TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3180-5p
miRNA Sequence: CUUCCAGACGCUCCGCCCCACGUCG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000046chr592798 2579 2168 2070 1146 310 303 200 35 2732 265 32990 1065 774 --
NM_000081chr1----1206 11882
NM_000084chrX115680 5521 5054 5048 4447 4369 2049 1368 1184 419 95 --24427 954 1165
NM_000088chr1711377 ----1132
NM_000090chr2------1127
NM_000092chr253802 2827 401 196 97 11461 ----
NM_000093chr961550 931 764 689 369 203 11912 11962 --
NM_000104chr273079 3000 2489 2481 2268 1893 290 --22009 201 --
NM_000108chr761691 1315 352 244 142 41 1429 1123 --
NM_000109chrX32394 1868 1833 --12324 --
NM_000111chr7----1129 --
NM_000125chr693605 3405 2857 2837 2796 2756 1634 1248 1196 22898 357 --12597
NM_000126chr15--189 ----
NM_000163chr541771 1637 772 503 --12187 --
NM_000165chr611357 --11400 11690
NM_000208chr19124423 4376 3667 3632 3371 1607 1289 1213 875 776 596 208 13191 24723 1679 21182 72
NM_000210chr241588 426 388 253 --11726 --
NM_000216chrX22857 325 21630 1358 --21064 167
NM_000248chr311145 32853 1958 361 ----
NM_000252chrX1404 ----2581 221
NM_000259chr1534948 3910 1249 42410 1320 788 137 14441 26023 168
NM_000264chr962892 2421 2262 926 728 236 22395 41 12725 --
NM_000266chrX3970 404 27 ----3757 378 179
NM_000268chr22103745 3566 3103 3035 2901 2816 2753 1508 1408 1245 33795 2572 349 12286 12487
NM_000280chr111209 ------
NM_000310chr111165 3968 454 142 11138 1999
NM_000314chr1032592 615 551 12368 22571 2280 --
NM_000318chr872780 2245 2003 1918 856 486 332 2870 157 1342 --
NM_000332chr666244 6190 5331 4365 2662 2247 ----1579
NM_000333chr351153 1065 1052 714 75 ------
NM_000337chr596362 4712 4558 4149 4031 1673 1358 968 789 14041 14366 34478 2609 1616
NM_000340chr321382 390 21254 1089 ----
NM_000346chr1731614 371 86 11410 ----
NM_000362chr2273338 3169 2984 2716 2698 1381 122 2851 231 23077 689 --
NM_000368chr994789 4387 4302 4173 3631 1650 831 166 136 23852 3747 1663 --
NM_000369chr1411630 1664 --21859 157
NM_000376chr1272952 2737 2419 2299 571 273 103 12670 12426 1907
NM_000387chr34681 609 38 30 --1627 1242
NM_000390chrX1343 --1499 136
NM_000393chr232135 1471 648 --11342 --
NM_000396chr1----172 --
NM_000399chr102848 61 --1981 --
NM_000408chr243205 841 709 633 32511 601 364 --32208 507 439
NM_000411chr2162783 2734 2382 2277 870 444 22570 831 1186 22791 52
NM_000430chr1793352 2593 2563 2451 1446 1300 548 118 40 --13005 --
NM_000442chr173258 240 29 1252 --1486
NM_000451chrX61981 1834 1397 748 274 88 22157 283 1356 21679 625
NM_000452chr132125 114 --1791 --
NM_000461chr354429 2942 1610 1083 541 11487 --1996
NM_000493chr61821 1726 ----
NM_000555chrX117610 6891 5188 5045 4953 2994 2456 755 476 449 181 26464 652 25268 728 12911
NM_000599chr233998 3352 2975 22961 817 33027 1855 1442 11097
NM_000600chr7--1306 ----
NM_000610chr115948 936 740 384 64 33030 40 23 32375 2162 522 12771
NM_000618chr1296037 5558 5463 5424 5339 4862 984 369 205 24296 2289 25083 81 --
NM_000618chr1296037 5558 5463 5424 5339 4862 984 369 205 24296 2289 25083 81 --
NM_000633chr1894583 4489 4078 4064 3960 1401 1018 814 463 25201 1291 43317 1754 1089 874 24778 297
NM_000635chr1961155 498 376 299 279 220 11496 --21247 58
NM_000679chr5--1488 ----
NM_000717chr171118 ------
NM_000719chr12116112 5429 4923 4565 4145 1868 1728 1310 518 433 92 --24624 2368 15524
NM_000722chr7--1261 ----
NM_000726chr251314 516 439 379 351 1325 ----
NM_000780chr8176 --1983 --
NM_000793chr1433684 1440 1379 34145 2033 434 --44183 3722 964 731
NM_000801chr202418 298 ------
NM_000807chr42647 488 1730 ----
NM_000808chrX2956 769 ------
NM_000809chr487546 7003 6661 6632 6459 2023 1578 1257 49148 3058 2084 249 39243 3663 1555 27523 2012
NM_000813chr531875 1233 660 23485 76 25488 303 14883
NM_000814chr1543721 3467 1591 1390 --13310 --
NM_000824chr42832 112 ------
NM_000827chr532094 1754 307 12104 ----
NM_000829chr111559 11720 1260 --
NM_000831chr1186075 5955 5785 5773 4959 4446 4306 4215 3918 3869 2006 1702 1679 1593 1584 677 528 63 34989 1466 1266 55674 4702 4350 4245 4170 1950
NM_000868chrX32339 1014 432 32092 889 818 11038 --
NM_000875chr15126955 6671 6552 6009 5455 5265 5155 4380 2289 2063 1819 1527 24283 383 46688 4362 2256 1964 26518 5384
NM_000885chr232017 660 97 1327 --11400
NM_000899chr1273391 3229 2961 2824 1582 297 170 23626 798 1104 23477 479
NM_000912chr853288 3231 2973 2293 2158 1899 12879 13084
NM_000935chr3137 ------
NM_000945chr221710 1345 ----11658
NM_000958chr521332 34 ------
NM_000961chr2073260 3049 2954 2916 2443 884 764 ------
NM_000963chr1--22411 1601 --22487 203
NM_000965chr3195 ------
NM_000966chr121258 ------
NM_000990chr1131489 561 477 63317 2548 1416 1371 961 917 23828 696 1901
NM_001001132chr2111172 ------
NM_001001323chr1232517 703 389 22400 2246 --1275
NM_001001344chrX32437 2349 1749 --1946 1754
NM_001001389chr115948 936 740 384 64 33030 40 23 32375 2162 522 12771
NM_001001390chr115948 936 740 384 64 33030 40 23 32375 2162 522 12771
NM_001001391chr115948 936 740 384 64 33030 40 23 32375 2162 522 12771
NM_001001392chr1161880 994 982 786 430 110 33076 86 69 32421 2208 568 12817
NM_001001395chr1242818 2274 1788 282 ------
NM_001001419chr583804 3691 3524 1763 1501 1193 800 268 24211 1112 14222 11849
NM_001001420chr583804 3691 3524 1763 1501 1193 800 268 24211 1112 14222 11849
NM_001001481chr841242 515 156 94 23070 3037 1789 2955 285
NM_001001521chr2----1260 --
NM_001001549chr762620 2354 342 268 47 31 22246 324 --1787
NM_001001550chr762620 2354 342 268 47 31 22246 324 --1787
NM_001001555chr762620 2354 342 268 47 31 22246 324 --1787
NM_001001664chr243092 2807 1021 966 21537 1422 --23023 1071
NM_001001668chr1984042 3718 3643 3619 3524 3332 3267 91 23563 2847 --13496
NM_001001740chr11119 ------
NM_001001740chr11119 ------
NM_001001924chr852117 1925 502 164 126 --1172 11450
NM_001001925chr852117 1925 502 164 126 --1172 11450
NM_001001931chr852117 1925 502 164 126 --1172 11450
NM_001001938chr9134117 3837 3480 3193 3167 3045 2707 1578 1496 572 377 334 167 174 34132 3423 2630 21655 1245
NM_001001971chr1011178 ----1948
NM_001001995chrX41438 655 500 138 ------
NM_001002006chr21339 ----2147 123
NM_001002269chr92468 423 138 150 --
NM_001002295chr1041131 921 329 192 ------
NM_001002759chr102425 113 ----1485
NM_001002843chr1511209 --2876 48 21036 417
NM_001002860chr1464215 2952 1505 1441 1040 807 13493 24178 3762 13230
NM_001002906chrY2535 165 ----1351
NM_001002919chr2--151 1418 --
NM_001003407chr1034842 3567 2058 11387 1787 14881
NM_001003408chr1034842 3567 2058 11387 1787 14881
NM_001003652chr1867371 7193 6891 5841 5744 5712 25614 1907 48310 5512 3221 836 13126
NM_001003679chr131422 885 215 ----1596
NM_001003688chr411041 11201 --127
NM_001003760chr642382 1379 1234 846 13105 22307 1051 --
NM_001003805chr141276 --171 --
NM_001003937chr21298 21699 1508 11557 --
NM_001003940chr1563729 3411 2963 2783 779 199 33378 2753 1015 43745 3621 1211 47 1342
NM_001003942chr1563729 3411 2963 2783 779 199 33378 2753 1015 43745 3621 1211 47 1342
NM_001003943chr1563733 3415 2967 2787 783 203 33382 2757 1019 43749 3625 1215 51 1346
NM_001004065chr953157 1220 1043 341 190 12456 33310 3108 2852 13870
NM_001004317chr654442 3433 2953 430 98 11034 54405 4375 3981 691 608 --
NM_001004328chr1251616 1601 1537 713 254 41860 736 107 23 ----
NM_001004329chr123444 109 54 ------
NM_001004342chr195307 5217 4219 2035 1961 1899 1834 1197 348 45574 5374 4317 1084 --26058 1300
NM_001004419chr1253809 3795 1377 1020 117 24565 207 1525 11003
NM_001004720chr211067 ------
NM_001004722chr211236 ------
NM_001005335chr19------1322
NM_001005353chr1----1980 --
NM_001005353chr1----1980 --
NM_001005386chr252144 801 706 637 402 1118 11755 12423
NM_001005404chr1753923 3511 3335 1049 736 1461 12806 --
NM_001005463chr1022003 1775 21610 513 22343 1851 --
NM_001005473chr566202 5939 5709 4604 4010 678 --26415 6116 12653
NM_001005476chr2----1630 --
NM_001005502chr1295085 4945 4410 4213 1947 1491 1210 1188 38 2808 102 11814 --
NM_001005609chrX113796 3713 3677 3561 3480 3374 3087 1490 993 878 377 33487 3005 1516 32810 901 667 --
NM_001005746chr251314 516 439 379 351 1325 ----
NM_001005747chr251314 516 439 379 351 1325 ----
NM_001005861chr31267 --1333 1795
NM_001005862chr172195 175 ----1611
NM_001006115chr392709 2642 2360 2051 2003 1705 973 435 152 22564 2061 21903 1848 12616
NM_001006600chr52296 46 12405 21501 582 12183
NM_001006658chr12666 37 ------
NM_001006684chrX2591 151 1189 ----
NM_001007023chr1433684 1440 1379 34145 2033 434 --44183 3722 964 731
NM_001007024chr1754324 3846 3326 2733 677 11294 41333 982 942 54 21099 787
NM_001007025chr1754324 3846 3326 2733 677 11294 41333 982 942 54 21099 787
NM_001007094chr1073575 3379 3329 2843 1789 1520 173 13775 1167 --
NM_001007156chr1581628 1603 1469 1462 1344 408 90 66 --1685 --
NM_001007237chr182596 2553 2226 1021 608 599 378 91 ------
NM_001007257chr131261 1146 416 ------
NM_001007277chr113850 411 159 ------
NM_001007466chr634748 4405 188 34296 1783 217 54053 1081 938 332 138 11701
NM_001007559chr1841885 1750 1665 507 11448 1273 1111
NM_001007563chr9--184 ----
NM_001008239chr1863738 3591 2452 1516 1166 747 ------
NM_001008392chr333443 3033 81 --52892 2767 2336 698 39 22741 2306
NM_001008408chr7136180 6129 5482 5328 4594 4445 4179 4045 2178 1350 1200 1139 195 46141 4664 3948 545 16410 --
NM_001008495chr82715 167 --11426 --
NM_001008539chr844609 4467 1254 142 22004 1463 --11285
NM_001008541chr1032354 1465 498 32200 1431 230 ----
NM_001008541chr1032354 1465 498 32200 1431 230 ----
NM_001008564chr13--22167 1566 21387 131 --
NM_001008660chr11--1356 --2343 321
NM_001008701chr1993130 2806 2711 2304 1989 1232 810 790 290 2540 533 ----
NM_001008703chr6146 ------
NM_001008704chr6146 ------
NM_001008711chr85469 445 357 166 43 --11258 --
NM_001008726chr1431242 1167 458 1125 --11142
NM_001008744chr1451562 1539 568 538 314 --1332 1221
NM_001008777chr17----1448 1215
NM_001008860chr152722 134 ----1814
NM_001008892chr152722 134 ----1814
NM_001008894chr152722 134 ----1814
NM_001008925chr453173 3117 2979 658 152 2408 203 1433 --
NM_001009554chr454569 3769 1271 1261 168 24591 915 33696 3414 1768 --
NM_001009554chr454569 3769 1271 1261 168 24591 915 33696 3414 1768 --
NM_001009555chr421464 1387 11230 ----
NM_001009880chr22124324 4219 3560 3391 1947 1819 1489 1130 862 739 695 110 21120 574 34576 4137 454 21279 254
NM_001009899chr3125636 5318 5272 5053 4846 4797 4774 2242 2019 1914 1460 1375 1278 13954 16453
NM_001010853chr662615 1268 926 775 640 299 12436 --12997
NM_001010861chr122121 704 11902 ----
NM_001010862chrX92498 2241 2111 2095 2025 1243 1150 907 129 --22663 156 --
NM_001010867chr1236636 6446 6132 5933 5912 5494 5417 5376 5229 5185 4887 4760 4303 2575 2406 2351 2113 2028 1678 1345 591 512 398 26018 4794 31780 1481 298 24227 129
NM_001010888chrX54027 1498 679 544 459 14186 24207 3824 --
NM_001010891chr596407 5349 5213 5128 4866 2767 2630 2545 1494 26320 1653 16138 --
NM_001010898chr172876 2820 1023 1008 930 271 191 33405 1161 858 21332 746 --
NM_001010923chr61509 --11539 --
NM_001010971chr1--1915 ----
NM_001010980chr173077 1384 1299 846 790 743 703 21069 986 21177 1017 12236
NM_001010984chr11701 --22399 1680 12576
NM_001010986chrX2768 381 ----1955
NM_001010989chr161391 ------
NM_001010990chr161391 ------
NM_001011513chr454056 3974 3838 3536 2581 11478 13051 --
NM_001011515chr4--1291 --21016 379
NM_001011516chr4--1291 --21016 379
NM_001011537chr342145 1636 827 568 ----22322 1657
NM_001011546chr202637 585 1659 ----
NM_001011663chr101163 11028 2394 363 --
NM_001011666chr796367 6285 6178 4400 1991 1461 1182 792 93 11209 ----
NM_001011713chr1411016 21348 1071 21456 1204 --
NM_001012393chr1121854 1821 24140 1961 24029 539 14065
NM_001012398chr161997 ----1161
NM_001012420chr1532399 1040 754 1561 1339 12183
NM_001012423chr1532399 1040 754 1561 1339 12183
NM_001012426chr6103203 3052 3039 3018 2981 2866 2811 2673 2588 1103 ----12097
NM_001012427chr6103203 3052 3039 3018 2981 2866 2811 2673 2588 1103 ----12097
NM_001012642chr1562026 1927 620 355 217 50 2858 325 41679 1327 395 245 --
NM_001012754chr1352059 1739 1587 1312 581 ----12128
NM_001012755chrX84740 4217 3502 3103 1452 1315 1229 786 33354 604 546 33317 2000 352 --
NM_001012968chrX2940 263 --22516 2303 --
NM_001012980chrX----130 --
NM_001013031chr1043192 2564 1386 887 11114 1186 21180 328
NM_001013399chr631045 759 293 2121 37 --1209
NM_001013438chr31683 --1279 1620
NM_001013439chr31529 --1125 --
NM_001014380chr1385406 3986 2293 2078 1954 1458 892 462 25572 1154 23707 84 15110
NM_001014434chr11225 ------
NM_001014449chr161209 ------
NM_001014451chr161209 ------
NM_001014797chr1065482 5139 2741 2609 1083 896 36321 6297 5175 27159 2371 34969 1546 313
NM_001015045chr442453 2447 1673 177 2776 218 32068 1751 75 12006
NM_001017368chr1772636 1864 1775 662 656 515 55 21031 726 1691 --
NM_001017371chr22424 107 --21295 215 --
NM_001017395chr383382 2749 2400 2355 868 563 475 403 --1288 13292
NM_001017405chr41192 ------
NM_001017423chr104781 678 625 136 2521 115 ----
NM_001017424chr121443 1229 1605 1158 --
NM_001017425chr121443 1229 1605 1158 --
NM_001017440chr7137675 6692 6661 6375 6255 6102 5661 2977 2530 2102 2006 1870 948 67455 6492 5858 5609 3145 2358 2989 715 36275 2474 2448
NM_001017535chr1272952 2737 2419 2299 571 273 103 12670 12426 1907
NM_001017923chr1431454 354 235 --11578 --
NM_001017969chr91603 ------
NM_001017970chr1462475 2074 1009 829 583 462 22678 624 11681 --
NM_001017977chr11108 --1149 --
NM_001018037chr91116 --11261 --
NM_001018050chr2273068 2357 2123 1176 1161 580 318 23420 1138 --11389
NM_001018052chr2273068 2357 2123 1176 1161 580 318 23420 1138 --11389
NM_001018065chr9106017 5969 5589 5061 4358 3867 2280 2252 1480 1130 --1298 --
NM_001018066chr9106017 5969 5589 5061 4358 3867 2280 2252 1480 1130 --1298 --
NM_001018067chr1115152 4659 4221 4095 4013 3531 3490 1670 1576 1131 469 24613 3709 11094 --
NM_001018068chr1115152 4659 4221 4095 4013 3531 3490 1670 1576 1131 469 24613 3709 11094 --
NM_001018069chr1115152 4659 4221 4095 4013 3531 3490 1670 1576 1131 469 24613 3709 11094 --
NM_001018111chr763931 3664 3071 1380 698 68 43097 2916 1301 485 1657 24005 2578
NM_001020658chr11650 --11701 --
NM_001020658chr11650 --11701 --
NM_001023560chr62384 169 --2885 433 --
NM_001023587chr36956 444 341 304 170 51 1184 1452 1965
NM_001024218chr14194 ------
NM_001024455chrX42411 1726 581 281 2268 203 32623 1072 756 11812
NM_001024647chr12127576 6891 6669 6460 6016 5639 4809 2633 1993 1639 1123 949 67376 7078 5891 2188 1229 838 17231 --
NM_001024808chr1242132 2002 946 804 --12679 --
NM_001024847chr342201 2182 1913 726 199 --11968
NM_001024956chr11125644 4156 4056 3850 3590 1910 1845 1810 1798 780 663 617 15102 21348 706 23947 123
NM_001025068chr331338 1203 255 ----11583
NM_001025069chr331338 1203 255 ----11583
NM_001025076chr1032306 2230 1520 15951 21988 1460 26259 236
NM_001025077chr1024725 2878 37309 4835 429 12818 27617 1594
NM_001025079chr341220 958 504 30 43233 3226 2999 2927 ----
NM_001025100chr1863435 2610 1389 825 401 249 22924 116 1929 12939
NM_001025108chr264144 3819 2765 1398 1197 60 33526 3435 2851 --13468
NM_001025266chr3123979 3845 3760 3671 3565 3195 1843 1712 1627 562 523 273 11432 24530 551 33296 931 807
NM_001025356chr1241889 1198 813 249 2851 170 11993 1905
NM_001025580chrX34017 3893 781 24161 3034 33396 3083 1471 11524
NM_001025780chr921243 376 1179 ----
NM_001029863chr662695 2050 2041 1163 810 758 1412 32679 790 21 1359
NM_001029883chr292683 2081 2006 1962 1144 1130 1048 941 129 1120 12515 --
NM_001030chr1153 ------
NM_001030007chr1673510 3446 3114 2873 2578 1428 1121 23166 1615 2327 214 154
NM_001030047chr1971045 946 882 367 318 191 171 3956 729 256 1214 1228
NM_001030055chr1473751 3609 3363 2948 2903 1079 33 23495 195 ----
NM_001031677chr52201 70 ----1412
NM_001031684chr241375 1365 443 122 --11387 --
NM_001031690chr752675 2612 2443 2013 274 33105 200 140 1733 22875 779
NM_001031695chr2295286 4774 4560 4017 1979 1905 1393 1142 534 13516 2766 679 13881
NM_001031732chr462944 2756 2713 1272 685 337 1174 11287 --
NM_001031801chr221173 ------
NM_001031804chr1653826 3780 1461 805 505 23148 1044 14281 --
NM_001031812chr511993 ------
NM_001032280chr621638 1266 ------
NM_001032282chr81399 11246 ----
NM_001032283chr122885 187 1753 1238 --
NM_001032284chr122885 187 1753 1238 --
NM_001032293chr172453 30 --1171 --
NM_001032296chr1352708 2418 1154 793 114 1404 42570 1124 873 396 --
NM_001032367chr151255 168 2191 79 --
NM_001032999chr2064337 4284 1409 658 364 73 24400 856 24699 940 14042
NM_001033057chr312048 ----1232
NM_001033059chr621628 1524 --11446 2826 527
