TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3186-5p
miRNA Sequence: CAGGCGUCUGUCUACGUGGCUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000020chr1232427 2400 123 1926 2533 223 --
NM_000037chr832060 1623 606 --22388 1882 12357
NM_000044chrX1281 ------
NM_000052chrX12278 12146 23078 2941 --
NM_000084chrX46350 5530 1665 919 ----11687
NM_000087chr4134 ------
NM_000088chr171946 ------
NM_000108chr71696 ------
NM_000109chrX22631 2148 1271 ----
NM_000112chr524903 682 --14266 --
NM_000141chr10173 1930 21143 979 --
NM_000163chr53914 331 132 ------
NM_000167chrX--1735 ----
NM_000170chr9--1447 138 --
NM_000176chr51554 12960 ----
NM_000212chr1742324 2277 1963 273 ------
NM_000217chr1235038 1895 91 ------
NM_000248chr32345 202 ------
NM_000264chr91107 1991 --13374
NM_000276chrX12181 ------
NM_000278chr1062121 2071 895 458 450 278 --1106 --
NM_000310chr121184 1131 ------
NM_000314chr1013201 ------
NM_000332chr626707 5730 ------
NM_000333chr3----188 --
NM_000337chr535604 1607 1408 15763 14916 --
NM_000346chr1711359 ------
NM_000368chr934735 946 184 ------
NM_000387chr31583 1532 ----
NM_000390chrX--1854 ----
NM_000393chr211545 11989 ----
NM_000428chr14--1747 ----
NM_000430chr1712503 13805 ----
NM_000434chr6----185 --
NM_000439chr52715 451 ------
NM_000442chr172959 833 11221 ----
NM_000445chr8--178 1947 --
NM_000448chr11--12385 ----
NM_000450chr111313 --1117 --
NM_000459chr93940 228 77 ------
NM_000461chr31331 --33188 2910 1090 --
NM_000484chr2111038 --1157 --
NM_000503chr81308 1171 ----
NM_000522chr7142 ------
NM_000523chr211185 --1740 --
NM_000533chrX--1241 ----
NM_000555chrX21827 858 --15300 --
NM_000578chr2----11491 --
NM_000598chr72384 39 1164 ----
NM_000599chr231297 83 64 --13235 --
NM_000612chr1143840 3418 3104 32 ----13129
NM_000618chr1222032 1062 ------
NM_000618chr1222032 1062 ------
NM_000619chr122475 379 ------
NM_000720chr31144 ------
NM_000726chr21190 ------
NM_000767chr1931360 1186 376 ------
NM_000806chr51460 ------
NM_000813chr535062 4718 105 13625 ----
NM_000814chr1573935 3861 3454 1665 1193 1061 360 --1908 --
NM_000817chr221012 36 ------
NM_000824chr41116 ------
NM_000826chr4121 ------
NM_000827chr5----12163 --
NM_000831chr176091 6032 5804 4623 817 499 260 --1435 --
NM_000837chr81361 --1127 --
NM_000838chr611977 12563 ----
NM_000842chr111109 ------
NM_000864chr121042 970 ------
NM_000870chr551051 617 543 380 36 ------
NM_000875chr1596595 6260 4828 4795 2732 2089 1674 1252 947 --11454 --
NM_000901chr422365 638 ------
NM_000912chr822628 2317 ------
NM_000918chr173777 568 69 ------
NM_000933chr20----1326 --
NM_000935chr3161 ------
NM_000944chr452077 1969 1868 1764 230 ------
NM_000945chr2169 ------
NM_000961chr2043960 2669 1104 904 13245 ----
NM_000963chr1----1253 --
NM_000965chr321002 966 1449 ----
NM_001001132chr2111191 ------
NM_001001323chr121124 ------
NM_001001395chr12----12606 --
NM_001001396chr133844 3796 1273 --13314 --
NM_001001481chr812816 ------
NM_001001586chr12364 189 ------
NM_001001665chr242583 2310 594 472 1962 13427 --
NM_001001890chr2133361 215 133 13560 ----
NM_001001924chr811780 ------
NM_001001925chr811780 ------
NM_001001931chr811780 ------
NM_001001974chr101536 ------
NM_001001995chrX--21471 1461 ----
NM_001002295chr101353 ------
NM_001002814chr853788 3438 3295 1030 601 ------
NM_001003674chr18--15118 15360 --
NM_001003675chr18--15118 15360 --
NM_001003682chr11585 180 ----
NM_001003792chr3189 ------
NM_001003793chr3189 ------
NM_001003895chrY122 ------
NM_001003940chr1542899 2779 1340 1243 ------
NM_001003942chr1542899 2779 1340 1243 ------
NM_001003943chr1542903 2783 1344 1247 ------
NM_001004304chr1243017 1988 1023 769 --12740 --
NM_001004317chr633019 1713 660 14466 --1783
NM_001004419chr1211594 ------
NM_001004439chr1531235 1215 840 --1145 --
NM_001004720chr21995 ------
NM_001005354chr12165 ------
NM_001005360chr192849 724 ------
NM_001005361chr192849 724 ------
NM_001005362chr192849 724 ------
NM_001005386chr221695 348 ------
NM_001005404chr1723357 140 --1721 --
NM_001005463chr1022422 394 --11693 1280
NM_001005609chrX13844 ------
NM_001005611chrX1343 ------
NM_001005739chr2----171 --
NM_001005746chr21190 ------
NM_001005747chr21190 ------
NM_001005782chr2--1818 ----
NM_001006617chr941042 1027 902 288 --11061 --
NM_001006619chr941042 1027 902 288 --11061 --
NM_001006620chr941042 1027 902 288 --11061 --
NM_001006621chr941042 1027 902 288 --11061 --
NM_001007026chr121480 ------
NM_001007098chr1----170 --
NM_001007226chr17--11216 ----
NM_001007227chr17--11216 ----
NM_001007228chr17--11216 ----
NM_001007229chr17--11216 ----
NM_001007230chr17--11216 ----
NM_001007257chr11211 --21151 462 --
NM_001007466chr641159 1131 156 87 --1184 --
NM_001007559chr18--11440 ----
NM_001008225chr71709 1132 ----
NM_001008410chr222234 743 ------
NM_001008495chr81219 ------
NM_001008541chr1031863 1751 313 ------
NM_001008541chr1031863 1751 313 ------
NM_001008800chr1----186 --
NM_001008883chr1----186 --
NM_001009184chr81361 --1127 --
NM_001009899chr324857 4607 --14991 --
NM_001009955chr1253 21 ------
NM_001009955chr1253 21 ------
NM_001009958chr7143 ------
NM_001009993chr231710 1697 80 ----11255
NM_001010000chr181164 12787 12404 --
NM_001010862chrX--13048 ----
NM_001010888chrX44234 4126 1862 153 --13677 --
NM_001010908chr10187 ------
NM_001010971chr11977 ------
NM_001011553chr7----1169 --
NM_001011645chrX1281 ------
NM_001011666chr721485 220 ------
NM_001011713chr14----1436 --
NM_001011724chr131315 ------
NM_001011725chr131315 ------
NM_001011885chr1521718 1138 ------
NM_001012393chr1133545 526 31 14293 ----
NM_001012732chr4163 ------
NM_001012754chr1321889 1796 ------
NM_001012755chrX53397 1491 1339 1326 1174 ------
NM_001013398chr72384 39 1164 ----
NM_001013690chr123566 325 189 ------
NM_001014431chr142877 863 ----1791
NM_001014432chr142877 863 ----1791
NM_001014443chr1------179
NM_001014445chr17----1736 --
NM_001014797chr1037765 7580 7505 ------
NM_001015881chrX----1882 --
NM_001017368chr172155 134 12051 ----
NM_001017371chr21145 ------
NM_001017395chr333112 2852 2270 ------
NM_001017424chr12655 636 --1245 11718
NM_001017425chr12655 636 --1245 11718
NM_001017523chr1211429 ------
NM_001017961chr1137 ------
NM_001017995chr564648 4464 4000 1819 173 67 ------
