11949 ------
NM_001035254chr942497 1019 890 863 1273 --1777
NM_001037132chr711714 32067 869 344 ----
NM_001037133chr711714 32067 869 344 ----
NM_001037163chr71873 188 ----
NM_001037317chr112780 ------
NM_001037324chr32769 234 ------
NM_001037332chr51674 1161 ----
NM_001037333chr51674 1161 ----
NM_001037954chr111162 ------
NM_001038702chr551872 1724 967 549 49 ------
NM_001039350chr721657 1303 11265 ----
NM_001039457chr1171 1206 125 --
NM_001039459chr721169 112 ------
NM_001039538chr222770 617 ------
NM_001039547chr366999 6231 2059 1891 1811 1162 ------
NM_001039574chr131069 989 296 --11022 --
NM_001039577chr174430 3682 1706 1587 335 309 141 13279 1182 1623
NM_001039580chr434532 3888 498 ------
NM_001039585chr121318 147 ------
NM_001039590chrX12550 21571 37 ----
NM_001039591chrX12550 21571 37 ----
NM_001039690chr1622326 49 --11828 --
NM_001039709chr2055242 3825 3244 947 391 45289 1817 168 81 14666 11017
NM_001039711chr11408 ------
NM_001039712chr11408 ------
NM_001039715chr111017 ------
NM_001039716chr121081 39 ------
NM_001039762chr1021665 899 ------
NM_001039840chrX45077 1696 1680 90 --15976 --
NM_001039937chr13--13983 11230 --
NM_001039960chr12----134 --
NM_001040101chr441505 1430 992 542 21604 1026 1411 --
NM_001040110chr721218 431 ------
NM_001040113chr161958 ------
NM_001040142chr21407 ------
NM_001040143chr21407 ------
NM_001040144chr1622326 49 --11828 --
NM_001040146chr1622326 49 --11828 --
NM_001040152chr723618 3117 ------
NM_001040167chr761194 1085 802 418 403 113 --1107 --
NM_001040280chr61473 ------
NM_001040284chr1625160 3626 2451 34 ----
NM_001040424chr2163009 3001 2777 2758 2611 891 12605 ----
NM_001040446chr531723 665 615 22528 1929 ----
NM_001040450chr152222 91 ------
NM_001040453chr152222 91 ------
NM_001040624chr842477 563 163 116 ------
NM_001040625chr842477 563 163 116 ------
NM_001040626chr842477 563 163 116 ------
NM_001040627chr842477 563 163 116 ------
NM_001040628chr842477 563 163 116 ------
NM_001040629chr842477 563 163 116 ------
NM_001040630chr842477 563 163 116 ------
NM_001040708chr81289 ------
NM_001040712chr922705 536 ------
NM_001042355chr1635372 3537 1146 11214 ----
NM_001042357chr10178 ------
NM_001042358chr10178 ------
NM_001042360chr10178 ------
NM_001042363chr10178 ------
NM_001042389chr10178 ------
NM_001042390chr10178 ------
NM_001042392chr10178 ------
NM_001042395chr10178 ------
NM_001042404chr131401 377 324 ------
NM_001042412chr1635372 3537 1146 11214 ----
NM_001042413chr92739 679 ------
NM_001042424chr453234 2968 2626 2444 458 ------
NM_001042453chrX11517 ------
NM_001042475chr62278 51 ------
NM_001042478chr1----147 --
NM_001042479chrX1605 ------
NM_001042480chrX1605 ------
NM_001042492chr1723248 494 ------
NM_001042506chrX31163 949 256 ------
NM_001042537chrX32268 1552 594 --11998 --
NM_001042599chr226684 4783 ------
NM_001042601chr32379 173 --1462 --
NM_001042603chr1254511 3529 3347 1536 1488 43595 3472 3414 3356 --12043
NM_001042604chr323605 564 --14482 24805 3428
NM_001042632chr203912 453 255 --1408 --
NM_001042633chr203912 453 255 --1408 --
NM_001042646chr341545 1491 280 144 ------
NM_001042669chr4--11917 1515 --
NM_001042681chr162205 1940 1800 835 351 27 ------
NM_001042682chr162205 1940 1800 835 351 27 ------
NM_001042682chr162205 1940 1800 835 351 27 ------
NM_001042749chrX11496 ------
NM_001042750chrX11496 ------
NM_001042751chrX11496 ------
NM_001043318chr1452902 1044 997 698 138 ----1193
NM_001043351chr122040 491 ------
NM_001044305chr62504 140 ------
NM_001065chr123506 420 207 --1185 --
NM_001068chr3------1240
NM_001069chr6--123 ----
NM_001079874chr11301 ----1208
NM_001083620chr412447 ------
NM_001092chr1732289 402 251 32265 1759 669 12308 --
NM_001094chr171839 --1195 --
NM_001095chr1221732 1184 ------
NM_001096chr171701 ------
NM_001100108chr156069 5886 5147 2531 977 --17715 --
NM_001106chr378989 7789 3179 2972 2383 1795 266 --27030 3715 --
NM_001113490chrX13322 22712 450 ----
NM_001116chr1662442 2057 1178 734 639 347 12243 12499 12410
NM_001127chr223934 233 204 --1296 --
NM_001128chr1613985 1591 --12899
NM_001135chr151276 2807 788 ----
NM_001144chr164961 480 425 40 ------
NM_001146chr8----1279 --
NM_001148chr442061 1527 409 25 ------
NM_001149chr1011268 ------
NM_001173chr1423467 3184 ------
NM_001187chr211150 1561 ----
NM_001188chr61226 11242 ----
NM_001219chr71684 --1179 --
NM_001222chr1031323 601 450 ------
NM_001232chr1--11141 ----
NM_001259chr736200 1732 86 --11523 --
NM_001260chr131314 156 ----
NM_001277chr112986 72 ------
NM_001280chr194721 544 460 39 --1549 --
NM_001282chr1731005 138 34 --1271 --
NM_001304chr1713708 ------
NM_001305chr7168 1849 ----
NM_001310chr121561 ------
NM_001332chr51124 --1565 --
NM_001356chrX2312 113 ----12449
NM_001364chr1134190 3564 3013 34677 1720 1647 --14220
NM_001386chr822105 975 ------
NM_001387chr543085 3077 2104 532 ------
NM_001392chr181244 ------
NM_001396chr2142556 2322 1094 785 12482 ----
NM_001399chrX281 28 --2756 660 --
NM_001400chr111071 ------
NM_001406chr1741214 1176 493 103 ------
NM_001408chr131697 1476 1415 --1423 --
NM_001419chr1954697 3249 2993 1821 1772 --13002 --
NM_001427chr712048 ------
NM_001429chr22--1131 ----
NM_001438chr122553 1431 ------
NM_001448chrX--1189 ----
NM_001451chr16------21054 299
NM_001452chr6--1624 ----
NM_001453chr621092 538 ------
NM_001490chr942420 2264 814 362 ------
NM_001491chr621749 430 ------
NM_001497chr962727 2670 1847 334 296 52 21096 532 22570 2462 --
NM_001498chr6171 ------
NM_001518chr73820 765 74 ------
NM_001542chr132642 2525 1803 ------
NM_001616chr232828 967 910 ------
NM_001634chr61238 ------
NM_001635chr731071 832 248 1741 ----
NM_001650chr1821032 287 ------
NM_001656chr511850 ------
NM_001658chr161074 807 360 322 126 112 --1772 --
NM_001660chr31590 ------
NM_001662chr71394 ------
NM_001665chr111490 --179 --
NM_001670chr222235 81 1615 ----
NM_001677chr12860 743 ------
NM_001679chr3----1323 --
NM_001681chr121728 187 ----
NM_001683chr332369 2099 1887 ------
NM_001684chr131460 366 104 ----14197
NM_001690chr312412 ------
NM_001693chr8--11150 1491 --
NM_001695chr8--1530 ----
NM_001699chr191322 21703 166 ----
NM_001704chr61567 ------
NM_001706chr311008 ------
NM_001709chr1122601 943 ------
NM_001722chr82167 32 ------
NM_001723chr6--125 ----
NM_001731chr121110 ------
NM_001753chr721196 621 ------
NM_001754chr2153976 1444 1425 1244 352 23123 1525 14191 --
NM_001782chr9148 ------
NM_001788chr71393 ------
NM_001789chr351524 663 257 232 94 ------
NM_001798chr121870 ------
NM_001800chr19----1364 --
NM_001810chr201292 ----181
NM_001819chr201249 ------
NM_001830chrX31004 248 221 ------
NM_001833chr91242 1251 ----
NM_001858chr621809 1523 ----11651
NM_001859chr933429 3155 1320 ------
NM_001876chr11----1498 --
NM_001880chr21246 ------
NM_001895chr2031178 418 108 --1803 --
NM_001904chr311036 ------
NM_001915chr1731605 576 220 ------
NM_001924chr11207 ------
NM_001936chr721657 1303 11265 ----
NM_001949chr623205 1001 --2421 337 --
NM_001964chr51414 ------
NM_001967chr31157 ------
NM_001969chr1423006 706 ------
NM_001980chr1221760 1491 ------
NM_001981chr142338 2091 870 275 ------
NM_001982chr12--1999 --1191
NM_001991chr1741932 1799 320 56 ------
NM_001999chr521346 958 ------
NM_002006chr432149 1689 825 ------
NM_002013chr141211 ------
NM_002024chrX1547 ------
NM_002025chrX58671 6920 2734 1803 1303 16079 11758 --
NM_002044chr1521587 64 ------
NM_002051chr1031089 989 255 ------
NM_002062chr631594 1117 273 ------
NM_002069chr711749 ------
NM_002074chr121553 200 ------
NM_002086chr1721678 862 --11989 --
NM_002091chr181184 ------
NM_002103chr1921007 360 --21055 197 --
NM_002107chr11484 ------
NM_002111chr4123762 2969 2687 2419 1443 1257 1115 970 645 491 463 401 1619 1250 --
NM_002119chr632316 1688 1619 --1104 --
NM_002128chr1322264 102 ----12448
NM_002138chr42855 797 ------
NM_002141chr71171 ------
NM_002147chr17138 --1852 --
NM_002148chr21178 1665 ----
NM_002149chr22703 684 --146 --
NM_002196chr203884 351 33 ------
NM_002196chr203884 351 33 ------
NM_002199chr41140 ------
NM_002204chr1751215 912 453 415 380 --1488 --
NM_002210chr223404 2682 ------
NM_002214chr734605 1316 351 ------
NM_002222chr3--1361 ----
NM_002223chr1243641 3507 3399 2757 --1945 --
NM_002226chr144840 726 681 239 ------
NM_002232chr1----126 --
NM_002234chr123678 250 232 ------
NM_002241chr121972 459 ------
NM_002246chr22494 148 1367 ----
NM_002264chr344396 1865 1250 931 ------
NM_002267chr131366 ----1788
NM_002268chr321616 1206 ------
NM_002270chr555503 4446 2047 1509 1207 11189 ----
NM_002274chr171247 ------
NM_002285chr223428 68 13890 ----
NM_002293chr11528 11035 ----
NM_002309chr2252985 2404 412 169 24 --11041 --
NM_002310chr544113 2349 696 595 14761 --11237
NM_002313chr1034924 1864 1249 --35026 1608 521 --
NM_002319chr731044 762 315 ------
NM_002334chr11--1180 ----
NM_002356chr622808 938 ------
NM_002359chr17103431 1653 1359 1257 1168 1155 1056 677 294 191 ----1582
NM_002360chr792625 2555 2465 2361 2129 1793 920 767 752 --12611 1792
NM_002361chr192260 65 ------
NM_002373chr1531298 1291 846 ------
NM_002374chr222770 617 ------
NM_002382chr1421116 946 ------
NM_002387chr531027 653 249 ----1321
NM_002390chr173692 261 155 11751 ----
NM_002397chr5----1100 --
NM_002398chr2----11013 --
NM_002399chr1531282 928 429 ------
NM_002401chr1772240 1942 1818 984 282 136 98 12403 12254 --
NM_002402chr71771 ------
NM_002428chr1671394 1182 1173 1112 1004 942 502 ------
NM_002430chr2232416 1950 951 --1876 --
NM_002431chr141116 ------
NM_002444chrX31798 1765 84 ------
NM_002480chr121607 ------
NM_002499chr151333 2991 773 1321 --
NM_002500chr2261 44 ------
NM_002501chr1953741 3545 3464 1535 1200 ----1267
NM_002515chr1411969 21691 1548 --11384
NM_002520chr51112 ------
NM_002522chr1723503 667 --21030 895 --
NM_002524chr111088 ------
NM_002541chr7----2868 115 --
NM_002552chr21144 ------
NM_002553chr7153 ------
NM_002576chr1131011 295 153 ------
NM_002577chr323644 3187 ------
NM_002582chr166698 375 339 267 167 41 1830 ----
NM_002585chr12272 34 ------
NM_002588chr521625 1609 ------
NM_002595chr1221793 1225 --11736 --
NM_002611chr174913 893 779 674 ------
NM_002613chr16164753 4628 4342 4193 3683 3312 2108 1894 1727 918 630 447 400 269 254 235 11134 1515 --
NM_002628chr31962 ------
NM_002636chr6174 1187 ----
NM_002648chr611218 --1468 --
NM_002655chr823350 733 --146 --
NM_002657chr2023438 1372 11328 ----
NM_002670chr321647 347 ------
NM_002674chr12--1167 ----
NM_002693chr15----182 --
NM_002697chr1----1106 --
NM_002698chr192728 151 ------
NM_002708chr112262 21 --1277 --
NM_002710chr1211128 11117 ----
NM_002715chr52951 177 ------
NM_002717chr8----1659 --
NM_002719chr1432144 608 75 ------
NM_002731chr132252 203 147 ------
NM_002742chr141285 ----1593
NM_002744chr1122 ------
NM_002745chr2234426 4061 879 23945 1400 ----
NM_002829chr951247 994 986 435 99 ------
NM_002830chr2159 ------
NM_002839chr922705 536 ------
NM_002843chr1143241 2207 1150 185 ------
NM_002850chr191122 11226 11032 --
NM_002852chr31245 ------