NM_001033081chr151433 1373 687 420 109 3639 575 171 41916 1630 1598 1440 31576 1486 1311
NM_001033082chr151433 1373 687 420 109 3639 575 171 41916 1630 1598 1440 31576 1486 1311
NM_001033117chr3104792 4293 4175 3785 3647 3431 1637 1513 457 230 32964 1791 310 44441 1119 584 120 --
NM_001033506chr111416 ------
NM_001033521chr20--1189 ----
NM_001033522chr20--1189 ----
NM_001033925chr1031423 525 514 1400 1122 11935
NM_001034837chr5----2247 127 --
NM_001034838chr5----2247 127 --
NM_001034841chr16104504 4149 4064 3578 2096 1416 1400 960 830 495 43402 1502 1023 111 35176 1593 893 --
NM_001034850chr541655 1617 1411 580 1445 ----
NM_001035chr12383 258 178 2970 124 1243
NM_001035254chr952058 1897 1573 594 181 31696 318 23 22250 44 12220
NM_001037164chr711258 --21480 550 --
NM_001037172chr3----11205 --
NM_001037317chr122121 704 11902 ----
NM_001037334chr182957 191 --2662 118 --
NM_001037339chr12453 134 ----21255 519
NM_001037340chr12453 134 ----21255 519
NM_001037341chr12453 134 ----21255 519
NM_001037341chr12453 134 ----21255 519
NM_001037954chr1141379 1314 1089 722 --22409 219 22158 338
NM_001038493chr2160 ----11439
NM_001039091chrX3539 470 62 1484 ----
NM_001039465chr141396 --1120 --
NM_001039479chr14149 31869 1740 616 2133 41 22351 646
NM_001039535chr18101840 1631 1227 1215 753 619 457 393 305 258 11681 ----
NM_001039547chr3115205 3181 2745 2660 2519 2257 1880 1425 1270 1136 359 37947 7303 2374 --11571
NM_001039569chr262892 2803 2755 2630 2497 1065 1864 ----
NM_001039570chr2264477 4377 4082 3634 612 451 13179 --14679
NM_001039571chr2264477 4377 4082 3634 612 451 13179 --14679
NM_001039577chr194436 4238 4099 3895 3649 3253 1408 810 690 ----34014 3210 3177
NM_001039618chr1185894 5696 4110 3698 3680 759 678 619 54196 2106 1869 871 440 22363 398 12171
NM_001039709chr2064337 4284 1409 658 364 73 24400 856 24699 940 14042
NM_001039716chr12360 70 ----150
NM_001039840chrX24632 4495 15952 167 12164
NM_001039937chr1363336 2768 1284 918 825 439 1623 ----
NM_001039938chr1321492 469 2611 595 --11061
NM_001040020chr731349 1310 1180 ------
NM_001040057chr721518 329 --2226 112 --
NM_001040100chr331110 863 149 1512 --1312
NM_001040102chr1052683 2557 2237 603 38 --1127 --
NM_001040103chr1052683 2557 2237 603 38 --1127 --
NM_001040152chr794192 3142 1640 1459 1452 1305 1045 636 293 14435 14312 13574
NM_001040153chr13----1979 1855
NM_001040157chr461064 817 732 693 590 114 32856 579 363 --12421
NM_001040260chr44785 371 204 182 1142 21007 915 1362
NM_001040261chr44785 371 204 182 1142 21007 915 1362
NM_001040284chr1675818 5644 5467 4919 4750 4114 75 45873 5012 3722 1812 ----
NM_001040424chr2142942 2800 2589 483 12113 12717 --
NM_001040429chr1312393 ------
NM_001040446chr552695 1935 1693 897 216 21777 554 2854 837 12538
NM_001040450chr1542511 740 194 22 1215 12351 --
NM_001040453chr1542511 740 194 22 1215 12351 --
NM_001040619chr121655 1292 1271 --11362
NM_001040624chr852549 2190 2177 502 477 --1896 32495 1945 661
NM_001040625chr852549 2190 2177 502 477 --1896 32495 1945 661
NM_001040626chr852549 2190 2177 502 477 --1896 32495 1945 661
NM_001040627chr852549 2190 2177 502 477 --1896 32495 1945 661
NM_001040628chr852549 2190 2177 502 477 --1896 32495 1945 661
NM_001040629chr852549 2190 2177 502 477 --1896 32495 1945 661
NM_001040630chr852549 2190 2177 502 477 --1896 32495 1945 661
NM_001040712chr933399 2368 21 --1850 --
NM_001040875chr82691 547 22486 427 1835 22537 1828
NM_001040876chr411881 21846 561 1106 --
NM_001042355chr1684653 4598 3819 2047 1713 1530 882 679 12109 24224 296 --
NM_001042361chr1031165 572 27 1385 1427 21045 373
NM_001042364chr1031165 572 27 1385 1427 21045 373
NM_001042365chr1031165 572 27 1385 1427 21045 373
NM_001042387chr1031165 572 27 1385 1427 21045 373
NM_001042393chr1031165 572 27 1385 1427 21045 373
NM_001042396chr1031165 572 27 1385 1427 21045 373
NM_001042397chr1031165 572 27 1385 1427 21045 373
NM_001042404chr141221 646 112 55 --12016 --
NM_001042412chr1684653 4598 3819 2047 1713 1530 882 679 12109 24224 296 --
NM_001042413chr941265 974 843 685 33917 3790 1007 ----
NM_001042424chr411999 ----23242 518
NM_001042425chr621638 1266 ------
NM_001042453chrX21243 103 --1128 11565
NM_001042481chr1441895 1715 1683 155 ----22393 784
NM_001042510chr81604 --1882 1203
NM_001042511chr81604 --1882 1203
NM_001042533chr333185 1037 870 --22691 319 --
NM_001042543chr4----21381 585 11371
NM_001042555chr1274681 4611 4476 4435 4248 1599 295 11470 32926 1005 813 --
NM_001042599chr2107370 6495 6478 6050 5671 4996 2729 2644 1130 1028 35053 2988 451 17302 15371
NM_001042601chr362510 2473 2207 1086 896 634 1423 1917 --
NM_001042603chr1265216 4622 3943 3582 1090 88 --15313 --
NM_001042604chr354728 4589 4379 3279 1067 11312 ----
NM_001042632chr2072519 1007 999 762 742 425 324 22263 436 1515 11917
NM_001042633chr2072519 1007 999 762 742 425 324 22263 436 1515 11917
NM_001042728chr121258 ------
NM_001043318chr14102737 2652 1493 1480 1470 1305 1217 872 633 26 12586 13628 --
NM_001043351chr1112308 2109 1993 1985 1695 1663 1526 1442 863 617 107 22227 926 1386 1217
NM_001044305chr631610 1582 632 ------
NM_001044722chr511993 ------
NM_001044723chr511993 ------
NM_001049chr1482129 1974 1862 1799 1757 773 516 247 1222 1749 22359 2116
NM_001079874chr131701 1460 795 1487 --21997 764
NM_001083621chr1134699 4359 3668 3198 3051 2956 2915 2903 1532 1147 1029 859 687 11777 21791 675 --
NM_001100108chr198079 7111 6941 6489 5366 2935 2164 484 306 97332 1986 1365 645 567 448 315 251 239 46980 5911 5295 2441 22839 1800
NM_001106chr3249366 8335 7929 7393 7320 7189 7088 6147 6081 3648 2807 2666 2207 2177 2012 1852 1687 1676 797 635 629 623 608 184 --38811 2080 667 49539 9081 3810 77
NM_001113490chrX82694 1200 737 707 661 557 263 135 43364 3094 519 461 32315 690 393 1635
NM_001116chr1632320 825 219 22448 203 --12966
NM_001117chr184904 874 561 406 1943 --1976
NM_001121chr1041635 1581 1497 417 21551 133 1539 --
NM_001123chr101573 ------
NM_001128chr1673510 3446 3114 2873 2578 1428 1121 23166 1615 2327 214 154
NM_001146chr832122 2033 927 --2309 162 1420
NM_001152chrX1238 ------
NM_001160chr1262476 1915 918 705 620 589 150 22311 327 --
NM_001167chrX166466 6394 6217 5871 5736 5608 5235 4812 4698 4474 2667 2121 1984 1943 1899 325 11526 35382 4394 2468 1737
NM_001173chr1473751 3609 3363 2948 2903 1079 33 23495 195 ----
NM_001177chr1232240 2105 1573 11796 --157
NM_001201chr473416 3131 2937 2852 2446 1572 1397 ------
NM_001206chr91451 ----22750 1151
NM_001215chr11249 --1113 1373
NM_001218chr1572031 1072 932 774 627 70 46 42600 2209 373 323 52202 977 762 746 281 1460
NM_001220chr7142 ------
NM_001233chr721813 1480 1474 1404 2794 24
NM_001237chr41916 ----1264
NM_001237chr41916 ----1264
NM_001256chr17--52824 2510 1915 1123 284 22746 2528 --
NM_001259chr754712 3863 2395 1012 128 23850 247 1104 34002 1716 809
NM_001269chr14930 723 700 187 11052 1176 --
NM_001270chr5127 ----1930
NM_001278chr10--158 ----
NM_001284chr51413 ------
NM_001316chr20--1410 ----
NM_001324chr20--1189 ----
NM_001326chr11--199 ----
NM_001332chr5--21590 190 ----
NM_001343chr531744 1611 298 21224 1092 1555 --
NM_001346chr342253 2043 798 777 ----11769
NM_001356chrX1228 ------
NM_001364chr1174543 3741 3496 1681 1638 631 503 14139 11001 14198
NM_001378chr21181 ------
NM_001386chr821621 502 22266 1951 ----
NM_001390chr1853626 3562 1355 1296 1071 22990 554 11458 12513
NM_001391chr181767 1234 --21077 79
NM_001396chr212893 847 12082 ----
NM_001399chrX113796 3713 3677 3561 3480 3374 3087 1490 993 878 377 33487 3005 1516 32810 901 667 --
NM_001402chr661913 1449 1333 637 444 407 1501 --2613 369
NM_001412chrX43024 2873 1457 55 13107 ----
NM_001419chr1964868 3686 3280 3151 1464 282 23223 552 2980 149 --
NM_001422chr1121363 151 ------
NM_001429chr2231054 268 114 ------
NM_001446chr6125 --1270 --
NM_001453chr611654 11326 ----
NM_001494chr101557 ----1780
NM_001530chr14131 ------
NM_001533chr19------1322
NM_001542chr182596 2553 2226 1021 608 599 378 91 ------
NM_001543chr5164658 4554 4067 3901 3893 3852 3056 1749 1673 1493 1435 1416 1230 713 588 43 34679 4044 3876 23923 3498 11631
NM_001546chr61276 11223 ----
NM_001554chr12578 255 ------
NM_001584chr112121 22 ------
NM_001604chr111209 ------
NM_001614chr172537 103 1453 ----
NM_001614chr172537 103 1453 ----
NM_001616chr22289 47 32460 977 114 22920 157 --
NM_001634chr621628 1524 --11446 2826 527
NM_001650chr1874152 3829 3360 2917 2901 1244 360 12646 14064 23523 3095
NM_001660chr31566 --2819 100 1773
NM_001663chr1452721 2523 2178 980 27 12375 1118 12411
NM_001664chr3----1858 1692
NM_001668chr132287 2258 1768 --1879 2506 371
NM_001679chr33825 629 610 ------
NM_001682chr1232231 417 103 22114 1960 ----
NM_001709chr1132318 1764 479 11963 ----
NM_001718chr621249 222 11032 ----
NM_001730chr13--1120 1199 11633
NM_001730chr13--1120 1199 11633
NM_001731chr122902 176 ------
NM_001753chr731486 1309 1230 ------
NM_001759chr1275321 4537 4145 4042 3855 1268 1077 23801 1862 14051 --
NM_001777chr341220 958 504 30 43233 3226 2999 2927 ----
NM_001789chr351738 1220 1117 119 105 31509 486 398 ----
NM_001792chr185777 268 232 116 26 11088 --1183
NM_001800chr191471 1540 ----
NM_001806chr1942473 2121 827 496 22828 2249 42988 904 267 132 12131
NM_001819chr20--1285 --1264
NM_001821chr1130 24658 3108 ----
NM_001830chrX63942 3338 3198 2743 1037 693 33893 3676 2477 --1126
NM_001833chr9197 ------
NM_001850chr31136 1112 ----
NM_001859chr973570 3239 2981 2615 1586 1410 821 13940 12950 --
NM_001874chr1295085 4945 4410 4213 1947 1491 1210 1188 38 2808 102 11814 --
NM_001895chr2011229 ------
NM_001904chr33989 172 164 --1977 --
NM_001920chr121273 186 ----
NM_001938chr111631 --1723 11312
NM_001939chrX42983 2723 519 132 11505 31162 927 687 23422 798
NM_001946chr1241136 1025 271 27 --2368 191 2860 467
NM_001964chr541021 484 284 144 ------
NM_001967chr3122 ------
NM_001969chr1483549 3455 3331 3283 1450 1287 1001 258 12629 --13228
NM_001981chr141700 946 674 421 11792 1321 --
NM_001987chr1261531 1242 225 199 161 67 --33513 948 255 --
NM_002006chr463834 3755 1276 1246 517 104 45264 5133 3893 1521 13854 --
NM_002015chr1322336 1201 22721 248 22504 785 22446 634
NM_002017chr114519 479 270 50 ----21220 1182
NM_002024chrX2586 298 21901 615 --11552
NM_002025chrX138445 8134 7656 6854 6207 6175 3423 3338 3152 2975 2441 1371 1070 78596 8052 7107 6342 3480 3380 3167 27604 7244 26114 882
NM_002040chr211158 ------
NM_002051chr1041131 921 329 192 ------
NM_002056chr23713 290 227 ------
NM_002069chr721602 638 11461 1117 1367
NM_002074chr1134 --1473 11451
NM_002078chr3--191 ----
NM_002086chr1762012 1977 1645 1440 402 147 31749 1638 834 12127 --
NM_002092chr464656 4417 4282 4196 3405 1249 13589 34738 4368 3177 11730
NM_002093chr3------180
NM_002106chr42275 135 ------
NM_002107chr11331 ------
NM_002126chr1743689 2785 2720 2583 --33041 1494 29 --
NM_002130chr531262 592 84 --2621 614 1433
NM_002136chr12----1438 --
NM_002137chr711854 ------
NM_002160chr92574 417 ------
NM_002182chr312207 1941 --12650
NM_002207chr33711 690 227 --2485 71 --
NM_002210chr253398 3024 2856 1102 400 23342 806 ----
NM_002214chr764827 4773 3488 1840 1294 35 24508 1554 23774 2167 --
NM_002222chr31163 --1241 --
NM_002223chr1273869 2560 1562 1446 759 601 388 1269 31298 1213 654 --
NM_002228chr121067 1006 --11190 --
NM_002233chr111458 ------
NM_002239chr2--11041 --31064 891 306
NM_002241chr152435 745 384 325 160 23044 87 12185 12910
NM_002264chr344540 3407 1384 256 13509 54938 4056 1872 1634 792 1165
NM_002265chr1721175 69 2249 43 --11231
NM_002267chr1332266 2065 405 ----1353
NM_002268chr321511 564 --1175 --
NM_002270chr565597 4368 1761 1567 596 150 1630 1217 --
NM_002271chr1332324 1497 209 --22418 2232 22268 127
NM_002285chr264144 3819 2765 1398 1197 60 33526 3435 2851 --13468
NM_002309chr226958 916 853 739 669 159 2687 655 31210 523 236 12324
NM_002310chr596399 6367 4938 4702 2520 2378 2326 2268 2112 24323 1320 21692 1301 16451
NM_002313chr1034842 3567 2058 11387 1787 14881
NM_002317chr52387 132 ------
NM_002355chr1221278 488 1549 ----
NM_002356chr642830 2528 2187 81 11096 ----
NM_002395chr631388 996 69 ------
NM_002408chr14----2593 565 --
NM_002430chr22102483 1972 1643 1611 965 932 835 801 737 634 1506 1521 --
NM_002481chr1147764 7301 6518 5782 5726 5533 5526 5295 5095 3201 3098 2601 861 266 46008 5816 1743 1110 33045 2558 501 2805 256
NM_002482chr13703 627 66 1510 ----
NM_002487chr15------1583
NM_002492chr3--144 ----
NM_002499chr1552382 966 955 190 49 12481 22328 40 11924
NM_002500chr211222 --1158 --
NM_002505chr631047 627 599 ----21516 1149
NM_002514chr82746 193 --1957 --
NM_002515chr1421704 1433 ------
NM_002519chr111399 --2603 378 --
NM_002522chr1743196 1065 772 654 --33467 3102 889 23872 405
NM_002538chr5177 ------
NM_002545chr1121854 1821 24140 1961 24029 539 14065
NM_002546chr81211 2693 268 ----
NM_002556chr1151933 629 606 572 68 1696 ----
NM_002568chr81405 ------
NM_002577chr333873 2533 1564 12995 --1920
NM_002581chr951668 1199 1182 1078 576 31675 1631 1051 35160 3491 1301 1392
NM_002582chr161732 1117 168 --
NM_002590chr132395 120 ------
NM_002591chr20--1622 --1482
NM_002595chr122473 94 --11477 --
NM_002597chr11328 ------
NM_002600chr12453 134 ----21255 519
NM_002601chr2142 ----1376
NM_002610chr231903 1233 402 --32992 2446 53 1799
NM_002613chr16114492 3369 2122 1664 1438 1406 1176 781 763 756 456 --24372 3850 11882
NM_002645chr1112239 --33158 209 25 --
NM_002646chr181656 1523 1438 1407 868 561 461 397 11911 --1191
NM_002655chr834872 3429 1248 14788 1171 11358
NM_002656chr63807 378 100 --2395 34 188
NM_002657chr20123682 3422 3158 2660 2613 1492 1186 1096 1084 827 738 320 22390 991 13399 23541 3471
NM_002687chr14------1126
NM_002689chr111327 ------
NM_002699chr131358 1348 92 21500 997 ----
NM_002706chr2--1101 ----
NM_002709chr21712 11008 ----
NM_002711chr72188 56 ------
NM_002718chr342667 2428 518 155 1729 1423 --
NM_002729chr10182 ----1124
NM_002737chr17136467 6213 5766 5556 5523 4943 4810 4725 4306 4077 2420 1150 357 --46673 5790 806 424 --
NM_002740chr332614 1780 459 21807 1018 12080 --
NM_002745chr2274341 3244 2885 1697 1215 892 131 14331 ----
NM_002748chr151893 ------
NM_002752chr5------1372
NM_002758chr171171 ------
NM_002760chrY85766 5371 4929 1899 1739 234 223 133 45852 3744 1755 35 22134 205 22188 963
NM_002763chr1151 ------
NM_002765chrX3539 470 62 1484 ----
NM_002789chr15----1228 1241
NM_002803chr7137 ------
NM_002815chr17126 ------
NM_002816chr17136 ------
NM_002822chr1211470 2438 420 --1117
NM_002828chr184789 659 344 333 1403 ----
NM_002839chr933399 2368 21 --1850 --
NM_002843chr1132728 594 425 --43340 3112 2504 25 --
NM_002860chr104781 678 625 136 2521 115 ----
NM_002865chr81185 ------
NM_002869chr1131739 1721 502 --22030 770 --
NM_002873chr5------1467
NM_002874chr922113 1834 22062 2032 22310 70 --
NM_002886chr3114948 4347 4142 4120 3815 3768 2079 1656 804 697 597 2564 339 --34854 2016 1813
NM_002906chr1132381 1776 1587 --1929 --
NM_002940chr411881 21846 561 1106 --
NM_002941chr31525 1664 11096 --
NM_002942chr311301 ------
NM_002951chr20----1283 --
NM_002957chr9133556 3394 3346 2950 2879 2815 1441 1163 1084 1048 922 340 111 22977 1026 1428 23474 2897
NM_002958chr31267 --1333 1795
NM_002959chr1134025 3441 3096 3026 2986 2967 2863 1746 1451 1235 1166 867 509 --24426 2756 --
NM_002968chr162792 249 11014 ----
NM_002971chr3--1146 --1408
NM_002973chr122395 65 ------
NM_002976chr21473 ------
NM_002977chr222702 1230 --12401 1401
NM_002990chr16112535 2125 2000 1868 1758 1027 942 437 424 329 323 12583 ----
NM_002998chr821902 1856 22119 1645 11500 1484
NM_003010chr1741608 477 377 346 1332 32344 908 471 --
NM_003016chr1731249 737 465 --1524 --
NM_003024chr212373 293 2845 792 --162
NM_003032chr3102656 2598 2338 2210 2061 1777 1718 756 544 462 2492 68 ----
NM_003034chr12117657 6622 6488 6403 6283 6031 5971 2964 2452 2285 702 26782 110 36479 3118 1633 27742 2631
NM_003045chr1394272 3935 3798 3354 1723 1485 987 933 830 23515 1133 1382 --
NM_003046chr844609 4467 1254 142 22004 1463 --11285
NM_003048chr242635 2074 1101 540 --21981 120 --
NM_003051chr131917 1898 467 1813 ----
NM_003071chr321937 1283 --1829 --
NM_003072chr191309 ------
NM_003074chr381924 1797 1755 1711 1523 830 804 46 1871 --12220
NM_003077chr177771 750 627 262 56 39 32 ----1830
NM_003079chr172205 129 1832 ----
NM_003081chr201905 ------
NM_003088chr761072 786 735 384 358 233 21148 124 1330 --
NM_003090chr15138 ------
NM_003099chr15105770 5633 5599 4730 4440 4151 4126 4087 2322 2275 35367 5336 322 24870 454 21449 537
NM_003107chr652648 1791 817 767 184 ------
NM_003108chr276969 6399 2465 1631 1582 1546 654 1193 34791 477 318 15519
NM_003111chr22424 107 --21295 215 --
NM_003112chr71657 2727 199 --4872 484 244 64
