TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3185
miRNA Sequence: AGAAGAAGGCGGUCGGUCUGCGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr511201 ------
NM_000021chr143898 691 34 --31047 922 38 --
NM_000024chr51139 ------
NM_000037chr832447 2391 356 --1428 --
NM_000044chrX1163 ------
NM_000045chr63115 99 64 ------
NM_000051chr1182258 2242 2162 1372 1145 1032 872 562 2858 834 32334 818 815 11273
NM_000052chrX143409 3317 3284 3249 3036 2529 2329 2230 2131 700 624 588 546 97 43130 1181 858 654 1612 1162
NM_000055chr33366 294 67 ------
NM_000068chr1921513 1429 --11503 --
NM_000074chrX2608 340 --1776 --
NM_000081chr141640 619 502 283 1703 1327 --
NM_000084chrX146525 5921 5897 5882 5448 5164 5094 2710 2683 2342 1917 1475 816 274 --15855 16130
NM_000088chr1761286 1051 1007 973 264 143 ------
NM_000089chr74733 682 103 62 1225 4706 72 69 66 1663
NM_000090chr26930 623 361 302 201 166 ------
NM_000091chr262234 1882 1082 1050 161 83 32566 87 33 1360 --
NM_000092chr274095 3945 3495 1778 1383 1014 497 33911 3268 715 11407 13134
NM_000093chr982271 2251 2232 2125 965 893 857 384 12510 1955 --
NM_000096chr31955 1779 ----
NM_000108chr761710 1607 1544 524 314 26 ------
NM_000109chrX72301 2294 2134 2038 2020 1737 846 32418 2162 344 42045 2024 753 561 --
NM_000110chr12294 212 ------
NM_000112chr5125480 5293 5180 4214 4206 3925 3814 1946 1786 1780 686 220 35297 4248 1252 15191 1393
NM_000125chr644046 3806 3014 388 --11602 11223
NM_000127chr82337 303 ------
NM_000133chrX----2355 123 --
NM_000138chr1532332 1845 137 12143 1906 --
NM_000139chr1162817 2689 2494 2464 2193 210 ------
NM_000141chr1031225 546 503 ------
NM_000142chr441502 1341 1183 1125 11129 --11097
NM_000146chr192138 94 ------
NM_000158chr33454 446 50 1461 ----
NM_000161chr1471711 1539 1461 760 390 205 191 1311 11494 --
NM_000163chr572397 2369 1960 435 419 334 92 1895 ----
NM_000165chr641549 1498 1101 646 21700 1086 31147 649 296 1686
NM_000167chrX61776 1392 699 677 575 39 11477 1470 --
NM_000168chr7113372 3349 3144 3107 2786 2563 2349 2338 324 287 248 23100 1231 22341 327 --
NM_000170chr9----2484 433 --
NM_000176chr533769 1028 566 33833 1325 359 --23955 3641
NM_000189chr232096 1512 753 --143 1834
NM_000192chr1281392 1386 1361 1336 455 442 361 202 21180 111 1324 --
NM_000194chrX1105 ------
NM_000196chr161544 ------
NM_000208chr19184715 4308 4196 4190 3438 2988 2914 1881 1864 1854 1747 800 765 726 542 512 337 279 34665 4131 546 23520 1885 --
NM_000210chr252302 1805 1666 842 398 3851 402 35 1231 12352
NM_000212chr1742005 1680 668 289 32387 2011 334 11684 --
NM_000214chr2031154 677 607 154 ----
NM_000217chr12185372 5155 4963 4685 4185 4096 3350 3340 2073 1982 1951 1575 1559 1409 1081 955 714 358 24013 351 21767 1761 23987 975
NM_000222chr451944 1905 1887 1604 71 --146 --
NM_000223chr172154 124 ------
NM_000232chr483103 2852 2642 2101 2058 1276 926 48 --22934 2192 --
NM_000240chrX51775 1682 1481 680 666 --21934 422 --
NM_000242chr10102666 2339 2238 2155 1876 1709 496 435 337 34 12057 12320 --
NM_000245chr742146 339 157 86 2467 52 ----
NM_000248chr3112894 2748 2476 2137 2027 1995 1045 952 820 83 44 53084 937 738 713 116 ----
NM_000252chrX21494 1390 1570 --11070
NM_000253chr43830 771 754 ------
NM_000255chr62325 306 ------
NM_000259chr15186006 5844 5763 5741 5460 5451 5274 5261 4924 4378 4279 2522 2256 2079 1632 1017 653 37 25767 5650 ----
NM_000264chr953261 3138 3007 1156 748 23014 1341 13094 11266
NM_000266chrX2631 221 --1186 --
NM_000267chr1793489 3135 2461 1320 1086 880 764 502 200 2433 193 23211 897 1392
NM_000271chr182677 253 2681 567 ----
NM_000276chrX42260 2233 2144 1454 11863 ----
NM_000278chr1032260 2021 557 --22263 1591 --
NM_000280chr1121014 789 ------
NM_000281chr102285 27 ------
NM_000286chr172809 660 2978 140 ----
NM_000289chr121308 194 ----
NM_000291chrX--2768 197 1819 1894
NM_000293chr161643 ------
NM_000297chr4102060 1913 1837 1598 818 776 591 459 386 185 41853 1655 1301 483 31363 821 191 11920
NM_000304chr173886 234 203 ------
NM_000310chr151348 1234 1134 486 360 11262 ----
NM_000313chr331088 430 248 1337 ----
NM_000314chr1092749 2589 2580 2272 2155 1132 342 227 69 1591 11053 --
NM_000319chr1251177 1033 950 282 269 ------
NM_000321chr1341720 1683 723 120 --1352 --
NM_000325chr41454 ------
NM_000329chr12912 810 ------
NM_000330chrX32186 1418 249 --12113 --
NM_000332chr6307052 6943 6881 6490 6164 6104 5484 5026 4969 4842 4727 4692 4547 4444 2768 2733 2473 2135 2108 1890 1884 1711 1642 1496 1239 1046 985 739 605 101 55990 5523 1774 1246 1056 65673 5519 5516 2849 431 179 --
NM_000335chr352111 1697 844 409 373 ----21366 46
NM_000337chr5136622 6029 5255 5222 4925 4817 4084 2647 2126 1679 1091 1018 45 55971 5102 4605 2523 1106 25709 1707 --
NM_000338chr1541110 820 338 167 11027 ----
NM_000340chr361552 1438 1400 490 397 291 1277 11153 --
NM_000346chr17131982 1813 1704 1683 1420 1377 1363 1326 1303 575 528 294 127 --51971 142 139 136 133 --
NM_000351chrX74174 2938 2652 1643 871 756 667 11301 --1519
NM_000362chr2263615 3396 3073 883 722 103 21281 1166 3369 280 198 --
NM_000368chr964813 3083 1524 598 528 284 13036 1714 11100
NM_000369chr1461932 1410 1335 717 265 54 --21394 1339 11414
NM_000378chr11--11249 1328 1114
NM_000384chr2130 --133 --
NM_000386chr172759 508 1496 ----
NM_000390chrX83303 3016 2930 2846 2098 1056 1041 390 23278 416 ----
NM_000393chr261450 1409 1368 811 676 359 31821 307 217 1362 --
NM_000405chr551780 1688 715 708 369 ------
NM_000406chr472728 1972 1055 527 403 272 134 ------
NM_000408chr2122909 2816 2372 2122 1358 1002 808 770 748 295 222 111 1752 22126 228 22340 2291
NM_000411chr2161274 712 333 163 116 82 --1119 --
NM_000412chr3190 --1268 --
NM_000421chr173345 258 59 1287 1262 --
NM_000428chr1452349 1699 1650 988 865 ------
NM_000430chr1753424 3361 1310 1263 348 23128 984 1419 --
NM_000439chr582215 2057 2047 1640 971 641 251 128 32299 870 439 2132 42 --
NM_000441chr752020 1440 926 697 94 173 ----
NM_000447chr11100 ------
NM_000448chr11163237 3115 3070 2976 2919 2706 2493 1196 1164 1095 1031 983 639 521 512 387 3806 708 458 22664 2110 1820
NM_000449chr161376 1355 1030 983 454 93 --165 --
NM_000450chr171673 1591 1277 626 377 266 97 ----1694
NM_000451chrX32143 1855 422 22013 443 11922 --
NM_000452chr1371931 1884 1689 1613 1568 1440 750 2435 172 11966 --
NM_000461chr3114355 4338 3714 3672 3421 3098 2808 1674 1572 85 73 44486 2822 897 692 54265 3145 1152 990 788 23543 3103
NM_000462chr1561821 1716 1326 467 303 277 11585 --1173
NM_000474chr73675 513 134 1519 ----
NM_000477chr42308 81 2216 133 187 --
NM_000478chr13702 695 301 ------
NM_000484chr211884 1958 11054 --
NM_000486chr1252761 2739 2645 2313 1038 ----1250
NM_000489chrX103338 2738 2280 1263 1113 496 462 207 170 141 23356 385 32476 1092 690 1697
NM_000492chr731235 1116 404 --1470 --
NM_000493chr631101 703 387 1784 ----
NM_000495chrX81042 1035 939 925 876 835 238 205 1386 ----
NM_000503chr8101856 1721 1712 1630 1325 1244 550 495 438 418 11860 --11560
NM_000509chr4268 29 ------
NM_000522chr751228 1048 948 415 216 1893 ----
NM_000523chr241168 827 749 132 ------
NM_000527chr1952493 2432 2372 1949 189 ----12326
NM_000530chr131089 1070 687 ------
NM_000533chrX51607 1581 1299 331 111 ------
NM_000538chr1321269 577 21380 1368 --11520
NM_000544chr6_cox_hap1103283 3138 2935 2497 2450 2387 2231 1223 1030 283 32948 1016 641 ----
NM_000553chr8131 2647 625 ----
NM_000555chrX297685 7550 7145 6960 6925 6709 6322 5934 5813 5693 5523 5486 5285 4906 2772 2709 2041 2019 1964 1948 1535 1431 1425 1282 1187 1021 1002 952 927 67833 6687 6520 3047 2443 2358 46976 6963 5817 5654 --
NM_000574chr151345 1330 859 327 57 ------
NM_000575chr221039 1014 1235 ----
NM_000578chr211518 ------
NM_000582chr42506 399 --190 --
NM_000594chr6----1638 --
NM_000596chr72180 118 1371 ----
NM_000598chr731420 238 173 21405 1079 ----
NM_000599chr2124533 4321 4216 3928 3885 3360 1192 1028 1014 999 829 237 --24222 1002 --
NM_000600chr71301 --144 --
NM_000601chr71349 ------
NM_000609chr1022249 1212 1186 --11242
NM_000610chr1152517 2175 1851 138 113 3716 509 160 1686 --
NM_000615chr1162919 2579 2458 997 685 191 12194 31082 668 665 --
NM_000617chr1282326 2148 1866 1555 813 724 560 172 11759 12330 --
NM_000618chr12186225 5858 5699 5303 5297 5290 4981 4472 4447 4397 4190 2643 2327 2229 1180 818 810 652 36600 5652 746 54480 2634 1827 1184 430 11909
NM_000618chr12186225 5858 5699 5303 5297 5290 4981 4472 4447 4397 4190 2643 2327 2229 1180 818 810 652 36600 5652 746 54480 2634 1827 1184 430 11909
NM_000620chr1252037 1624 1470 414 325 ------
NM_000633chr18115054 4911 4883 4867 4822 3890 3728 2094 1665 1213 498 11925 ----
NM_000663chr1632473 1061 322 12850 ----
NM_000675chr221818 ------
NM_000676chr171357 ------
NM_000678chr202693 228 --1834 --
NM_000680chr82381 77 ------
NM_000682chr24404 353 306 59 ----1409
NM_000684chr1041107 314 257 214 --3279 237 234 --
NM_000685chr31170 ------
NM_000685chr31170 ------
NM_000693chr1551643 1573 1130 535 106 --11737 --
NM_000701chr11241 ------
NM_000702chr131628 495 273 12258 ----
NM_000719chr1296740 4617 1918 1686 1109 886 749 728 26 35096 1802 1605 24917 918 --
NM_000721chr132678 2641 1870 --12307 --
NM_000724chr1041506 597 446 373 11529 1179 --
NM_000726chr221476 1377 21114 252 ----
NM_000788chr4101256 1086 1056 961 926 526 386 348 174 162 188 ----
NM_000800chr511675 --1159 --
NM_000801chr202743 720 1729 1709 --
NM_000806chr541846 1783 560 505 ------
NM_000807chr42284 218 ------
NM_000809chr4269286 9083 8809 8497 8408 8104 7421 7047 6997 6852 6746 6432 5931 5788 5704 3603 3000 2296 2248 1641 1528 665 585 442 114 54 128251 7714 6443 6023 3626 3081 1689 906 857 301 189 86 48555 6211 5611 1429 57414 6784 5745 1170 669
NM_000813chr5185547 5376 4600 4448 4126 3978 2078 1839 1665 1536 1368 1258 1176 1104 1052 880 469 374 35330 1985 1290 31774 1722 1566 13732
NM_000814chr1583802 2973 2695 2639 1396 1055 551 317 ------
NM_000817chr21183 1389 ----
NM_000820chr13----1268 --
NM_000826chr462416 2053 1026 846 263 209 52527 1795 985 786 688 1340 --
NM_000827chr5112585 2562 2399 2354 2140 2029 1892 437 380 197 186 1825 21026 976 12278
NM_000828chrX82038 2029 876 519 461 333 223 160 21874 370 ----
NM_000829chr1171928 1741 734 707 628 590 232 ----12165
NM_000834chr1241263 1098 813 113 --21296 214 --
NM_000836chr192267 244 ------
NM_000838chr652719 1925 1907 1885 1812 --11758 --
NM_000839chr31371 ------
NM_000840chr72356 108 ------
NM_000842chr114758 511 481 202 ------
NM_000844chr3--1891 ----
NM_000845chr72402 333 ------
NM_000859chr531720 1574 167 31115 585 564 11590 --
NM_000864chr171095 808 792 233 156 140 63 --2958 143 --
NM_000868chrX82522 947 717 306 286 277 70 58 --1266 163
NM_000872chr1031388 151 73 11261 11364 --
NM_000875chr15187038 6758 5885 5735 4994 4881 4430 2604 2450 2351 2118 1831 1458 1394 1364 1224 392 204 36962 5000 186 12827 11148
NM_000876chr631393 891 446 11410 ----
NM_000880chr81214 177 ----
NM_000883chr71278 ------
NM_000883chr71278 ------
NM_000891chr17113615 3422 3271 3250 2657 1419 1058 932 654 582 261 12428 12700 13426
NM_000895chr122109 38 --1156 --
NM_000899chr1284348 4320 2684 1683 1643 1390 1364 462 43850 3001 2688 385 23367 3096 --
NM_000900chr12129 ------
NM_000901chr462272 2024 964 602 443 168 ------
NM_000902chr332481 2263 686 2716 656 ----
NM_000903chr164620 480 294 97 21095 263 2600 103 --
NM_000908chr52675 26 2772 42 --1584
NM_000909chr43241 139 127 1303 11338 --
NM_000912chr873432 2855 2741 2607 2472 674 32 13465 21359 1321 --
NM_000917chr106997 763 721 678 280 171 --1914 --
NM_000919chr51531 1546 1244 --
NM_000921chr122182 132 ------
NM_000922chr111388 2779 320 ----
NM_000926chr11259043 8467 8379 7948 7900 7786 7259 6097 6055 3490 3363 2854 2827 2616 2481 1606 1379 1332 1042 1027 705 217 166 93 48 69425 7652 7039 5940 1665 569 48234 7670 5729 2534 --
NM_000927chr72575 32 1470 ----
NM_000933chr2031647 1142 480 11587 --11526
NM_000935chr391045 1012 985 901 821 483 342 174 150 --1953 --
NM_000938chr42137 66 ------
NM_000944chr462377 2315 2197 1815 762 399 1654 31654 698 676 --
NM_000945chr272026 1940 1702 281 269 108 39 1285 11946 --
NM_000949chr54921 588 213 41 145 ----
NM_000950chrX123622 3399 3206 3130 3065 2848 2758 2705 2432 1214 718 155 32460 507 143 13403 --
NM_000958chr52479 267 --1852 --
NM_000959chr182887 2794 2689 2588 2479 1314 972 706 33067 669 185 11186 1977
NM_000963chr182217 1636 978 738 597 518 434 257 --21865 1706 22278 718
NM_000965chr341134 996 986 358 --11274 --
NM_000966chr122934 425 ------
NM_000983chr151583 1333 1304 1277 1257 --2527 167 --
NM_000990chr1172685 1064 1045 933 867 440 418 168 22508 42 --
NM_001001132chr2131003 931 362 21499 494 1391 --
NM_001001323chr1283110 3063 2888 2450 1260 1052 758 478 12553 22786 2106 --
NM_001001331chr351751 723 616 528 409 11689 12320 1195
NM_001001342chr1071504 1017 957 467 396 354 31 --1180 --
NM_001001344chrX32003 339 280 22117 803 22181 357 --
NM_001001389chr1152517 2175 1851 138 113 3716 509 160 1686 --
NM_001001390chr1152517 2175 1851 138 113 3716 509 160 1686 --
NM_001001391chr1152517 2175 1851 138 113 3716 509 160 1686 --
NM_001001392chr1162563 2221 1897 1886 184 159 3762 555 206 1732 --
NM_001001394chr2283 27 --2584 33 --
NM_001001395chr12112808 2796 2341 2332 2244 2074 1846 866 770 54 45 --32302 936 368 1814
NM_001001396chr1154449 4088 4052 3669 3538 3156 2847 2771 2713 1749 999 875 846 765 291 33523 3240 758 34095 4092 3542 --
NM_001001419chr5224995 4749 4684 4659 4506 4218 4167 4120 4084 4044 3734 3555 2094 2030 1931 1789 1073 1000 945 673 430 116 45231 3655 3216 624 33843 3664 1650 12063
NM_001001420chr5224995 4749 4684 4659 4506 4218 4167 4120 4084 4044 3734 3555 2094 2030 1931 1789 1073 1000 945 673 430 116 45231 3655 3216 624 33843 3664 1650 12063
NM_001001433chr20113176 3144 3134 3077 3030 2599 2551 2472 2446 1978 195 1411 ----
NM_001001436chr164791 687 556 117 ------
NM_001001481chr872835 2739 1371 1236 1051 990 867 33383 3219 1067 43418 2823 2704 2701 --
NM_001001484chr1082421 2085 869 593 494 380 361 294 21583 420 ----
NM_001001485chr31336 --1380 --
NM_001001520chr191133 ------
NM_001001521chr2143 ------
NM_001001549chr792883 2849 2515 2390 1961 1790 625 396 378 --1410 --
NM_001001550chr792883 2849 2515 2390 1961 1790 625 396 378 --1410 --
NM_001001555chr792883 2849 2515 2390 1961 1790 625 396 378 --1410 --
NM_001001556chr1541380 557 420 177 11628 2423 180 --
NM_001001557chr842223 2039 1657 260 12021 1779 --
NM_001001560chr222848 532 ------
NM_001001664chr243649 3177 1487 1219 63360 1578 1327 1223 556 172 12672 --
NM_001001702chr531645 270 24 --11564 --
NM_001001715chr132528 114 1402 ----
NM_001001787chr12189 175 ------
NM_001001790chr9----1354 --
NM_001001791chr10--11533 ----
NM_001001890chr21154268 4019 3742 3685 3469 3365 3223 2997 2941 2817 2755 860 654 496 391 23573 634 53988 3645 3605 2762 592 --
NM_001001924chr861649 1409 841 752 706 380 31293 718 364 11351 1299
NM_001001925chr861649 1409 841 752 706 380 31293 718 364 11351 1299
NM_001001928chr22168122 7969 7783 7668 7238 7167 7101 7064 6997 5435 5392 5147 3007 1895 552 424 33175 2868 1493 15158 11392
NM_001001931chr861649 1409 841 752 706 380 31293 718 364 11351 1299
NM_001001936chr1021124 268 --1207 --
NM_001001938chr973336 1566 396 356 266 117 85 43371 3329 1541 933 13344 --
NM_001001974chr10112277 2210 2159 1902 1811 1766 1648 1636 867 752 289 2906 185 12300 21919 1874
NM_001001995chrX21586 1448 2602 182 1178 --
NM_001002006chr21898 --2118 56 --
NM_001002032chr17239 31 ------
NM_001002243chr23301 241 39 ------
NM_001002257chr2153222 3205 3170 2870 2582 2262 2221 1289 1273 1095 921 827 763 297 103 23119 890 52355 2349 1219 791 473 11119
NM_001002259chr121134 ------
NM_001002265chr103805 747 79 --1136 --
NM_001002266chr103805 747 79 --1136 --
NM_001002275chr13456 223 123 1450 ----
NM_001002294chr1--1259 1308 --
NM_001002295chr103903 896 795 ------
NM_001002296chr841406 1245 455 270 ------
NM_001002814chr893877 3854 3640 3250 3158 2664 1574 462 342 1367 23649 2667 --
NM_001002838chrX81856 1796 1388 1358 1207 585 358 75 2221 37 --1406
NM_001002860chr14144646 4416 4353 4017 3953 3377 3319 3059 3038 1538 1313 448 385 264 23733 3332 13721 --
NM_001002909chr1792014 1957 1643 1585 837 772 748 329 191 12135 1195 --
NM_001002926chr782647 2630 782 669 634 597 425 253 32634 2163 2030 12582 --
NM_001003407chr10154857 4801 4714 4293 3701 3576 3240 1699 1219 1130 1060 1028 948 494 290 44832 4675 3677 3253 2297 294 13580
NM_001003408chr10154857 4801 4714 4293 3701 3576 3240 1699 1219 1130 1060 1028 948 494 290 44832 4675 3677 3253 2297 294 13580
NM_001003652chr18338631 8414 8366 8244 8085 7987 7878 7448 7164 6675 6604 6308 5939 5909 5577 5369 3452 3243 3119 3009 2846 2750 2633 1785 1595 1499 1049 1019 738 647 547 476 399 37954 5913 2922 35580 2456 2453 --
NM_001003665chr122233 88 --1819 --
NM_001003674chr18117033 6842 5363 5342 5322 4968 4699 4310 1953 1630 1262 76644 5436 4951 4838 4523 1014 995 25631 445 --
NM_001003675chr18117033 6842 5363 5342 5322 4968 4699 4310 1953 1630 1262 76644 5436 4951 4838 4523 1014 995 25631 445 --
NM_001003676chr11----1259 1268
NM_001003679chr182220 2178 2125 1705 1578 1382 784 549 22147 2102 ----
NM_001003681chr2252023 1897 1566 1484 252 ------
NM_001003688chr441084 816 800 338 --1439 --
NM_001003698chr651413 545 525 284 270 ------
NM_001003699chr651413 545 525 284 270 ------
NM_001003712chr12174024 3905 3764 3645 3617 3470 3152 3041 2893 2666 2505 1595 1527 1125 806 608 539 83758 3688 3388 2965 1209 1161 889 412 11137 --
NM_001003786chr172510 118 ------
NM_001003787chr172510 118 ------
NM_001003788chr172510 118 ------
NM_001003792chr371233 960 945 487 452 351 331 --1445 --
NM_001003793chr371233 960 945 487 452 351 331 --1445 --
NM_001003800chr973497 3364 3103 2695 1326 1173 571 32909 2378 760 ----
NM_001003810chr42657 212 ------
NM_001003940chr1532458 359 287 13820 43262 2396 863 175 11053
NM_001003942chr1532458 359 287 13820 43262 2396 863 175 11053
NM_001003943chr1532462 363 291 13824 43266 2400 867 179 11057
NM_001004023chr11219 1159 ----
NM_001004051chrX--1229 ----
NM_001004065chr963822 3812 3638 2954 1424 221 32568 789 635 ----
NM_001004106chr511016 ------
NM_001004127chr132689 69 ------
NM_001004196chr321217 147 --2957 954 11084
NM_001004303chr12688 572 ------
NM_001004303chr12688 572 ------
NM_001004304chr1243198 1244 814 555 --1818 --
NM_001004317chr694166 3516 2740 851 680 631 622 437 23 --2593 453 --
NM_001004342chr1126104 5950 5790 4376 4334 4235 812 766 697 512 343 152 15801 25022 728 15274
NM_001004346chr41990 1115 ----
NM_001004354chr931031 702 665 ------
NM_001004360chr251890 1856 452 281 203 --11674 11772
NM_001004419chr1264581 4233 4054 1509 1372 158 ------
NM_001004720chr21951 1880 2955 665 1976
NM_001004722chr211120 11049 21124 834 11145
NM_001005158chr32496 397 --1401 --
NM_001005159chr32496 397 --1401 --
NM_001005217chr431169 364 73 --162 --
NM_001005242chr1241621 561 519 58 31444 1358 525 11550 11075
NM_001005266chr15166 1717 ----
NM_001005267chr15166 1717 ----
NM_001005268chr15166 1717 ----
NM_001005269chr15166 1717 ----
NM_001005271chr1711066 ------
NM_001005273chr1711066 ------
NM_001005335chr192261 102 ------
NM_001005366chr122752 257 ------
NM_001005372chr172348 51 ------
NM_001005375chrY11879 1256 21395 1382 --
NM_001005386chr262359 971 685 526 250 40 22512 2365 ----
NM_001005404chr17154357 4122 3976 3654 3502 3428 3371 3250 3211 3010 1749 1506 1142 1117 59 14372 13755 --
NM_001005417chr1------1467
NM_001005463chr1052633 2189 2081 822 407 32576 958 763 1861 21711 194
NM_001005473chr5136501 5802 5561 5383 5190 5178 4906 4855 4584 2582 2282 2109 389 65288 4859 2537 1166 264 152 35139 2291 2112 15427
NM_001005474chr321493 1423 1369 ----
NM_001005476chr22134 32 ------
NM_001005505chr321708 243 ------
NM_001005609chrX43829 3054 1127 559 31264 966 910 33347 833 242 --
NM_001005732chr21--2126 69 1631 --
NM_001005733chr21--2126 69 1588 --
NM_001005739chr22674 266 1237 ----
NM_001005743chr14--1378 ----
NM_001005744chr14--1378 ----
NM_001005745chr14--1378 ----
NM_001005746chr221476 1377 21114 252 ----
NM_001005747chr221476 1377 21114 252 ----
NM_001005751chr101146 ------
NM_001005753chr272316 2252 2062 2043 2028 1702 547 --12122 --
NM_001005781chr25523 423 384 247 228 1427 ----
NM_001005782chr29972 872 833 696 677 222 61 40 21 2876 403 --1258
NM_001005845chr851836 1431 460 447 440 11554 3403 38 35 --
NM_001005849chr173598 474 126 2435 40 ----
NM_001005861chr32361 154 1638 ----
NM_001005862chr171489 ------
NM_001006115chr342578 2172 992 447 --1830 --
NM_001006600chr552390 2060 664 444 427 1859 11751 11980
NM_001006605chr13905 863 807 ----1473
NM_001006605chr13905 863 807 ----1473
NM_001006610chr161378 ----1864
NM_001006612chrX2378 50 ------
NM_001006613chrX2378 50 ------
NM_001006614chrX2378 50 ------
NM_001006617chr951263 1233 443 389 354 --11266 1915
NM_001006619chr951263 1233 443 389 354 --11266 1915
NM_001006620chr951263 1233 443 389 354 --11266 1915
NM_001006621chr951263 1233 443 389 354 --11266 1915
NM_001006624chr141977 1894 1880 1263 ------
NM_001006634chr162639 72 1218 ----
NM_001006636chr22818 396 ------
NM_001006657chr263214 2649 859 786 579 306 --12251 1501
NM_001006665chr13763 674 235 1757 ----
NM_001006684chrX4437 418 405 42 1181 1409 --
NM_001006946chr251439 1300 1224 656 535 ------
NM_001007024chr17144320 3918 3741 3710 3597 3459 3285 3268 2978 2956 1506 428 389 204 33439 3144 2899 13582 --
NM_001007025chr17144320 3918 3741 3710 3597 3459 3285 3268 2978 2956 1506 428 389 204 33439 3144 2899 13582 --
NM_001007027chr11139 ------
NM_001007067chr821055 982 --31061 787 50 --
NM_001007068chr821055 982 --31061 787 50 --
NM_001007069chr821055 982 --31061 787 50 --
NM_001007070chr821055 982 --31061 787 50 --
NM_001007075chr43912 391 193 --1946 --
NM_001007097chr9124956 4020 3967 3865 3553 3183 1907 1359 909 879 342 270 13849 13833 21167 530
NM_001007098chr11319 3853 714 231 1116 --
NM_001007099chr15829 809 797 151 125 --1902 1766
NM_001007100chr15829 809 797 151 125 --1902 1766
NM_001007102chr671604 1269 615 599 401 376 256 11024 11180 21432 381
NM_001007156chr1551955 1518 1494 646 224 ------
NM_001007189chr5--1161 ----
NM_001007214chr11715 1719 ----
NM_001007226chr17----11425 --
NM_001007227chr17----11425 --
NM_001007228chr17----11425 --
NM_001007229chr17----11425 --
NM_001007230chr17----11425 --
NM_001007237chr182718 2428 533 375 351 335 328 234 12104 22461 2379 --
NM_001007245chr72663 45 ------
NM_001007246chr2161889 1293 1200 627 523 459 11897 41893 1532 1204 526 --
NM_001007250chr16951 931 919 659 273 247 --21024 35 1888
NM_001007257chr151408 1186 610 526 467 --11256 --
NM_001007259chr21124 ------
NM_001007267chr23825 771 131 3863 829 161 ----
NM_001007277chr113771 424 361 ------
NM_001007278chr13195293 5183 5158 5023 4926 4414 4334 4299 3748 3704 3577 3356 3328 1294 876 699 359 194 27 55050 3678 3508 1635 335 --12113
NM_001007466chr6185164 5029 4795 4784 4630 4572 4511 4265 3969 3446 2001 1963 1804 1588 1072 442 362 301 --34788 312 304 --