NM_001018025chrX1348 ------
NM_001018050chr2243368 2660 2345 643 ------
NM_001018052chr2243368 2660 2345 643 ------
NM_001018054chr11973 ------
NM_001018065chr944472 1475 125 65 --13816 --
NM_001018066chr944472 1475 125 65 --13816 --
NM_001018067chr1----14930 --
NM_001018068chr1----14930 --
NM_001018069chr1----14930 --
NM_001018072chr1211429 ------
NM_001018074chr51554 12960 ----
NM_001018075chr51554 12960 ----
NM_001018076chr51554 12960 ----
NM_001018077chr51554 12960 ----
NM_001020658chr121618 642 ------
NM_001020658chr121618 642 ------
NM_001020825chr5--1435 ----
NM_001024094chr51554 12960 ----
NM_001024372chr8122 ------
NM_001024401chr1621966 1091 --1359 --
NM_001024647chr1275648 5288 5154 2879 2748 2107 22 11490 11224 --
NM_001024680chr211575 ------
NM_001024808chr1242174 1045 993 367 ------
NM_001024847chr32284 189 ----12048
NM_001024947chr51413 ------
NM_001024948chr1----1222 --
NM_001024959chr31256 1619 ----
NM_001024960chr31256 1619 ----
NM_001025068chr311461 ------
NM_001025069chr311461 ------
NM_001025076chr1015153 12184 ----
NM_001025079chr311468 --1301 --
NM_001025201chr21188 1488 ----
NM_001025266chr323869 479 ------
NM_001025356chr1222560 2285 ------
NM_001025366chr611796 ------
NM_001025366chr611796 ------
NM_001025367chr611796 ------
NM_001025367chr611796 ------
NM_001025368chr611796 ------
NM_001025368chr611796 ------
NM_001025369chr611812 ------
NM_001025369chr611812 ------
NM_001025370chr611796 ------
NM_001025370chr611796 ------
NM_001025595chr421495 1467 ------
NM_001029858chr623378 1347 ----1208
NM_001029875chr512143 ------
NM_001029891chrX1768 ------
NM_001031738chr21382 ------
NM_001032221chr921377 155 --1298 --
NM_001032280chr641370 1317 681 32 ------
NM_001032288chr2031208 543 92 ------
NM_001032293chr171591 ------
NM_001032393chrX1492 ------
NM_001033047chr412525 ------
NM_001033059chr612062 ------
NM_001033112chr51639 ------
NM_001033117chr334103 3585 1608 ------
NM_001033503chr5----1454 --
NM_001033504chr173598 223 160 ------
NM_001033506chr111157 ------
NM_001033756chr611730 ------
NM_001033756chr611730 ------
NM_001033925chr1012071 1551 ----
NM_001034025chr122188 164 ------
NM_001034837chr51762 ------
NM_001034838chr51762 ------
NM_001034954chr1052593 2394 2352 1196 332 --11150 --
NM_001034955chr1052593 2394 2352 1196 332 --11150 --
NM_001034956chr1052593 2394 2352 1196 332 --11150 --
NM_001034957chr1052593 2394 2352 1196 332 --11150 --
NM_001035254chr93999 439 115 --1373 --
NM_001037164chr71140 --1543 --
NM_001037331chr181241 1849 ----
NM_001037332chr552450 962 880 459 436 ------
NM_001037333chr552450 962 880 459 436 ------
NM_001037339chr11438 ------
NM_001037340chr11438 ------
NM_001037341chr11438 ------
NM_001037341chr11438 ------
NM_001037631chr21453 ------
NM_001039091chrX--1419 ----
NM_001039348chr211030 ------
NM_001039349chr211030 ------
NM_001039459chr72837 81 ------
NM_001039465chr141370 ------
NM_001039547chr346956 5498 2902 2076 ------
NM_001039574chr111004 ------
NM_001039840chrX35622 1741 1384 23671 1570 ----
NM_001039916chr122867 479 ------
NM_001039917chr122867 479 ------
NM_001039918chr122867 479 ------
NM_001039919chr122867 479 ------
NM_001039920chr122867 479 ------
NM_001039937chr1324111 3074 ------
NM_001040057chr71147 ------
NM_001040092chr81135 ------
NM_001040110chr711537 ------
NM_001040113chr161907 ------
NM_001040142chr211816 ------
NM_001040143chr211816 ------
NM_001040172chr551051 617 543 380 36 ------
NM_001040173chr551051 617 543 380 36 ------
NM_001040181chr31199 ------
NM_001040182chr31199 ------
NM_001040183chr31199 ------
NM_001040199chr31199 ------
NM_001040200chr31199 ------
NM_001040429chr1312942 1764 ----
NM_001040431chr17160 ------
NM_001040441chr145476 4473 1785 1652 23802 799 ----
NM_001040446chr511096 ----1266
NM_001040708chr81775 ------
NM_001040875chr822638 2256 --12328 --
NM_001042406chr61434 ------
NM_001042414chr13151 ------
NM_001042425chr641370 1317 681 32 ------
NM_001042453chrX11158 --11125 --
NM_001042473chr1011371 ------
NM_001042479chrX2660 365 11870 ----
NM_001042480chrX2660 365 11870 ----
NM_001042494chr1531512 923 247 ------
NM_001042495chr1531512 923 247 ------
NM_001042496chr1531512 923 247 ------
NM_001042497chr1531512 923 247 ------
NM_001042548chr21784 ------
NM_001042555chr1214624 ------
NM_001042576chr202478 48 ------
NM_001042599chr226709 5639 ------
NM_001042604chr324031 3459 ------
NM_001042749chrX11408 ------
NM_001042750chrX11408 ------
NM_001042751chrX11408 ------
NM_001043318chr1433449 3398 143 ------
NM_001044305chr6------11595
NM_001048183chr142747 2419 1185 745 1941 23714 876 --
NM_001071775chr1311532 ------
NM_001083620chr4121 ------
NM_001092chr171151 ------
NM_001095chr1211935 ------
NM_001099678chr314889 12062 ----
NM_001113490chrX11304 ------
NM_001117chr1841977 1578 755 488 ------
NM_001121chr1011808 ------
NM_001126chr11924 1863 --1151
NM_001153chr2--1115 ----
NM_001157chr10----1199 --
NM_001167chrX76248 6165 6032 6012 5258 4172 945 16382 ----
NM_001186chr2112519 12408 ----
NM_001196chr221900 ------
NM_001204chr247599 7115 4976 4843 ------
NM_001218chr1532265 2245 1800 ----12333
NM_001241chr2----1401 --
NM_001241chr2----1401 --
NM_001264chr62825 29 ------
NM_001277chr111915 ------
NM_001280chr192574 163 ------
NM_001298chr211300 ------
NM_001310chr1232032 1138 617 ------
NM_001316chr201400 ------
NM_001326chr11179 ------
NM_001349chr2--1532 ----
NM_001356chrX1887 ------
NM_001358chr41174 ------
NM_001386chr8--12445 ----
NM_001399chrX13844 ------
NM_001401chr91576 2997 435 ----
NM_001402chr631818 1659 1473 ------
NM_001419chr1934631 1731 737 ----14328
NM_001420chr1932386 1234 1150 12263 ----
NM_001427chr711907 ------
NM_001431chr611167 ------
NM_001438chr123643 614 ------
NM_001449chrX2940 367 --21250 358 --
NM_001527chr634434 4344 1761 --24586 3042 14476
NM_001530chr141332 ------
NM_001587chrX12181 ------
NM_001614chr171556 ------
NM_001614chr171556 ------
NM_001626chr1933009 2873 1296 --1315 --
NM_001634chr612062 ------
NM_001635chr71110 ------
NM_001655chr112508 54 ------
NM_001660chr31252 ------
NM_001663chr14--12170 ----
NM_001664chr31836 ------
NM_001665chr111128 ------
NM_001668chr122104 733 --12263 --
NM_001678chr1711795 ------
NM_001684chr133561 3513 990 --13031 --
NM_001699chr19192 --11720 --