NM_002866chr192531 243 ------
NM_002868chr121847 12097 ----
NM_002871chr12251 103 ------
NM_002885chr11384 --31029 690 70 --
NM_002886chr32840 169 ------
NM_002890chr5--1193 ----
NM_002895chr202841 249 ------
NM_002896chr111103 --1292 --
NM_002897chr21490 ------
NM_002906chr1122178 122 ------
NM_002911chr1931584 1057 400 ------
NM_002912chr6--1666 ----
NM_002918chr1951154 1042 788 752 359 --1793 --
NM_002942chr31385 ------
NM_002951chr201222 ------
NM_002959chr154157 3557 3361 1417 977 14071 1813 --
NM_002979chr1--1217 ----
NM_002994chr41396 ------
NM_002996chr1621972 647 --11621 --
NM_002997chr241589 1379 1310 149 ------
NM_002998chr822128 2030 12076 ----
NM_003010chr1711678 ------
NM_003015chr101677 --131 --
NM_003016chr17180 ----11721
NM_003021chr1931017 874 480 11100 1352 --
NM_003026chr921148 280 ------
NM_003030chr3----11298 --
NM_003034chr1236465 5513 3064 27528 1178 ----
NM_003036chr121153 118 ------
NM_003043chr331620 592 428 ------
NM_003068chr8190 ------
NM_003069chrX2726 520 ------
NM_003076chr12155 ------
NM_003077chr17----1269 --
NM_003081chr201923 ------
NM_003085chr51494 --1442 --
NM_003087chr101228 ------
NM_003093chr6173 ------
NM_003107chr6--12476 --12488
NM_003108chr296927 6238 4550 2571 2433 2282 1325 1005 175 ------
NM_003110chr17----1246 --
NM_003128chr262693 2656 844 358 290 88 12159 12460 12090
NM_003131chr62364 319 1556 ----
NM_003137chr61464 ------
NM_003155chr832292 460 80 ------
NM_003161chr1742811 2403 1057 684 ------
NM_003162chr21989 ------
NM_003173chrX41253 552 157 151 ------
NM_003178chr32484 186 --1648 --
NM_003179chrX21347 340 ------
NM_003185chr2011111 ------
NM_003188chr6--1528 ----
NM_003194chr62468 231 ------
NM_003199chr1832158 1141 1092 ------
NM_003200chr1982147 1834 1797 1450 660 450 253 45 1751 11483 --
NM_003204chr17--11305 ----
NM_003211chr1221354 1316 ------
NM_003214chr621328 1185 ------
NM_003215chr441591 1573 1089 1037 11545 ----
NM_003217chr1231755 1507 433 ------
NM_003223chr161828 --1536 --
NM_003224chr202871 850 ------
NM_003236chr212609 1131 ----
NM_003242chr32215 133 ------
NM_003244chr18--1314 ----
NM_003246chr151119 ------
NM_003247chr61810 2377 36 ----
NM_003250chr172317 190 ------
NM_003253chr21--1495 1450 --
NM_003257chr15----11271 --
NM_003262chr334608 3765 1054 ------
NM_003274chr213649 564 114 ------
NM_003288chr2031245 974 231 --11375 --
NM_003314chr51475 ------
NM_003315chr17198 ------
NM_003320chr1174451 4171 4117 2824 693 632 373 ------
NM_003339chr51446 1118 ----
NM_003340chr411299 ------
NM_003341chr31677 ------
NM_003342chr1733056 2835 2562 ------
NM_003345chr16----1444 --
NM_003347chr2212191 21562 47 --1778
NM_003348chr1211332 ------
NM_003350chr81751 ------
NM_003373chr1021511 721 --2510 446 --
NM_003375chr10--1290 ----
NM_003376chr61490 ------
NM_003376chr61490 ------
NM_003378chr72397 66 ------
NM_003387chr21233 ------
NM_003388chr732055 1957 1327 ------
NM_003392chr341612 1601 1053 308 --13967 --
NM_003404chr20----1801 --
NM_003406chr81443 ------
NM_003410chrX3729 694 109 ------
NM_003411chrY21649 104 ------
NM_003418chr31245 ----1127
NM_003432chr5--1469 ----
NM_003439chr743552 2731 2199 562 ------
NM_003457chr171613 ------
NM_003458chr353967 3619 1238 411 50 11144 ----
NM_003459chr23583 565 489 --2673 597 --
NM_003463chr611067 ------
NM_003466chr21667 --12522 --
NM_003468chr221144 456 ------
NM_003470chr1621779 1678 1368 ----
NM_003471chr332216 1697 49 1164 ----
NM_003474chr103707 533 508 --3404 156 151 --
NM_003482chr1232422 2186 1790 ------
NM_003483chr1212318 ------
NM_003489chr21--23010 3002 ----
NM_003498chr1612665 --12319 --
NM_003502chr161139 1550 125 1518
NM_003508chr71313 ------
NM_003558chr91599 ------
NM_003563chr172934 505 ------
NM_003564chr12510 438 ------
NM_003565chr1221436 388 ------
NM_003574chr1841983 1550 1054 635 --1896 --
NM_003575chr731353 1125 1009 --11155 11484
NM_003576chr1362621 2583 1100 1066 879 166 --11081 --
NM_003583chr1233309 904 862 ------
NM_003590chr231218 1083 985 13833 ----
NM_003591chr10182 ------
NM_003601chr4----1177 --
NM_003603chr42428 165 ------
NM_003607chr1--23968 3888 ----
NM_003615chr322857 446 ------
NM_003621chr11--126 ----
NM_003629chr1------13403
NM_003635chr101499 ------
NM_003642chr2154 ------
NM_003644chr1766079 6062 5360 5009 4945 2568 35994 4972 927 36319 4519 250 --
NM_003648chr272477 673 521 409 386 356 296 ----12427
NM_003654chr111268 ------
NM_003663chr313360 ------
NM_003684chr141018 948 893 333 ------
NM_003690chr21475 ------
NM_003701chr13--1750 ----
NM_003704chr43220 191 90 --1110 --
NM_003721chr19--1144 ----
NM_003728chr42449 271 ------
NM_003735chr521625 1609 ------
NM_003736chr521625 1609 ------
NM_003745chr16----145 1360
NM_003750chr101959 ------
NM_003760chr11629 ------
NM_003768chr141801 669 514 131 ------
NM_003779chr1----1117 --
NM_003787chr1811118 ------
NM_003791chr16172 --1253 --
NM_003794chr31146 ------
NM_003819chr11201 ------
NM_003828chrX1521 1126 ----
NM_003829chr9188 ----1882
NM_003831chr1851818 1795 1354 478 119 ------
NM_003861chr1421078 201 ------
NM_003873chr103626 378 173 ----1490
NM_003875chr3130 ------
NM_003877chr121797 ------
NM_003885chr1752681 2246 2010 472 277 11858 ----
NM_003909chr831978 1867 315 --1381 --
NM_003910chr71143 ------
NM_003936chr2----11136 --
NM_003938chr192270 85 ----1138
NM_003941chr722286 2179 1147 ----
NM_003942chr113728 458 39 --1692 --
NM_003956chr101504 --142 --
NM_003958chr643924 2969 677 79 ----12753
NM_003966chr542414 645 516 53 ------
NM_003968chr3--1546 ----
NM_003971chr171183 ------
NM_003981chr154792 705 38 27 ------
NM_003983chr1633967 3123 2917 ----11073
NM_004006chrX11777 ------
NM_004007chrX11777 ------
NM_004009chrX11777 ------
NM_004010chrX11777 ------
NM_004011chrX11777 ------
NM_004012chrX11777 ------
NM_004013chrX11777 ------
NM_004014chrX11777 ------
NM_004015chrX11777 ------
NM_004017chrX11777 ------
NM_004020chrX11777 ------
NM_004024chr121386 368 ------
NM_004028chr1821032 287 ------
NM_004035chr1735140 4593 727 ------
NM_004037chr13836 661 74 ------
NM_004040chr241335 292 205 88 ------
NM_004041chr112715 676 146 ----
NM_004047chr1171 1206 125 --
NM_004055chr1121621 124 ------
NM_004061chr51439 ------
NM_004067chr71524 --1227 --
NM_004087chr311285 1408 ----
NM_004090chr173917 466 46 1502 ----
NM_004093chr1332595 347 24 22386 224 1250 --
NM_004098chr101512 ------
NM_004114chrX--11193 ----
NM_004116chr21481 ------
NM_004124chr1423503 794 ------
NM_004134chr5----1475 --
NM_004152chr19--1114 ----
NM_004157chr31125 1808 ----
NM_004170chr911498 ------
NM_004171chr1169002 8229 2297 2228 1327 178 28556 1213 11034 --
NM_004176chr174468 405 334 137 154 ----
NM_004210chr1022147 1762 ------
NM_004227chr742325 2265 257 161 1645 22354 1192 --
NM_004233chr61473 ------
NM_004238chr21281 ----1336
NM_004242chr6--2295 272 ----
NM_004261chr11369 ------
NM_004272chr51412 ------
NM_004302chr122707 594 1669 22670 551 --
NM_004309chr1751052 919 284 237 110 ------
NM_004319chr11367 12253 1331 --
NM_004320chr163367 122 32 1340 ----
NM_004321chr2113543 3443 3364 3335 3228 3139 2480 2328 1014 845 155 --43309 2502 190 172 --
NM_004326chr111221 --1286 --
NM_004327chr2232037 1818 444 ------
NM_004338chr1887053 6858 5651 5624 5296 4540 2340 1886 14780 ----
NM_004342chr71238 ------
NM_004364chr193974 793 344 --195 --
NM_004370chr621699 587 --11620 --
NM_004380chr1612548 12430 ----
NM_004383chr152519 500 ------
NM_004385chr5159 --1138 --
NM_004395chr5----2790 76 --
NM_004397chr1111169 1387 ----
NM_004414chr211321 --1154 --
NM_004418chr22500 34 ------
NM_004419chr1021029 923 183 ----
NM_004427chr1----11109 --
NM_004428chr11711 --2598 581 1292
NM_004431chr1----169 --
NM_004436chr13631 594 64 ------
NM_004438chr232256 756 464 --1691 --
NM_004443chr32736 100 134 ----
NM_004444chr72737 85 ------
NM_004449chr21----11128 --
NM_004454chr322057 1503 1875 1900 --
NM_004457chr221717 508 ------
NM_004459chr1711829 ------
NM_004481chr162460 1965 1956 880 798 467 1162 1906 --
NM_004497chr193729 706 516 ------
NM_004498chr15----1277 --
NM_004500chr1421951 461 ------
NM_004514chr1782956 2655 2600 2047 720 643 322 293 12091 ----
NM_004525chr221346 1240 --1382 --
NM_004535chr2041628 444 375 190 --11682 1673
NM_004538chrX2730 326 ------
NM_004550chr1--1144 ----
NM_004569chr14--1180 ----
NM_004575chr42622 378 ------
NM_004578chr12866 709 ------
NM_004580chr15--11731 ----
NM_004588chr112409 29 1547 33654 2668 453 --
NM_004602chr2041167 321 186 169 ------
NM_004612chr924535 4194 1197 1314 --
NM_004630chr111897 ------
NM_004631chr121179 23 ------
NM_004651chrX3364 143 125 --1262 --
NM_004655chr1721176 64 --1852 --
NM_004656chr32262 161 --140 --
NM_004657chr231577 1454 27 --132 --
NM_004660chrY1112 ------
NM_004664chr122119 58 ------
NM_004667chr153182 150 62 ------
NM_004687chr172726 473 12056 ----
NM_004709chrX21818 619 1718 ----
NM_004725chr1011503 ------
NM_004726chrX34993 4724 110 11605 1535 --
NM_004736chr1--1668 ----
NM_004740chr17186 --1283 --
NM_004742chr321172 250 ----11180
NM_004745chr812584 16715 ----
NM_004758chr1721135 219 --1832 --
NM_004768chr121133 883 ------
NM_004772chr511435 ------
NM_004774chr171226 13053 ----
NM_004776chr2072966 2833 2454 1310 363 352 341 ------
NM_004779chr52423 52 ------
NM_004781chr111564 11732 1440 --
NM_004781chr111564 11732 1440 --
NM_004783chr163637 618 506 ------
NM_004787chr4154 ------
NM_004788chr1122125 2046 ------
NM_004824chr611452 ------
NM_004834chr232711 827 112 ------
NM_004845chrX11399 --13480 --
NM_004850chr211207 ------
NM_004857chr1423247 1679 ------
NM_004859chr1743010 2427 2411 690 ------
NM_004863chr1433980 3822 1895 ------
NM_004871chr1733523 1572 182 --11443 --
NM_004879chr113311 274 46 ------
NM_004886chr192219 28 ------
NM_004887chr511074 ------
NM_004891chr21259 ------
NM_004904chr734612 1741 453 14240 11713 --
NM_004906chr6--1553 ----
NM_004929chr8--157 ----
NM_004932chr52387 130 ------
NM_004937chr173820 440 39 ------
NM_004947chr342608 2351 2255 151 ------
NM_004949chr1812051 1713 ----
NM_004952chr11943 ------
NM_004958chr1--1686 ----
NM_004965chr211520 ------
NM_004973chr611591 --1499 --
NM_004976chr1154666 3544 3483 1879 420 --13854 --
NM_004978chr131732 1652 588 --11685 --
NM_004985chr1224466 2754 ------
NM_004992chrX148090 7620 7492 6962 6597 5780 5724 5357 3257 2915 2358 1946 1914 543 28148 6937 ----
NM_004992chrX148090 7620 7492 6962 6597 5780 5724 5357 3257 2915 2358 1946 1914 543 28148 6937 ----
NM_005010chr711714 32067 869 344 ----
NM_005011chr721218 431 ------
NM_005022chr171184 ------
NM_005028chr102676 434 11727 21770 1719 --
NM_005056chr1264755 3773 3591 1780 1732 68 53839 3716 3658 3600 148 ----
NM_005063chr1053596 3387 3372 2777 1015 12581 ----
NM_005065chr1415092 ------
NM_005066chr11309 ------
NM_005067chr32955 117 ------
NM_005093chr2055242 3825 3244 947 391 45289 1817 168 81 14666 11017
NM_005096chrX2977 426 ------
NM_005099chr121061 110 ------
NM_005105chr141714 462 299 88 ------
NM_005116chr2041039 568 428 149 --14161 23771 3709
NM_005117chr112843 43 ------