NM_001007471chr93707 675 69 ------
NM_001007527chr5------2551 190
NM_001007538chr1371535 1451 1324 730 723 410 349 21645 1483 ----
NM_001007546chr231452 1239 1080 11366 ----
NM_001007553chr141012 1000 827 431 --1440 --
NM_001007559chr1851928 1618 1431 720 400 11413 ----
NM_001007565chr31333 ------
NM_001007794chr11542 2767 127 1687 --
NM_001008220chr5154 --3551 548 44 --
NM_001008222chrX51057 884 167 153 113 ------
NM_001008225chr71602 1173 ----
NM_001008226chr1521623 48 21781 198 ----
NM_001008239chr18153474 3387 3199 3134 2956 2677 2662 1413 1228 1004 800 542 366 209 156 43689 3360 2718 1319 31194 567 213 --
NM_001008388chr47820 813 395 284 105 90 28 1357 ----
NM_001008391chr113590 213 121 2446 182 --1202
NM_001008392chr331048 438 235 ------
NM_001008393chr4172929 2816 2727 2480 2344 2144 2058 1901 1134 900 777 643 620 554 141 130 49 12420 22631 2233 --
NM_001008401chr1931504 1332 1182 31295 1094 521 ----
NM_001008405chr751800 1587 704 582 378 ------
NM_001008408chr7175826 5433 5173 5069 5054 2107 2031 2012 1334 1021 927 887 833 827 605 300 250 24234 54 25928 4820 36292 5393 4407
NM_001008495chr8122179 2123 2013 1851 1817 1732 1699 1652 1486 1422 828 421 22188 764 11840 --
NM_001008539chr8135325 5304 4419 4209 3491 3423 1571 1336 1303 1106 1059 607 334 --21091 1026 --
NM_001008540chr23358 43 21 3439 131 63 ----
NM_001008541chr1051942 1832 1796 946 276 ------
NM_001008541chr1051942 1832 1796 946 276 ------
NM_001008564chr13122288 2127 2118 2069 1878 1744 1427 351 205 171 119 62 22131 146 ----
NM_001008566chr221430 ------
NM_001008660chr11101595 1537 1439 1417 1405 1049 490 440 264 241 --2983 113 --
NM_001008701chr1953126 2818 2797 2000 1118 --22800 2155 --
NM_001008707chr1421432 772 ------
NM_001008708chr2--1242 1594 --
NM_001008723chr101485 ------
NM_001008726chr1461681 1196 504 290 221 54 21075 410 ----
NM_001008738chr5102879 2625 2423 2296 2108 1799 1036 736 695 84 32182 1075 904 32839 172 87 --
NM_001008744chr1431595 1279 196 --165 --
NM_001008777chr172485 96 ----2615 67
NM_001008783chr65900 746 722 277 93 ------
NM_001008784chr3----2219 22 --
NM_001008801chr1952012 1969 1946 1857 1456 32141 1984 1771 22185 1460 --
NM_001008860chr154837 536 153 114 3695 314 100 ----
NM_001008892chr154837 536 153 114 3695 314 100 ----
NM_001008894chr154837 536 153 114 3695 314 100 ----
NM_001008895chr1351376 1225 592 210 198 --1185 --
NM_001008925chr4113125 3107 2860 2849 2730 1230 1145 1097 800 732 575 43232 2458 1101 929 33427 3048 2804 --
NM_001008938chr111332 ------
NM_001009185chr52625 614 ------
NM_001009552chr82463 50 ------
NM_001009554chr473871 3172 2985 683 493 430 295 44184 3367 907 651 --11782
NM_001009554chr473871 3172 2985 683 493 430 295 44184 3367 907 651 --11782
NM_001009555chr421328 1267 11138 --1356
NM_001009565chr2125 --1440 --
NM_001009567chr102581 122 187 ----
NM_001009571chr771567 1486 1128 652 324 297 192 1124 31708 1494 656 --
NM_001009814chr131247 ------
NM_001009880chr22114928 4886 4543 4430 4257 3998 3885 3743 3333 3229 1267 34678 3750 1793 13337 14264
NM_001009881chr13647 552 499 1471 ----
NM_001009882chr13647 552 499 1471 ----
NM_001009899chr3226392 5734 5049 5016 4995 4979 4724 4639 4392 4210 4043 2591 2504 2470 2282 1865 1762 1737 1121 907 457 217 45875 5086 2510 629 35546 1878 579 11967
NM_001009909chr1173845 3318 2692 1150 1133 483 53 23518 1494 --1105
NM_001009955chr12445 197 ------
NM_001009955chr12445 197 ------
NM_001009959chr262446 2105 1727 898 393 379 ----1128
NM_001009960chr742696 2381 2274 814 22353 270 22584 1120 1710
NM_001009993chr2134337 4279 3477 3104 3056 1808 1797 1140 1032 982 971 568 97 2499 466 23933 1603 11813
NM_001010000chr18113482 3373 3095 2818 2346 1404 1284 685 420 391 202 23196 346 13168 --
NM_001010844chr6255 36 ------
NM_001010853chr6153242 2967 2569 2526 2151 2142 1073 895 818 514 343 290 238 108 48 12603 ----
NM_001010854chr142639 498 ------
NM_001010861chr162489 2112 1942 871 193 46 32794 2205 22 32644 2159 711 --
NM_001010862chrX72998 1264 974 542 320 259 100 13304 12149 --
NM_001010867chr156274 5325 2581 1975 1963 16683 ----
NM_001010888chrX93975 3888 3814 3705 3490 3192 1178 824 399 43170 2945 413 24 33709 3496 385 --
NM_001010891chr5226558 6550 6404 6262 5488 5093 5079 4631 4335 2501 2226 2129 2050 1433 957 938 768 699 547 439 425 392 26251 1010 --16747
NM_001010895chr961532 1296 544 522 490 45 21559 108 --1631
NM_001010898chr143070 2645 2541 73 ------
NM_001010908chr102638 618 --1622 1609
NM_001010917chr1052323 2174 2016 2006 100 --12022 --
NM_001010924chr1041210 800 782 361 ------
NM_001010927chr61365 ------
NM_001010932chr71349 ------
NM_001010971chr12705 690 ------
NM_001010984chr162393 2060 2022 997 957 225 3910 779 218 2990 542 --
NM_001010986chrX71984 1661 1595 748 636 425 351 22415 2380 1933 --
NM_001010989chr161493 ------
NM_001010990chr161493 ------
NM_001011513chr4113780 3349 2958 2930 2619 2510 1631 1614 1055 930 919 22592 1516 42666 1635 343 208 23785 3008
NM_001011515chr43787 421 53 2391 61 1115 --
NM_001011516chr43787 421 53 2391 61 1115 --
NM_001011537chr332307 2218 1505 32139 2016 462 1258 --
NM_001011551chrX2177 97 1181 1101 --
NM_001011553chr72769 234 ------
NM_001011645chrX1163 ------
NM_001011663chr1061045 846 819 390 317 253 1230 1673 --
NM_001011666chr7186442 6298 5469 5403 5092 4691 4504 4410 2575 2442 2069 1961 1333 1149 678 608 501 58 45416 4181 2583 110 35997 1573 626 --
NM_001011708chr242850 999 934 349 ------
NM_001011713chr1471549 1224 1199 1161 1037 1002 212 2644 459 ----
NM_001011720chr831424 383 28 ------
NM_001011722chr1--1164 ----
NM_001011722chr1--1164 ----
NM_001011885chr1591693 1527 1416 1394 1305 1264 394 329 125 ----1452
NM_001012264chr142700 190 --2687 674 --
NM_001012267chr911344 11642 ----
NM_001012333chr111253 --2322 300 --
NM_001012334chr111253 --2322 300 --
NM_001012337chr3190 ------
NM_001012393chr11165043 5031 5014 4572 4565 4347 4193 4083 4055 3530 3363 1258 532 461 126 103 13299 44087 3659 2044 92 --
NM_001012398chr162714 267 ------
NM_001012410chr3134 ------
NM_001012415chr91215 --1740 --
NM_001012418chr6134218 3912 3775 3756 3725 3570 3398 3331 3208 2789 1387 669 287 22887 693 23697 3689 --
NM_001012420chr1572820 2349 2065 983 800 624 223 22296 1175 11126 1228
NM_001012423chr1572820 2349 2065 983 800 624 223 22296 1175 11126 1228
NM_001012426chr621033 1005 --21045 468 --
NM_001012427chr621033 1005 --21045 468 --
NM_001012456chr71111 125 ----
NM_001012478chr192525 509 ------
NM_001012515chr1882374 2113 1797 1650 1565 1457 926 147 12203 1867 --
NM_001012614chr41532 ------
NM_001012732chr431177 266 91 11155 ----
NM_001012751chr1031736 1297 411 11592 1667 --
NM_001012755chrX95048 4730 4668 4645 4372 4072 1797 1182 1038 23729 1572 23790 73 11061
NM_001012761chr5112555 2365 1929 1824 1694 1074 1028 926 915 883 193 11068 1783 1607
NM_001012968chrX102663 2503 2232 1754 1121 946 666 511 489 345 42636 1979 997 679 ----
NM_001012977chrX31369 568 455 ------
NM_001012989chrX160 1457 154 --
NM_001012990chrX1263 1267 1314 --
NM_001013031chr1063219 3180 860 257 242 107 23038 116 1246 11086
NM_001013398chr731420 238 173 21405 1079 ----
NM_001013399chr64419 314 285 151 21013 155 ----
NM_001013406chr731293 70 55 11392 11621 --
NM_001013415chr481586 1420 1106 1031 543 477 374 309 31618 636 302 ----
NM_001013437chr18397 83 68 176 ----
NM_001013438chr34942 936 930 184 ------
NM_001013439chr34788 782 776 30 1336 ----
NM_001013615chr131015 933 210 --1999 --
NM_001013620chr12197760 6809 5914 5793 5705 5313 5259 5157 2993 2818 2664 2538 2157 2010 1738 1731 1589 937 92 48444 6437 6079 1785 ----
NM_001013635chr1221096 187 --2864 344 --
NM_001013690chr124811 777 215 155 --21737 817 --
NM_001013693chr122795 1011 ------
NM_001013693chr122795 1011 ------
NM_001013699chr12169 ----1415
NM_001013703chr151413 1454 ----
NM_001013843chr154923 597 213 115 --1363 --
NM_001014283chr1352205 2136 2042 1689 799 ------
NM_001014286chr13274 27 ------
NM_001014380chr13275813 5457 5313 5275 5224 4678 4380 4369 4203 3924 3549 2118 2035 1994 1877 1779 1676 1548 1515 1455 1000 974 937 767 682 564 347 32005 736 93 11611 --
NM_001014434chr15820 807 673 90 34 1693 143 --
NM_001014443chr12252 94 ------
NM_001014764chr17123 1165 ----
NM_001014796chr11179 ------
NM_001014796chr11179 ------
NM_001014797chr10158233 7231 6865 5476 5057 2552 2446 2118 2035 1578 1391 1144 497 414 198 47952 7389 6831 5447 47234 2179 516 505 13284
NM_001014811chr111106 ------
NM_001014812chr152413 384 ------
NM_001015045chr442459 1757 782 355 22243 647 ----
NM_001015048chr1483122 3065 2932 2293 2267 2186 542 242 1468 ----
NM_001015049chr1483122 3065 2932 2293 2267 2186 542 242 1468 ----
NM_001015053chr17154 --1526 --
NM_001015508chr81305 1578 ----
NM_001015877chrX82894 2448 2048 1137 1092 1023 101 60 52580 1969 1174 442 65 31979 486 483 --
NM_001015880chr1051459 494 456 295 22 ------
NM_001015881chrX31288 1199 55 ------
NM_001015887chr391850 1760 1705 1614 1508 1466 1401 729 535 31844 1566 319 ----
NM_001015892chr5--1156 ----
NM_001017365chr1151 ------
NM_001017366chr1151 ------
NM_001017367chr1151 ------
NM_001017369chr43892 715 415 1385 1161 --
NM_001017371chr261405 1155 1076 1023 413 84 --11085 --
NM_001017395chr382693 2667 2625 2547 2294 1070 895 142 1146 ----
NM_001017405chr42351 106 ----1270
NM_001017415chr14815 714 619 308 ------
NM_001017416chr14815 714 619 308 ------
NM_001017424chr171612 1603 1440 1410 249 211 178 11386 ----
NM_001017425chr171612 1603 1440 1410 249 211 178 11386 ----
NM_001017434chr13519 255 154 --121 --
NM_001017440chr7178278 7611 7564 7427 7383 7078 7070 7058 6702 5883 5475 2624 2342 2154 1548 847 397 28189 2238 77643 7386 2510 2316 1486 907 828 --
NM_001017523chr1261477 1321 1175 622 612 491 21332 616 ----
NM_001017923chr1451690 1555 1110 432 346 31040 593 573 11066 --
NM_001017926chr8101535 1512 1505 1462 1350 1201 1151 710 401 266 41444 1286 1137 37 ----
NM_001017962chr106997 763 721 678 280 171 --1914 --
NM_001017967chr161926 ----1801
NM_001017969chr92668 185 ------
NM_001017977chr13122 115 66 170 ----
NM_001017979chr41273 2555 297 1292 --
NM_001017995chr584820 4587 4264 3293 3126 2950 1450 130 11458 14813 1440
NM_001017999chr192069 2054 1701 867 755 393 366 317 299 2761 303 1323 --
NM_001017999chr192069 2054 1701 867 755 393 366 317 299 2761 303 1323 --
NM_001018000chr192069 2054 1701 867 755 393 366 317 299 2761 303 1323 --
NM_001018000chr192069 2054 1701 867 755 393 366 317 299 2761 303 1323 --
NM_001018001chr192069 2054 1701 867 755 393 366 317 299 2761 303 1323 --
NM_001018004chr152671 29 ------
NM_001018006chr152671 29 ------
NM_001018007chr152671 29 ------
NM_001018009chr31157 3987 908 186 11150 --
NM_001018020chr152671 29 ------
NM_001018037chr961461 1372 1299 1078 541 506 2489 211 1317 --
NM_001018053chr161631 1342 1250 604 347 246 ----1374
NM_001018054chr151032 900 382 231 205 ----11025
NM_001018056chr9--1582 189 1429
NM_001018064chr94839 309 276 261 11971 3265 244 194 1168
NM_001018067chr174890 4625 4533 3980 1573 863 737 2574 264 ----
NM_001018068chr174890 4625 4533 3980 1573 863 737 2574 264 ----
NM_001018069chr174890 4625 4533 3980 1573 863 737 2574 264 ----
NM_001018072chr1261477 1321 1175 622 612 491 21332 616 ----
NM_001018074chr533769 1028 566 33833 1325 359 --23955 3641
NM_001018075chr533769 1028 566 33833 1325 359 --23955 3641
NM_001018076chr533769 1028 566 33833 1325 359 --23955 3641
NM_001018077chr533769 1028 566 33833 1325 359 --23955 3641
NM_001018090chr15142594 2524 2239 2226 2093 2039 2009 1983 1924 1070 947 753 317 277 32154 1953 286 3550 422 326 --
NM_001018091chr15142704 2634 2349 2336 2203 2149 2119 2093 2034 1180 1057 863 427 387 32264 2063 396 3660 532 436 --
NM_001018100chr153688 256 23 ------
NM_001018102chr15142594 2524 2239 2226 2093 2039 2009 1983 1924 1070 947 753 317 277 32154 1953 286 3550 422 326 --
NM_001018108chr1551891 1735 822 786 595 --1491 --
NM_001018111chr793985 3847 3637 3065 2899 2884 2837 2784 147 --23346 914 --
NM_001018159chr162121 107 ------
NM_001018160chr162121 107 ------
NM_001018676chr82191 126 ------
NM_001018677chr82191 126 ------
NM_001020658chr141560 1247 1143 646 11167 ----
NM_001020658chr141560 1247 1143 646 11167 ----
NM_001020818chr1951905 1721 1536 505 47 165 91908 1546 562 467 456 268 185 134 79 --
NM_001020819chr1951905 1721 1536 505 47 165 91908 1546 562 467 456 268 185 134 79 --
NM_001020820chr1951905 1721 1536 505 47 165 91908 1546 562 467 456 268 185 134 79 --
NM_001020821chr1951905 1721 1536 505 47 165 91908 1546 562 467 456 268 185 134 79 --
NM_001023567chr1542212 991 357 221 1229 --1805
NM_001023587chr33868 711 200 11154 ----
NM_001024094chr533769 1028 566 33833 1325 359 --23955 3641
NM_001024218chr144669 320 233 226 ------
NM_001024226chr13990 236 164 ------
NM_001024227chr13990 236 164 ------
NM_001024228chr13990 236 164 ------
NM_001024372chr841809 1782 1490 532 11464 1540 22216 143
NM_001024455chrX32531 2196 2176 22119 363 140 --
NM_001024463chr15----11094 --
NM_001024647chr12116872 6254 6172 4694 4674 1984 1211 1031 1020 147 106 47399 1368 1151 182 ----
NM_001024649chr5122918 2787 2205 2031 2023 1922 1117 1017 704 640 267 32 42583 2303 2036 933 21021 857 --
NM_001024660chr341712 1352 1119 452 11358 11305 --
NM_001024666chrX1452 --1649 --
NM_001024688chr8111992 1873 1854 1631 1625 790 695 523 467 361 157 41799 1720 838 213 1794 --
NM_001024808chr1242746 1962 412 370 22801 2728 ----
NM_001024847chr382407 2344 2249 1841 1830 1557 895 811 22312 901 --11003
NM_001024934chr62199 98 1497 ----
NM_001024935chr62199 98 1497 ----
NM_001024936chr62199 98 1497 ----
NM_001024948chr1133453 3434 3255 3234 3214 2681 2437 1261 1000 907 517 427 269 12757 22852 1269 --
NM_001024956chr11135770 5657 5565 5430 5134 5031 4957 3916 3794 1931 1161 435 57 35721 4888 459 14318 --
NM_001024959chr33866 306 298 ------
NM_001024960chr33866 306 298 ------
NM_001025068chr331419 1134 654 1725 ----
NM_001025069chr331419 1134 654 1725 ----
NM_001025076chr10256174 6085 5291 4386 4180 4040 3829 3820 3796 2367 2237 2118 2020 1575 1528 1475 1336 1131 1054 834 610 392 344 330 41 76204 6141 5881 5376 2068 1390 532 --11716
NM_001025077chr10327532 7443 6649 5744 5538 5398 5187 5178 5154 5052 4985 4954 4825 2933 2886 2833 2694 2489 2412 2192 1968 1750 1702 1688 1397 1379 1323 762 710 308 281 41 87562 7499 7239 6734 2748 1890 1012 296 ----
NM_001025079chr3123915 3740 3505 3437 3007 2918 2819 2793 2694 1566 1510 1471 33013 1393 940 1947 --
NM_001025100chr18153991 3982 3685 3617 3313 3181 3131 3108 2955 2662 1315 1290 902 841 395 21081 616 --11400
NM_001025105chr581406 1242 1089 1079 1054 1026 511 454 21246 259 21410 1391 11353
NM_001025107chr172389 475 253 209 170 106 98 --12438 12156
NM_001025107chr172389 475 253 209 170 106 98 --12438 12156
NM_001025108chr2123229 3041 2887 1346 1309 1279 1267 980 968 950 876 387 43928 2891 1562 1144 2880 230 --
NM_001025201chr25740 674 544 525 89 ------
NM_001025233chr1282723 2046 1966 1726 848 740 622 584 1788 ----
NM_001025252chr843161 2616 2372 373 2735 472 ----
NM_001025253chr843161 2616 2372 373 2735 472 ----
NM_001025266chr3164944 4751 4275 4034 3707 3668 3496 3357 3255 1309 902 880 486 202 182 71 1921 14637 14567
NM_001025356chr1292997 2955 2804 2725 2552 1907 846 680 313 32611 395 141 1236 --
NM_001025366chr661817 1711 1249 572 431 274 11299 ----
NM_001025366chr661817 1711 1249 572 431 274 11299 ----
NM_001025367chr661817 1711 1249 572 431 274 11299 ----
NM_001025367chr661817 1711 1249 572 431 274 11299 ----
NM_001025368chr661817 1711 1249 572 431 274 11299 ----
NM_001025368chr661817 1711 1249 572 431 274 11299 ----
NM_001025369chr661833 1727 1265 588 447 290 11315 ----
NM_001025369chr661833 1727 1265 588 447 290 11315 ----
NM_001025370chr661817 1711 1249 572 431 274 11299 ----
NM_001025370chr661817 1711 1249 572 431 274 11299 ----
NM_001025580chrX93522 3093 3024 1256 612 330 311 256 68 11543 34038 377 358 --
NM_001025595chr4101596 1482 1384 1147 1107 1039 602 561 225 136 11111 --1145
NM_001025596chr113376 330 201 ------
NM_001025603chr161376 1355 1030 983 454 93 --165 --
NM_001025616chr431903 620 428 31627 1342 236 ----
NM_001025777chr251545 1400 378 254 67 ------
NM_001025780chr92221 37 ------
NM_001029839chr331506 589 241 ------
NM_001029840chr331506 589 241 ------
NM_001029858chr673155 2694 1184 968 880 660 427 --12697 --
NM_001029859chr111192 12414 ----
NM_001029863chr642632 2172 2086 989 1616 --12177
NM_001029875chr572869 2134 1168 1089 986 727 696 12843 --1720
NM_001029882chr12559 241 1578 ----
NM_001029882chr12559 241 1578 ----
NM_001029998chr42884 431 ------
NM_001030001chr141325 ------
NM_001030006chr1752648 1984 1811 697 588 --1288 --
NM_001030007chr1693758 3626 3220 2978 2512 1382 1354 1072 1065 2785 26 3533 395 246 23808 3462
NM_001030055chr14164723 4613 4303 4049 4028 3937 3838 3359 3075 1857 1457 1175 1113 831 626 320 43482 3250 943 711 ----
NM_001030059chr10--195 ----
NM_001030272chr112419 386 ------
NM_001030273chr112419 386 ------
NM_001031677chr52424 344 ------
NM_001031679chr1283477 3307 2848 1233 521 298 265 128 23577 89 32810 287 134 1236
NM_001031689chr9147 ------
NM_001031690chr782912 2888 2779 2667 1222 1012 832 661 1357 --11128
NM_001031695chr22204742 4716 4632 4623 4556 4211 4080 1810 1601 1049 1042 862 786 628 479 239 213 187 172 152 --1824 --
NM_001031700chr472310 2209 2049 1829 637 425 224 12491 12313 --
NM_001031710chr73882 261 147 ----21044 863
NM_001031711chr551821 1687 643 636 182 ------
NM_001031716chr221093 373 ------
NM_001031717chr3138 --1720 --
NM_001031723chr44386 372 312 45 ------
NM_001031732chr4163639 2989 2592 2499 2284 1255 887 854 603 541 534 508 492 334 328 269 22820 2801 1797 --
NM_001031738chr21502 1436 156 --
NM_001031743chr6--1173 ----
NM_001031803chr171251 ------
NM_001031804chr16144422 4069 3657 3646 3638 2786 2757 1293 1106 1024 1018 631 555 435 2648 386 42764 1146 444 441 --
NM_001031812chr582130 1950 1692 1578 410 309 178 161 11886 31881 1878 164 --
NM_001031855chrX2205 60 ------
NM_001032279chr111384 ------
NM_001032280chr641634 600 389 328 ------
NM_001032282chr841302 883 365 206 --1473 1490
NM_001032283chr123935 244 227 ------
NM_001032284chr123935 244 227 ------
NM_001032288chr2011585 1527 11504 --
NM_001032293chr171595 --1224 1228
NM_001032296chr1372704 2685 2198 776 61 37 31 12016 --2758 47
NM_001032363chr141672 899 163 92 31581 857 255 1903 --
NM_001032363chr141672 899 163 92 31581 857 255 1903 --
NM_001032367chr151446 ------
NM_001032393chrX4611 572 173 163 1155 ----
NM_001032394chr682707 2640 2589 2564 2477 2459 306 289 22846 2198 22468 536 --
NM_001032395chr682574 2507 2456 2431 2344 2326 173 156 22713 2065 22335 403 --
NM_001032730chr12581 487 ------
NM_001032999chr2095237 4440 3802 3767 1662 1342 1331 1254 709 24454 1093 ----
NM_001033025chr141504 1260 284 203 ----1368
NM_001033045chr284179 3961 3896 3569 3494 1556 1139 864 24159 3989 34155 3696 1142 --
NM_001033047chr431621 588 147 12060 149 --
NM_001033049chr2121976 1634 --22023 1513 22146 1926
NM_001033057chr361920 1854 1584 454 226 80 11840 1329 --
NM_001033059chr641577 1495 647 545 2775 479 ----
NM_001033087chr2083224 3058 2964 2308 2261 1324 614 344 1552 22732 708 --
NM_001033112chr52792 302 1884 ----
NM_001033117chr364039 3883 3428 3255 3232 1079 --21868 494 --
NM_001033503chr51475 ------
NM_001033507chr121288 54 ------
NM_001033518chr792526 1961 770 681 660 595 568 244 223 1364 ----
NM_001033519chr792526 1961 770 681 660 595 568 244 223 1364 ----
NM_001033520chr792526 1961 770 681 660 595 568 244 223 1364 ----
NM_001033521chr206794 578 272 151 125 24 1550 ----
NM_001033522chr206794 578 272 151 125 24 1550 ----
NM_001033557chr231292 1189 66 31310 1158 1141 ----
NM_001033561chr172776 586 1671 2589 171 --
NM_001033566chr171944 ------
NM_001033568chr171944 ------
NM_001033576chr1762554 2503 2384 1913 1738 287 32394 2149 331 32373 1741 760 --
NM_001033578chr872283 2129 950 465 298 279 145 12241 ----
NM_001033659chr1721501 1445 21395 416 ----
NM_001033756chr661751 1645 1183 506 365 208 11233 ----
NM_001033756chr661751 1645 1183 506 365 208 11233 ----
NM_001033910chr171749 1397 637 256 237 162 31 21933 509 22043 116 12239
NM_001033925chr1062043 1900 1338 539 215 178 21462 219 ----
NM_001034837chr52816 205 --1209 --
NM_001034838chr52816 205 --1209 --
NM_001034841chr16125524 5195 4384 4365 3978 3874 3741 1753 1422 1164 1079 1036 11673 34819 3817 1668 --
NM_001034850chr551472 1386 1065 544 331 3457 348 338 1334 --
NM_001034954chr10113191 3175 2975 2969 2269 1157 873 855 773 280 67 23195 2257 ----
NM_001034955chr10113191 3175 2975 2969 2269 1157 873 855 773 280 67 23195 2257 ----
NM_001034956chr10113191 3175 2975 2969 2269 1157 873 855 773 280 67 23195 2257 ----
NM_001034957chr10113191 3175 2975 2969 2269 1157 873 855 773 280 67 23195 2257 ----
NM_001035chr141181 1078 1039 290 1530 ----
NM_001035005chr182647 85 --2583 210 --
NM_001035260chr103427 325 292 11376 ----
NM_001035511chr172107 1994 1873 1410 618 553 122 --42012 1753 557 218 --
NM_001035512chr172214 2101 1980 1517 725 660 229 --42119 1860 664 325 --
NM_001035513chr172214 2101 1980 1517 725 660 229 --42119 1860 664 325 --
NM_001035521chr2----1526 --
NM_001037132chr772030 1759 1707 1515 682 642 516 11902 --1203
NM_001037133chr772030 1759 1707 1515 682 642 516 11902 --1203
NM_001037163chr72182 59 2940 743 ----
NM_001037164chr761782 738 693 510 478 184 22017 1459 ----
NM_001037165chr7148881 8854 8765 8129 7391 7289 6984 6685 6596 2453 2059 1840 576 235 48862 8479 8116 7378 28110 5660 25981 978
NM_001037174chr251902 1587 354 232 196 11593 1114 --
NM_001037304chr11--1163 ----
NM_001037317chr162489 2112 1942 871 193 46 32794 2205 22 32644 2159 711 --
NM_001037331chr183722 158 116 --2356 205 1305
NM_001037332chr532280 2248 1838 --1250 --
NM_001037333chr532280 2248 1838 --1250 --
NM_001037334chr1851877 953 449 313 249 12130 1900 22403 328
NM_001037339chr141460 711 503 407 --1546 --
NM_001037340chr141460 711 503 407 --1546 --
NM_001037341chr141460 711 503 407 --1546 --
NM_001037341chr141460 711 503 407 --1546 --
NM_001037535chrX41365 1027 75 57 1228 11474 1170
NM_001037536chrX41365 1027 75 57 1228 11474 1170
NM_001037540chrX41365 1027 75 57 1228 11474 1170
NM_001037553chr2165110 4771 4048 4040 1414 101 --34355 4352 3528 15163
NM_001037582chr41514 11706 ----
NM_001037631chr22463 102 ------
NM_001037637chr52249 73 ------
NM_001037738chr51196 ------
NM_001037872chr24639 594 137 110 1696 1530 --
NM_001037954chr11103339 3124 2993 2523 2235 931 859 850 749 465 1757 1753 --
NM_001038493chr251591 1566 1423 1360 201 ------
NM_001038640chr154871 694 267 42 ------
NM_001038702chr5132763 2667 1829 1758 1698 910 854 838 502 273 256 220 159 --21907 869 --
NM_001038707chr142195 1926 1711 651 32340 1981 1952 12209 --
NM_001038707chr142195 1926 1711 651 32340 1981 1952 12209 --
NM_001039111chr32119 82 ------
NM_001039199chr20154970 4745 4663 4517 4203 3784 3344 3331 3149 3051 3045 1970 1091 282 33 43910 3868 1241 467 23159 42 --
