TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3177-5p
miRNA Sequence: UGUGUACACACGUGCCAGGCGCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX23142 471 ----23212 2724
NM_000084chrX44821 2440 2149 1444 1698 12181 15258
NM_000138chr1531044 826 120 --1595 2709 469
NM_000167chrX1722 ----11816
NM_000176chr583574 1021 820 785 597 474 415 58 --22591 1381 --
NM_000214chr2041304 627 588 385 11171 ----
NM_000222chr43770 672 200 --11533 22148 743
NM_000248chr363007 2046 928 229 217 177 --11051 --
NM_000264chr963148 2906 2440 384 371 296 --23239 1028 22653 193
NM_000304chr1721024 163 139 --1218
NM_000318chr852431 2366 2100 352 74 --12317 12672
NM_000332chr667186 6463 5280 2779 870 647 26361 398 27159 5067 --
NM_000340chr31571 --11217 11169
NM_000362chr2233582 2428 781 --12534 11006
NM_000399chr101958 --1461 21070 810
NM_000459chr92746 193 1685 2880 121 1109
NM_000489chrX72706 2341 2321 1308 650 587 91 ----12683
NM_000527chr1952445 2363 2332 2174 2136 --2850 841 --
NM_000544chr6_cox_hap113339 13215 --1299
NM_000555chrX76728 5912 5613 2818 2400 1699 1547 --37857 6915 1784 16634
NM_000596chr73403 97 91 --2506 429 --
NM_000633chr1854985 4381 4305 2029 799 --23753 1569 15103
NM_000719chr1296649 6508 5872 4269 1691 1226 1207 1123 391 11253 45835 5358 2189 870 14794
NM_000724chr1051806 1716 1292 556 48 12011 --21607 770
NM_000806chr561960 1504 1438 1351 518 376 11240 1768 --
NM_000807chr44114 105 65 31 1500 --1567
NM_000809chr4138596 8523 8204 8068 6731 6616 2939 2912 2605 1944 1920 1912 1739 18227 --17432
NM_000811chr51747 ----2625 580
NM_000813chr5104832 4519 3920 3912 3434 3424 1799 1388 1341 55 ------
NM_000814chr1561559 1425 1034 194 176 132 11278 13323 184
NM_000824chr43207 199 21 1781 1661 --
NM_000831chr194639 4579 4554 4515 3992 2367 2223 2066 1940 16264 22252 1838 34605 2381 2245
NM_000859chr541681 1542 1356 1345 ----11699
NM_000875chr1566911 6840 5752 2649 1257 23 14528 --1444
NM_000891chr1723281 3148 12414 12466 23663 2875
NM_000899chr1254301 2981 834 515 35 ----11412
NM_000902chr312066 ----1229
NM_000944chr452051 1529 628 471 412 --11961 11586
NM_000958chr52931 54 ----21190 451
NM_000959chr143945 2963 2940 1304 --22720 179 --
NM_000965chr3----21220 444 1336
NM_001001331chr331767 637 508 12592 2655 341 --
NM_001001395chr1242706 943 412 292 ----2219 71
NM_001001396chr194304 4260 4210 4132 3993 3340 3293 2823 729 11163 14481 --
NM_001001481chr862693 2591 2308 714 311 149 --1854 --
NM_001001484chr1082397 2247 2226 2162 2069 2053 838 672 ------
NM_001001549chr752823 2695 1997 1974 610 ----12774
NM_001001550chr752823 2695 1997 1974 610 ----12774
NM_001001555chr752823 2695 1997 1974 610 ----12774
NM_001001664chr244007 3465 3444 1594 1879 23867 776 12967
NM_001001928chr2248311 8099 7454 7342 27355 6779 25982 5477 12057
NM_001002243chr23895 803 159 1147 --1263
NM_001002257chr243484 3059 2181 2168 1809 --1208
NM_001002258chr21105 11941 11874 11351
NM_001002860chr1454720 4621 1720 419 136 --23456 306 14505
NM_001003652chr1898606 8338 7894 7434 5359 2639 1696 910 308 17512 15327 --
NM_001003674chr1876713 6409 6397 5895 5071 4995 1719 25512 4782 16679 --
NM_001003675chr1876713 6409 6397 5895 5071 4995 1719 25512 4782 16679 --
NM_001003681chr2252102 1961 588 149 56 ----11953
NM_001003712chr12103967 3931 3536 3397 3265 3137 2498 1029 712 688 13920 11626 1280
NM_001004065chr932668 1596 1371 13971 21278 868 13087
NM_001004317chr643773 1671 332 227 11788 24436 266 --
NM_001004419chr1243660 3508 3327 832 11716 13367 34558 3188 431
NM_001005404chr1724230 3398 ----14446
NM_001005473chr546566 4817 2362 1950 ----32008 1989 1971
NM_001005474chr32590 519 ----2555 69
NM_001007088chrX21084 833 11112 --1819
NM_001007466chr6115058 4893 4818 4523 3556 3536 3428 2053 1645 1447 1356 1764 24904 4035 --
NM_001008220chr583973 3936 3304 3105 2963 1556 1524 1391 12841 --12943
NM_001008225chr71697 ----197
NM_001008738chr552949 2632 2133 266 146 --12907 42891 2869 1111 570
NM_001008925chr453471 3089 3070 2910 1058 23137 2499 11366 --
NM_001009899chr356503 6328 5326 1064 110 1738 24871 78 35753 1211 67
NM_001011513chr464036 3987 3455 3341 3043 825 ----14123
NM_001011666chr776563 6555 4936 4840 4240 372 283 26388 5110 15099 13998
NM_001011708chr252726 2221 1815 873 602 ----11934
NM_001011722chr12424 411 ----1441
NM_001011722chr12424 411 ----1441
NM_001012393chr1145182 5119 3424 1370 1416 13816 1477
NM_001012755chrX74986 4946 4935 4843 4828 3437 1973 --11732 --
NM_001012761chr562681 2043 438 319 108 97 1326 --1150
NM_001013620chr1255870 2408 1765 1292 299 17723 --25897 1440
NM_001014380chr1395868 5612 5005 4404 3940 3893 3737 2171 1980 ----14969
NM_001014797chr1077212 6486 5906 5575 5440 1453 361 37978 5548 5120 18213 38203 7562 607
NM_001015877chrX43017 2760 2212 256 12928 12313 --
NM_001017415chr15788 761 679 671 25 --1508 --
NM_001017416chr15788 761 679 671 25 --1508 --
NM_001017440chr778222 8153 7829 6339 2419 1049 47 ----18077
NM_001017969chr92575 531 ----1492
NM_001018065chr975312 4432 4230 3847 1998 919 901 11193 --15020
NM_001018066chr975312 4432 4230 3847 1998 919 901 11193 --15020
NM_001018067chr174902 4798 4521 4443 3859 1456 996 --24141 4109 --
NM_001018068chr174902 4798 4521 4443 3859 1456 996 --24141 4109 --
NM_001018069chr174902 4798 4521 4443 3859 1456 996 --24141 4109 --
NM_001018074chr583574 1021 820 785 597 474 415 58 --22591 1381 --
NM_001018075chr583574 1021 820 785 597 474 415 58 --22591 1381 --
NM_001018076chr583574 1021 820 785 597 474 415 58 --22591 1381 --
NM_001018077chr583574 1021 820 785 597 474 415 58 --22591 1381 --
NM_001020658chr171590 1543 1421 1105 1067 1056 247 --21524 278 1262
NM_001020658chr171590 1543 1421 1105 1067 1056 247 --21524 278 1262
NM_001024094chr583574 1021 820 785 597 474 415 58 --22591 1381 --
NM_001024948chr143318 3151 1053 1038 --12550 13441
NM_001025076chr1054504 4137 1315 1179 752 15392 ----
NM_001025077chr1085862 5495 5067 2673 2537 2110 686 383 16750 ----
NM_001025108chr2104090 3890 3755 3727 3697 3622 3419 3245 3175 327 1295 23660 1102 --
NM_001029858chr623383 2528 ----173
NM_001029863chr622609 426 ----23252 224
NM_001029884chr642710 2553 2462 2368 --183 1628
NM_001030055chr1484586 3875 3371 3150 1896 1565 681 79 --1742 --
NM_001031695chr2255357 5226 4514 2099 231 13832 14400 11334
NM_001031812chr562045 2000 1738 1503 887 752 --11770 --
NM_001032296chr1362673 735 492 438 428 321 1272 22273 586 --
NM_001032394chr622698 952 ----12597
NM_001032395chr622565 819 ----12464
NM_001032999chr2075312 5289 4344 4216 1903 1017 730 --34931 1818 169 --
NM_001033117chr3104546 4249 3147 3088 478 414 394 368 356 135 23839 3609 21785 385 --
NM_001033561chr172911 693 --133 2862 68
NM_001033566chr171721 --149 1259
NM_001033568chr171721 --149 1259
NM_001033578chr842347 437 154 89 ----11592
NM_001034954chr1062766 2744 2730 2371 1084 613 ----13252
NM_001034955chr1062766 2744 2730 2371 1084 613 ----13252
NM_001034956chr1062766 2744 2730 2371 1084 613 ----13252
NM_001034957chr1062766 2744 2730 2371 1084 613 ----13252
NM_001037174chr23808 472 33 ----12192
NM_001037553chr2134189 3962 681 --14455 45092 4622 4416 1681
NM_001037637chr5--1261 --1300
NM_001038702chr552532 1728 1110 1058 358 --22675 845 --
NM_001039570chr221343 ----14583
NM_001039571chr221343 ----14583
NM_001039585chr144202 3220 3197 1561 --22977 436 --
NM_001039590chrX63877 2750 2713 1571 243 191 13087 138 13252
NM_001039591chrX63877 2750 2713 1571 243 191 13087 138 13252
NM_001039618chr1184202 3999 3795 2006 1994 1980 1240 663 --25050 589 --
NM_001039693chr253756 3033 1297 797 447 ----23791 3763
NM_001039709chr2075312 5289 4344 4216 1903 1017 730 --34931 1818 169 --
NM_001039762chr101563 12059 --32328 1732 346