NM_005121chr17--123 ----
NM_005126chr31217 ------
NM_005159chr15--1884 ----
NM_005163chr142153 57 ------
NM_005168chr2----11413 --
NM_005171chr12----1812 --
NM_005176chr12151 ------
NM_005184chr1951580 1512 1209 1138 1131 ------
NM_005187chr1631889 1761 38 11519 2590 75 --
NM_005188chr1187374 7091 6432 5591 2500 2479 1900 425 --1366 --
NM_005197chr1455623 4176 2354 1915 898 1810 ----
NM_005202chr131506 563 114 1215 ----
NM_005204chr10--1288 ----
NM_005206chr171576 11109 1372 --
NM_005219chr51503 --1632 --
NM_005230chr12177 ------
NM_005233chr322118 42 --22439 1022 --
NM_005235chr226684 4783 ------
NM_005238chr1112920 --154 13055
NM_005245chr4----1200 --
NM_005249chr141857 ------
NM_005252chr142145 125 ------
NM_005254chr1521107 867 ------
NM_005256chr111684 ------
NM_005257chr181116 ------
NM_005259chr2169 ------
NM_005277chr411725 ------
NM_005308chr10--1421 ----
NM_005311chr731063 184 65 ------
NM_005316chr1111067 ------
NM_005324chr1721752 1655 ------
NM_005328chr8--1257 ----
NM_005336chr272093 888 755 620 323 241 154 --1185 --
NM_005339chr444197 3826 1053 430 13130 ----
NM_005342chrX32740 611 465 1278 ----
NM_005347chr911597 ------
NM_005354chr19165 ------
NM_005359chr1835836 4169 2111 1985 ----
NM_005370chr19146 ------
NM_005376chr13832 379 27 1407 ----
NM_005381chr21165 ------
NM_005392chr911424 11257 ----
NM_005406chr1821472 311 ------
NM_005407chr141165 ------
NM_005415chr22246 189 ------
NM_005426chr1--1243 ----
NM_005433chr1812015 ------
NM_005436chr1043629 3522 2702 1291 13953 ----
NM_005440chr171556 ------
NM_005442chr31624 --1427 --
NM_005455chr11250 ------
NM_005458chr922120 441 ------
NM_005465chr13801 543 514 ------
NM_005474chr1731456 1146 608 --197 --
NM_005477chr1522219 966 ----1719
NM_005477chr1522219 966 ----1719
NM_005493chr61754 ------
NM_005497chr1735348 4984 24 ----15130
NM_005503chr1521175 883 --31115 335 296 --
NM_005504chr1246256 5149 1559 524 2578 104 ----
NM_005505chr121314 1594 1756 --
NM_005507chr112427 370 ------
NM_005509chr51725 11605 ----
NM_005512chr1141694 1529 1272 193 --1484 --
NM_005520chr51517 ----150
NM_005523chr721579 400 ----1217
NM_005537chr13--146 ----
NM_005542chr72465 225 ------
NM_005544chr21325 ------
NM_005569chr223240 71 56 ------
NM_005574chr111730 --1298 --
NM_005587chr15--1396 ----
NM_005596chr955467 5095 4206 2106 1709 ------
NM_005602chr3--11318 ----
NM_005604chr61439 ------
NM_005614chr71792 ------
NM_005627chr61333 ------
NM_005629chrX21327 1094 ------
NM_005632chr162972 244 ----128
NM_005637chr1822020 1907 ------
NM_005639chr12--11689 11472 --
NM_005647chrX2371 48 --1348 --
NM_005650chr2211040 1109 1937 --
NM_005656chr2111162 31349 159 69 ----
NM_005662chr81370 ------
NM_005667chr21395 ------
NM_005668chr533385 945 857 ------
NM_005688chr341269 1202 1164 381 ------
NM_005704chr131079 1018 259 ------
NM_005707chr152154 147 ------
NM_005711chr5--168 ----
NM_005718chr33729 346 275 ------
NM_005721chr21259 ------
NM_005730chr1233449 2477 55 ------
NM_005731chr2----1164 --
NM_005736chr101290 --2259 141 --
NM_005737chr222938 542 --1676 --
NM_005746chr712306 ------
NM_005759chr264388 3475 2922 1858 1511 400 ----14780
NM_005766chr131993 --11344 --
NM_005768chr122455 23 --1129 --
NM_005779chr52881 573 23606 3299 ----
NM_005782chr17----183 --
NM_005786chr182488 420 1172 ----
NM_005808chr332627 1058 105 33308 2344 31 13242 --
NM_005811chr12----1131 --
NM_005819chr133089 395 134 ------
NM_005822chr611703 --1853 --
NM_005828chr1784894 3812 3494 3191 1119 1044 328 192 ------
NM_005840chrX21738 1609 --1380 --
NM_005852chr171218 ------
NM_005857chr111450 ------
NM_005859chr511286 ------
NM_005862chr3--1807 ----
NM_005880chr162529 286 ------
NM_005883chr1942434 2230 568 191 --12751 --
NM_005885chr51332 ------
NM_005895chr1274090 3887 3674 3430 346 275 23 --33679 3391 1529 --
NM_005900chr41766 ------
NM_005909chr514129 13275 ----
NM_005920chr113773 ------
NM_005922chr6172 ------
NM_005933chr11----12222 --
NM_005937chr1732969 1622 120 --13213 --
NM_005938chrX21330 229 ------
NM_005941chr8--11008 ----
NM_005955chr174984 4465 3918 3803 3453 651 516 ------
NM_005964chr1721210 351 ------
NM_005966chr212427 ------
NM_005990chr572587 2493 775 639 148 134 105 12548 ----
NM_005994chr171680 ------
NM_006007chr933846 3153 2849 14338 ----
NM_006011chr1524001 1183 13777 ----
NM_006015chr12113 29 ------
NM_006022chr131296 11021 ----
NM_006030chr321471 452 ------
NM_006037chr2104661 4643 4277 4269 4210 3309 1033 513 299 73 --24447 3253 --
NM_006038chr2032105 794 141 ------
NM_006040chr1611412 ------
NM_006047chr20144 ------
NM_006048chr11456 ------
NM_006054chr1121588 1482 ------
NM_006060chr783712 2871 2765 1438 642 528 451 381 11750 ----
NM_006079chr61722 ------
NM_006095chr433685 2864 740 1172 ----
NM_006113chr11301 ----1208
NM_006122chr152802 157 ----11051
NM_006133chr1132491 1516 811 ------
NM_006135chr111361 ------
NM_006141chr16--1531 ----
NM_006162chr1831538 1472 1405 1317 ----
NM_006166chr1221014 661 ------
NM_006167chr81682 ------
NM_006176chr114787 771 746 187 --182 --
NM_006186chr2----187 --
NM_006194chr1411219 ------
NM_006203chr521140 711 --13466 --
NM_006224chr172918 107 ------
NM_006226chr21423 ------
NM_006243chr11162 ------
NM_006245chr63951 752 676 ------
NM_006256chr12960 78 ------
NM_006257chr102985 848 --1193 --
NM_006267chr21605 ------
NM_006277chr2--1489 ----
NM_006279chr11890 --2235 146 --
NM_006281chr811200 ----1184
NM_006281chr811200 ----1184
NM_006283chr824157 1963 ------
NM_006293chr152819 703 --1131 --
NM_006294chr81490 ------
NM_006301chr122216 185 ------
NM_006312chr121861 1207 1754 --
NM_006321chr342053 2004 1970 1577 1580 ----
NM_006322chr131164 ------
NM_006323chr41613 ------
NM_006328chr11----1441 --
NM_006345chr41934 ------
NM_006352chr111750 ------
NM_006357chr2153 ------
NM_006359chrX32268 1552 594 --11998 --
NM_006375chrX21597 1562 ------
NM_006378chr911140 2123 94 ----
NM_006380chr1723413 1020 ------
NM_006387chr1941162 804 470 46 --1170 --
NM_006389chr1121196 493 11067 ----
NM_006401chr9195 ------
NM_006431chr12--1221 1168 --
NM_006434chr1011009 ----1613
NM_006439chr41504 ------
NM_006454chr493057 2967 2848 2817 2481 2384 2274 2107 1147 --53066 2057 792 336 105 --
NM_006459chr1041901 1844 1744 314 ------
NM_006480chr52320 84 ------
NM_006482chr1233309 904 862 ------
NM_006489chr1411969 21691 1548 --11384
NM_006497chr172165 91 ------
NM_006526chr2021744 116 ------
NM_006534chr2053401 3099 2195 1095 213 ------
NM_006540chr82167 74 ------
NM_006546chr1736076 5943 1620 36110 4751 794 ----
NM_006549chr1242168 2090 681 493 12619 ----
NM_006561chr1035911 5622 1362 13856 ----
NM_006562chr10------1241
NM_006570chr9181 ------
NM_006574chr33266 250 223 ------
NM_006595chr111780 ------
NM_006599chr1635735 1633 455 1706 13086 --
NM_006603chrX11496 ------
NM_006609chr232575 2064 22 ------
NM_006614chr313162 ------
NM_006618chr111358 --11090 --
NM_006621chr111848 ------
NM_006644chr13--1241 ----
NM_006668chr143522 397 379 --144 --
NM_006690chr2031838 1635 637 --1184 --
NM_006695chr171276 ------
NM_006700chr123559 312 160 143 --165
NM_006717chr912764 ------
NM_006720chr1034924 1864 1249 --35026 1608 521 --
NM_006724chr6172 ------
NM_006726chr42775 441 ------
NM_006734chr6----11073 --
NM_006742chr1641683 1309 214 142 ------
NM_006749chr841041 822 523 74 ----199
NM_006751chr2--1284 ----
NM_006754chr71154 ------
NM_006755chr111172 ------
NM_006756chr821367 956 ------
NM_006763chr131853 1836 46 --133 --
NM_006766chr842025 1920 1893 1827 ------
NM_006772chr611399 140 ----
NM_006775chr6----12221 --
NM_006777chrX12160 --12124 --
NM_006811chr20----1259 --
NM_006822chr171136 ------
NM_006823chr851332 1302 1288 478 161 --1108 --
NM_006861chr1251760 1618 556 461 92 1789 ----
NM_006884chr3----11298 --
NM_006885chr1622989 1441 ------
NM_006888chr1442976 1314 777 771 1608 --12956
NM_006892chr2021362 101 1117 ----
NM_006892chr2021362 101 1117 ----
NM_006896chr721150 861 ------
NM_006908chr711335 ------
NM_006910chr161108 ------
NM_006914chr9--1464 ----
NM_006920chr21555 ------
NM_006922chr212094 ------
NM_006924chr1713628 14088 ----
NM_006927chr1632244 560 235 --1116 --
NM_006939chr1411158 ------
NM_006950chrX2814 742 --1785 --
NM_006981chr922438 729 12380 ----
NM_006982chr12188 ------
NM_007005chr921494 515 11291 11114 --
NM_007007chr1222968 1136 24570 1656 ----
NM_007011chr1566659 6359 6350 2018 967 873 --1930 --
NM_007017chr51135 ------
NM_007023chr21964 ------
NM_007030chr531793 1291 636 23463 610 1351 --
NM_007038chr2135225 526 60 12020 ----
NM_007042chr31433 --11036 --
NM_007047chr631743 954 752 12228 ----
NM_007050chr2078099 8072 7886 1509 664 184 43 1346 ----
NM_007054chr513645 1243 ----
NM_007064chr3--2682 101 ----
NM_007073chr611535 --13873 --
NM_007078chr102888 358 1167 12395 --
NM_007087chr162796 514 ------
NM_007096chr91242 1251 ----
NM_007107chr311730 12216 ----
NM_007111chr131180 ------
NM_007129chr13----1823 --
NM_007166chr1111059 ------
NM_007174chr1232219 1800 1647 ------
NM_007182chr31115 --157 --
NM_007198chr821628 140 ------
NM_007207chr1--1326 ----
NM_007212chr111564 ------
NM_007218chr81313 ------
NM_007245chr161323 ------
NM_007246chr4--1183 ----
NM_007249chr1339305 8664 257 11484 ----
NM_007270chr7--2517 213 --11516
NM_007275chr341112 1052 410 140 11102 ----
NM_007292chr1735140 4593 727 ------
NM_007308chr41227 ------
NM_007347chr1523108 1102 ------
NM_007358chr1--11778 ----
NM_007363chrX------1978
NM_007371chr92661 291 ------
NM_007373chr1021791 1122 ------
NM_007375chr121104 747 11722 ----
NM_012064chr1231067 274 160 --1238 --
NM_012081chr533721 3658 3584 ------
NM_012082chr81228 ------
NM_012090chr111087 ------
NM_012099chr1911249 1202 ----
NM_012102chr162205 1940 1800 835 351 27 ------
NM_012120chr622916 215 ------
NM_012137chr14196 103 95 60 ------
NM_012141chr13--13983 11230 --
NM_012154chr82634 265 --1570 --
NM_012156chr2043389 2919 2743 1311 ------
NM_012176chr5156 ------
NM_012193chr1154958 2138 1014 356 238 15162 12009 --
NM_012199chr114498 24346 1446 160 --
NM_012210chr91621 1449 ----
NM_012214chr256371 2439 1785 1268 1126 ------
NM_012218chr194985 725 199 128 --1185 12974
NM_012232chr1732194 2146 1568 ------
NM_012234chr332923 2617 1289 ----1294
NM_012242chr101539 ------
NM_012247chr101338 ------
NM_012262chr121241 845 --15201 --
NM_012281chr722250 43 1576 --1619
NM_012288chr665356 4560 4333 4250 2270 263 ------
NM_012293chr252148 1898 1630 1541 721 --136 --
NM_012296chr1143887 1411 671 215 ------
NM_012297chr42834 601 --1963 --
NM_012301chr712058 ------
NM_012307chr181843 ----1849
NM_012308chr114619 570 518 341 12228 1248 --
NM_012309chr1154452 1898 1087 678 58 ------
NM_012316chr154328 1835 1758 966 129 ------
NM_012320chr163403 250 35 11277 ----
NM_012325chr2011212 ------
NM_012326chr23329 255 41 ------
NM_012329chr171152 ------
NM_012384chr2022378 1534 ------
NM_012388chr1521217 956 ------
NM_012402chr1111053 ------
NM_012405chr133685 1350 846 143 ----
NM_012416chr91211 ------
NM_012421chr11116 ------