NM_001039350chr71610 ------
NM_001039395chr962274 1578 667 480 208 87 ------
NM_001039465chr14131 ------
NM_001039535chr187481 472 453 435 110 98 67 --1487 --
NM_001039538chr2113568 3214 2626 2560 2280 1457 1355 1304 1231 1221 1060 73646 3615 3224 2488 2293 1225 89 --1844
NM_001039547chr3307870 7792 7152 7140 6845 6716 6586 6422 5982 5945 5211 4983 3134 2610 2437 2011 1940 1776 1669 1649 1640 1499 1132 978 836 759 650 621 299 178 67122 3127 2937 828 418 410 32014 1999 1782 --
NM_001039550chr22722 694 ------
NM_001039569chr292732 2723 2396 2365 2344 2278 2221 2202 123 53289 2675 2668 2098 494 42356 2290 978 410 --
NM_001039577chr184501 4308 3170 2873 1691 1684 1572 164 11534 ----
NM_001039585chr1113144 3051 2946 2845 2736 2574 1571 1229 963 96 41 33324 926 442 11443 11234
NM_001039590chrX153965 3437 3352 3203 3188 2558 1526 1515 1474 991 757 600 484 337 288 23285 590 22814 64 --
NM_001039591chrX153965 3437 3352 3203 3188 2558 1526 1515 1474 991 757 600 484 337 288 23285 590 22814 64 --
NM_001039618chr11215848 5838 5449 5154 4879 4751 4694 4630 4503 4305 4036 3891 2223 2189 1988 1928 1341 1288 935 388 215 45880 5690 4795 4072 ----
NM_001039690chr1662384 1872 1861 1724 649 330 12396 31711 871 289 --
NM_001039693chr264051 3933 1642 1110 1095 987 ----11549
NM_001039709chr2095237 4440 3802 3767 1662 1342 1331 1254 709 24454 1093 ----
NM_001039711chr14839 780 328 110 11104 1889 --
NM_001039712chr14839 780 328 110 11104 1889 --
NM_001039762chr1052250 1677 1542 775 207 22378 516 ----
NM_001039802chr161395 1380 1235 890 435 423 11258 ----
NM_001039840chrX205920 5797 5587 5572 5552 5544 5342 4960 4761 3890 3864 2338 2015 1545 1284 957 847 362 170 125 54741 2310 1526 1288 106 12060 24766 2362
NM_001039888chr12644 561 ----1553
NM_001039916chr1241068 1055 1014 87 --2159 55 1173
NM_001039917chr1241068 1055 1014 87 --2159 55 1173
NM_001039918chr1241068 1055 1014 87 --2159 55 1173
NM_001039919chr1241068 1055 1014 87 --2159 55 1173
NM_001039920chr1241068 1055 1014 87 --2159 55 1173
NM_001039937chr1383706 3570 3138 3052 1373 696 612 304 21569 169 32857 2707 142 141
NM_001039938chr1391529 1253 1190 1164 1027 951 503 359 175 2463 31 11457 --
NM_001039960chr1241430 1252 1141 248 11125 2266 263 --
NM_001040057chr73447 200 102 ------
NM_001040058chr42506 399 --190 --
NM_001040059chr172596 113 ------
NM_001040060chr42506 399 --190 --
NM_001040092chr82438 155 ------
NM_001040100chr351151 786 518 306 177 ------
NM_001040101chr421172 438 ------
NM_001040102chr1061719 985 643 328 274 95 1334 2764 345 --
NM_001040103chr1061719 985 643 328 274 95 1334 2764 345 --
NM_001040108chr1452044 2017 998 873 154 2669 359 43314 2539 2415 851 1478
NM_001040110chr721619 122 11609 1256 --
NM_001040142chr252007 1901 1729 621 424 32358 2100 1580 ----
NM_001040143chr252007 1901 1729 621 424 32358 2100 1580 ----
NM_001040144chr1662384 1872 1861 1724 649 330 12396 31711 871 289 --
NM_001040146chr1662384 1872 1861 1724 649 330 12396 31711 871 289 --
NM_001040147chr185704 593 445 241 112 1623 ----
NM_001040152chr7104589 4525 3684 3291 3106 1628 1606 1391 804 341 24008 1566 ----
NM_001040153chr134931 886 276 96 ----1696
NM_001040158chr53477 417 400 ------
NM_001040159chr421489 1118 1276 178 --
NM_001040181chr361147 1125 938 768 726 383 ------
NM_001040182chr361147 1125 938 768 726 383 ------
NM_001040183chr361147 1125 938 768 726 383 ------
NM_001040199chr361147 1125 938 768 726 383 ------
NM_001040200chr361147 1125 938 768 726 383 ------
NM_001040202chr452521 2378 1950 553 106 12062 1100 --
NM_001040214chr642314 2246 1536 49 11488 ----
NM_001040260chr461052 1031 1025 791 449 422 ------
NM_001040261chr461052 1031 1025 791 449 422 ------
NM_001040272chr931911 1786 549 182 11663 11667
NM_001040280chr641455 1304 1135 22 1278 125 --
NM_001040284chr16225575 5175 5134 4176 2332 2312 1698 1633 1587 1509 1348 1289 1188 1107 963 951 945 742 689 601 563 129 35847 5138 1305 35591 4123 1316 --
NM_001040402chr4112922 2715 2447 1244 834 803 786 766 722 513 366 43013 2546 2036 759 12577 --
NM_001040409chr231008 794 708 ------
NM_001040429chr1373586 3369 3356 1193 173 157 34 ----21444 178
NM_001040440chr51608 182 1451 --
NM_001040441chr154166 3574 2149 2128 686 24926 333 1295 --
NM_001040446chr572685 2631 2299 2066 954 797 519 32640 348 162 1874 1605
NM_001040450chr1552499 2306 2283 2124 642 32225 1888 124 22470 879 1163
NM_001040453chr1552499 2306 2283 2124 642 32225 1888 124 22470 879 1163
NM_001040455chr1121237 253 --1412 --
NM_001040458chr581904 1883 1430 1285 607 529 270 106 1162 11691 --
NM_001040633chr72838 125 21042 281 ----
NM_001040665chr7135032 4722 4653 4164 4044 3997 3512 3325 3079 1927 911 386 195 84671 3991 3150 1597 1226 1053 676 152 34857 4596 1843 24455 4340
NM_001040666chr71734 --2559 298 2157 42
NM_001040697chr112463 137 1231 --1514
NM_001040708chr841086 940 375 166 21074 180 ----
NM_001040709chr172131 1882 950 834 733 228 192 11886 ----
NM_001040712chr9143570 3521 3513 3385 3235 3228 3173 2930 2410 2365 2348 987 562 93 11076 ----
NM_001040876chr441439 1429 675 594 ------
NM_001042355chr16105238 4259 4217 4165 4066 3844 1854 1317 548 397 15276 --1370
NM_001042357chr1041299 483 134 113 21538 464 ----
NM_001042358chr1041299 483 134 113 21538 464 ----
NM_001042360chr1041299 483 134 113 21538 464 ----
NM_001042363chr1041299 483 134 113 21538 464 ----
NM_001042383chr352747 2198 1174 993 238 23452 369 22464 196 --
NM_001042388chr18--1668 --1763
NM_001042389chr1041299 483 134 113 21538 464 ----
NM_001042390chr1041299 483 134 113 21538 464 ----
NM_001042392chr1041299 483 134 113 21538 464 ----
NM_001042395chr1041299 483 134 113 21538 464 ----
NM_001042399chr12189 ------
NM_001042403chr12384 48 23 1186 --1336
NM_001042404chr151549 694 443 301 125 21553 784 --1406
NM_001042412chr16105238 4259 4217 4165 4066 3844 1854 1317 548 397 15276 --1370
NM_001042413chr9103734 3647 3306 2701 1464 1451 1442 1237 1115 134 11061 21240 196 --
NM_001042424chr453288 3157 2742 2251 647 2832 817 1572 --
NM_001042425chr641634 600 389 328 ------
NM_001042453chrX61434 1372 1323 475 404 275 11508 11130 --
NM_001042454chr16----1353 --
NM_001042459chr3158 ------
NM_001042465chr102313 48 ------
NM_001042466chr102313 48 ------
NM_001042473chr1041686 1623 554 110 --22167 1674 --
NM_001042481chr1482688 2643 2454 2315 2246 2083 1996 318 2120 70 1453 197
NM_001042486chr2051110 459 320 240 160 ------
NM_001042492chr1793489 3135 2461 1320 1086 880 764 502 200 2433 193 23211 897 1392
NM_001042493chr672002 1913 1623 662 217 187 88 1666 1190 --
NM_001042494chr15103729 3591 2910 2517 2507 2391 927 898 741 35 31275 1079 515 11257 1584
NM_001042495chr15103729 3591 2910 2517 2507 2391 927 898 741 35 31275 1079 515 11257 1584
NM_001042496chr15103729 3591 2910 2517 2507 2391 927 898 741 35 31275 1079 515 11257 1584
NM_001042497chr15103729 3591 2910 2517 2507 2391 927 898 741 35 31275 1079 515 11257 1584
NM_001042506chrX31460 568 455 11338 --21391 582
NM_001042510chr851778 1718 1594 1457 823 21959 844 ----
NM_001042511chr851778 1718 1594 1457 823 21959 844 ----
NM_001042533chr363240 3057 1261 1216 748 315 43302 2617 2216 729 22572 346 23071 334
NM_001042537chrX82472 2360 2244 1832 1734 677 485 308 ------
NM_001042543chr431389 434 188 31507 1203 254 11119 11325
NM_001042548chr23795 329 81 1155 ----
NM_001042550chr91239 21836 1745 ----
NM_001042555chr12134757 4391 4245 3948 3864 3800 3577 1838 855 777 485 346 116 24452 3525 ----
NM_001042589chr94609 214 98 53 ------
NM_001042590chr94609 214 98 53 ------
NM_001042599chr2297825 7582 7541 7495 7358 7280 7161 7032 6818 6605 6162 6044 5974 5565 5478 5139 5016 2913 2668 2641 2375 2081 1909 1111 892 640 534 343 314 65649 1588 879 838 651 217 41114 357 329 323 1744
NM_001042601chr3153202 3146 2949 2894 2305 2078 1175 886 667 624 604 355 291 104 87 33035 3000 574 ----
NM_001042603chr12215136 5070 5040 4786 4287 4260 4121 3915 3732 3565 3556 3286 1972 1918 1794 1569 1499 1204 1198 1151 963 --43940 1341 1304 207 --
NM_001042604chr3184416 4324 4143 4136 3933 3659 3534 3343 3331 3131 3078 3033 1242 914 856 471 50 30 44596 1565 1190 127 24440 3463 --
NM_001042631chr191443 ------
NM_001042646chr381756 1241 765 759 596 534 309 221 --1313 1557
NM_001042669chr431903 620 428 31627 1342 236 ----
NM_001042681chr1112281 2173 2099 1869 1858 1037 597 562 526 299 64 1117 --12148
NM_001042682chr1112281 2173 2099 1869 1858 1037 597 562 526 299 64 1117 --12148
NM_001042682chr1112281 2173 2099 1869 1858 1037 597 562 526 299 64 1117 --12148
NM_001042683chr691705 1629 1568 1397 1299 1157 733 580 303 11369 ----
NM_001042728chr122934 425 ------
NM_001042749chrX51880 1715 283 217 98 1582 11740 --
NM_001042750chrX51880 1715 283 217 98 1582 11740 --
NM_001042751chrX51880 1715 283 217 98 1582 11740 --
NM_001042762chr741127 1093 1073 831 1896 --146
NM_001042784chr4--122 184 --
NM_001044305chr631531 641 95 ------
NM_001044385chr243791 2695 2677 790 12870 13038 --
NM_001044387chr1983903 3483 3463 3423 3413 2931 2614 1392 64141 3851 3487 2791 376 200 ----
NM_001044388chr1983903 3483 3463 3423 3413 2931 2614 1392 64141 3851 3487 2791 376 200 ----
NM_001044722chr582130 1950 1692 1578 410 309 178 161 11886 31881 1878 164 --
NM_001044723chr582130 1950 1692 1578 410 309 178 161 11886 31881 1878 164 --
NM_001046chr592820 2317 2295 1027 890 667 291 218 109 1784 1465 --
NM_001068chr31289 127 ----
NM_001071775chr1371524 1486 1346 771 564 216 121 21422 601 --11820
NM_001077628chr11264 --1209 --
NM_001078chr11708 --1698 --
NM_001079874chr131946 1711 268 --1317 1677
NM_001083620chr462414 2051 1025 845 262 208 52525 1793 984 785 687 1339 --
NM_001083621chr132952 1052 744 --11173 --
NM_001084chr7144 ------
NM_001092chr1741709 821 361 340 ------
NM_001094chr176819 810 770 697 661 300 ------
NM_001099678chr3136268 6253 5870 5575 5561 5497 5072 4181 2462 2400 2041 1520 1072 34500 1570 785 25564 2466 35195 995 623
NM_001100108chr1178224 7536 6988 5748 5179 3268 3182 3070 2748 2492 2327 1669 1541 1204 1022 985 805 58005 7628 2381 1280 989 36441 2755 2209 16776
NM_001106chr3289780 9706 9589 8656 8441 8429 7870 7256 7078 7035 6221 6166 5964 3791 3674 3240 3117 2940 2901 2675 2395 2339 1306 1237 894 853 330 132 98640 8573 8360 2511 2464 2449 1733 1340 954 47302 7295 3450 3381 11989
NM_001111chr172389 475 253 209 170 106 98 --12438 12156
NM_001113490chrX113427 3129 3058 2907 2878 2477 2302 910 645 568 128 ------
NM_001116chr1653050 2599 1933 1226 180 --22142 375 --
NM_001117chr1882322 2167 2070 1628 1590 642 544 160 ------
NM_001121chr1051723 1447 1316 1274 633 1662 ----
NM_001122679chr511201 ------
NM_001123chr103836 682 101 ------
NM_001125chr3101660 1640 1540 812 306 191 171 74 63 33 1154 21876 36 11938
NM_001126chr15940 796 755 325 55 4759 329 257 195 ----
NM_001128chr1693758 3626 3220 2978 2512 1382 1354 1072 1065 2785 26 3533 395 246 23808 3462
NM_001135chr15296 86 1262 ----
NM_001146chr862242 2018 1898 1859 1827 1804 12320 --11918
NM_001148chr462040 1942 1921 1883 1853 442 ------
NM_001149chr102463 422 21310 957 ----
NM_001153chr25840 821 375 327 63 ------
NM_001154chr41295 --1167 --
NM_001160chr1251048 575 405 83 32 1198 1166 --
NM_001167chrX176748 6462 6409 4853 4725 4660 4560 2527 2491 1863 1459 1047 1010 978 514 338 168 66785 6663 6545 2236 843 177 14603 --
NM_001173chr14164723 4613 4303 4049 4028 3937 3838 3359 3075 1857 1457 1175 1113 831 626 320 43482 3250 943 711 ----
NM_001174chrX32315 2086 1964 32211 2146 1887 ----
NM_001177chr1282262 2219 1569 1520 487 383 230 218 ----11640
NM_001178chr112419 386 ------
NM_001186chr21103005 2677 2439 2231 954 892 559 438 407 104 22933 980 11091 --
NM_001191chr201344 ------
NM_001192chr161213 ------
NM_001197chr222107 82 ------
NM_001198chr692342 2301 2218 2170 2065 1891 748 476 30 1348 22173 1598 --
NM_001200chr2041082 1004 795 333 1867 1798 --
NM_001201chr4113940 3809 3539 3428 2995 2804 1012 502 466 321 243 43848 3361 1057 649 52998 2807 1271 862 62 21084 866
NM_001204chr2227579 7398 7073 6838 6615 5422 5240 2614 2452 2154 2063 1612 1602 1550 1347 1273 908 768 673 576 542 353 77738 7200 5345 5198 2048 2000 1364 37291 7077 1470 16457
NM_001206chr992971 2654 2585 2453 2446 2057 778 487 303 ------
NM_001207chr52249 73 ------
NM_001219chr751568 817 631 271 102 --3903 638 635 --
NM_001222chr1011788 --1508 --
NM_001227chr1031293 1151 182 1459 ----
NM_001233chr74874 828 416 377 22291 1770 2789 47 --
NM_001235chr113594 587 575 2680 604 ----
NM_001237chr441091 940 826 143 --3841 813 803 1292
NM_001237chr441091 940 826 143 --3841 813 803 1292
NM_001238chr191116 ------
NM_001241chr262036 1617 716 481 134 123 22427 240 ----
NM_001241chr262036 1617 716 481 134 123 22427 240 ----
NM_001251chr172596 113 ------
NM_001253chr62246 219 1114 ----
NM_001254chr1771083 932 924 841 772 217 108 1146 ----
NM_001256chr17142808 2728 2632 2500 2189 2107 1960 1816 1041 728 362 262 251 56 42554 1067 443 266 12891 1375
NM_001257chr1661535 1370 1266 1231 1185 440 1142 1288 --
NM_001259chr7205814 5783 5119 5013 4964 4727 4694 4505 4226 4182 2293 1969 1877 927 919 827 802 615 482 299 45907 4063 2412 2402 11604 14592
NM_001260chr13--1286 ----
NM_001261chr92465 39 1440 1275 --
NM_001262chr11231 ------
NM_001265chr131941 --2222 207 --
NM_001270chr58860 850 811 731 414 233 222 35 1941 1129 --
NM_001271chr1543093 2006 681 349 23097 2458 11276 --
NM_001273chr124558 451 387 376 ------
NM_001278chr104936 482 452 68 31203 748 88 ----
NM_001280chr195690 616 447 253 191 ------
NM_001282chr1752648 1984 1811 697 588 --1288 --
NM_001283chr72682 525 ------
NM_001284chr52452 227 ------
NM_001290chr49975 905 870 853 435 408 321 206 145 1667 1153 --
NM_001299chr191484 ------
NM_001300chr101343 ------
NM_001304chr1793602 3189 3034 1344 1161 1145 1114 492 351 42440 2340 856 443 32489 882 241 1100
NM_001310chr1292477 2389 2055 1230 1059 906 847 347 80 12640 ----
NM_001315chr631472 1450 845 12306 1268 --
NM_001319chr1921106 320 ------
NM_001324chr206794 578 272 151 125 24 1550 ----
NM_001326chr11--1309 ----
NM_001328chr41532 ------
NM_001329chr101440 1247 21637 288 --
NM_001331chr11132767 2451 2330 2184 2073 1953 1895 1745 1123 472 444 285 224 12165 41072 170 149 80 --
NM_001332chr561385 1159 636 471 78 61 1640 ----
NM_001338chr213955 868 46 1232 ----
NM_001343chr551207 1101 651 578 467 --1600 --
NM_001351chr321861 527 1161 21369 1356 --
NM_001356chrX61847 1773 1558 879 518 334 12198 11573 --
NM_001357chr12229 72 1233 ----
NM_001358chr42125 117 1129 ----
NM_001362chr141305 --11005 --
NM_001364chr11214404 4378 4367 4227 4207 3775 3757 3656 3364 3290 3251 3157 3109 3097 2933 2909 1443 1358 1302 1216 455 --33870 3779 918 11787
NM_001365chr176781 631 619 577 496 111 ------
NM_001385chr85394 340 324 296 151 --1142 --
NM_001386chr8102342 2066 2021 1911 1731 792 754 473 432 82 --2400 68 --
NM_001389chr214551 442 173 65 --1479 --
NM_001391chr1821016 455 --1109 1113
NM_001394chr83922 804 288 1573 ----
NM_001395chrX--1982 1212 --
NM_001396chr21112667 2317 2113 2001 1110 959 432 406 233 58 27 --21130 1118 --
NM_001399chrX43829 3054 1127 559 31264 966 910 33347 833 242 --
NM_001400chr151096 1061 1012 885 493 ----1429
NM_001401chr971460 1417 1302 1092 1018 498 390 ----11069
NM_001406chr1771657 1383 1239 484 435 405 40 --3438 364 244 --
NM_001407chr331207 492 485 1262 ----
NM_001408chr121165 1053 21664 261 --11073
NM_001412chrX83399 2948 2935 2412 2381 722 537 207 23581 3221 --1957
NM_001416chr173176 132 111 ------
NM_001417chr1271772 1660 1199 570 234 127 119 ------
NM_001418chr111550 --1295 --
NM_001418chr111550 --1295 --
NM_001419chr19154818 4412 4347 4316 4005 3939 3905 3872 3834 3746 1241 1145 1136 1024 63 44539 4450 4224 4210 1954 --
NM_001422chr1151045 521 207 96 88 ------
NM_001423chr1231917 1596 1579 31554 1496 1299 11990 --
NM_001426chr21546 ----1475
NM_001427chr7101949 1911 1820 1468 1458 1445 774 325 284 246 --4784 781 778 732 --
NM_001429chr2281085 902 886 787 772 404 233 57 --1890 1714
NM_001430chr24658 493 360 249 11547 1160 --
NM_001431chr661133 881 853 806 458 247 --1448 --
NM_001432chr4103883 3656 3626 2758 1445 1270 1138 874 850 762 12666 11055 --
NM_001438chr1143248 2323 1191 1033 786 516 453 388 318 277 256 246 217 183 2844 348 83098 520 505 462 338 286 260 207 1889
NM_001439chr141504 1260 284 203 ----1368
NM_001440chr821989 960 --11924 --
NM_001446chr63264 230 42 ------
NM_001448chrX81710 1292 550 384 360 335 309 86 --11157 --
NM_001449chrX2520 49 ----1108
NM_001451chr1651289 1169 972 454 77 ------
NM_001452chr6--1721 ----
NM_001453chr681472 1456 1302 658 606 464 326 194 --1383 --
NM_001458chr72645 604 ------
NM_001460chr183512 3503 3475 3034 1190 170 150 124 23546 2973 13249 --
NM_001461chr1--2439 29 2391 146 --
NM_001463chr22704 260 --1707 --
NM_001482chr153371 325 158 --1716 --
NM_001483chr73894 721 408 2349 141 ----
NM_001491chr652734 1802 1738 386 234 ----11098
NM_001493chrX3581 246 174 ------
NM_001494chr102238 231 ----1675
NM_001495chr851048 1040 297 153 115 --1792 --
NM_001497chr982171 1888 828 545 424 372 353 234 1357 21891 500 --
NM_001498chr651107 541 409 372 147 ------
NM_001518chr73844 423 118 1416 --1151
NM_001521chr2----1526 --
NM_001527chr6174860 4790 4058 3206 1612 1597 1309 1094 1072 771 633 476 301 196 174 148 66 11663 1135 --
NM_001530chr1441069 272 168 26 41093 989 410 182 1310 --
NM_001533chr192261 102 ------
NM_001540chr7194 ------
NM_001542chr182718 2428 533 375 351 335 328 234 12104 22461 2379 --
NM_001543chr543638 3258 959 703 14238 23699 3261 --
NM_001546chr62480 185 1991 ----
NM_001550chr72663 45 ------
NM_001552chr1711096 --21103 1100 --
NM_001553chr42232 81 ------
NM_001557chr221337 83 ------
NM_001560chrX72671 2635 2548 2530 2481 336 48 11049 22301 941 --
NM_001584chr1161013 445 285 150 105 54 11180 1459 --
NM_001587chrX42260 2233 2144 1454 11863 ----
NM_001604chr1121014 789 ------
NM_001609chr1084110 3686 3670 3634 3436 1501 237 156 21111 1071 23595 3396 12785
NM_001612chr111179 1236 ----
NM_001614chr172616 484 ------
NM_001614chr172616 484 ------
NM_001616chr2113417 3363 3166 3150 2379 2311 2281 1045 1012 762 330 11075 1831 --
NM_001617chr231231 1064 421 ------
NM_001620chr112728 554 1542 ----
NM_001621chr7152965 2925 2846 2578 2288 2279 1171 1145 1038 850 606 561 497 438 312 32971 1877 719 21871 609 --
NM_001621chr7152965 2925 2846 2578 2288 2279 1171 1145 1038 850 606 561 497 438 312 32971 1877 719 21871 609 --
NM_001629chr131288 1240 --191
NM_001634chr641577 1495 647 545 2775 479 ----
NM_001642chr1141224 464 265 172 --21231 1140 --
NM_001650chr18104102 2999 2814 2563 2547 1554 1322 1014 611 477 22875 2553 ----
NM_001655chr1172078 1945 772 233 186 108 76 12188 ----
NM_001656chr571885 1790 1342 1316 816 342 242 31465 793 273 1417 --
NM_001658chr13990 236 164 ------
NM_001660chr31663 1805 ----
NM_001662chr72293 287 ------
NM_001663chr146872 864 402 394 194 184 22733 2462 3829 188 100 --
NM_001664chr341031 1010 275 267 --2743 283 184
NM_001665chr11----2149 133 --
NM_001668chr151933 1916 1822 1688 479 ------
NM_001677chr13935 827 813 1370 ----
NM_001678chr1711727 --31705 1649 1370 --
NM_001679chr34579 558 515 280 ------
NM_001681chr122721 255 ------
NM_001682chr1292824 2777 2602 2164 1042 974 766 472 192 12267 22500 1820 --
NM_001683chr351751 723 616 528 409 11689 12320 1195
NM_001684chr1124166 3805 3769 3386 3255 2873 2564 1466 716 592 563 482 33240 2957 475 33812 3809 3259 --
NM_001688chr11190 1348 ----
NM_001690chr352459 2106 1936 932 595 12344 --196
NM_001693chr841187 1112 956 248 21181 55 ----
NM_001695chr8154084 3867 3580 3429 3297 2661 1706 1550 1419 1357 1242 870 194 161 107 13893 24088 3712 --
NM_001699chr1941645 1625 1441 399 ------
NM_001701chr941568 1496 1474 244 2474 439 ----
NM_001702chr82562 550 1569 ----
NM_001704chr61388 1451 ----
NM_001706chr33884 391 368 1842 1229 --
NM_001707chr72800 224 ------
NM_001709chr1142653 856 792 573 ------
NM_001714chr122575 86 ------
NM_001716chr1121490 1401 ------
NM_001717chr1531378 260 204 140 --1448
NM_001718chr621245 1101 ----11015
NM_001719chr20139 1179 ----
NM_001730chr132625 603 1426 21512 1509 --
NM_001730chr132625 603 1426 21512 1509 --
NM_001731chr123940 915 710 ------
NM_001735chr9174 --178 --
NM_001740chr161510 ----1478
NM_001742chr721839 1566 ------
NM_001743chr25508 489 148 58 30 ------
NM_001745chr571201 1089 464 364 291 231 107 1912 1294 --
NM_001746chr5122918 2787 2205 2031 2023 1922 1117 1017 704 640 267 32 42583 2303 2036 933 21021 857 --
NM_001748chr11279 --1940 --
NM_001752chr111415 1531 ----
NM_001753chr791644 1559 1445 1400 1325 592 236 225 39 21472 672 ----
NM_001754chr21154268 4019 3742 3685 3469 3365 3223 2997 2941 2817 2755 860 654 496 391 23573 634 53988 3645 3605 2762 592 --
NM_001755chr1672036 1833 809 689 431 346 278 22166 1401 12102 --
NM_001759chr12204980 4974 4960 4885 3759 3520 3414 3398 1948 1919 1886 1852 1533 1468 1426 1410 1109 885 350 76 31984 1966 357 84991 3469 3426 3423 712 709 57 54 --
NM_001766chr12816 198 1435 --1202
NM_001773chr131513 1425 1083 --21096 588 --
NM_001777chr3123915 3740 3505 3437 3007 2918 2819 2793 2694 1566 1510 1471 33013 1393 940 1947 --
NM_001781chr122662 138 ------
NM_001788chr72769 234 ------
NM_001790chr51387 --2370 351 --
NM_001791chr161395 1380 1235 890 435 423 11258 ----
NM_001792chr182920 248 ----1260
NM_001797chr161559 ------
NM_001798chr122966 727 1904 --1862
NM_001799chr51187 ------
NM_001800chr192184 79 ------
NM_001806chr1952955 2891 1153 982 438 --21157 313 --
NM_001819chr201205 157 ----
NM_001822chr25740 674 544 525 89 ------
NM_001826chr13347 159 89 ------
NM_001829chr43858 677 91 ------
NM_001830chrX103356 3284 3153 3008 2780 2603 1556 976 576 120 13495 --11561
NM_001833chr92109 93 ------
NM_001839chr11283 1705 2156 149 --
NM_001845chr1311264 11250 350 47 44 --
NM_001854chr171467 1343 1219 1102 1015 552 273 ------
NM_001855chr94899 857 546 39 1122 ----
NM_001858chr6164858 4168 3907 3757 3633 3562 3509 2058 1850 1780 1772 499 454 287 192 95 34905 4099 2034 --1291
NM_001859chr9103079 3044 3000 1582 1139 391 351 320 206 89 13385 12969 --
NM_001873chr43577 471 66 ------
NM_001875chr22287 280 1742 --1174
NM_001880chr22241 210 ------
NM_001881chr102404 200 ------
NM_001884chr52109 64 ----1444
NM_001892chr581406 1242 1089 1079 1054 1026 511 454 21246 259 21410 1391 11353
NM_001894chr2271226 1202 1133 1106 1020 155 146 154 11100 --
NM_001895chr2061235 903 850 841 273 177 --2998 361 --
NM_001896chr161335 ------
NM_001901chr651082 1002 677 110 65 1962 ----
NM_001903chr52658 616 ------
NM_001904chr32875 830 ------
NM_001913chr71631 ----1636
NM_001914chr183331 317 258 --1262 --
NM_001918chr1189038 8999 8891 7912 7069 6889 6639 6600 6533 5830 2226 1436 1094 1051 975 232 161 28 15952 19243 --
NM_001920chr122645 310 ------
NM_001921chr431177 266 91 11155 ----
NM_001923chr112483 83 --1611 --
NM_001931chr1131222 1195 86 ------
NM_001933chr142281 165 ----1522
NM_001935chr22887 873 11035 1328 1363
NM_001936chr71610 ------
NM_001938chr161813 1804 1770 1482 42 27 11924 ----
NM_001942chr1851967 1600 1452 1345 710 1633 31971 1878 243 124