NM_001039840chrX55499 5129 3682 2071 234 15596 25385 1820 --
NM_001040020chr721261 113 --11428 1603
NM_001040110chr731627 1164 315 --1278 1325
NM_001040142chr251592 810 798 790 535 --2777 123 1828
NM_001040143chr251592 810 798 790 535 --2777 123 1828
NM_001040202chr452264 1969 1926 211 147 --161 12177
NM_001040214chr642205 2006 1780 721 1553 11972 --
NM_001040272chr942378 1960 1757 868 --22257 1818 --
NM_001040402chr4103117 2946 2935 1160 1108 640 544 286 278 257 ------
NM_001040429chr1353308 1366 1260 978 557 11284 12362 --
NM_001040446chr542559 2528 2410 2285 --12674 11829
NM_001040450chr1522183 522 --32423 1995 573 --
NM_001040453chr1522183 522 --32423 1995 573 --
NM_001040712chr993479 2908 2849 2835 2716 2692 1275 931 725 --12320 --
NM_001042355chr1641846 1242 1214 1155 11442 13608 15388
NM_001042404chr11414 ----2702 78
NM_001042412chr1641846 1242 1214 1155 11442 13608 15388
NM_001042473chr1012064 21611 241 --1139
NM_001042481chr1462521 2479 2351 888 207 24 --1480 --
NM_001042494chr1533722 3606 521 1880 1640 1114
NM_001042495chr1533722 3606 521 1880 1640 1114
NM_001042496chr1533722 3606 521 1880 1640 1114
NM_001042497chr1533722 3606 521 1880 1640 1114
NM_001042537chrX3918 737 623 --1153 12046
NM_001042543chr431487 628 82 1101 11598 1509
NM_001042555chr12144563 4112 3913 3834 3750 3484 3258 3238 1922 1823 924 613 211 133 --1370 --
NM_001042599chr2117741 7567 7331 6470 6375 6217 4756 3008 1336 1183 432 1802 14799 27007 5873
NM_001042603chr1294443 3641 3596 3472 3414 3356 2043 1993 789 --14072 15237
NM_001042604chr3114805 4192 4158 3953 3501 3428 1908 1757 1617 849 200 --1186 --
NM_001043318chr1444010 3848 1207 193 13429 --13983
NM_001044385chr254047 3998 3722 2835 951 --1650 181
NM_001044722chr562045 2000 1738 1503 887 752 --11770 --
NM_001044723chr562045 2000 1738 1503 887 752 --11770 --
NM_001046chr553007 2285 2016 1071 960 12396 --12278
NM_001049chr1422200 1647 --11681 12050
NM_001071775chr1341700 1387 520 78 ----1323
NM_001078chr15735 663 608 240 44 ----1263
NM_001099678chr394724 4699 4610 4434 2316 1890 1631 1539 1257 --32276 862 413 --
NM_001100108chr1138098 7668 6765 6199 6033 5968 3100 2978 2929 2578 1772 1742 1257 18063 37833 7253 6789 13201
NM_001106chr389785 9005 8581 6973 6379 6076 2985 2835 27426 1218 29184 8889 --
NM_001113490chrX103282 3253 3118 2820 2712 1229 745 450 434 378 --12526 13175
NM_001117chr1832415 1991 786 1305 12317 2476 30
NM_001121chr1031873 1757 1517 1492 1753 1683
NM_001148chr452252 2223 1704 554 547 11579 11439 --
NM_001167chrX96713 6128 5485 4774 2298 1414 678 372 286 --21311 129 --
NM_001173chr1484586 3875 3371 3150 1896 1565 681 79 --1742 --
NM_001198chr662405 1543 1506 723 670 502 ----3651 222 80
NM_001200chr20----1253 1394
NM_001201chr493912 3699 3654 3530 3339 3198 2601 1406 573 ----12763
NM_001204chr2107526 7497 5969 5895 5636 4784 2097 1834 1413 512 12960 36354 2795 2522 --
NM_001206chr933139 3042 1129 ----23133 405
NM_001207chr5--1261 --1300
NM_001237chr43174 163 58 ----11164
NM_001237chr43174 163 58 ----11164
NM_001241chr242339 2107 787 545 21977 1654 --1584
NM_001241chr242339 2107 787 545 21977 1654 --1584
NM_001244chr91125 ----11050
NM_001257chr162966 379 ----1946
NM_001332chr541091 545 457 39 11411 21126 512 --
NM_001346chr342074 1089 471 196 12468 --179
NM_001364chr11134677 4653 4419 4220 4212 3347 1720 1687 1647 1372 732 418 135 --14095 14105
NM_001401chr9----11013 11249
NM_001412chrX33449 393 378 --23458 1446 12704
NM_001427chr741977 1562 145 77 ----21803 1696
NM_001432chr473540 3520 3225 2410 768 185 178 1286 --12854
NM_001498chr62324 76 --2257 181 2875 188
NM_001543chr564839 4634 3309 3279 1036 788 13521 14062 --
NM_001616chr223491 591 --1251 1522
NM_001621chr752757 2646 2306 1070 586 ----23054 2795
NM_001621chr752757 2646 2306 1070 586 ----23054 2795
NM_001655chr1121466 496 ----22170 1452
NM_001668chr121717 284 11609 --11596
NM_001683chr331767 637 508 12592 2655 341 --
NM_001684chr194021 3977 3927 3849 3710 3057 3010 2540 446 1880 14198 --
NM_001689chr21105 11941 11874 11351
NM_001695chr81530 11295 34260 1619 1557 23477 330
NM_001730chr1361571 458 303 217 135 126 ------
NM_001730chr1361571 458 303 217 135 126 ------
NM_001753chr72432 26 ----11614
NM_001858chr674884 3892 1913 1789 1695 1651 674 --11268 11886
NM_001918chr168585 8321 8290 8264 1228 805 --33402 3184 1944 18496
NM_001920chr121620 ----1544
NM_001931chr112991 298 1335 --2913 191
NM_001949chr682911 2834 2707 2640 2630 2578 2540 276 --12349 --
NM_001969chr1463530 2408 851 766 710 82 11416 33135 679 548 --
NM_002006chr494946 4369 3859 2300 2243 852 296 191 92 --22063 1085 --
NM_002009chr1562740 2109 830 697 257 151 1202 --12595
NM_002015chr1383254 2553 1059 711 662 335 208 186 --22532 954 13272
NM_002024chrX31558 811 335 ----11691
NM_002025chrX149173 9079 8993 8308 8096 7977 7200 6079 2835 2684 2627 1795 784 188 18241 ----
NM_002040chr2143180 804 671 108 ----11097
NM_002069chr721481 544 --1516 1285
NM_002092chr475103 4010 3084 1826 1592 966 907 --34296 3905 1114 --
NM_002126chr1773439 2729 1584 1455 925 160 138 1497 24096 743 --
NM_002128chr1362448 2369 2227 1893 143 126 1277 --160
NM_002158chr283518 3508 3059 2920 2757 1278 1033 841 --13450 21445 1435
NM_002203chr5113985 3845 3817 3278 3170 2540 1317 1136 1076 676 452 --13615 --
NM_002210chr283586 2920 2868 2745 678 425 338 261 ------
NM_002214chr745223 4004 3836 2291 15126 1124 1850
NM_002232chr12304 278 ----11328
NM_002239chr24904 297 242 158 ----1442
NM_002240chr211585 ----2623 527
NM_002245chr1------2566 534
NM_002247chr1041985 1505 954 144 ----11904
NM_002270chr555191 3700 1716 1189 316 24716 2277 24850 4497 --
NM_002285chr2104090 3890 3755 3727 3697 3622 3419 3245 3175 327 1295 23660 1102 --
NM_002310chr596418 6264 4855 4761 4058 3991 1237 605 301 --24561 369 11717
NM_002336chr1285015 5000 3166 1968 664 228 159 113 ------
NM_002382chr141197 --11213 11273
NM_002397chr54842 422 232 216 --1684 --
NM_002480chr12--11325 21503 1457 1361
NM_002514chr82877 414 --21157 340 11032
NM_002545chr1145182 5119 3424 1370 1416 13816 1477
NM_002581chr984980 4954 4204 4170 3537 1809 559 246 1342 25701 3734 14968
NM_002594chr2082088 1905 1897 1879 1869 1818 1808 772 22224 1826 ----
NM_002645chr1173072 2816 2549 2272 2257 842 103 1689 1735 --
NM_002647chr182216 67 --1281 1236
NM_002655chr8135103 5066 5021 4958 4552 4345 4152 3792 3760 3313 2128 407 111 23521 718 14623 --
NM_002709chr252646 1212 979 755 193 13320 43452 1139 721 68 12430
NM_002710chr1221119 301 --2397 263 1724
NM_002719chr1452441 2425 2172 1792 1498 --12296 12366
NM_002737chr1756615 6503 1546 1364 1006 11719 1941 24438 785
NM_002745chr2274510 3951 3762 2911 1400 781 256 22918 1031 11649 12936
NM_002748chr1531028 1008 876 1478 11055 2420 343
NM_002760chrY135605 5166 4224 2064 2034 1936 1785 1175 1081 712 567 531 322 14483 15828 35953 5798 1709
NM_002838chr15855 792 435 259 185 186 1457 --
NM_002839chr993479 2908 2849 2835 2716 2692 1275 931 725 --12320 --
NM_002844chr65915 523 424 278 85 ----1976
NM_002906chr1132350 1928 595 --22063 336 11883
NM_002942chr371320 1244 1231 1113 295 279 188 11120 ----
NM_002959chr154419 3898 3806 1751 689 24073 918 23906 1041 13877
NM_002968chr162861 426 --1437 1898
NM_002977chr222755 519 21021 779 --21248 1072
NM_003045chr1365023 4744 3950 1312 521 395 --44969 4737 4038 3093 23347 728
NM_003099chr1522149 292 --25587 1595 11383
NM_003108chr2107255 6162 5944 5321 4991 1429 1282 1186 980 730 16006 --16580
NM_003113chr23287 140 124 1269 --157
NM_003115chr1----1367 1345
NM_003128chr272144 2090 1147 902 781 750 706 22161 624 ----
NM_003189chr163377 3308 2890 1197 918 884 --11272 13180
NM_003199chr1885227 5185 3961 3741 1647 1194 267 253 --14546 14279