NM_012428chr151227 ------
NM_012446chr51458 ------
NM_012448chr1722272 294 1148 12102 --
NM_012461chr14--1280 ----
NM_012474chr11211 ------
NM_012478chr17----164 --
NM_012479chr742658 1030 1000 762 --1197 --
NM_013227chr151276 2807 788 ----
NM_013242chr161382 ------
NM_013254chr122176 120 ------
NM_013255chr748641 7592 2841 1220 18361 ----
NM_013260chr1731009 983 176 31114 424 37 21020 529 --
NM_013261chr413146 --13009 --
NM_013269chr121865 ----13435
NM_013281chr201349 ------
NM_013286chr361022 733 668 638 531 248 ----1760
NM_013309chr1522260 103 ----12228
NM_013381chr121638 1350 ----
NM_013400chr71259 ------
NM_013410chr12319 69 --11159 --
NM_013411chr122840 1016 11759 ----
NM_013423chrX1502 ------
NM_013427chrX1502 ------
NM_013433chr1921983 1893 1538 21988 85 --
NM_013438chr91101 11199 ----
NM_013447chr1922862 236 --11191 --
NM_013449chr1241201 1039 1000 947 ------
NM_013943chr122902 799 ------
NM_013951chr21667 --12522 --
NM_013952chr221585 744 --12599 --
NM_013953chr221585 744 --12599 --
NM_013989chr1411888 ------
NM_013992chr221585 744 --12599 --
NM_014000chr1021511 721 --2510 446 --
NM_014001chr172632 162 ------
NM_014011chr232405 419 264 ------
NM_014016chr3--11083 ----
NM_014028chr623153 1109 ------
NM_014030chr1721039 972 ------
NM_014056chr311741 ------
NM_014071chr202337 68 ------
NM_014079chr33261 253 245 ------
NM_014112chr824017 573 ------
NM_014117chr1632368 522 380 ------
NM_014154chr3--1399 1140 --
NM_014155chr1166904 5840 5696 2398 927 317 15202 ----
NM_014159chr3199 ------
NM_014191chr122667 95 ------
NM_014212chr124962 794 188 136 ------
NM_014223chr11716 ------
NM_014225chr191376 1105 ----
NM_014231chr121606 ------
NM_014232chr1741587 1545 123 107 ------
NM_014232chr1741587 1545 123 107 ------
NM_014240chr333683 3138 3107 ------
NM_014243chr4--21421 846 ----
NM_014249chr15------1515
NM_014253chrX32469 2402 591 12366 ----
NM_014263chr1021270 1136 ------
NM_014267chr111798 ------
NM_014271chrX--1652 ----
NM_014275chr53833 347 224 ----1625
NM_014280chr11380 ------
NM_014282chr931218 1043 113 --1367 --
NM_014283chr11490 ------
NM_014284chr12681 415 ----11078
NM_014292chr2271259 1208 759 723 363 327 99 --11476 --
NM_014293chr2232886 2701 1004 1885 23244 120 --
NM_014294chr81100 ------
NM_014299chr1931990 1885 1364 21951 676 ----
NM_014309chr2233681 517 294 --11907 --
NM_014310chr2221795 66 11937 ----
NM_014317chr10144 ------
NM_014325chr1221623 808 11720 1341 --
NM_014333chr113704 296 146 ------
NM_014351chr2231458 1220 953 21042 934 ----
NM_014352chr1111006 ------
NM_014368chr931729 1350 839 --12115 --
NM_014372chr112123 1102 ----
NM_014374chr71259 ------
NM_014376chr51674 1161 ----
NM_014383chr191276 ------
NM_014392chr441505 1430 992 542 21604 1026 1411 --
NM_014405chr1732248 2004 651 1941 41927 1694 1648 822 --
NM_014408chr1161 ------
NM_014415chr311487 ----11438
NM_014417chr191637 ------
NM_014426chr201751 ------
NM_014445chr311902 ------
NM_014452chr6--1337 ----
NM_014454chr62258 205 ----1908
NM_014456chr101435 ------
NM_014460chr2251216 1067 421 389 141 1195 ----
NM_014491chr7--1711 ----
NM_014504chr7--11430 --1481
NM_014515chr12--1877 ----
NM_014554chr1221799 209 ------
NM_014563chrX32024 1440 537 ------
NM_014571chr142945 2075 956 897 12771 ----
NM_014572chr1321657 623 1426 21690 1646 --
NM_014574chr1411244 ------
NM_014577chr221179 --1237 --
NM_014584chr1421497 1221 ------
NM_014587chr1651173 1078 1022 575 377 ------
NM_014601chr1941430 1214 1133 29 ------
NM_014614chr21443 1582 ----
NM_014615chr1633524 3437 2256 1342 ----
NM_014618chr9------1333
NM_014630chr1552738 2601 1450 805 719 --1338 --
NM_014633chr112165 61 1194 ----
NM_014634chr2253336 2850 2484 1273 172 23540 3409 13257 --
NM_014636chr983985 2889 2847 1450 1176 999 388 88 13485 --1954
NM_014659chr152288 278 ----1781
NM_014665chr811291 --11170 --
NM_014666chr5------146
NM_014667chr31471 --11813 --
NM_014676chr1--11056 ----
NM_014682chr811517 ------
NM_014686chr1962350 2306 1922 1881 350 51 ------
NM_014690chr773120 457 281 264 245 228 52 --1333 12588
NM_014693chr32769 234 ------
NM_014701chr1522666 34 ------
NM_014703chr311234 ------
NM_014705chr71845 ------
NM_014707chr711573 ------
NM_014709chr22482 399 1609 ----
NM_014711chr1631720 1514 217 ------
NM_014717chr191887 ------
NM_014718chr121697 ------
NM_014721chr612462 22619 1769 --17032
NM_014726chr1721383 947 1477 ----
NM_014729chr81263 --22232 2203 --
NM_014731chr202397 131 ----11474
NM_014732chr16115828 4767 3960 1517 1282 1228 830 694 539 505 441 35216 4679 984 14877 --
NM_014740chr17143 ------
NM_014743chr41959 22866 1161 ----
NM_014746chr253068 2889 676 261 141 ------
NM_014748chr2161 ------
NM_014750chr141217 ------
NM_014755chr21964 23699 77 14144 --
NM_014764chr12122 ----1811
NM_014767chr101870 --1401 12395
NM_014772chr1853350 3305 2344 1157 343 ------
NM_014774chr122919 1106 --11001 --
NM_014779chr32910 868 ------
NM_014782chrX1250 ------
NM_014784chr111002 ------
NM_014787chr132743 1783 36 ------
NM_014790chr5------1351
NM_014798chr1731531 103 93 11457 11914 --
NM_014800chr721169 112 ------
NM_014803chr1011982 ------
NM_014806chr93406 144 125 ------
NM_014807chr111818 ------
NM_014810chr1--13476 ----
NM_014812chr131401 377 324 ------
NM_014820chr3--1209 ----
NM_014824chr113737 646 175 11966 ----
NM_014826chr1--23968 3888 ----
NM_014835chr2022158 822 --1189 --
NM_014838chr222727 91 --11768 --
NM_014839chr13979 508 358 --12332 --
NM_014840chr122557 92 --12139 --
NM_014841chr621099 152 ------
NM_014850chr383975 3519 1780 1219 1174 683 36 26 1135 13453 14249
NM_014862chr1554103 3407 952 559 133 21668 549 23962 1357 --
NM_014873chr124718 659 11087 ----
NM_014876chr2221491 58 21961 211 ----
NM_014877chr1757100 6103 2427 2281 1754 ----15706
NM_014883chr422469 445 ------
NM_014892chr61426 ------
NM_014893chrY1625 1533 ----
NM_014897chr1722420 388 ------
NM_014901chr531448 737 546 1270 ----
NM_014903chr12--11900 ----
NM_014905chr211384 1223 ----
NM_014906chr1723354 3275 ------
NM_014912chr1012873 198 ----
NM_014917chr1134 1858 ----
NM_014920chr633561 2843 2519 ------
NM_014921chr1912590 22103 1067 ----
NM_014923chr1321569 442 ------
NM_014924chr141265 ------
NM_014932chr3----1647 --
NM_014935chr141045 667 377 37 1691 ----
NM_014938chr1262036 1864 1838 1808 793 214 --21818 295 --
NM_014942chr622522 1916 --1428 --
NM_014944chr1----21305 140 --
NM_014947chr111918 147 ----
NM_014949chr1187 ------
NM_014966chr3123 ------
NM_014969chr131182 207 200 11115 ----
NM_014974chr1021105 56 11565 ----
NM_014978chr10----11263 --
NM_014989chr622030 524 ------
NM_014994chr1532019 702 269 --12028 --
NM_014997chr742135 1157 1001 714 --1721 --
NM_015000chr1222530 317 ------
NM_015001chr12749 400 ------
NM_015002chr121159 ------
NM_015008chr323428 2880 ------
NM_015011chr1331140 253 155 ------
NM_015020chr162432 373 ----137
NM_015025chr232641 2137 911 ------
NM_015027chr1661991 1697 798 735 584 77 ------
NM_015035chr2035502 4233 1664 --26511 5941 12688
NM_015040chr213174 ------
NM_015042chr1523834 1183 --11312 --
NM_015045chr1022172 358 ------
NM_015052chr7--1513 --1153
NM_015059chr1563524 2824 904 586 480 240 12842 ----
NM_015064chr1242897 2239 1363 952 11463 ----
NM_015071chr546207 5939 4977 1174 26307 4193 12148 --
NM_015075chrX----11388 --
NM_015079chr1563203 2746 2050 846 297 250 --1527 --
NM_015099chr171252 143 1189 --
NM_015101chr112714 ----1821
NM_015102chr1152 1128 ----
NM_015103chr32280 79 1334 ----
NM_015107chrX4840 834 828 515 ------
NM_015110chr911803 ------
NM_015113chr1732390 304 164 ------
NM_015125chr191565 ------
NM_015132chr71692 1404 ----
NM_015137chr822585 791 1722 1763 --
NM_015138chr1542269 1945 870 783 ------
NM_015143chr42938 41 ------
NM_015144chr1653562 3380 2594 1104 910 11202 ----
NM_015149chr121946 1788 1782 11363 --
NM_015155chr1052701 2681 893 847 36 1832 1524 --
NM_015156chr1423476 144 ------
NM_015161chr1611357 1163 ----
NM_015163chr1431857 1289 78 ------
NM_015172chr111139 --11468 --
NM_015176chr1--1263 ----
NM_015199chr3146 1292 ----
NM_015200chr411634 ------
NM_015209chr14460 424 229 42 1940 21764 88 --
NM_015215chr11536 ------
NM_015216chr511039 ------
NM_015219chr175876 694 299 186 137 --22090 1630 12187
NM_015225chr91707 ------
NM_015231chr111171 ------
NM_015236chr42514 337 ------
NM_015238chr53690 547 42 ------
NM_015245chr62192 23 12665 ----
NM_015247chr1635372 3537 1146 11214 ----
NM_015250chr951361 571 490 459 412 21805 345 ----
NM_015254chr842861 314 305 209 11207 22830 1973 --
NM_015260chr1931056 183 65 --1347 --
NM_015267chr124746 715 609 168 ------
NM_015270chr1232284 78 60 --1141 --
NM_015271chr421549 1377 ----14178
NM_015278chr623339 2172 150 ----
NM_015288chr533911 180 122 --23744 717 --
NM_015289chr1531475 1445 502 --11816 --
NM_015292chr122302 108 ------
NM_015294chr1721111 1088 ------
NM_015296chr132142 119 ------
NM_015299chr1422874 1324 13048 ----
NM_015310chr828218 2282 15070 ----
NM_015317chr211757 ------
NM_015318chr1911235 --21689 780 --
NM_015327chr121222 1087 ------
NM_015328chr742835 2595 2445 163 --3581 576 114 --
NM_015336chr1232601 2574 61 ------
NM_015347chr12------22342 2286
NM_015349chr61187 --1583 --
NM_015355chr17------11622
NM_015365chrX14259 ------
NM_015374chr2241290 1258 365 217 ------
NM_015385chr1011009 ----1613
NM_015387chr21582 ------
NM_015401chr122687 279 ------
NM_015435chr8142 ------
NM_015443chr1741398 1000 491 457 ------
NM_015444chr3185 ------
NM_015455chr532560 1069 940 2996 977 ----
NM_015460chr321840 1555 ------
NM_015472chr31117 ------
NM_015472chr31117 ------
NM_015475chr211052 ------
NM_015483chr72462 390 ----1988
NM_015488chr221592 1467 ------
NM_015493chr1922126 1983 ------
NM_015497chr152870 856 ------
NM_015508chr31374 ------
NM_015509chr1221186 549 ------
NM_015520chr342322 1962 1743 730 ------
NM_015532chr1512664 ------
NM_015554chr1511891 11064 ----
NM_015568chr2063941 3857 1626 713 607 229 ------
NM_015569chr124146 3988 ------
NM_015570chr721849 564 ----1383
NM_015575chr243018 1358 1345 287 13687 11339 12684
NM_015576chr321140 525 ----1990
NM_015630chr2127 1751 ----
NM_015635chr922059 593 ----11980
NM_015640chr154293 3826 3320 1960 505 --13483 --
NM_015657chr21999 ------
NM_015676chr141102 1301 ----
NM_015686chrX22301 1813 --1600 --
NM_015695chr661983 1947 1750 413 267 193 ------
NM_015716chr171211 ------
NM_015831chr71583 --1154 --
NM_015878chr811458 ------
NM_015885chr11--1275 ----
NM_015892chr1022343 2116 --1462 --
NM_015898chr1922399 1563 ------
NM_015902chr8125 ------
NM_015906chr113337 --12935 --
NM_015912chr8--1436 --11863
NM_015963chr2143 ------
NM_015981chr563218 3098 3016 2790 2476 557 --132 --
NM_016009chr164827 4538 4385 3365 1594 1115 14741 ----
NM_016018chr821131 982 ------
NM_016019chr71871 1918 ----
NM_016021chr6126 12042 --12966
NM_016025chr161776 11421 ----
NM_016040chr112451 1161 ----
NM_016057chr124989 923 312 56 11297 ----
NM_016061chr21459 ------
NM_016075chr1322749 640 ------
NM_016083chr613501 1930 ----
NM_016100chr201321 ------
NM_016120chrX1945 ------