NM_003127chr91114 ------
NM_003128chr242780 2123 1986 1754 22045 297 ----
NM_003129chr81129 --265 37 --
NM_003133chr11403 1242 --1206
NM_003137chr621549 891 ----11992
NM_003144chr612124 --2772 430 --
NM_003157chr31768 --186 --
NM_003161chr1732794 835 826 1895 ----
NM_003174chr10178 --1759 3642 547 194
NM_003199chr1845306 4462 3590 1592 --24102 1047 21232 349
NM_003203chr252012 1850 925 884 219 32492 841 293 --11831
NM_003216chr22103142 2915 2767 2571 2483 2429 1061 834 588 511 22383 2131 1297 --
NM_003220chr621638 1266 ------
NM_003221chr653285 2604 1573 362 228 --33958 551 97 1318
NM_003239chr146882 797 713 657 381 102 --21050 155 --
NM_003242chr342201 2182 1913 726 199 --11968
NM_003246chr1531773 1556 656 --161 --
NM_003255chr1762547 2511 1667 574 267 235 32578 366 86 1175 --
NM_003263chr4----152 --
NM_003274chr213956 742 594 32857 2392 1992 21850 696 --
NM_003295chr132141 22 ------
NM_003298chr395812 5691 5043 4466 4389 3939 1957 1910 381 65327 5026 4272 3776 2422 2242 35574 5562 229 --
NM_003299chr12283 21 ------
NM_003314chr5135 ------
NM_003319chr2--1672 ----
NM_003320chr1174386 3815 3684 3476 3216 1557 38 54316 4216 2995 927 324 1813 21758 1003
NM_003338chr10----11943 --
NM_003339chr531318 296 164 11295 ----
NM_003340chr431046 187 40 1504 ----
NM_003344chr741668 1588 1476 1201 ------
NM_003348chr122523 215 --21590 1360 1637
NM_003350chr83927 809 243 ------
NM_003369chr1142773 2437 2298 2003 12457 12638 --
NM_003370chr19183 1138 1628 --
NM_003374chr52787 656 --191 --
NM_003380chr10----1123 1317
NM_003390chr11--1716 1741 --
NM_003392chr353399 3262 3110 1511 803 23037 1150 12644 --
NM_003404chr201445 --1355 --
NM_003405chr22----1775 --
NM_003410chrX2744 635 --21912 790 --
NM_003411chrY21474 737 --21533 1334 --
NM_003413chrX21763 1700 --21428 776 --
NM_003418chr31683 ------
NM_003421chr1073575 3379 3329 2843 1789 1520 173 13775 1167 --
NM_003441chr44901 499 337 41 41161 418 254 98 ----
NM_003442chr111178 1780 ----
NM_003457chr172453 30 --1171 --
NM_003463chr673270 2451 2206 1168 1083 190 26 --12587 --
NM_003466chr2102459 2241 2156 2141 2100 2059 2032 785 610 52 --22364 1802 11948
NM_003472chr62514 261 1992 11134 --
NM_003474chr1051469 665 574 462 337 21813 376 1720 --
NM_003478chr1153320 3059 2978 92 41 2712 78 23149 2339 12574
NM_003489chr2183256 3077 2927 2151 1045 851 566 25 --1968 11242
NM_003498chr16112643 2493 2283 2133 1928 976 759 723 454 351 53 --12241 --
NM_003507chr261990 1522 759 525 201 129 1449 21502 637 1173
NM_003566chr1253361 701 279 226 92 --1138 --
NM_003574chr1865567 4598 4364 3580 2311 2012 25297 1714 11270 13856
NM_003576chr1352708 2418 1154 793 114 1404 42570 1124 873 396 --
NM_003581chr211067 ------
NM_003583chr1253374 1481 1261 1102 468 22582 1054 ----
NM_003587chr6----185 --
NM_003590chr213020 156 13558 22878 1092
NM_003597chr252111 1786 1630 685 308 22130 2029 1553 11966
NM_003603chr442099 1425 1331 609 ------
NM_003615chr313998 13520 1134 11092
NM_003617chr144969 4024 3648 165 14710 14379 --
NM_003618chr21968 ------
NM_003620chr17--1440 21037 126 --
NM_003626chr1111098 --178 --
NM_003628chr2----1630 --
NM_003634chr2221093 1009 1331 3700 693 101 --
NM_003644chr17175878 5763 5731 5719 5599 5444 5215 5124 4423 2108 2039 1810 1204 1075 386 337 280 31462 1282 619 45159 4692 2538 526 24085 719
NM_003651chr123430 155 147 1234 ----
NM_003663chr312346 22420 1243 ----
NM_003671chr9122943 2521 2486 2459 2248 1396 1377 1087 1013 765 714 150 23112 859 12341 13031
NM_003688chrX132 --1267 1284
NM_003692chr93662 157 98 ----11006
NM_003701chr131415 ----144
NM_003704chr41233 ------
NM_003705chr2------1601
NM_003710chr151255 168 2191 79 --
NM_003718chr71350 ----140
NM_003743chr23327 313 123 ----1764
NM_003749chr1332241 1738 106 12357 1538 1131
NM_003750chr102892 793 1189 2370 209 --
NM_003758chr1511207 1293 ----
NM_003758chr1511207 1293 ----
NM_003759chr454069 3097 2953 736 516 1609 1114 12624
NM_003787chr18--1663 --11608
NM_003791chr16----1428 --
NM_003796chr19------1582
NM_003800chr622184 783 ----2586 361
NM_003806chr12------1224
NM_003818chr204841 350 248 126 1220 1281 1670
NM_003825chr151534 --1305 11171
NM_003831chr1821438 1260 ------
NM_003842chr882229 2098 2013 863 530 445 232 116 --11786 154
NM_003848chr31951 --1153 --
NM_003850chr131144 ------
NM_003861chr1441972 1855 510 452 1557 12631 12478
NM_003864chr4--1146 ----
NM_003873chr101389 194 --1336
NM_003877chr12186 ----1828
NM_003884chr321546 1419 ----11186
NM_003887chr211474 22328 524 32071 782 362 --
NM_003895chr2141642 638 220 198 2799 166 ----
NM_003909chr832982 2741 244 12781 ----
NM_003913chr663454 3414 3022 2878 718 583 14339 13144 13389
NM_003924chr431146 591 482 ------
NM_003932chr2231855 560 314 ------
NM_003934chr92376 243 11220 1232 --
NM_003939chr10103870 3685 3653 2976 2795 993 777 608 421 260 13254 1572 --
NM_003945chr5----1503 --
NM_003958chr6103456 3395 3211 3145 3038 2798 1164 1031 946 358 32808 1225 457 33154 1302 62 11438
NM_003961chr161191 ------
NM_003966chr5145959 5823 4729 2134 1800 1316 871 795 749 528 506 342 318 98 47402 2541 1407 559 22585 1109 15723
NM_003994chr1273391 3229 2961 2824 1582 297 170 23626 798 1104 23477 479
NM_004006chrX32394 1868 1833 --12324 --
NM_004007chrX32394 1868 1833 --12324 --
NM_004009chrX32394 1868 1833 --12324 --
NM_004010chrX32394 1868 1833 --12324 --
NM_004011chrX32394 1868 1833 --12324 --
NM_004012chrX32394 1868 1833 --12324 --
NM_004013chrX32394 1868 1833 --12324 --
NM_004014chrX32394 1868 1833 --12324 --
NM_004015chrX32394 1868 1833 --12324 --
NM_004016chrX32308 1782 1747 --12238 --
NM_004017chrX32394 1868 1833 --12324 --
NM_004018chrX32308 1782 1747 --12238 --
NM_004020chrX32394 1868 1833 --12324 --
NM_004021chrX32308 1782 1747 --12238 --
NM_004022chrX32308 1782 1747 --12238 --
NM_004023chrX32308 1782 1747 --12238 --
NM_004024chr121564 1201 1180 --11271
NM_004028chr1874152 3829 3360 2917 2901 1244 360 12646 14064 23523 3095
NM_004035chr17124571 4436 4042 3760 3641 3331 3244 2041 1703 1563 1396 746 2971 501 21585 767 23388 1485
NM_004050chr1462195 1009 711 301 170 76 11955 2915 399 --
NM_004056chr811092 ------
NM_004065chrX7248 229 212 195 122 85 30 --3302 284 67 --
NM_004067chr731298 631 254 ----11499
NM_004080chr711153 2923 67 --11235
NM_004085chrX------123
NM_004087chr322063 1557 --173 1322
NM_004090chr1773362 3288 2950 2173 1382 1245 861 43249 2684 2318 656 2730 700 13045
NM_004093chr1352085 1105 385 215 208 32194 793 89 22724 587 22671 1982
NM_004094chr1432657 820 729 --1413 11220
NM_004100chr652326 2022 1700 436 277 11019 1121 --
NM_004112chr1781124 559 529 466 413 364 303 21 11521 21093 478 --
NM_004113chr321445 368 --1473 11918
NM_004124chr1483544 3306 3131 3074 2893 2303 1428 53 1313 13156 --
NM_004133chr822228 2089 22622 2460 --12258
NM_004162chr34365 298 244 24 ------
NM_004170chr941815 234 168 146 126 2578 267 --
NM_004171chr11117684 6305 6122 3771 2206 2073 1983 1788 1150 264 251 49608 6591 6347 6269 12566 26197 2672
NM_004193chr101430 ------
NM_004225chr821406 144 11064 ----
NM_004226chr2125 ------
NM_004229chrX22041 1720 --1473 --
NM_004232chr18------13854
NM_004242chr6------1168
NM_004261chr1----1766 --
NM_004267chr31400 ------
NM_004272chr52603 147 ------
NM_004274chr1432735 1194 443 12379 ----
NM_004290chr561336 1127 1090 886 526 421 ----11204
NM_004296chr1473860 3496 3241 3150 2977 2731 925 23488 3036 13989 22571 378
NM_004299chrX136 ------
NM_004311chr1063159 2872 2794 2705 2170 614 12303 21925 752 --
NM_004319chr182733 2715 2123 853 779 671 399 61 11944 22921 480 --
NM_004327chr2261865 1780 635 368 279 23 32016 167 43 1187 --
NM_004331chr832583 1726 588 52467 1898 1889 1046 23 1921 12290
NM_004342chr722079 2041 ------
NM_004352chr162483 131 ----1445
NM_004373chr12151 ------
NM_004379chr231507 1210 570 11472 ----
NM_004380chr1642414 2378 995 282 22534 2009 ----
NM_004384chr511993 ------
NM_004385chr52108 100 1480 ----
NM_004392chr1332414 1657 449 12569 1967 12285
NM_004397chr11114335 3307 2867 2790 1269 1075 1060 1014 766 265 38 23996 3518 53433 2611 1533 1227 104 --
NM_004409chr193672 600 38 ------
NM_004412chr1095833 5073 3912 3827 3693 2309 1095 923 134 32336 2288 1145 36004 5977 1541 26025 2219
NM_004432chr942401 2342 706 683 2798 589 ----
NM_004438chr253028 2584 949 422 212 22078 592 33151 767 364 --
NM_004440chr61477 --11999 --
NM_004442chr171338 1224 1207 1119 596 499 223 11569 11455 2545 374
NM_004447chr12--21123 218 --1973
NM_004448chr172195 175 ----1611
NM_004450chr14140 ------
NM_004454chr331950 1735 142 21400 501 --3784 252 124
NM_004457chr221300 355 ------
NM_004485chr1154368 4283 3170 3035 2950 1675 1561 1426 1342 1124 819 685 600 526 268 33731 3574 451 ----
NM_004498chr151298 ------
NM_004499chr5147 ------
NM_004501chr142524 1311 1151 611 23551 550 23647 1406 --
NM_004504chr292610 2337 2199 1996 1131 1010 471 411 24 21888 450 12990 --
NM_004520chr52253 204 --2703 88 --
NM_004525chr21555 11511 --1271
NM_004529chr911002 --11076 --
NM_004537chr1221566 1117 21180 61 1284 --
NM_004540chr213283 112 46 ------
NM_004549chr1171536 1454 1321 1236 1167 1010 291 ------
NM_004554chr1471844 1437 1227 530 375 266 73 41196 454 433 308 11511 --
NM_004566chr1062496 1994 899 795 379 247 31613 499 387 12281 --
NM_004571chr2131186 585 31 12566 33171 1349 703 --
NM_004575chr421264 1103 --11352 11339
NM_004576chr51123 ------
NM_004586chrX55399 3553 1689 530 198 12156 1922 15333
NM_004588chr1193990 3946 3933 3355 2787 1540 1029 705 494 1882 33849 2929 209 13368
NM_004595chrX3369 342 334 ------
NM_004598chr542407 778 625 230 12571 33261 792 135 --
NM_004612chr984722 4385 3540 3531 3499 3362 746 163 34856 4681 320 1778 --
NM_004637chr321216 334 1359 ----
NM_004654chrY----11303 --
NM_004655chr171431 ------
NM_004660chrY1221 ------
NM_004663chr1541576 1283 501 237 ----1609
NM_004666chr61513 --1992 --
NM_004677chrY2535 165 ----1351
NM_004703chr1751913 974 676 556 378 21024 121 2713 355 --
NM_004719chr1232753 2221 1898 1285 --1752
NM_004726chrX115640 5179 5172 5065 4717 4463 3956 2096 1961 1876 1414 14021 --35736 5073 862
NM_004727chr1572095 2070 2003 790 611 274 206 2165 100 --11738
NM_004730chr54831 518 238 103 ----11962
NM_004744chr462691 1580 690 440 357 116 23129 228 ----
NM_004745chr846467 770 424 322 24966 4381 35338 1856 316 35143 5133 4766
NM_004748chr1531684 1009 965 33502 2583 1190 43680 901 832 332 1843
NM_004755chr141106 ----11080
NM_004760chr761757 1645 1545 680 435 90 12363 12507 --
NM_004766chr3183 ------
NM_004772chr51568 21063 994 ----
NM_004775chr1821700 1524 ------
NM_004776chr2062749 1322 899 839 188 69 --12494 11215
NM_004787chr4------130
NM_004788chr1142353 2239 2141 1769 12320 12166 --
NM_004797chr383537 3404 3327 2861 1021 802 592 464 12736 ----
NM_004804chr242455 1766 1035 266 --32619 2547 1854 11687
NM_004808chr1052813 2761 2673 2534 2348 23221 487 163 1447
NM_004822chr1793760 3426 3357 3337 2521 1146 939 873 195 43385 3236 1066 247 --1932
NM_004824chr62349 120 1133 1367 --
NM_004827chr431737 1708 1610 2462 437 3678 662 603 21274 288
NM_004834chr262671 2498 2083 660 76 60 1292 11015 --
NM_004865chr61149 ----1447
NM_004871chr1754324 3846 3326 2733 677 11294 41333 982 942 54 21099 787
NM_004879chr113728 289 37 ------
NM_004888chr92903 141 ----1848
NM_004897chr105690 333 187 155 149 ------
NM_004904chr796367 6285 6178 4400 1991 1461 1182 792 93 11209 ----
NM_004906chr6------1206
NM_004921chr141949 1912 530 486 3742 623 556 1160 --
NM_004932chr521207 1147 --11196 21759 1113
NM_004949chr1841991 327 165 156 1629 ----
NM_004952chr12816 46 1986 ----
NM_004956chr753970 3954 1520 1437 679 14154 43021 2954 846 820 --
NM_004973chr63554 374 63 --11522 2524 211
NM_004976chr11105158 5064 4746 4505 3255 3234 1630 1586 1512 451 23951 3830 24211 96 24061 370
NM_004985chr1234258 3010 1122 --13112 --
NM_004992chrX117608 7010 6943 6731 6549 6472 6033 5888 5807 1772 1589 28240 8174 48037 5881 2792 2373 15160
NM_004992chrX117608 7010 6943 6731 6549 6472 6033 5888 5807 1772 1589 28240 8174 48037 5881 2792 2373 15160
NM_004999chr643644 381 178 28 24491 3555 24276 1133 23390 498
NM_005022chr17--1195 ----
NM_005028chr1032135 840 489 --11756 --
NM_005044chrX94322 3893 3448 2855 1639 1198 197 51 40 14408 122 1883
NM_005056chr1265460 4866 4187 3826 1334 332 --15557 --
NM_005063chr1033092 2434 446 22596 2387 13810 23106 1153
NM_005065chr1445263 4920 4509 3536 155 35385 694 509 24133 262
NM_005066chr1----1177 --
NM_005087chr31529 --1125 --
NM_005088chrX1759 ------
NM_005093chr2064337 4284 1409 658 364 73 24400 856 24699 940 14042
NM_005095chr14810 679 652 362 21690 72 ----
NM_005109chr362538 2291 1936 1003 724 452 --12438 --
NM_005113chr141399 ------
NM_005114chr41539 ------
NM_005116chr2054525 4357 2833 1772 274 ----23871 938
NM_005124chr62963 889 --1124 1820
NM_005126chr321718 1601 21548 235 --1695
NM_005137chr22102190 1976 1657 1644 815 680 644 595 464 228 --5848 778 615 402 31 --
NM_005141chr4165 ------
NM_005151chr182957 191 --2662 118 --
NM_005153chr161590 ------
NM_005156chr975118 3668 3539 3322 1910 1486 557 25166 815 --1662
NM_005160chr2276774 5913 5509 4545 2657 1901 896 44795 2463 2086 693 21453 554 --
NM_005168chr2----1147 --
NM_005180chr101285 21685 221 1292 --
NM_005188chr1187960 7509 7411 6923 6269 5695 5653 2441 57970 7327 6853 5262 319 47356 5390 2206 1773 26311 2265
NM_005190chr631045 759 293 2121 37 --1209
NM_005197chr1476066 4749 4517 4281 2080 576 179 --35318 4864 4085 15696
NM_005207chr2273132 2858 840 705 620 425 225 22894 239 1147 53098 2759 2403 1468 519
NM_005233chr322632 25 --11959 185
NM_005235chr2107370 6495 6478 6050 5671 4996 2729 2644 1130 1028 35053 2988 451 17302 15371
NM_005238chr1162985 2970 1073 1003 966 901 33518 2717 728 21377 427 12880
NM_005249chr14----1214 --
NM_005254chr151408 ----1932
NM_005261chr81278 ------
NM_005275chr6147 ------
NM_005302chr71421 ------
NM_005311chr762620 2354 342 268 47 31 22246 324 --1787
NM_005313chr1521352 1268 31221 1057 892 1294 --
NM_005318chr2231136 863 136 11294 ----
NM_005324chr1721783 1623 --11726 11810
NM_005336chr272325 2276 2226 1651 725 701 555 --22220 1818 11422
NM_005339chr434027 3241 587 13479 32784 1472 735 --
NM_005349chr41597 1237 ----
NM_005359chr18106017 5338 5239 5153 4959 2467 2425 2345 1696 1025 26091 1641 34735 4462 4027 1956
NM_005369chrX2596 261 ----162
NM_005382chr8--1483 ----
NM_005387chr113246 194 77 1166 ----
NM_005388chr92658 44 2670 308 21395 579 --
NM_005397chr763931 3664 3071 1380 698 68 43097 2916 1301 485 1657 24005 2578
NM_005400chr242977 2484 2277 264 22390 462 32144 1110 574 22127 1157
NM_005402chr731299 639 137 ----1105
NM_005406chr181284 11364 ----
NM_005433chr1822482 122 ------
NM_005436chr1033838 252 90 13863 23850 3539 --
NM_005442chr3----1563 --
NM_005455chr121146 63 2496 485 ----
NM_005465chr131974 1922 550 1808 1292 --
NM_005475chr1212893 11101 42384 2228 1317 138 12056
NM_005479chr1031333 520 39 --41459 1060 188 103 --
NM_005497chr1786009 5332 4962 4607 2231 1743 1658 875 31465 1049 571 22176 145 24541 253
NM_005502chr913121 --11054 --
NM_005504chr1255948 2326 1630 952 56 25750 1757 --15248
NM_005509chr5--11399 ----
NM_005537chr131721 ------
NM_005542chr731491 717 232 1133 21551 43 --
NM_005544chr2----1977 11009
NM_005546chr562360 2081 1633 1576 209 189 --12053 1935
NM_005562chr171393 1292 657 568 333 327 246 11424 ----
NM_005572chr1----197 --
NM_005575chr51120 --1300 --
NM_005578chr334378 3436 1424 35083 3884 653 ----
NM_005587chr151742 11019 ----
NM_005593chr12------1586
NM_005603chr1841958 655 412 21 1639 --11355
NM_005604chr622147 948 21598 266 1879 12391
NM_005605chr8--2316 70 ----
NM_005618chr61429 ------
NM_005626chr12445 22 ------
NM_005637chr1841885 1750 1665 507 11448 1273 1111
NM_005639chr121130 ------
NM_005644chr1140 ------
NM_005647chrX62576 1260 995 591 577 445 22965 256 --11007
NM_005665chr174875 3535 3291 1674 763 627 542 14171 1815 23169 70
NM_005669chr552257 565 242 131 49 1105 --1224
NM_005682chr1641263 1219 389 284 11255 --21389 112
NM_005684chr1146 ----170
NM_005687chr21320 ------
NM_005722chr252144 801 706 637 402 1118 11755 12423
NM_005725chr122053 1619 1267 1231 1676
NM_005730chr1263478 2804 2541 1284 633 89 21021 132 13618 33069 2823 545
NM_005731chr2145 ----1140
NM_005737chr272833 1086 799 774 649 605 510 ----12755
NM_005738chr711258 --21480 550 --
NM_005739chr1511499 1709 --22149 347
NM_005746chr732205 956 660 12573 ----
NM_005748chr1243450 3129 2619 2301 --13267 --
NM_005752chr1621206 376 1964 1928 --
NM_005754chr52973 375 11223 11253 --
NM_005759chr243463 1043 1014 219 --44767 3230 972 319 --
NM_005765chrX--138 1531 1274
NM_005776chr141335 ------
NM_005778chr3----1448 --