NM_003246chr1552060 2041 1730 1424 799 ----22000 1629
NM_003247chr651279 667 377 353 36 ----11598
NM_003253chr2141483 439 337 228 ----11816
NM_003257chr152494 359 1402 1550 1952
NM_003272chr12292 266 ----1677
NM_003274chr2142636 1092 839 44 ----11037
NM_003298chr3106136 4115 4086 4079 4019 3972 1247 862 356 87 --24053 1299 44126 4107 3930 595
NM_003339chr51585 11207 --2157 120
NM_003342chr1731047 1029 108 --1306 1264
NM_003350chr82780 774 --1156 1833
NM_003368chr15788 761 679 671 25 --1508 --
NM_003392chr324292 3323 1323 13099 11424
NM_003406chr841935 745 486 281 11470 1511 --
NM_003410chrX43096 2702 113 94 --12914 --
NM_003442chr113619 207 166 ----1117
NM_003463chr663156 2617 2213 813 662 376 --12262 --
NM_003471chr351848 1770 1466 697 334 ----2247 166
NM_003473chr10----1899 1330
NM_003478chr1153341 3252 2814 2385 2148 ----22183 1142
NM_003489chr2183010 3002 2937 2901 2864 2853 2709 65 ----23391 2913
NM_003566chr1293417 3166 3090 3059 2591 2473 2372 843 376 --22317 387 --
NM_003574chr1885699 5685 4203 3542 1582 884 204 117 --13837 11445
NM_003576chr1362673 735 492 438 428 321 1272 22273 586 --
NM_003590chr263223 2829 991 781 736 114 2835 615 ----
NM_003603chr432105 1546 1502 ----21734 1525
NM_003615chr31197 11548 13154 12451
NM_003618chr241153 336 315 80 ----21311 228
NM_003631chr103985 168 151 ----2883 106
NM_003677chr1251985 308 172 144 104 --11451 5242 222 200 166 128
NM_003705chr22745 310 --1301 1293
NM_003749chr1362452 2330 2128 2095 1778 390 --32322 2144 2028 --
NM_003759chr472900 1709 1330 1322 995 797 312 23997 3987 24308 3341 11694
NM_003772chr112414 185 ----1231
NM_003783chr15836 445 217 56 27 ----21201 1019
NM_003799chr1884537 3993 3011 2908 1174 454 186 112 --14512 --
NM_003822chr122077 333 22140 905 12045 --
NM_003858chr14199 --1236 1631
NM_003861chr1422909 1785 ----22667 327
NM_003887chr262228 2219 1864 1669 1493 600 11816 --22094 829
NM_003895chr2161759 1370 159 140 103 83 12171 11418 32186 508 473
NM_003902chr13857 623 151 --1308 1239
NM_003972chr1081250 1171 1161 1134 1087 1071 358 324 ------
NM_003980chr621231 1089 11180 1544 11394
NM_003994chr1254301 2981 834 515 35 ----11412
NM_004093chr1362925 2386 2265 932 468 224 22346 2247 --22879 2257
NM_004100chr642200 1919 453 45 1256 22722 2146 --
NM_004114chrX51172 1123 961 913 199 --11235 11195
NM_004171chr11169656 8978 8905 8814 8556 8139 8115 6692 6660 2933 2879 2626 2581 1295 1213 360 ----18019
NM_004187chrX21179 332 11476 --11447
NM_004272chr591723 1585 1369 666 635 577 421 239 154 11354 ----
NM_004274chr1462102 884 860 852 680 642 12412 ----
NM_004316chr1241140 796 776 327 ----1736
NM_004329chr1021434 1000 ----11058
NM_004338chr1876713 6409 6397 5895 5071 4995 1719 25512 4782 16679 --
NM_004360chr161400 ----21920 1604
NM_004380chr1652430 2328 1024 891 835 2569 559 22563 930 --
NM_004384chr562045 2000 1738 1503 887 752 --11770 --
NM_004392chr1372532 2521 1732 1041 858 807 225 ----1281
NM_004397chr1122934 987 --1980 14242
NM_004432chr942430 2315 2135 1815 11961 22382 1880 --
NM_004438chr243062 2865 2811 2508 33336 3224 152 12189 --
NM_004440chr611819 ----31612 1362 312
NM_004459chr1732040 1618 829 ----31669 585 577
NM_004501chr123179 863 14115 31207 218 167 --
NM_004504chr252083 886 317 225 157 ----1289
NM_004523chr1051340 1203 576 337 82 11024 11220 --
NM_004586chrX44762 1635 483 306 15013 --2663 511
NM_004588chr112547 58 --13869 23703 2590
NM_004598chr573139 3046 2621 2140 1216 875 663 12636 1640 --
NM_004612chr9134223 4115 4065 3904 3887 3601 3224 3145 1412 1370 1220 952 410 13302 34378 579 198 --
NM_004685chr1361907 1861 1058 942 931 653 --1262 --
NM_004726chrX85608 5470 5450 5295 4804 1390 1344 418 24784 2231 12205 --
NM_004745chr876562 6451 5694 2002 1297 907 55 --36716 2674 2151 12491
NM_004768chr131147 1103 983 --131 1102
NM_004774chr1733053 2802 389 --12993 12545
NM_004815chr164731 3049 1498 1105 648 98 1962 13132 --
NM_004863chr1435075 2121 891 15286 23456 853 11910
NM_004866chr584085 3060 1852 1633 988 763 505 127 13691 23485 1900 --
NM_004869chr1831777 1601 1206 ----11198
NM_004898chr43671 564 543 --1177 12229
NM_004904chr776563 6555 4936 4840 4240 372 283 26388 5110 15099 13998
NM_004956chr724394 471 1897 1173 14127
NM_004985chr1224281 1750 --24312 57 12906
NM_005011chr731627 1164 315 --1278 1325
NM_005036chr2248311 8099 7454 7342 27355 6779 25982 5477 12057
NM_005056chr12114687 3885 3840 3716 3658 3600 3427 2237 1033 148 139 --14316 15481
NM_005065chr1485306 5108 3986 3696 3670 625 380 342 --11595 14495
NM_005093chr2075312 5289 4344 4216 1903 1017 730 --34931 1818 169 --
NM_005121chr1773761 2626 2477 743 661 467 23 --12798 --
NM_005126chr321592 807 --275 42 1814
NM_005135chr1533722 3606 521 1880 1640 1114
NM_005153chr16--2570 158 --2776 677
NM_005154chr15----1593 2447 411
NM_005156chr975315 5111 4276 3690 1577 1551 499 11291 15282 --
NM_005159chr1541911 884 699 101 ----22249 1794
NM_005160chr22136840 6670 6524 5653 5407 5207 5139 2393 2181 1822 1076 1015 919 16657 34510 782 456 --
NM_005164chr1272654 2435 2034 1764 576 488 292 --12257 --
NM_005171chr1221221 464 --1502 11255
NM_005233chr342537 2463 2303 2249 1635 --22231 2148
NM_005235chr2117741 7567 7331 6470 6375 6217 4756 3008 1336 1183 432 1802 14799 27007 5873
NM_005245chr42711 522 ----1555
NM_005254chr1531303 568 470 ----166
NM_005259chr241315 1222 545 465 ----1964
NM_005277chr421470 1369 --21390 450 11870
NM_005284chr61203 --1494 1195
NM_005311chr752823 2695 1997 1974 610 ----12774
NM_005316chr11----3807 430 271 1284
NM_005339chr443251 3130 2647 1396 ----34257 1174 1073
NM_005342chrX41724 576 508 391 --1279 1223
NM_005359chr1884847 4131 1206 985 738 655 428 344 15633 16477 --
NM_005385chr322652 274 ----32693 2669 450
NM_005398chr1021221 175 1376 --31285 994 941
NM_005399chr154130 4016 3425 2755 2739 ----11133
NM_005436chr1063637 1492 1320 1092 293 234 --13729 13955
NM_005477chr1572594 922 581 575 556 550 538 --1720 --
NM_005477chr1572594 922 581 575 556 550 538 --1720 --
NM_005487chr2252102 1961 588 149 56 ----11953
NM_005497chr1766081 6002 5130 1557 755 302 15277 23794 356 --
NM_005504chr1265784 4448 4401 837 578 104 12107 12451 --
NM_005596chr985322 4837 4651 3990 2117 1713 1384 1164 11911 13984 --
NM_005613chr131512 501 458 11633 --2545 519
NM_005639chr1231689 348 277 --11339 1695
NM_005641chr72136 56 163 --149
NM_005665chr144831 4563 977 373 ----21047 92
NM_005668chr594581 4035 3813 3558 3542 2994 1660 277 245 --13020 34071 4047 3635
NM_005748chr1232814 2538 2450 --12349 1417
NM_005756chrX51323 1123 1099 398 383 21046 968 ----
NM_005759chr264392 4183 3126 1282 576 202 11845 1342 --
NM_005779chr563606 3299 2848 2814 2712 2698 23175 192 ----
NM_005828chr1775096 5041 4628 4477 917 482 280 1661 --14865
NM_005840chrX117008 6974 3030 2946 2185 2009 2000 1958 1692 420 152 --12639 --
NM_005871chr103888 861 755 ----1767
NM_005885chr571317 1066 651 582 287 261 206 --3602 446 269 --
NM_005901chr1898606 8338 7894 7434 5359 2639 1696 910 308 17512 15327 --
NM_005902chr1563551 3351 1611 1508 764 133 13798 13990 --
NM_005909chr5104244 3416 3275 3082 2870 1679 1356 1278 1141 963 1924 13008 --
NM_005935chr435109 5016 3595 14626 11556 24976 4670
NM_005955chr155452 3635 3505 719 305 ----14734
NM_005986chr133837 258 97 12511 1355 1711
NM_005994chr172750 72 --1673 1686
NM_006007chr9114159 3597 3255 2758 1487 1400 1128 1103 867 403 201 --11278 --
NM_006033chr1872293 2284 2230 2197 1778 1511 741 1299 22128 1987 --
NM_006038chr2042082 1754 1745 622 ----11500
NM_006047chr2053231 2926 2628 2172 547 ----1499
NM_006060chr733631 3429 1750 --11039 23758 1653
NM_006095chr484465 3337 3292 3150 3144 1172 172 150 ------
NM_006134chr212649 194 173 198 11496
NM_006141chr1632297 531 47 --22645 2591 --