NM_001946chr123995 784 81 2954 333 --1761
NM_001949chr693002 2802 2794 2396 2322 2178 2055 791 531 22238 522 194 --
NM_001950chr161731 ----1642
NM_001951chr83127 100 59 1143 ----
NM_001954chr62729 215 --1521 --
NM_001955chr611118 --1222 --
NM_001957chr452104 1845 1418 833 421 22088 857 199 2837 195
NM_001962chr51128 ------
NM_001963chr43777 643 62 1560 ----
NM_001964chr51431 1247 ----
NM_001965chr21431 --180 --
NM_001967chr31247 --175 --
NM_001968chr42658 585 ------
NM_001969chr14113410 3311 3222 2915 2836 1100 1080 1039 1020 939 228 2880 308 11089 --
NM_001977chr431417 621 295 1243 ----
NM_001980chr1252155 1980 1731 539 363 22168 1969 11734 --
NM_001981chr1111780 1733 1567 1497 1469 740 460 184 175 153 39 3963 523 157 142 --
NM_001982chr1221071 198 ----1269
NM_001987chr1294169 3867 1543 1472 1433 1331 1204 1072 628 22967 1189 31709 608 507 11381
NM_001995chr43578 499 139 11008 1973 --
NM_001999chr571523 1248 509 465 324 315 113 1469 ----
NM_002006chr4205832 5446 5417 4693 4578 4035 3903 3790 3715 1750 1581 1192 1113 1105 1051 1007 970 662 524 386 65281 3907 1826 1333 1229 319 35450 1398 1126 25241 256
NM_002009chr1572783 2291 889 868 287 81 63 31948 806 47 ----
NM_002014chr122467 112 ------
NM_002015chr13113303 2968 2479 1334 1082 814 420 380 179 144 106 ------
NM_002017chr1131330 340 101 3991 314 134 ----
NM_002024chrX72026 1404 805 694 553 347 287 12171 ----
NM_002025chrX238884 8355 7816 7555 7463 7427 7413 6986 6880 6851 6584 6266 5993 5874 5659 3219 2211 1883 1128 1048 628 256 213 57750 7434 7295 6148 736 38045 5877 127 --
NM_002026chr231012 756 92 --21020 95 1760
NM_002027chr82191 126 ------
NM_002028chr143865 196 135 ------
NM_002030chr1951212 1185 1160 150 76 1984 ----
NM_002031chr63643 566 254 ----1614
NM_002033chr1184098 3452 3155 829 812 414 264 51 1104 2897 574 --
NM_002035chr18133902 3722 3092 2927 2698 2520 1606 1528 1012 910 735 520 328 11193 23060 1069 --
NM_002037chr61323 1439 ----
NM_002039chr4------1290
NM_002040chr2193106 2412 2361 2216 2088 853 771 165 35 12439 21257 91 --
NM_002044chr1541380 557 420 177 11628 2423 180 --
NM_002048chr92549 213 1841 1132 --
NM_002051chr103903 896 795 ------
NM_002054chr22408 135 --1485 --
NM_002056chr21102 2874 263 ----
NM_002061chr16738 628 453 384 263 111 ----11205
NM_002062chr631663 584 295 11109 ----
NM_002063chrX31127 257 29 ----1521
NM_002067chr191272 --1246 --
NM_002069chr771612 1445 1369 1221 1170 674 176 21676 585 11616 11226
NM_002072chr991015 941 890 757 673 405 365 308 234 --4806 803 795 328 --
NM_002074chr141099 492 254 141 31358 1248 1240 21611 1102 --
NM_002077chr952136 843 691 527 499 21675 763 144 11695
NM_002082chr51979 ------
NM_002090chr42447 144 ------
NM_002092chr4114971 4521 4066 3879 3441 1797 1149 891 740 381 62 34765 4105 353 14805 --
NM_002094chr161354 1324 ----
NM_002106chr41110 ------
NM_002107chr13356 177 99 --161 --
NM_002111chr432782 2428 549 ------
NM_002114chr6385 52 26 ------
NM_002126chr1794181 3814 3589 3558 3550 3085 1447 1243 1088 22944 1465 33194 1185 1033 --
NM_002128chr1362540 2345 1628 497 136 27 2839 315 ----
NM_002134chr16197 ------
NM_002137chr7122226 1885 1850 966 707 537 436 378 367 281 267 259 --21813 321 31875 937 732
NM_002138chr42657 212 ------
NM_002139chrX1109 ------
NM_002140chr951038 291 93 54 21 ------
NM_002145chr173301 267 150 1339 2157 154 --
NM_002146chr1761402 1380 1163 1094 574 435 11389 ----
NM_002148chr2--1267 ----
NM_002149chr21500 ------
NM_002154chr51100 ----2519 205
NM_002158chr2133853 3455 3397 3381 2951 2727 1335 1133 736 569 365 308 114 41262 423 358 42 22899 2855 --
NM_002160chr93557 430 183 1544 ----
NM_002166chr25580 510 128 32 23 2262 90 ----
NM_002167chr12467 419 ------
NM_002182chr3132717 2683 2264 2029 2007 953 860 661 570 483 410 308 233 32754 2747 721 ----
NM_002188chr52692 65 ------
NM_002193chr221393 154 --31431 562 59 --
NM_002194chr21129 ------
NM_002196chr2031061 698 330 1783 1906 --
NM_002196chr2031061 698 330 1783 1906 --
NM_002198chr52846 191 --2598 289 --
NM_002199chr44889 782 74 36 ------
NM_002202chr52856 26 --11028 --
NM_002203chr584163 4055 3723 3329 2832 1518 914 74 34110 3905 506 ----
NM_002204chr171233 --11357 144
NM_002207chr3196 1671 --1127
NM_002211chr1051123 943 896 256 245 --1912 --
NM_002214chr7245642 5456 5275 4882 4668 4647 4640 4620 4199 4091 3971 3951 3547 3533 3482 2028 1766 1473 1154 1094 1070 983 671 567 23641 1650 23754 3522 34651 4060 186
NM_002222chr351080 1065 1035 915 236 21345 919 1426 --
NM_002225chr15146 ------
NM_002228chr11854 ------
NM_002229chr193495 456 194 ------
NM_002230chr172444 108 --1168 --
NM_002232chr121264 378 ------
NM_002234chr122526 170 1707 1673 --
NM_002239chr241185 1171 1050 801 --11058 --
NM_002240chr212553 70 197 174 --
NM_002241chr133106 2085 1941 12323 2967 939 1124
NM_002245chr11628 ------
NM_002247chr1062328 2116 1539 831 435 109 21943 1478 ----
NM_002252chr21169 ------
NM_002253chr42994 74 11216 --1232
NM_002254chr211444 --2274 163 --
NM_002264chr3144956 4463 4447 4241 4214 3478 3421 3119 2023 1838 1578 1073 564 484 1587 44797 1956 519 315 --
NM_002266chr172251 81 ------
NM_002267chr1362391 2060 2023 1853 980 252 31860 1808 474 ----
NM_002268chr311400 ------
NM_002270chr5185486 5009 4912 4208 4036 3904 3852 2166 1911 1812 1682 1607 1413 1113 1031 849 700 452 54838 4678 4626 4005 1860 --13648
NM_002271chr13112152 2081 1643 1579 884 779 532 296 243 121 68 --1535 --
NM_002278chr171188 ------
NM_002285chr2123229 3041 2887 1346 1309 1279 1267 980 968 950 876 387 43928 2891 1562 1144 2880 230 --
NM_002293chr172630 2616 2391 1092 1049 877 668 32471 709 88 ----
NM_002296chr191648 1498 1169 703 447 372 118 112 83 1451 ----
NM_002310chr5156624 6130 5874 5816 5494 5416 4675 4160 4039 2220 1559 1450 1160 1130 690 --45661 4046 4043 2400 16124
NM_002312chr1321058 683 ------
NM_002313chr10154857 4801 4714 4293 3701 3576 3240 1699 1219 1130 1060 1028 948 494 290 44832 4675 3677 3253 2297 294 13580
NM_002314chr71903 1945 ----
NM_002333chr1941249 1212 311 87 ------
NM_002336chr12145026 4867 4818 4330 3950 3593 1772 1670 1278 1215 973 848 717 187 44558 3250 3100 1266 23367 938 14337
NM_002345chr122636 40 1534 ----
NM_002349chr261529 1163 1062 513 376 331 ----21238 115
NM_002350chr821154 441 ----1807
NM_002351chrX51712 1695 1491 703 555 ------
NM_002354chr21374 ------
NM_002355chr1251348 1308 1057 477 191 31152 939 374 ----
NM_002356chr6112699 2516 2379 2289 1002 501 347 288 172 138 124 --1253 --
NM_002359chr1763493 3467 3422 2964 1239 935 14302 13824 --
NM_002360chr742510 2255 1917 1902 ------
NM_002374chr2113568 3214 2626 2560 2280 1457 1355 1304 1231 1221 1060 73646 3615 3224 2488 2293 1225 89 --1844
NM_002376chr142557 161 --1595 --
NM_002381chr28954 884 852 783 671 368 179 64 21054 287 ----
NM_002382chr1461164 935 515 497 123 108 --31174 522 279 --
NM_002387chr594630 3911 3845 3477 2077 1314 1247 802 376 45040 3887 1983 844 34784 3228 1102 11251
NM_002391chr111253 --2322 300 --
NM_002396chr182682 133 151 ----
NM_002397chr5102160 2064 2052 1801 1736 1431 837 778 746 33 11740 1258 --
NM_002398chr241347 612 580 376 21180 441 11384 --
NM_002399chr1511312 1456 21315 1018 1973
NM_002401chr171408 ------
NM_002402chr731085 322 305 1471 ----
NM_002403chr1175 ------
NM_002408chr143670 587 295 ------
NM_002430chr2272524 2441 465 442 431 420 134 --2434 291 --
NM_002431chr141304 1208 ----
NM_002438chr102581 122 187 ----
NM_002442chr122490 458 --21748 1745 --
NM_002444chrX11955 --31385 1382 38 1394
NM_002451chr9113915 3833 3783 1308 1280 1269 1246 1203 873 845 658 13753 13261 --
NM_002455chr1131 ------
NM_002465chr12----1228 --
NM_002467chr83419 403 176 ------
NM_002469chr121414 ------
NM_002470chr17------194
NM_002473chr2261283 1001 987 456 365 91 1369 ----
NM_002478chr112442 185 ------
NM_002480chr1231286 497 447 ----1548
NM_002481chr1197494 6569 6452 5419 5365 5144 5090 5050 2839 1955 1818 1673 1502 1256 710 582 550 384 185 37717 2448 937 33125 2638 118 1554
NM_002482chr12131 75 158 ----
NM_002485chr8111992 1873 1854 1631 1625 790 695 523 467 361 157 41799 1720 838 213 1794 --
NM_002486chr972269 1617 1599 487 267 107 87 ------
NM_002487chr152316 250 ------
NM_002493chr91276 ------
NM_002499chr1582496 2446 2234 1811 1544 985 869 649 --11547 1904
NM_002500chr22915 474 1394 --1867
NM_002501chr1963802 2802 2558 2551 1611 1576 --33129 2904 616 --
NM_002507chr1741934 1818 1648 1430 ------
NM_002509chr203705 692 630 --1286 --
NM_002515chr142192 90 1661 ----
NM_002518chr231204 1195 998 1462 ----
NM_002519chr1151389 1267 573 548 344 ------
NM_002520chr5180 ------
NM_002522chr1783922 3903 3130 2929 1331 1323 1100 363 23915 3796 1389 13765
NM_002523chr72824 781 11113 ----
NM_002524chr13410 262 247 2919 300 ----
NM_002526chr661677 1501 1439 638 425 291 2653 45 --1298
NM_002537chr153795 685 425 --11024 --
NM_002543chr1261453 1370 1075 1041 255 66 --11388 1312
NM_002544chr171232 ------
NM_002545chr11165043 5031 5014 4572 4565 4347 4193 4083 4055 3530 3363 1258 532 461 126 103 13299 44087 3659 2044 92 --
NM_002546chr82602 579 ------
NM_002547chrX114173 3792 3776 3577 3374 1288 1135 803 747 738 64 13199 11377 169
NM_002556chr1162136 1769 1635 1452 1352 129 --31890 869 297 --
NM_002569chr1531479 1350 50 ------
NM_002572chr114337 293 247 81 ------
NM_002577chr3154076 4054 3887 3598 3226 2823 1521 1432 1295 1064 965 634 426 79 29 21358 378 52954 1537 968 894 778 2975 198
NM_002578chrX2470 133 2418 108 1146 --
NM_002581chr9175494 5453 5360 5220 5090 4862 4804 4156 3869 3486 2149 1562 1425 968 950 666 430 --15318 14710
NM_002583chr123513 471 245 --1157 1161
NM_002585chr1----1147 --
NM_002586chr651638 1318 1020 247 220 --31101 301 232 --
NM_002588chr521795 1763 1682 11392 11239
NM_002590chr131213 ------
NM_002593chr7163 ------
NM_002594chr2051711 1587 760 176 117 22076 243 ----
NM_002595chr1281755 1716 1581 1273 549 137 79 41 ------
NM_002600chr141460 711 503 407 --1546 --
NM_002601chr22410 67 --1179 --
NM_002605chr1531230 1200 922 ----1414
NM_002607chr721287 417 11153 ----
NM_002610chr252718 2394 2184 1132 879 11156 32826 2456 2310 --
NM_002613chr16175333 5326 5249 4744 4725 4685 4453 4251 4181 3604 3349 3342 3291 2115 1635 538 341 14123 --13997
NM_002616chr172573 45 ------
NM_002618chr2148 ------
NM_002620chr42123 72 ------
NM_002623chr204799 779 671 98 ----172
NM_002628chr351139 1030 762 497 93 3948 863 97 1447 --
NM_002629chr101616 --1884 --
NM_002633chr11469 ----1117
NM_002636chr61461 ------
NM_002641chrX51961 1770 1640 1346 191 2397 248 ----
NM_002643chr22134 24 ------
NM_002645chr1182857 2795 2629 2158 750 663 555 197 22801 2379 11961 22335 580
NM_002647chr18--1226 ----
NM_002651chr12346 316 --1835 --
NM_002652chr7190 ------
NM_002655chr8175251 4077 3809 3667 3386 3340 3320 1739 1542 1518 1147 1126 1088 746 444 252 246 --11732 --
NM_002656chr631043 842 23 ------
NM_002657chr20113560 3325 3216 3130 3094 2636 2604 1440 1419 947 799 23871 1529 ----
NM_002658chr103926 776 38 --1260 --
NM_002661chr161199 2214 114 ----
NM_002667chr61117 1427 --1410
NM_002669chr4129 ------
NM_002670chr391614 1487 1457 1440 1181 602 533 297 172 21555 1104 11617 --
NM_002677chr892781 994 860 796 781 656 636 321 30 22294 1972 12872 12881
NM_002687chr1471313 265 165 121 49 32 21 --11154 --
NM_002690chr82102 54 ----1107
NM_002693chr154324 309 301 87 1121 ----
NM_002698chr1952587 2366 2233 885 78 --22237 1962 --
NM_002699chr121380 76 --11384 --
NM_002701chr61221 198 ----
NM_002702chr123936 797 700 ------
NM_002703chr461937 782 660 247 218 146 ------
NM_002706chr22575 472 1593 ----
NM_002707chr21306 --174 1380
NM_002709chr2123564 3353 2970 2391 2341 1392 1293 1281 992 908 441 153 43521 2407 2291 1185 21028 912 --
NM_002710chr1251067 958 867 738 313 2974 357 ----
NM_002711chr72317 103 ----1616
NM_002713chr131037 277 218 ------
NM_002715chr531244 913 469 1837 ----
NM_002717chr81243 ------
NM_002718chr372691 2645 1851 1725 695 86 48 21082 942 1504 --
NM_002719chr14102326 2242 2077 2007 1993 1922 1784 1597 106 41 22246 485 ----
NM_002720chr161228 --1243 --
NM_002721chr96186 124 83 57 43 31 ------
NM_002726chr63196 175 159 1450 2395 200 --
NM_002730chr1921187 30 ------
NM_002731chr1102972 2728 2655 2137 1949 931 559 459 274 230 --13081 --
NM_002734chr1772255 1748 1483 652 588 419 286 11572 ----
NM_002736chr781950 1611 734 708 563 431 117 111 31964 1942 857 --11755
NM_002737chr17156600 6493 6227 6207 6087 5437 5216 4427 2329 2240 2186 1992 1469 817 703 56606 5465 4461 1628 348 25365 1782 --
NM_002738chr1631150 1052 307 178 1319 --
NM_002740chr3122804 2439 2385 2357 1818 1775 967 907 884 526 438 275 32195 467 233 12145 12183
NM_002742chr141669 1734 ----
NM_002745chr22124590 4455 4263 3826 3804 3601 3523 1549 1038 679 386 55 44233 4122 1078 181 21041 58 --
NM_002747chr1871819 1751 608 588 560 532 154 11755 ----
NM_002748chr154426 369 151 55 3409 384 34 1155 --
NM_002750chr10--1236 ----
NM_002755chr152713 367 ------
NM_002756chr172692 663 ------
NM_002763chr12198 164 ------
NM_002764chrX2355 23 --1893 --
NM_002767chr173512 152 121 ------
NM_002772chr211387 ------
NM_002775chr102540 151 ------
NM_002778chr102313 48 ------
NM_002779chr101201 --1224 --
NM_002787chr73656 215 85 --1272 --
NM_002796chr1--1102 180 --
NM_002797chr142202 31 ------
NM_002806chr141303 ------
NM_002810chr12127 118 ------
NM_002811chr16278 22 ----182
NM_002812chr19--2429 365 ----
NM_002816chr173277 258 86 --197 --
NM_002821chr62829 633 ------
NM_002822chr1271855 1554 1125 555 338 270 112 ------
NM_002823chr24583 569 492 232 ------
NM_002824chr121470 --1131 --
NM_002825chr74625 609 582 544 ------
NM_002826chr12793 150 1294 ----
NM_002827chr2061411 1244 1194 450 416 193 ------
NM_002828chr184992 751 690 622 1868 ----
NM_002833chr151335 --31142 338 109 --
NM_002835chr7--1693 1304 --
NM_002836chr20----1183 --
NM_002837chr12104302 3654 3569 3398 3056 1603 1458 1385 255 197 21566 217 11111 11370
NM_002839chr9143570 3521 3513 3385 3235 3228 3173 2930 2410 2365 2348 987 562 93 11076 ----
NM_002840chr141658 455 382 328 --1294 --
NM_002841chr35502 436 106 67 55 ------
NM_002843chr1193399 2902 893 733 318 304 253 244 106 13105 23265 914 --
NM_002844chr64551 513 364 297 21059 923 ----
NM_002845chr181125 ------
NM_002847chr721487 284 --1261 --
NM_002848chr1261133 1083 1065 1018 941 87 2908 348 ----
NM_002850chr194801 787 771 444 --11007 --
NM_002851chr72258 171 ------
NM_002855chr1163731 3510 1362 1058 1005 651 1387 ----
NM_002858chr111036 1529 ----
NM_002868chr1292405 2327 2300 2088 2034 1907 910 540 153 2341 266 ----
NM_002869chr1172148 2090 1408 1399 1377 278 266 32168 2023 821 1597 128
NM_002871chr151920 1420 661 494 95 --2415 325 --
NM_002873chr51462 1118 ----
NM_002874chr9122479 2411 2340 2232 2192 2057 628 592 546 350 301 259 12440 12352 --
NM_002881chr261423 1262 1177 508 222 81 11273 1238 1128
NM_002882chr22392 44 21 ------
NM_002886chr3145193 4790 4159 3438 3367 1868 1859 1647 1258 536 458 417 408 77 33756 3525 1199 24892 546 --
NM_002890chr51799 ------
NM_002892chr1461665 1560 1315 613 250 231 1451 1159 --
NM_002893chrX1350 --1335 1119
NM_002897chr24767 560 543 69 ------
NM_002901chr115750 277 271 233 143 1324 ----
NM_002902chr15------1648
NM_002906chr1182220 2188 1743 830 731 269 252 191 129 1258 --
NM_002907chr122336 315 ------
NM_002911chr1951679 573 549 339 331 1564 21459 343 --
NM_002912chr63789 184 75 139 ----
NM_002924chr12239 200 ------
NM_002931chr61305 --174 --
NM_002938chr431945 1661 1517 21921 1505 1497 --
NM_002940chr441439 1429 675 594 ------
NM_002941chr341318 1022 316 274 1507 ----
NM_002942chr351425 319 288 209 176 ------
NM_002943chr151188 ------
NM_002945chr171887 1716 1767 --
NM_002946chr12485 233 ------
NM_002948chr33421 196 104 21258 279 ----
NM_002953chr13763 674 235 1757 ----
NM_002955chr651413 545 525 284 270 ------
NM_002956chr1241441 1091 939 227 1896 ----
NM_002957chr923734 65 --1623 --
NM_002958chr32361 154 1638 ----
NM_002959chr1123725 3527 1761 1459 1125 1024 967 607 571 279 241 191 64363 3795 1066 805 581 234 22853 793 --
NM_002968chr1621009 143 21046 698 1926 --
NM_002971chr321083 763 11161 ----
NM_002973chr121122 ------
NM_002977chr2123275 2961 2623 2377 2282 2246 1226 932 733 716 508 94 33356 647 193 22285 720 --
NM_002979chr15829 809 797 151 125 --1902 1766
NM_002993chr421051 106 1715 ----
NM_002994chr481923 1830 1754 1573 684 494 140 123 21580 677 ----
NM_002996chr1621391 527 ------
NM_002997chr251439 1300 1224 656 535 ------
NM_002998chr83894 812 422 32256 600 163 31722 702 300 --
NM_003001chr172214 2101 1980 1517 725 660 229 --42119 1860 664 325 --
NM_003010chr1732332 2227 698 3783 723 503 --11497
NM_003011chr961563 1476 375 95 75 33 ----11520
NM_003013chr41704 1635 ----
NM_003016chr1782026 1967 1844 1293 756 750 246 72 1785 ----
NM_003017chr62891 375 ------
NM_003020chr153297 173 99 ------
NM_003026chr93977 287 214 ------
NM_003030chr371858 1617 1600 1580 1362 1350 448 --1710 --
NM_003031chr162628 378 ----1864
NM_003034chr12177864 7692 7571 6678 6329 6318 5904 5613 5499 5484 5406 5308 5082 3165 2917 2439 1672 12432 68040 7981 7804 7011 6322 631 14929
NM_003036chr131195 927 495 1499 ----
NM_003042chr342010 1958 791 229 11777 ----
NM_003043chr394333 4282 4238 4225 2776 1176 419 383 303 ------
NM_003046chr8135325 5304 4419 4209 3491 3423 1571 1336 1303 1106 1059 607 334 --21091 1026 --
NM_003051chr171913 1564 1543 803 780 665 324 --21947 1711 --
NM_003060chr521074 944 1281 ----
NM_003068chr83986 852 314 142 ----
NM_003069chrX5666 642 579 269 189 --1568 1561
NM_003070chr93773 573 538 --1698 --
NM_003071chr361447 1396 823 640 548 151 --21757 311 --
NM_003074chr371603 800 400 172 102 90 81 --32102 1912 1533 12289
NM_003076chr1221588 1179 21573 656 31693 1182 172 --
NM_003077chr172523 188 --1578 --
NM_003079chr1781038 921 718 651 201 174 97 35 ------
NM_003081chr2041005 765 328 192 1259 ----
NM_003082chr142887 127 2199 187 ----
NM_003088chr71293 ------
NM_003091chr20187 ------
NM_003094chr141217 743 191 167 ------
NM_003095chr122378 282 163 1326 --
NM_003099chr15102208 2138 1897 1425 766 712 548 495 188 44 1299 --1613
NM_003100chr51323 1327 ----
NM_003106chr32888 354 --1251 --
NM_003107chr6102621 2456 2417 2107 2097 1891 1052 655 536 489 12191 1895 --
NM_003108chr2297201 6891 6810 6664 6627 6465 6350 6231 5723 5681 5667 5143 5052 5005 4961 4781 4669 2583 2123 1801 1756 1178 1050 944 836 547 365 261 250 97284 6469 5712 5242 5216 4744 4451 2132 1013 46203 1760 1036 369 --
NM_003110chr1721095 751 ------
NM_003111chr261405 1155 1076 1023 413 84 --11085 --
NM_003112chr792869 2852 2377 2340 2070 1298 991 407 356 43024 2786 952 534 1410 1122
NM_003113chr22807 24 1307 ----
NM_003114chr88767 645 619 557 308 196 175 24 ------
NM_003115chr12465 426 ------
NM_003129chr81280 ------
NM_003130chr751211 1181 916 255 179 1315 1910 --
NM_003131chr662264 1958 1568 789 774 712 175 2504 207 11536
NM_003133chr12333 138 1357 ----
NM_003135chr5188 ------
NM_003136chr143156 129 100 --2160 71 --
NM_003137chr662231 2205 701 549 522 314 --12020 11396
NM_003139chr111660 --151 --
NM_003140chrY2102 49 ------
NM_003144chr6102135 2106 863 838 687 528 349 330 177 53 ------
NM_003149chr341591 1431 1040 572 --11101 11044
NM_003150chr1752348 1468 509 456 335 ------
NM_003154chr41106 ------
NM_003155chr872527 2257 919 852 618 553 272 12237 ----
NM_003156chr1141376 1215 528 347 ------
NM_003157chr33703 683 116 ------
NM_003161chr1792925 2875 2361 2192 1394 1196 1155 633 512 73506 3255 3009 2670 2650 2603 535 43348 2878 1117 440 --
NM_003162chr21997 --11001 --
NM_003168chr174841 674 650 57 --1162 --
NM_003174chr102311 287 2105 91 1201 --
NM_003176chr1--2327 320 1229 --
NM_003176chr1--2327 320 1229 --
NM_003178chr352174 2153 497 135 110 2857 23 1594 --
NM_003182chr7--1141 ----
NM_003182chr7--1141 ----
NM_003185chr2031033 51 26 11241 1993 --
NM_003187chr5--1156 ----
NM_003188chr63830 97 46 1143 ----
NM_003189chr173264 3042 2998 2493 946 645 227 --12147 1557
NM_003194chr64547 436 419 369 1555 139 --
NM_003199chr18145554 5452 5174 4196 4084 4021 3905 3689 3662 1782 1467 1327 744 710 44407 3693 1341 232 24088 343 13819
NM_003201chr104944 748 723 126 1421 ----
NM_003202chr521901 477 11918 ----
NM_003204chr1751375 1362 1330 1176 103 ------
NM_003205chr1562358 2292 2009 1946 1799 1660 31902 1806 1723 11824 --
NM_003206chr6--2444 406 ----
NM_003211chr1251636 1339 1309 272 234 11471 --11700
NM_003215chr421583 1249 11106 2401 398 --
NM_003216chr2273090 3005 2364 2110 1026 1010 847 --23212 2082 --
NM_003217chr1261917 1905 1782 1760 223 60 11786 ----
NM_003220chr641634 600 389 328 ------
NM_003221chr6104123 3425 3211 1650 1482 1452 1354 1093 427 261 14132 --33847 1136 1029
NM_003222chr205930 920 276 256 167 1412 --1491
NM_003223chr164714 681 651 305 ----1137
NM_003234chr34732 716 675 531 11486 ----
NM_003242chr382407 2344 2249 1841 1830 1557 895 811 22312 901 --11003
NM_003244chr182465 291 3443 404 305 ----
NM_003246chr1572053 1990 1897 1715 1472 1459 1310 --21974 112 --
NM_003247chr641864 1679 1672 1290 1134 21525 288 --
NM_003250chr171184 ------
NM_003253chr2151858 1668 1344 557 550 --11283 --
NM_003255chr1742064 1969 865 712 ------
NM_003257chr1571435 1384 1013 904 565 348 86 ------
NM_003262chr3125036 4368 4262 3837 2062 1844 1534 1384 1272 583 486 323 51699 1276 459 418 99 14050 11449
NM_003269chr621259 362 ------
NM_003270chrX2749 363 ------
NM_003272chr11227 ------
NM_003274chr2162662 2122 2023 1886 852 800 42929 2753 2716 2586 ----
NM_003275chr921120 195 3459 199 122 ----
NM_003285chr12514 337 --2547 348 --
NM_003286chr201971 --1838 --
NM_003290chr193291 233 192 1198 --1217
NM_003291chr132855 205 ------
NM_003292chr12506 470 62254 1908 1475 164 136 118 21742 725 --
NM_003297chr122330 38 ------
NM_003298chr366066 6010 5896 5699 1580 1206 55778 5610 4726 4239 4164 15096 --
NM_003299chr12161 ------
NM_003300chr141325 --1447 --
NM_003304chr341250 500 261 204 2655 124 ----
NM_003309chr671799 1754 1678 1417 1372 1304 587 21807 1272 ----
NM_003317chr144869 301 174 105 --2872 787 --
NM_003319chr22931 309 ------
NM_003320chr1184466 4123 3327 2877 1685 1426 1252 232 --13010 --
NM_003324chr12----11397 --
NM_003326chr162501 2348 1825 879 750 630 2637 76 --1299
NM_003336chrX4972 925 777 244 11135 ----
NM_003337chr531236 239 174 3689 340 309 --128
NM_003338chr1071879 1288 1224 750 581 480 397 21964 55 11954 --
NM_003339chr541568 1493 1394 279 --11506 --
NM_003340chr44177 110 76 66 ------
NM_003342chr17133108 2878 2715 2170 1289 1099 1015 998 690 410 392 341 69 11119 1542 --
NM_003344chr761684 1602 1506 1433 422 169 11262 21097 355 --
NM_003347chr2272250 1485 1431 481 357 266 147 1403 11648 --
NM_003348chr1241415 1374 1111 413 31598 1567 1352 --11381
NM_003349chr2011585 1527 11504 --
NM_003350chr841012 920 865 206 --1924 --
NM_003352chr29972 872 833 696 677 222 61 40 21 2876 403 --1258
NM_003359chr441135 1025 950 909 11029 ----
NM_003368chr14815 714 619 308 ------
NM_003369chr1142615 2569 2505 294 ------
NM_003370chr192764 624 ------
NM_003371chr932162 1866 35 12124 ----