NM_005779chr533392 904 239 13320 23454 1430 22890 782
NM_005783chr22466 220 --1424 1211
NM_005808chr333443 3033 81 --52892 2767 2336 698 39 22741 2306
NM_005813chr232436 2128 635 --22260 1028 12576
NM_005819chr193244 2723 2160 1391 1307 1024 896 453 175 21374 105 --13383
NM_005832chr32923 240 ------
NM_005839chr11851 --3868 843 645 --
NM_005840chrX117261 7221 6639 5147 2519 2409 2267 1283 1223 1158 73 --36303 5530 388 --
NM_005842chr131539 ------
NM_005843chr21351 11378 1683 11821
NM_005845chr1331629 1123 53 ------
NM_005863chr103535 368 293 1497 1458 --
NM_005871chr102715 384 ------
NM_005882chr41192 ------
NM_005885chr52323 66 11214 ----
NM_005900chr411041 11201 --127
NM_005901chr1867371 7193 6891 5841 5744 5712 25614 1907 48310 5512 3221 836 13126
NM_005902chr15124380 4246 4111 3379 3291 2998 2979 2838 1281 729 398 70 34081 1405 1042 1336 --
NM_005903chr583804 3691 3524 1763 1501 1193 800 268 24211 1112 14222 11849
NM_005906chr641687 1387 635 130 167 1103 11099
NM_005909chr513919 24046 1235 --1263
NM_005910chr1773753 2822 1378 989 952 643 364 1615 33064 1097 1080 14143
NM_005920chr193580 3567 3342 3122 2362 1076 753 202 189 43478 3018 712 698 23411 742 11305
NM_005927chr5------2876 496
NM_005933chr1132286 289 83 12388 --1914
NM_005935chr454822 4728 4028 964 51 24420 1417 ----
NM_005937chr1754079 2790 949 287 72 53895 3712 3544 576 99 --12835
NM_005941chr82567 377 12839 1608 --
NM_005955chr185274 5044 4755 2109 1975 1893 1057 459 25134 286 35509 3409 1243 2185 28
NM_005962chr1032354 1465 498 32200 1431 230 ----
NM_005962chr1032354 1465 498 32200 1431 230 ----
NM_005963chr17185 ------
NM_005964chr1711058 --11377 1549
NM_005966chr212210 ----129
NM_005977chr131832 ------
NM_005990chr552502 1883 751 415 268 11959 --12756
NM_005999chr141402 1133 418 333 ------
NM_006007chr954012 3912 3674 3082 3039 14124 23192 478 --
NM_006011chr15104111 4031 3506 3491 1474 1446 911 897 662 325 13973 1413 --
NM_006047chr2063215 2920 2889 2448 1096 824 --23338 2378 23326 211
NM_006060chr774383 4329 3734 1327 886 797 119 24257 360 ----
NM_006063chr21352 ------
NM_006080chr71777 22948 59 11903 --
NM_006095chr434210 3809 200 --1976 --
NM_006106chr1162881 2245 2112 1274 1181 292 11213 21371 1347 --
NM_006107chr171436 --158 --
NM_006108chr1132137 1938 815 --2339 272 22100 774
NM_006113chr131701 1460 795 1487 --21997 764
NM_006135chr12577 551 ------
NM_006153chr3--2649 93 ----
NM_006154chr1522414 1907 --12528 32270 577 456
NM_006157chr112164 150 ------
NM_006158chr831605 1265 1255 1582 ----
NM_006190chr21256 11082 2693 285 1243
NM_006195chr91461 ------
NM_006197chr831722 298 175 ----2688 326
NM_006206chr44410 240 46 34 --12017 --
NM_006212chr1145205 4908 4745 3995 3775 1954 1739 1733 1289 1011 794 630 624 510 12095 31727 719 270 13853
NM_006246chr144966 856 474 192 ----21222 1034
NM_006251chr55625 540 473 421 140 --23136 117 --
NM_006252chr186532 5839 5745 5067 2326 967 714 75 --1723 --
NM_006256chr12409 276 1212 ----
NM_006267chr21343 ----21474 1264
NM_006282chr2084770 4590 4104 3300 3081 1792 1099 55 44461 1621 1025 289 44393 2922 632 345 14419
NM_006283chr884182 3506 3394 3217 750 485 228 173 14102 24804 4034 33818 3063 710
NM_006306chrX125850 4411 3720 3688 3589 1227 978 815 742 607 61 30 34180 1609 1125 44798 3734 1098 172 24941 3788
NM_006313chr122404 308 1582 ----
NM_006315chr444403 3255 1047 83 34033 1269 692 23911 1311 --
NM_006317chr51153 1824 ----
NM_006320chr421109 816 ------
NM_006325chr121193 --1217 --
NM_006345chr411330 21369 39 ----
NM_006352chr131885 601 592 2448 99 --11679
NM_006371chr374332 3693 1894 1523 477 343 258 53957 1296 1261 1090 1001 24170 2062 12115
NM_006375chrX21701 283 31535 1504 126 ----
NM_006378chr921305 1103 1397 1945 21436 197
NM_006380chr1773633 3572 3486 3317 2879 1405 90 13338 12696 --
NM_006386chr2281994 1966 1946 1847 767 571 534 269 1874 1215 --
NM_006390chr1231465 1354 397 21818 1450 ----
NM_006393chr1054086 3972 1095 219 164 34142 3494 1107 21189 366 33259 1169 281
NM_006403chr621460 650 31390 167 55 --2532 463
NM_006431chr12128 ------
NM_006449chr221748 1648 11552 --1763
NM_006457chr454056 3974 3838 3536 2581 11478 13051 --
NM_006469chr141529 1334 592 419 ----2239 174
NM_006482chr1253374 1481 1261 1102 468 22582 1054 ----
NM_006489chr1421704 1433 ------
NM_006496chr131587 203 197 21922 664 --21726 1228
NM_006504chr1032685 871 181 12372 1445 --
NM_006517chrX52199 1943 1895 807 289 --22339 261 1232
NM_006526chr2051864 1793 740 230 221 1253 ----
NM_006529chr4----21372 576 11362
NM_006534chr2063424 2876 2416 2224 377 98 ----1278
NM_006537chr151114 ------
NM_006544chr14135533 5453 5164 5033 4900 4144 4032 1839 1599 1001 672 181 134 15096 11212 11350
NM_006546chr17106374 6210 5262 5238 5085 4951 4649 2618 2046 1118 46476 4252 1500 941 ----
NM_006547chr712006 1741 --1830
NM_006561chr1032306 2230 1520 15951 21988 1460 26259 236
NM_006582chr1139 ------
NM_006595chr1131699 1646 257 ------
NM_006599chr16118235 8155 7718 5916 2953 2288 1920 1877 1411 674 630 26230 621 16291 11957
NM_006601chr123943 876 414 11076 ----
NM_006618chr121220 586 --2340 283 --
NM_006622chr52185 148 1473 ----
NM_006625chr1--1280 ----
NM_006625chr1--1280 ----
NM_006625chr1--1280 ----
NM_006628chr15103789 3701 3566 3481 3055 2896 1844 1710 1110 404 14452 13767 --
NM_006633chr52258 39 ----1781
NM_006648chr9--1135 ----
NM_006654chr1274681 4611 4476 4435 4248 1599 295 11470 32926 1005 813 --
NM_006695chr171309 ------
NM_006703chr6--136 ----
NM_006706chr52746 721 ----1159
NM_006713chr51106 ----1569
NM_006717chr953174 1025 932 892 768 13132 31072 1001 682 --
NM_006718chr63807 378 100 --2395 34 188
NM_006720chr1034842 3567 2058 11387 1787 14881
NM_006721chr101573 ------
NM_006722chr311145 32853 1958 361 ----
NM_006726chr42388 53 11217 21154 466 --
NM_006729chrX45588 4741 3566 473 22254 89 11347 24792 518
NM_006738chr1593911 3672 3661 3551 3099 2885 1247 406 300 23727 1407 --23131 1124
NM_006750chr16117893 7809 7339 7315 7122 6949 6348 2214 2007 715 493 46364 6124 1866 908 27636 2307 --
NM_006754chr71972 --1372 --
NM_006756chr831139 558 27 ------
NM_006759chr2----1260 --
NM_006766chr832726 844 189 ------
NM_006775chr633097 2475 1133 12091 --1981
NM_006777chrX42498 694 318 34 22359 2207 22182 1796 1472
NM_006791chr15128 ----1606
NM_006805chr531519 1203 23 --21170 472 --
NM_006814chr2082501 2123 1626 1012 702 348 132 47 1603 11722 --
NM_006815chr1221137 384 ------
NM_006823chr821024 915 2965 925 161 --
NM_006827chr1473064 2751 2531 2107 424 326 57 12617 11226 --
NM_006838chr1261764 1651 475 402 307 145 2696 51 11245 --
NM_006852chr1732594 1858 1782 --172 --
NM_006857chr2----1325 1797
NM_006868chr1843061 2778 508 131 22342 190 1481 --
NM_006870chr202637 585 1659 ----
NM_006895chr221441 115 --22036 162 --
NM_006898chr21793 ------
NM_006912chr142361 2083 1975 378 21588 702 --11704
NM_006918chr11125644 4156 4056 3850 3590 1910 1845 1810 1798 780 663 617 15102 21348 706 23947 123
NM_006920chr221818 776 22008 1700 1645 --
NM_006922chr232630 2572 2031 ------
NM_006924chr1783749 2987 2749 1735 1721 1411 399 289 23911 1709 24012 3349 13412
NM_006925chr141396 --1120 --
NM_006939chr1421049 31 1151 ----
NM_006948chr2162022 2016 1973 473 280 195 --1288 11924
NM_006951chr101244 1135 2119 27 --
NM_006981chr962561 2018 1988 1096 353 294 ----22416 76
NM_006997chr103477 331 21 ------
NM_006999chr521361 1341 ----12096
NM_007005chr931039 619 220 ----1571
NM_007007chr121565 1304 13648 --
NM_007011chr15115420 4598 4502 4489 4273 1592 1291 1101 924 907 168 1774 56015 4633 1969 1504 42 2744 676
NM_007013chr82698 351 ------
NM_007023chr23844 428 398 ------
NM_007026chr171572 --1216 --
NM_007034chr11813 ------
NM_007038chr2135432 4442 37 65850 2409 2390 1290 845 542 --12067
NM_007042chr322551 2098 --12590 2356 24
NM_007045chr6187 --2552 403 --
NM_007050chr20187659 7059 6455 6386 6353 5534 5025 5001 4891 2437 2324 2152 1829 1138 1104 1043 914 516 34966 2028 1250 46724 5423 2594 850 11637
NM_007054chr562906 2772 2687 2485 1373 443 1133 --13441
NM_007078chr1062732 2474 2417 1192 1046 236 11860 2620 127 22969 1912
NM_007084chr1321228 371 1963 1534 --
NM_007096chr9197 ------
NM_007111chr131729 --1720 1784
NM_007114chr3----12230 --
NM_007124chr611451 11635 --1263
NM_007145chr1921197 1022 1345 1465 1302
NM_007146chr17102549 2543 2127 2067 1994 915 906 896 654 154 --1867 --
NM_007150chrX1703 1623 11738 --
NM_007153chr1963208 2999 1752 1618 321 151 33408 658 406 --21084 765
NM_007157chrX42816 1932 137 67 12989 1165 12862
NM_007159chr3----11711 1588
NM_007166chr11--1356 --2343 321
NM_007173chr1141549 940 542 536 --31719 1584 798 12370
NM_007195chr18103632 3538 3072 2574 1499 1489 1431 1297 1180 829 12943 13211 --
NM_007197chr121789 ------
NM_007200chr1593911 3672 3661 3551 3099 2885 1247 406 300 23727 1407 --23131 1124
NM_007202chr171309 --2744 563 --
NM_007203chr953157 1220 1043 341 190 12456 33310 3108 2852 13870
NM_007212chr1--1655 2639 179 --
NM_007214chr631281 1117 903 11370 160 --
NM_007242chr161209 ------
NM_007249chr1387808 7629 6899 6609 1832 1295 385 212 26015 2172 35796 3699 3608 19430
NM_007276chr72810 140 ------
NM_007292chr17124571 4436 4042 3760 3641 3331 3244 2041 1703 1563 1396 746 2971 501 21585 767 23388 1485
NM_007345chr1831855 633 69 --12358 --
NM_007350chr1264281 3834 3582 3433 3343 129 13062 23277 3201 24499 3088
NM_007358chr131886 665 378 1414 11993 --
NM_007365chr141687 1665 1389 103 1632 1363 22201 1761
NM_007373chr1011575 ------
NM_007375chr122205 1004 --12011 --
NM_012069chrX62303 2211 2088 1953 1868 1644 32280 762 629 22556 794 11083
NM_012081chr523211 410 12417 22760 743 --
NM_012092chr251522 1433 488 263 233 21341 1243 1140 --
NM_012095chr1043529 2692 1139 234 --12972 11253
NM_012113chr1------1400
NM_012141chr1363336 2768 1284 918 825 439 1623 ----
NM_012164chr9176738 6594 6157 5681 4735 2781 2735 2473 2338 2253 2059 1929 1751 1309 794 776 747 24876 1333 --11777
NM_012193chr11105243 4491 4376 4223 4190 4058 2178 1319 1303 57 44446 4283 3528 459 53890 1948 1802 961 195 --
NM_012199chr154484 3945 3794 3787 3674 23547 1737 11112 23879 1298
NM_012214chr255807 4026 2582 2486 1723 34279 4218 142 16124 36094 1813 565
NM_012215chr1051930 1906 1713 1591 176 ------
NM_012219chr383084 2663 2590 2167 947 670 643 478 22546 840 23018 536 --
NM_012223chr22196 159 --11120 11100
NM_012234chr333041 1265 360 185 23476 588 22707 2674
NM_012243chr11910 ------
NM_012249chr263523 2451 2217 1291 1269 1024 ----12686
NM_012252chr774152 4104 3965 2046 1993 1637 327 132 ----
NM_012255chr201367 ----1411
NM_012262chr185206 4828 4660 4268 985 495 243 78 23362 684 13909 --
NM_012281chr712437 12421 --12202
NM_012287chr374304 4168 3436 3319 1500 1366 1281 23339 122 13097 24252 3827
NM_012290chr221637 557 ------
NM_012297chr422610 2016 1371 183 --
NM_012302chr1--1454 ----
NM_012308chr1141983 1861 919 727 ----12207
NM_012309chr1184348 4295 3752 1874 1510 1181 667 660 --44948 4640 1630 1055 --
NM_012316chr1125389 4423 4301 4109 4026 1801 1765 1345 1332 658 174 159 24570 123 25245 1364 --
NM_012325chr2031149 1015 505 2292 233 1514 1485
NM_012327chr183647 405 29 --2157 132 --
NM_012330chr1031585 278 266 ------
NM_012334chr5104164 4114 1791 1725 1523 1024 1002 953 511 368 14646 1117 --
NM_012347chr682730 2581 2521 887 553 486 259 155 22250 1978 23023 718 --
NM_012382chr554008 3968 2915 1396 1070 2911 868 1169 180
NM_012405chr1123665 3083 2913 2776 2691 2684 2536 2455 1194 349 179 51 23649 3218 23706 125 --
NM_012416chr911068 1934 1401 --
NM_012417chr171515 ------
NM_012419chr62178 27 2588 84 ----
NM_012420chr1042295 2165 2088 2051 1519 ----
NM_012461chr141762 ----1496
NM_012464chr452610 2515 1034 859 552 21063 399 1754 1546
NM_012465chr1062640 1301 855 814 462 364 --22720 2340 --
NM_012479chr752426 1999 1050 233 208 ----11986
NM_013229chr1262476 1915 918 705 620 589 150 22311 327 --
NM_013230chrY51724 1288 1103 601 225 --21385 69 --
NM_013231chr1434134 3271 3119 21695 674 --1992
NM_013232chr51422 ------
NM_013233chr221073 305 ------
NM_013255chr798118 8040 7932 7444 7042 6478 5573 2017 57 58094 7634 5736 5361 2302 16054 28541 2092
NM_013263chr162174 127 --1114 --
NM_013269chr1253736 3722 1304 947 44 24492 134 1452 1930
NM_013279chr11111966 1781 862 617 547 399 385 315 158 143 85 11747 1872 --
NM_013301chr19----1411 --
NM_013314chr10190 ------
NM_013352chr61861 --1224 --
NM_013374chr342929 2153 2146 2084 --12267 --
NM_013381chr1212406 ----1327
NM_013386chr121489 640 --153 21743 1635
NM_013410chr1----1980 --
NM_013438chr9193 --1185 1516
NM_013444chrX--11042 1725 1374
NM_013445chr2------1133
NM_013446chr711246 11264 ----
NM_013448chr14--1287 ----
NM_013451chr10--1161 --1327
NM_013943chr132134 1222 242 12601 33268 812 446 --
NM_013951chr2102459 2241 2156 2141 2100 2059 2032 785 610 52 --22364 1802 11948
NM_013952chr2112536 2318 2233 2218 2177 2136 2109 1592 862 687 129 --22441 1879 12025
NM_013953chr2112536 2318 2233 2218 2177 2136 2109 1592 862 687 129 --22441 1879 12025
NM_013989chr1433684 1440 1379 34145 2033 434 --44183 3722 964 731
NM_013992chr2112536 2318 2233 2218 2177 2136 2109 1592 862 687 129 --22441 1879 12025
NM_013995chrX52205 1912 1784 1646 376 ------
NM_014003chr16------1390
NM_014007chr951196 348 302 204 65 ------
NM_014011chr23933 288 178 22193 2148 2718 452 --
NM_014016chr34573 449 56 33 11385 ----
NM_014023chr10112689 2165 1975 1920 1857 984 963 598 550 377 225 2406 107 22628 2437 --
NM_014028chr673352 2755 2607 2427 2138 885 187 --12721 --
NM_014048chr1673940 1991 1650 1542 1215 745 147 14049 1615 23994 1520
NM_014059chr13--1328 ----
NM_014071chr201428 131 --1394
NM_014089chr13--22167 1566 21387 131 --
NM_014109chr831038 987 201 21161 939 ----
NM_014117chr1632739 1810 956 12678 31849 1789 1075 11089
NM_014153chr161250 ------
NM_014154chr32625 145 --11467 --
NM_014155chr1177033 6778 6600 4871 1516 1294 1203 22411 1140 45939 1923 1718 736 24767 307
NM_014178chr141108 ------
NM_014181chr232485 2098 1048 1836 21135 62 187
NM_014184chr11117 ------
NM_014213chr2--1211 ----
NM_014217chr121443 1229 1605 1158 --
NM_014233chr1761994 1817 1746 457 451 165 --2710 682 1876
NM_014236chr11155 ----1242
NM_014240chr343879 3305 3151 833 11256 33479 3065 809 1314
NM_014243chr45555 393 292 209 126 ------
NM_014268chr1831084 483 63 ----156
NM_014271chrX3237 64 31 --1154 --
NM_014283chr12395 261 1574 1277 --
NM_014294chr821055 284 21367 500 1475 1911
NM_014299chr19102084 1455 879 766 642 559 417 305 286 276 --1410 11634
NM_014305chr13----1106 --
NM_014309chr2295276 4764 4550 4007 1969 1895 1383 1132 524 13506 2756 669 13871
NM_014319chr1251338 793 498 313 210 ------
NM_014325chr1231757 1479 109 11650 11549 --
NM_014332chrX----1352 --
NM_014333chr1131765 418 71 22401 128 1404 1174
NM_014345chr611071 --194 1671
NM_014368chr951489 862 760 404 218 11988 31561 1376 242 2684 470
NM_014372chr111778 1515 ----
NM_014394chr102407 369 1951 --1174
NM_014418chr1441288 814 506 477 21895 621 ----
NM_014423chr595532 5099 4844 4665 4135 3865 3492 2173 1066 ----24710 4695
NM_014435chr41180 ------
NM_014452chr6----1842 3863 219 26
NM_014469chr11----1194 --
NM_014470chr122228 131 --1756 --
NM_014494chr1632279 724 285 ----22271 871
NM_014498chr3--1286 ----
NM_014515chr121704 --1845 1772
NM_014516chr19284 76 ----1246
NM_014517chr32770 534 1421 1236 1339
NM_014547chr15--1103 125 --
NM_014547chr15--1103 125 --
NM_014554chr1231947 1901 1829 2338 75 --12287
NM_014574chr1441176 572 360 121 --11039 --
NM_014584chr1431236 584 32 11292 11066 1536
NM_014586chr21104399 3274 3040 2954 1668 1405 1095 1088 318 184 23618 3240 54757 4651 4314 3896 922 --
NM_014592chr5----2247 127 --
NM_014607chr231938 634 525 21378 72 --1647
NM_014612chr9134 ----2126 61
NM_014616chr323384 948 12907 --23352 2417
NM_014618chr91410 1147 ----
NM_014637chr841451 1181 1011 376 1521 11136 --
NM_014646chr1852608 2042 234 226 194 32779 2688 845 1119 1891
NM_014647chr1662178 2084 1878 1786 793 546 1835 11897 --
NM_014660chr731152 405 179 --11124 --
NM_014671chr721213 636 ----21484 529
NM_014674chr373608 3262 2966 664 486 356 288 13806 13305 13815
NM_014676chr11650 --11701 --
NM_014685chr161391 ------
NM_014686chr1952534 680 643 621 552 2221 209 --1406
NM_014690chr752675 2612 2443 2013 274 33105 200 140 1733 22875 779
NM_014701chr1522814 2392 --12371 12861
NM_014711chr1631850 297 112 ------
NM_014719chr7----1100 11128
NM_014720chr1011506 --1722 --
NM_014721chr677174 6796 5210 5057 4780 1519 83 3813 398 148 --25650 23
NM_014729chr842144 1763 1415 231 21731 834 21859 154 --
NM_014730chr1295196 4201 3260 1865 1601 1073 571 458 407 35004 3451 3339 1560 --
NM_014730chr1295196 4201 3260 1865 1601 1073 571 458 407 35004 3451 3339 1560 --