NM_006166chr125963 800 277 237 105 12186 11791 --
NM_006187chr1243010 679 147 127 --1104 1139
NM_006251chr593308 2758 2308 2148 1355 1301 1234 215 206 ----32788 954 289
NM_006256chr162624 2240 2010 1040 976 970 --11094 2953 519
NM_006265chr851533 1329 272 149 108 --21237 565 --
NM_006283chr864525 4286 3281 1733 1703 1477 --13496 --
NM_006298chr643185 1199 1015 537 --2959 860 42308 2162 2148 682
NM_006323chr41514 ----1549
NM_006333chr22457 38 ----122
NM_006359chrX3918 737 623 --1153 12046
NM_006379chr731700 499 389 --22088 1994 12167
NM_006403chr631707 1155 238 ----1210
NM_006420chr2093474 3434 3358 2789 2709 2410 1292 1006 370 11262 ----
NM_006434chr1062766 2744 2730 2371 1084 613 ----13252
NM_006457chr464036 3987 3455 3341 3043 825 ----14123
NM_006469chr1163 --11168 1153
NM_006526chr2041992 1913 863 844 12034 11579 21623 131
NM_006529chr431478 619 73 192 11589 1500
NM_006538chr284138 3778 3542 3486 2865 2733 2699 2633 --14015 --
NM_006544chr1496106 5832 4784 4317 4115 2401 1915 1732 1510 --15751 15925
NM_006548chr331618 1466 1168 --1393 1404
NM_006549chr1272975 2914 2877 2742 2619 1023 988 --1829 --
NM_006561chr1054504 4137 1315 1179 752 15392 ----
NM_006572chr1722674 1140 ----21132 553
NM_006599chr16128094 6947 6728 6170 6125 5851 5182 2017 1987 1548 706 564 --38246 7257 1618 16530
NM_006614chr342602 1071 984 616 1381 33005 1381 1193 22703 900
NM_006629chr1872624 2602 2595 2559 2221 1118 619 21106 1028 ----
NM_006650chr583973 3936 3304 3105 2963 1556 1524 1391 12841 --12943
NM_006654chr12144563 4112 3913 3834 3750 3484 3258 3238 1922 1823 924 613 211 133 --1370 --
NM_006717chr963416 3186 2750 2515 943 917 13322 --2457 422
NM_006722chr363007 2046 928 229 217 177 --11051 --
NM_006734chr631580 458 232 --31510 589 511 21491 300
NM_006738chr1564510 4490 1387 1346 689 421 175 33646 2947 706 --
NM_006749chr81100 ----2372 209
NM_006750chr1657689 6181 2608 2569 1628 16507 38033 7966 7263 17189
NM_006756chr841453 1276 1181 940 ----1504
NM_006766chr842463 1888 1849 1819 --32688 1660 1083 --
NM_006775chr62818 756 ----1870
NM_006826chr241188 1150 1008 195 1811 --1858
NM_006922chr232219 1828 276 1467 --22431 2115
NM_006924chr1744245 4088 1299 1157 12729 1798 141
NM_006956chr762379 2284 820 686 560 238 --182 --
NM_006962chrX21084 833 11112 --1819
NM_007005chr941309 1250 486 469 ----11504
NM_007007chr1294570 4376 3289 3264 1784 1656 1506 1164 292 1835 ----
NM_007038chr21105762 5229 5106 4370 4275 4112 3993 2020 1910 1006 --35781 1463 170 --
NM_007043chr121755 --11962 1214
NM_007050chr2097806 7123 6568 2892 2386 2109 1129 346 261 37508 5162 3191 17984 25978 5773
NM_007054chr583943 3919 3681 797 723 331 243 192 1599 1451 23964 3711
NM_007078chr1033090 1173 892 ----23009 158
NM_007084chr1331348 126 52 ----3117 46 36
NM_007114chr342857 2027 655 180 13137 1475 1699
NM_007125chrY41326 964 931 227 ----1923
NM_007146chr1722334 1817 ----11020
NM_007200chr1564510 4490 1387 1346 689 421 175 33646 2947 706 --
NM_007203chr932668 1596 1371 13971 21278 868 13087
NM_007214chr61221 --31151 1066 1035 --
NM_007218chr81656 --1215 1226
NM_007231chrX42115 1549 220 31 ----1100
NM_007249chr1399348 9068 8005 7680 7446 6945 6489 3049 1484 --26973 297 17490
NM_007287chr312066 ----1229
NM_007288chr312066 ----1229
NM_007289chr312066 ----1229
NM_007353chr71487 1814 --22654 355
NM_012081chr552802 769 569 547 392 --12370 1663
NM_012092chr221636 750 1534 1525 --
NM_012097chr23808 472 33 ----12192
NM_012120chr642299 1950 1065 498 ----1286
NM_012129chr741994 1744 886 58 ----22442 335
NM_012214chr276203 5293 3943 3881 2083 768 486 1476 --1286
NM_012234chr313464 --23675 311 1296
NM_012238chr102304 183 --11748 11645
NM_012243chr12895 154 ----1943
NM_012249chr242912 2365 1264 692 --1877 1676
NM_012257chr721058 344 ----2420 323
NM_012287chr384482 4380 3306 3044 1090 959 640 629 13149 34501 3507 1067 21059 52
NM_012290chr231717 1480 1290 --11079 11532
NM_012297chr451011 940 838 393 36 11598 --1618
NM_012302chr12201 187 ----1811
NM_012334chr544596 1332 692 582 ----1683
NM_013231chr1474206 3940 2993 2776 274 264 117 ----24085 66
NM_013255chr7147272 7105 6368 6213 5534 3468 3054 2475 2453 1494 1450 1199 519 225 27176 1067 --28848 8363
NM_013257chr842347 437 154 89 ----11592
NM_013261chr463749 3067 1117 370 302 120 13756 11246 --
NM_013269chr1243587 3435 3254 759 11643 13294 34485 3115 358
NM_013341chr252726 2221 1815 873 602 ----11934
NM_013381chr1282209 2199 935 735 708 681 350 278 11563 2723 265 2689 644
NM_013386chr111551 --11702 1171
NM_013438chr961444 1347 1268 1199 727 609 ----1478
NM_013444chrX41100 932 913 864 1852 --11147
NM_014011chr262434 2074 1701 769 60 47 ----12399
NM_014021chr142857 2249 764 240 --2952 388 21259 497
NM_014023chr1062524 387 211 201 161 121 --12371 12620
NM_014043chr311410 11367 --21565 628
NM_014048chr1643344 813 770 709 13634 --35243 5218 5184
NM_014079chr32667 397 ----21014 926
NM_014109chr811245 11092 --1158
NM_014112chr843775 1701 1561 1327 --14577 33724 1120 650
NM_014155chr11117304 7293 5980 5602 5245 5202 2969 2054 1846 707 634 1472 26639 331 27062 695
NM_014243chr471974 1852 1768 1421 801 487 303 --22109 1652 12038
NM_014250chr2252102 1961 588 149 56 ----11953
NM_014253chrX42366 2165 658 95 --1682 1894
NM_014309chr2255347 5216 4504 2089 221 13822 14390 11324
NM_014310chr2221693 720 21705 1560 21940 1679 21729 1717
NM_014319chr1291905 1656 1345 723 711 685 584 576 553 --11809 1394
NM_014333chr1172609 2524 2489 2453 2278 722 180 12483 22764 2692 1347
NM_014393chr81468 ----161
NM_014421chr432110 1853 1732 ----1238
NM_014423chr595602 5425 5355 5001 3987 3454 1927 1602 1322 --35190 4079 3461 13511
NM_014607chr231980 762 22 ----11915
NM_014615chr1643261 791 672 342 ----21249 688
NM_014676chr171590 1543 1421 1105 1067 1056 247 --21524 278 1262
NM_014682chr811461 --32326 2262 2146 21487 1446
NM_014683chr1742025 1574 1566 850 11626 1864 1684
NM_014700chr1651439 1208 496 364 325 --11269 11400
NM_014701chr1523066 2980 11161 11227 1753
NM_014702chr663466 3280 2779 291 253 243 --2465 400 23173 3085
NM_014705chr721456 507 1401 --11591
NM_014707chr741974 1847 737 112 ----1424
NM_014717chr192644 164 ----2154 108
NM_014721chr697096 7007 5770 5080 4842 4574 2679 2274 1769 16886 16804 17034
NM_014739chr644104 3879 3534 491 --13726 23102 438
NM_014743chr472894 2866 2771 2562 2335 1161 260 22695 2003 1533 11232
NM_014747chr185794 5664 4989 4826 3805 1654 1102 194 15708 --173
NM_014755chr293882 3867 3129 2984 673 562 450 338 77 --24247 1608 14059
NM_014757chr522167 893 12339 --32033 1506 903
NM_014781chr851277 1239 863 444 293 --1134 --
NM_014810chr143476 3283 1252 157 --33638 941 69 --
NM_014812chr11414 ----2702 78
NM_014829chr552293 2228 1745 1617 807 31605 1588 326 ----
NM_014830chr1223822 1546 13580 13872 11521
NM_014841chr63919 509 239 --11370 21057 372
NM_014850chr3104546 4249 3147 3088 478 414 394 368 356 135 23839 3609 21785 385 --
NM_014859chr1751425 1307 1233 1225 1169 ----134
NM_014877chr17107383 7071 6721 5796 5706 2819 2808 1508 436 296 16484 15674 11182
NM_014888chr721261 113 --11428 1603
NM_014903chr1242079 1900 1663 544 --32438 2247 1618 12230
NM_014904chr1063998 3982 2879 2590 1280 501 --1471 13941
NM_014905chr241409 360 230 94 ----1143
NM_014918chr15--189 --1999
NM_014920chr662467 1249 454 264 205 86 --13302 13144
NM_014923chr1352336 2087 1934 1698 824 1834 12020 1866
NM_014932chr341389 619 546 163 1459 31687 1661 1406 --
NM_014947chr142941 2909 370 47 11057 12301 12896
NM_014962chr2082895 2754 2235 2023 1940 914 438 159 140 22227 1090 --
NM_014978chr1031511 535 500 --11860 21764 1286
NM_014982chr1434551 4150 482 --33432 2088 1407 --
NM_014988chr442020 1972 1853 1721 1219 22835 2118 --
NM_014989chr621930 1539 1287 11311 11780