NM_001706chr31677 ------
NM_001720chr141738 1461 859 257 12051 ----
NM_001730chr131263 ------
NM_001730chr131263 ------
NM_001754chr2133361 215 133 13560 ----
NM_001759chr1245024 3814 2037 318 ------
NM_001777chr311468 --1301 --
NM_001788chr7----1169 --
NM_001789chr33209 188 130 ------
NM_001792chr181380 ------
NM_001806chr1912563 --12794 --
NM_001822chr21188 1488 ----
NM_001843chr121237 ------
NM_001851chr6140 ------
NM_001854chr11572 --1144 --
NM_001859chr963885 3800 3717 2428 748 529 --1665 --
NM_001894chr222283 181 ------
NM_001901chr61334 ------
NM_001918chr178589 7057 2378 1776 1633 567 314 --12511 --
NM_001921chr4163 ------
NM_001924chr11114 ------
NM_001933chr141563 ------
NM_001940chr121480 ------
NM_001945chr511038 ------
NM_001946chr121808 ------
NM_001950chr16--1789 1108 --
NM_001951chr81610 ------
NM_001955chr61868 --1379 --
NM_001961chr193166 107 21 ------
NM_001964chr53790 766 318 ------
NM_001969chr1433578 2617 989 ------
NM_001980chr1241859 1479 160 94 --11572 --
NM_001987chr1214268 --1680 --
NM_001999chr511122 ------
NM_002010chr131382 ------
NM_002015chr1313131 ------
NM_002017chr111554 11054 ----
NM_002023chr121641 1434 --1519 --
NM_002025chrX48759 7930 2886 824 --13215 --
NM_002045chr31109 ------
NM_002048chr91300 ------
NM_002051chr101353 ------
NM_002061chr111720 ------
NM_002072chr93845 833 647 ------
NM_002074chr121210 21 ------
NM_002083chr14170 ------
NM_002088chr194353 123 114 25 ------
NM_002092chr434306 4261 3986 ------
NM_002126chr1711210 ------
NM_002136chr121423 ------
NM_002137chr72881 244 ------
NM_002139chrX--1497 ----
NM_002148chr21596 ------
NM_002149chr24562 195 152 77 ------
NM_002158chr21179 ------
NM_002199chr4----1315 --
NM_002204chr173993 256 191 ------
NM_002222chr31232 ------
NM_002223chr1213696 --13566 --
NM_002224chr61247 ------
NM_002240chr211536 ------
NM_002254chr21224 ------
NM_002264chr323916 579 43647 3306 3069 1400 ----
NM_002267chr1321537 106 ------
NM_002268chr3--11372 ----
NM_002270chr524548 1848 14684 --1370
NM_002271chr1321851 1616 148 ----
NM_002334chr1121809 1306 ----153
NM_002336chr1234226 643 284 24630 3516 ----
NM_002353chr1173 ------
NM_002373chr1511318 --1256 --
NM_002376chr143473 139 92 ------
NM_002382chr1411129 --1378 --
NM_002397chr511428 ------
NM_002398chr21128 ------
NM_002401chr171361 --11599 --
NM_002473chr222112 77 11212 1424 --
NM_002479chr12191 55 ------
NM_002480chr121327 ------
NM_002481chr137627 2067 493 --27957 2201 --
NM_002522chr1742755 2490 1143 268 ------
NM_002524chr12794 743 ------
NM_002545chr1133545 526 31 14293 ----
NM_002576chr11180 ------
NM_002577chr323962 2597 1473 ----
NM_002581chr925703 4393 ------
NM_002583chr121241 ------
NM_002588chr52708 352 ------
NM_002592chr20159 ------
NM_002595chr121364 1735 ----
NM_002600chr11438 ------
NM_002605chr1511078 ------
NM_002613chr1644932 3445 1809 967 --23365 76 --
NM_002634chr172874 802 ------
NM_002651chr1----1790 --
NM_002670chr3144 ------
NM_002698chr193788 656 310 ------
NM_002699chr121115 491 ------
NM_002703chr41340 --11957 --
NM_002705chr16136 --1252 --
NM_002713chr111213 ------
NM_002719chr142950 391 --11754 --
NM_002721chr91454 ------
NM_002730chr1911124 1376 ----
NM_002736chr721813 82 ------
NM_002737chr1736645 5915 250 --26003 418 11178
NM_002742chr141622 ------
NM_002745chr223982 600 349 11429 ----
NM_002752chr51125 ------
NM_002765chrX--1419 ----
NM_002822chr1211805 ------
NM_002827chr2011768 ------
NM_002828chr18184 ------
NM_002829chr91266 ------
NM_002833chr1511192 ------
NM_002840chr131460 1372 1276 ------
NM_002841chr31466 ------
NM_002849chr121893 ------
NM_002850chr191909 --145 --
NM_002856chr191306 ------
NM_002857chr121927 1688 ------
NM_002868chr121160 ------
NM_002874chr921723 194 11589 ----
NM_002886chr323591 714 ------
NM_002897chr21702 ------
NM_002906chr1122424 299 ------
NM_002911chr1931528 1260 369 1471 ----
NM_002918chr191777 ------
NM_002924chr11173 ------
NM_002941chr321287 77 --154 --
NM_002956chr1221256 261 ------
NM_002957chr953385 2773 1481 1295 54 --1260 --
NM_002968chr161391 ------
NM_002994chr4----11289 11839
NM_002996chr1651968 1617 1417 1324 277 ------
NM_002998chr82890 449 --21656 1395 --
NM_003012chr83670 406 99 ------
NM_003016chr1721755 266 --11712 --
NM_003022chrX11014 --11255 --
NM_003029chr141269 509 270 31 ------
NM_003036chr12385 110 ------
NM_003037chr11108 ------
NM_003043chr321241 637 ------
NM_003051chr111817 ------
NM_003060chr511243 ------
NM_003077chr171631 --1220 --
NM_003099chr1585781 5577 4599 4462 4302 2614 1266 36 ------
NM_003106chr31212 ------
NM_003107chr611615 --12409 --
NM_003108chr226498 2557 1738 1484 --
NM_003110chr171438 --1704 --
NM_003111chr21145 ------
NM_003112chr713081 ------
NM_003132chr1123 ------
NM_003149chr321551 243 --31502 1208 49 11641
NM_003155chr812773 ------
NM_003164chr111362 ------
NM_003173chrX21298 979 ------
NM_003174chr101307 ------
NM_003185chr202973 47 ------
NM_003188chr61542 ------
NM_003199chr1814775 --11589 --
NM_003204chr1721256 99 ------
NM_003216chr2243065 963 180 141 ------
NM_003220chr641370 1317 681 32 ------
NM_003236chr232216 1243 875 --186 --
NM_003242chr32284 189 ----12048
NM_003244chr181365 --1434 --
NM_003253chr211638 ------
NM_003262chr354700 3531 1171 974 616 ------
NM_003269chr611004 ------
NM_003291chr131212 ------
NM_003298chr353801 3781 1759 1716 204 ------
NM_003299chr12187 ------
NM_003315chr17192 ------
NM_003317chr14--1652 1169 --
NM_003319chr22774 382 ------
NM_003320chr1123621 922 14340 ----
NM_003337chr521130 323 11538 ----
NM_003339chr52480 102 ------
NM_003342chr1722602 2148 ------
NM_003344chr711378 ------
NM_003349chr2031208 543 92 ------
NM_003352chr2--1818 ----
NM_003373chr1011661 ------
NM_003376chr611796 ------
NM_003376chr611796 ------
NM_003389chr92484 393 --1226 --
NM_003400chr2185 ------
NM_003403chr14171 ------
NM_003413chrX1618 ------
NM_003430chr191565 --139 --
NM_003445chr191697 ------
NM_003457chr171591 ------
NM_003458chr343543 3364 707 457 ------
NM_003463chr622681 1056 12338 ----
NM_003468chr212828 11509 ----
NM_003483chr1232060 2038 414 ------
NM_003486chr1692786 2739 2647 2113 2073 2030 1100 1062 881 ------
NM_003563chr17--11216 ----
NM_003581chr21995 ------
NM_003586chr161611 ------