NM_014733chr561748 1728 1688 1443 1403 556 --11465 --
NM_014737chr20103947 3423 3381 3338 2849 2647 1312 1093 142 24 2683 577 ----
NM_014742chr203684 431 306 --1103 --
NM_014746chr294400 3379 3244 3159 2845 1755 1004 995 311 22859 1558 14285 --
NM_014747chr185715 4874 4784 995 712 570 225 92 44627 4244 3871 2082 35302 4962 1129 35099 3585 554
NM_014750chr14175 ------
NM_014762chr1102600 2241 2007 1009 782 559 487 465 252 194 32153 2092 740 32543 2108 1806 --
NM_014765chr151873 1814 1005 602 73 ----22271 414
NM_014766chr743802 709 557 539 12530 22400 984 11521
NM_014776chr1232752 2234 1179 --13133 12193
NM_014787chr162606 2399 2044 2000 1920 1764 2877 423 12614 12659
NM_014795chr2--11205 11138 --
NM_014802chr123739 144 135 ----1912
NM_014803chr1012437 11858 --1401
NM_014807chr115831 224 160 148 104 ------
NM_014812chr141221 646 112 55 --12016 --
NM_014819chr512356 1415 1877 --
NM_014820chr331737 702 343 ----11680
NM_014824chr11----11834 --
NM_014841chr63287 221 52 11199 --1338
NM_014850chr3104792 4293 4175 3785 3647 3431 1637 1513 457 230 32964 1791 310 44441 1119 584 120 --
NM_014870chr1134699 4359 3668 3198 3051 2956 2915 2903 1532 1147 1029 859 687 11777 21791 675 --
NM_014877chr17127814 6804 6753 6588 5950 5566 5523 4735 3063 2330 1113 706 25767 1831 47637 5698 5311 1470 15492
NM_014883chr442453 2447 1673 177 2776 218 32068 1751 75 12006
NM_014887chr131764 ------
NM_014888chr731349 1310 1180 ------
NM_014897chr1762867 2804 2727 2594 2509 2169 --12127 --
NM_014900chr211130 1425 1863 --
NM_014904chr1013582 ------
NM_014909chr14113840 3460 3366 2978 2834 2807 2425 788 697 215 60 11248 42535 2470 1186 380 --
NM_014910chr19----1140 --
NM_014912chr1043332 2486 387 32 23530 2845 13279 190
NM_014917chr11983 1275 ----
NM_014918chr1521640 626 ----21547 1288
NM_014921chr1993130 2806 2711 2304 1989 1232 810 790 290 2540 533 ----
NM_014932chr331732 449 412 --11265 --
NM_014946chr222995 461 13125 11921 --
NM_014947chr172324 2316 2057 1179 1044 959 248 11989 --12128
NM_014950chr14----1183 --
NM_014951chr1072589 1995 1821 878 828 553 302 1108 --22393 82
NM_014953chr1344039 3931 431 185 23890 608 ----
NM_014961chr412174 1156 11657 11822
NM_014962chr2032584 346 324 21773 612 1541 --
NM_014970chr1167 1278 ----
NM_014978chr1041720 1344 1157 688 ------
NM_014982chr1444009 3917 3293 2043 24430 57 --35217 3334 932
NM_014988chr442704 2284 648 588 ------
NM_014991chr442758 2506 1290 69 1751 --1351
NM_014992chr14------2741 197
NM_014996chr311052 --185 --
NM_015000chr1242225 2176 496 241 ----12191
NM_015002chr1222224 2105 ----31748 1583 1558
NM_015008chr383382 2749 2400 2355 868 563 475 403 --1288 13292
NM_015020chr16103511 3332 3015 2402 1398 1037 538 486 237 153 2828 557 ----
NM_015025chr212273 21991 572 1878 --
NM_015026chr1264795 3642 1444 1147 909 780 ----24005 3231
NM_015032chr1322935 2421 ----141
NM_015033chr973293 3192 1003 730 602 544 39 --12644 23259 2609
NM_015035chr20146637 6499 6206 5783 5575 4384 2562 2511 1954 1070 1049 873 450 121 11261 1525 140
NM_015039chr1124063 3198 3124 2867 1399 1186 1169 1040 828 412 334 184 11212 33348 3223 1465 --
NM_015042chr15164005 3963 3920 3888 3613 3363 3350 3247 3168 1693 1516 1255 1028 769 752 364 51563 1391 653 510 210 24315 3906 11631
NM_015045chr1052181 1788 311 125 39 12105 ----
NM_015068chr793044 1462 1443 1180 1083 492 311 304 157 23287 1024 23164 1046 12426
NM_015071chr575637 5373 4684 1971 1965 1153 938 35649 1429 892 11593 16143
NM_015074chr184841 4795 4047 3231 1558 1444 969 737 ------
NM_015076chr684437 4159 3317 3003 2868 2783 1778 987 13698 ----
NM_015077chr17134200 4161 4071 3741 3656 3574 3452 3393 3380 2997 1026 729 297 24148 1001 14508 43603 3487 289 184
NM_015079chr1563148 3052 2186 2142 1227 195 32905 2497 1159 13227 11289
NM_015082chr542449 2116 1996 1773 22439 2172 --21898 597
NM_015090chr1136129 5535 5520 5321 4557 4282 4097 2202 1361 949 553 246 224 22341 439 25585 777 1662
NM_015092chr1633567 3492 972 12912 1347 14613
NM_015093chr621797 1178 11299 ----
NM_015097chr311889 12012 194 --
NM_015101chr162676 2643 2599 2297 2041 1940 1892 22891 2626 1231
NM_015110chr942400 2165 2031 1946 22503 2328 --1112
NM_015120chr2130 ------
NM_015130chr4----11243 --
NM_015132chr741500 1439 1212 65 ----1521
NM_015138chr1592243 2237 2193 2104 2095 1809 831 351 92 2340 110 1511 --
NM_015144chr1633168 2839 2740 11140 31167 540 481 --
NM_015149chr13889 614 571 3456 372 173 1732 1605
NM_015150chr31305 1197 --1596
NM_015156chr1453809 2963 1460 358 100 33964 2879 1265 1844 2506 274
NM_015161chr1641579 1468 334 73 11131 ----
NM_015172chr111264 21356 1005 --21483 1456
NM_015199chr342653 2256 1197 491 ----1539
NM_015200chr421024 812 --2821 317 2993 524
NM_015203chr1147 ------
NM_015206chr1523261 607 --1896 12448
NM_015215chr12882 245 13113 12035 --
NM_015226chr1693447 2886 2357 2215 2112 707 438 213 81 1700 12437 --
NM_015231chr11--1644 ----
NM_015247chr1684653 4598 3819 2047 1713 1530 882 679 12109 24224 296 --
NM_015254chr8112973 2714 2665 2434 2319 988 739 512 417 236 29 32700 2104 695 2563 163 --
NM_015264chr22124324 4219 3560 3391 1947 1819 1489 1130 862 739 695 110 21120 574 34576 4137 454 21279 254
NM_015265chr21160 --22451 1942 --
NM_015267chr1211390 --21845 358 --
NM_015271chr474227 3215 2764 961 803 621 50 --1578 1525
NM_015278chr672241 1388 1303 958 330 85 26 33015 2997 2804 32869 2411 692 22784 2456
NM_015285chr1812355 1287 11895 --
NM_015288chr583344 3260 3133 3123 2498 2373 1516 1429 ----2985 687
NM_015299chr14113820 3771 3755 2994 2757 2686 1484 1220 430 390 121 12586 --22839 1199
NM_015308chr111201 ------
NM_015310chr876969 6001 5302 3030 2320 585 420 47949 7449 1134 513 26292 2996 17984
NM_015313chr1153902 1136 721 127 42 --33864 3714 1901 13911
NM_015315chr5112994 2714 1248 1069 1038 1000 874 524 492 323 107 23227 1379 21304 586 1895
NM_015328chr742573 2298 760 370 13066 42360 2031 439 380 1956
NM_015335chr122986 389 1210 1449 32416 2276 583
NM_015338chr2071959 1862 1435 1419 1333 780 183 --2637 591 --
NM_015344chr831942 1773 1759 --1302 1201
NM_015347chr12--1359 --21017 822
NM_015353chr1772649 2242 1959 1083 637 367 309 2973 341 32461 2260 1816 22132 708
NM_015359chr831847 315 29 --21971 251 --
NM_015361chr2172 1799 ----
NM_015365chrX34017 3893 781 24161 3034 33396 3083 1471 11524
NM_015378chr142854 2419 1179 499 1843 11960 --
NM_015387chr2--2691 608 11943 --
NM_015435chr82556 47 ------
NM_015436chr442992 2936 2798 477 2227 22 1252 --
NM_015455chr51112 1294 34112 3870 1110 1511
NM_015458chr834860 4711 536 --23631 3492 --
NM_015470chr271251 461 440 281 177 166 152 11016 1336 1893
NM_015472chr3--159 ----
NM_015472chr3--159 ----
NM_015503chr161199 ------
NM_015514chr145561 539 189 73 59 1159 ----
NM_015520chr352746 1893 446 322 157 ----2930 435
NM_015525chr611049 11013 21036 832 --
NM_015534chr11818 ----180
NM_015550chr732374 961 517 13353 --12498
NM_015553chr6105211 4516 4285 4166 4081 3494 3202 475 251 207 21990 416 ----
NM_015557chr182568 1417 1392 1273 1148 1123 1000 677 43328 2499 1458 1081 13537 --
NM_015564chr532587 1377 879 32485 2415 224 --12960
NM_015565chr212312 58 --2907 547 2198 125
NM_015569chr153632 3614 1325 1272 304 1911 --13588
NM_015571chr611618 --11953 1104
NM_015575chr2143408 2925 2746 2456 1483 1448 1421 1365 1299 1147 967 931 757 63 32902 2265 1378 11042 --
NM_015576chr362336 2145 1952 957 684 138 32845 829 696 ----
NM_015578chr1911426 --2820 225 --
NM_015605chr1031165 572 27 1385 1427 21045 373
NM_015630chr22958 886 1998 ----
NM_015640chr1115152 4659 4221 4095 4013 3531 3490 1670 1576 1131 469 24613 3709 11094 --
NM_015652chr101241 ------
NM_015678chr1311632 11710 11589 --
NM_015695chr631669 1559 1401 ------
NM_015702chr2--1282 ----
NM_015713chr833071 2236 1430 23261 1080 1794 --
NM_015834chr213933 799 766 ------
NM_015852chr711462 121298 1133 1049 965 797 629 545 461 377 209 125 41 ----
NM_015866chr131261 1146 416 ------
NM_015874chr41597 1237 ----
NM_015878chr8----11478 --
NM_015879chr18127846 7834 7569 6790 6509 6445 5925 2854 1297 978 617 278 38377 6806 2471 38309 5322 2097 38229 6361 5693
NM_015886chr845597 1929 1732 966 1604 11011 51794 1499 1038 564 40
NM_015888chr132276 686 584 21335 618 2595 568 13165
NM_015892chr1082242 1877 1693 870 560 410 365 266 1932 1151 1356
NM_015904chr23294 94 27 ------
NM_015905chr72397 121 ------
NM_015906chr164112 3806 3013 1340 391 95 --24766 3110 --
NM_015975chrX2630 501 ----1463
NM_015995chr15105046 4972 3529 1932 1685 1455 1391 1291 723 614 35141 5054 959 35246 2123 329 14808
NM_016018chr83944 652 585 42328 1017 736 147 --1432
NM_016021chr652869 2808 1932 494 324 ------
NM_016025chr162499 55 ------
NM_016039chr14--1196 --171
NM_016045chr2041769 543 343 326 1268 ----
NM_016047chr22140 24 ------
NM_016072chr1222021 615 --22310 435 --
NM_016073chr1541100 1088 991 744 --1825 --
NM_016075chr1352419 1118 730 257 105 --11223 --
NM_016076chr142173 2084 567 233 ----12563
NM_016083chr653954 3593 1047 775 285 ------
NM_016096chr81604 --1882 1203
NM_016106chr14135 ------
NM_016121chr12984 144 --1423 2273 186
NM_016127chr8142 ------
NM_016132chr1542766 2607 2601 1365 --11255 --
NM_016152chr3195 ------
NM_016173chr394482 4222 4176 3784 3565 3479 1383 1343 1078 --34452 606 592 --
NM_016195chr10150 ------
NM_016205chr42983 447 ------
NM_016206chr398075 7845 7746 7518 7433 6419 2689 2063 1948 155 28347 2658 38893 6500 1075
NM_016213chr15----173 --
NM_016217chr642646 2640 1258 340 1444 --52592 2480 1054 687 407
NM_016221chr522195 295 2882 583 1924 12174
NM_016224chr672069 1926 1876 1707 1400 890 490 ----1240
NM_016227chr12395 261 1574 1277 --
NM_016231chr1731128 1066 50 --31447 72 57 --
NM_016235chr1631104 922 326 2307 294 --1126
NM_016257chr1103544 2743 2650 2536 2216 1413 1166 643 482 340 --3729 660 579 --
NM_016258chr11141 1172 1695 --
NM_016260chr2127530 7277 6689 6116 5449 3030 2683 2672 2282 2219 1639 388 15401 24942 837 --
NM_016262chr6------182
NM_016263chr19113422 2737 2614 1358 745 727 373 314 191 146 136 43105 2765 1392 798 1641 --
NM_016281chr122927 291 ------
NM_016289chr232362 2169 2038 ------
NM_016302chr3------2310 63
NM_016308chr121896 1543 21366 120 ----
NM_016315chr211340 1504 11556 --
NM_016322chr941126 738 490 52 1890 13241 22753 2490
NM_016353chr852081 1850 682 284 179 2635 118 ----
NM_016357chr121116 --1366 1129
NM_016374chr141276 650 376 241 ----1220
NM_016374chr141276 650 376 241 ----1220
NM_016376chr1763787 2785 1609 1530 770 122 1313 23467 1187 13141
NM_016403chr114651 480 296 276 1225 1539 1760
NM_016410chr91506 ------
NM_016422chr1132380 1197 480 --33161 591 344 1721
NM_016424chr1711941 --11563 1257
NM_016436chr2042354 2347 359 125 12094 1735 12719
NM_016447chr71176 ------
NM_016448chr1--11795 ----
NM_016472chr1411372 1459 ----
NM_016507chr1732510 2153 910 13205 --1881
NM_016531chr464245 3920 2976 2904 1678 239 ------
NM_016542chrX21243 103 --1128 11565
NM_016545chr13198 180 132 1678 1284 1173
NM_016575chr12175335 5104 4940 4709 4085 3438 3391 2018 1517 1383 1298 917 842 581 282 265 228 1808 23695 2150 191
NM_016587chr72810 140 ------
NM_016603chr531568 789 293 ----1325
NM_016604chr53524 370 84 11141 --1255
NM_016605chr522288 2196 2134 94 1603 12138
NM_016613chr462734 1886 1878 1696 1087 486 --11810 --
NM_016620chr111065 ------
NM_016621chr1194513 4336 3463 3311 3256 3229 1237 548 235 11405 --191
NM_016628chr10194 ------
NM_016631chr21--1359 --1979
NM_016654chr151408 ----1932
NM_016824chr1041635 1581 1497 417 21551 133 1539 --
NM_016834chr1773753 2822 1378 989 952 643 364 1615 33064 1097 1080 14143
NM_016835chr1773753 2822 1378 989 952 643 364 1615 33064 1097 1080 14143
NM_016841chr1773753 2822 1378 989 952 643 364 1615 33064 1097 1080 14143
NM_016946chr1143371 3238 3153 2568 2433 2224 1394 958 921 699 546 505 393 217 22608 1154 12963 --
NM_017412chr831299 1065 170 1131 ----
NM_017415chr543341 781 446 295 33893 806 609 21576 1039 21550 516
NM_017423chr442203 1601 746 117 ----12030
NM_017437chr1432257 2123 2036 --21478 385 11686
NM_017440chr12--1144 ----
NM_017447chr2131588 846 604 --13171 14260
NM_017449chr171338 1224 1207 1119 596 499 223 11569 11455 2545 374
NM_017482chr221575 1379 2256 134 1984 1341
NM_017544chrX2767 139 --1942 --
NM_017551chr1062700 2617 2231 974 554 496 --1867 --
NM_017554chr362054 1931 1836 1757 889 431 1202 1692 --
NM_017563chr395370 4310 4058 3923 2026 1902 1757 866 117 11430 31647 820 461 --
NM_017588chr971832 1718 1542 1462 1418 1196 787 ----31591 1342 529
NM_017594chr923156 2743 51315 1290 1094 1080 241 22047 184 23354 3106
NM_017599chr1231933 1519 1333 2263 70 22073 522 --
NM_017610chr1521910 1585 1557 197 --
NM_017633chr663928 3650 3036 2710 1568 1399 --33799 2622 2560 --
NM_017637chr958880 8147 7829 5704 1464 37327 7018 3027 17075 28804 8343
NM_017640chr64895 732 361 99 ------
NM_017643chr1782114 1142 714 643 633 614 261 92 ----13010
NM_017644chr364664 3917 3712 3518 1891 1463 ----13298
NM_017650chr765351 4893 4102 3676 2098 522 44471 4354 3750 2193 ----
NM_017655chr131535 164 83 11580 ----
NM_017658chr1431302 972 407 13091 11513 13075
NM_017661chr1511209 --2876 48 21036 417
NM_017694chr22209 94 1420 --11816
NM_017709chr134199 3572 156 3982 606 219 33656 1727 1028 --
NM_017724chr32539 184 1803 1330 --
NM_017742chr1831701 1691 1408 11919 11268 --
NM_017745chrX1264 1714 ----
NM_017747chr5152 ------
NM_017754chr674351 3733 3479 3440 3168 3150 847 ----23515 1651
NM_017755chr52661 177 1271 1523 --
NM_017762chr1551768 907 818 494 118 1974 1530 --
NM_017769chr1423085 2772 --2756 481 --
NM_017799chr1421544 699 2579 428 21280 59 --
NM_017801chr341969 1735 579 110 12521 ----
NM_017813chr873696 3661 2072 1987 1441 458 61 --15395 11291
NM_017848chrX43222 1465 1408 1366 11778 43524 1482 285 167 21557 196
NM_017875chr3--2269 104 --2703 545
NM_017896chr2073083 2524 1273 1166 1150 682 557 42596 2315 2232 836 32682 1333 249 --
NM_017902chr10135704 5547 4201 3794 2131 1785 1597 1514 907 481 381 185 148 45338 1955 1863 1417 11580 --
NM_017944chr1133027 1991 526 1487 22931 611 12737
NM_017953chr131083 914 104 11062 ----
NM_017964chr22718 243 --1938 --
NM_017969chr2158 ------
NM_017983chr173465 431 52 ------
NM_018011chr131243 ----1114
NM_018013chr652094 524 479 391 374 12042 --12947
NM_018014chr21222 ------
NM_018017chr1032640 2533 2074 12315 --12517
NM_018018chr12182 134 11480 --
NM_018030chr18----1223 --
NM_018045chr132774 681 24 43091 2283 2030 1138 12655 22804 2231
NM_018046chr521791 1364 ----153
NM_018047chr54882 797 289 66 ------
NM_018061chr141482 1318 1300 536 ------
NM_018078chr41809 ------
NM_018084chr212947 12371 32754 1323 1074 --
NM_018086chr251452 1379 574 358 158 21433 754 ----
NM_018105chr811123 ------
NM_018120chr811368 ----21475 1263
NM_018126chr411315 21490 1236 ----
NM_018133chr311438 1459 21742 833 12181
NM_018155chr313013 12230 13272 --
NM_018156chr142854 2419 1179 499 1843 11960 --
NM_018179chr12------1215
NM_018191chr1342092 1356 248 37 21335 323 1128 --
NM_018195chr1162141 1632 1611 808 377 359 ------
NM_018198chr141431 1087 259 50 1208 2520 347 2574 67
NM_018206chr162639 602 ------
NM_018227chr42286 236 1485 --145
NM_018243chr422644 303 --23596 1176 12549
NM_018247chr643058 1960 1151 718 --13147 1909
NM_018257chr2052622 1741 1684 450 89 21733 781 22334 676 11041
NM_018279chr1232850 2110 2103 32474 887 840 32697 1946 1854 --
NM_018287chr10184 11009 11247 --
NM_018293chr342800 1868 877 777 ----11854
NM_018299chr841242 515 156 94 23070 3037 1789 2955 285
NM_018301chrX4304 143 88 46 ------
NM_018319chr1451562 1539 568 538 314 --1332 1221
NM_018320chr11--11276 ----
NM_018323chr41278 21483 1414 1720 --
NM_018325chr931157 580 540 --11259 --
NM_018327chr201536 ----21237 691
NM_018332chr161145 --1870 1206
NM_018354chr201235 ----1273
NM_018364chr123088 1295 13219 1294 --
NM_018365chr151108 ------
NM_018373chr1496287 6102 5463 4737 2454 1489 1097 1014 727 12407 --14069
NM_018374chr711136 1861 34700 3926 3189 24910 3522
NM_018383chr271530 1489 726 698 251 116 34 ----1323
NM_018393chr11--178 ----
NM_018416chr123688 526 335 32582 2190 469 32183 1674 1046 --
NM_018440chr8158575 8127 7400 7350 7172 6654 6346 2797 2690 1897 1805 1551 910 650 612 38059 7037 5401 27159 3403 146
NM_018442chr11108 --1149 --
NM_018509chr1751717 1427 1392 464 43 1395 ----
NM_018569chr42644 487 11442 ----
NM_018590chr10190 ------
NM_018638chr1234221 2104 702 24765 3882 12162 --
NM_018640chr1242818 2274 1788 282 ------
NM_018660chr862888 2608 2590 2080 804 613 --31172 990 745 1822
NM_018695chr52296 46 12405 21501 582 12183
NM_018698chrX41918 1708 510 158 ----1351
NM_018708chr1921514 1246 ------
NM_018710chr82254 63 ------
NM_018717chr4122606 2114 2033 1101 1056 882 772 719 693 556 513 408 22913 497 12892 --