NM_014991chr4103203 3174 3044 2990 2877 2806 2699 2476 1062 419 --12563 --
NM_015024chr85576 425 325 171 25 --1336 11272
NM_015025chr2102673 2526 2298 2037 1947 1915 1903 1750 512 202 12350 ----
NM_015026chr1263805 3656 1565 526 504 299 1254 --12985
NM_015032chr1362696 2530 2457 2174 886 305 ------
NM_015042chr1534201 3093 1132 --43536 3459 2860 2854 --
NM_015046chr962606 2540 2458 1888 317 309 ----12485
NM_015057chr132550 523 --2699 678 1160
NM_015071chr546193 4193 2599 804 ----15817
NM_015074chr144921 4907 3626 3261 14854 24785 4201 13687
NM_015076chr684245 3891 3471 1532 815 405 311 148 11642 --1944
NM_015087chr1332530 2460 279 12562 ----
NM_015092chr16104637 4509 4489 3468 1834 961 896 873 375 145 --21238 939 --
NM_015093chr671630 1399 709 641 609 601 250 ------
NM_015097chr341815 1649 1595 323 ----11620
NM_015115chr4103117 2946 2935 1160 1108 640 544 286 278 257 ------
NM_015130chr41191 ----1322
NM_015132chr751619 744 411 404 327 21930 656 11962 --
NM_015137chr842313 918 722 350 12445 1878 22193 996
NM_015143chr4------2437 419
NM_015170chr832291 902 621 ----22153 940
NM_015192chr2032458 2315 1010 --22798 694 12899
NM_015200chr442452 579 536 191 ----1748
NM_015205chr1374191 3499 3404 3386 3304 1683 1014 74846 3844 3746 3619 3597 3586 3535 43683 3548 3232 230 33760 3283 3191
NM_015208chr1883095 2935 2602 683 599 572 537 472 --13767 12964
NM_015215chr193061 2154 1205 1183 1174 1128 1018 827 373 1122 12225 --
NM_015225chr923168 933 1409 12490 13007
NM_015247chr1641846 1242 1214 1155 11442 13608 15388
NM_015265chr242655 418 412 406 --12182 --
NM_015268chr32575 537 2525 214 1681 1708
NM_015271chr464178 4066 3825 3226 2802 1689 --14028 11126
NM_015285chr1842466 2369 2316 147 --21914 1662 22556 631
NM_015296chr131974 1303 --4991 964 845 811
NM_015310chr8168403 8384 8233 8209 8135 6632 6267 5070 3079 2932 2749 2371 2155 548 156 136 --17607 16311
NM_015313chr1144227 1475 443 277 ----13605
NM_015315chr533484 3283 1052 --11160 1147
NM_015317chr2122804 2795 2351 1821 1761 1124 757 690 677 430 260 167 --11133 --
NM_015335chr1292560 2372 2214 2149 2081 1771 1661 1615 481 --12407 21031 364
NM_015336chr1222281 1663 1992 2764 468 1483
NM_015344chr831958 1537 394 11833 22060 527 --
NM_015347chr1262947 2342 2333 2092 1131 610 --12269 12955
NM_015349chr642883 874 827 339 --12237 12914
NM_015355chr171186 ----22013 1624
NM_015375chr185032 4913 3086 1848 1282 1021 1015 321 --14997 --
NM_015385chr1062766 2744 2730 2371 1084 613 ----13252
NM_015387chr261488 1468 1441 528 177 54 1643 ----
NM_015436chr453290 2908 2889 2729 877 22956 2318 11185 --
NM_015455chr573978 3794 3469 2629 996 977 459 --21502 834 --
NM_015458chr864907 4647 3670 1842 1338 694 ----15030
NM_015477chr151915 ----2802 793
NM_015534chr121016 719 ----21059 71
NM_015541chr321350 183 --11388 2218 101
NM_015554chr1542794 1064 834 562 11167 12710 32823 2543 41
NM_015565chr2141903 1641 269 35 ----12071
NM_015569chr194226 3265 3247 3115 3082 1792 1699 997 244 13418 34556 4066 3237 13293
NM_015570chr741141 465 168 136 1149 11672 1387
NM_015576chr372916 2905 2512 2469 2096 1150 990 --1554 --
NM_015578chr1941476 662 654 256 --1103 1558
NM_015626chr172767 315 ----1246
NM_015640chr174902 4798 4521 4443 3859 1456 996 --24141 4109 --
NM_015678chr1321218 486 --3434 138 110 11249
NM_015886chr884423 1588 1173 1022 913 233 135 54 25136 1325 --35676 1726 350
NM_015906chr164403 4144 4008 3388 3171 344 --1840 --
NM_015955chr21489 ----2380 341
NM_016009chr154741 3926 3507 1974 1631 --24530 874 24777 837
NM_016083chr643756 3267 930 914 --1554 13770
NM_016131chr252204 569 371 335 201 ----12121
NM_016133chr231327 130 26 ----21494 1289
NM_016152chr3----21220 444 1336
NM_016206chr3108841 8482 7723 5786 5511 2808 1286 721 391 235 15900 15708 12430
NM_016248chr1363696 3085 2826 2782 842 163 13143 33574 2626 2572 --
NM_016252chr22902 168 ----1247
NM_016260chr2147619 7442 7408 7389 7368 6884 6240 5986 5765 5154 5106 5095 2697 1526 27520 2109 ----
NM_016271chr1841436 915 891 94 ----1355
NM_016275chr352445 2436 2391 1019 226 1855 12293 --
NM_016277chr661217 638 576 536 504 38 11077 1596 --
NM_016287chr121847 64 --1252 12078
NM_016289chr23819 774 598 1388 --12256
NM_016308chr152043 1337 577 312 126 11302 ----
NM_016315chr231564 1365 481 11789 --147
NM_016322chr9102538 2482 2207 1191 1060 982 762 697 657 349 --188 --
NM_016374chr191580 1465 1231 1165 1047 483 433 345 150 ------
NM_016374chr191580 1465 1231 1165 1047 483 433 345 150 ------
NM_016376chr1723874 1648 11253 24187 2802 11679
NM_016396chr1562950 1113 1062 868 630 254 12734 --22712 1995
NM_016424chr172408 197 ----11439
NM_016442chr572221 2054 1454 1443 617 470 201 ------
NM_016513chr662467 1249 454 264 205 86 --13302 13144
NM_016530chr1563636 3127 2849 2796 2561 1349 --23944 384 --
NM_016531chr494148 3709 3562 3473 3088 3011 3005 832 804 --194 --
NM_016548chr92649 623 --1108 11634
NM_016603chr532232 2156 1553 1465 31820 1758 1689 --
NM_016654chr1531303 568 470 ----166
NM_016824chr1031873 1757 1517 1492 1753 1683
NM_016953chr275906 5747 5612 4792 2071 1418 374 15654 25643 4470 13905
NM_017420chr1453640 3501 3062 2676 697 33290 451 166 13097 1340
NM_017519chr651026 1010 493 209 202 --11355 --
NM_017553chr1531267 1181 255 --1457 11261
NM_017610chr1531736 510 439 ----2822 166
NM_017628chr464038 1762 1558 681 305 222 24535 3358 15195 13714
NM_017633chr693346 2919 2826 1077 1045 1024 1009 970 114 ------
NM_017637chr9199455 9172 8557 8468 8170 7411 6991 6696 3602 3258 3233 2965 2813 2716 2535 1803 927 331 117 36621 1905 803 --28106 6203
NM_017643chr1773092 2981 2908 2402 580 271 73 ------
NM_017650chr775729 5558 5288 4757 2289 2184 1195 --55814 5630 5360 4203 3909 14936
NM_017657chr23895 803 159 1147 --1263
NM_017658chr1434497 4037 683 --33736 1257 303 --
NM_017742chr1841329 1253 592 304 --11558 11846
NM_017752chrX21701 780 ----21767 1750
NM_017753chr9----1133 21036 304
NM_017768chr11872 1641 --1221
NM_017769chr1433059 2414 1085 ----12377
NM_017779chr131029 546 356 1941 22550 1688 --
NM_017831chr1861805 1361 901 783 318 105 ------
NM_017919chr965587 5472 4531 3956 3871 795 --15600 --
NM_017943chr144840 796 679 167 --2788 112 --
NM_017944chr1132617 388 231 --4969 837 827 193 1327
NM_018027chr1033268 3194 2329 --12121 22707 2636
NM_018036chr1464399 4183 3570 3446 1220 660 12810 24132 962 --
NM_018043chr1141393 1365 1312 1101 ----11471
NM_018061chr171701 1262 525 483 322 253 79 ----1264
NM_018105chr811228 ----1469
NM_018125chr12424 411 ----1441
NM_018150chr12876 602 1139 --2111 84
NM_018155chr393407 3135 2390 2271 1380 1359 1313 748 552 --23389 1372 --
NM_018157chr1241169 1155 749 524 11183 --1887
NM_018159chrX31701 1544 1531 11609 ----
NM_018181chr1831666 1344 201 ----11964
NM_018247chr641181 493 362 35 12812 11161 --
NM_018287chr1051227 1079 850 836 821 --21318 952 --
NM_018293chr31895 --11904 12977
NM_018299chr862693 2591 2308 714 311 149 --1854 --
NM_018307chr171721 --149 1259
NM_018313chr362139 1779 1031 668 491 263 1791 1122 --
NM_018328chr27465 438 423 387 372 323 62 ------
NM_018351chr1251860 1423 1127 915 82 --1297 --
NM_018370chr1262206 602 444 379 305 186 ------
NM_018440chr886902 2913 2748 2226 2046 1150 1126 227 --15823 --
NM_018482chr832512 2443 80 --22275 865 1487
NM_018490chr1141696 1612 1590 1385 1504 11558 11378
NM_018555chr1961904 1550 1482 746 660 623 11775 1231 22231 1495
NM_018557chr261632 1499 1446 1267 35 27 ----1673
NM_018569chr431514 1046 64 ----11503
NM_018640chr1242706 943 412 292 ----2219 71
NM_018682chr73502 105 50 --192 1602
NM_018689chr1512610 --22689 810 22395 2368
NM_018717chr422485 2184 1488 12451 12215
NM_018718chr742320 2025 1632 274 22349 1652 22071 634 --