NM_003590chr212625 12807 ----
NM_003591chr10--1170 ----
NM_003603chr431910 93 60 ------
NM_003612chr154151 136 57 24 ------
NM_003615chr3----22497 753 --
NM_003622chr1232395 2237 955 ------
NM_003630chr61100 ------
NM_003633chr5--1707 1687 --
NM_003644chr1766111 5006 4641 696 614 80 11662 11610 --
NM_003648chr232549 758 83 --1737 --
NM_003654chr112491 178 --1209 --
NM_003659chr221072 785 ------
NM_003660chr191683 ------
NM_003663chr311339 ------
NM_003670chr321140 511 --1289 --
NM_003681chr2145538 5278 1731 75 --35887 2211 1614 --
NM_003701chr13----1771 --
NM_003713chr11377 ------
NM_003716chr32745 395 ------
NM_003735chr52708 352 ------
NM_003736chr52708 352 ------
NM_003743chr2----1613 --
NM_003749chr1342416 931 876 63 ------
NM_003750chr101747 ------
NM_003760chr1166 ------
NM_003774chr122831 203 ------
NM_003794chr31270 ------
NM_003795chr61104 ------
NM_003800chr611698 11776 11801 --
NM_003825chr1511358 1224 ----
NM_003861chr1412322 ------
NM_003873chr1021939 883 --11854 --
NM_003876chr171261 ------
NM_003884chr311472 ------
NM_003888chr1521588 39 ------
NM_003897chr62477 135 ------
NM_003902chr11327 ------
NM_003913chr624357 746 --11633 --
NM_003940chr3140 ------
NM_003972chr1011127 ------
NM_003987chr1062121 2071 895 458 450 278 --1106 --
NM_003989chr1072057 2007 870 831 394 386 214 --142 --
NM_003990chr1072057 2007 870 831 394 386 214 --142 --
NM_004006chrX22631 2148 1271 ----
NM_004007chrX22631 2148 1271 ----
NM_004009chrX22631 2148 1271 ----
NM_004010chrX22631 2148 1271 ----
NM_004011chrX22631 2148 1271 ----
NM_004012chrX22631 2148 1271 ----
NM_004013chrX22631 2148 1271 ----
NM_004014chrX22631 2148 1271 ----
NM_004015chrX22631 2148 1271 ----
NM_004016chrX22545 2062 1185 ----
NM_004017chrX22631 2148 1271 ----
NM_004018chrX22545 2062 1185 ----
NM_004020chrX22631 2148 1271 ----
NM_004021chrX22545 2062 1185 ----
NM_004022chrX22545 2062 1185 ----
NM_004023chrX22545 2062 1185 ----
NM_004035chr1784909 4459 4447 4038 1867 1726 1218 41 ------
NM_004056chr81833 ------
NM_004087chr322025 413 ------
NM_004089chrX----1882 --
NM_004093chr1363114 2687 381 375 264 233 --156 --
NM_004100chr6172 ------
NM_004105chr211030 ------
NM_004114chrX1481 ------
NM_004124chr14--22625 80 11139 --
NM_004171chr1149474 5939 3667 2097 13586 ----
NM_004181chr42259 129 ------
NM_004227chr742367 1919 545 320 22842 1103 12531 --
NM_004229chrX12157 ------
NM_004230chr1932371 2256 99 --1489 --
NM_004235chr91713 1789 ----
NM_004236chr15125 ------
NM_004238chr21100 ------
NM_004261chr11358 ------
NM_004272chr511375 ------
NM_004274chr1422722 50 ------
NM_004296chr1433666 3269 510 ------
NM_004311chr1022126 1901 --13126 --
NM_004329chr10----1239 --
NM_004331chr81765 ------
NM_004338chr18--15118 15360 --
NM_004339chr2111847 --129 --
NM_004362chr41568 ------
NM_004364chr192853 495 1320 ----
NM_004369chr21591 ------
NM_004389chr2198 ------
NM_004392chr1311623 ------
NM_004393chr352220 1951 1824 1624 1523 ------
NM_004397chr111883 ------
NM_004411chr7--1697 ----
NM_004416chr1221020 54 ------
NM_004423chr332197 1720 687 ------
NM_004426chr1211446 ------
NM_004430chr85740 732 480 388 146 --1203 --
NM_004432chr911766 1571 ----
NM_004436chr11444 --135 --
NM_004438chr2--1437 12494 --
NM_004442chr161746 1649 1552 1253 495 153 ------
NM_004454chr31377 ------
NM_004457chr22593 126 ------
NM_004458chrX22026 369 ------
NM_004459chr171337 --1417 --
NM_004501chr113365 ------
NM_004504chr221918 660 1530 ----
NM_004516chr19----1449 --
NM_004537chr1211475 ------
NM_004566chr101208 --22532 506 --
NM_004586chrX31501 678 516 ------
NM_004587chr202478 48 ------
NM_004593chr31671 ------
NM_004612chr942959 823 618 209 ------
NM_004626chr111113 ------
NM_004631chr11973 ------
NM_004643chr141259 ------
NM_004660chrY1860 ------
NM_004661chr521213 76 ------
NM_004663chr151521 ------
NM_004667chr151203 1685 ----
NM_004673chr1--21086 367 ----
NM_004680chrY122 ------
NM_004685chr1312730 ------
NM_004708chr19192 ------
NM_004717chr7----11266 --
NM_004719chr121790 12623 1924 --
NM_004723chr12232 218 ------
NM_004726chrX----15513 --
NM_004730chr511969 ------
NM_004742chr311169 ------
NM_004745chr866502 6307 6174 5953 310 65 --36749 2014 50 --
NM_004755chr142229 56 ------
NM_004768chr11927 ------
NM_004770chr8178 ------
NM_004774chr1711088 ------
NM_004776chr202639 167 --1255 --
NM_004781chr131500 1133 386 --11545 --
NM_004781chr131500 1133 386 --11545 --
NM_004783chr161500 --1472 --
NM_004798chr2033067 3019 2477 ------
NM_004808chr1022237 734 --11132 --
NM_004815chr123935 823 --14046 --
NM_004818chr121191 --151 --
NM_004824chr61116 ----11182
NM_004836chr2165 ------
NM_004862chr16171 ------
NM_004874chr8185 ------
NM_004898chr41423 12501 ----
NM_004904chr721485 220 ------
NM_004922chr101979 ------
NM_004926chr14----1295 --
NM_004945chr192849 724 ------
NM_004953chr31284 ------
NM_004969chr101207 ------
NM_004973chr611127 ------
NM_004978chr141667 618 486 415 ------
NM_004981chr22157 ------
NM_004985chr121223 ------
NM_004992chrX37612 6658 757 --1610 --
NM_004992chrX37612 6658 757 --1610 --
NM_005011chr711537 ------
NM_005028chr1021550 763 ------
NM_005032chrX1220 ------
NM_005044chrX34347 4151 396 ------
NM_005057chr131783 1449 1315 11769 ----
NM_005063chr1011189 --23734 2637 --
NM_005065chr1424783 3521 11408 1157 --
NM_005097chr101103 ------
NM_005102chr21784 ------
NM_005110chr51594 ------
NM_005116chr2043762 3600 2991 468 11148 --14306
NM_005121chr171427 ------
NM_005126chr311682 ------
NM_005128chr211476 ------
NM_005135chr1531512 923 247 ------
NM_005137chr221101 --22464 1981 --
NM_005156chr975380 4526 3563 3437 3338 1780 1772 1634 --14414
NM_005163chr142877 863 ----1791
NM_005168chr211093 ------
NM_005169chr11142 ------
NM_005180chr1011214 2603 350 ----
NM_005187chr162307 254 --191 --
NM_005189chr1711590 ------
NM_005197chr1421975 1411 --14265 11830
NM_005201chr32170 112 ------
NM_005204chr101843 ------
NM_005206chr1721338 1204 ------
NM_005214chr21416 ------
NM_005229chrX1240 ------
NM_005233chr32679 139 ------
NM_005235chr226709 5639 ------
NM_005241chr321348 92 --1865 --
NM_005261chr8--1311 ----
NM_005277chr411280 ------
NM_005324chr1711317 ------
NM_005329chr161504 ----1766
NM_005336chr24797 492 147 108 ------
NM_005339chr423106 184 ------