NM_003372chrX3781 589 186 --1323 --
NM_003373chr1041759 1438 1388 1335 1172 11952 --
NM_003374chr53583 518 251 ------
NM_003375chr102156 83 ------
NM_003376chr661817 1711 1249 572 431 274 11299 ----
NM_003376chr661817 1711 1249 572 431 274 11299 ----
NM_003380chr103269 263 228 1101 ----
NM_003383chr9--1582 189 1429
NM_003384chr144147 51 41 32 ------
NM_003385chr22319 145 ------
NM_003387chr272797 2648 2415 2325 2026 1960 1901 12843 2384 83 --
NM_003390chr113885 814 438 1977 ----
NM_003392chr383385 3311 2777 1704 867 351 132 100 13340 33149 355 259 --
NM_003394chr121507 --1662 1670
NM_003400chr25760 660 615 339 26 --1123 --
NM_003403chr143752 705 590 1300 1329 --
NM_003404chr2061867 1854 1475 1256 627 351 1119 ----
NM_003405chr223617 215 60 --1575 --
NM_003406chr871868 1742 1452 1409 1391 1236 788 ------
NM_003407chr192582 573 ------
NM_003409chr1841451 1308 1103 254 41436 1423 1390 568 --1922
NM_003410chrX72622 2286 1195 1103 631 397 143 --23076 621 --
NM_003411chrY21823 1120 2186 142 11644 --
NM_003412chr382842 2415 1033 650 358 303 206 122 42459 2274 2227 2100 21941 342 11038
NM_003413chrX71989 1787 1713 1396 591 377 318 1521 2380 243 --
NM_003418chr3----129 --
NM_003423chr1931948 1872 1853 11009 ----
NM_003427chr61676 ------
NM_003431chr12187 179 --1663 --
NM_003445chr192819 110 ------
NM_003452chr94923 711 664 383 1673 ----
NM_003453chr133304 259 217 ------
NM_003454chr1641401 1354 240 218 21366 1197 ----
NM_003455chr1121458 551 --11237 --
NM_003457chr171595 --1224 1228
NM_003458chr353838 920 855 468 383 ----13856
NM_003463chr653031 2566 2289 979 917 ------
NM_003467chr23358 43 21 3439 131 63 ----
NM_003468chr2154320 3506 2993 2932 1539 1393 1119 1110 999 890 674 367 260 242 213 1528 13340 32727 485 226
NM_003470chr1651370 1179 664 565 179 --11897 --
NM_003471chr372336 1644 1564 571 440 206 135 1348 ----
NM_003472chr621405 136 1269 ----
NM_003473chr102180 169 21097 823 ----
NM_003474chr1032383 2017 1945 11791 31544 778 775 --
NM_003477chr11--1616 ----
NM_003478chr11113353 3079 3036 2867 2854 2784 2202 2156 466 343 334 22261 642 ----
NM_003481chr12----1104 --
NM_003482chr1222630 2517 --12757 --
NM_003483chr1282810 2659 2089 2041 1181 966 587 289 32818 2554 663 2545 198 --
NM_003488chr176949 876 738 405 115 29 --1323 --
NM_003489chr2182553 2217 2128 1262 1085 847 273 32 43367 628 518 115 ----
NM_006846chr52312 89 ------
NM_006851chr12102800 2772 2668 2443 926 918 911 839 390 55 31162 888 660 2852 849 --
NM_006852chr17112728 2574 2474 2355 2208 1109 1066 601 421 134 127 22446 845 22764 2633 --
NM_006854chr751602 1277 413 344 196 ------
NM_006856chr1231020 395 151 ----1890
NM_006861chr1242110 1499 682 346 ------
NM_006873chr283270 3038 2505 1327 1280 451 374 361 33186 1046 973 23243 2871 --
NM_006874chr43967 955 786 ------
NM_006877chr62304 296 --1276 --
NM_006884chr371858 1617 1600 1580 1362 1350 448 --1710 --
NM_006885chr16144058 4033 3395 2844 1507 1451 1394 1339 1262 1153 1072 946 496 433 53867 3409 2913 2850 561 41697 1359 1330 199 --
NM_006887chr23542 239 207 --2264 188 --
NM_006888chr1463354 3294 3237 2238 869 858 1313 22802 24 --
NM_006892chr2091266 1255 1199 1101 973 517 300 293 246 ------
NM_006892chr2091266 1255 1199 1101 973 517 300 293 246 ------
NM_006894chr1--1259 1308 --
NM_006895chr291936 1852 1461 1437 740 602 590 542 449 2523 354 11766 --
NM_006908chr751193 967 257 145 127 1273 ----
NM_006910chr161384 ------
NM_006913chr61294 1374 ----
NM_006914chr921028 250 31171 1157 135 ----
NM_006915chrX62222 2060 1904 1650 370 322 32113 2068 916 --22510 407
NM_006918chr11135770 5657 5565 5430 5134 5031 4957 3916 3794 1931 1161 435 57 35721 4888 459 14318 --
NM_006920chr291932 1873 1814 1782 1608 1520 1303 797 416 11457 --11545
NM_006922chr232394 1891 1797 12481 12337 --
NM_006924chr17124231 4217 4138 4043 3186 2885 2707 1621 1384 1349 1127 633 --22746 1208 --
NM_006925chr14131 ------
NM_006930chr551863 1844 1406 1259 558 11267 11263 --
NM_006931chr1232152 1585 179 ----11556
NM_006937chr173598 474 126 2435 40 ----
NM_006939chr142361 94 1337 ----
NM_006940chr1261299 756 499 476 468 300 41445 1387 1360 672 1480 --
NM_006943chr2011273 12172 43312 3303 2947 844 --
NM_006947chr441396 1360 485 124 2504 292 --11254
NM_006965chr1841100 314 303 95 2363 46 142 --
NM_006981chr9102698 2632 2579 2536 2499 2394 2164 1902 1114 139 --1517 --
NM_006982chr122243 23 --1247 --
NM_006988chr2131055 787 270 ------
NM_006990chr111561 --41792 54 31 28 --
NM_006996chr171863 1740 1645 1551 1318 232 107 --122 --
NM_006997chr102471 179 --1101 --
NM_006999chr572074 2066 1297 702 469 241 142 ------
NM_007002chr20190 ------
NM_007005chr941071 394 139 63 11058 11187 --
NM_007006chr1693536 2808 2777 2696 2589 2469 310 255 226 1678 ----
NM_007007chr12104606 4107 3770 3351 1930 1809 1801 1738 977 82 54736 3997 3482 1546 1217 13670 --
NM_007008chr2----1243 --
NM_007010chr1771917 1564 1228 724 398 193 187 ------
NM_007011chr15126738 4667 4355 4241 4232 2676 2647 2415 2077 1933 1556 511 35090 983 701 ----
NM_007013chr83892 410 135 ------
NM_007014chr1611776 ------
NM_007017chr56892 870 656 353 300 87 1812 ----
NM_007018chr9--1399 ----
NM_007023chr231021 980 350 1761 1265 --
NM_007027chr32188 139 ------
NM_007033chr14656 195 110 67 173 --1200
NM_007034chr141028 674 326 107 ----11007
NM_007035chr124686 610 198 139 1742 ----
NM_007039chr1462011 1929 1581 858 610 420 2770 666 22050 1566 --
NM_007040chr1961080 773 703 282 265 189 --1276 --
NM_007042chr31441 32447 2019 1697 12601 --
NM_007043chr1281862 1690 1471 1307 816 729 690 102 1145 1694 --
NM_007046chr21379 ------
NM_007050chr20198006 7905 7867 7382 6696 5904 5631 2949 2878 2391 1709 1631 1614 1010 909 845 829 702 695 25919 1520 ----
NM_007054chr583462 2644 1106 1010 974 961 838 649 --13631 13268
NM_007064chr341712 1352 1119 452 11358 11305 --
NM_007067chr1731495 1133 557 1534 ----
NM_007068chr223962 97 27 ------
NM_007073chr6124257 4192 4138 4056 3716 1260 924 364 347 331 176 162 --21449 350 173
NM_007078chr10113059 2924 2843 2486 2213 2067 786 753 585 147 82 12446 ----
NM_007080chr43323 97 57 1118 173 --
NM_007084chr1341336 1100 408 341 --1411 --
NM_007096chr92109 93 ------
NM_007099chr21130 1857 ----
NM_007106chr1352139 2054 1727 672 201 52838 2606 2128 980 182 11066 --
NM_007107chr362151 1572 915 847 576 558 11803 1399 --
NM_007111chr133766 261 57 1265 ----
NM_007114chr392992 2825 2816 2516 2346 1011 536 246 82 23166 213 11071 --
NM_007115chr22334 101 ------
NM_007118chr51279 ------
NM_007124chr691945 1805 1266 769 749 735 449 348 213 12010 2680 217 --
NM_007125chrY21222 279 1382 ----
NM_007129chr1351028 948 727 398 315 1664 1836 --
NM_007136chr33311 45 33 ------
NM_007137chrX145538 5523 4435 4114 3899 3591 3489 2064 1541 1311 816 717 570 541 34565 507 315 34096 3971 1482 --
NM_007139chr741118 969 896 828 1900 ----
NM_007144chr172464 68 --256 24 --
NM_007146chr1772770 2635 1157 1108 1085 714 138 12398 12448 --
NM_007147chr19150 --11077 --
NM_007150chrX42118 1682 831 212 2554 124 12126 --
NM_007158chr141012 1000 827 431 --1440 --
NM_007159chr34704 368 291 83 21277 229 ----
NM_007166chr11101595 1537 1439 1417 1405 1049 490 440 264 241 --2983 113 --
NM_007170chr13370 338 83 ------
NM_007172chr2293214 3183 2516 2142 2034 1157 1051 192 75 22703 285 186 1701
NM_007173chr1172065 1714 1580 1571 665 411 145 21636 812 ----
NM_007174chr1282335 2125 1983 1743 423 415 403 392 22325 2148 12321 --
NM_007175chr893563 3306 3245 3216 2838 1275 1195 733 555 ----23181 1200
NM_007178chr122371 344 ------
NM_007187chr1341038 930 752 729 2700 150 --1935
NM_007190chr1061020 809 423 398 359 28 --2818 815 --
NM_007191chr122613 204 ------
NM_007192chr1441110 272 81 32 ------
NM_007195chr18113414 3109 2883 2837 2795 2770 2336 1158 1139 768 365 43453 3329 2325 273 23129 3113 1533
NM_007197chr123755 70 57 21041 1003 386 83 80 --
NM_007200chr1564604 3283 3151 3011 1446 1165 34546 1814 1200 13445 --
NM_007202chr172542 52 172 ----
NM_007203chr963822 3812 3638 2954 1424 221 32568 789 635 ----
NM_007204chr1--2205 152 ----
NM_007207chr16913 825 813 669 598 77 --1807 --
NM_007212chr1152042 919 828 775 621 613 540 525 410 254 239 207 175 114 34 3573 306 51 22298 624 12245
NM_007214chr651244 966 887 851 361 11009 --11002
NM_007218chr83711 364 277 4881 857 368 326 ----
NM_007219chr201864 --1113 --
NM_007222chr8101535 1512 1505 1462 1350 1201 1151 710 401 266 41444 1286 1137 37 ----
NM_007224chr121652 ------
NM_007231chrX72212 1931 1593 542 383 323 199 2620 129 11597 12471
NM_007235chr123514 423 136 2447 372 --194
NM_007236chr1562357 1899 727 640 422 411 32251 1782 234 --1403
NM_007238chr2044910 1900 899 397 1338 ----
NM_007245chr162916 835 ------
NM_007246chr461056 1005 923 824 740 380 1780 1192 --
NM_007249chr13179101 8604 8515 7135 6345 5933 3649 3003 2420 1871 1641 1593 1539 1396 1206 896 421 36733 6425 5745 47730 7621 2762 153 17139
NM_007250chrX4597 449 368 74 1215 ----
NM_007255chr51552 ------
NM_007257chr8112973 2703 2413 1085 556 525 385 227 216 200 59 32513 655 63 22125 208 1221
NM_007260chr12760 218 ------
NM_007266chr22638 406 ------
NM_007269chr12452 129 1245 ----
NM_007271chr641683 1138 153 39 ------
NM_007275chr331086 393 327 ------
NM_007278chr172122 64 --1355 --
NM_007279chr192525 509 ------
NM_007280chr153417 190 76 ------
NM_007281chr41185 ------
NM_007285chr162196 128 ------
NM_007287chr332481 2263 686 2716 656 ----
NM_007288chr332481 2263 686 2716 656 ----
NM_007289chr332481 2263 686 2716 656 ----
NM_007292chr17115183 4913 4848 4301 4267 4017 3204 1162 1029 600 117 34208 3906 3829 34979 4645 73 --
NM_007294chr1731150 1134 314 21225 236 ----
NM_007295chr1731150 1134 314 21225 236 ----
NM_007296chr1731150 1134 314 21225 236 ----
NM_007297chr1731150 1134 314 21225 236 ----
NM_007298chr1731150 1134 314 21225 236 ----
NM_007299chr1731150 1134 314 21225 236 ----
NM_007300chr1731150 1134 314 21225 236 ----
NM_007302chr1731150 1134 314 21225 236 ----
NM_007303chr1731150 1134 314 21225 236 ----
NM_007304chr1731150 1134 314 21225 236 ----
NM_007305chr1731150 1134 314 21225 236 ----
NM_007313chr921564 367 --1407 1359
NM_007315chr271351 1328 1281 1239 1137 450 153 11086 31331 1183 1125 --
NM_007325chrX82038 2029 876 519 461 333 223 160 21874 370 ----
NM_007331chr472534 2341 826 796 725 464 193 11778 ----
NM_007345chr1852154 1772 1655 482 328 1937 11573 --
NM_007347chr1552970 2062 1992 780 134 1945 ----
NM_007349chr73410 395 167 ------
NM_007350chr12124236 3888 3611 3319 3305 3238 2821 1655 1519 960 557 159 24620 2996 34461 3892 1339 11494
NM_007358chr1101870 1517 1298 1270 1241 726 686 498 300 91 31874 1490 691 ----
NM_007362chr331509 1087 247 11282 ----
NM_007363chrX31034 882 50 1990 1818 --
NM_007371chr91112 ----1224
NM_007372chr171174 1868 1223 --
NM_007373chr10101776 1767 1501 1331 1224 507 434 222 198 56 2669 438 ----
NM_007375chr182399 2162 1708 465 413 329 153 51 2372 157 --12595
NM_009585chr31170 ------
NM_009585chr31170 ------
NM_012064chr1221075 149 ----1108
NM_012069chrX62717 2520 999 944 824 76 183 179 --
NM_012074chr1451019 811 329 239 124 ------
NM_012081chr5113442 3298 3155 3125 2941 2810 2745 2641 894 440 286 11145 1137 --
NM_012082chr83667 644 602 ------
NM_012089chr171350 407 295 248 203 174 123 11410 11153 --
NM_012090chr151215 986 828 448 141 11067 1499 1370
NM_012092chr23692 617 600 --1431 11373
NM_012093chr121255 1187 11191 ----
NM_012095chr1083509 2438 2137 1417 1108 1005 995 247 32878 2353 1405 13513 11314
NM_012096chr393411 2452 2276 1474 1450 1272 382 283 181 33676 1399 352 ----
NM_012097chr251902 1587 354 232 196 11593 1114 --
NM_012102chr1112281 2173 2099 1869 1858 1037 597 562 526 299 64 1117 --12148
NM_012104chr1193400 3365 3340 2466 1441 1158 802 737 337 12476 21425 340 --
NM_012104chr1193400 3365 3340 2466 1441 1158 802 737 337 12476 21425 340 --
NM_012110chr41267 ------
NM_012115chr62567 103 ------
NM_012120chr652475 2314 2229 235 207 1940 1427 --
NM_012129chr7122514 2305 2175 1916 1814 1641 741 549 536 366 204 34 22181 876 31839 1693 372 --
NM_012137chr192426 2140 2091 1816 1026 934 926 372 347 32553 2127 388 32315 2252 2150 --
NM_012141chr1383706 3570 3138 3052 1373 696 612 304 21569 169 32857 2707 142 141
NM_012153chr1162603 1738 909 773 325 284 1265 22461 1610 21614 288
NM_012154chr8------1829
NM_012155chr191227 ------
NM_012156chr2053332 2898 2497 2450 460 23288 308 23114 2486 --
NM_012157chr31621 1887 ----
NM_012158chr1341751 1669 1464 713 ------
NM_012160chr61526 ------
NM_012164chr9227195 7106 6480 6191 5981 5955 5771 5742 5222 5200 4722 2970 2858 2748 2516 2193 1795 925 852 395 381 284 37375 4601 1214 27131 6095 --
NM_012175chr111214 1584 ----
NM_012177chr61129 1460 ----
NM_012188chr531091 1083 935 ------
NM_012193chr11135194 4753 4689 3901 1882 1871 1821 1722 1716 983 710 669 391 41737 1489 730 27 34702 4699 1875 11207
NM_012197chr961601 1475 653 465 363 352 --21368 58 --
NM_012198chr27758 628 604 598 173 100 42 ------
NM_012199chr1174443 4229 3996 3958 3826 3682 3458 3296 2963 2831 1819 1681 1637 1504 1188 955 826 11133 63299 3281 1799 1521 1461 1147 14234
NM_012207chr1061026 994 420 238 74 58 1426 ----
NM_012210chr951532 1148 1001 350 24 11046 ----
NM_012214chr2196187 5064 4930 4740 4540 2529 2408 1988 1977 1875 945 893 636 557 546 536 511 70 27 45346 596 301 218 35452 2293 886 12266
NM_012215chr1061411 799 726 664 543 230 11277 ----
NM_012218chr191463 --1826 --
NM_012219chr343217 2762 2724 1232 1894 1385 --
NM_012223chr261134 1063 958 428 246 116 11075 11071 --
NM_012224chr431026 418 127 2392 164 1913 --
NM_012234chr373530 3131 1440 1379 1172 433 268 43758 3534 3439 2452 --12343
NM_012238chr1061785 1633 544 431 266 202 41406 1309 490 145 ----
NM_012242chr102284 258 1165 ----
NM_012243chr11270 128 ----
NM_012247chr106979 965 903 705 297 168 ------
NM_012249chr293437 3167 3101 2504 2479 2295 2209 1243 612 22497 929 ----
NM_012250chr112882 261 ------
NM_012252chr7195365 4859 4642 4476 4158 3954 3924 3743 3570 3558 3542 3389 1756 1071 1001 867 812 210 100 75251 4989 3647 3546 3394 3383 823 34739 3448 214 13730
NM_012255chr203405 117 69 ------
NM_012257chr71226 ----11018
NM_012259chr661462 1394 1187 425 183 168 --11417 --
NM_012261chr20--1675 1617 --
NM_012262chr1115017 4876 4515 4245 3928 3610 3474 1997 1981 1849 202 22012 350 23340 872 --
NM_012278chrX1148 ------
NM_012281chr762218 874 493 378 286 268 1907 ----
NM_012286chrX2409 50 187 166 --
NM_012287chr3174402 4344 4139 4132 3968 3609 3433 1581 1245 1232 1072 1032 698 586 453 340 310 44143 3116 747 435 24017 1584 --
NM_012288chr6135674 5640 5433 4921 4273 4176 3817 3770 1253 1131 382 349 182 15662 23591 162 1893
NM_012290chr231278 631 85 51523 1388 1350 460 386 31384 1035 89 --
NM_012294chr7123886 3467 3422 3230 3013 2752 1531 1478 1286 1167 443 263 21181 775 ----
NM_012295chr221400 ------
NM_012296chr1153815 3425 1094 508 82 --13207 23019 496
NM_012297chr492584 2099 2081 1951 816 755 414 111 100 21797 827 21834 548 --
NM_012300chr551791 1782 667 606 404 ----1408
NM_012301chr762248 1376 805 648 524 48 --12252 --
NM_012302chr121048 861 21274 1180 1798 --
NM_012307chr184867 826 679 398 --2873 838 --
NM_012308chr1142305 2166 2059 1763 --11999 --
NM_012309chr11144304 4237 4068 3321 3181 3130 1856 1611 1605 1395 1377 925 594 241 31949 1679 701 44022 4019 1228 579 --
NM_012311chr103656 582 97 ------
NM_012316chr1145447 5419 5262 4271 4071 3485 1606 1085 583 568 400 351 333 239 65615 3733 3541 2236 394 363 51713 1098 1095 1092 1089 14065
NM_012318chr411093 --11229 --
NM_012322chr7168 ------
NM_012323chr2221613 264 --11620 --
NM_012325chr2061634 1619 1189 1010 129 103 136 ----
NM_012327chr1841264 631 561 255 41505 1198 639 532 21553 172 1247
NM_012328chr731376 1321 1263 2934 219 1250 --
NM_012329chr1751083 469 436 363 310 ------
NM_012330chr1081759 1696 1578 1163 708 527 369 182 11816 1197 --
NM_012333chr131195 375 176 1665 21188 503 --
NM_012334chr594404 3624 3563 3389 1761 1485 1465 1246 556 23148 1489 ----
NM_012342chr104534 501 492 146 ------
NM_012343chr531103 1083 1034 3972 436 161 ----
NM_012347chr682531 2441 2262 2204 1032 563 534 181 21969 927 12405 1325
NM_012382chr5184441 4357 4343 4063 3851 3542 3454 3356 3116 3043 2874 1743 1666 1454 933 881 833 36 2840 118 1429 13679
NM_012383chr9--1364 ----
NM_012388chr15123166 2933 2892 2726 2042 2020 786 601 525 326 146 24 1202 ----
NM_012392chr12670 51 1690 184 --
NM_012394chr1125 ------
NM_012395chr783415 2591 2281 817 784 458 276 114 --22366 2127 1404
NM_012399chr2251898 1361 1274 790 495 1570 1503 --
NM_012405chr183850 3828 3556 3149 2652 808 410 92 --23786 2988 --
NM_012408chr203870 655 276 ------
NM_012414chr13839 713 106 ------
NM_012420chr1071501 718 510 440 287 183 34 ------
NM_012421chr1--1470 ----
NM_012426chr161346 ------
NM_012428chr156864 796 699 681 246 240 1886 ----
NM_012430chr35752 664 520 131 111 ------
NM_012432chr12343 27 ------
NM_012434chr631664 1470 97 ------
NM_012444chr202433 176 ------
NM_012446chr51128 1397 ----
NM_012448chr1792359 2349 2293 1652 1603 1011 968 523 499 ----2947 31
NM_012453chr751552 1294 221 176 115 --1135 --
NM_012454chr61365 ------
NM_012464chr4102426 2142 1865 1837 1785 1091 1023 843 745 341 31119 1046 703 12004 --
NM_012465chr10103264 3031 2982 2964 2942 2847 841 472 201 108 22747 777 33034 2163 845 1291
NM_012467chr16125 ------
NM_012475chr12252 94 ------
NM_012479chr782647 2596 2366 2140 2051 2017 1969 58 12149 1788 --
NM_012486chr11100 ------
NM_013227chr15296 86 1262 ----
NM_013229chr1251048 575 405 83 32 1198 1166 --
NM_013230chrY71772 1610 1501 1393 1341 1172 1146 11349 ----
NM_013231chr1463620 1749 1196 863 316 226 13874 11530 --
NM_013232chr52393 103 ------
NM_013233chr21269 1553 ----
NM_013235chr54905 593 307 194 --1928 --
NM_013242chr161329 --147 --
NM_013243chr1551045 530 518 504 162 --1311 --
NM_013245chr163728 644 269 ------
NM_013247chr22543 164 ------
NM_013248chr202307 237 ------
NM_013249chr111205 1209 ----
NM_013254chr121607 1681 ----
NM_013255chr7208879 8724 8709 8202 7333 7230 7039 6921 6866 5919 5817 5644 5487 2144 2087 2060 1604 790 335 260 68315 7023 6130 5695 1993 1129 46851 5840 3524 2616 --
NM_013257chr872283 2129 950 465 298 279 145 12241 ----
NM_013261chr4163671 3427 3241 3208 2817 2778 2603 2431 1471 1457 1446 1195 1138 975 778 772 --21175 784 --
NM_013262chr651350 1311 1104 1088 428 11403 ----
NM_013263chr16------143
NM_013264chr113222 160 91 ------
NM_013269chr1264508 4160 3981 1436 1299 85 ------
NM_013272chr15152 --1156 --
NM_013277chr1251012 928 901 726 283 --1969 11099
NM_013281chr2031519 343 156 41368 1268 1008 410 --11450
NM_013282chr1961121 1096 989 875 231 139 31343 1227 159 11291 --
NM_013283chr57889 857 802 613 197 60 21 --1816 --
NM_013286chr343017 2790 1212 623 21458 459 11353 --
NM_013293chr74773 91 43 35 ------
NM_013300chr121240 ------
NM_013302chr1684733 1855 1724 1327 1245 827 654 616 23530 863 23336 3333 13007
NM_013304chr161233 ------
NM_013309chr1552622 1930 1785 447 352 22637 643 ----
NM_013316chr73816 249 130 21043 789 ----
NM_013322chr741507 1402 1093 364 11389 ----
NM_013330chr12220 79 ------
NM_013336chr32175 123 --1577 --
NM_013341chr242850 999 934 349 ------
NM_013348chr1921294 1011 --21304 1298 --
NM_013354chr841487 1407 482 316 11368 ----
NM_013355chr91273 ------
NM_013357chr84865 585 92 84 ----1708
NM_013365chr222848 532 ------
NM_013367chr41115 ------
NM_013371chr11331 ------
NM_013372chr1553419 2799 2362 1212 497 32481 1349 583 22803 2216 --
NM_013374chr373049 2798 2064 1017 846 534 382 1751 1942 --
NM_013377chr121201 2165 154 1183 --
NM_013381chr1262309 881 830 773 623 59 42295 1728 1512 871 11821 12142
NM_013390chr931747 543 301 11702 ----
NM_013392chr21440 ------
NM_013396chr213303 104 40 21279 1194 ----
NM_013411chr151844 1821 1000 850 177 12791 21971 700 --
NM_013412chr241238 1054 480 363 ------
NM_013423chrX41277 1048 926 96 31173 1108 849 199 --
NM_013427chrX41277 1048 926 96 31173 1108 849 199 --
NM_013433chr1962058 1787 1773 1650 1337 1330 --11362 --
NM_013436chr23744 148 114 ------
NM_013437chr841434 1153 553 116 21219 1074 ----
NM_013438chr93307 175 165 --11291 --
NM_013441chr11432 ------
NM_013443chr92840 221 ------
NM_013444chrX3973 200 105 187 ----
NM_013448chr142743 699 2772 298 1686 --
NM_013449chr1292531 2492 2459 2257 2248 1154 1129 552 265 --11988 --
NM_013450chr241223 925 108 27 31244 1033 378 1112 --
NM_013937chr64904 795 724 285 1718 1916 --
NM_013943chr183256 3212 3016 2726 2635 2238 2018 1282 43203 2968 2084 829 ----
NM_013952chr211903 12365 ----
NM_013953chr211903 12365 ----
NM_013958chr82472 28 1476 --1337
NM_013959chr82472 28 1476 --1337
NM_013961chr82472 28 1476 --1337
NM_013962chr82472 28 1476 --1337
NM_013986chr22--1138 ----
NM_013992chr211903 12365 ----
NM_013993chr62729 215 --1521 --
NM_013994chr62729 215 --1521 --
NM_013995chrX142542 2408 2044 1947 1715 1631 1609 921 891 686 645 422 354 183 32546 2486 2072 1925 --
NM_013996chr7--1141 ----
NM_013996chr7--1141 ----
NM_013997chr7--1141 ----
NM_013997chr7--1141 ----
NM_013998chr7--1141 ----
NM_013998chr7--1141 ----
NM_014000chr1041759 1438 1388 1335 1172 11952 --
NM_014003chr161319 ------
NM_014011chr262604 2122 954 398 386 316 12639 --197
NM_014015chr16--1649 1789 --
NM_014016chr351736 1245 681 457 97 21316 581 ----
NM_014021chr122532 2344 43463 1147 699 24 13445 12972
NM_014023chr1032685 631 129 22868 607 11845 12576
NM_014034chr671259 1144 1105 456 403 256 194 --11109 --
NM_014038chr73424 297 45 1312 ----
NM_014041chr32363 236 ------
NM_014043chr331672 538 70 --1549 1316
NM_014044chr2160 ------
NM_014048chr16144927 4881 4860 4683 4201 4184 4077 3730 3233 1945 1389 1273 1119 858 33954 3822 3459 --12030
NM_014055chr124459 343 200 71 2175 121 ----
NM_014057chr921569 452 31390 1344 534 1455 --
NM_014071chr20175 ------
NM_014089chr13122288 2127 2118 2069 1878 1744 1427 351 205 171 119 62 22131 146 ----
NM_014106chr1592891 2647 2232 2127 2075 1197 934 579 353 ----11051
NM_014109chr841203 842 778 420 2440 27 ----
NM_014110chr131037 277 218 ------
NM_014112chr8185450 5380 5101 5008 4762 4364 3809 3626 2099 2072 1904 1836 1488 1010 811 230 146 42 24390 978 24794 135 12077
NM_014117chr1692537 2448 2181 2082 1826 985 848 353 191 32718 2353 923 --12441
NM_014141chr7205298 5178 4759 3808 3605 3490 3475 3449 2147 1893 1688 1641 1390 1182 1145 1008 979 819 384 182 45122 4780 714 194 31536 1529 910 11645
NM_014149chr72717 586 1764 2589 347 --
NM_014153chr163616 526 465 ------
NM_014154chr331446 353 169 --11437 --
NM_014155chr11217410 7390 7365 7167 6773 6742 6521 6309 5971 5360 5301 4999 4988 2974 2114 1248 1239 757 617 441 408 47243 2000 834 805 36201 2950 549 12339
NM_014178chr144433 379 133 28 --192 --
NM_014181chr252858 2587 1095 523 450 --1823 --
NM_014182chr123761 723 199 --1274 --
NM_014183chr201307 1311 ----
NM_014186chr1111516 --2693 199 21966 581
NM_014190chr431885 1152 1144 --11156 --
NM_014191chr121815 1352 ----
NM_014212chr123836 719 627 --2659 87 --
NM_014216chr1431525 488 110 ------