NM_018834chr5----11036 1307
NM_018837chr202365 219 1337 1156 --
NM_018840chr203308 103 96 ------
NM_018841chr163409 1338 1310 911 268 124 ----23819 803
NM_018934chr51289 ------
NM_018945chr632979 567 333 --1123 11114
NM_018957chr221349 ------
NM_018959chr193765 158 136 --1525 1297
NM_018972chr82691 547 22486 427 1835 22537 1828
NM_018999chr1053856 1833 1484 670 293 --191 --
NM_019000chr541655 1617 1411 580 1445 ----
NM_019001chr354728 4589 4379 3279 1067 11312 ----
NM_019004chr731931 892 429 ------
NM_019006chr151282 ------
NM_019022chr1863126 2787 2458 707 409 170 ------
NM_019053chr1021092 701 --1380 1902
NM_019063chr212172 1290 ----
NM_019067chrX144736 4645 4404 4183 4075 3942 3854 1840 1715 1580 1495 1004 398 366 11956 21243 850 --
NM_019072chr554271 1624 1539 1457 260 1859 13587 13692
NM_019074chr151931 1744 ----
NM_019083chr1------2467 340
NM_019084chr1051951 599 340 292 170 1739 11022 --
NM_019094chr1253206 2406 1499 1282 1073 ----12872
NM_019116chr1673363 3201 3188 2398 2373 1429 421 --32470 1008 93 --
NM_019117chrX23010 2853 23222 114 22969 413 11286
NM_019555chr33232 187 79 --11820 --
NM_019600chr15--1176 --1791
NM_019610chr122072 1587 21563 1494 12178 11458
NM_019843chr222442 96 ------
NM_019885chr242550 2160 1078 563 2516 246 22021 808 12938
NM_019903chr1041635 1581 1497 417 21551 133 1539 --
NM_020122chr254024 3696 1971 718 586 25903 3847 35425 1293 1186 12028
NM_020133chr6116352 6283 6081 5803 5418 4213 4141 2407 2306 1265 463 12469 15645 15310
NM_020144chr731974 1704 524 ------
NM_020150chr103235 228 40 12010 --11753
NM_020152chr214821 759 728 222 ------
NM_020154chr15--166 ----
NM_020159chr411364 --11371 11307
NM_020182chr2043542 2889 2522 2234 --13657 23305 2731
NM_020198chr1721552 450 1184 ----
NM_020199chr531176 487 445 1990 1277 1133
NM_020204chr11225 ------
NM_020205chr132609 1389 1117 23014 125 --1539
NM_020243chr222287 74 ------
NM_020245chr634654 4311 94 34202 1689 123 53959 987 844 238 44 11607
NM_020337chr442740 1071 747 649 22348 2234 22656 2294 13156
NM_020338chr1053128 3074 2369 1282 75 1958 22520 209 32635 2495 565
NM_020342chr231973 968 806 12549 ----
NM_020348chr1072814 2308 1772 797 656 480 375 1273 3762 312 266 --
NM_020351chr31136 1112 ----
NM_020357chr331625 1300 89 --11123 --
NM_020381chr65797 663 578 525 378 --1156 11427
NM_020390chr394413 4007 3582 3467 3044 1187 1050 965 440 11793 11299 --
NM_020403chr131414 ----1310
NM_020416chr442596 2277 950 561 12287 1871 --
NM_020429chr762606 667 644 565 512 96 23059 537 1388 --
NM_020432chr711669 --2478 392 --
NM_020443chr1166949 6241 6228 6001 5952 5866 5749 4578 2710 2651 989 670 505 415 322 273 35272 4608 620 22674 1795 16788
NM_020453chr43255 123 41 31509 1385 663 --12072
NM_020463chr231327 1293 251 ----11367
NM_020466chr694814 4566 4352 4011 3499 1603 1443 1385 1194 11297 --23832 1989
NM_020474chr182778 462 ----1319
NM_020644chr113290 131 116 151 1996 --
NM_020647chr842168 599 197 127 31898 363 163 2609 226 11976
NM_020654chr321386 125 147 ----
NM_020666chr5--3881 662 649 ----
NM_020699chr185370 5026 3948 3831 3669 1945 1762 1430 15043 32088 1972 749 14373
NM_020703chr1------1519
NM_020704chr742554 2183 1695 107 1207 1477 1431
NM_020718chr16116578 6391 6239 5345 5055 2601 1758 1225 850 327 246 35953 5477 898 24755 2393 11732
NM_020737chr61300 ----1245
NM_020739chr1531684 1009 965 33502 2583 1190 43680 901 832 332 1843
NM_020747chr5----1610 --
NM_020748chr1751446 1319 531 195 108 2281 254 1699 --
NM_020749chr852117 1925 502 164 126 --1172 11450
NM_020760chr241944 1809 178 77 21974 163 --11907
NM_020766chrX93880 3770 3673 3380 3361 3125 1140 871 389 13929 --11221
NM_020768chr542660 2457 2409 2135 12649 1414 12914
NM_020771chr6--11060 ----
NM_020772chr1798316 8252 7306 6608 2372 2328 1708 878 620 36478 2083 389 26869 705 37279 1232 835
NM_020774chr1875530 3935 3809 1261 907 869 75 1175 15849 25042 4734
NM_020778chr15104754 4552 3628 1978 1885 1516 1228 1220 1157 307 31392 1105 96 21533 1264 24431 1606
NM_020783chr182324 21 --12345 --
NM_020792chr332180 1894 359 1298 --42820 2799 546 59
NM_020800chr321348 494 ------
NM_020801chr532189 935 868 ----1951
NM_020803chr431498 889 317 --1152 --
NM_020805chr1821950 1466 ------
NM_020806chr14194 ------
NM_020813chr1972772 2045 919 871 701 662 553 1305 32448 1936 1168 --
NM_020839chr321122 1059 ----11451
NM_020853chr1251977 1893 1814 985 866 1315 21946 1864 22115 254
NM_020854chr1841128 504 307 180 11359 11329 --
NM_020872chr3--2513 30 1396 --
NM_020905chr23443 146 112 ------
NM_020909chr2103980 3398 2959 1609 1381 1165 898 278 169 46 33725 1557 957 ----
NM_020921chr1473325 3315 3232 1446 1055 796 114 1442 ----
NM_020925chr12400 368 11330 137 157
NM_020935chr254188 3087 1758 1039 394 33877 2867 542 2717 87 --
NM_020948chr133174 632 28 12454 12531 --
NM_020958chr142301 276 ------
NM_020973chr42570 187 ----144
NM_020981chr21826 --1595 1313
NM_020993chr1242132 2002 946 804 --12679 --
NM_021020chr8163379 3356 3200 3085 2858 2785 2157 1098 1022 902 731 447 401 112 42 27 42989 2365 808 412 23396 942 12774
NM_021032chr321445 368 --1473 11918
NM_021033chr1323512 1243 22427 1179 --13318
NM_021061chr884560 4512 4090 3961 3694 3140 1703 1568 1528 1954 14492
NM_021069chr442099 1425 1331 609 ------
NM_021079chr1782604 2516 2062 1152 927 873 563 23 12030 42371 2182 2115 1312 23225 529
NM_021083chrX73421 3277 2713 727 682 616 42 22912 1193 12289 13501
NM_021090chr22114950 4326 4012 4004 3780 3686 3242 890 678 589 492 11038 193 --
NM_021097chr242140 770 515 498 11959 --12383
NM_021109chrX1373 ------
NM_021109chrX1373 ------
NM_021116chr7168697 8647 8420 8109 6094 5865 3347 3240 3168 2823 2801 2201 1530 1310 607 23 56208 2852 2033 1210 246 39079 8291 703 33637 3259 533
NM_021148chr732151 965 880 174 --2735 451
NM_021155chr1972194 1153 838 701 616 416 259 --169 12558
NM_021159chr4--1412 ----
NM_021163chr732717 1117 262 33449 2800 347 2830 560 11271
NM_021167chr762687 2641 2585 2374 2285 2250 32141 2046 207 12423 --
NM_021175chr19172 ------
NM_021179chr1148 ------
NM_021183chrX173 ------
NM_021190chr11447 --1885 --
NM_021191chr1222187 579 --2919 626 22479 2149
NM_021194chr11301 ----1223
NM_021222chr12962 72 ----1473
NM_021239chr1421383 478 11420 ----
NM_021245chr10152 ------
NM_021255chr1453459 3136 2915 834 544 23099 118 ----
NM_021574chr2261865 1780 635 368 279 23 32016 167 43 1187 --
NM_021627chr31223 ----1779
NM_021629chr333912 948 667 23746 2002 1815 141
NM_021639chr12768 745 ------
NM_021647chr454569 3769 1271 1261 168 24591 915 33696 3414 1768 --
NM_021705chr631047 627 599 ----21516 1149
NM_021738chr10178 --1759 3642 547 194
NM_021813chr6115126 5065 4670 4354 2224 1985 1762 1623 1332 1175 676 1524 ----
NM_021818chr14----1468 1414
NM_021831chr21114 ----1353
NM_021911chr531875 1233 660 23485 76 25488 303 14883
NM_021912chr1543721 3467 1591 1390 --13310 --
NM_021914chr14264 24 1880 ----
NM_021940chr631610 1582 632 ------
NM_021942chr4--1874 --1719
NM_021945chr652719 1408 664 375 35 12398 13097 43350 2224 336 191
NM_021949chrX32732 2644 2044 123 --11049
NM_021956chr621063 580 --1400 --
NM_021961chr11106953 6032 5903 5467 4582 2911 2852 2458 2310 1042 26517 4740 11922 --
NM_021964chr376421 5828 4946 4166 2562 2519 2122 11599 21472 1064 --
NM_021965chr921004 922 ----1102
NM_021973chr4----1119 --
NM_021979chr141107 1320 ----
NM_021998chrX11044 2534 476 11394 --
NM_021999chr131289 --1568 --
NM_022048chr1556027 1959 1548 1523 79 25450 480 11845 --
NM_022073chr14----11535 21399 502
NM_022090chr51484 ------
NM_022093chr12914 236 1323 185 2384 333
NM_022114chr124706 802 33474 3384 601 11728 13940
NM_022130chr51323 ------
NM_022133chr82391 237 --11762 --
NM_022138chr651481 1413 1217 585 399 21281 231 ----
NM_022153chr10153604 3396 2789 2593 2445 2310 2284 1209 1027 884 602 505 167 119 40 33241 950 743 --1778
NM_022166chr1685695 4661 4527 4348 1931 1287 805 454 35543 4946 1379 13972 34540 4342 4125
NM_022337chr11----1509 --
NM_022366chr1------145
NM_022373chr71889 1988 ----
NM_022456chr12127576 6891 6669 6460 6016 5639 4809 2633 1993 1639 1123 949 67376 7078 5891 2188 1229 838 17231 --
NM_022457chr11119 ------
NM_022459chr1344117 1599 114 107 15828 15047 --
NM_022462chr19133139 2885 2293 1490 1310 1244 1150 930 638 555 376 190 179 --33682 3048 217 --
NM_022473chr1582728 1253 1192 955 809 491 190 145 11113 21651 238 --
NM_022476chr161997 ----1161
NM_022483chr531857 404 328 ----1317
NM_022491chr1253481 1064 848 748 615 2120 100 138 23067 2952
NM_022496chr12--1418 ----
NM_022497chr362778 2725 2704 2611 381 56 1102 1810 2395 111
NM_022576chr11328 ------
NM_022652chr1241136 1025 271 27 --2368 191 2860 467
NM_022659chr81347 ------
NM_022716chr152878 2448 2440 1986 1250 --1207 22864 2688
NM_022726chr611105 11346 ----
NM_022739chr171823 --11207 --
NM_022753chr142538 2070 1885 98 --12465 1148
NM_022763chr311987 ------
NM_022771chr121265 1298 ----
NM_022776chr31613 ------
NM_022781chr923308 209 --13097 12857
NM_022817chr271615 1583 1447 880 653 404 55 ------
NM_022826chr22964 888 ------
NM_022843chr1331101 298 47 11234 ----
NM_022893chr221060 552 33114 2796 644 ----
NM_022898chr1474267 3978 3690 3488 1325 825 679 --14582 1840
NM_022900chr7--2449 167 --2842 79
NM_022912chr252917 2026 1181 940 850 22693 2600 ----
NM_022918chr1131632 594 220 ------
NM_023009chr1------1736
NM_023033chr123571 499 416 --1435 --
NM_023076chr1672589 2380 2180 1157 363 147 113 12481 22819 2200 12289
NM_023915chr3121 ------
NM_023929chr83641 61 37 22287 626 ----
NM_024007chr532937 1970 173 22486 679 11125 11229
NM_024086chr17133698 2969 2817 1499 1414 1328 1043 753 566 427 338 297 47 31335 548 22 22945 524 --
NM_024094chr8----1643 --
NM_024315chr7169 ------
NM_024332chrX21641 1446 11390 21459 611 11223
NM_024345chr975973 5426 5127 5070 4659 3911 1271 12404 ----
NM_024408chr163576 2407 2392 963 407 278 31445 1395 719 2955 99 1673
NM_024482chr1139 ------
NM_024523chr751171 456 276 120 24 1477 --11094
NM_024529chr111197 --1417 127
NM_024545chr22273 25 ------
NM_024546chr13198 ------
NM_024563chr531851 1574 147 11477 --11339
NM_024573chr62819 235 1937 --1949
NM_024576chr61154 ------
NM_024582chr4------1257
NM_024586chr1----1576 --
NM_024612chr171935 ------
NM_024613chr82653 265 ----1458
NM_024636chr742340 1792 1118 176 --1499 --
NM_024645chr841244 1174 469 217 ----31510 995 155
NM_024665chr341046 328 262 219 1674 14157 --
NM_024674chr182749 2351 2219 2136 1039 887 591 218 13227 22470 2302 --
NM_024675chr16260 32 ------
NM_024680chr11173 ------
NM_024692chr231322 569 562 --2421 250 --
NM_024700chr1145 1979 ----
NM_024721chr811895 --2625 262 12659
NM_024740chr11163699 3586 3567 3058 2973 2578 1571 1418 1262 1256 829 801 592 136 127 121 22767 2542 11508 13514
NM_024744chr232498 2190 759 1315 11055 1847
NM_024761chr9115042 4915 4777 3611 2114 2008 1905 1165 452 444 337 --122 24972 2016
NM_024770chr2106650 6411 5916 5901 4700 2569 1805 1689 1547 1462 25522 5366 ----
NM_024798chr1592514 2297 2083 2038 1083 726 592 507 172 12408 1959 12920
NM_024808chr133904 763 178 186 --1891
NM_024824chr142649 98 --139 11629
NM_024828chr921296 1245 --11060 --
NM_024835chr171372 ------
NM_024841chr1151558 876 681 408 283 21687 572 1354 1535
NM_024854chr121290 11247 11523 --
NM_024884chr1464096 3204 2956 1296 1190 1054 13084 12825 23977 1472
NM_024900chr462032 1947 1750 1626 1516 919 --1908 --
NM_024900chr462032 1947 1750 1626 1516 919 --1908 --
NM_024930chr522759 1800 12040 11925 3793 421 412
NM_024944chr2141143 959 76 39 ------
NM_024947chr3149533 8917 8651 8467 8182 7647 7567 7432 6970 6964 2181 2094 1268 1240 --27921 565 16404
NM_024949chr473926 2010 1554 1174 907 486 463 34254 3687 3154 14032 11538
NM_024953chr1232646 1054 209 1452 11986 12169
NM_024963chr7215909 5520 5269 4798 4192 4103 3949 3809 3602 2390 2355 2308 1860 1740 1709 1122 858 596 336 209 58 35396 2262 764 ----
NM_024989chr2126505 6265 5978 5544 3123 2443 2309 2224 2048 2001 1455 99 57088 5467 3094 1800 892 23147 1116 --
NM_024993chr241498 1239 1065 227 11375 ----
NM_025054chr824135 260 24121 2773 ----
NM_025057chr142872 202 ------
NM_025080chr111389 21007 94 --11073
NM_025114chr121131 166 ----
NM_025133chr2--1927 163 --
NM_025134chr1622436 39 ------
NM_025146chr322650 520 12369 ----
NM_025154chr741297 385 61 43 ------
NM_025160chr131501 1145 834 13905 31082 798 730 1375
NM_025179chr1114736 3639 1861 1682 1304 1105 1083 1035 669 189 56 54378 1799 1257 756 26 14245 23404 3119
NM_025212chr4------136
NM_025235chr1011736 1799 21893 1623 --
NM_030576chr1782619 2079 2057 2045 1914 987 277 41 11851 1956 1197
NM_030579chr1653686 3130 2998 2646 2634 --13389 22591 2377
NM_030621chr1433916 3402 3372 --2712 185 11281
NM_030625chr1022150 878 --22330 921 --
NM_030627chr511078 23291 251 13756 --
NM_030634chr121702 1550 42209 647 296 250 --1398
NM_030647chr7195987 5753 5115 4381 4121 3977 2305 2126 1966 1835 1474 1272 1200 899 517 185 87 63 34 1244 1399 1411
NM_030648chr455493 1954 1394 1296 32 11404 24729 4446 23919 1472
NM_030650chr234072 3374 466 23507 1184 33499 1484 1461 --
NM_030670chr1262168 2030 1780 1600 877 596 11992 --1750
NM_030671chr1262168 2030 1780 1600 877 596 11992 --1750
NM_030780chr831619 625 540 ----11497
NM_030790chr16--1128 ----
NM_030791chr143699 642 246 11679 --11159
NM_030799chr511414 --11706 21874 1632
NM_030806chr1229228 9179 8022 7892 7621 7605 7263 7242 6898 6444 6276 5925 3717 3195 3145 2660 1655 1468 1421 1150 598 502 38184 8032 2777 39021 8523 6564 --
NM_030816chr133133 2619 976 ----12552
NM_030820chr61189 --1726 --
NM_030877chr20183 ------
NM_030881chr2281994 1966 1946 1847 767 571 534 269 1874 1215 --
NM_030885chr332294 1499 696 ------
NM_030918chr1124701 3836 3769 3715 2095 1955 1914 1871 1148 484 343 59 14198 2989 355 1473
NM_030922chr152722 134 ----1814
NM_030925chr1371969 1840 1781 748 498 129 96 1363 ----
NM_030937chr141400 1202 1063 217 ----3978 174 141
NM_030939chr641194 1144 959 933 ------
NM_030940chr91201 193 11049 --
NM_030945chr522017 1710 1286 11661 12648
NM_030953chr531622 1459 501 --11054 --
NM_030958chr8--1470 ----
NM_030965chr13696 553 283 1628 ----
NM_031157chr12----1438 --
NM_031216chr1821630 805 --11953 1372
NM_031243chr711854 ------
NM_031266chr5147 ------
NM_031267chr71350 ----140
NM_031268chr16114492 3369 2122 1664 1438 1406 1176 781 763 756 456 --24372 3850 11882
NM_031284chr152795 723 1311 2606 77 --
NM_031296chr462001 1734 1048 915 830 526 1323 --12599
NM_031371chr141276 650 376 241 ----1220
NM_031371chr141276 650 376 241 ----1220
NM_031407chrX2427 360 ------
NM_031422chr182518 492 1443 --1223
NM_031427chr14115730 5696 5532 5178 4581 4024 3712 3633 2099 1934 627 1529 ----
NM_031435chr1222897 2634 13436 ----
NM_031438chr511805 21972 309 1683 --
NM_031442chrX43108 2071 2010 308 21034 602 12398 --
NM_031445chr262674 2625 2370 1327 421 332 11141 13267 12907
NM_031468chr7137675 6692 6661 6375 6255 6102 5661 2977 2530 2102 2006 1870 948 67455 6492 5858 5609 3145 2358 2989 715 36275 2474 2448
NM_031483chr2032354 551 450 --31402 778 644 12319
NM_031844chr142524 1311 1151 611 23551 550 23647 1406 --
NM_031885chr16172 ------
NM_031911chr432641 1826 44 22549 1865 ----
NM_031914chr142843 165 ------
NM_031946chr71423 ------
NM_032017chr121582 292 --12127 21461 518
NM_032041chr852549 2190 2177 502 477 --1896 32495 1945 661
NM_032102chr1152364 1908 1081 252 86 12678 ----
NM_032116chr1385406 3986 2293 2078 1954 1458 892 462 25572 1154 23707 84 15110
NM_032153chr321891 187 ----12780
NM_032154chr101163 11028 2394 363 --
NM_032160chr1874067 3875 3742 3657 1335 762 686 34300 1003 991 1937 1571
NM_032175chr52131 40 21710 360 2398 257 1345
NM_032182chr1041393 1272 174 78 1313 --11148
NM_032186chr111065 ------
NM_032199chr1032937 2452 344 12656 12394 11199
NM_032208chr253646 1257 1042 419 22 --21443 567 1499
NM_032217chr43509 256 42 ------
NM_032228chr1143143 2949 2379 403 --21397 321 --
NM_032239chr42575 230 1327 ----
NM_032288chr342145 1636 827 568 ----22322 1657
NM_032291chr1124 ------
NM_032329chr294391 3855 3805 3359 3076 1639 1525 566 420 22772 1749 44443 3023 1280 951 1740
NM_032357chr22711 275 ----1645
NM_032373chr1075878 5253 5194 4717 4548 2282 1763 11345 ----
NM_032408chr731262 233 122 ----1871
NM_032433chr1921230 1041 --2330 166 --
NM_032435chr152039 1666 549 213 192 --11833 --
NM_032439chr1021680 1160 ------
NM_032440chr1032038 1190 416 1439 ----
NM_032446chr582773 2532 2504 1536 1267 1172 120 30 ------
NM_032449chr142074 1887 958 475 22211 171 1544 22517 77
NM_032458chrX32579 2145 633 1360 12867 1556
NM_032487chr3259 22 --177 --
NM_032509chr842271 1918 1904 1795 --42305 1867 272 167 --
NM_032574chr2193 ------
NM_032626chr161361 ------