NM_005359chr1832571 2235 309 ------
NM_005378chr23737 608 358 ------
NM_005392chr9----1199 --
NM_005402chr731811 701 598 ------
NM_005406chr181301 ------
NM_005436chr1033931 3660 2743 ------
NM_005455chr12220 46 ------
NM_005458chr912369 --1244 --
NM_005460chr52175 110 --1207 --
NM_005479chr1041504 1095 396 356 ------
NM_005497chr1765487 4243 4199 2411 1145 871 1416 ----
NM_005501chr172806 69 ------
NM_005503chr153998 114 94 --2421 352 --
NM_005509chr51505 --1152 --
NM_005515chr72483 74 1589 1203 --
NM_005524chr31291 ------
NM_005529chr13831 114 108 --1996 --
NM_005545chr151726 ------
NM_005563chr1----1646 --
NM_005581chr19----1362 --
NM_005596chr91789 --1428 --
NM_005603chr181525 142 ----
NM_005607chr8121 ------
NM_005618chr61215 --1163 --
NM_005626chr11374 ------
NM_005627chr62831 294 ------
NM_005629chrX----1213 --
NM_005637chr18--11440 ----
NM_005638chrX21536 147 ------
NM_005656chr2131459 1356 26 ------
NM_005665chr123644 651 --21527 1240 --
NM_005715chr61147 ------
NM_005717chr111190 ------
NM_005718chr31256 1619 ----
NM_005722chr221695 348 ------
NM_005724chr151333 ------
NM_005730chr1263591 3471 3020 2651 467 156 ------
NM_005734chr11--1303 ----
NM_005738chr71140 --1543 --
NM_005754chr52978 945 ------
NM_005796chr161368 ------
NM_005803chr6122 ------
NM_005811chr12----121 --
NM_005813chr21836 12213 --1555
NM_005822chr61939 ------
NM_005824chr71254 ------
NM_005840chrX1728 11415 1169 --
NM_005864chr14----1651 --
NM_005879chr3136 ------
NM_005898chr1122125 998 ------
NM_005924chr71358 ------
NM_005935chr421219 26 ------
NM_005941chr813574 ------
NM_005955chr154615 3890 2133 1999 63 --14010 --
NM_005962chr1031863 1751 313 ------
NM_005962chr1031863 1751 313 ------
NM_005998chr1----186 --
NM_006015chr12378 195 ------
NM_006016chr62537 95 ------
NM_006034chr1142368 1681 630 33 ------
NM_006037chr283756 3206 1955 738 296 230 192 80 --24627 829 --
NM_006051chr5--145 ----
NM_006067chr16----1794 --
NM_006094chr822136 975 ------
NM_006095chr421691 627 --11037 --
NM_006106chr1133018 2593 303 ------
NM_006108chr114626 351 194 142 ------
NM_006136chr7----11194 --
NM_006156chr141103 ------
NM_006195chr9134 ------
NM_006201chrX2408 43 ------
NM_006203chr535508 1734 22 ------
NM_006206chr421121 208 ------
NM_006209chr81135 ------
NM_006218chr31245 ------
NM_006241chr312383 2960 172 ----
NM_006245chr62196 106 --1258 --
NM_006252chr115468 14881 ----
NM_006255chr141763 ------
NM_006258chr10----1113 --
NM_006265chr81376 ------
NM_006277chr21254 ------
NM_006279chr12706 208 ------
NM_006283chr8--1130 ----
NM_006306chrX21850 1038 --15802 --
NM_006313chr1211175 ------
NM_006322chr13172 ------
NM_006329chr142537 25 ------
NM_006338chr13508 497 78 ------
NM_006350chr51111 ------
NM_006375chrX21512 1360 ------
NM_006420chr2011328 13256 ----
NM_006421chr8156 ------
NM_006434chr1052593 2394 2352 1196 332 --11150 --
NM_006469chr1--1499 ----
NM_006478chr221210 ------
NM_006540chr811403 ------
NM_006544chr1415251 ------
NM_006547chr7136 ------
NM_006548chr31304 ------
NM_006551chr11183 ------
NM_006552chr11185 ------
NM_006561chr1015153 12184 ----
NM_006572chr1743491 3246 2776 2613 ------
NM_006599chr1612448 17659 11385 --
NM_006602chr20161 ----1609
NM_006603chrX11408 ------
NM_006614chr3----12846 --
NM_006620chr621722 634 ------
NM_006626chr91614 ------
NM_006628chr1514556 --13235 --
NM_006654chr1214624 ------
NM_006698chr2031414 1286 532 --1122 --
NM_006708chr611015 ------
NM_006722chr32345 202 ------
NM_006726chr411222 ------
NM_006734chr6193 ------
NM_006741chr1211063 ------
NM_006750chr1657206 5889 5753 5545 2864 --22399 1795 13120
NM_006761chr171676 ------
NM_006766chr8--12479 32575 2445 2307 --
NM_006772chr61115 ------
NM_006775chr622516 54 ------
NM_006788chr1851867 1454 532 399 141 ------
NM_006802chr11274 ------
NM_006805chr51461 ------
NM_006811chr201898 ------
NM_006826chr2----11177 --
NM_006854chr721993 1435 ------
NM_006861chr1232013 352 253 --2702 235 --
NM_006874chr41836 ------
NM_006885chr1612980 ------
NM_006892chr20------11414
NM_006892chr20------11414
NM_006908chr731276 998 51 ------
NM_006924chr1714083 ------
NM_006925chr141370 ------
NM_006931chr1221726 1341 --21850 91 --
NM_006939chr14----21054 357 --
NM_006950chrX1842 ------
NM_006981chr912825 ------
NM_006990chr142429 566 558 60 --22029 631 --
NM_006991chr31160 ------
NM_007007chr121572 13278 163 --
NM_007011chr1556377 5619 5229 2158 585 --25535 1649 --
NM_007033chr121889 63 ----11726
NM_007054chr532930 1186 49 ------
NM_007067chr171169 ------
NM_007073chr663764 3662 1553 1332 314 226 ------
NM_007106chr13----12321 --
NM_007118chr5--1348 ----
NM_007129chr131712 ------
NM_007174chr1212234 11757 1777 --
NM_007178chr122489 365 ------
NM_007182chr31710 ------
NM_007191chr121179 ------
NM_007207chr12656 180 ------
NM_007217chr31254 ------
NM_007246chr41731 ------
NM_007249chr1323242 990 ------
NM_007271chr6----11152 --
NM_007292chr1784909 4459 4447 4038 1867 1726 1218 41 ------
NM_007327chr94970 865 331 140 --1222 11214
NM_007350chr1213369 ------
NM_007358chr1--1467 ----
NM_007368chr1341072 420 392 27 ------
NM_012081chr523382 3196 --13273 --
NM_012083chr10187 ------
NM_012104chr1142843 2804 1134 131 ------
NM_012104chr1142843 2804 1134 131 ------
NM_012129chr711637 ------
NM_012137chr112857 ------
NM_012141chr1324111 3074 ------
NM_012154chr82149 112 ------
NM_012156chr2022212 98 ------
NM_012193chr1144626 4250 1690 952 ------
NM_012197chr931389 1131 217 ------
NM_012199chr121312 1065 --1121 --
NM_012215chr1021833 397 ------
NM_012234chr333470 2876 1323 ------
NM_012237chr19126 ------
NM_012247chr101976 ------
NM_012249chr222269 739 ------
NM_012250chr111554 ------
NM_012259chr6194 11147 ----
NM_012282chrX5832 766 690 213 61 ------
NM_012288chr644301 1377 764 288 --11225 --
NM_012294chr734112 1493 332 ------
NM_012296chr112597 240 ----11365
NM_012300chr51122 171 ----
NM_012302chr12924 237 ------
NM_012307chr181352 ------
NM_012316chr134945 4632 542 --24765 1706 --
NM_012325chr201399 ------
NM_012330chr1021316 403 ------
NM_012333chr11587 ----11096
NM_012334chr584094 3774 3718 3264 1632 1087 1070 247 ------
NM_012337chr1----129 --
NM_012464chr4----1292 --
NM_012471chrX11591 ------
NM_012474chr1------1233
NM_012475chr1------179
NM_012482chr11109 ------