NM_014217chr171612 1603 1440 1410 249 211 178 11386 ----
NM_014223chr14573 297 210 197 ----1494
NM_014231chr1242104 2042 1903 1877 --31483 249 139 1742
NM_014232chr1761490 1417 669 633 290 217 --3514 358 355 --
NM_014232chr1761490 1417 669 633 290 217 --3514 358 355 --
NM_014233chr1742179 1778 1470 117 1127 22042 1888 --
NM_014241chr102306 112 --128 --
NM_014243chr462095 2069 1925 1919 1321 319 ------
NM_014245chr31357 1102 ----
NM_014248chr22--1114 ----
NM_014250chr2252023 1897 1566 1484 252 ------
NM_014252chr133118 102 65 ------
NM_014253chrX72503 2453 2131 1993 1719 1660 542 11760 ----
NM_014264chr42596 43 ------
NM_014267chr112607 334 --1293 --
NM_014268chr1871313 1292 1263 337 286 167 49 31300 393 280 ----
NM_014270chr19275 68 ------
NM_014271chrX3346 296 160 ------
NM_014278chr4----1444 --
NM_014280chr13160 111 70 2802 667 ----
NM_014282chr92885 136 --11224 --
NM_014283chr1111366 1308 1270 1163 1120 1066 430 345 136 47 33 1243 1414 --
NM_014288chr11212 ------
NM_014294chr841207 331 272 76 --11338 --
NM_014296chr331616 1273 422 21155 52 ----
NM_014299chr1962147 1932 1803 1648 721 81 --1405 --
NM_014302chr71111 125 ----
NM_014305chr135677 532 490 204 100 ------
NM_014309chr22204732 4706 4622 4613 4546 4201 4070 1800 1591 1039 1032 852 776 618 469 229 203 177 162 142 --1814 --
NM_014319chr1271380 1280 364 346 85 74 62 --11772 --
NM_014320chr63307 301 143 ------
NM_014322chr15998 893 817 332 184 ------
NM_014324chr521138 853 21175 1099 ----
NM_014325chr12102158 1502 736 490 402 393 356 270 233 218 11904 1740 --
NM_014329chr162303 282 ------
NM_014331chr4207516 7456 6742 6196 6119 6091 5995 5841 5383 5158 5142 5110 4923 2742 2464 2230 2208 1727 1061 352 67246 6924 2048 1044 737 693 12283 --
NM_014333chr11132820 2659 2539 2472 2165 1876 1099 577 384 330 235 203 169 22636 2155 1856 12041
NM_014335chr1511055 1125 ----
NM_014342chr113153 145 94 --21477 424 --
NM_014344chr112696 153 1252 ----
NM_014350chr54996 408 386 303 ------
NM_014352chr1141408 1046 556 330 --21379 1052 2966 144
NM_014363chr1331177 1066 894 ----11050
NM_014370chrX1192 ------
NM_014372chr1112034 1961 1925 1888 1822 1458 541 501 399 371 351 11349 ----
NM_014376chr532280 2248 1838 --1250 --
NM_014381chr1452044 2017 998 873 154 2669 359 43314 2539 2415 851 1478
NM_014382chr381793 1464 1340 1286 640 582 391 97 --31150 1083 491 --
NM_014388chr1175917 5900 5894 5801 5268 4603 2245 1917 1773 1484 1046 498 426 348 338 295 146 64949 4623 1669 1090 727 564 64994 3682 2229 1665 1662 1050 14013
NM_014390chr71429 ------
NM_014392chr421172 438 ------
NM_014393chr8112240 2213 2014 1773 1740 857 744 726 398 376 201 42045 260 251 51 52300 2216 1868 236 233 --
NM_014394chr1051168 1148 969 297 165 --2934 802 --
NM_014395chr471921 1852 1833 1315 580 505 105 ------
NM_014397chr921085 505 1223 ----
NM_014399chr73993 270 167 ------
NM_014405chr1732367 1897 51 ------
NM_014411chr752030 1560 1419 1348 757 1173 ----
NM_014415chr31394 ------
NM_014423chr5155570 5413 5217 4057 3642 2115 1873 1808 1577 1534 1139 1000 597 510 454 44164 1553 1396 992 24645 4386 --
NM_014426chr202545 204 ------
NM_014429chr34647 221 68 56 1135 ----
NM_014431chr1041460 1377 165 151 ------
NM_014435chr43644 615 605 --1587 --
NM_014445chr352198 2136 1958 1658 1587 21923 154 ----
NM_014447chr4101595 1481 1383 1146 1106 1038 602 561 225 136 11110 --1145
NM_014448chr11521 ------
NM_014452chr66483 413 311 196 174 65 ------
NM_014454chr631097 239 144 1685 ----
NM_014455chr11140 ----1147
NM_014456chr1071411 584 465 323 226 189 172 1662 ----
NM_014458chr141414 1394 1177 1048 11207 --11341
NM_014469chr114615 309 257 209 --2623 293 --
NM_014470chr12--1107 1703 --
NM_014491chr73273 248 190 --5206 203 200 197 194 --
NM_014494chr16112232 2048 1695 1670 1641 907 899 746 340 302 291 21618 600 ----
NM_014498chr33351 118 42 ------
NM_014505chr121383 ------
NM_014515chr123257 213 38 1243 11047 --
NM_014517chr341736 720 530 318 --11628 --
NM_014521chr251739 1453 575 379 257 ------
NM_014547chr152629 327 ------
NM_014547chr152629 327 ------
NM_014554chr1272248 1933 1703 1671 1659 1502 1428 --21713 1446 21925 264
NM_014562chr22739 560 ------
NM_014570chr2231010 260 149 ----1116
NM_014572chr13131740 1499 1449 1439 1308 1185 1174 1127 671 574 564 514 291 11267 ----
NM_014574chr1441351 981 600 317 1437 4334 331 328 325 --
NM_014575chr32495 152 ------
NM_014577chr222255 112 --2272 115 --
NM_014583chr32481 382 ----1448
NM_014584chr1411125 1426 21616 1613 --
NM_014587chr1631588 1377 213 --21360 1350 --
NM_014588chr203529 503 106 1772 ----
NM_014592chr52816 205 --1209 --
NM_014600chr221686 560 --3585 417 414 --
NM_014603chr1731403 386 358 ----11693
NM_014606chr441111 983 434 174 31466 1148 1069 11419 1988
NM_014607chr262089 1791 616 568 449 271 ------
NM_014608chr152448 157 185 ----
NM_014612chr961563 1315 1090 529 494 310 1442 ----
NM_014613chr572655 2042 2020 1885 758 731 584 23068 612 12692 --
NM_014614chr231505 404 223 31146 1105 1039 ----
NM_014615chr16103316 3290 2320 1412 898 648 606 372 280 236 2542 79 ----
NM_014616chr343073 2752 2408 869 22399 233 ----
NM_014618chr93442 407 401 ------
NM_014630chr1593981 3607 3335 2937 1328 1321 1300 551 240 23987 3663 --12942
NM_014633chr115631 210 118 102 43 ------
NM_014635chr231700 1279 78 11380 ----
NM_014636chr964245 4048 3754 2978 676 401 14303 24138 1702 11612
NM_014637chr831074 572 527 --1117 11005
NM_014644chr141026 980 655 342 ------
NM_014647chr1642206 1809 184 146 22076 212 2200 193 --
NM_014649chr19185 ------
NM_014659chr15----11094 --
NM_014660chr74847 274 259 250 --2378 265 --
NM_014663chr111062 ------
NM_014665chr842865 2778 1242 566 ------
NM_014666chr551121 380 358 218 92 11217 ----
NM_014667chr362438 2398 2312 1953 1893 383 --2896 372 --
NM_014669chr161147 ------
NM_014670chr241628 1218 1162 555 11546 ----
NM_014671chr771611 1539 1410 1329 565 496 149 --1118 --
NM_014674chr384033 3955 3933 3781 3002 2507 1604 1315 23372 696 23673 526 --
NM_014675chr11464 --158 --
NM_014676chr141560 1247 1143 646 11167 ----
NM_014677chr811052 51323 1196 1000 846 350 1346 --
NM_014678chr22181 ------
NM_014679chr113967 538 489 1324 ----
NM_014682chr882289 2161 1436 793 442 264 238 183 2823 251 1536 --
NM_014683chr1752012 1906 1839 1551 103 --1215 1786
NM_014685chr161493 ------
NM_014686chr1932262 969 471 1477 ----
NM_014689chr22414 181 ------
NM_014690chr782912 2888 2779 2667 1222 1012 832 661 1357 --11128
NM_014700chr1621321 998 ------
NM_014701chr1553190 2749 2533 2249 725 ----1412
NM_014702chr6163449 3100 2459 2337 2224 2176 1354 1076 1043 990 907 657 608 413 259 177 1911 33336 3191 997 --
NM_014703chr33989 853 185 ------
NM_014705chr761364 770 677 282 269 33 ----1569
NM_014707chr762265 1854 1797 1628 1435 489 31893 1880 1594 ----
NM_014711chr1682015 1936 1810 1703 824 708 480 275 21591 810 11957 --
NM_014712chr161214 ------
NM_014713chr23172 150 41 ------
NM_014718chr121547 1686 ----
NM_014720chr1071483 667 614 507 429 355 129 2511 267 ----
NM_014721chr6237387 7312 7191 6946 6653 6610 6593 6504 6476 6166 5969 5504 5348 5334 5314 4801 2713 2269 2173 2059 2022 1938 1846 55540 5378 2312 1429 260 36480 2308 664 --
NM_014723chr2022336 122 22012 129 ----
NM_014726chr171560 ------
NM_014727chr191260 --1246 --
NM_014729chr871759 1695 907 739 726 376 208 1882 2214 21 1174
NM_014730chr1284283 4156 3901 3786 1281 809 756 345 35272 975 80 24287 3426 --
NM_014730chr1284283 4156 3901 3786 1281 809 756 345 35272 975 80 24287 3426 --
NM_014733chr581872 1770 796 681 580 553 483 248 12097 ----
NM_014735chrX62127 1565 1498 1359 540 121 12064 22050 1696 22142 2113
NM_014737chr2063284 1640 1580 1081 198 78 --13822 --
NM_014739chr694035 3893 3749 3574 3233 3226 3182 2835 2729 42666 1177 1161 1034 43239 1139 1133 1093 --
NM_014741chr1122177 34 1859 2535 524 --
NM_014742chr2091776 1725 1716 1662 1643 1271 1183 316 182 1239 2323 235 --
NM_014743chr4142954 2718 2710 2368 2303 2164 1266 952 784 650 605 291 192 145 --12439 --
NM_014746chr2144381 4058 3611 3416 3107 3042 1568 847 659 634 555 501 484 94 11287 14067 --
NM_014747chr145544 5403 4254 4000 45775 4033 791 416 34048 3580 726 13511
NM_014751chr851660 674 284 255 217 --1386 --
NM_014752chr1131389 514 428 31828 768 671 21824 282 --
NM_014755chr2153652 3535 3476 3070 3044 2653 1682 1668 1590 1110 1031 590 476 355 198 --13983 21185 100
NM_014756chr111332 ------
NM_014757chr532315 2268 560 --11574 --
NM_014758chr1142395 2354 868 575 1564 121 12460
NM_014762chr162458 2370 2323 2196 2167 845 12345 12462 --
NM_014765chr172648 2073 2029 1984 476 383 171 --12312 --
NM_014766chr743077 414 379 25 ------
NM_014767chr1032817 2596 314 ------
NM_014770chr1231215 1200 976 ----11324
NM_014772chr1842838 2440 1304 242 1710 1246 12467
NM_014774chr1103291 2599 2584 2321 2142 2011 772 714 285 270 32845 1248 418 ----
NM_014779chr34957 843 388 68 21023 982 ----
NM_014781chr841180 146 93 39 31204 1015 433 --11184
NM_014783chr1531680 1111 192 21401 141 1185 --
NM_014784chr131112 787 383 ------
NM_014786chr111400 ----11124
NM_014787chr142800 2654 1794 416 --2845 735 --
NM_014790chr51140 ------
NM_014791chr93318 255 214 ------
NM_014795chr261394 1192 881 561 426 36 41278 1164 1046 516 ----
NM_014802chr1231126 1063 74 11044 1971 --
NM_014803chr1092709 2676 2377 2092 1826 921 855 660 603 32846 2045 312 32444 664 363 --
NM_014810chr1113413 3057 3027 2899 2543 2447 2377 1384 732 539 521 --1328 --
NM_014811chr93746 489 194 ------
NM_014812chr151549 694 443 301 125 21553 784 --1406
NM_014819chr572321 2312 2265 2258 1921 1813 1779 32410 504 220 11817 1444
NM_014820chr382053 1892 1634 1446 1275 652 625 31 11472 11911 --
NM_014822chr43618 97 53 2534 456 ----
NM_014824chr1171887 1572 1550 1491 1326 791 181 31981 810 408 ----
NM_014827chr151590 1582 1057 498 343 31576 364 94 1351 --
NM_014828chr1452544 2025 701 202 137 ------
NM_014829chr562121 1978 1915 1751 870 837 41898 1775 841 614 ----
NM_014830chr1273882 3837 3399 2887 2406 1484 248 23657 242 23403 3366 --
NM_014832chr1392004 1986 1879 1783 1633 1406 846 446 371 11454 --22009 1325
NM_014838chr2252893 2094 2078 1798 352 ------
NM_014839chr1102380 2275 2061 2035 1988 792 755 740 342 229 62568 2039 672 655 346 294 22316 2064 --
NM_014840chr1253197 3178 2197 1256 1007 --22807 2294 12925
NM_014841chr661336 966 939 514 419 283 21218 1069 --1496
NM_014844chr1424148 1491 14052 ----
NM_014846chr81109 ------
NM_014847chr11211 ----1380
NM_014848chr1562414 1845 1825 1130 923 844 12091 12514 12518
NM_014850chr364039 3883 3428 3255 3232 1079 --21868 494 --
NM_014858chr121121 1071 --178 --
NM_014859chr1711263 ------
NM_014862chr1574128 4083 3786 1505 1133 836 397 11160 --11069
NM_014864chr174088 3713 3691 3622 1033 854 418 33682 3576 3341 41617 1167 1164 30 --
NM_014868chr126846 809 618 291 268 54 ------
NM_014870chr132952 1052 744 --11173 --
NM_014871chr121212 ----1206
NM_014872chr931450 668 52 1954 ----
NM_014873chr1144912 4667 4300 3901 3893 3822 3714 3694 3599 3431 3392 923 732 48 34578 4471 615 11199 --
NM_014874chr121628 453 21670 1647 1274 11711
NM_014875chr12748 127 170 ----
NM_014876chr2252206 2188 2181 1914 113 --11642 --
NM_014877chr17237803 7727 7599 7477 6761 5913 5084 4931 3107 3033 3006 2976 2940 2906 2832 2708 2505 1563 1153 953 858 634 522 57123 6275 2891 1921 1137 27603 2980 --
NM_014878chr93173 123 37 --1127 --
NM_014883chr442459 1757 782 355 22243 647 ----
NM_014890chr3158 ------
NM_014892chr63249 216 203 ------
NM_014893chrY42047 1594 771 429 12096 ----
NM_014897chr1763074 2215 2055 1176 523 439 32895 2029 650 2597 527 --
NM_014899chr5113179 3160 2765 2317 1233 1224 1045 816 638 78 28 12204 ----
NM_014902chr2051110 459 320 240 160 ------
NM_014903chr125959 756 686 634 316 --11790 --
NM_014904chr10113913 3360 3143 2930 2498 1475 1289 1251 780 745 591 33218 1349 343 ----
NM_014905chr211447 21972 134 21458 660 --
NM_014906chr1783985 3728 3529 1239 921 656 628 498 23564 3069 --12737
NM_014909chr1412728 11000 ----
NM_014912chr1073078 2700 2671 2427 609 345 135 93378 3361 3239 3218 3121 3105 2313 1125 997 ----
NM_014916chr71590 ------
NM_014917chr12965 719 ------
NM_014918chr1591572 1350 1192 1110 588 272 255 189 116 150 11297 --
NM_014920chr6143758 2656 2610 2376 2333 1110 682 548 512 315 244 199 152 126 ------
NM_014921chr1953126 2818 2797 2000 1118 --22800 2155 --
NM_014923chr1372298 2194 2041 1517 741 268 251 21879 594 2574 229 11757
NM_014924chr14122808 2753 2743 2438 2173 1968 925 719 609 471 135 46 1650 1646 --
NM_014925chr122690 176 --3251 237 205 --
NM_014926chr35951 740 452 367 30 138 ----
NM_014932chr351891 1814 1609 1281 676 11526 --21627 230
NM_014936chr642726 2573 1113 375 11784 ----
NM_014939chr1851355 1193 606 565 183 1198 1186 --
NM_014945chr541867 1339 352 246 ------
NM_014946chr2132961 2473 1073 957 775 631 615 574 529 489 428 399 107 33064 2936 1978 1818 32541 579 279
NM_014947chr172936 1223 918 541 510 398 257 1308 ----
NM_014949chr15886 709 239 140 41 --1853 --
NM_014952chr1541960 1871 828 125 ----12063
NM_014953chr1354107 3312 2646 1118 36 14149 13833 13031
NM_014961chr461863 1605 876 860 595 175 31394 655 290 11402 --
NM_014962chr2062695 1889 1100 944 665 138 22628 978 2948 711 --
NM_014964chr1732134 662 474 2978 870 11688 --
NM_014974chr1061242 1185 559 379 309 265 11217 ----
NM_014978chr1061665 1575 559 281 92 40 21421 306 21578 285 --
NM_014982chr14215370 5046 4751 4664 4339 4289 4078 3974 3808 3726 3518 3496 2054 1656 1133 1126 709 361 352 287 28 55441 3559 1066 949 755 84590 3977 3277 2138 1789 1147 1144 32 --
NM_014988chr482551 2497 2359 2327 2099 2011 169 145 22559 39 1316 --
NM_014989chr64761 560 466 420 1130 1568 --
NM_014990chr1451139 946 844 372 273 ------
NM_014991chr4113131 2972 2799 2589 2421 2129 862 638 598 446 311 23291 2197 22592 402 1703
NM_014992chr144773 679 287 103 1729 ----
NM_014997chr772889 2831 2707 1106 1048 649 320 2798 156 42355 2269 1127 195 1862
NM_014999chr1241593 637 576 564 1580 ----
NM_015000chr12142827 2654 2613 2544 2279 2218 2166 2085 1914 1075 1037 1021 782 192 22484 571 22874 801 --
NM_015001chr12966 275 ------
NM_015002chr12102135 2088 1924 880 774 735 623 584 468 324 12016 12239 --
NM_015008chr382693 2667 2625 2547 2294 1070 895 142 1146 ----
NM_015011chr1361167 1109 726 438 360 194 ------
NM_015017chr151129 1029 869 814 129 1107 ----
NM_015018chr6288 82 ------
NM_015020chr1673498 2576 2368 933 901 787 84 12515 23297 1087 --
NM_015023chr121801 1647 1109 --11328
NM_015024chr841405 1369 1331 583 1343 11245 --
NM_015025chr241058 588 447 327 --12223 --
NM_015026chr12124551 4531 4465 4438 4245 3128 3120 3113 1338 1271 332 84 54329 3687 3451 2947 853 14448 1399
NM_015032chr1372766 2652 2286 2257 478 265 50 31838 1182 787 --12679
NM_015035chr20105213 5197 4607 2429 2279 1750 1467 1299 1066 223 26450 4616 12524 1750
NM_015037chr101267 ------
NM_015039chr1114209 4196 3513 3415 3311 3267 1501 1337 880 498 470 1549 12863 1679
NM_015042chr1594301 4275 3565 3524 3440 2981 2969 1189 825 --1914 --
NM_015044chr1623028 549 1366 22622 2487 --
NM_015045chr1062066 1818 1503 486 298 148 ----1464
NM_015046chr942452 2325 747 366 --22397 1778 --
NM_015049chr2102852 2663 2655 2236 1230 1188 1157 1118 956 263 --31217 1211 994 1577
NM_015050chr62509 423 --2964 83 --
NM_015051chr993374 3287 3279 3056 2966 2605 1271 365 140 33060 2992 930 ----
NM_015052chr741297 1103 1090 1053 21078 970 1171 --
NM_015055chr1162904 1855 917 605 556 477 --1431 12266
NM_015056chr2192128 2083 1969 1831 1817 1793 556 456 82 --21047 630 --
NM_015057chr13----1206 --
NM_015059chr1583743 3715 2591 1137 1125 985 576 411 11606 23011 414 --
NM_015061chr92859 780 1737 ----
NM_015064chr1242838 2283 576 449 1298 1897 --
NM_015068chr773441 3377 2536 1543 480 458 243 22860 418 11530 --
NM_015069chr161427 ------
NM_015071chr5146477 6257 5723 5381 5160 4301 4278 2251 2100 2084 1666 809 797 787 34161 2006 1743 22164 2161 --
NM_015072chr141432 --1401 --
NM_015074chr1134898 4718 4598 3416 3027 890 668 574 555 525 482 444 184 44549 4525 3468 428 11740 1725
NM_015075chrX32240 2052 1488 --1195 --
NM_015076chr6134478 4199 4176 3105 3048 2742 1566 1502 1459 1358 1237 1007 291 24295 979 --21218 168
NM_015080chr112930 381 --3896 390 387 --
NM_015086chr1231367 1360 65 ------
NM_015087chr1372380 2241 2231 792 438 399 230 ------
NM_015090chr1126237 6039 6032 5967 5909 5889 5667 5622 5111 4713 479 412 ----15627
NM_015091chr141868 1791 ----
NM_015092chr16154427 4345 4295 4269 4013 3944 3908 3613 3484 3319 3207 3107 1312 1056 1015 34683 2856 1166 13616 --
NM_015093chr641173 740 692 672 11724 1319 --
NM_015094chr2251802 886 800 665 616 ------
NM_015097chr352290 1659 1481 814 734 11768 1562 --
NM_015100chr171910 1728 1583 1466 621 299 261 21601 542 ----
NM_015101chr172445 2409 2237 2146 744 506 50 2979 270 ----
NM_015107chrX42337 1893 1828 123 2313 306 12397 --
NM_015110chr962417 2379 979 848 768 494 1936 --1200
NM_015115chr4112922 2715 2447 1244 834 803 786 766 722 513 366 43013 2546 2036 759 12577 --
NM_015120chr22261 100 ------
NM_015125chr192558 369 ------
NM_015130chr481292 1251 1191 1169 874 388 76 60 --21239 1142 --
NM_015132chr751749 1345 739 274 151 --11753 --
NM_015135chr72185 74 --1145 --
NM_015137chr882546 2337 2305 1942 1708 478 237 98 ----1564
NM_015138chr1562566 2546 2135 1851 962 752 22664 697 3986 983 505 --
NM_015143chr4284 34 ------
NM_015144chr1683806 3763 3244 2928 2764 819 701 99 --11090 --
NM_015149chr162026 1752 1534 1436 840 388 ------
NM_015153chr62789 680 ----2794 186
NM_015155chr1092741 2574 1148 973 586 372 348 256 137 32071 1152 182 ----
NM_015156chr14103998 3703 2569 2480 1468 910 500 465 456 164 12788 33357 914 889 --
NM_015158chr92773 569 ------
NM_015163chr1431775 397 325 21885 1541 11713 --
NM_015170chr882117 2013 1790 1662 1652 1609 835 824 22356 2060 ----
NM_015172chr161569 1402 1295 1184 1036 435 --21285 597 --
NM_015173chr441431 406 301 287 11183 ----
NM_015176chr1101555 1400 1144 498 448 428 404 255 193 153 --11618 --
NM_015178chr832668 854 137 ------
NM_015180chr14----1123 1767
NM_015184chr3--1641 ----
NM_015185chrX92932 2924 2300 1940 827 512 440 357 67 2918 624 32738 2241 2194 --
NM_015186chr94479 352 329 108 ------
NM_015191chr1121070 91 1416 22622 1852 --
NM_015192chr2083044 2986 2911 2525 2491 2327 442 243 --1314 --
NM_015197chr1423389 2147 --13152 --
NM_015199chr332760 668 237 ----153
NM_015200chr452393 543 514 506 255 ------
NM_015202chr1621704 1199 ------
NM_015206chr1552885 2837 2578 1249 318 13814 22979 615 --
NM_015208chr1883510 3363 2494 1517 1252 1084 510 480 32556 918 449 ----
NM_015209chr192069 2054 1701 867 755 393 366 317 299 2761 303 1323 --
NM_015213chr115723 654 536 186 61 ------
NM_015215chr153179 2778 1941 868 730 --23031 2724 1787
NM_015216chr531535 112 26 21277 553 ----
NM_015226chr1633200 648 324 --1627 2922 184
NM_015227chr2143491 3391 835 134 12631 13394 13423
NM_015229chr17----11144 --
NM_015230chr431762 1346 1262 51830 1510 1437 1358 1276 ----
NM_015235chr1091913 1694 1588 1470 1390 1374 587 165 141 --1144 --
NM_015236chr441256 365 219 142 ------
NM_015238chr53539 456 143 ------
NM_015245chr652245 2026 1882 1106 293 ------
NM_015247chr16105238 4259 4217 4165 4066 3844 1854 1317 548 397 15276 --1370
NM_015250chr961799 1666 1405 323 141 119 1680 1251 --
NM_015251chr1642275 2073 1488 133 --1124 --
NM_015252chr23979 881 753 --1735 1886
NM_015254chr841978 650 175 124 1765 12236 --
NM_015256chr52625 614 ------
NM_015262chr101146 ------
NM_015263chr153854 466 356 1238 1752 --
NM_015264chr22114928 4886 4543 4430 4257 3998 3885 3743 3333 3229 1267 34678 3750 1793 13337 14264
NM_015265chr272592 2505 2153 564 168 147 129 22290 62 --11974
NM_015268chr31229 --1123 --
NM_015269chr13647 552 499 1471 ----
NM_015270chr1232157 401 217 --1390 --
NM_015271chr474126 4012 3361 2758 2627 652 640 13936 --21639 701
NM_015272chr1682049 2018 1808 1307 856 656 570 304 --11798 1164
NM_015275chr1261939 1775 1589 864 815 306 11971 1560 --
NM_015277chr1841551 1462 632 369 132 11834 --
NM_015278chr663250 2604 2598 1261 1150 536 13480 32451 2203 1130 1540
NM_015282chr231917 426 407 32008 722 359 12681 12925
NM_015285chr1862596 2505 1631 1022 522 246 11930 --1587
NM_015288chr543667 3596 1435 1264 33639 3368 1453 22628 966 22510 2356
NM_015291chr193472 3433 3112 3058 3023 2751 282 228 39 23216 1319 ----
NM_015296chr1331130 400 267 ------
NM_015305chr1461976 1901 1644 1557 1550 359 --21955 137 --
NM_015308chr113893 171 23 1706 ----
NM_015310chr8166563 6533 5810 3226 3084 2820 2416 1783 1507 1362 1266 1022 899 344 180 127 47773 5163 1090 52 38027 5463 1513 12824
NM_015313chr11124408 3971 3425 3382 3341 3185 2980 2938 2929 1459 855 789 21647 169 --14433
NM_015314chr782578 2172 2140 1952 798 624 496 489 22431 549 12143 --
NM_015315chr583463 2937 2926 2439 2239 2180 1387 734 --22424 238 12336
NM_015317chr262866 2465 1908 995 455 363 --22790 2229 22042 890
NM_015320chr22753 58 --1172 --
NM_015321chr1933058 1518 917 13140 ----
NM_015326chr142119 835 739 515 12874 11012 --
NM_015328chr762638 2616 2607 620 602 314 12645 22463 2319 22881 508
NM_015329chr1931813 1072 900 ------
NM_015331chr13631 582 267 --1620 --
NM_015335chr1292662 2443 2430 2387 1911 1843 1702 708 455 1100 12473 --
NM_015336chr12--52561 2460 2060 291 144 12094 --
NM_015338chr2021685 417 --11850 --
NM_015339chr202712 296 ------
NM_015340chr321278 1222 ------
NM_015344chr872154 1895 1655 676 328 278 240 11458 11994 --
NM_015345chr632778 2402 2245 12418 --12765
NM_015346chr1421644 238 ----11202
NM_015347chr1242797 1091 1054 295 11819 ----
NM_015349chr6122642 2626 2406 2255 2128 2068 1917 1114 544 428 164 143 11073 11959 --
NM_015355chr1761806 1697 783 408 377 350 ----1615
NM_015358chr2161064 514 425 370 347 40 1303 ----
NM_015359chr862374 2175 1917 1896 1858 286 22669 498 --12462
NM_015361chr24805 700 370 228 2708 336 1891 1948
NM_015365chrX93522 3093 3024 1256 612 330 311 256 68 11543 34038 377 358 --
NM_015367chr2251631 1343 1030 586 524 11275 ----
NM_015375chr184856 4723 4170 3830 1439 1339 1136 1117 --11429 --
NM_015379chr7----144 --
NM_015381chr2242014 1942 1531 454 --11330 --
NM_015382chr143717 551 111 1560 ----
NM_015385chr10113191 3175 2975 2969 2269 1157 873 855 773 280 67 23195 2257 ----
NM_015387chr262080 1906 1789 1520 1340 156 11395 1100 --
NM_015393chr4123779 3724 3615 3461 3155 2937 2581 2432 1126 559 487 377 2195 40 23599 277 --
NM_015396chr32416 225 --11353 --
NM_015397chr981930 1770 1740 667 271 186 75 60 1275 --1309
NM_015409chr1252782 2599 2254 2018 326 22468 446 ----
NM_015415chr11216 ------
NM_015423chr1161297 1234 631 481 431 193 --1358 --
NM_015435chr841289 1251 1101 500 1504 11328 --
NM_015436chr4122944 2926 2679 2668 2549 1312 1049 964 916 619 551 394 43051 2277 920 748 53246 2867 2623 1316 1253 --
NM_015441chr11454 1325 ----
NM_015442chr31186 ------
NM_015443chr1771379 1191 1099 487 381 192 151 31451 1227 1162 11276 --
NM_015446chr161571 1509 1338 1183 402 183 ------
NM_015455chr5133711 3663 1528 1291 1254 1223 910 900 862 658 386 352 263 73959 3717 3351 3280 2639 1370 683 23395 1077 1410