NM_032632chr1431954 1383 291 21907 1853 --1322
NM_032635chr19------176
NM_032638chr381470 1207 1079 1016 596 443 240 129 ----11006
NM_032682chr311161 139 1108 13187
NM_032717chr4----1315 1930
NM_032737chr1942332 1837 1740 254 22707 2153 21816 865 12109
NM_032778chr333185 1037 870 --22691 319 --
NM_032800chr172422 2389 2179 2032 1781 858 774 12549 32502 2162 226 1133
NM_032801chr1132476 610 558 21944 898 --12367
NM_032804chr1032000 240 98 12537 12186 --
NM_032824chr22810 111 --1313 1215
NM_032833chr142371 2228 1862 1726 31975 1025 332 --22144 832
NM_032859chr1342965 2795 715 535 23509 166 11195 --
NM_032869chr831261 62 55 2141 34 ----
NM_032873chr1194307 4152 1193 800 717 290 231 204 36 --33301 3246 2775 --
NM_032884chr1164 ----195
NM_032900chr1093702 3643 2711 2559 2503 1530 1262 1234 617 13188 32517 1150 963 --
NM_032905chr1021195 114 --1906 --
NM_032906chr42717 279 ------
NM_032918chr1251261 974 434 113 95 134 ----
NM_032932chr17145016 4403 4001 3951 2587 2302 1937 1630 1453 991 354 312 258 40 21647 1216 22150 542 16274
NM_032949chr132395 120 ------
NM_032967chrX----1390 --
NM_032971chrY----1417 --
NM_032972chrY----1417 --
NM_032975chr1853626 3562 1355 1296 1071 22990 554 11458 12513
NM_032978chr181767 1234 --21077 79
NM_032979chr181767 1234 --21077 79
NM_032980chr1853626 3562 1355 1296 1071 22990 554 11458 12513
NM_032981chr181767 1234 --21077 79
NM_033012chr131415 ----144
NM_033020chr164112 3806 3013 1340 391 95 --24766 3110 --
NM_033030chr2--11037 ----
NM_033036chr1151566 1280 1200 1157 304 ------
NM_033121chr1221656 1194 ------
NM_033133chr1783746 3392 2795 2788 1174 972 553 483 33506 3168 2485 22376 963 23310 1062
NM_033138chr722079 2041 ------
NM_033139chr722079 2041 ------
NM_033140chr722079 2041 ------
NM_033143chr473978 3803 2937 1262 1079 511 328 ------
NM_033157chr722079 2041 ------
NM_033181chr653954 3593 1047 775 285 ------
NM_033207chr1052683 2557 2237 603 38 --1127 --
NM_033222chr91879 --1563 --
NM_033224chr7117274 7074 6861 6725 6636 6585 6350 5954 1384 482 316 37389 6150 1129 15127 15646
NM_033253chr21339 ----2147 123
NM_033274chr583172 2581 2408 2235 1232 738 179 41 33335 1444 1205 33456 2255 1184 --
NM_033285chr834462 3416 1754 23727 3289 2850 599 2746 232
NM_033290chrX82930 2778 1456 1336 1306 1002 601 30 1662 1725 --
NM_033305chr91116 --11261 --
NM_033326chr1152501 2125 2027 1659 326 ----1711
NM_033331chr9122943 2521 2486 2459 2248 1396 1377 1087 1013 765 714 150 23112 859 12341 13031
NM_033360chr1234379 3131 1243 --13233 --
NM_033389chr1774693 4303 3635 3094 2947 1143 195 34208 1817 1275 14702 --
NM_033393chr452690 1907 1001 856 30 32811 2717 2097 158 --
NM_033394chr211260 --1652 2416 34
NM_033425chr1141379 1314 1089 722 --22409 219 22158 338
NM_033430chr443670 3645 1459 1361 12970 1385 --
NM_033437chr443670 3645 1459 1361 12970 1385 --
NM_033480chr682730 2581 2521 887 553 486 259 155 22250 1978 23023 718 --
NM_033481chr682730 2581 2521 887 553 486 259 155 22250 1978 23023 718 --
NM_033503chr1563729 3411 2963 2783 779 199 33378 2753 1015 43745 3621 1211 47 1342
NM_033505chr2116491 5876 5574 5541 5218 5019 4927 4667 4444 1313 161 11620 56632 6405 6208 5969 390 --
NM_033512chr862206 1938 760 686 511 110 12074 12919 22933 1054
NM_033551chr5112994 2714 1248 1069 1038 1000 874 524 492 323 107 23227 1379 21304 586 1895
NM_033624chr1222224 2105 ----31748 1583 1558
NM_033631chr1102783 2754 2669 2655 2412 1092 724 666 628 358 33789 803 116 --13416
NM_033637chr10103870 3685 3653 2976 2795 993 777 608 421 260 13254 1572 --
NM_033656chr2134251 2101 1682 15042 --15579
NM_052821chr971832 1718 1542 1462 1418 1196 787 ----31591 1342 529
NM_052832chr812163 42399 690 559 154 1364 --
NM_052834chr1812355 1287 11895 --
NM_052845chr1262827 2653 2213 1280 332 73 22182 324 31027 524 426 12550
NM_052857chr17----1388 1161
NM_052875chr11112178 2024 1707 1518 797 629 609 577 377 254 239 --11862 21396 158
NM_052879chr1253238 334 194 138 76 11591 11264 13173
NM_052896chr152178 1863 1717 886 144 41917 763 753 189 11839 1662
NM_052898chr821563 1342 ----1555
NM_052900chr811464 135 --11538
NM_052907chr1294206 3636 3163 2926 910 755 600 151 56 33333 1483 217 24119 517 34233 842 183
NM_052911chr181824 1149 ----
NM_052918chr1033391 2763 1086 22306 1313 1385 21379 527
NM_052927chr531448 598 343 1826 21405 315 11599
NM_052937chr832715 2358 1664 32725 1885 209 --11876
NM_052958chr8----1720 --
NM_053016chr9116334 6273 6162 5051 3196 2017 873 326 273 95 28 16112 47637 5877 5327 3024 11277
NM_053023chr1162893 2083 916 885 693 352 --32779 1093 486 --
NM_053043chr7136180 6129 5482 5328 4594 4445 4179 4045 2178 1350 1200 1139 195 46141 4664 3948 545 16410 --
NM_053056chr1123059 2572 --12584 11995
NM_053064chr1442220 375 221 40 21059 832 --1121
NM_053067chr9193 ------
NM_053279chr8102712 2261 1150 774 647 340 318 115 50 31 ----22115 898
NM_054014chr20------1377
NM_054111chr65865 717 269 31 21 --3312 259 177 --
NM_057169chr1232752 2234 1179 --13133 12193
NM_057170chr1232752 2234 1179 --13133 12193
NM_057175chr442186 1966 556 34 --2994 303 --
NM_057178chr1772636 1864 1775 662 656 515 55 21031 726 1691 --
NM_057749chr83351 344 28 ------
NM_058170chr111357 1178 ----
NM_058172chr411548 1577 21209 103 --
NM_078470chr1072569 2384 2052 1938 737 650 25 1573 --11657
NM_079421chr191471 1540 ----
NM_080391chr12253 143 164 177 --
NM_080544chr341369 1183 1115 58 1103 2288 189 11043
NM_080546chr931985 1717 864 12124 12209 11776
NM_080597chr18----1223 --
NM_080616chr201229 --2253 196 --
NM_080617chr203285 198 61 ------
NM_080654chr1121282 185 --11202 --
NM_080666chr1431242 1167 458 1125 --11142
NM_080678chr2----1575 --
NM_080743chr642299 2092 283 148 12507 --12522
NM_080759chr1332414 1657 449 12569 1967 12285
NM_080760chr1332414 1657 449 12569 1967 12285
NM_080792chr2072317 1778 1729 1431 1420 618 221 52237 2136 649 525 260 31878 537 119 --
NM_080822chr171321 ------
NM_080867chr1495078 4489 4459 4292 3827 3609 3502 803 78 13999 1684 --
NM_080872chr843436 3422 254 223 1320 --12867
NM_080927chr342372 2055 555 474 23183 3145 ----
NM_100264chr10194 ------
NM_100486chr10194 ------
NM_130385chr1182608 2416 2372 748 734 460 454 258 22882 209 1533 12826
NM_130387chr3168 ----11076
NM_130391chr933399 2368 21 --1850 --
NM_130392chr933399 2368 21 --1850 --
NM_130393chr933399 2368 21 --1850 --
NM_130434chr15------11045
NM_130435chr1032685 871 181 12372 1445 --
NM_130436chr212893 847 12082 ----
NM_130438chr211364 12659 ----
NM_130439chr1032354 1465 498 32200 1431 230 ----
NM_130439chr1032354 1465 498 32200 1431 230 ----
NM_130781chr52201 70 ----1412
NM_130798chr151534 --1305 11171
NM_130811chr201905 ------
NM_130830chr393193 2990 2913 2883 2517 1385 1110 820 42 2657 52 12978 21249 703
NM_130847chr11115299 4963 4505 4118 3758 3667 3653 2249 1849 569 367 11770 13681 14860
NM_133170chr20187659 7059 6455 6386 6353 5534 5025 5001 4891 2437 2324 2152 1829 1138 1104 1043 914 516 34966 2028 1250 46724 5423 2594 850 11637
NM_133265chrX82694 1200 737 707 661 557 263 135 43364 3094 519 461 32315 690 393 1635
NM_133266chr1131121 341 125 --21090 913 --
NM_133329chr241838 1573 660 364 21593 450 ----
NM_133330chr411999 ----23242 518
NM_133331chr411999 ----23242 518
NM_133335chr411999 ----23242 518
NM_133338chr5------1467
NM_133339chr5------1467
NM_133340chr5------1467
NM_133341chr5------1467
NM_133342chr5------1467
NM_133343chr5------1467
NM_133344chr5------1467
NM_133367chr693162 2336 1214 1126 890 464 397 200 47 32856 2279 364 ----
NM_133370chr462944 2756 2713 1272 685 337 1174 11287 --
NM_133378chr2--1672 ----
NM_133432chr2--1672 ----
NM_133433chr51116 2299 255 ----
NM_133437chr2--1672 ----
NM_133443chr1652015 828 744 511 470 42262 1405 389 139 --2338 279
NM_133445chr973275 3081 2970 2525 883 745 602 23152 2789 11460 --
NM_133450chr16--1360 --1377
NM_133478chr222189 256 22392 331 22312 625 1460
NM_133493chr674409 3879 3388 3051 1523 1143 259 31857 518 391 23456 1771 --
NM_133496chr184483 4471 3033 2948 2799 1095 940 722 34193 488 425 23362 401 14361
NM_133503chr121273 186 ----
NM_133504chr121273 186 ----
NM_133505chr121273 186 ----
NM_133506chr121273 186 ----
NM_133510chr14173 ------
NM_133631chr31525 1664 11096 --
NM_133633chr2231181 827 133 ------
NM_133645chr62497 283 1606 ----
NM_133646chr245481 4745 1660 1548 ----34546 1976 40
NM_134428chr91127 ------
NM_134442chr231507 1210 570 11472 ----
NM_134447chr19------1582
NM_138287chr392551 2227 2142 967 882 643 471 298 213 --21685 164 11706
NM_138323chr151162 1672 1111 1635
NM_138338chr2273068 2357 2123 1176 1161 580 318 23420 1138 --11389
NM_138346chr11167 --189 --
NM_138357chr104667 584 241 80 --11846 --
NM_138426chr71543 ------
NM_138444chr13144542 4236 4173 3858 3691 3152 1761 1422 1077 570 479 323 208 189 --34644 3983 1323 --
NM_138455chr8147 --1257 --
NM_138457chr6103203 3052 3039 3018 2981 2866 2811 2673 2588 1103 ----12097
NM_138468chr246211 5778 5337 596 11885 14302 2482 344
NM_138473chr1274481 3661 3634 3546 3487 1138 474 21901 919 14784 --
NM_138479chr151752 1720 1595 1560 710 41892 1810 1578 294 21624 779 1803
NM_138559chr21212 ------
NM_138569chr6----146 --
NM_138576chr1474267 3978 3690 3488 1325 825 679 --14582 1840
NM_138635chr7103065 2887 2022 1293 797 662 578 369 270 70 22607 353 ----
NM_138638chr14264 24 1880 ----
NM_138694chr661247 1090 857 345 92 56 1790 12318 12616
NM_138713chr16118235 8155 7718 5916 2953 2288 1920 1877 1411 674 630 26230 621 16291 11957
NM_138714chr16118235 8155 7718 5916 2953 2288 1920 1877 1411 674 630 26230 621 16291 11957
NM_138731chr1444187 1602 1128 23 13643 23450 1665 --
NM_138771chr71375 1984 11505 --
NM_138782chr532312 1959 1895 1928 ----
NM_138786chr3--1340 --1332
NM_138959chr164578 4490 4206 2451 1861 1638 36824 4600 1719 36060 950 161 14669
NM_138966chr181394 ------
NM_139048chr331100 446 53 ------
NM_139068chr5------1503
NM_139069chr5------1503
NM_139070chr5------1372
NM_139131chr113246 194 77 1166 ----
NM_139168chr521967 35 1343 11782 --
NM_139201chr12----1722 --
NM_139207chr1242240 1791 1385 1379 21854 735 1253 --
NM_139279chr243559 2949 2714 1112 22160 293 22411 1120 12842
NM_139321chr2073980 2996 2851 2762 1663 1600 260 63289 3279 1515 1295 824 114 --13939
NM_139323chr201445 --1355 --
NM_144568chr141170 ------
NM_144571chr4136917 5888 5711 5590 4936 4378 1869 1296 1221 706 650 471 184 26604 2064 45937 5741 2784 2173 --
NM_144578chr1465359 4960 2029 1518 1416 510 24886 3912 25563 5416 15076
NM_144582chr2112587 2516 2328 2243 1946 1788 1601 751 583 544 360 --1130 1834
NM_144595chr13----1979 1855
NM_144598chr151171 ------
NM_144599chr1564696 3562 3431 1273 1143 265 14065 ----
NM_144632chr2----22058 1859 11494
NM_144642chr311323 ------
NM_144643chr4--1150 ----
NM_144658chrX153 ------
NM_144660chr102152 93 ------
NM_144673chr16--1125 ----
NM_144685chr191199 ------
NM_144721chr422103 107 --1117 12636
NM_144726chr521208 776 --138 --
NM_144767chr1593911 3672 3661 3551 3099 2885 1247 406 300 23727 1407 --23131 1124
NM_144949chr23933 288 178 22193 2148 2718 452 --
NM_144963chr831065 947 892 ------
NM_144969chrX2653 177 182 1218 --
NM_144973chr1283834 3667 1955 1503 1093 1019 179 64 23990 667 23527 121 1590
NM_144992chr2--1585 ----
NM_145000chr51500 ----1478
NM_145014chr11------1374
NM_145049chr5------1362
NM_145052chrX4852 705 664 299 11013 1123 1882
NM_145055chr1863738 3591 2452 1516 1166 747 ------
NM_145060chr18101840 1631 1227 1215 753 619 457 393 305 258 11681 ----
NM_145176chr662717 2199 1343 738 396 59 --12512 12687
NM_145239chr1631120 823 391 ----2298 279
NM_145247chr102425 113 ----1485
NM_145251chr1421085 272 --11109 --
NM_145268chr741069 439 207 132 ------
NM_145284chrX1216 12218 12489 11792
NM_145290chr41262 --1115 --
NM_145307chr1063796 3634 1320 980 553 251 --2760 474 13663
NM_145320chr732374 961 517 13353 --12498
NM_145321chr732374 961 517 13353 --12498
NM_145322chr732374 961 517 13353 --12498
NM_145686chr262671 2498 2083 660 76 60 1292 11015 --
NM_145687chr262671 2498 2083 660 76 60 1292 11015 --
NM_145735chr1352111 1841 1141 553 315 --2955 878 --
NM_145753chr311668 1347 ----
NM_145808chr751205 1032 622 213 174 --1704 --
NM_145814chr191354 ----1472
NM_145909chr6--1130 --1329
NM_145912chr2293624 3539 3424 3257 3215 3016 1640 1071 556 33881 1879 690 54690 4421 4058 3895 616 --
NM_147150chr953157 1220 1043 341 190 12456 33310 3108 2852 13870
NM_147175chrX2793 400 11934 ----
NM_147223chr23510 496 306 1106 --1947
NM_147233chr23327 313 123 ----1764
NM_148174chr8----11478 --
NM_148904chr1----1576 --
NM_148905chr1----1576 --
NM_148906chr1----1576 --
NM_148907chr1----1576 --
NM_148908chr1----1576 --
NM_148909chr1----1576 --
NM_148955chr15105770 5633 5599 4730 4440 4151 4126 4087 2322 2275 35367 5336 322 24870 454 21449 537
NM_148957chr1372631 2272 1762 1025 103 85 39 22229 2027 ----
NM_152261chr1222379 92 --21924 886 --
NM_152263chr195691 5606 3871 2182 1539 1166 695 77 27 22066 190 12353 --
NM_152267chr2261993 879 856 640 99 38 --21841 154 32051 1814 393
NM_152272chr821201 130 --2168 97 1920
NM_152277chr542038 1501 1352 1321 21876 1475 1693 --
NM_152280chr163407 3287 1279 492 357 272 ----42761 1326 1119 754
NM_152282chr3----11205 --
NM_152283chr52764 287 --11022 --
NM_152284chr81704 ------
NM_152298chr13703 627 66 1510 ----
NM_152305chr33419 375 210 11605 1397 --
NM_152330chr1441895 1715 1683 155 ----22393 784
NM_152373chr1--1220 2150 104 --
NM_152375chr12674 70 32590 2396 2151 22525 853 32002 1964 401
NM_152407chr53625 448 111 ------
NM_152409chr523344 2748 --11248 --
NM_152424chrX94739 4673 4487 2896 2883 1900 1508 1319 1249 21585 1468 ----
NM_152430chr11----169 --
NM_152437chr1241935 1816 830 250 21731 425 --1755
NM_152493chr12489 196 --11155 1331
NM_152542chr432142 533 247 --11455 11912
NM_152556chr732353 1977 862 163 ----
NM_152577chrX----121 --
NM_152581chrX11396 2187 50 1557 --
NM_152624chr576465 4847 2803 2534 740 710 630 12866 57036 5844 1673 569 534 36952 1838 907
NM_152629chr941265 974 843 685 33917 3790 1007 ----
NM_152636chr1163045 2636 2505 2252 2180 255 22025 684 --12206
NM_152638chr122378 213 ------
NM_152641chr1221848 322 1666 ----
NM_152660chr12829 816 ------
NM_152663chr11331 ------
NM_152673chr374107 1573 1383 1261 611 473 438 13840 44429 3795 2750 1658 --
NM_152682chr421473 1400 ------
NM_152688chr6----1736 --
NM_152716chr1111589 ------
NM_152733chr6196238 6151 5792 5438 4438 4378 3952 2535 2462 2409 2030 1683 1481 1236 993 727 438 392 329 26093 5486 26110 5168 --
NM_152734chr674721 4248 3886 1427 727 276 93 14650 21745 460 --
NM_152736chr62384 169 --2885 433 --
NM_152737chr651916 1812 1580 439 162 ------
NM_152748chr7----1371 --
NM_152753chr671461 1356 1310 559 538 335 106 ------
NM_152754chr732355 1260 541 1523 23409 277 12941
NM_152756chr574091 3716 2841 2636 1549 900 151 --43429 3307 2942 1207 --
NM_152758chr841927 1099 845 477 ----22155 54
NM_152774chr762555 2538 2493 2445 2420 1854 --12698 12616
NM_152780chrX135 1523 --11154
NM_152787chrX43319 3052 2843 2788 21367 237 22935 1440 2917 429
NM_152789chr721518 329 --2226 112 --
NM_152826chr15105770 5633 5599 4730 4440 4151 4126 4087 2322 2275 35367 5336 322 24870 454 21449 537
NM_152835chr131824 1800 1054 12066 12138 22344 295
NM_152836chr82391 237 --11762 --
NM_152837chr82391 237 --11762 --
NM_152838chr2063215 2920 2889 2448 1096 824 --23338 2378 23326 211
NM_152862chr2145 ----1140
NM_152896chr9141 ------
NM_152910chr13297 61 ------
NM_152924chr15115420 4598 4502 4489 4273 1592 1291 1101 924 907 168 1774 56015 4633 1969 1504 42 2744 676
NM_152994chr2--1141 --1386
NM_152996chr131951 1771 252 --1213 11765
NM_153020chr6------1213
NM_153026chr121193 ------
NM_153035chr193199 3167 2798 2479 2329 2287 2190 987 559 32769 2510 833 22459 2178 12808
NM_153040chr15132 --1144 --
NM_153050chr22114950 4326 4012 4004 3780 3686 3242 890 678 589 492 11038 193 --
NM_153051chr22114950 4326 4012 4004 3780 3686 3242 890 678 589 492 11038 193 --
NM_153181chr181394 ------
NM_153182chr333185 1037 870 --22691 319 --
NM_153183chrX31139 1114 130 11157 ----
NM_153184chr311439 148 2751 567 1511
NM_153188chr565597 4368 1761 1567 596 150 1630 1217 --
NM_153207chr1211430 1372 --23230 3078
NM_153223chr5----11430 --
NM_153235chr62978 379 ------
NM_153240chr321169 161 --160 --
NM_153255chr61285 --1885 --
NM_153262chr122986 1086 ----12345
NM_153273chr392709 2642 2360 2051 2003 1705 973 435 152 22564 2061 21903 1848 12616
NM_153332chr852703 708 566 439 415 ----13301
NM_153333chrX2591 151 1189 ----
NM_153341chr1----155 --
NM_153354chr52702 222 --1977 --
NM_153365chr421825 318 2661 375 12288 32179 1114 214
NM_153367chr1031044 783 221 33950 3558 672 22829 1015 33189 2573 868
NM_153371chr1362284 2176 963 732 598 513 1195 21913 1783 --