NM_016129chr4--122 ----
NM_016131chr221682 511 ------
NM_016152chr311099 ------
NM_016156chr1132274 914 352 1362 ----
NM_016162chr122614 75 ------
NM_016185chr171746 ------
NM_016201chr382287 2113 2081 1668 596 369 182 54 --1711 --
NM_016205chr411397 1371 21202 560 21208 38
NM_016206chr358436 5724 2719 751 574 1235 ----
NM_016227chr11490 ------
NM_016231chr1721480 584 11085 ----
NM_016240chr82164 92 ------
NM_016248chr1311350 --23785 2565 --
NM_016258chr11722 ------
NM_016260chr237245 4845 2314 17368 ----
NM_016272chr223999 465 314 ------
NM_016281chr121194 ------
NM_016291chr3----156 --
NM_016308chr112084 ------
NM_016319chr12182 ------
NM_016322chr92587 434 ------
NM_016329chr3--1173 ----
NM_016338chr521180 804 ------
NM_016340chr5138 ------
NM_016357chr121831 ------
NM_016376chr1734329 790 457 12801 ----
NM_016396chr151885 --12746 --
NM_016423chr141428 ------
NM_016424chr171232 ------
NM_016436chr201494 1242 ----
NM_016470chr201116 ------
NM_016479chr32134 94 ------
NM_016485chr61919 ------
NM_016486chr1------1133
NM_016507chr1722994 1069 ------
NM_016513chr633561 2843 2519 ------
NM_016522chr1121129 463 1295 ----
NM_016529chr132961 265 ------
NM_016530chr151361 12796 --13127
NM_016532chr172831 782 --1367 --
NM_016542chrX11517 ------
NM_016577chr344411 3973 1213 761 ------
NM_016596chr122687 279 ------
NM_016603chr532213 2026 1548 ------
NM_016604chr51902 ------
NM_016605chr552724 2607 2543 2456 682 --11965 --
NM_016620chr111149 ------
NM_016621chr1153706 3449 2869 1795 1554 1615 11469 11417
NM_016623chr82585 169 ------
NM_016628chr101574 ------
NM_016654chr1521107 867 ------
NM_016733chr223240 71 56 ------
NM_016823chr171446 1979 1242 --
NM_016836chr21490 ------
NM_016839chr21490 ------
NM_016929chr623402 853 11416 ----
NM_016931chr112341 85 ------
NM_016936chr1652133 1575 463 284 210 ------
NM_016937chrX2949 58 ------
NM_016946chr122379 999 ------
NM_016953chr215692 ------
NM_017409chr121163 ------
NM_017415chr561106 671 630 412 113 106 14074 13969 --
NM_017420chr1443718 3606 2899 1436 ------
NM_017423chr4--11879 ----
NM_017450chr172592 338 --1274 --
NM_017452chr2041167 321 186 169 ------
NM_017453chr2041167 321 186 169 ------
NM_017454chr2041167 321 186 169 ------
NM_017455chr151227 ------
NM_017481chr112190 38 ------
NM_017514chrX2254 41 --1813 --
NM_017519chr6--1493 ----
NM_017520chr133621 170 163 ------
NM_017522chr121179 23 ------
NM_017540chr532014 1254 1126 ------
NM_017544chrX2799 223 ------
NM_017548chr32645 538 21895 1655 ----
NM_017575chr1731053 449 151 11434 ----
NM_017577chr31220 ------
NM_017583chr1121706 635 ------
NM_017596chr184018 3494 3218 1685 1515 854 808 644 ------
NM_017607chr192545 68 ------
NM_017610chr1521926 769 ------
NM_017628chr444144 1017 859 814 1139 1795 --
NM_017629chr11324 ------
NM_017633chr6--13346 ----
NM_017637chr928016 7292 28468 3602 ----
NM_017641chr12136 ------
NM_017643chr17------12543
NM_017644chr313547 14758 ----
NM_017649chr1061243 1218 1195 1087 502 415 ------
NM_017658chr1424364 3401 ------
NM_017670chr112821 706 --1163 --
NM_017714chr20--1121 ----
NM_017724chr31706 ------
NM_017730chr31631 ------
NM_017737chr141845 1539 659 433 ------
NM_017742chr181300 ------
NM_017745chrX1573 ------
NM_017748chr171322 ------
NM_017772chr631278 78 70 ------
NM_017778chr811016 11457 ----
NM_017784chr311110 ------
NM_017786chr8122 1590 1247 --
NM_017787chr1052862 2157 1916 995 347 ------
NM_017789chr23756 721 581 ------
NM_017793chr153687 235 211 1721 ----
NM_017810chr16164 --1176 --
NM_017817chr13164 132 ----
NM_017824chr101697 2939 306 ----
NM_017831chr1824256 4126 ------
NM_017848chrX44407 4046 3981 434 ------
NM_017856chrX1605 ------
NM_017870chr111181 ------
NM_017873chr973025 1003 764 610 588 412 152 --1627 --
NM_017896chr2053420 2826 854 633 44 --1323 --
NM_017902chr1075768 4705 3878 3872 1455 950 816 13706 ----
NM_017919chr944230 3812 2013 733 25472 4531 ----
NM_017925chr91751 ------
NM_017934chr6190 ------
NM_017938chrX1850 ------
NM_017943chr141248 ------
NM_017944chr1122581 2073 --12601 1388
NM_017964chr21388 ------
NM_017994chr722982 2800 12628 ----
NM_018010chr311607 11637 ----
NM_018032chr163892 166 128 2365 238 176 --
NM_018054chr161128 ------
NM_018061chr11633 --1403 --
NM_018068chr8157 ------
NM_018070chr11516 ------
NM_018077chr72123 78 ------
NM_018084chr212701 12654 ----
NM_018086chr2----11197 --
NM_018092chr1621263 550 ------
NM_018105chr81871 ------
NM_018110chr161374 ------
NM_018113chr121426 ------
NM_018115chr42619 328 ------
NM_018120chr82524 427 ------
NM_018121chr1012373 13049 ----
NM_018144chr101267 ------
NM_018150chr12868 187 ------
NM_018184chr3--11897 ----
NM_018198chr141407 1375 953 288 --1467 --
NM_018200chr1542279 2258 633 581 ------
NM_018216chr11106 ------
NM_018227chr412401 ------
NM_018234chr262062 2043 1696 841 598 375 --11638 --
NM_018240chr11790 1180 ----
NM_018243chr433851 3727 2882 1208 ----
NM_018244chr202875 369 ------
NM_018266chr311127 ------
NM_018275chr71169 --177 --
NM_018307chr172986 807 ------
NM_018315chr411119 ------
NM_018361chr841631 1313 1100 780 ------
NM_018362chr1113369 ------
NM_018374chr713433 1744 ----
NM_018403chr343416 1356 1046 296 --13632 --
NM_018412chr7155 ------
NM_018423chr12--1256 ----
NM_018425chr1032065 1043 602 ------
NM_018448chr1211157 ------
NM_018462chr31637 ------
NM_018469chr17192 ------
NM_018488chr17134 ------
NM_018489chr112204 --1800 1806
NM_018553chr172663 579 ------
NM_018555chr1941748 1454 587 306 ------
NM_018557chr2----11149 --
NM_018566chr113708 ------
NM_018569chr411433 --11255 --
NM_018584chr11979 1481 ----
NM_018650chr121862 1439 ------
NM_018689chr151275 --2562 119 --
NM_018703chr161108 ------
NM_018708chr1921659 531 --11536 --
NM_018715chr131814 1779 898 --1626 12084
NM_018718chr72755 387 ------
NM_018836chr11390 --147 --
NM_018847chr911873 ------
NM_018890chr711335 ------
NM_018898chr551699 1465 776 659 323 ------
NM_018899chr551699 1465 776 659 323 ------
NM_018900chr551699 1465 776 659 323 ------
NM_018901chr551699 1465 776 659 323 ------
NM_018902chr551699 1465 776 659 323 ------
NM_018903chr551699 1465 776 659 323 ------
NM_018904chr551699 1465 776 659 323 ------
NM_018905chr551699 1465 776 659 323 ------
NM_018906chr551699 1465 776 659 323 ------
NM_018907chr551699 1465 776 659 323 ------
NM_018908chr551699 1465 776 659 323 ------
NM_018909chr551699 1465 776 659 323 ------
NM_018910chr551699 1465 776 659 323 ------
NM_018911chr551699 1465 776 659 323 ------
NM_018912chr521625 1609 ------
NM_018913chr521625 1609 ------
NM_018914chr521625 1609 ------
NM_018915chr521625 1609 ------
NM_018916chr521625 1609 ------
NM_018917chr521625 1609 ------
NM_018918chr521625 1609 ------
NM_018919chr521625 1609 ------
NM_018920chr521625 1609 ------
NM_018921chr521625 1609 ------
NM_018922chr521625 1609 ------
NM_018923chr521625 1609 ------
NM_018924chr521625 1609 ------
NM_018925chr521625 1609 ------
NM_018926chr521625 1609 ------
NM_018927chr521625 1609 ------
NM_018928chr521625 1609 ------
NM_018929chr521625 1609 ------
NM_018951chr721287 90 1147 21243 472 --
NM_018953chr121772 ------
NM_018963chr2111048 ------
NM_018992chr1641112 1041 418 83 11202 ----
NM_019000chr511543 ------
NM_019001chr323605 564 --14482 24805 3428
NM_019006chr151290 ------
NM_019009chr1182395 1874 1711 762 491 219 130 105 1850 1912 --
NM_019027chr41232 ------
NM_019042chr7--162 1887 --
NM_019046chr102891 725 ------
NM_019049chr11192 ------
NM_019057chr53365 112 81 ------
NM_019064chr172787 274 ------
NM_019083chr11119 ------
NM_019094chr1233691 2680 233 ------
NM_019096chr621130 229 11046 ----
NM_019102chr7--1381 ----
NM_019102chr7--1381 ----
NM_019106chr2232651 2182 634 --12291 --
NM_019558chr22141 57 ------
NM_019591chr121350 ------
NM_019593chr2022103 2097 ----12262
NM_019594chr921543 1113 ------
NM_019595chr2--1489 ----
NM_019597chrX2674 521 ------
NM_019606chr7----1202 --
NM_019613chr172265 218 ------
NM_019845chr2----162 --
NM_019885chr242865 2846 2379 2373 --1390 --
NM_020039chr1221732 1184 ------
NM_020064chr93580 551 499 ------
NM_020122chr274225 4206 4107 3867 1775 313 34 11449 ----
NM_020123chr10--11518 ----
NM_020134chr21165 ------
NM_020141chr131519 596 382 ------
NM_020148chr1842537 2337 161 47 1440 1646 --
NM_020150chr1012096 ------
NM_020154chr15173 ------
NM_020155chr11196 ------
NM_020156chr72529 168 ------
NM_020168chr1521173 319 1922 ----
NM_020182chr2023080 240 ------
NM_020193chr1121365 108 ------
NM_020205chr112603 --13370 --
NM_020214chr151267 ------
NM_020225chr41126 ------
NM_020240chr551872 1724 967 549 49 ------
NM_020248chr152374 2056 2037 1958 1844 --11849 --
NM_020251chr112715 676 146 ----
NM_020310chr1742645 2148 2140 699 ------
NM_020337chr41190 ------
NM_020338chr1062467 1483 1192 198 118 83 12869 12990 --
NM_020341chr20--194 11249 --
NM_020342chr222369 986 ------
NM_020346chr1111539 ------
NM_020354chr10188 ------
NM_020362chr12222 32 ------
NM_020374chr1211631 --1626 --
NM_020394chr111053 ------
NM_020403chr13152 ------
NM_020429chr742067 851 841 289 166 ----
NM_020432chr71353 1701 ----
NM_020433chr2041718 1637 447 166 11796 ----
NM_020443chr136591 2275 2217 --15947 26447 2323
NM_020456chr131626 11791 ----
NM_020457chr161488 ------
NM_020465chr1621810 1310 ------
NM_020474chr1821779 169 1221 ----
NM_020478chr821023 728 ------
NM_020546chr552860 2128 519 443 197 ------
NM_020630chr101677 ------
NM_020640chr311934 ------
NM_020647chr822235 498 ------
NM_020655chr1641306 966 553 227 ------
NM_020689chr2031448 222 111 144 1610 --
NM_020692chr144975 736 55 39 ------
NM_020697chr841174 972 910 377 --1355 --
NM_020699chr123700 2153 13655 ----
NM_020704chr72883 55 ------
NM_020708chr2052068 708 490 108 102 ----11937
NM_020711chr232624 1973 492 ------
NM_020718chr1646156 1605 1567 81 14030 11246 --
NM_020728chr753041 2552 2177 298 272 ------
NM_020732chr6--1493 ----
NM_020737chr6130 ------
NM_020742chrX2639 425 2570 546 ----
NM_020748chr1711983 ------
NM_020750chr611383 2321 158 1361 --
NM_020752chr101750 11076 11964 --
NM_020764chr1621233 995 1236 --1934
NM_020766chrX43982 1264 911 541 --1578 --
NM_020768chr511234 --21213 610 --
NM_020770chr111238 ------
NM_020772chr1745233 2962 2236 848 28280 6996 ----
NM_020778chr1521797 1098 ------
NM_020783chr1821799 286 ------
NM_020794chr111092 ----1224
NM_020796chr511859 ------
NM_020804chr622575 2066 --1706 --
NM_020807chr162220 46 --1476 --
NM_020813chr1942696 2534 949 362 12129 ----
NM_020819chr6------1191
NM_020826chr1131326 1121 66 12405 ----
NM_020834chr141479 ------
NM_020841chr1211419 ------
NM_020845chr1212407 1600 ----
NM_020850chr1642520 2403 2334 1217 ------
NM_020851chr1561762 1384 1376 1228 1204 444 11552 ----
NM_020854chr182572 496 ------
NM_020856chr1911510 ------
NM_020860chr411030 ------
NM_020873chr31347 ------
NM_020888chr13664 618 518 ------
NM_020899chr1722421 2356 ------
NM_020927chr163697 110 73 ------
NM_020935chr224467 3926 ------
NM_020940chr1012521 ------
NM_020946chr9----21656 1493 --
NM_020951chr1911524 ------