NM_013230chrY31753 206 23 ------
NM_013254chr12272 53 ------
NM_013261chr413383 1449 ----
NM_013269chr1211521 ------
NM_013275chr163190 171 143 ------
NM_013281chr20----1210 --
NM_013309chr1522103 1679 ------
NM_013316chr721008 245 ------
NM_013336chr341960 1665 1337 44 11744 ----
NM_013354chr81370 ------
NM_013372chr15--13149 ----
NM_013380chr19--1262 ----
NM_013438chr911703 ------
NM_013943chr1151 ------
NM_013960chr82514 145 ------
NM_014000chr1011661 ------
NM_014011chr21857 --1563 --
NM_014048chr16----15104 --
NM_014057chr911515 ------
NM_014060chrX188 ------
NM_014106chr1532228 725 628 ------
NM_014110chr111213 ------
NM_014112chr834294 3792 510 11792 ----
NM_014117chr1632545 2133 1952 --1171 --
NM_014141chr733569 1820 864 25289 4708 ----
NM_014153chr16----1727 --
NM_014155chr1121043 95 ------
NM_014181chr211129 12110 ----
NM_014203chr191352 --1121 --
NM_014217chr12655 636 --1245 11718
NM_014220chr31129 ------
NM_014240chr363827 3693 3680 3665 3418 1013 --13156 --
NM_014278chr4185 ------
NM_014283chr111304 ------
NM_014286chr932828 2785 921 --23218 23 11073
NM_014289chrX11301 ------
NM_014296chr3--1616 1307 --
NM_014300chr15132 ------
NM_014325chr1232121 2098 1655 ------
NM_014332chrX1109 ------
NM_014333chr1112618 --12651 --
NM_014345chr6157 ------
NM_014376chr552450 962 880 459 436 ------
NM_014393chr81164 ------
NM_014394chr10----1150 --
NM_014415chr311208 ------
NM_014417chr19126 ------
NM_014423chr511110 --15177 13432
NM_014445chr31675 --1871 --
NM_014447chr421494 1466 ------
NM_014455chr11197 ------
NM_014470chr122557 185 ------
NM_014494chr161502 ------
NM_014500chrX1105 ------
NM_014517chr3--147 ----
NM_014520chr17------152
NM_014571chr142987 2127 1105 833 --1952 --
NM_014573chr17190 1406 --135
NM_014575chr31404 ------
NM_014587chr1631400 400 134 11287 ----
NM_014592chr51762 ------
NM_014603chr1731371 1117 302 ------
NM_014608chr15139 ------
NM_014612chr911107 ------
NM_014615chr162397 173 ----11061
NM_014630chr1523865 1609 ------
NM_014636chr923047 697 ------
NM_014647chr1611710 ------
NM_014665chr8113646 3388 3191 3127 3055 2839 2305 1256 1238 972 452 --22615 1082 --
NM_014676chr121618 642 ------
NM_014677chr8----11146 --
NM_014683chr17----2872 49 --
NM_014707chr7--11832 ----
NM_014710chrX1163 ------
NM_014713chr21168 ------
NM_014720chr101193 1382 ----
NM_014735chrX11816 ------
NM_014736chr152752 30 --1886 --
NM_014739chr614006 ------
NM_014742chr2021772 1764 ------
NM_014743chr4----1465 --
NM_014746chr274258 4048 2864 1738 844 550 138 ------
NM_014747chr155034 4680 4296 271 114 --11748 --
NM_014762chr132260 2024 678 ------
NM_014770chr122422 153 ------
NM_014776chr1222081 1972 --23025 2045 --
NM_014795chr2----1102 --
NM_014797chr642590 2570 2453 70 ------
NM_014798chr1721547 1540 --21452 300 --
NM_014800chr72837 81 ------
NM_014807chr11----1654 --
NM_014810chr111467 ------
NM_014820chr31542 ------
NM_014824chr1111880 1272 ----
NM_014827chr11208 ------
NM_014830chr1223130 781 ----13744
NM_014841chr61270 --1345 --
NM_014847chr11134 ------
NM_014850chr334103 3585 1608 ------
NM_014868chr121815 ------
NM_014869chr331384 1310 75 --133 --
NM_014872chr92185 72 ------
NM_014876chr2222155 2099 --1714 12028
NM_014877chr1757799 7049 6193 5443 2641 ------
NM_014892chr61642 ------
NM_014912chr1011035 ------
NM_014913chr181279 ------
NM_014918chr1511293 ------
NM_014923chr131264 ------
NM_014926chr321136 920 1881 ----
NM_014934chr1323274 3097 --13311 --
NM_014936chr621105 737 ------
NM_014946chr211184 ------
NM_014961chr4----2717 336 --
NM_014964chr172843 46 ------
NM_014988chr412766 ------
NM_014997chr722571 2437 --1136 --
NM_015002chr1221535 308 --174 --
NM_015008chr333112 2852 2270 ------
NM_015025chr2----143 --
NM_015027chr1611582 ------
NM_015042chr1513125 12926 1783 --
NM_015050chr61532 ------
NM_015051chr912788 ------
NM_015056chr2112048 12173 ----
NM_015059chr1553150 981 572 397 232 ------
NM_015064chr1243554 3419 2666 1297 12571 1770 --
NM_015075chrX51950 875 678 147 27 --12275 --
NM_015076chr633640 2892 96 ------
NM_015085chr1732705 1005 608 13012 --12724
NM_015087chr131647 ------
NM_015090chr185649 5216 4086 2198 1335 1299 959 593 11415 22010 577 --
NM_015092chr1634525 1532 324 14628 11668 --
NM_015100chr121738 199 11816 ----
NM_015107chrX1688 ------
NM_015113chr175634 623 227 148 134 ------
NM_015132chr711881 ------
NM_015143chr411431 ------
NM_015144chr1633282 2633 276 ------
NM_015155chr1033097 2253 1138 ------
NM_015156chr1442986 1248 497 187 ------
NM_015157chr1111079 ------
NM_015163chr141195 ------
NM_015172chr111032 ------
NM_015191chr1112072 ------
NM_015197chr141473 ----196
NM_015203chr1--1155 ----
NM_015206chr1533626 2486 379 ------
NM_015208chr1833822 961 92 --23959 809 --
NM_015225chr912969 11255 ----
NM_015236chr411074 ------
NM_015238chr51653 ------
NM_015250chr921911 1358 12007 ----
NM_015263chr1521086 388 ------
NM_015272chr16--1427 ----
NM_015284chr121969 1751 ------
NM_015288chr543095 3070 2563 1372 ------
NM_015291chr113228 --1812 --
NM_015296chr13----1490 --
NM_015310chr822884 433 ------
NM_015313chr1144705 4399 3468 1668 13777 ----
NM_015315chr531146 954 688 ------
NM_015317chr232176 2027 255 ------
NM_015328chr72898 730 ------
NM_015335chr12--1772 ----
NM_015344chr8------11670
NM_015349chr612891 ------
NM_015353chr1752474 2046 1941 978 363 ------
NM_015355chr171625 ------
NM_015361chr22635 252 ------
NM_015374chr2221528 74 11508 ----
NM_015378chr133006 2129 489 12492 1560 --
NM_015381chr2241412 807 720 59 --1380 --
NM_015385chr1052593 2394 2352 1196 332 --11150 --
NM_015387chr221498 237 ------
NM_015423chr1111442 ------
NM_015447chr93236 206 50 1705 ----
NM_015455chr521609 289 ------
NM_015477chr15----191 --
NM_015488chr231502 1461 1329 11748 1463 --
NM_015516chr112305 238 ------
NM_015517chr11----196 --
NM_015520chr33704 623 211 --1357 --
NM_015530chr2--1371 ----
NM_015542chr10----1193 --
NM_015544chr173598 223 160 ------
NM_015554chr1532761 2103 1812 ------
NM_015557chr142639 2616 490 54 ----11006
NM_015559chr1811066 ------
NM_015568chr2043735 1630 1545 1350 --129 13280
NM_015577chr511311 --11696 --
NM_015627chr11265 --1204 --
NM_015638chr20159 ------
NM_015640chr1----14930 --
NM_015657chr21674 ------
NM_015695chr61410 ------
NM_015834chr211949 ------