NM_153374chr15291 45 ------
NM_153456chr13106111 6050 5175 5145 4325 2295 1707 1586 932 120 46099 5068 4785 162 --11675
NM_153605chr311604 1230 ----
NM_153646chr1471578 589 495 475 128 33 22 2885 581 2831 512 12620
NM_153647chr1471578 589 495 475 128 33 22 2885 581 2831 512 12620
NM_153648chr1471578 589 495 475 128 33 22 2885 581 2831 512 12620
NM_153649chr1112308 2109 1993 1985 1695 1663 1526 1442 863 617 107 22227 926 1386 1217
NM_153689chr232281 848 196 1327 22168 461 1887
NM_153702chr4----1247 --
NM_153712chr283660 3584 3512 3311 2869 2724 377 300 43532 3321 1276 28 --33024 2916 2518
NM_153810chr1095018 4829 4574 4511 3968 3926 2012 1872 48 34494 4162 656 11935 --
NM_170606chr7168 --31849 1373 130 --
NM_170665chr12104259 4137 3832 3136 3005 1753 1512 1348 1342 893 --13041 --
NM_170672chr251418 1203 567 512 151 11577 144 1100
NM_170679chr521032 972 2428 421 1381 --
NM_170706chr1124063 3198 3124 2867 1399 1186 1169 1040 828 412 334 184 11212 33348 3223 1465 --
NM_170711chr194941 334 312 128 --1701 --
NM_170731chr1132318 1764 479 11963 ----
NM_170732chr1132318 1764 479 11963 ----
NM_170733chr1132318 1764 479 11963 ----
NM_170734chr1132318 1764 479 11963 ----
NM_170735chr1132318 1764 479 11963 ----
NM_170751chr62349 120 1133 1367 --
NM_170752chr62349 120 1133 1367 --
NM_170753chr10----190 --
NM_170768chr1141690 1309 528 365 31736 1442 1344 11498 11464
NM_170774chr20103947 3423 3381 3338 2849 2647 1312 1093 142 24 2683 577 ----
NM_171998chrX31839 1567 103 --1791 --
NM_171999chr18--1242 ----
NM_172037chr811061 1170 --1961
NM_172069chr221573 646 ----32253 464 396
NM_172071chr1147427 7181 7032 6947 6924 6673 5470 5447 2542 2392 2326 2241 2209 287 67323 6167 5867 5808 4740 880 22457 581 --
NM_172078chr7142 ------
NM_172079chr7142 ------
NM_172080chr7142 ------
NM_172081chr7142 ------
NM_172082chr7142 ------
NM_172083chr7142 ------
NM_172084chr7142 ------
NM_172103chr652326 2022 1700 436 277 11019 1121 --
NM_172105chr652326 2022 1700 436 277 11019 1121 --
NM_172164chr13703 627 66 1510 ----
NM_172193chr1411256 1284 ----
NM_172240chr1221294 342 ----11149
NM_172344chr241838 1573 660 364 21593 450 ----
NM_172373chr1311068 --11334 --
NM_173075chr421732 338 21335 640 ----
NM_173082chr6170 --1139 --
NM_173083chr111065 198 11006 --
NM_173198chr962561 2018 1988 1096 353 294 ----22416 76
NM_173200chr962561 2018 1988 1096 353 294 ----22416 76
NM_173214chr16118235 8155 7718 5916 2953 2288 1920 1877 1411 674 630 26230 621 16291 11957
NM_173216chr3102656 2598 2338 2210 2061 1777 1718 756 544 462 2492 68 ----
NM_173217chr3102656 2598 2338 2210 2061 1777 1718 756 544 462 2492 68 ----
NM_173359chr351741 1378 1306 1187 718 ----148
NM_173468chr455611 5453 3734 2440 86 35048 4269 2189 24484 3821 14432
NM_173469chr15125 ------
NM_173470chrX22472 44 --2963 357 1369
NM_173473chr1042012 1698 1027 589 22705 360 ----
NM_173475chr1641722 1645 1500 1488 --11769 177
NM_173476chr1682034 1896 1500 1488 753 601 457 31 32175 713 353 1469 11664
NM_173503chr171119 1102 ----
NM_173505chr18--181 --1737
NM_173510chr2252822 2778 2320 1084 950 11819 22886 2829 --
NM_173511chr272552 1533 1448 1366 1303 840 254 --23611 138 132
NM_173515chr62948 152 1891 ----
NM_173552chr331840 1730 215 1294 22059 91 --
NM_173562chr642324 1045 785 46 22775 2265 31317 820 719 1524
NM_173576chr1032156 2041 730 1699 11734 --
NM_173582chr1125774 5434 24602 2179 23921 3868 --
NM_173632chr1932678 2217 1313 32149 231 65 13180 1674
NM_173642chr1118097 7129 6465 6219 6141 3124 2082 1658 339 117 73 76266 6253 6075 3699 1000 745 442 45775 3554 3514 2130 18554
NM_173648chr21664 ------
NM_173654chr3101813 1768 710 670 577 536 492 411 326 296 11996 22368 1502 --
NM_173670chr51125 --1396 --
NM_173694chrX2834 447 ----11021
NM_173797chr51928 ----1358
NM_173807chr1134 ------
NM_173808chr1--34476 3606 3241 11177 13968
NM_173825chr352952 2701 1937 593 326 ----22094 755
NM_173834chrX1101 ------
NM_173851chr853732 3476 3166 2466 1591 23586 531 11034 11007
NM_174887chr171310 --1365 --
NM_174902chr1141237 1217 559 318 ------
NM_174909chr5--1718 --1353
NM_174911chr863071 2486 540 398 310 99 12641 33402 698 111 23606 130
NM_175052chr53860 720 157 ------
NM_175056chr321560 482 --11849 21551 27
NM_175607chr31113 11212 11048 1199
NM_175611chr21154 ------
NM_175612chr31113 11212 11048 1199
NM_175623chr12127576 6891 6669 6460 6016 5639 4809 2633 1993 1639 1123 949 67376 7078 5891 2188 1229 838 17231 --
NM_175624chr12127671 6986 6764 6555 6111 5734 4904 2728 2088 1734 1218 1044 67471 7173 5986 2283 1324 933 17326 --
NM_175625chr12127671 6986 6764 6555 6111 5734 4904 2728 2088 1734 1218 1044 67471 7173 5986 2283 1324 933 17326 --
NM_175733chr1131619 754 402 31397 579 360 --12102
NM_175748chr1451565 861 607 110 58 21931 767 ----
NM_175854chr1332678 1693 1054 21951 964 --12018
NM_175861chr1275840 5488 4078 2126 1457 1043 626 35155 4053 316 23971 1442 1448
NM_175907chr18----12482 21018 730
NM_175920chr51120 --1300 --
NM_176081chr1095833 5073 3912 3827 3693 2309 1095 923 134 32336 2288 1145 36004 5977 1541 26025 2219
NM_176083chr1095833 5073 3912 3827 3693 2309 1095 923 134 32336 2288 1145 36004 5977 1541 26025 2219
NM_176787chr183647 405 29 --2157 132 --
NM_176814chr7131 21412 1377 ----
NM_176871chr8153046 3035 2821 2379 2112 1274 1192 932 852 804 346 255 198 126 93 13141 12964 --
NM_177424chr141556 616 597 529 --21648 149 1794
NM_177438chr1433916 3402 3372 --2712 185 11281
NM_177538chr2168429 8344 7560 7360 6897 6368 6144 6054 5836 3289 2894 2055 1986 1721 1005 138 28619 3090 47322 7232 2663 1241 --
NM_177559chr2011229 ------
NM_177560chr2011229 ------
NM_177968chr22467 441 1748 --11368
NM_177969chr2--1101 ----
NM_177972chr1174386 3815 3684 3476 3216 1557 38 54316 4216 2995 927 324 1813 21758 1003
NM_178009chr13260 24 ------
NM_178011chr1033270 2846 2467 1866 12671 11122
NM_178151chrX117610 6891 5188 5045 4953 2994 2456 755 476 449 181 26464 652 25268 728 12911
NM_178152chrX117610 6891 5188 5045 4953 2994 2456 755 476 449 181 26464 652 25268 728 12911
NM_178153chrX117610 6891 5188 5045 4953 2994 2456 755 476 449 181 26464 652 25268 728 12911
NM_178191chr121286 1001 --11145 --
NM_178423chr72240 164 ------
NM_178425chr72240 164 ------
NM_178426chr142387 2358 1868 31 ----2606 471
NM_178427chr132287 2258 1768 --1879 2506 371
NM_178450chr5----148 --
NM_178508chr6146 ------
NM_178539chr12--21993 1626 --11902
NM_178578chr2082501 2123 1626 1012 702 348 132 47 1603 11722 --
NM_178585chr442758 2506 1290 69 1751 --1351
NM_178815chr1032201 841 149 1406 ----
NM_180989chr1312504 11881 ----
NM_181054chr143851 177 133 ------
NM_181349chr762606 667 644 565 512 96 23059 537 1388 --
NM_181354chr82452 149 ----166
NM_181356chr6--1814 2907 382 --
NM_181358chr184175 3395 2845 2597 1543 1451 255 156 ------
NM_181361chr32923 240 ------
NM_181443chr2032584 346 324 21773 612 1541 --
NM_181459chr211042 1305 ----
NM_181504chr552743 1531 1084 210 122 23679 3309 13440 3673 386 56
NM_181523chr552743 1531 1084 210 122 23679 3309 13440 3673 386 56
NM_181524chr552743 1531 1084 210 122 23679 3309 13440 3673 386 56
NM_181552chr71744 ------
NM_181642chr151255 168 2191 79 --
NM_181645chr11----1280 1503
NM_181659chr2063424 2876 2416 2224 377 98 ----1278
NM_181659chr2063424 2876 2416 2224 377 98 ----1278
NM_181671chr171826 ------
NM_181672chrX61943 1274 593 383 352 52 11981 21548 251 --
NM_181673chrX61943 1274 593 383 352 52 11981 21548 251 --
NM_181674chr51123 ------
NM_181675chr51123 ------
NM_181676chr51123 ------
NM_181677chr51123 ------
NM_181678chr51123 ------
NM_181702chr81278 ------
NM_181704chr2121168 28 31049 469 445 ----
NM_181723chr81422 --1147 12148
NM_181784chr221838 371 11876 --11813
NM_181809chr1123589 3039 2957 2868 2674 1567 1512 1500 677 592 419 43 1904 2463 263 --
NM_181833chr22103745 3566 3103 3035 2901 2816 2753 1508 1408 1245 33795 2572 349 12286 12487
NM_181838chr531318 296 164 11295 ----
NM_181839chr821024 915 2965 925 161 --
NM_181844chr1742004 1456 1270 707 1254 21397 629 1659
NM_181861chr1262476 1915 918 705 620 589 150 22311 327 --
NM_181868chr1262476 1915 918 705 620 589 150 22311 327 --
NM_181869chr1262561 2000 1003 790 705 674 1135 22396 412 --
NM_181876chr442596 2277 950 561 12287 1871 --
NM_181886chr431046 187 40 1504 ----
NM_181887chr431046 187 40 1504 ----
NM_181888chr431046 187 40 1504 ----
NM_181889chr431046 187 40 1504 ----
NM_181890chr431046 187 40 1504 ----
NM_181891chr431046 187 40 1504 ----
NM_181892chr431093 234 87 1551 ----
NM_181893chr431046 187 40 1504 ----
NM_181897chr342667 2428 518 155 1729 1423 --
NM_182314chrX21701 283 31535 1504 126 ----
NM_182484chr2121168 28 31049 469 445 ----
NM_182485chr443432 3345 3237 3139 --22906 2388 --
NM_182503chr6105394 5366 2024 1900 1621 1239 1109 1040 363 353 1971 13450 13871
NM_182507chr1282134 2108 2058 1537 1490 765 428 422 1502 1492 11770
NM_182515chr1995616 5597 5477 5159 1979 1846 1761 158 48 3575 407 240 16495 11283
NM_182528chr2------1115
NM_182646chr443432 3345 3237 3139 --22906 2388 --
NM_182648chr14--1287 ----
NM_182691chr71404 ----2938 231
NM_182692chr71404 ----2938 231
NM_182697chr741668 1588 1476 1201 ------
NM_182715chr71972 --1372 --
NM_182760chr31206 ------
NM_182767chr1241840 594 327 168 ----11760
NM_182830chr1432284 2068 1659 ----1291
NM_182835chr14135 ------
NM_182896chr3173 1587 --1382
NM_182898chr796367 6285 6178 4400 1991 1461 1182 792 93 11209 ----
NM_182899chr796367 6285 6178 4400 1991 1461 1182 792 93 11209 ----
NM_182943chr3137 ------
NM_182944chr141105 ------
NM_182970chr20134242 3641 3587 3332 3193 3181 3103 2789 2639 1552 1268 1129 60 139 44088 3939 3922 3801 --
NM_182975chr1148 1983 ----
NM_183004chr1483549 3455 3331 3283 1450 1287 1001 258 12629 --13228
NM_183043chr131832 ------
NM_183044chr131832 ------
NM_183049chr41368 ------
NM_183078chr6103362 3301 3117 3051 2944 2704 1070 937 852 264 32714 1131 363 23060 1208 11344
NM_183238chr1273083 2913 1562 1141 997 909 626 31015 972 866 --12986
NM_183387chr143927 818 350 1300 ----
NM_183398chr561336 1127 1090 886 526 421 ----11204
NM_183399chr561336 1127 1090 886 526 421 ----11204
NM_183400chr561336 1127 1090 886 526 421 ----11204
NM_183401chr561336 1127 1090 886 526 421 ----11204
NM_183416chr131900 483 210 12012 21271 719 --
NM_183419chr82556 47 ------
NM_194071chr7114988 4911 4840 4785 4580 4234 3860 912 517 350 147 21781 1764 21858 852 --
NM_194247chr233693 1671 1303 12847 11392 --
NM_194278chr14102737 2652 1493 1480 1470 1305 1217 872 633 26 12586 13628 --
NM_194285chr1153279 2911 2340 2264 1231 ----13136
NM_194286chr1296103 6054 5624 4667 2346 1842 1602 1512 550 ----25991 1583
NM_194291chr822734 2344 1842 12577 --
NM_194314chr174448 3548 1805 714 575 173 30 --24779 2228 1946
NM_194318chr1342469 2257 972 854 51899 1588 503 378 47 21815 682 1199
NM_194328chr923308 209 --13097 12857
NM_194329chr923308 209 --13097 12857
NM_194330chr923308 209 --13097 12857
NM_194332chr923308 209 --13097 12857
NM_194429chr6187 --2552 403 --
NM_194434chr1865567 4598 4364 3580 2311 2012 25297 1714 11270 13856
NM_194439chr441497 1464 1263 960 ------
NM_194449chr18----1344 --
NM_194452chr11--11276 ----
NM_194453chr11--11276 ----
NM_197939chr1761131 1084 834 202 82 23 3472 228 152 --1139
NM_197970chr2--11037 ----
NM_198047chr22593 479 ------
NM_198066chr1473113 2833 2548 2462 2258 1223 1216 --12672 --
NM_198123chr811464 135 --11538
NM_198124chr811464 135 --11538
NM_198158chr311145 32853 1958 361 ----
NM_198159chr311145 32853 1958 361 ----
NM_198177chr311145 32853 1958 361 ----
NM_198178chr311145 32853 1958 361 ----
NM_198212chr721775 1442 1436 1366 1756
NM_198217chr131721 ------
NM_198218chr131721 ------
NM_198219chr131721 ------
NM_198268chr184175 3395 2845 2597 1543 1451 255 156 ------
NM_198269chr184175 3395 2845 2597 1543 1451 255 156 ------
NM_198270chrX32206 813 384 21281 1234 12797 --
NM_198273chr532481 636 259 --22237 46 --
NM_198320chr1295085 4945 4410 4213 1947 1491 1210 1188 38 2808 102 11814 --
NM_198381chr1121363 151 ------
NM_198395chr52973 375 11223 11253 --
NM_198399chr331338 1203 255 ----11583
NM_198400chr1522414 1907 --12528 32270 577 456
NM_198465chrX52728 2368 373 283 274 12554 12243 --
NM_198467chr71244 ------
NM_198506chr431508 81 70 ------
NM_198511chrX11497 --21622 108 --
NM_198560chr3123596 3527 3517 3189 2756 2577 2528 2393 833 769 541 296 --2679 362 13273
NM_198568chr631203 787 181 1472 ----
NM_198793chr341216 954 500 26 43229 3222 2995 2923 ----
NM_198844chr17--1115 1355 1131
NM_198859chr311331 44982 1238 1147 855 24363 3346 1214
NM_198889chr43509 256 42 ------
NM_198896chr1131739 1721 502 --22030 770 --
NM_198904chr511773 ----22093 696
NM_198935chr2051280 1233 859 482 22 --1853 22252 793
NM_198965chr121109 ------
NM_198966chr121109 ------
NM_198991chr181173 ------
NM_199000chr722289 829 1241 --1203
NM_199040chr1253206 2406 1499 1282 1073 ----12872
NM_199051chr1----175 --
NM_199053chr4--1896 --1741
NM_199072chr733126 2354 1035 133 ----
NM_199160chr951430 803 701 345 159 11929 31502 1317 183 2625 411
NM_199169chr2043542 2889 2522 2234 --13657 23305 2731
NM_199170chr2043542 2889 2522 2234 --13657 23305 2731
NM_199171chr2043542 2889 2522 2234 --13657 23305 2731
NM_199188chr1253238 334 194 138 76 11591 11264 13173
NM_199189chr5----11036 1307
NM_199190chr1253238 334 194 138 76 11591 11264 13173
NM_199321chr17--1115 1355 1131
NM_199324chr441219 1028 155 96 33379 2530 362 12276 --
NM_199421chr1495078 4489 4459 4292 3827 3609 3502 803 78 13999 1684 --
NM_199436chr222995 461 13125 11921 --
NM_199454chr124706 802 33474 3384 601 11728 13940
NM_199461chr1053307 2682 2593 1194 643 1787 12957 --
NM_199482chr2--2691 608 11943 --
NM_201263chr132009 1462 1402 12111 1789 --
NM_201269chr111065 ------
NM_201432chr17175878 5763 5731 5719 5599 5444 5215 5124 4423 2108 2039 1810 1204 1075 386 337 280 31462 1282 619 45159 4692 2538 526 24085 719
NM_201433chr17175878 5763 5731 5719 5599 5444 5215 5124 4423 2108 2039 1810 1204 1075 386 337 280 31462 1282 619 45159 4692 2538 526 24085 719
NM_201437chr831139 558 27 ------
NM_201524chr1641263 1219 389 284 11255 --21389 112
NM_201525chr1641263 1219 389 284 11255 --21389 112
NM_201567chr351738 1220 1117 119 105 31509 486 398 ----
NM_203283chr41597 1237 ----
NM_203284chr41597 1237 ----
NM_203301chr14------11402
NM_203305chr952058 1897 1573 594 181 31696 318 23 22250 44 12220
NM_203327chr2054525 4357 2833 1772 274 ----23871 938
NM_203341chr1164 --1839 --
NM_203346chr272325 2276 2226 1651 725 701 555 --22220 1818 11422
NM_203364chr112489 39 --1323 --
NM_203372chr221300 355 ------
NM_203406chr512437 12758 --12664
NM_203446chr2142452 1030 1008 656 2976 332 ----
NM_203451chr1322400 677 --1606 11609
NM_203459chr131719 163 142 ----12376
NM_203463chr244636 4264 3069 49 44842 3869 3541 1587 --54752 4555 3694 1233 856
NM_203464chr1----1980 --
NM_203487chr131414 ----1310
NM_203504chr422610 2016 1371 183 --
NM_203505chr422610 2016 1371 183 --
NM_203506chr1762012 1977 1645 1440 402 147 31749 1638 834 12127 --
NM_205768chr131885 601 592 2448 99 --11679
NM_205848chr142809 2351 652 45 1517 22089 945 1460
NM_206839chr15128 ----1606
NM_206853chr653393 3363 3200 1258 474 24009 1582 13140 --
NM_206854chr644654 4624 4461 1735 35270 840 245 14401 23688 3434
NM_206855chr645619 5589 5426 727 46235 1805 1210 369 15366 24653 4399
NM_206860chr103477 331 21 ------
NM_206861chr103477 331 21 ------
NM_206862chr103477 331 21 ------
NM_206876chr21712 11008 ----
NM_206907chr55625 540 473 421 140 --23136 117 --
NM_206909chr876969 6001 5302 3030 2320 585 420 47949 7449 1134 513 26292 2996 17984
NM_206925chr1572031 1072 932 774 627 70 46 42600 2209 373 323 52202 977 762 746 281 1460
NM_207012chr1043529 2692 1139 234 --12972 11253
NM_207111chr772781 2013 855 759 461 383 165 32590 1877 435 11960 1663
NM_207116chr772781 2013 855 759 461 383 165 32590 1877 435 11960 1663
NM_207303chr1011448 43791 3697 3012 2725 21457 1296 1259
NM_207372chr101569 --31622 789 95 12423
NM_207406chr425065 1232 15113 86101 5830 5528 5412 2053 1725 649 195 11167
NM_207411chr883268 2861 2449 2383 2246 874 836 256 43481 701 431 48 2689 545 --
NM_207422chrX2235 119 ------
NM_207435chr12292 54 176 1743 --
NM_207442chr144912 817 243 61 1182 2995 54 1219
NM_207481chr241076 300 294 199 --1556 --
NM_207660chr142649 98 --139 11629
NM_207661chr142649 98 --139 11629
NM_207662chr142649 98 --139 11629
NM_212460chr711258 --21480 550 --
NM_212467chr1552045 1760 1059 888 823 1312 32114 1840 298 11807
NM_212557chr4------1273
NM_212558chr934172 821 210 14232 11001 --
NM_213606chr1022066 679 2942 730 22609 2114 --
NM_213609chr31408 ----143
NM_213651chr121489 640 --153 21743 1635
NM_213654chr32625 145 --11467 --