NM_015457chr111349 1921 ----
NM_015458chr8164435 4291 4265 3803 3227 1859 1826 1818 1810 1759 1619 1563 1505 1283 863 34 64843 4284 1906 1287 523 437 1311 11590
NM_015460chr341765 1611 723 331 11708 ----
NM_015461chr181609 ------
NM_015462chr171291 ------
NM_015463chr21832 ----1779
NM_015464chr74976 923 877 174 1190 1160 1738
NM_015465chr52741 589 ------
NM_015466chr3--1211 ----
NM_015472chr31129 ------
NM_015472chr31129 ------
NM_015474chr201254 ------
NM_015475chr241015 868 379 302 ------
NM_015477chr1541002 935 864 669 ------
NM_015481chr122686 385 --11081 --
NM_015483chr7151 ------
NM_015484chr15960 266 211 149 70 1802 ----
NM_015485chr11329 ------
NM_015488chr211487 1567 ----
NM_015496chr82271 210 ------
NM_015497chr1521154 215 1991 ----
NM_015507chrX3456 372 142 ------
NM_015508chr341551 1454 1225 149 ----11498
NM_015509chr1241555 1398 1284 1204 1346 11377 21370 125
NM_015511chr2031148 833 434 1165 174 1145
NM_015516chr1151470 1188 1052 449 429 ------
NM_015520chr362618 2552 2282 1942 924 778 12538 11027 --
NM_015523chr112253 62 ------
NM_015525chr63390 330 251 1129 ----
NM_015528chr172196 175 ------
NM_015530chr22792 393 ------
NM_015532chr15142594 2524 2239 2226 2093 2039 2009 1983 1924 1070 947 753 317 277 32154 1953 286 3550 422 326 --
NM_015534chr121043 992 1229 --1424
NM_015535chr2114207 3973 3650 3510 3410 3038 2655 873 865 516 438 14176 1886 14216
NM_015542chr1031129 1106 1016 ------
NM_015548chr63791 666 146 ------
NM_015550chr7113486 3342 2448 2442 1235 1168 1149 979 614 464 222 1165 12239 --
NM_015553chr6114738 4476 4411 4041 4035 3783 3684 2003 1238 1115 76 34790 1231 382 13850 14416
NM_015554chr15122953 2690 2431 2389 2016 1013 948 937 776 589 518 484 12381 ----
NM_015559chr184874 746 740 686 ----11085
NM_015564chr5113448 3390 3194 2897 2698 2670 2583 1040 728 488 318 12773 33451 2406 1050 --
NM_015565chr2162178 1702 1501 655 263 205 21805 1777 ----
NM_015567chr132934 224 --1499 --
NM_015568chr2044142 3109 1717 1255 --21732 919 --
NM_015569chr1174735 4716 4618 4603 4381 3744 3682 3564 2999 1902 1890 1201 1015 780 496 489 396 44681 3829 786 353 21928 680 13814
NM_015570chr761831 1730 506 359 252 231 1188 ----
NM_015571chr662550 2427 2229 1924 937 196 52554 951 892 336 220 ----
NM_015575chr293028 2786 2452 802 779 672 636 383 363 1165 4395 392 389 136 --
NM_015576chr362999 2742 2606 2400 1873 1039 22756 630 --12314
NM_015577chr541537 661 548 415 11198 1122 --
NM_015578chr1981918 1361 768 594 576 468 249 143 1303 1458 --
NM_015601chr103649 334 57 2396 338 ----
NM_015602chr161824 1387 519 324 102 85 11313 1691 --
NM_015607chr11167 ------
NM_015608chr10--3601 494 470 --1180
NM_015609chr142340 2329 476 467 ------
NM_015610chr792526 1961 770 681 660 595 568 244 223 1364 ----
NM_015630chr231053 767 453 1298 ----
NM_015635chr962196 1832 1485 875 341 218 21815 264 ----
NM_015640chr174890 4625 4533 3980 1573 863 737 2574 264 ----
NM_015641chr771292 1209 1105 941 481 165 148 1152 1366 --
NM_015642chr3122 ----1313
NM_015649chr191412 --1122 --
NM_015657chr23949 846 167 ------
NM_015660chr71271 --1275 --
NM_015670chr171153 1119 ----
NM_015676chr142327 117 2255 80 ----
NM_015677chr22566 146 --122 --
NM_015678chr1351357 1209 1056 682 504 21201 175 11213 11460
NM_015686chrX22321 2280 ------
NM_015691chrX62943 2747 2182 1178 360 191 1420 ----
NM_015695chr671843 1484 1451 1365 813 551 325 31864 1386 604 2600 555 --
NM_015704chr222119 46 ------
NM_015711chr194851 694 266 111 ------
NM_015713chr8103573 3508 3276 2763 2669 2458 1262 929 750 632 43589 3488 3342 1221 22772 2309 2933 754
NM_015714chr12386 323 ------
NM_015725chr191504 ------
NM_015726chr171865 1626 451 344 320 263 108 1328 21686 324 11368
NM_015831chr71222 --2338 335 --
NM_015833chr2121976 1634 --22023 1513 22146 1926
NM_015840chr172389 475 253 209 170 106 98 --12438 12156
NM_015841chr172389 475 253 209 170 106 98 --12438 12156
NM_015850chr841796 1786 1702 683 ------
NM_015852chr763444 3136 3114 2894 2592 2453 --13117 --
NM_015855chr111636 ------
NM_015866chr151408 1186 610 526 467 --11256 --
NM_015872chr1----1469 --
NM_015874chr43603 434 92 2615 249 ----
NM_015878chr851822 1736 1364 659 105 3702 663 575 --11780
NM_015879chr18138464 8159 7024 6748 6179 3394 3078 2815 1541 1478 1424 1402 679 36139 2412 1354 25559 1486 --
NM_015885chr113822 359 25 1268 --1730
NM_015886chr8175753 5730 5258 5190 5003 4594 4588 4255 4241 4225 3953 3598 2057 1984 1719 613 498 11435 --22065 1364
NM_015888chr1122988 2886 2837 2750 2495 2328 1320 828 806 515 471 399 ------
NM_015891chr632049 1438 621 11862 ----
NM_015892chr1082320 2145 2088 2027 1978 927 608 433 1643 ----
NM_015898chr1972203 2086 1868 1599 933 920 211 --12178 --
NM_015902chr85930 904 634 280 58 --1687 --
NM_015904chr21571 1523 ----
NM_015906chr1124705 4017 3984 3906 3642 3417 1880 1754 1607 1411 540 385 21566 1420 ----
NM_015907chr4--1278 ----
NM_015912chr842328 2191 1594 728 11807 ----
NM_015913chr13515 508 210 --1543 --
NM_015926chr3--1246 ----
NM_015927chr16----1353 --
NM_015934chr22215 184 ------
NM_015939chr204637 607 575 502 187 1480 --
NM_015949chr71758 1879 ----
NM_015955chr23406 136 128 ------
NM_015975chrX51789 1315 515 212 123 21496 174 ----
NM_015976chr12295 62 ------
NM_015980chr541462 415 296 186 ------
NM_015982chr172314 56 ------
NM_015984chr11382 --1159 --
NM_015990chr43912 391 193 --1946 --
NM_015994chr142659 21 ------
NM_015995chr1565332 5313 4731 4042 3841 1911 1119 ----
NM_015999chr11592 --160 --
NM_016002chr14742 727 613 73 1235 1796 --
NM_016003chr792526 1961 770 681 660 595 568 244 223 1364 ----
NM_016004chr201231 2166 71 125 --
NM_016009chr194610 4589 3975 3825 1611 1453 614 226 210 24798 303 1321 --
NM_016018chr862578 2524 2513 2443 1995 532 32752 2078 39 12072 --
NM_016019chr73383 367 259 ------
NM_016021chr682943 2710 2634 2260 2159 763 257 117 1536 22163 275 --
NM_016023chr872034 1892 1799 1771 754 735 181 11819 --11996
NM_016025chr1682002 1976 1489 1241 495 448 430 155 11247 --11601
NM_016032chrX51057 884 167 153 113 ------
NM_016037chr131093 771 229 ------
NM_016039chr141153 1159 ----
NM_016040chr152578 2519 2291 2105 368 22698 2653 --12377
NM_016041chr173384 317 308 ------
NM_016047chr23170 66 57 ------
NM_016048chr54332 220 124 79 2975 844 ----
NM_016057chr1261319 521 437 254 187 177 11030 --1181
NM_016059chr63819 720 275 --2356 175 --
NM_016061chr23552 398 144 21238 1098 2665 631 --
NM_016070chr17194 ------
NM_016072chr12142318 2175 2098 1911 1828 886 865 704 608 558 519 381 333 282 51938 1692 938 635 109 1896 --
NM_016073chr152819 189 ------
NM_016075chr13112671 2588 2516 2412 2338 2326 2007 902 840 784 25 22013 1963 12954 --
NM_016076chr183097 2904 2258 1956 1285 1001 984 243 32931 2910 128 22789 2314 --
NM_016078chr173903 851 111 ------
NM_016079chr272316 2252 2062 2043 2028 1702 547 --12122 --
NM_016081chr462084 2068 1956 1544 830 344 21423 834 11867 --
NM_016083chr663584 2631 1216 834 664 559 43491 1495 860 613 13839 --
NM_016087chr751600 1409 1136 591 197 11062 ----
NM_016090chr1151082 1052 772 336 317 1119 ----
NM_016096chr851778 1718 1594 1457 823 21959 844 ----
NM_016097chr185866 722 354 323 310 1907 --1358
NM_016098chr6----1199 --
NM_016099chr841406 1245 455 270 ------
NM_016103chr51475 ------
NM_016107chr56870 511 456 405 235 130 2899 60 ----
NM_016120chrX3793 283 78 ----1328
NM_016122chr12189 ------
NM_016124chr151473 1445 1325 1314 1045 ------
NM_016127chr82652 143 2684 49 ----
NM_016129chr4----137 --
NM_016131chr272003 1922 1514 739 547 145 50 31763 1502 185 2757 534 --
NM_016132chr15143377 2839 2806 2731 2724 2529 2514 1303 1264 1041 970 505 348 259 32410 1103 384 12151 12800
NM_016133chr231204 491 484 11023 ----
NM_016138chr1651395 284 267 182 166 11402 ----
NM_016139chr72274 244 ------
NM_016141chr31763 ----1101
NM_016144chr53624 293 133 3628 196 24 ----
NM_016147chr111451 --1946 --
NM_016151chr162336 315 ------
NM_016152chr341134 996 986 358 --11274 --
NM_016156chr1181975 1968 1872 1497 1469 934 874 477 2530 486 ----
NM_016169chr1053250 2473 2362 727 493 --1497 --
NM_016192chr22245 201 ------
NM_016200chr73273 205 169 ------
NM_016201chr382023 2000 1646 1453 658 512 269 216 ------
NM_016203chr72838 125 21042 281 ----
NM_016205chr431121 1011 327 1584 ----
NM_016206chr3318745 8585 8113 8050 6961 6859 6456 6436 6263 6232 5880 5774 5713 5615 5456 5442 3327 2278 1846 1683 1602 1504 1254 1212 1111 1042 613 607 361 152 75 45840 3491 2988 1585 47715 7274 3380 2983 18660
NM_016213chr151156 ------
NM_016217chr693536 2794 2728 2328 1473 1427 1398 1034 837 1582 1382 --
NM_016218chr53923 174 68 2488 364 ----
NM_016221chr552295 2228 2078 1925 669 11931 1626 --
NM_016224chr681803 1786 1747 1704 1525 1366 417 71 11471 --11693
NM_016227chr1111366 1308 1270 1163 1120 1066 430 345 136 47 33 1243 1414 --
NM_016230chr64545 170 161 122 ------
NM_016231chr1731079 1053 322 11273 ----
NM_016235chr1631135 1092 66 --11389 --
NM_016247chr31509 2355 151 ----
NM_016248chr13173996 3962 3832 3720 3444 3280 3224 2746 2443 1482 1441 1403 777 570 544 308 212 24017 3171 --12601
NM_016252chr24943 799 783 184 1201 ----
NM_016255chr663086 3018 2261 1238 280 260 --13240 --
NM_016258chr15775 741 312 300 86 1734 ----
NM_016260chr2307584 6915 6850 6839 6766 6731 6527 6510 6307 6289 6228 5744 5625 5330 5184 4984 4862 4790 2996 2481 2350 2211 2091 1563 1422 1372 1158 877 699 678 97045 6920 5025 2710 2369 1257 1067 478 221 27335 1305 --
NM_016262chr65633 593 577 46 27 2396 96 1505 1509
NM_016263chr1911354 ------
NM_016271chr1872125 1784 1729 1690 659 621 272 32353 588 296 --32048 1941 1556
NM_016272chr2292632 2527 2346 2330 2216 853 767 266 249 22638 2376 2789 253 --
NM_016274chr1171 ------
NM_016275chr382730 2709 2578 844 642 365 311 122 ------
NM_016277chr631548 1262 375 11491 ----
NM_016281chr1221050 1003 21127 972 21091 968 --
NM_016282chr961479 1404 1117 342 302 101 11559 ----
NM_016284chr163961 623 282 ------
NM_016287chr1112067 1894 1719 1655 1615 1603 1492 1480 1426 319 313 1641 1264 --
NM_016289chr282312 2287 1907 1550 798 767 644 555 2144 124 ----
NM_016299chr10------189
NM_016300chr31443 127 ----
NM_016303chrX2378 50 ------
NM_016304chr152749 21 ------
NM_016306chr3--1389 ----
NM_016308chr181850 1539 1272 603 436 305 158 72 11452 1374 --
NM_016315chr251599 1465 1453 1421 383 11349 ----
NM_016316chr24639 594 137 110 1696 1530 --
NM_016322chr9122837 2747 2661 2144 1122 1015 967 610 521 380 236 64 12148 ----
NM_016323chr4--1261 ----
NM_016328chr72142 101 ------
NM_016329chr32496 397 --1401 --
NM_016331chr36850 689 342 246 121 54 ------
NM_016333chr164469 193 156 150 --2517 62 --
NM_016338chr52399 358 ------
NM_016339chr171698 --41250 509 406 383 --
NM_016340chr53956 820 321 31307 1257 325 ----
NM_016351chr72499 168 ------
NM_016357chr1241220 1156 935 142 1216 11031 --
NM_016374chr161296 1271 391 155 122 54 11144 ----
NM_016374chr161296 1271 391 155 122 54 11144 ----
NM_016376chr17143981 3783 3599 3493 3462 3130 1524 1513 1421 1282 1065 800 580 517 34138 4023 3813 12739 --
NM_016377chr631455 1121 668 21727 1421 11614 11449
NM_016395chr1561731 1371 494 366 66 24 1309 ----
NM_016396chr15103042 2786 2407 2244 2066 1978 1158 482 459 119 12537 ----
NM_016403chr115620 584 289 76 58 1137 1133 --
NM_016404chr112147 22 ------
NM_016410chr97600 453 204 180 145 107 98 1648 ----
NM_016418chr2263542 3139 2829 1348 1326 1316 12450 23741 48 12517
NM_016422chr1182716 2691 2482 1254 925 707 351 272 ------
NM_016424chr1791791 1776 1519 792 494 374 334 310 70 21782 801 12028 --
NM_016436chr2041768 766 416 268 12558 ----
NM_016441chr2112133 1713 956 930 777 755 690 673 569 406 212 32366 2142 1553 1959 --
NM_016442chr552279 1961 929 773 311 32157 2108 1481 --12291
NM_016447chr71209 ------
NM_016467chr261429 1113 981 946 535 45 ------
NM_016470chr202162 136 ------
NM_016475chr1421238 1188 2406 275 11242 --
NM_016480chr52792 302 1884 ----
NM_016488chr1261963 1642 1463 1366 763 733 --11646 --
NM_016497chr12----1117 --
NM_016499chr112517 493 1125 ----
NM_016500chrX3279 234 217 ------
NM_016506chr112535 164 ----1641
NM_016507chr17133169 2820 2268 2059 1964 1281 1253 926 759 622 549 453 415 32824 2548 920 1594 --
NM_016513chr6143758 2656 2610 2376 2333 1110 682 548 512 315 244 199 152 126 ------
NM_016516chr22674 266 1237 ----
NM_016519chr44549 359 168 70 ------
NM_016521chrX5308 268 238 89 57 1272 ----
NM_016522chr1161538 1530 1199 1191 588 235 ------
NM_016525chr92622 101 1960 ----
NM_016530chr15154107 3921 3769 3728 3695 3266 3227 2824 1503 918 819 743 717 282 243 2588 580 23424 503 1192
NM_016531chr4114071 3596 3356 3234 2554 1038 1011 578 260 235 225 22788 530 11014 --
NM_016538chr171450 ------
NM_016539chr193501 50 30 --153 --
NM_016542chrX61434 1372 1323 475 404 275 11508 11130 --
NM_016557chr34936 841 781 682 ------
NM_016559chr371504 1491 1428 1092 1073 1049 310 --1427 11432
NM_016569chr1291534 1517 1322 1314 1161 625 582 372 175 ------
NM_016570chr123310 52 30 ------
NM_016575chr1294503 4262 4246 4231 4030 3719 2142 1562 246 11556 13723 --
NM_016578chr113656 211 84 --1215 --
NM_016584chr12--1283 ----
NM_016588chr63171 153 82 ------
NM_016598chr341511 1342 204 116 11432 ----
NM_016603chr551645 1381 405 354 337 --21564 418 11914
NM_016604chr541206 827 816 328 --1830 --
NM_016605chr551913 1718 795 780 586 22277 707 12326 --
NM_016607chrX51479 1324 1316 251 214 ------
NM_016612chr83575 459 26 --1240 --
NM_016617chr1382132 2047 1947 1928 1868 1384 524 144 ------
NM_016618chr23416 396 88 1106 ----
NM_016620chr141348 1216 1202 56 ------
NM_016621chr11153903 3869 3476 2877 1563 1252 1047 1002 970 653 347 242 178 114 105 31089 1011 983 13413 --
NM_016622chr231745 689 613 --1502 --
NM_016623chr85669 530 478 138 113 --1162 1411
NM_016625chr3179 ------
NM_016626chr1851755 1187 1138 516 93 11320 --1433
NM_016628chr103641 353 200 1564 ----
NM_016631chr212374 76 2204 154 ----
NM_016640chr51117 ------
NM_016644chr52430 386 1456 ----
NM_016649chr203483 451 138 --1118 --
NM_016651chr143983 111 40 ------
NM_016654chr1521036 300 11241 21226 1185 11371
NM_016656chrX1108 ------
NM_016818chr214847 817 801 567 --1805 --
NM_016824chr1051723 1447 1316 1274 633 1662 ----
NM_016830chr122466 404 ------
NM_016831chr1112381 2193 2104 1871 1824 885 741 221 147 116 61 ------
NM_016834chr1734008 3046 306 12984 ----
NM_016835chr1734008 3046 306 12984 ----
NM_016836chr24767 560 543 69 ------
NM_016839chr24767 560 543 69 ------
NM_016841chr1734008 3046 306 12984 ----
NM_016848chr9------1111
NM_016936chr1662114 1931 1908 1553 823 105 1715 ----
NM_016946chr153583 3487 1183 1097 247 33660 3022 2827 1131 --
NM_016950chr421489 1118 1276 178 --
NM_016954chrX1117 151 ----
NM_017409chr12183 ------
NM_017410chr1241279 1169 1141 850 ------
NM_017412chr841431 924 149 56 ------
NM_017413chrX32533 2515 854 --31811 680 283 --
NM_017420chr14133831 3114 3086 2637 2627 2458 1054 1006 990 809 739 196 26 43312 3305 934 919 --21380 503
NM_017423chr441577 513 454 235 --1315 --
NM_017425chr11274 58 ------
NM_017426chr43648 107 43 ------
NM_017440chr125513 435 189 89 47 2235 51 ----
NM_017444chr871630 1459 1267 1219 496 144 131 ----1105
NM_017447chr21134337 4060 4036 3841 3435 3331 2725 1585 1562 1500 1055 666 212 53034 2991 2902 2839 1630 23347 801 --
NM_017449chr11586 ------
NM_017450chr1761449 1431 1004 984 429 108 ------
NM_017452chr2041428 1297 600 332 ------
NM_017453chr2041428 1297 600 332 ------
NM_017454chr2041428 1297 600 332 ------
NM_017455chr156864 796 699 681 246 240 1886 ----
NM_017459chr1175 ------
NM_017481chr11----145 --
NM_017483chr231231 1064 421 ------
NM_017489chr82369 118 1185 ----
NM_017491chr43864 626 172 ----1869
NM_017514chrX2932 910 ------
NM_017519chr66863 308 298 279 236 229 31196 936 287 --1868
NM_017520chr133582 221 76 ------
NM_017522chr151032 900 382 231 205 ----11025
NM_017545chr202579 125 139 1508 --
NM_017548chr372050 1913 851 826 793 298 234 ------
NM_017551chr1062252 1832 765 440 129 56 42601 2444 2129 758 11764 --
NM_017558chr163404 55 25 --1444 --
NM_017563chr376123 5052 4640 1775 1544 1501 1012 45413 4800 4589 4159 22179 1294 --
NM_017567chr2185 ------
NM_017569chr134247 111 64 54 ------
NM_017577chr351266 629 550 200 138 31112 230 108 ----
NM_017578chr3192 ------
NM_017580chr1082356 2311 2038 1493 905 784 355 244 --12314 12221
NM_017582chr161821 1722 1523 1501 380 107 ------
NM_017588chr961946 1902 783 742 347 202 1326 ----
NM_017593chr44495 327 101 65 ----1499
NM_017594chr9113062 3004 2425 2411 2305 2195 2082 900 882 795 495 22060 703 31194 825 799 --
NM_017596chr184290 4081 3206 1295 1281 833 87 37 --44294 3934 120 117 --
NM_017599chr12112069 1856 1612 1513 1475 1318 671 572 563 379 304 1270 ----
NM_017602chrX1104 --3796 81 72 --
NM_017610chr155628 345 266 218 197 11672 1721 --
NM_017617chr941589 301 191 95 21582 370 ----
NM_017626chr1061763 1484 1259 1095 586 544 ------
NM_017628chr4214830 4633 4514 4503 4432 4052 3931 3626 3558 2060 1461 1147 1122 985 916 875 777 622 520 151 116 11161 24636 3306 --
NM_017629chr161794 1382 1335 1202 476 372 11798 ----
NM_017631chr43526 227 78 150 ----
NM_017632chr42356 103 ------
NM_017633chr6113959 3551 3448 2675 2658 2511 1369 1309 1295 953 375 23542 3009 ----
NM_017634chr892006 1976 1844 1557 1444 1226 589 174 60 11894 ----
NM_017635chr1151354 579 453 206 193 ------
NM_017637chr9299269 9060 8897 8121 7669 7579 7392 6660 6600 6408 5806 5744 3777 3265 3093 2432 2043 1960 1930 1847 1834 1828 1664 1146 1105 1082 906 587 456 67884 2304 2022 1218 827 204 48736 7069 6461 864 13440
NM_017640chr64201 155 93 79 1124 3592 120 117 --
NM_017641chr1211128 156 ----
NM_017643chr17103125 2929 2750 2574 2480 2235 1923 1030 401 302 2593 133 1463 --
NM_017644chr3165138 4863 4834 4712 4589 4143 3650 3504 3434 3339 1565 1404 1211 798 523 198 44916 4519 1971 1792 --14852
NM_017645chr9113044 2618 2349 2299 1930 1274 1212 447 320 265 185 43090 2879 561 109 13086 1148
NM_017649chr10--2351 272 --1962
NM_017650chr7146044 5723 5711 5371 5283 4922 3993 3967 3888 2273 2251 1838 1704 1119 35569 2277 1929 11472 --
NM_017655chr181371 1266 596 291 172 132 54 41 2362 320 --21338 609
NM_017657chr23301 241 39 ------
NM_017658chr14164599 4527 3943 3934 1752 1745 1713 1597 1534 1262 1196 775 503 446 327 100 2779 471 32883 1165 259 23428 903
NM_017660chr1982291 2284 1226 1145 940 934 905 248 ------
NM_017664chr136972 784 301 272 245 220 ------
NM_017666chrX152146 2107 2031 1970 1853 1808 1694 1626 877 519 386 348 340 254 217 3428 419 390 21706 318 --
NM_017668chr162810 535 --3147 144 96 --
NM_017670chr114779 761 341 70 --1106 --
NM_017672chr1531130 245 152 --11146 --
NM_017676chr531807 1399 260 --2431 223 --
NM_017679chr172590 555 --1545 --
NM_017680chr931013 657 221 21003 274 ----
NM_017691chr152423 384 ------
NM_017693chr1351544 1465 1280 1181 509 11330 ----
NM_017694chr241868 645 446 252 --12036 --
NM_017705chr1553773 3623 3487 2599 663 2744 343 1545 --
NM_017709chr1154180 4146 4073 3466 1694 1573 1074 1058 1023 905 854 817 703 137 125 23266 821 22786 1430 --
NM_017712chr19116117 5002 2347 2069 1249 647 575 555 539 507 203 12100 ----
NM_017714chr202634 91 ------
NM_017715chr7----1115 --
NM_017719chr332297 345 187 --11869 --
NM_017724chr33687 555 278 1694 ----
NM_017730chr33582 264 88 ------
NM_017737chr172162 2143 1964 1943 1923 1390 257 21466 482 11561 --
NM_017738chr951038 1026 808 383 41 --11042 --
NM_017741chr462621 1758 1731 911 835 774 1511 32720 2008 972 --
NM_017742chr1871965 1572 769 751 344 270 87 1130 2736 402 --
NM_017744chr142041 222 142 45 2973 228 ----
NM_017745chrX3661 276 167 1217 --1118
NM_017747chr51351 ------
NM_017748chr173778 712 314 --191 --
NM_017753chr961047 1027 995 919 313 237 ------
NM_017755chr53261 235 173 --154 --
NM_017757chr1851176 1109 882 836 342 ------
NM_017758chr1741470 1228 541 137 --1945 --
NM_017761chr131558 1091 456 --1262 --
NM_017762chr1571797 1781 1746 700 437 285 45 --2526 159 11732
NM_017768chr14986 727 661 306 1325 ----
NM_017769chr1472909 2746 2660 2385 2291 223 107 22830 2586 --2838 32
NM_017770chr642813 2460 960 103 --1862 --
NM_017772chr651591 1312 584 498 356 11091 ----
NM_017774chr62401 138 --1386 --
NM_017778chr881189 1172 1097 455 195 145 87 60 ----1150
NM_017779chr152505 1859 1105 493 220 --2496 404 --
NM_017780chr86876 848 740 278 271 242 ------
NM_017784chr341191 901 345 322 1354 1778 --
NM_017790chr9147 1656 1252 --
NM_017794chr91261 2230 70 ----
NM_017798chr2051235 933 899 362 123 --1170 --
NM_017801chr392622 2584 2247 2147 962 795 598 515 323 11007 1106 12155
NM_017810chr16156 ------
NM_017811chr982760 2696 2497 1970 1160 561 252 165 1226 23105 2775 22802 1138
NM_017812chr72533 61 ------
NM_017813chr8175066 5057 4942 4906 4565 3977 3955 3927 1952 1756 1728 1533 1384 1173 1158 564 114 23763 30 --11761
NM_017816chr4----144 --
NM_017824chr1052546 2425 2330 2211 413 32473 785 562 --1627
NM_017831chr18154742 4684 4639 4415 3337 3221 1667 1619 1382 1212 1085 1052 1001 919 911 43895 3486 1680 952 44745 3247 1635 1406 14375
NM_017845chr41523 ------
NM_017847chr1122 11441 ----
NM_017848chrX104686 4484 4381 4038 3799 3755 3388 702 468 363 --24545 2926 1497
NM_017849chr293230 2968 2911 2866 2271 2192 2104 2001 824 --43097 2833 2277 2036 --
NM_017857chr11--1655 1620 --
NM_017860chr11579 1133 1297 --
NM_017880chr22467 183 ------
NM_017893chr101124 --11479 11374
NM_017906chr62100 75 ------
NM_017907chr111486 ------
NM_017910chr21320 2304 267 ----
NM_017913chr92361 67 ------
NM_017915chr124998 750 332 248 ------
NM_017919chr9195624 5436 5408 5306 5261 5093 4436 3750 3623 3591 3550 1639 1414 1395 1140 1098 821 765 345 15501 21514 1032 12053
NM_017921chr1731879 409 381 ------
NM_017922chr142259 210 ------
NM_017923chr41126 124 --1328
NM_017925chr921279 76 21247 267 ----
NM_017926chr145926 892 306 183 151 ------
NM_017933chr251552 1203 1155 650 260 31618 1596 1220 ----
NM_017938chrX31911 1849 1809 ----1319
NM_017944chr1173020 2999 2194 2090 2049 958 803 --1306 --
NM_017946chr751050 981 169 122 89 21082 236 ----
NM_017953chr14851 295 254 111 ------
NM_017954chr771567 1486 1128 652 324 297 192 1124 31708 1494 656 --
NM_017957chr1721247 233 ------
NM_017958chr273006 2949 2877 2662 2556 1151 291 22126 2065 22881 400 1416
NM_017964chr23873 781 351 2757 235 ----
NM_017972chr145926 892 306 183 151 ------
NM_017974chr221052 1020 ------
NM_017987chr10112186 2034 1939 1788 1660 1590 1540 690 647 481 307 21507 182 ----
NM_017988chr124727 693 298 202 ------
NM_017990chr1694197 4056 3115 1690 1631 1583 1409 409 161 23575 696 2731 224 14227
NM_017994chr752794 1859 1157 1145 959 --52735 1865 1166 963 520 --
NM_017998chr92985 941 11406 ----
NM_018003chr1562437 2187 789 541 520 55 1764 --1170
NM_018004chr33164 40 23 ------
NM_018011chr133171 158 21 1233 ----
NM_018014chr221127 892 1439 --1971
NM_018017chr10112651 2344 2082 2042 2033 1902 1767 786 606 322 88 32354 901 630 ----
NM_018018chr1251846 1737 1263 1229 21 21741 1498 21888 25 21186 768
NM_018023chr321924 600 ------
NM_018025chr191245 ------