NM_015845chr181150 ------
NM_015850chr821714 541 ------
NM_015866chr11211 --21151 462 --
NM_015879chr1847158 2974 1442 692 26818 1653 ----
NM_015885chr111668 ------
NM_015886chr834339 3510 669 11123 ----
NM_015898chr1982066 2014 2006 1736 1530 813 727 649 11782 ----
NM_015912chr842456 2310 2111 511 ------
NM_015949chr71868 ------
NM_015955chr2123 ------
NM_016019chr7------1172
NM_016021chr612992 1847 ----
NM_016061chr221636 219 ------
NM_016078chr17--1818 ----
NM_016083chr62992 328 13364 ----
NM_016103chr5----1454 --
NM_016129chr41320 ------
NM_016131chr211794 ------
NM_016141chr3153 ------
NM_016147chr11173 ------
NM_016152chr321002 966 1449 ----
NM_016173chr333771 3447 3297 14431 23385 22 --
NM_016201chr31767 ------
NM_016227chr111304 ------
NM_016235chr1611489 ------
NM_016242chr4--144 1139 --
NM_016248chr1322595 1537 1829 ----
NM_016252chr21636 ------
NM_016260chr232702 2201 2100 ------
NM_016263chr19102547 2107 1038 897 821 815 409 385 306 161 --13119 --
NM_016269chr41173 ------
NM_016270chr191159 --1310 --
NM_016271chr1811634 ------
NM_016275chr322077 674 12099 ----
NM_016300chr31205 ------
NM_016322chr9--13221 13133 --
NM_016374chr111041 ------
NM_016374chr111041 ------
NM_016376chr1724259 3092 --13449 --
NM_016423chr141384 ------
NM_016424chr17--1774 11402 --
NM_016441chr211620 ------
NM_016480chr51639 ------
NM_016507chr171897 --11085 --
NM_016516chr2----171 --
NM_016522chr11----11427 --
NM_016531chr412653 ------
NM_016542chrX11158 --11125 --
NM_016603chr511559 ------
NM_016621chr1124270 3719 ------
NM_016626chr18--2489 331 ----
NM_016631chr211839 ------
NM_016823chr1721208 1074 ------
NM_016824chr1011808 ------
NM_016836chr21702 ------
NM_016839chr21702 ------
NM_016929chr644515 3468 2965 764 ------
NM_016936chr16----11885 --
NM_016946chr132248 1252 841 1723 192 --
NM_016952chr1163703 2913 1218 992 718 181 11203 ----
NM_017413chrX41787 1589 960 866 ------
NM_017420chr1413780 ------
NM_017432chr191345 ------
NM_017449chr161746 1649 1552 1253 495 153 ------
NM_017522chr11973 ------
NM_017544chrX--130 ----
NM_017545chr201438 ------
NM_017580chr102952 165 ------
NM_017592chr19----32598 887 800 --
NM_017593chr42379 365 ------
NM_017617chr941383 1333 465 71 ------
NM_017628chr414224 ------
NM_017629chr131945 1864 511 166 ----
NM_017633chr633747 3371 2960 ------
NM_017637chr927087 6368 ------
NM_017640chr61275 ------
NM_017641chr12----1312 --
NM_017650chr715860 ------
NM_017658chr1422878 675 14337 ----
NM_017660chr191718 --12320 --
NM_017668chr162729 670 ------
NM_017679chr172674 538 ------
NM_017730chr32737 578 ------
NM_017741chr432085 325 85 ------
NM_017772chr61402 ------
NM_017779chr112707 12101 ----
NM_017791chr141342 ------
NM_017798chr2031048 1039 1033 --11102 --
NM_017799chr1411260 ------
NM_017801chr3----11023 --
NM_017824chr1022691 346 ------
NM_017851chr152381 73 ------
NM_017856chrX2660 365 11870 ----
NM_017893chr10------11133
NM_017917chr14--1109 ----
NM_017933chr23498 437 276 ------
NM_017994chr722307 826 --11082 --
NM_018009chr121158 ------
NM_018010chr311437 ------
NM_018014chr22278 53 ------
NM_018015chrX11021 ------
NM_018017chr1011016 22145 1156 ----
NM_018028chr191167 ------
NM_018061chr1--1688 ----
NM_018070chr1253 21 ------
NM_018078chr4146 1359 ----
NM_018079chr2123 ------
NM_018084chr212961 ------
NM_018085chr131324 1188 770 16255 ----
NM_018092chr1621278 369 ------
NM_018096chr17----1736 --
NM_018105chr81782 ------
NM_018124chr1622252 2092 2699 58 11602 --
NM_018133chr311832 ------
NM_018145chr15132 ------
NM_018155chr332951 1335 222 ------
NM_018156chr133006 2129 489 12492 1560 --
NM_018157chr1212880 1673 ----
NM_018181chr181416 ------
NM_018184chr311875 ------
NM_018195chr1111933 1651 1139 --
NM_018218chr241531 1499 550 48 --21350 93 --
NM_018234chr222234 743 ------
NM_018243chr453780 2591 640 339 253 11277 13016 --
NM_018299chr812816 ------
NM_018312chr1121607 1483 11477 ----
NM_018313chr3--1871 ----
NM_018364chr113397 13312 ----
NM_018374chr714855 --11146 --
NM_018424chr9----11704 --
NM_018433chr2----1549 --
NM_018445chr15175 ------
NM_018457chr12165 ------
NM_018460chr2----1111 147
NM_018566chr134424 4306 218 13268 13119 --
NM_018638chr1225312 129 ------
NM_018639chr1211377 ------
NM_018640chr12----12606 --
NM_018650chr1--177 ----
NM_018683chr2031393 1370 631 ------
NM_018698chrX1201 ------
NM_018712chr111113 ----11034
NM_018717chr451899 1842 1033 784 214 ------
NM_018719chr711075 ----11318
NM_018834chr51861 ------
NM_018836chr12200 43 1238 ----
NM_018841chr11470 --13484 --
NM_018845chr13545 522 419 ------
NM_018890chr731276 998 51 ------
NM_018912chr52708 352 ------
NM_018913chr52708 352 ------
NM_018914chr52708 352 ------
NM_018915chr52708 352 ------
NM_018916chr52708 352 ------
NM_018917chr52708 352 ------
NM_018918chr52708 352 ------
NM_018919chr52708 352 ------
NM_018920chr52708 352 ------
NM_018921chr52708 352 ------
NM_018922chr52708 352 ------
NM_018923chr52708 352 ------
NM_018924chr52708 352 ------
NM_018925chr52708 352 ------
NM_018926chr52708 352 ------
NM_018927chr52708 352 ------
NM_018928chr52708 352 ------
NM_018929chr52708 352 ------
NM_018952chr172666 152 ------
NM_018970chr712851 --12905 --
NM_018972chr822638 2256 --12328 --
NM_018976chr12139 ------
NM_018992chr162554 190 11661 ----
NM_019001chr324031 3459 ------
NM_019027chr432139 1788 53 1194 ----
NM_019036chr61434 ------
NM_019042chr711152 1803 ----
NM_019049chr12761 524 ------
NM_019053chr1021048 308 ------
NM_019071chr71493 ------
NM_019084chr1032116 815 764 ------
NM_019094chr1211391 13843 31379 224 87 --
NM_019106chr221268 13293 ----
NM_019116chr1643666 2808 2336 628 --12831 --
NM_019557chr11825 ------
NM_019593chr20187 --13150 --
NM_019595chr21254 ------
NM_019597chrX1492 ------
NM_019605chr11135 ------
NM_019606chr71172 ------
NM_019845chr22180 37 ------
NM_019895chr31199 ------
NM_019903chr1011808 ------
NM_020039chr1211935 ------
NM_020119chr753926 3920 3810 185 30 1769 ----
NM_020122chr224720 4015 24492 1122 14850 --
NM_020134chr231194 990 803 ------
NM_020155chr11132 ------
NM_020177chr523319 2775 ------
NM_020178chr1711188 ------
NM_020180chr1831268 1207 368 --21255 407 --
NM_020188chr16----122 --
NM_020198chr17130 ------
NM_020309chr192813 691 ------