NM_020956chr1963553 3447 2938 1162 1069 1054 --41898 1820 1742 1664 13483
NM_020960chr964775 3550 3469 1756 1428 667 11895 15009 --
NM_020962chr1521832 874 ----171
NM_020964chr1833751 3214 1614 1779 14002 1636
NM_020977chr442061 1527 409 25 ------
NM_020983chr1232284 78 60 --1141 --
NM_020987chr1011268 ------
NM_020988chr161159 --1829 --
NM_020993chr1242623 1144 1056 186 --1726 --
NM_021007chr21407 ------
NM_021012chr1742907 2310 2214 588 22931 2730 23012 1023 --
NM_021020chr813133 161 22477 2285 --
NM_021033chr1311302 ------
NM_021064chr621354 622 ------
NM_021069chr42428 165 ------
NM_021072chr52436 126 ------
NM_021076chr22--1559 ----
NM_021079chr1753275 1063 247 215 199 --12103 --
NM_021090chr2223980 785 21557 85 --11723
NM_021103chr2148 ------
NM_021109chrX1121 ------
NM_021109chrX1121 ------
NM_021116chr798303 6774 6590 5671 3625 2368 2298 1654 1054 58481 7984 7974 773 224 25613 3124 16148
NM_021120chrX31978 1270 232 --43067 3062 3057 3052 --
NM_021155chr1932712 990 769 ------
NM_021158chr202844 142 ------
NM_021191chr121299 ------
NM_021240chr93627 119 42 ------
NM_021242chrX2686 290 ------
NM_021260chr142336 95 ------
NM_021574chr2232037 1818 444 ------
NM_021627chr3----1206 --
NM_021629chr321054 67 --13868 --
NM_021643chr221767 1553 ------
NM_021647chr454776 3315 1630 1236 1109 13719 ----
NM_021648chr642048 731 423 176 12430 ----
NM_021729chr11----1298 --
NM_021809chr2052075 2062 1958 520 376 ------
NM_021913chr191322 21703 166 ----
NM_021914chr1411610 ------
NM_021935chr31992 ------
NM_021940chr62504 140 ------
NM_021945chr633340 2797 2200 1831 ----
NM_021947chr17------1953
NM_021954chr132162 30 ------
NM_021956chr61121 191 ----
NM_021961chr1136963 6125 201 ------
NM_021962chr1732289 402 251 32265 1759 669 12308 --
NM_021964chr312051 ------
NM_021965chr911340 ------
NM_021999chr13--1616 ----
NM_022037chr21768 ------
NM_022041chr162895 97 --11715 --
NM_022048chr1535899 625 537 1544 11603 --
NM_022051chr11169 ------
NM_022060chr141908 ------
NM_022080chr2072735 2581 2574 1099 869 384 156 ------
NM_022090chr51521 ------
NM_022114chr184562 4172 3658 2990 1563 1544 1157 613 24391 2955 ----
NM_022133chr8--1274 ----
NM_022137chr1421540 425 2747 102 11474 --
NM_022143chr721266 521 ------
NM_022157chr1128 ------
NM_022173chr21768 ------
NM_022336chr22928 65 ------
NM_022337chr111648 ------
NM_022343chr91989 --21002 79 --
NM_022346chr411210 --1121 --
NM_022369chr152387 35 ------
NM_022450chr16----127 --
NM_022456chr1247456 6553 1166 167 12078 ----
NM_022459chr1324093 2460 11625 --11554
NM_022465chr1222323 2183 ------
NM_022469chr162756 2534 2076 1023 523 220 ------
NM_022474chr142968 442 ------
NM_022497chr342879 2548 1196 412 1513 ----
NM_022557chr171187 ------
NM_022572chr221592 1467 ------
NM_022574chr722091 295 --1747 --
NM_022648chr264513 4468 4331 3367 3042 574 24535 3569 1556 --
NM_022650chr5--1193 ----
NM_022716chr132349 916 517 ------
NM_022719chr2293286 3198 2592 2415 1411 1253 589 394 176 --1146 --
NM_022726chr611787 ------
NM_022737chr1961083 1042 1025 310 297 52 ------
NM_022744chr1631044 901 273 ------
NM_022763chr321253 417 ------
NM_022780chr221618 519 --11623 --
NM_022781chr933297 2706 201 ------
NM_022829chr20--1619 ----
NM_022831chr121600 630 ------
NM_022832chr422514 131 --1627 --
NM_022836chr12540 175 ------
NM_022838chrX1264 ------
NM_022844chr161958 ------
NM_022898chr1423392 81 1217 ----
NM_022910chr1621810 1310 ------
NM_022912chr221904 955 23000 2930 ----
NM_022917chr91410 ------
NM_022965chr431405 1194 624 ----1235
NM_023009chr1297 45 ------
NM_023010chrX----1112 --
NM_023067chr33928 208 146 ----1436
NM_023076chr1642737 2505 803 315 ------
NM_023925chr121230 ------
NM_023927chr51332 --11152 --
NM_023929chr821045 121 ------
NM_024007chr51395 22316 2147 ----
NM_024016chr171675 1326 ----
NM_024034chr203987 183 44 ------
NM_024050chr191608 ------
NM_024082chrX2364 80 ------
NM_024085chr24960 817 365 130 11028 1858 --
NM_024090chr41403 ------
NM_024293chr21185 1825 ----
NM_024336chr16--1106 ----
NM_024345chr955086 4623 4597 4363 241 ------
NM_024411chr20--1541 ----
NM_024520chr2143 ------
NM_024522chr11116 11924 ----
NM_024524chr31719 ------
NM_024539chrX--1948 ----
NM_024545chr21123 ------
NM_024551chr1211019 12352 ----
NM_024551chr1211019 12352 ----
NM_024565chr521517 131 ------
NM_024567chr81668 --2581 532 --
NM_024582chr41980 ------
NM_024595chr11425 --1217 --
NM_024607chr864304 4233 1288 742 496 266 2257 63 1468 --
NM_024659chr21962 ------
NM_024665chr314542 23503 3021 1234 --
NM_024674chr121299 674 ------
NM_024698chr1121205 1132 ------
NM_024704chr20--1739 ----
NM_024721chr82729 22 ----11641
NM_024742chr1651735 1649 1534 1445 1341 --184 --
NM_024755chr152303 275 ------
NM_024761chr934391 920 542 22062 534 11673 23353 1923
NM_024779chr121411 ------
NM_024834chr101384 ------
NM_024859chrX21074 337 --1813 --
NM_024874chr131403 1094 182 --1365 --
NM_024877chr19----2290 171 11073
NM_024911chr11117 ------
NM_024915chr862392 1818 1774 1147 758 127 1600 11881 12234
NM_024923chr331251 1176 907 147 ----
NM_024930chr532096 1947 1028 ------
NM_024939chr162631 300 11373 ----
NM_024940chr8----1404 --
NM_024944chr2111294 --1185 --
NM_024947chr346574 6434 2382 1136 ------
NM_024949chr444542 4097 543 431 13572 23126 400 --
NM_024969chr2--1334 ----
NM_024989chr227380 922 26542 270 --15460
NM_024991chr1011009 ----1613
NM_025058chr12707 135 ------
NM_025074chr422793 1062 ------
NM_025090chr1721240 129 11116 11494 174
NM_025113chr1311301 ------
NM_025125chr1021623 279 ------
NM_025146chr31975 --11084 --
NM_025151chr832019 442 223 11635 ----
NM_025160chr121278 255 13949 ----
NM_025164chr1122046 148 ------
NM_025179chr154093 3987 3244 1878 1250 ------
NM_025181chr21196 ------
NM_025191chr12813 167 ------
NM_025195chr81189 ----11517
NM_025202chr22138 126 1780 134 --
NM_025204chr2251014 967 839 379 369 1926 ----
NM_025211chr9------178
NM_025222chr332488 1855 619 12950 ----
NM_025224chr2072116 1670 748 691 510 492 49 ------
NM_025238chr1511014 ------
NM_025250chr772911 2052 1986 950 777 425 50 1543 22225 101 --
NM_025263chr62614 146 1630 ----
NM_030594chr1531351 1277 1183 ------
NM_030621chr1431494 1183 422 --11170 --
NM_030625chr101726 ------
NM_030627chr511642 11250 ----
NM_030629chr1641908 1628 346 108 ------
NM_030647chr735594 2316 156 11890 ----
NM_030648chr421439 98 ------
NM_030661chr71504 1475 11110 11188
NM_030665chr1731127 985 426 --21005 998 --
NM_030670chr1221958 317 ------
NM_030671chr1221958 317 ------
NM_030751chr102551 96 11281 ----
NM_030751chr102551 96 11281 ----
NM_030755chr141234 ------
NM_030805chr221105 227 --1337 1819
NM_030806chr178958 7578 7029 6697 6240 1772 583 --12759 --
NM_030915chr231970 1638 713 ------
NM_030918chr125114 1334 --14784 177
NM_030920chr1--11871 ----
NM_030934chr121420 1289 ------
NM_030939chr6------1197
NM_030940chr9--11431 ----
NM_030958chr8168 ------
NM_030981chr1131067 1042 761 --1237 --
NM_031268chr16164753 4628 4342 4193 3683 3312 2108 1894 1727 918 630 447 400 269 254 235 11134 1515 --
NM_031305chr4--11917 1515 --
NM_031314chr1421951 461 ------
NM_031369chr42855 797 ------
NM_031370chr42855 797 ------
NM_031407chrX1125 ------
NM_031411chr551699 1465 776 659 323 ------
NM_031417chr1932466 2174 1085 12028 1208 --
NM_031442chrX----12947 --
NM_031453chr10--12262 ----
NM_031459chr111347 11455 11396 --
NM_031468chr747756 7159 5750 753 26339 2419 155 --
NM_031483chr2022416 1134 ------
NM_031845chr222770 617 ------
NM_031847chr222770 617 ------
NM_031849chr551699 1465 776 659 323 ------
NM_031857chr551699 1465 776 659 323 ------
NM_031860chr551699 1465 776 659 323 ------
NM_031882chr52111 32 ------
NM_031890chr2262604 2440 2264 2067 789 374 ------
NM_031892chrX3841 810 642 ------
NM_031953chr41170 ------
NM_032012chr943898 3443 2088 66 --189 --
NM_032041chr842477 563 163 116 ------
NM_032042chr522798 123 --1202 --
NM_032052chr222442 398 ------
NM_032088chr521625 1609 ------
NM_032092chr521625 1609 ------
NM_032105chr157647 7343 5874 1328 421 ------
NM_032116chr1365860 5663 4089 923 805 358 ------
NM_032127chr111169 ------
NM_032144chr231413 392 275 ------
NM_032156chr121230 ------
NM_032174chr12506 248 ------
NM_032186chr111149 ------
NM_032193chr1131788 1381 1338 ------
NM_032199chr1011012 ------
NM_032208chr223311 2708 1458 12883 --
NM_032228chr11--1312 ----
NM_032229chr132731 35 ------
NM_032231chr151309 ------
NM_032242chr392917 2821 2751 2681 2601 2558 2502 2438 687 12614 1759 --
NM_032271chr1651320 445 404 370 21 ------
NM_032283chr13426 317 288 1662 1165 --
NM_032288chr32501 349 ----12254
NM_032316chr352356 1928 1833 163 37 188 ----
NM_032352chr14--11259 ----
NM_032373chr1015365 1623 1268 --
NM_032379chr111359 ------
NM_032403chr521625 1609 ------
NM_032420chr52748 707 ------
NM_032421chr732055 1957 1327 ------
NM_032430chr192446 50 --1154 --
NM_032434chr231206 110 63 ------
NM_032435chr13590 104 89 ------
NM_032445chr15--22590 2408 ----
NM_032451chr161834 11008 --174
NM_032452chr1441034 482 132 89 ------
NM_032457chr412667 ------
NM_032466chr831583 507 70 --11394 --
NM_032468chr831583 507 70 --11394 --
NM_032491chr122842 281 --1972 --
NM_032505chr31422 ------
NM_032521chr20------1343
NM_032538chr622290 1934 12534 12567 --
NM_032547chr421333 333 ------
NM_032552chr92736 141 ----11933
NM_032557chr41841 ------
NM_032558chr911296 ------
NM_032574chr2--1211 ----
NM_032578chr1031439 1415 22 --1191 11375
NM_032596chr9----1124 --
NM_032663chr1212054 11527 --11866
NM_032682chr322581 2245 1230 ----
NM_032711chr17103431 1653 1359 1257 1168 1155 1056 677 294 191 ----1582
NM_032725chr11281 33 ------
NM_032727chr101327 ------
NM_032728chr91898 --1372 --
NM_032796chrX--1584 ----
NM_032804chr1022437 61 1438 ----
NM_032827chr211127 ------
NM_032840chr121159 ------
NM_032859chr1321096 694 ------
NM_032869chr821884 175 ------
NM_032870chr61351 ------
NM_032873chr11--1961 ----
NM_032875chr172781 320 ------
NM_032932chr1756116 6006 1493 189 183 35856 685 139 15358 2216 158
NM_032943chr111359 ------
NM_032947chr51328 --3790 126 43 --
NM_032961chr41547 ------
NM_032983chr742158 952 775 419 ------
NM_032998chr11408 ------
NM_032999chr73820 765 74 ------
NM_033000chr73820 765 74 ------
NM_033001chr73820 765 74 ------
NM_033012chr13--1750 ----
NM_033020chr113337 --12935 --
NM_033027chr321085 179 ------
NM_033044chr111087 ------
NM_033083chr343390 2410 2213 858 ------
NM_033105chr82453 93 ------
NM_033132chr1311515 ------
NM_033133chr1751383 1281 1256 1092 867 13571 ----
NM_033136chr521840 608 ------
NM_033137chr521840 608 ------
NM_033138chr71238 ------
NM_033139chr71238 ------
NM_033140chr71238 ------
NM_033157chr71238 ------
NM_033181chr613501 1930 ----
NM_033201chr1641049 372 362 326 1978 ----
NM_033215chrX--2345 52 ----
NM_033225chr811161 13172 22580 2089 --
NM_033228chr51420 ------
NM_033260chr61525 ------
NM_033285chr821310 166 1708 11725 --
NM_033300chr121179 23 ------
NM_033309chr16--1181 --171
NM_033310chr111244 ------
NM_033326chr11----1391 --