NM_018026chr1141458 1307 1019 996 11436 ----
NM_018027chr1073248 2801 2283 2241 773 756 222 12740 ----
NM_018028chr1931007 986 122 --11019 --
NM_018030chr182272 70 ------
NM_018036chr14124352 3906 3599 3466 3401 2972 2738 1448 1046 877 655 359 23419 905 23853 3683 24217 3604
NM_018037chr13259 199 150 1500 ----
NM_018045chr152987 2966 2451 1991 997 23007 634 12713 22386 864
NM_018046chr541466 1387 575 64 ------
NM_018047chr52626 80 1738 ----
NM_018051chr71356 ------
NM_018054chr162639 72 1218 ----
NM_018056chr11143 ------
NM_018061chr131777 1517 57 11496 ----
NM_018070chr12445 197 ------
NM_018071chr141104 ------
NM_018078chr47937 423 412 380 289 182 74 ----1294
NM_018079chr21149 ------
NM_018084chr2143056 2873 2837 2811 1319 1287 1264 1160 987 895 820 752 741 567 53265 2877 2229 772 362 13035 13061
NM_018085chr1127861 7719 7162 7062 6875 6493 6487 1498 878 697 243 85 21962 1553 17864 13233
NM_018086chr271821 1811 1652 1626 1609 1504 599 --11329 --
NM_018087chr11214 ------
NM_018092chr1691325 1098 1074 1040 1019 588 465 409 388 21364 392 ----
NM_018094chrX1312 2305 99 ----
NM_018095chr112535 164 ----1641
NM_018098chr33989 909 143 11054 ----
NM_018103chr12350 261 ------
NM_018105chr841173 1098 785 443 1955 ----
NM_018112chr98960 946 866 801 709 138 71 40 1351 --1681
NM_018117chr103688 503 285 ------
NM_018119chr16----1228 --
NM_018120chr881331 1255 999 508 485 385 348 233 1436 ----
NM_018121chr10113131 3121 3059 2506 2429 2186 1193 1181 910 733 330 --13212 --
NM_018125chr1--1164 ----
NM_018126chr41152 ------
NM_018128chr172174 131 1432 ----
NM_018131chr101843 1871 ----
NM_018133chr342147 1705 1542 604 11863 ----
NM_018144chr101105 ------
NM_018150chr11608 ------
NM_018151chr26763 743 507 306 189 48 2232 196 ----
NM_018157chr1243178 838 448 307 53293 3252 2155 1295 509 --12928
NM_018159chrX61452 1316 364 296 241 124 ------
NM_018169chr12141 2471 398 ----
NM_018171chr1261016 749 391 339 254 230 ------
NM_018178chr161945 1537 826 815 379 109 11710 11853 --
NM_018179chr122540 107 ------
NM_018181chr1891868 1647 1588 1336 1306 1257 420 294 222 1313 ----
NM_018184chr3102087 1608 1601 1456 1380 779 757 612 221 30 ----1116
NM_018191chr1382085 2053 1953 1610 1534 553 174 117 22014 1748 2836 288 --
NM_018195chr1181952 1925 1909 1863 1832 1805 217 178 31986 1901 736 ----
NM_018199chr1451127 1104 436 356 213 ------
NM_018200chr1592577 2423 2415 2047 1907 603 538 423 405 11603 --1932
NM_018201chr912543 12478 ----
NM_018202chr13854 228 182 1339 --1685
NM_018206chr161118 ------
NM_018208chr111178 ------
NM_018211chr142179 1544 1424 376 11820 ----
NM_018214chr661297 1218 836 500 432 422 ------
NM_018221chr22452 301 2481 327 ----
NM_018222chr1171931 1763 1756 1285 661 587 509 --11170 --
NM_018227chr4112663 2470 2374 2009 1976 1965 1207 1165 912 906 387 22944 758 ----
NM_018240chr11312 --2217 112 1929
NM_018241chr451015 857 803 299 207 1819 ----
NM_018243chr4123919 3755 3454 3167 3094 2533 1572 1562 1516 1363 414 247 63963 3651 3503 2504 928 77 23175 784 --
NM_018247chr653090 2963 2417 2108 254 --22112 150 12599
NM_018254chr162172 1766 1679 571 432 409 4952 438 331 163 21660 553 --
NM_018257chr20112504 2477 2322 1901 1806 989 968 798 530 280 142 42601 2510 855 622 1284 --
NM_018264chr73934 758 196 --1824 --
NM_018270chr202757 727 ------
NM_018279chr1292971 2891 2847 2463 1097 902 778 578 221 31163 978 857 11076 1621
NM_018286chr171758 1908 --2872 176
NM_018287chr1071358 1299 1197 465 358 332 116 --1469 --
NM_018290chr431165 836 416 11024 ----
NM_018293chr342640 2349 2333 439 --12352 --
NM_018294chr104922 324 234 51 ------
NM_018299chr872835 2739 1371 1236 1051 990 867 33383 3219 1067 43418 2823 2704 2701 --
NM_018302chr41655 ------
NM_018307chr171944 ------
NM_018312chr1162206 2047 1980 1353 554 449 1420 --11507
NM_018313chr372665 2641 2133 568 549 352 288 22254 1936 11911 1724
NM_018314chr112615 289 ----1666
NM_018315chr481586 1420 1106 1031 543 477 374 309 31618 636 302 ----
NM_018317chr4--138 ----
NM_018318chr123186 176 92 ----1191
NM_018319chr1431595 1279 196 --165 --
NM_018320chr113866 241 199 1803 1411 --
NM_018321chr5--127 1155 --
NM_018323chr441176 756 645 355 21840 1613 11340 --
NM_018325chr931559 1145 398 ------
NM_018326chr74543 327 316 231 --1749 --
NM_018330chr1051280 1057 515 447 335 31631 1615 1377 1476 --
NM_018332chr1631361 537 229 ------
NM_018335chr142207 132 --1403 --
NM_018339chr951880 1680 1491 1195 669 11500 ----
NM_018340chr1675078 4971 4694 4530 4412 3771 3420 24628 1453 11413 1726
NM_018348chr1661257 1068 1033 956 360 36 21122 963 ----
NM_018351chr1294686 4047 3707 3337 3256 2953 2932 1871 336 31608 265 178 22874 1011 --
NM_018360chrX2120 92 --1100 --
NM_018362chr11112946 2890 2830 2633 2483 1434 819 397 335 298 183 74005 3836 3126 1495 593 440 358 --1249
NM_018364chr1134104 4065 4025 3839 3572 2633 2513 1310 1109 603 558 153 34 33665 3576 3508 --1270
NM_018367chr1172295 2188 2102 2090 1571 373 289 1561 1334 --
NM_018368chr61253 ------
NM_018371chr851050 637 614 583 157 11380 134 --
NM_018373chr14156108 5396 5312 5281 5033 4834 4365 2352 1789 1636 1185 1032 487 381 322 1155 14663 --
NM_018374chr7114879 4759 4084 3983 3784 3662 3428 1730 1559 1162 435 44883 4474 3736 1260 ----
NM_018383chr221901 53 21797 556 1259 --
NM_018386chr133276 147 137 --160 --
NM_018387chr93137 85 72 ------
NM_018394chr351583 572 268 241 90 1223 ----
NM_018398chr31327 ------
NM_018401chr481903 1882 1539 1489 1402 1390 1333 1295 31680 1483 1465 ----
NM_018403chr393803 3621 3492 3159 1445 1212 1132 589 131 44082 3680 3519 2706 12555 12639
NM_018413chr123242 102 34 ------
NM_018416chr12122634 1767 1668 1643 1026 890 856 220 210 189 124 117 --22326 962 --
NM_018424chr931505 1268 299 11711 ----
NM_018425chr1072585 2329 2316 2237 1036 921 559 ------
NM_018426chr63606 594 394 ------
NM_018429chr5102874 2664 2433 2390 2099 1840 941 595 104 22 1108 32673 1132 392 1445
NM_018433chr21501 --196 --
NM_018434chr5--1119 ----
NM_018439chr18112572 2539 2300 1850 1048 801 776 684 470 368 141 21889 1731 ----
NM_018440chr8278702 8046 7873 7770 7548 7533 7344 7319 7304 7070 6800 6446 6112 3397 3337 3110 2835 2397 1905 1827 1802 1275 1226 748 674 392 54 57861 6832 2761 2220 1494 37774 1559 440 --
NM_018441chr24824 247 102 69 ------
NM_018442chr13122 115 66 170 ----
NM_018444chr852148 1755 1681 903 578 2510 391 1267 1237
NM_018445chr151569 ------
NM_018448chr12111081 1061 931 872 845 827 437 419 358 149 115 --1423 --
NM_018449chr9------1314
NM_018451chr133892 158 41 ------
NM_018462chr34623 565 328 122 1130 ----
NM_018469chr1721322 109 1374 --1402
NM_018471chr22579 68 --1519 --
NM_018472chrX1110 ------
NM_018475chr45664 563 555 253 212 ------
NM_018477chr144860 774 272 151 11054 ----
NM_018482chr862577 2333 2104 2060 1929 1028 22549 1980 22336 2063 --
NM_018489chr1112246 2065 2037 1960 1734 1633 1490 726 538 329 215 22075 1744 21497 500 --
NM_018490chr1141760 1531 696 289 ------
NM_018509chr1741713 1218 665 83 1489 --1158
NM_018534chr24617 202 190 73 --1196 --
NM_018553chr1761694 1614 1332 1278 590 290 --11561 --
NM_018557chr241484 1347 413 328 21657 108 2459 116 11613
NM_018566chr1194960 4934 4712 4339 4054 3973 3602 3468 3361 3351 2058 1943 1720 1497 1397 977 928 889 520 21010 932 24329 1285 11556
NM_018569chr491560 1550 1489 1331 1174 1151 1031 380 86 --1484 --
NM_018571chr22571 250 --2480 57 --
NM_018584chr141172 969 422 327 --1825 --
NM_018590chr101118 1110 11335 --
NM_018593chr6137 ------
NM_018602chr1541640 1209 154 144 --11502 --
NM_018638chr12165649 5617 5375 4944 4370 4064 3920 3843 3519 1994 1798 614 442 327 258 54 13847 ----
NM_018640chr12112808 2796 2341 2332 2244 2074 1846 866 770 54 45 --32302 936 368 1814
NM_018649chr104593 522 206 64 ------
NM_018650chr161929 1899 1650 1560 730 355 22149 2115 ----
NM_018652chr154871 694 267 42 ------
NM_018657chr33848 254 204 1112 ----
NM_018658chr17101706 1668 1623 1612 1583 1464 643 248 187 79 --31659 1449 805 --
NM_018660chr8122586 2427 2376 2131 2113 950 909 741 593 432 379 208 22575 2335 33007 2431 662 --
NM_018667chr1682817 2757 2660 2641 2601 2587 852 235 1353 22820 964 --
NM_018672chr173735 348 121 2651 169 136 2253 44
NM_018682chr77669 548 272 232 152 137 79 ------
NM_018683chr2021650 646 11440 ----
NM_018684chrX21225 157 ------
NM_018685chr751122 965 752 400 321 11048 11026 --
NM_018689chr1572635 2565 2465 2447 2405 2209 891 --22594 2155 --
NM_018691chr561108 1034 966 953 302 189 2988 814 ----
NM_018695chr552390 2060 664 444 427 1859 11751 11980
NM_018697chr752378 2253 1508 369 236 ----1202
NM_018699chr42336 284 ------
NM_018703chr161384 ------
NM_018704chr12671 197 11620 ----
NM_018710chr831000 903 229 ------
NM_018711chr1221497 455 --1459 --
NM_018712chr1121281 280 11100 ----
NM_018718chr741866 1785 1515 35 32271 2224 1756 ----
NM_018719chr731210 920 114 ------
NM_018724chr11650 ------
NM_018728chr1541479 1069 518 276 131 127 --
NM_018834chr5267 46 ------
NM_018837chr203952 754 254 ------
NM_018840chr201180 ------
NM_018841chr1123762 3623 3606 3237 2842 2667 2584 2434 1471 1039 501 275 22674 404 22936 2533 11475
NM_018844chr742042 1829 824 620 ------
NM_018845chr11195 ------
NM_018846chr74882 644 261 147 ----1863
NM_018847chr961938 1879 698 470 236 69 ------
NM_018890chr751193 967 257 145 127 1273 ----
NM_018897chr2281 33 ------
NM_018898chr532267 1633 797 --185 --
NM_018899chr532267 1633 797 --185 --
NM_018900chr532267 1633 797 --185 --
NM_018901chr532267 1633 797 --185 --
NM_018902chr532267 1633 797 --185 --
NM_018903chr532267 1633 797 --185 --
NM_018904chr532267 1633 797 --185 --
NM_018905chr532267 1633 797 --185 --
NM_018906chr532267 1633 797 --185 --
NM_018907chr532267 1633 797 --185 --
NM_018908chr532267 1633 797 --185 --
NM_018909chr532267 1633 797 --185 --
NM_018910chr532267 1633 797 --185 --
NM_018911chr532267 1633 797 --185 --
NM_018912chr521795 1763 1682 11392 11239
NM_018913chr521795 1763 1682 11392 11239
NM_018914chr521795 1763 1682 11392 11239
NM_018915chr521795 1763 1682 11392 11239
NM_018916chr521795 1763 1682 11392 11239
NM_018917chr521795 1763 1682 11392 11239
NM_018918chr521795 1763 1682 11392 11239
NM_018919chr521795 1763 1682 11392 11239
NM_018920chr521795 1763 1682 11392 11239
NM_018921chr521795 1763 1682 11392 11239
NM_018922chr521795 1763 1682 11392 11239
NM_018923chr521795 1763 1682 11392 11239
NM_018924chr521795 1763 1682 11392 11239
NM_018925chr521795 1763 1682 11392 11239
NM_018926chr521795 1763 1682 11392 11239
NM_018927chr521795 1763 1682 11392 11239
NM_018928chr521795 1763 1682 11392 11239
NM_018929chr521795 1763 1682 11392 11239
NM_018932chr51731 1131 ----
NM_018945chr673566 3164 3101 2706 2402 1470 522 33726 3105 1446 11476 --
NM_018948chr131032 942 258 1569 ----
NM_018951chr741301 509 177 170 128 ----
NM_018958chr1583383 3357 3315 3176 3034 2973 2706 2610 14080 13604 --
NM_018959chr193289 276 180 --1280 --
NM_018970chr741004 950 708 599 22818 245 1944 --
NM_018976chr12132470 2073 2010 986 969 773 693 622 595 498 386 153 128 22627 2354 --11067
NM_018979chr1292573 2119 1836 550 494 485 468 220 119 --22423 798 --
NM_018981chr221014 268 11035 1175 21377 1159
NM_018992chr1641623 257 137 111 --21353 576 --
NM_018993chr2041380 431 421 333 --1425 --
NM_018994chr12493 396 ------
NM_018999chr10164838 4554 4526 4197 4160 3849 3417 3207 3196 3172 3161 1904 1363 1292 756 372 14594 --1106
NM_019000chr551472 1386 1065 544 331 3457 348 338 1334 --
NM_019001chr3184416 4324 4143 4136 3933 3659 3534 3343 3331 3131 3078 3033 1242 914 856 471 50 30 44596 1565 1190 127 24440 3463 --
NM_019002chr2170 ------
NM_019004chr762409 1979 1648 1641 491 219 1409 ----
NM_019006chr154640 585 502 67 1464 ----
NM_019008chr2283009 2745 2648 2496 1403 715 384 244 23013 1495 13726 --
NM_019022chr18143218 3076 2892 2865 2725 2665 2636 2197 2172 1189 1162 857 822 576 --1477 --
NM_019026chr13586 272 32 ------
NM_019027chr432437 1916 336 12618 21793 873 --
NM_019030chr52232 181 ------
NM_019035chr451639 1293 630 454 273 31899 1612 444 ----
NM_019040chr112194 79 ------
NM_019042chr721057 905 ------
NM_019045chrX3619 588 88 2672 594 1738 --
NM_019049chr11125 --1529 --
NM_019050chr462265 1840 1757 1587 862 501 --11763 --
NM_019053chr101329 2838 218 ----
NM_019057chr52327 72 1337 ----
NM_019059chr71371 ------
NM_019063chr24663 571 429 417 41959 1790 354 133 --1554
NM_019071chr71514 ------
NM_019072chr584039 3789 3679 3475 3467 3453 3420 1504 ------
NM_019074chr15--192 ----
NM_019080chr1361477 1420 1307 1086 613 29 21539 181 ----
NM_019083chr161583 1472 1421 451 380 150 ------
NM_019084chr1042391 1827 661 149 ------
NM_019087chr541582 1289 1161 623 ----11574
NM_019091chr24822 292 231 85 1724 ----
NM_019094chr1253802 3572 2860 809 160 42601 2392 1430 141 156 13837
NM_019096chr61310 --2758 407 --
NM_019098chr851864 1799 1767 376 278 11379 21770 380 11804
NM_019113chr19174 ------
NM_019114chr972386 2311 2207 1901 1563 785 197 32152 441 427 22426 54 --
NM_019116chr16143568 3562 3226 3013 2980 2812 2544 2514 2459 606 538 461 455 207 --42745 1218 1000 609 1548
NM_019117chrX102930 2692 2682 2345 1256 1242 1133 987 663 86 33199 3166 2352 22348 89 --
NM_019555chr321676 1548 ----193
NM_019556chrX41145 940 297 238 11013 ----
NM_019557chr13754 602 286 ------
NM_019590chr1051473 1374 1240 519 181 1364 ----
NM_019592chr94822 659 605 289 --1293 --
NM_019593chr2043094 2164 1119 565 31195 1034 61 ----
NM_019594chr91357 ------
NM_019597chrX4611 572 173 163 1155 ----
NM_019600chr153701 519 198 ------
NM_019604chr1151146 1080 1040 384 368 ------
NM_019605chr12253 186 ------
NM_019606chr72141 117 ------
NM_019610chr152174 2068 1517 308 115 ------
NM_019843chr222473 380 1451 ----
NM_019852chr14185 ----190
NM_019859chr1031419 182 104 11292 11395 --
NM_019860chr1031467 230 152 11340 11443 --
NM_019862chr1641787 1680 1632 1379 11514 ----
NM_019884chr192396 182 ------
NM_019885chr222428 1168 12611 ----
NM_019891chr141305 1092 872 441 ------
NM_019895chr361147 1125 938 768 726 383 ------
NM_019898chr1641787 1680 1632 1379 11514 ----
NM_019899chr1641787 1680 1632 1379 11514 ----
NM_019900chr1641787 1680 1632 1379 11514 ----
NM_019903chr1051723 1447 1316 1274 633 1662 ----
NM_020062chr202994 222 ------
NM_020064chr92722 700 ------
NM_020066chr17973 840 797 643 222 127 103 ------
NM_020069chr111179 1236 ----
NM_020116chr461700 1688 1606 1484 1171 361 --11775 --
NM_020120chr251545 1400 378 254 67 ------
NM_020122chr2105563 5201 4176 1918 1852 1506 1162 1072 788 541 64282 2315 1733 1640 1463 810 12311 --
NM_020123chr1091139 1009 559 537 530 519 451 177 37 11095 11118 142
NM_020127chr181835 1800 1539 1339 1245 1222 482 276 21543 1141 ----
NM_020132chr2165110 4771 4048 4040 1414 101 --34355 4352 3528 15163
NM_020135chr63330 157 37 1337 ----
NM_020139chr461925 1616 1291 492 435 125 41442 1317 344 160 ----
NM_020141chr152426 2363 2153 799 503 1326 2424 395 --
NM_020143chr22864 304 2925 383 1118 --
NM_020144chr751988 1780 1741 1562 667 42029 1317 685 646 11784 --
NM_020147chr1541058 982 772 215 ------
NM_020148chr1842848 2348 2328 572 32026 916 295 11030 --
NM_020150chr1052048 1917 1904 424 385 11586 1835 11644
NM_020152chr212258 236 --1970 1974
NM_020159chr461707 1638 1210 444 147 105 11159 ----
NM_020168chr1521291 1243 ------
NM_020177chr5153203 3072 2827 2459 1333 1317 1309 1157 870 746 718 704 615 450 366 53295 2281 1166 731 722 33215 1296 379 --
NM_020178chr1761193 1056 884 822 427 79 1138 197 --
NM_020179chr112457 166 --1417 --
NM_020180chr181529 1196 ----
NM_020182chr2093653 3299 3221 2367 1004 322 283 228 62 11399 11013 --
NM_020184chr242048 380 350 282 ------
NM_020189chr81146 ------
NM_020193chr1141033 896 196 160 --1261 --
NM_020194chr22593 125 --167 1524
NM_020198chr1761322 1113 1019 481 379 211 ------
NM_020199chr551101 962 942 466 49 11282 1272 --
NM_020204chr15820 807 673 90 34 1693 143 --
NM_020205chr1113480 3336 3329 2963 2819 2242 2204 1095 1073 1010 520 1409 11144 --
NM_020226chr44709 650 500 297 1790 ----
NM_020228chr1142363 1770 572 388 21013 692 91969 1966 1963 1960 1957 1954 1951 1948 1945 --
NM_020231chr34691 669 272 207 ------
NM_020239chr142195 1926 1711 651 32340 1981 1952 12209 --
NM_020240chr5132763 2667 1829 1758 1698 910 854 838 502 273 256 220 159 --21907 869 --
NM_020243chr221613 ----1877
NM_020245chr6185070 4935 4701 4690 4536 4478 4417 4171 3875 3352 1907 1869 1710 1494 978 348 268 207 --34694 218 210 --
NM_020246chr71368 ------
NM_020251chr114644 512 101 85 --170 --
NM_020307chr34441 376 149 109 ------
NM_020336chr20113662 3415 3342 3009 2671 2562 1259 596 503 385 249 13403 --11264
NM_020337chr4112892 2882 2715 2049 1203 1142 669 586 461 391 246 32163 2018 50 11207 --
NM_020338chr1053748 2833 1017 920 377 ------
NM_020341chr20111948 1936 1850 1632 1462 1267 650 561 451 402 162 2591 245 ----
NM_020342chr252425 2206 821 732 697 32576 2082 1641 ----
NM_020346chr1141756 1408 1277 664 11611 ----
NM_020347chr392273 2246 2214 1886 1860 1737 811 549 106 21516 255 --12056
NM_020348chr1062541 1935 1088 990 388 337 12710 2993 330 1997
NM_020353chr3101951 1850 1751 1585 1539 1477 1394 507 343 98 22039 1894 12029 --
NM_020354chr105894 760 713 312 68 ------
NM_020357chr361588 1201 494 273 99 61 ----1111
NM_020362chr11795 --1798 --
NM_020379chr11326 --1141 --
NM_020382chr121246 ----143
NM_020383chr102145 111 --2290 95 --
NM_020390chr3174676 4656 4467 4400 4354 4076 3955 3844 3649 3180 3115 1419 1324 1085 916 617 107 23486 3058 ----
NM_020401chr12178 ------
NM_020403chr1331635 668 373 --1632 --
NM_020416chr452622 1932 499 351 294 1373 22692 2256 --
NM_020418chr32420 160 1569 ----
NM_020420chrY11879 1256 21395 1382 --
NM_020423chr12507 43 ------
NM_020425chr672002 1913 1623 662 217 187 88 1666 1190 --
NM_020426chr172102 69 163 173 --
NM_020431chr1412723 1748 22039 678 --
NM_020432chr772285 1726 1560 722 432 170 83 21651 383 --11786
NM_020438chr941338 1217 1167 126 ------
NM_020440chr1143211 3081 3029 2962 2767 2635 2596 2129 1169 649 609 589 279 250 1376 1194 --
NM_020443chr1156651 6473 6045 5717 5158 4746 2694 1517 985 909 895 889 853 819 291 26509 1346 36488 2574 901 14750
NM_020444chr551394 1330 1097 992 38 21258 570 ----
NM_020449chrX2762 592 ------
NM_020452chr132167 1347 512 21964 1725 11701 11445
NM_020453chr482057 1620 1460 1297 565 252 89 30 11925 ----
NM_020455chr682707 2640 2589 2564 2477 2459 306 289 22846 2198 22468 536 --
NM_020456chr1382137 1630 1614 817 729 516 427 300 ------
NM_020458chr241420 1340 828 183 ------
NM_020463chr241406 1287 1026 447 1522 ----
NM_020465chr1621703 1652 --11466 --
NM_020466chr685036 5005 4907 4384 4140 4064 3821 3745 33701 3050 1247 24068 3824 --
NM_020473chrX51961 1770 1640 1346 191 2397 248 ----
NM_020474chr18102015 1896 1762 1564 1520 1485 1440 1334 1295 404 ------
NM_020475chr832384 2328 293 --1365 --
NM_020476chr832384 2328 293 --1365 --
NM_020477chr832384 2328 293 --1365 --
NM_020478chr832447 2391 356 --1428 --
NM_020480chr832384 2328 293 --1365 --
NM_020482chr62793 753 2523 331 ----
NM_020526chr121590 1268 ------
NM_020528chr211117 ------
NM_020529chr142186 62 ------
NM_020532chr2----1243 --
NM_020546chr532842 1955 341 --1699 --
NM_020548chr2164 ------
NM_020630chr104651 157 95 46 --1724 --
NM_020640chr372049 1962 1596 772 535 415 172 22000 1981 ----
NM_020642chr113469 152 33 ------
NM_020645chr111241 1461 ----
NM_020647chr862229 2095 2064 1668 807 275 ------
NM_020648chr18142843 2467 2455 2422 2346 2310 2200 2108 2048 2033 2006 1896 1127 131 31831 970 387 12755 --
NM_020651chr261483 1308 1236 694 407 87 11264 11358 11668
NM_020654chr351522 650 636 437 252 21547 644 ----
NM_020655chr162205 166 --1537 11427
NM_020666chr52946 209 1370 ----
NM_020673chr20197318 6471 6400 5961 5434 5360 5045 5029 3077 3057 2918 2836 2750 2682 2106 1903 1336 1253 679 37217 5907 2670 ----
NM_020686chr1632473 1061 322 12850 ----
NM_020689chr2051721 664 529 498 346 --2562 36 --
NM_020693chr113367 184 72 --2510 188 --
NM_020696chr3167 195 ----
NM_020697chr83295 262 145 ------
NM_020699chr1155208 4441 4095 4032 3518 3318 2141 2019 1880 1362 1159 933 451 444 214 1247 2436 430 15017
NM_020703chr11381 --2603 470 --
NM_020708chr2042495 2438 2405 1800 --1242 --
NM_020711chr262446 2105 1727 898 393 379 ----1128
NM_020717chrX144540 4281 4104 3916 3761 3704 3593 3302 3253 3158 2006 1175 1162 897 --33928 3256 64 --
NM_020718chr16246210 5695 5661 5649 5614 5513 4889 4854 4436 4402 4195 2048 1623 1513 1492 1378 1266 1173 965 819 406 323 298 99 15963 22229 1177 21884 1334
NM_020726chr53436 420 240 ------
NM_020727chr2173895 3462 3236 2875 2655 2611 1474 23741 3407 33921 566 365 --
NM_020728chr743050 732 511 425 12979 13000 13004
NM_020732chr66863 308 298 279 236 229 31196 936 287 --1868
NM_020734chr12183221 2896 2548 2386 1329 1301 1290 1135 943 936 883 793 762 611 559 543 305 43 21071 313 33096 2159 51 --
NM_020738chr241670 1081 364 273 11717 --11675
NM_020739chr15144179 3973 3797 3727 3719 3384 2899 2871 2839 2573 1235 851 251 44 --11239 11247
NM_020742chrX52115 1740 871 832 418 11684 ----
NM_020747chr54926 799 381 257 1251 ----
NM_020748chr1761844 1700 1583 339 245 238 12181 --12011
NM_020749chr861649 1409 841 752 706 380 31293 718 364 11351 1299
NM_020750chr631472 79 35 --149 --
NM_020752chr1062440 2212 2073 1907 860 505 ------
NM_020754chr351450 1125 475 451 371 1131 11010 --
NM_020755chr621558 158 ----11563
NM_020760chr261661 1551 1436 1412 1248 485 21507 801 1255 --
NM_020766chrX133758 3535 2786 1802 1713 1438 1412 1385 1305 812 653 305 61 13617 1657 13012
NM_020768chr5123103 2755 1995 1983 1129 681 671 433 339 221 190 109 22292 707 ----
NM_020769chrX1919 ------
NM_020770chr131281 1262 491 1349 ----
NM_020772chr17247856 7522 7408 6755 6657 6642 6190 5918 5818 5724 5470 5390 3375 2460 2342 2302 1780 1700 1613 1239 645 503 272 202 26713 966 --38017 7991 6741
NM_020773chr442671 2537 1948 462 ------
NM_020774chr18175779 5542 5519 5409 5336 4699 2419 1855 1473 1445 1281 996 777 521 346 300 282 45346 4910 1073 113 35863 4344 1411 24127 2199
NM_020775chr11146 ------
NM_020777chr442506 2500 2493 2218 ----1443
NM_020778chr1554854 4387 3860 3808 3363 ----14543
NM_020779chr263214 2649 859 786 579 306 --12251 1501
NM_020783chr1882379 1602 1531 865 664 427 103 57 21859 431 ----
NM_020791chr172427 330 ------
NM_020792chr3102507 2474 2402 2149 2076 572 349 333 89 73 21088 984 ----
NM_020794chr141416 1155 1128 278 ----21201 560
NM_020796chr552772 2471 2372 1995 720 1836 12540 --
NM_020799chr102163 69 ------
NM_020800chr321327 1312 ------
NM_020801chr5132664 2621 2549 2540 2358 991 932 900 761 753 645 392 250 22440 2343 2373 308 --
NM_020803chr4121993 1970 1847 1722 1671 941 566 528 499 392 355 89 2699 521 1872 --
NM_020805chr1821728 1602 --11606 1761
NM_020806chr144669 320 233 226 ------
NM_020807chr1621636 270 ------
NM_020808chr121129 74 --1265 --
NM_020809chr1131889 1761 1487 31900 794 679 2810 216 --
NM_020810chr1432962 1434 797 22923 1196 13201 --
NM_020818chr142386 167 ------
NM_020819chr65793 420 215 153 112 1806 --1235
NM_020824chr102313 74 2622 489