NM_018841chr193216 3173 2625 1578 1253 613 575 459 427 ----22406 481
NM_018945chr652316 1438 860 714 173 12283 1788 13602
NM_018976chr1262786 2569 2532 2452 2417 1060 ----12379
NM_018979chr1232407 849 379 --22543 2481 --
NM_018999chr1094876 4289 4208 3876 1420 1210 905 790 146 2731 36 ----
NM_019001chr3114805 4192 4158 3953 3501 3428 1908 1757 1617 849 200 --1186 --
NM_019018chr56773 632 570 530 477 133 ------
NM_019035chr431664 125 35 ----1160
NM_019042chr731167 923 62 2368 35 1172 1179
NM_019063chr252040 1704 1692 729 670 ----11810
NM_019114chr921878 1634 --1948 12163
NM_019555chr341798 1407 1267 47 1113 --11396
NM_019843chr224360 345 333 319 --2460 189 1401
NM_019903chr1031873 1757 1517 1492 1753 1683
NM_020116chr431571 1520 677 ----1645
NM_020122chr276063 5551 5529 4640 2170 1227 1155 14651 1125 15018
NM_020132chr2134189 3962 681 --14455 45092 4622 4416 1681
NM_020133chr675121 4615 4382 4084 1791 1721 1027 16178 --15493
NM_020148chr1862945 2581 1940 932 851 442 --1611 --
NM_020240chr552532 1728 1110 1058 358 --22675 845 --
NM_020245chr6114964 4799 4724 4429 3462 3442 3334 1959 1551 1353 1262 1670 24810 3941 --
NM_020338chr1053632 3497 3382 185 177 13422 33487 1236 815 13023
NM_020357chr351452 1385 1191 312 137 11042 ----
NM_020390chr333658 1553 184 --14779 34146 3083 1843
NM_020432chr782033 1960 1799 895 855 773 701 138 --1717 --
NM_020455chr622698 952 ----12597
NM_020463chr22569 404 ----11472
NM_020466chr653722 3675 1171 669 103 --24419 1094 --
NM_020529chr143477 42 34 ----1436
NM_020640chr321540 38 ----129
NM_020718chr1666409 6352 4765 4065 4030 1958 36571 4834 1531 1733 36284 4516 292
NM_020727chr2143279 2764 1303 272 --1786 23191 3169
NM_020732chr651026 1010 493 209 202 --11355 --
NM_020734chr12102969 2751 2703 2671 2486 1357 1314 1308 729 339 1677 21107 916 --
NM_020742chrX102727 2455 2348 2061 1017 747 631 570 560 546 1240 ----
NM_020766chrX44374 3796 3005 1212 --14398 23515 3342
NM_020772chr17117749 6996 6457 6104 5913 3194 2033 1925 1343 1310 871 1725 18674 --
NM_020773chr432623 1939 1026 1642 --11958
NM_020774chr1876214 6074 4822 4554 4506 3888 1213 15556 45661 4170 1709 1115 1943
NM_020841chr12103967 3931 3536 3397 3265 3137 2498 1029 712 688 13920 11626 1280
NM_020935chr213621 13608 --44305 3758 2974 289
NM_020940chr1062586 2578 2570 2507 1976 175 --32555 1094 45 1665
NM_020948chr153692 2416 759 741 585 1698 ----
NM_020977chr452252 2223 1704 554 547 11579 11439 --
NM_021007chr251592 810 798 790 535 --2777 123 1828
NM_021045chr1051690 1010 841 578 427 11954 1852 1564
NM_021069chr432105 1546 1502 ----21734 1525
NM_021072chr532495 2369 322 ----12460
NM_021097chr221129 61 22957 1148 --12900
NM_021116chr7118821 8607 8482 7984 6148 6008 3541 3473 3460 1141 773 130 29030 3161 1226
NM_021140chrX5982 947 881 807 239 ------
NM_021148chr751852 1749 722 140 53 22443 1729 --1350
NM_021180chr11669 --1781 1617
NM_021229chr123510 493 41 ----1903
NM_021252chr103690 242 57 --21384 672 11295
NM_021255chr1421122 493 --1999 22604 1415
NM_021629chr395067 4489 4373 4313 3880 1676 1553 834 343 1909 --34900 360 299
NM_021813chr6115777 5461 5322 5116 4547 2088 1342 1195 930 924 835 1114 24913 4431 44564 4534 3862 427
NM_021911chr5104832 4519 3920 3912 3434 3424 1799 1388 1341 55 ------
NM_021912chr1561559 1425 1034 194 176 132 11278 13323 184
NM_021914chr1442331 1942 969 764 --1671 --
NM_021960chr141902 698 512 471 --12653 1859
NM_021961chr1187235 6886 5967 4873 1296 897 263 33 37299 1026 482 --31636 1212 55
NM_021964chr3125143 4865 4578 4478 4414 1996 1403 861 780 743 416 87 --21846 323 26516 5124
NM_021977chr673733 2827 2613 681 394 124 85 22452 248 11528 --
NM_022130chr541404 354 155 149 --31445 476 361 --
NM_022351chr873820 2635 1125 1017 400 129 100 --11337 11426
NM_022459chr13115728 5014 4474 1776 1625 1566 1554 1438 844 274 46 --16133 --
NM_022474chr1432371 1028 176 1698 22814 2360 2902 339
NM_022550chr51145 ----2476 167
NM_022758chr653234 2784 2742 993 533 --12777 22362 958
NM_022763chr383180 3127 2584 803 736 641 233 152 11033 ----
NM_022780chr211489 ----2424 149
NM_022781chr963039 2477 2171 556 455 50 --43346 3229 594 249 --
NM_022818chr1621455 1086 --11296 11490
NM_022841chr1552553 2270 2244 2136 1919 --11694 1891
NM_022893chr241941 1048 512 322 --11211 12557
NM_022898chr1474720 1701 869 632 263 217 32 --14794 --
NM_022900chr741072 915 231 158 11053 --1175
NM_022912chr243000 2989 2401 169 --42896 2506 2461 401 22932 511
NM_023016chr272713 2498 2310 2101 1054 734 718 ------
NM_023074chr1921364 92 --1367 1356
NM_024007chr573064 2744 2695 2316 2054 1987 942 --22148 2135 12573
NM_024294chr653234 2784 2742 993 533 --12777 22362 958
NM_024336chr165329 289 108 79 60 ----1309
NM_024345chr965728 4741 4672 4266 1350 504 24925 4647 ----
NM_024423chr1863634 3563 3046 1671 800 303 14243 ----
NM_024524chr342942 2885 632 523 --23169 2998 12310
NM_024561chr1321200 234 ----21425 267
NM_024594chr521765 192 ----11575
NM_024624chr221387 487 ----2312 298
NM_024639chr632441 662 525 ----1802
NM_024665chr363627 3503 2883 615 423 147 --34474 3634 960 144
NM_024700chr131074 883 369 ----1756
NM_024704chr2041040 999 923 739 ----11031
NM_024725chr11----190 1195
NM_024744chr262693 1697 641 580 401 203 ----12001
NM_024900chr42566 154 ----3583 148 88
NM_024900chr42566 154 ----3583 148 88
NM_024913chr731598 1254 389 1147 11630 1119
NM_024920chr411028 --11259 1356
NM_024930chr552835 783 679 642 86 ----1999
NM_024941chr531434 1272 200 ----1453
NM_024947chr369218 8595 7351 6831 3674 3580 11188 53589 1745 1378 646 484 16987
NM_024953chr1252584 2550 2195 1783 181 2827 534 ----
NM_024989chr2197940 7933 7495 6574 6542 6372 5848 5460 5053 3077 2667 2507 2477 2160 1221 1045 974 300 270 --36820 5839 5099 12689
NM_024991chr1062766 2744 2730 2371 1084 613 ----13252
NM_025054chr873823 3611 3531 3094 890 598 98 --21671 1173 --
NM_025135chr18----1489 1414
NM_025147chr2----11098 1169
NM_025154chr741453 1326 1213 35 --126 --
NM_025160chr123523 2673 23951 435 --1723
NM_025191chr123498 3486 --13006 13432
NM_025195chr811867 --11520 21859 1546
NM_025222chr372989 2950 1974 1927 1112 827 29 --3857 322 146 1952
NM_030629chr1631912 1352 665 ----1525
NM_030647chr786305 6074 5908 1713 1182 995 592 102 11328 ----
NM_030648chr445024 4709 2055 1169 23993 929 --1942
NM_030650chr263319 2633 1321 687 311 219 --23946 3791 --
NM_030664chr1082397 2247 2226 2162 2069 2053 838 672 ------
NM_030665chr1731258 954 911 ----21270 1203
NM_030674chr1254993 1547 933 440 111 15370 --14886
NM_030762chr121768 --1172 11453
NM_030806chr179371 9136 6576 2620 2609 2351 1619 18783 1132 28891 2895
NM_030816chr143592 2883 1242 509 43311 2262 1070 895 13081 --
NM_030885chr342311 2266 1637 807 --11807 --
NM_030964chr553619 3320 1195 688 580 13082 --22356 1363
NM_031371chr191580 1465 1231 1165 1047 483 433 345 150 ------
NM_031371chr191580 1465 1231 1165 1047 483 433 345 150 ------
NM_031418chr1142630 2580 1985 111 1956 22692 1064 21992 358
NM_031419chr32590 519 ----2555 69
NM_031461chr85877 315 93 85 64 --11596 --
NM_031468chr778222 8153 7829 6339 2419 1049 47 ----18077
NM_031844chr123179 863 14115 31207 218 167 --
NM_031946chr7----1418 1443
NM_032116chr1395868 5612 5005 4404 3940 3893 3737 2171 1980 ----14969
NM_032189chr1373993 3301 3206 3188 3106 1485 816 74648 3646 3548 3421 3399 3388 3337 33485 3350 32 23562 3085
NM_032199chr1043656 2792 534 457 12599 13601 11446
NM_032208chr263631 3039 2926 2762 704 139 1581 1459 11116
NM_032256chr12178 --1196 1396
NM_032352chr1461259 1100 1088 483 431 243 --11131 21411 1370
NM_032373chr1095837 5827 4798 3783 1562 1057 829 541 240 12294 25005 4277 --
NM_032439chr1041370 1178 1098 577 1326 1635 --
NM_032440chr1061012 845 188 152 137 29 --12443 1680