NM_033360chr1224587 2875 ------
NM_033387chr952606 2371 1882 806 130 --12008 --
NM_033425chr111162 ------
NM_033426chr14--12025 ----
NM_033449chr531402 874 667 21543 701 ----
NM_033467chr1158 --122 --
NM_033495chrX2375 289 ------
NM_033496chr10----1714 --
NM_033497chr10----1714 --
NM_033498chr10----1714 --
NM_033500chr10----1714 --
NM_033503chr1533204 845 446 23592 1238 ----
NM_033505chr266676 4748 4655 4148 2338 961 ------
NM_033515chr611363 ------
NM_033549chr511007 ------
NM_033624chr121159 ------
NM_033626chrX61651 1241 1125 738 316 101 ------
NM_033631chr163094 2482 1570 1397 554 138 ------
NM_033632chr411119 ------
NM_033642chrX--11193 ----
NM_044472chr11526 ------
NM_052827chr121870 ------
NM_052840chr1541504 1019 539 187 ------
NM_052845chr1272974 2917 2505 2168 1304 470 49 --2338 301 --
NM_052879chr1223813 1435 ----13077
NM_052896chr11979 --1204 --
NM_052900chr81319 ------
NM_052901chr93562 402 113 ----1391
NM_052905chr21374 ------
NM_052906chr22104894 4821 4148 3671 3180 1386 771 681 653 268 ------
NM_052911chr181976 ------
NM_052918chr1041433 1205 1127 470 23138 354 ----
NM_052950chr131702 --1253 --
NM_052968chr111565 1119 ----
NM_053002chr31408 ------
NM_053016chr947344 5620 2782 426 --17845 --
NM_053024chr311284 ------
NM_053067chr91101 ------
NM_053280chr11----1195 --
NM_054013chr53833 347 224 ----1625
NM_054027chr521695 1640 1760 1347 --
NM_054033chr21610 ------
NM_057161chr61140 ------
NM_057749chr8193 ------
NM_058237chr141891 ------
NM_079421chr19----1364 --
NM_080415chr17187 ------
NM_080491chr1143887 1411 671 215 ------
NM_080552chr201623 ------
NM_080605chr151642 1303 560 293 250 --1179 --
NM_080626chr121125 1293 ----
NM_080632chrX----1112 --
NM_080645chr621699 587 --11620 --
NM_080676chr2033235 908 68 ------
NM_080677chr17----1111 --
NM_080738chr141956 1826 1681 1511 --1621 --
NM_080792chr2041867 1467 780 66 ------
NM_080867chr1423849 3232 1235 ----
NM_080881chr5----2790 76 --
NM_100264chr101574 ------
NM_100486chr101574 ------
NM_130391chr922705 536 ------
NM_130392chr922705 536 ------
NM_130393chr922705 536 ------
NM_130436chr2142556 2322 1094 785 12482 ----
NM_130438chr2133133 2899 1362 13059 ----
NM_130442chr721169 112 ------
NM_130459chr921684 178 --11090 --
NM_130766chr172831 782 --1367 --
NM_130797chr721657 1303 11265 ----
NM_130811chr201923 ------
NM_130838chr1521816 161 21780 592 ----
NM_130839chr1521816 161 21780 592 ----
NM_133170chr2078099 8072 7886 1509 664 184 43 1346 ----
NM_133177chr131079 1018 259 ------
NM_133178chr131079 1018 259 ------
NM_133264chr1723013 276 ------
NM_133265chrX13322 22712 450 ----
NM_133330chr453234 2968 2626 2444 458 ------
NM_133331chr453234 2968 2626 2444 458 ------
NM_133334chr476053 5811 5198 4665 2124 1278 884 14979 ----
NM_133335chr453234 2968 2626 2444 458 ------
NM_133372chr512091 ------
NM_133433chr51877 ------
NM_133445chr923303 242 ------
NM_133452chr19--1847 1289 --
NM_133489chr121283 ------
NM_133496chr134172 3190 495 ------
NM_133499chrX2884 812 --1855 --
NM_133625chr331355 550 276 ------
NM_133634chr2141679 1512 419 157 ----11748
NM_134268chr1741195 1089 1077 1029 11142 ----
NM_134421chr22703 684 --146 --
NM_134428chr91108 ------
NM_134440chr19--1144 ----
NM_138270chrX12393 12681 ----
NM_138286chr1913262 11506 13292 --
NM_138356chr153726 68 45 1554 ----
NM_138373chr1911318 --1685 --
NM_138375chr1821054 944 ------
NM_138415chr2261631 1597 1510 701 351 190 ------
NM_138426chr71354 11743 ----
NM_138441chr6188 ------
NM_138459chr6--12563 ----
NM_138473chr1244944 4906 4523 3966 ------
NM_138576chr1423392 81 1217 ----
NM_138615chr3123 ------
NM_138619chr172632 162 ------
NM_138638chr1411610 ------
NM_138713chr1635735 1633 455 1706 13086 --
NM_138714chr1635735 1633 455 1706 13086 --
NM_138729chr1134 ------
NM_138730chr6--2320 297 ----
NM_138731chr1423709 1122 ------
NM_138782chr511982 ------
NM_138795chr121543 574 ------
NM_138931chr311008 ------
NM_139015chr1231606 1360 1338 --1121 --
NM_139035chrX2726 520 ------
NM_139062chr171102 ----175
NM_139071chr12155 ------
NM_139135chr12113 29 ------
NM_139136chr121432 ------
NM_139156chr13836 661 74 ------
NM_139168chr51676 1230 ----
NM_139170chr163545 486 232 ------
NM_139207chr12----1406 --
NM_139244chr61902 ------
NM_139280chr1721017 996 11396 ----
NM_139283chr1222562 2501 ------
NM_139312chr1021270 1136 ------
NM_139316chr731071 832 248 1741 ----
NM_139321chr2053154 3144 1372 1072 179 24179 347 191 --
NM_139323chr20----1801 --
NM_144498chr2022158 822 --1189 --
NM_144568chr143674 222 23 ------
NM_144571chr425719 5630 ------
NM_144579chr212700 135 22541 2021 --
NM_144580chr1----148 --
NM_144582chr211759 21709 984 ----
NM_144586chr231158 1049 123 1142 1868 --
NM_144599chr1554680 4576 4006 3852 59 ------
NM_144604chr16190 ------
NM_144607chr1741928 738 133 60 ------
NM_144618chr111440 1154 ----
NM_144635chr33350 259 63 ------
NM_144658chrX------161
NM_144728chr1--1326 ----
NM_144729chr1--1326 ----
NM_144778chr131244 ------
NM_144949chr232405 419 264 ------
NM_144976chr192442 139 ------
NM_144981chr11--173 ----
NM_144994chr22122 54 ------
NM_145013chr1142167 1033 842 28 2666 130 1538 --
NM_145036chr17----141 --
NM_145040chr11128 ------
NM_145065chr1141127 1078 706 286 1865 2136 27 --
NM_145112chr1421116 946 ------
NM_145113chr1421388 1218 192 ----
NM_145117chr1132499 608 257 --1484 --
NM_145159chr144840 726 681 239 ------
NM_145171chr14122 ------
NM_145203chr131104 ------
NM_145279chr131826 1800 1763 ------
NM_145285chr10------1748
NM_145330chr21185 ------
NM_145331chr6--1528 ----
NM_145341chr101435 ------
NM_145649chr621749 430 ------
NM_145655chr621749 430 ------
NM_145686chr232711 827 112 ------
NM_145687chr232711 827 112 ------
NM_145690chr81443 ------
NM_145716chr11516 ------
NM_145727chr61119 --1468 --
NM_145730chr223934 233 204 --1296 --
NM_145861chr141956 1826 1681 1511 --1621 --
NM_145891chr1611599 ----1643
NM_145892chr1611599 ----1643
NM_145912chr2264070 3491 1374 1055 953 435 ------
NM_147147chr611535 --13873 --
NM_147168chr9----1124 --
NM_147175chrX21999 1433 ------
NM_147189chr821432 38 ------
NM_147202chr952635 2607 2175 1719 1672 ----12682
NM_148174chr811458 ------
NM_148894chr41824 ------
NM_148898chr7--1711 ----
NM_148899chr7--1711 ----
NM_152227chr201751 ------
NM_152253chr2253451 2680 1664 496 418 ----14043
NM_152261chr1232278 1986 115 ------
NM_152280chr132974 2724 514 ------
NM_152287chr1642667 933 467 53 --1811 --
NM_152345chr171464 1714 ----
NM_152346chr173784 109 37 ------
NM_152380chr11107 ------
NM_152402chr4197 ------
NM_152409chr51450 --12526 --
NM_152410chr6----1464 --
NM_152414chr811552 --11199 11205
NM_152470chr1844162 3084 1391 1325 13501 33313 2765 1043 --
NM_152523chr21297 ------
NM_152557chr721197 52 ------
NM_152594chr1512134 ------
NM_152609chr11474 ------
NM_152622chr512813 ------
NM_152629chr92739 679 ------
NM_152641chr1232528 1026 228 ------
NM_152653chr3--2554 35 ----
NM_152663chr1189 --1325 --
NM_152666chr11169 ------
NM_152703chr71804 ------
NM_152716chr1111570 ------
NM_152733chr686460 5329 4259 4137 2099 1497 1001 909 1627 26369 4601 --
NM_152735chr621009 680 ------
NM_152739chr71276 ------
NM_152745chr711029 ------
NM_152749chr71462 --1975 --
NM_152758chr822959 2676 12696 ----
NM_152787chrX43855 3405 934 446 ------
NM_152793chr744104 3558 1580 1495 13278 ----
NM_152835chr112527 ------
NM_152836chr8--1274 ----
NM_152837chr8--1274 ----
NM_152838chr20144 ------
NM_152857chr62874 57 ------
NM_152858chr62874 57 ------
NM_152860chr1221402 948 11238 ----
NM_152862chr2----1164 --
NM_152879chr272477 673 521 409 386 356 296 ----12427
NM_152896chr9----1771 --
NM_152910chr131177 1392 ----
NM_152914chr1764330 3343 2729 1607 952 133 --13250 --
NM_152919chr1922862 236 --11191 --
NM_152924chr1566659 6359 6350 2018 967 873 --1930 --
NM_152996chr111410 ------
NM_153013chr532377 2361 2058 ------
NM_153015chr82985 791 ------
NM_153020chr611082 11668 ----
NM_153035chr112818 --1104 --
NM_153050chr2223980 785 21557 85 --11723
NM_153051chr2223980 785 21557 85 --11723
NM_153188chr555503 4446 2047 1509 1207 11189 ----
NM_153211chr181112 ------
NM_153223chr511451 ------
NM_153261chr1621111 1097 ------
NM_153273chr362798 2409 1879 893 472 71 12368 1851 --
NM_153321chr171971 ------
NM_153322chr171971 ------
NM_153350chr1651568 1155 672 385 265 ------
NM_153354chr5156 ------
NM_153367chr1053805 3728 1403 1036 64 195 ----
NM_153374chr151399 ------
NM_153426chr4188 ------
NM_153427chr4188 ------
NM_153437chr9182 ------
NM_153453chr621008 66 ------
NM_153464chr191266 ------
NM_153499chr1242266 2188 779 591 12717 ----
NM_153500chr1242266 2188 779 591 12717 ----
NM_153607chr5--1571 --12832
NM_153619chr1532727 1281 354 12524 ----
NM_153631chr71504 1475 11110 11188
NM_153632chr71504 1475 11110 11188
NM_153649chr122040 491 ------
NM_153685chr1231143 383 82 ------
NM_153690chr3------1802
NM_153712chr222587 1020 13459 --1504
NM_153715chr721287 90 1147 21243 472 --
NM_153748chr121432 ------
NM_153810chr1054416 3335 1128 834 599 13379 ----
NM_153819chr11--1216 ----
NM_153827chr171211 ------
NM_153832chr12292 71 ------
NM_153836chr2--1451 ----
NM_170663chr171211 ------
NM_170665chr1234563 2944 984 13922 23447 1435 11637
NM_170674chr1531282 928 429 ------
NM_170675chr152958 105 ------
NM_170676chr152958 105 ------
NM_170677chr1531282 928 429 ------
NM_170695chr18--1314 ----
NM_170712chr31115 --157 --
NM_170713chr31115 --157 --
NM_170714chr31115 --157 --
NM_170721chr1731279 935 446 ------
NM_170731chr1122601 943 ------
NM_170732chr1122601 943 ------
NM_170733chr1122601 943 ------
NM_170734chr1122601 943 ------
NM_170735chr1122601 943 ------
NM_170751chr611452 ------
NM_170752chr611452 ------
NM_171825chr563218 3098 3016 2790 2476 557 --132 --
NM_171998chrX21810 178 ------
NM_171999chr181563 ------
NM_172037chr811046 ------
NM_172071chr136961 1639 1240 ------
NM_172159chr332216 1697 49 1164 ----
NM_172160chr332216 1697 49 1164 ----
NM_172169chr1031323 601 450 ------
NM_172170chr1031323 601 450 ------
NM_172171chr1031323 601 450 ------
NM_172173chr1031323 601 450 ------
NM_172216chr1242168 2090 681 493 12619 ----
NM_172226chr1242266 2188 779 591 12717 ----
NM_172315chr1531282 928 429 ------
NM_172316chr1531282 928 429 ------
NM_172387chr1831491 1425 1358 1270 ----
NM_172388chr1831538 1472 1405 1317 ----
NM_172389chr1831538 1472 1405 1317 ----
NM_173076chr21999 ------
NM_173078chrX--1450 ----
NM_173156chr1--22201 298 11419 --
NM_173171chr2----187 --
NM_173172chr2----1395 --
NM_173173chr2----187 --
NM_173198chr922438 729 12380 ----
NM_173200chr922438 729 12380 ----
NM_173201chr163304 93 59 1277 ----
NM_173207chr18--1314 ----
NM_173208chr18--1314 ----
NM_173209chr18--1314 ----
NM_173210chr18--1314 ----
NM_173211chr18--1314 ----
NM_173214chr1635735 1633 455 1706 13086 --
NM_173354chr2141949 1565 319 281 --11559 --
NM_173465chr53666 334 36 11040 --1888
NM_173468chr435872 5028 2137 15738 ----
NM_173470chrX22070 387 12689 ----
NM_173491chr521430 1124 ------
NM_173505chr182879 854 1157 ----