NM_032445chr1592610 2590 2518 2483 2408 1945 1683 1596 1046 2996 473 12402 1520
NM_032457chr473883 3054 2758 1476 1325 335 181 21284 725 --13085
NM_032458chrX43347 3090 2542 586 13258 12643 --
NM_032521chr20103246 3214 2904 2658 2080 2049 1162 838 417 343 12109 23163 51 22695 2058
NM_032594chr142867 200 --1993 11094
NM_032622chr41354 --1289 11179
NM_032682chr363385 3144 2541 2444 230 100 12710 1383 13012
NM_032810chr103405 394 258 ----11095
NM_032859chr1374000 3891 1269 767 601 523 42 ----1928
NM_032869chr881775 1740 1702 1517 699 381 299 249 11953 1804 1413
NM_032932chr1786447 5902 5857 5627 5432 686 611 141 14976 --1160
NM_032933chr1831804 1790 64 --2613 55 11259
NM_032968chrX111602 1436 795 662 653 627 443 310 279 238 40 --13504 23940 1421
NM_032969chrX111602 1436 795 662 653 627 443 310 279 238 40 --13504 23940 1421
NM_032973chrY111601 1436 795 662 653 627 443 310 279 238 40 --13500 23932 1421
NM_033020chr164403 4144 4008 3388 3171 344 --1840 --
NM_033181chr643756 3267 930 914 --1554 13770
NM_033196chr1931465 1165 622 31389 412 341 1376 1496
NM_033224chr787369 6572 4932 3110 2379 2368 2121 1314 --18019 11877
NM_033225chr883172 2984 2912 2517 2404 2185 2150 736 11279 --12222
NM_033285chr883828 3757 3142 3136 610 445 69 63 --44245 4161 411 210 24352 2716
NM_033360chr1224402 2815 --24433 178 13027
NM_033389chr1764852 3789 3680 2961 1324 167 ----54401 2981 2971 1188 1173
NM_033427chr75612 343 331 323 315 ------
NM_033430chr4114130 4093 3951 3660 3592 3428 1602 1104 655 190 82 ------
NM_033437chr4114130 4093 3951 3660 3592 3428 1602 1104 655 190 82 ------
NM_033495chrX1368 --1976 1676
NM_033505chr256522 2342 1942 1067 229 --11732 26057 1850
NM_033551chr533484 3283 1052 --11160 1147
NM_033642chrX51172 1123 961 913 199 --11235 11195
NM_033656chr2165991 4367 1642 1214 1074 912 12031 1756 --
NM_052834chr1842466 2369 2316 147 --21914 1662 22556 631
NM_052851chr1392357 1563 515 381 362 339 314 273 70 ----22168 352
NM_052885chr1284843 4671 4229 3975 3912 1469 859 376 13193 14612 --
NM_052903chr153518 476 64 --150 1488
NM_052966chr14765 352 331 59 --2407 366 12714
NM_053053chr16983 973 938 137 100 93 ------
NM_053064chr1421995 456 --1684 13053
NM_057159chr9----11013 11249
NM_057749chr821246 380 ----21315 1076
NM_058241chr242239 2007 687 445 21877 1554 --1484
NM_058241chr242239 2007 687 445 21877 1554 --1484
NM_078483chr573571 3228 2919 1549 1035 981 310 23477 2526 24000 1536 11158
NM_080546chr972283 419 123 117 109 95 87 ------
NM_080682chr15735 663 608 240 44 ----1263
NM_080759chr1372532 2521 1732 1041 858 807 225 ----1281
NM_080760chr1372532 2521 1732 1041 858 807 225 ----1281
NM_080867chr1444899 4515 3077 690 13391 1245 11396
NM_080921chr15855 792 435 259 185 186 1457 --
NM_130391chr993479 2908 2849 2835 2716 2692 1275 931 725 --12320 --
NM_130392chr993479 2908 2849 2835 2716 2692 1275 931 725 --12320 --
NM_130393chr993479 2908 2849 2835 2716 2692 1275 931 725 --12320 --
NM_130847chr1154590 4544 1938 1284 283 --15707 15851
NM_133170chr2097806 7123 6568 2892 2386 2109 1129 346 261 37508 5162 3191 17984 25978 5773
NM_133265chrX103282 3253 3118 2820 2712 1229 745 450 434 378 --12526 13175
NM_133372chr552949 2632 2133 266 146 --12907 42891 2869 1111 570
NM_133496chr163870 3437 3396 3045 1030 55 ----11059
NM_133503chr121620 ----1544
NM_133504chr121620 ----1544
NM_133505chr121620 ----1544
NM_133506chr121620 ----1544
NM_133507chr121798 ----1722
NM_133647chr1533722 3606 521 1880 1640 1114
NM_134265chr172767 315 ----1246
NM_134424chr1241042 1022 997 845 ----1933
NM_138270chrX72706 2341 2321 1308 650 587 91 ----12683
NM_138290chr71101 ----1291
NM_138333chr932557 2549 2521 12246 12393 12427
NM_138340chr183428 239 83 165 1263 --
NM_138423chr154851 607 329 266 --11891 1162
NM_138426chr752386 2181 1743 1698 549 --22243 813 1898
NM_138444chr1374883 4388 4122 3591 1977 1822 916 14668 ----
NM_138459chr633241 2563 1360 1184 2193 177 194
NM_138468chr255839 4681 4079 2335 779 31761 1223 171 ----
NM_138554chr972590 2495 2414 2000 1705 755 127 ----22424 2195
NM_138576chr1474720 1701 869 632 263 217 32 --14794 --
NM_138621chr284138 3778 3542 3486 2865 2733 2699 2633 --14015 --
NM_138638chr1442331 1942 969 764 --1671 --
NM_138713chr16128094 6947 6728 6170 6125 5851 5182 2017 1987 1548 706 564 --38246 7257 1618 16530
NM_138714chr16128094 6947 6728 6170 6125 5851 5182 2017 1987 1548 706 564 --38246 7257 1618 16530
NM_138731chr1433181 1269 570 ----24081 2729
NM_138771chr741142 1038 596 277 ----1161
NM_138806chr35777 702 375 259 158 ----1362
NM_138811chr721037 308 ----21202 452
NM_139122chr72136 56 163 --149
NM_139123chr72136 56 163 --149
NM_139315chr72136 56 163 --149
NM_144571chr4116946 6752 6398 5093 5087 4546 2318 2285 592 154 49 12598 35798 2631 145 --
NM_144578chr1464454 3558 1079 765 169 45 ----1181
NM_144599chr1594545 3477 1133 962 880 777 707 466 422 --44245 4085 3587 1982 --
NM_144632chr262209 1972 1745 746 702 641 ------
NM_144664chr1152513 2243 786 770 616 ----22541 731
NM_144767chr1564510 4490 1387 1346 689 421 175 33646 2947 706 --
NM_144778chr1352753 2384 2298 2286 975 11987 --167
NM_144949chr262434 2074 1701 769 60 47 ----12399
NM_144973chr1265323 5117 1960 1790 1450 886 13301 11360 --
NM_145112chr141197 --11213 11273
NM_145259chr276837 6630 5032 2753 2520 2317 1476 ----11055
NM_145284chrX52526 970 947 881 518 ----12560
NM_145690chr841935 745 486 281 11470 1511 --
NM_145693chr252512 2409 2188 1609 1603 179 32377 2234 407 --
NM_145698chr1012064 21611 241 --1139
NM_145735chr1352835 2759 2734 2623 2446 2569 171 ----
NM_145753chr321377 601 ----11370
NM_147150chr932668 1596 1371 13971 21278 868 13087
NM_147156chr1031467 1182 280 ----1222
NM_147175chrX52057 2006 1833 1606 866 ----124
NM_148955chr1522149 292 --25587 1595 11383
NM_152261chr1242272 2215 2207 343 --1800 12372
NM_152330chr1462521 2479 2351 888 207 24 --1480 --
NM_152352chr1832553 2526 595 12796 --13026
NM_152374chr1101705 518 432 391 350 328 296 165 37 23 2442 76 --2202 192
NM_152388chr254047 3998 3722 2835 951 --1650 181
NM_152400chr472007 1896 1816 1753 1731 1589 1414 11687 11912 --
NM_152409chr532916 2563 2477 --12234 22579 206
NM_152417chr821308 35 ----11351
NM_152433chr1131680 1473 515 --1125 11346
NM_152594chr1572275 2151 1733 1651 492 379 308 --1728 --
NM_152622chr5113496 2976 2955 2762 2398 2382 2315 1123 663 128 31 ----13438
NM_152624chr5106304 5940 4542 2895 2634 2587 2276 1577 1062 580 16930 ----
NM_152665chr111030 1409 --21117 64
NM_152745chr721060 434 1258 --21163 915
NM_152754chr763834 1179 1143 797 331 64 12452 ----
NM_152756chr594297 4288 4213 4147 2971 1374 1245 1188 139 --21635 117 --
NM_152774chr772675 2645 2549 2209 1827 1056 669 11006 --2758 732
NM_152787chrX63885 3416 2825 2680 2601 689 13934 --22412 266
NM_152826chr1522149 292 --25587 1595 11383
NM_152838chr2053231 2926 2628 2172 547 ----1499
NM_152902chr121523 102 ----21765 1247
NM_153188chr555191 3700 1716 1189 316 24716 2277 24850 4497 --
NM_153207chr1274074 3146 2933 2863 2838 1172 215 --13327 --
NM_153235chr662160 1840 813 548 498 482 ------
NM_153262chr153184 2745 2463 2457 221 --1548 12420
NM_153267chr91869 1297 --1734
NM_153321chr1721024 163 139 --1218
NM_153322chr1721024 163 139 --1218
NM_153499chr1273073 3012 2975 2840 2717 1121 1086 --1927 --
NM_153500chr1273073 3012 2975 2840 2717 1121 1086 --1927 --
NM_153607chr562832 2639 796 745 571 448 13095 23002 2159 --
NM_153816chr61311 --1100 1419
NM_170606chr741785 1724 1660 1617 11829 --11560
NM_170665chr12124382 4287 4195 4046 3922 1637 1164 1018 672 295 266 211 --11046 --
NM_170709chr842347 437 154 89 ----11592
NM_170710chr483189 2830 2781 2440 2239 804 786 351 ----23101 442
NM_170780chr35777 702 375 259 158 ----1362
NM_172070chr252167 2106 1862 686 503 21452 246 ----
NM_172071chr177265 7196 2710 1801 547 414 405 --15784 1139
NM_172103chr642200 1919 453 45 1256 22722 2146 --
NM_172105chr642200 1919 453 45 1256 22722 2146 --
NM_172159chr351848 1770 1466 697 334 ----2247 166
NM_172160chr351848 1770 1466 697 334 ----2247 166
NM_172216chr1272975 2914 2877 2742 2619 1023 988 --1829 --
NM_172226chr1273073 3012 2975 2840 2717 1121 1086 --1927 --
NM_173177chr22457 38 ----122
NM_173214chr16128094 6947 6728 6170 6125 5851 5182 2017 1987 1548 706 564 --38246 7257 1618 16530
NM_173468chr495738 5356 5296 4357 4279 2214 2204 2072 897 --15482 25996 5037
NM_173508chr15886 880 861 807 90 ----2840 82
NM_173511chr242973 1029 739 682 ----23226 770
NM_173602chr1223691 610 ----2564 286
NM_173825chr332687 2538 220 ----13043
NM_175610chr152494 359 1402 1550 1952
NM_175736chr1267857 7790 7774 7565 6918 1200 --27680 809 1840
NM_175854chr1372780 2130 2108 1889 700 285 144 --1347 --
NM_175861chr1285304 5216 5208 4040 2117 1801 1780 1276 --45938 5862 5626 634 --
NM_175863chr651026 1010 493 209 202 --11355 --
NM_175876chr142114 2027 1799 26 ----12736
NM_177452chr1462370 1681 1530 507 475 103 ------
NM_177937chr92649 623 --1108 11634
NM_177974chr154851 607 329 266 --11891 1162
NM_177985chr23808 472 33 ----12192
NM_178006chr1392357 1563 515 381 362 339 314 273 70 ----22168 352
NM_178007chr1392357 1563 515 381 362 339 314 273 70 ----22168 352
NM_178140chr562096 1027 650 643 510 163 --12699 --
NM_178151chrX76728 5912 5613 2818 2400 1699 1547 --37857 6915 1784 16634
NM_178152chrX76728 5912 5613 2818 2400 1699 1547 --37857 6915 1784 16634
NM_178153chrX76728 5912 5613 2818 2400 1699 1547 --37857 6915 1784 16634
NM_178426chr121817 384 11709 --11696
NM_178427chr121717 284 11609 --11596
NM_178498chr1123881 96 14027 33868 3475 3178 13288
NM_178565chr841741 586 390 85 1214 --31586 546 52
NM_178566chr921804 1225 ----21906 298
NM_178585chr4103203 3174 3044 2990 2877 2806 2699 2476 1062 419 --12563 --
NM_178586chr1452441 2425 2172 1792 1498 --12296 12366
NM_180989chr1332252 1951 1539 21589 852 12078 --
NM_181265chr483189 2830 2781 2440 2239 804 786 351 ----23101 442
NM_181332chrX102727 2455 2348 2061 1017 747 631 570 560 546 1240 ----
NM_181358chr133846 2752 1079 --13857 11270
NM_181443chr2082895 2754 2235 2023 1940 914 438 159 140 22227 1090 --
NM_181481chr1876713 6409 6397 5895 5071 4995 1719 25512 4782 16679 --
NM_181482chr1876713 6409 6397 5895 5071 4995 1719 25512 4782 16679 --
NM_181483chr1876713 6409 6397 5895 5071 4995 1719 25512 4782 16679 --
NM_181504chr5113887 3873 3861 3843 3795 3062 3041 3035 3027 1030 960 23118 3109 1465 1715
NM_181521chr1665794 5693 2717 2690 2383 1489 --25886 4583 --
NM_181523chr5113887 3873 3861 3843 3795 3062 3041 3035 3027 1030 960 23118 3109 1465 1715
NM_181524chr5113887 3873 3861 3843 3795 3062 3041 3035 3027 1030 960 23118 3109 1465 1715
NM_181706chr1132347 2030 1596 --22390 417 --
NM_181723chr831744 836 624 --1690 11839
NM_181782chr661964 1763 852 765 737 390 1445 --2745 582
NM_181838chr51585 11207 --2157 120
NM_182485chr483400 2964 2941 2473 1064 1032 926 343 ----2757 475
NM_182515chr1996505 6350 5782 4472 2318 2251 1554 1499 323 12545 ----
NM_182551chr243484 3059 2181 2168 1809 --1208
NM_182641chr1732040 1618 829 ----31669 585 577
NM_182646chr483400 2964 2941 2473 1064 1032 926 343 ----2757 475
NM_182757chr633496 2514 639 21014 903 23421 938 --
NM_182762chr734478 2275 1176 --14507 24398 2336
NM_182763chr141891 687 501 460 --12642 1848
NM_182765chr1072316 1989 1871 1758 920 792 682 1454 1363 1651
NM_182767chr1272100 2080 1302 646 552 230 190 22067 360 ----
NM_182896chr341575 1317 1192 57 --21337 480 --
NM_182898chr776563 6555 4936 4840 4240 372 283 26388 5110 15099 13998
NM_182899chr776563 6555 4936 4840 4240 372 283 26388 5110 15099 13998
NM_182907chr662405 1543 1506 723 670 502 ----3651 222 80
NM_182931chr73502 105 50 --192 1602
NM_183004chr1463530 2408 851 766 710 82 11416 33135 679 548 --
NM_183227chr661217 638 576 536 504 38 11077 1596 --
NM_194247chr244286 1659 1354 756 --1259 12972
NM_194278chr1444010 3848 1207 193 13429 --13983
NM_194314chr155616 5378 3636 2053 420 1205 --25139 1368
NM_194317chr252740 2650 2270 604 373 ----12247
NM_194328chr963039 2477 2171 556 455 50 --43346 3229 594 249 --
NM_194329chr963039 2477 2171 556 455 50 --43346 3229 594 249 --
NM_194330chr963039 2477 2171 556 455 50 --43346 3229 594 249 --
NM_194332chr963039 2477 2171 556 455 50 --43346 3229 594 249 --
NM_194434chr1885699 5685 4203 3542 1582 884 204 117 --13837 11445
NM_198128chr1841436 915 891 94 ----1355
NM_198158chr363007 2046 928 229 217 177 --11051 --
NM_198159chr363007 2046 928 229 217 177 --11051 --
NM_198173chr11669 --1781 1617
NM_198174chr11669 --1781 1617
NM_198177chr363007 2046 928 229 217 177 --11051 --
NM_198178chr363007 2046 928 229 217 177 --11051 --
NM_198215chr1021014 930 ----11396
NM_198243chr151652 1122 --1263
NM_198268chr133846 2752 1079 --13857 11270
NM_198269chr133846 2752 1079 --13857 11270
NM_198273chr573052 2976 2903 2303 1218 713 39 --12413 --
NM_198390chr1631912 1352 665 ----1525
NM_198439chr1131680 1473 515 --1125 11346
NM_198465chrX4704 214 173 43 ----12702
NM_198569chr622565 819 ----12464
NM_198581chr237388 6371 6361 --47531 6917 610 374 --
NM_198715chr1106311 5539 4898 4361 2477 2334 1965 1615 490 326 36267 6076 1827 12432 21081 28
NM_198900chr1267857 7790 7774 7565 6918 1200 --27680 809 1840
NM_198935chr2073172 3069 2859 2384 661 238 219 --12420 --
NM_199421chr1444899 4515 3077 690 13391 1245 11396
NM_199462chr185032 4913 3086 1848 1282 1021 1015 321 --14997 --
NM_199482chr261488 1468 1441 528 177 54 1643 ----
NM_201437chr841453 1276 1181 940 ----1504
NM_201570chr1051806 1716 1292 556 48 12011 --21607 770
NM_201571chr1051806 1716 1292 556 48 12011 --21607 770
NM_201572chr1051806 1716 1292 556 48 12011 --21607 770
NM_201590chr1051806 1716 1292 556 48 12011 --21607 770
NM_201591chr421470 1369 --21390 450 11870
NM_201592chr421470 1369 --21390 450 11870
NM_201593chr1051806 1716 1292 556 48 12011 --21607 770
NM_201596chr1051806 1716 1292 556 48 12011 --21607 770
NM_201597chr1051806 1716 1292 556 48 12011 --21607 770
NM_203282chr1921616 312 --11741 1531
NM_203391chrX1722 ----11816
NM_203437chr23895 803 159 1147 --1263
NM_203446chr2162569 2180 969 950 913 893 22981 2029 12228 12996
NM_203459chr142495 1671 985 383 ----11660
NM_203463chr254524 1931 1334 996 140 --24713 4196 1660
NM_203504chr451011 940 838 393 36 11598 --1618
NM_203505chr451011 940 838 393 36 11598 --1618
NM_205836chr52647 496 ----2167 153
NM_205860chr122077 333 22140 905 12045 --
NM_206853chr673777 3069 2560 1633 1317 216 207 11333 ----
NM_206854chr6105038 4330 3821 1477 1468 718 397 324 129 76 --1373 --
NM_206855chr6116003 5295 4786 3859 2442 2433 1683 1362 1289 1094 1041 --44097 1338 547 223 --
NM_206876chr252646 1212 979 755 193 13320 43452 1139 721 68 12430
NM_206907chr593308 2758 2308 2148 1355 1301 1234 215 206 ----32788 954 289
NM_206909chr8168403 8384 8233 8209 8135 6632 6267 5070 3079 2932 2749 2371 2155 548 156 136 --17607 16311
NM_207043chr162020 1940 1853 1711 1688 751 12273 --11973
NM_207044chr162020 1940 1853 1711 1688 751 12273 --11973
NM_207047chr162020 1940 1853 1711 1688 751 12273 --11973
NM_207299chr9----1133 21036 304
NM_207303chr10104091 3680 2834 1517 1366 1334 620 378 269 23 12993 14007 14083
NM_207304chr1352640 2271 2185 2173 862 11874 ----
NM_207366chr742111 1480 522 118 --12291 --
NM_207406chr455548 4255 4076 2169 838 ----24788 907
NM_207517chr1531780 1741 355 --21395 1314 --
NM_213589chr2135352 5164 3938 3481 1726 1443 1362 1163 1140 677 211 179 168 --44980 3693 3433 145 2189 158
NM_213651chr111551 --11702 1171