NM_173511chr233810 92 75 ----11029
NM_173546chr31566 ------
NM_173552chr312461 ------
NM_173560chr6--2531 53 ----
NM_173561chr611034 --192 --
NM_173595chr1254740 4539 2014 1027 1002 ------
NM_173602chr1213656 ------
NM_173607chr1412100 ------
NM_173630chr182215 69 ------
NM_173642chr177976 7643 6430 6121 2400 2276 243 22529 2102 ----
NM_173809chr1021473 1033 ------
NM_173832chr863510 3388 3319 588 577 119 103648 2896 1345 1320 1270 1245 1195 1170 1145 1074 32748 2487 103 21295 1220
NM_173848chr81851 ------
NM_173851chr821425 212 ------
NM_174886chr18--1314 ----
NM_174911chr841006 919 492 159 12442 1958 --
NM_174937chr10----1607 --
NM_174963chr11890 --2235 146 --
NM_174964chr11890 --2235 146 --
NM_174965chr11909 --2254 165 --
NM_174966chr11890 --2235 146 --
NM_174967chr11909 --2254 165 --
NM_174968chr11890 --2235 146 --
NM_174969chr11890 --2235 146 --
NM_174970chr11909 --2254 165 --
NM_174971chr11890 --2235 146 --
NM_175061chr712054 ------
NM_175607chr311532 ------
NM_175610chr15----11271 --
NM_175612chr311532 ------
NM_175623chr1247456 6553 1166 167 12078 ----
NM_175630chr2153 ------
NM_175733chr1122127 506 --11937 --
NM_175736chr1235688 1764 94 17677 2497 488 --
NM_175767chr51631 1360 ----
NM_175848chr2021362 101 1117 ----
NM_175848chr2021362 101 1117 ----
NM_175849chr2021362 101 1117 ----
NM_175849chr2021362 101 1117 ----
NM_175850chr2021362 101 1117 ----
NM_175850chr2021362 101 1117 ----
NM_175854chr1312518 12130 11074 --
NM_175863chr6--1493 ----
NM_175876chr122756 1986 ----11799
NM_175884chr71401 ------
NM_175898chr151244 --11471 --
NM_175902chr171216 ----1240
NM_175907chr18--21902 924 ----
NM_175913chr2021016 893 1837 ----
NM_175931chr1631889 1761 38 11519 2590 75 --
NM_176783chr14197 ------
NM_177398chr111600 ------
NM_177399chr111600 ------
NM_177438chr1431494 1183 422 --11170 --
NM_177524chr71771 ------
NM_177525chr71771 ------
NM_177539chr1138 ------
NM_177553chr111684 ------
NM_177559chr2031178 418 108 --1803 --
NM_177560chr2031178 418 108 --1803 --
NM_177949chrX1250 ------
NM_177972chr1174451 4171 4117 2824 693 632 373 ------
NM_177990chr20--194 11249 --
NM_177996chr2043389 2919 2743 1311 ------
NM_177999chr983588 1327 1173 1151 975 715 466 434 --21190 439 --
NM_178009chr131140 1355 ----
NM_178011chr101521 12482 1526 --
NM_178031chr111181 ------
NM_178037chr1242897 2239 1363 952 11463 ----
NM_178038chr1242897 2239 1363 952 11463 ----
NM_178120chr21407 ------
NM_178135chr421184 235 ------
NM_178148chr6----1446 --
NM_178151chrX37742 7633 1645 15613 ----
NM_178152chrX37742 7633 1645 15613 ----
NM_178153chrX37742 7633 1645 15613 ----
NM_178313chr231972 479 361 11942 ----
NM_178314chr121814 ------
NM_178423chr71209 --11228 --
NM_178424chr51110 ------
NM_178425chr71209 --11228 --
NM_178426chr111954 ------
NM_178441chr142336 95 ------
NM_178496chr3153 ------
NM_178498chr1112494 ------
NM_178554chr372863 2742 2646 733 473 195 156 ----1741
NM_178568chr1711299 --11668 --
NM_178586chr1432144 608 75 ------
NM_178830chr192251 234 ------
NM_178839chr2194 ------
NM_178863chr161102 ------
NM_180976chr63951 752 676 ------
NM_180977chr63951 752 676 ------
NM_180989chr1322439 1001 ------
NM_181050chr161139 1550 125 1518
NM_181093chr11140 ------
NM_181332chrX2639 425 2570 546 ----
NM_181349chr742067 851 841 289 166 ----
NM_181351chr1112741 1772 ----
NM_181481chr1887053 6858 5651 5624 5296 4540 2340 1886 14780 ----
NM_181482chr1887053 6858 5651 5624 5296 4540 2340 1886 14780 ----
NM_181483chr1887053 6858 5651 5624 5296 4540 2340 1886 14780 ----
NM_181492chr221978 147 1875 --
NM_181504chr523470 2902 ----1464
NM_181521chr1666568 2686 2260 297 209 37 11489 ----
NM_181523chr523470 2902 ----1464
NM_181524chr523470 2902 ----1464
NM_181527chr201321 ------
NM_181528chr201376 ------
NM_181552chr71387 ------
NM_181644chr131327 1258 462 ----11523
NM_181659chr2053401 3099 2195 1095 213 ------
NM_181659chr2053401 3099 2195 1095 213 ------
NM_181672chrX11809 ----11468
NM_181673chrX11809 ----11468
NM_181701chr952077 1706 1693 741 58 --1702 --
NM_181704chr21147 1187 ----
NM_181714chr61355 ------
NM_181741chr21144 ------
NM_181742chr21144 ------
NM_181782chr622219 1544 ------
NM_181838chr51446 1118 ----
NM_181839chr851332 1302 1288 478 161 --1108 --
NM_181844chr1712023 ------
NM_181886chr411299 ------
NM_181887chr411299 ------
NM_181888chr411299 ------
NM_181889chr411299 ------
NM_181890chr411299 ------
NM_181891chr411299 ------
NM_181892chr411346 ------
NM_181893chr411299 ------
NM_182314chrX21597 1562 ------
NM_182484chr21147 1187 ----
NM_182485chr4--11032 ----
NM_182488chr131361 ------
NM_182511chr1811052 ------
NM_182540chrX2702 40 ------
NM_182580chr12691 572 --12038 11689
NM_182641chr1711829 ------
NM_182645chr621008 66 ------
NM_182646chr4--11032 ----
NM_182663chr131919 360 131 11698 2197 180 --
NM_182664chr132049 490 261 11828 2327 310 --
NM_182665chr131919 360 131 11698 2197 180 --
NM_182666chr31677 ------
NM_182678chr2153 ------
NM_182685chr11711 --2598 581 1292
NM_182687chr16----1205 --
NM_182715chr71154 ------
NM_182757chr642867 768 571 116 ----1639
NM_182760chr33940 725 40 ------
NM_182763chr121932 1725 --12700 --
NM_182765chr1021884 58 ------
NM_182894chr1421773 422 1560 ----
NM_182898chr734612 1741 453 14240 11713 --
NM_182899chr734612 1741 453 14240 11713 --
NM_182915chr262062 2043 1696 841 598 375 --11638 --
NM_182918chr21----11128 --
NM_182948chr132252 203 147 ------
NM_182964chr1132499 608 257 --1484 --
NM_182970chr2074072 3860 3768 3547 3390 1310 786 ------
NM_182972chr142191 2118 1735 278 --12459 --
NM_182976chr11786 ------
NM_183004chr1423006 706 ------
NM_183049chr41121 ------
NM_183061chr3137 ------
NM_183078chr633830 2875 583 ----12659
NM_183234chr15--11731 ----
NM_183235chr15--11731 ----
NM_183236chr15--11731 ----
NM_183353chrX1945 ------
NM_183373chr62659 64 ------
NM_183377chr171839 --1195 --
NM_183416chr121905 1660 ------
NM_183419chr8142 ------
NM_183422chr131296 11021 ----
NM_183425chr2051561 1530 1461 1186 419 3697 259 34 1213 --
NM_194071chr754906 4881 3905 860 442 1198 14676 11910
NM_194247chr221650 817 11659 ----
NM_194259chr16----1444 --
NM_194260chr16----1444 --
NM_194261chr16----1444 --
NM_194278chr1452902 1044 997 698 138 ----1193
NM_194282chr421142 972 11067 11230 --
NM_194285chr1132662 1127 746 ------
NM_194313chr92443 47 ------
NM_194328chr933297 2706 201 ------
NM_194329chr933297 2706 201 ------
NM_194330chr933297 2706 201 ------
NM_194332chr933297 2706 201 ------
NM_194434chr1841983 1550 1054 635 --1896 --
NM_194463chrX--1948 ----
NM_198040chr1----11109 --
NM_198077chr11496 ------
NM_198123chr81319 ------
NM_198124chr81319 ------
NM_198181chr1532684 1109 796 ------
NM_198195chr3--1546 ----
NM_198217chr13--146 ----
NM_198218chr13--146 ----
NM_198219chr13--146 ----
NM_198236chr111002 ------
NM_198243chr152768 101 --1610 --
NM_198270chrX21172 791 ----13390
NM_198279chrX11154 ------
NM_198321chr532014 1254 1126 ------
NM_198336chr72377 137 ------
NM_198390chr1641908 1628 346 108 ------
NM_198391chr201349 ------
NM_198446chr1----147 --
NM_198504chr31341 ------
NM_198513chr811737 1614 ----
NM_198530chr171460 ------
NM_198549chr133288 2585 1197 ------
NM_198570chr71345 ------
NM_198581chr255988 5755 5127 1496 733 ------
NM_198715chr166295 5366 5321 4074 744 406 ------
NM_198829chr711335 ------
NM_198830chr171701 ------
NM_198880chr31631 ------
NM_198900chr1235688 1764 94 17677 2497 488 --
NM_198903chr51206 ------
NM_198904chr521427 206 ------
NM_198935chr205732 534 500 326 215 ------
NM_199003chr811155 ------
NM_199040chr1233691 2680 233 ------
NM_199076chr1061243 1218 1195 1087 502 415 ------
NM_199129chr201417 ------
NM_199160chr931670 1291 780 --12056 --
NM_199168chr10--1237 ----
NM_199169chr2023080 240 ------
NM_199170chr2023080 240 ------
NM_199171chr2023080 240 ------
NM_199185chr51112 ------
NM_199188chr1223813 1435 ----13077
NM_199190chr1223813 1435 ----13077
NM_199359chr2031245 974 231 --11375 --
NM_199360chr2031245 974 231 --11375 --
NM_199361chr2031245 974 231 --11375 --
NM_199362chr2031245 974 231 --11375 --
NM_199363chr2031245 974 231 --11375 --
NM_199413chr154792 705 38 27 ------
NM_199421chr1423849 3232 1235 ----
NM_199454chr184562 4172 3658 2990 1563 1544 1157 613 24391 2955 ----
NM_199482chr21582 ------
NM_199487chr202875 369 ------
NM_201269chr111149 ------
NM_201278chr1132274 914 352 1362 ----
NM_201281chr1132274 914 352 1362 ----
NM_201403chr131826 1800 1763 ------
NM_201428chr1121588 1482 ------
NM_201429chr1121588 1482 ------
NM_201430chr1121514 1408 ------
NM_201432chr1766079 6062 5360 5009 4945 2568 35994 4972 927 36319 4519 250 --
NM_201433chr1766079 6062 5360 5009 4945 2568 35994 4972 927 36319 4519 250 --
NM_201437chr821367 956 ------
NM_201567chr351524 663 257 232 94 ------
NM_201568chr1--22201 298 11419 --
NM_201569chr1--22201 298 11419 --
NM_201591chr411725 ------
NM_201592chr411725 ------
NM_201599chrX2977 426 ------
NM_201613chr12--1259 ----
NM_201627chr51403 ------
NM_201628chr143345 3177 1123 1090 1702 ----
NM_202002chr122610 22 1337 ----
NM_203301chr14195 ------
NM_203305chr942497 1019 890 863 1273 --1777
NM_203327chr2041039 568 428 149 --14161 23771 3709
NM_203346chr272093 888 755 620 323 241 154 --1185 --
NM_203349chr1511927 ------
NM_203350chr11145 ------
NM_203351chr1772240 1942 1818 984 282 136 98 12403 12254 --
NM_203372chr221717 508 ------
NM_203394chr1232365 824 700 11825 ----
NM_203404chr13836 661 74 ------
NM_203406chr5154 --12548 --
NM_203417chr211321 --1154 --
NM_203418chr211321 --1154 --
NM_203434chr921139 940 ------
NM_203459chr112327 --12565 --
NM_203464chr12319 69 --11159 --
NM_203487chr13152 ------
NM_203504chr42834 601 --1963 --
NM_203505chr42834 601 --1963 --
NM_203506chr1721678 862 --11989 --
NM_205768chr111750 ------
NM_205848chr142797 2590 667 93 ------
NM_206538chr1941050 1035 827 373 ------
NM_206594chr122553 1431 ------
NM_206595chr122553 1431 ------
NM_206853chr621548 620 ------
NM_206854chr611881 2552 76 ----
NM_206873chr112262 21 --1277 --
NM_206909chr828218 2282 15070 ----
NM_206914chr1212022 1200 ----
NM_206927chr111359 ------
NM_206928chr111359 ------
NM_206929chr111359 ------
NM_206930chr111359 ------
NM_207009chr101346 ------
NM_207042chr13631 594 64 ------
NM_207043chr11427 ------
NM_207044chr11427 ------
NM_207045chr13631 594 64 ------
NM_207046chr13631 594 64 ------
NM_207047chr11427 ------
NM_207304chr131131 ------
NM_207306chr133927 1771 294 ----1149
NM_207317chr51293 ------
NM_207325chr191109 ------
NM_207344chr121861 1125 11281 --
NM_207352chr43544 480 220 ------
NM_207380chr1532642 1333 984 1197 ----
NM_207390chr192724 21 ------
NM_207406chr475946 4980 4277 2615 2111 1108 1059 ------
NM_207481chr21240 ------
NM_207517chr152762 29 ------
NM_207645chr111166 ------
NM_207647chr91103 2175 55 ----
NM_212464chr1531997 788 593 ------
NM_212469chr112986 72 ------
NM_212551chr1--11134 ----
NM_213589chr245126 4265 1587 1032 1417 ----
NM_213593chr111017 ------
NM_213594chr122842 281 --1972 --
NM_213654chr3--1399 1140 --