NM_020337chr442352 1237 843 74 ------
NM_020338chr1033188 749 576 ------
NM_020341chr2021649 817 ------
NM_020342chr212001 ------
NM_020348chr1022805 352 ------
NM_020357chr3------1570
NM_020382chr122478 425 --1141 --
NM_020383chr101279 ------
NM_020390chr311706 ------
NM_020403chr1311298 ------
NM_020432chr7--11804 ----
NM_020438chr921261 320 --21092 50 --
NM_020452chr122163 609 ------
NM_020466chr634714 3553 1877 ------
NM_020475chr831997 1560 543 --22325 1819 12294
NM_020476chr831997 1560 543 --22325 1819 12294
NM_020477chr831997 1560 543 --22325 1819 12294
NM_020478chr832060 1623 606 --22388 1882 12357
NM_020480chr831997 1560 543 --22325 1819 12294
NM_020482chr6--1763 ----
NM_020525chr12165 ------
NM_020546chr52923 614 ------
NM_020548chr2154 ------
NM_020640chr31427 ------
NM_020651chr2----1268 --
NM_020673chr2037276 6106 1000 17630 17555 1612
NM_020689chr2011085 --11176 1468
NM_020693chr112145 26 ------
NM_020697chr81196 ------
NM_020699chr124707 3780 ------
NM_020708chr2061702 1637 662 275 177 151 ------
NM_020717chrX24702 3321 ------
NM_020724chr411885 --12545 --
NM_020734chr121840 ------
NM_020747chr5192 ------
NM_020749chr811780 ------
NM_020752chr101979 ------
NM_020769chrX--1185 ----
NM_020772chr1736496 5535 548 ------
NM_020774chr1835640 1739 973 ------
NM_020791chr1711071 ------
NM_020794chr12583 380 131 ----
NM_020796chr521093 127 ------
NM_020801chr52628 359 12149 ----
NM_020803chr412199 1492 ----
NM_020807chr1641587 1456 361 43 ------
NM_020810chr1423317 690 ------
NM_020824chr101751 ------
NM_020825chr1663682 3139 1310 1107 518 247 ----12758
NM_020834chr1411836 --11929 --
NM_020845chr1222379 780 ------
NM_020856chr191543 --11268 --
NM_020860chr41130 ------
NM_020861chr611148 ------
NM_020865chr3175 ------
NM_020870chr41135 ------
NM_020871chrX1114 12095 ----
NM_020872chr31181 ------
NM_020896chr111856 ------
NM_020899chr172598 34 ------
NM_020943chr2131 ------
NM_020956chr1973846 3523 3381 3205 1473 1278 673 --33643 3397 768 --
NM_020962chr152495 425 --12300 --
NM_020975chr10--11721 ----
NM_020993chr1242174 1045 993 367 ------
NM_020998chr3124 ------
NM_021003chr141691 ------
NM_021007chr211816 ------
NM_021020chr883477 3340 2865 2250 2235 406 206 101 --12925 --
NM_021033chr1312642 --12809 --
NM_021044chr122136 86 ------
NM_021064chr62523 76 1233 ----
NM_021069chr431910 93 60 ------
NM_021072chr511831 ------
NM_021076chr221418 ------
NM_021106chr91528 ------
NM_021120chrX23132 208 ------
NM_021143chr191487 ------
NM_021155chr1952932 2153 862 716 135 --1211 --
NM_021183chrX2831 385 ------
NM_021188chr14----2440 71 --
NM_021192chr2----199 --
NM_021202chr2023023 2696 ------
NM_021218chr92900 764 ------
NM_021229chr12----1323 --
NM_021260chr142498 390 11297 ----
NM_021569chr94970 865 331 140 --1222 11214
NM_021570chr92379 31 ------
NM_021622chr101536 ------
NM_021638chr445009 1882 1840 1348 --1189 11186
NM_021643chr211604 ------
NM_021738chr101307 ------
NM_021813chr635337 5130 498 ------
NM_021814chr61416 ------
NM_021911chr535062 4718 105 13625 ----
NM_021912chr1573935 3861 3454 1665 1193 1061 360 --1908 --
NM_021913chr19192 --11720 --
NM_021914chr1452086 647 343 260 221 ------
NM_021931chr201801 ------
NM_021940chr6------11595
NM_021958chr11136 --1318 --
NM_021961chr1137127 5095 2438 --17423 --
NM_021962chr171151 ------
NM_021964chr314958 12467 ----
NM_021965chr9----165 --
NM_021988chr2031208 543 92 ------
NM_021998chrX11102 ------
NM_022041chr1612618 1470 ----
NM_022042chr44951 933 862 297 --158 --
NM_022048chr1575825 4175 4129 2422 2372 1215 136 ------
NM_022049chr141688 400 191 46 ------
NM_022062chr1111692 ------
NM_022075chr11967 ------
NM_022080chr20----12355 179
NM_022156chr17167 ------
NM_022169chr1111492 ------
NM_022340chr323400 793 --12817 --
NM_022442chr2031208 543 92 ------
NM_022456chr1275648 5288 5154 2879 2748 2107 22 11490 11224 --
NM_022469chr12961 54 13374 ----
NM_022484chr721297 333 ------
NM_022485chr3171 ------
NM_022495chr14----1113 --
NM_022572chr231502 1461 1329 11748 1463 --
NM_022652chr121808 ------
NM_022719chr2242818 2520 1541 330 --131 12756
NM_022737chr1921145 85 ------
NM_022748chr722766 2234 --134 --
NM_022755chr932579 2268 547 ------
NM_022756chr121164 499 11379 ----
NM_022776chr31574 ------
NM_022826chr22448 142 2300 90 ----
NM_022844chr161907 ------
NM_022845chr16--1890 ----
NM_022897chr5--1148 ----
NM_022898chr1424796 3982 ------
NM_022912chr223063 625 ------
NM_022970chr10173 1930 21143 979 --
NM_022977chrX22026 369 ------
NM_023008chr192234 118 ------
NM_023076chr1652301 977 915 813 807 11872 12798 --
NM_023105chr821714 541 ------
NM_023106chr821714 541 ------
NM_023110chr821714 541 ------
NM_023111chr821714 541 ------
NM_023923chr142747 2419 1185 745 1941 23714 876 --
NM_023931chr1641412 462 231 54 ------
NM_024019chr41332 ------
NM_024034chr201266 ------
NM_024046chr331246 881 96 ------
NM_024061chr7143 ------
NM_024117chr941042 1027 902 288 --11061 --
NM_024416chr911515 ------
NM_024511chr423315 2244 --13448 12552
NM_024522chr111353 --128 1488
NM_024524chr322166 1090 --1692 --
NM_024551chr1222316 79 --22308 668 --
NM_024551chr1222316 79 --22308 668 --
NM_024567chr81636 ------
NM_024595chr12992 278 ------
NM_024624chr221328 522 ------
NM_024630chr61808 ------
NM_024631chr11186 ------
NM_024639chr62376 208 12409 ----
NM_024646chr133802 2753 429 ------
NM_024657chrX2125 70 ------
NM_024674chr122584 658 ------
NM_024680chr11--1368 ----
NM_024686chr11403 ------
NM_024689chrX21229 1134 ------
NM_024713chr1531546 1272 551 ------
NM_024721chr832392 2146 762 ------
NM_024722chr17----2551 187 --
NM_024745chr16--11143 ----
NM_024769chr11127 --1806 --
NM_024811chr1111976 ------
NM_024816chr161159 --2430 41 --
NM_024828chr911291 ------
NM_024841chr1112042 ------
NM_024884chr1431078 1065 194 ------
NM_024911chr11100 ------
NM_024920chr421531 203 --11253 --
NM_024947chr328206 3428 28343 3659 11809 --
NM_024953chr121447 12558 ----
NM_024956chr151206 ------
NM_024963chr775030 4612 4513 4448 1584 937 62 --55867 4746 1833 1070 619 --
NM_024989chr237464 2990 2281 --16454 --
NM_024991chr1052593 2394 2352 1196 332 --11150 --
NM_025054chr814040 ------
NM_025058chr11757 ------
NM_025074chr422698 732 ------
NM_025079chr11266 ------
NM_025106chr131775 735 507 ------
NM_025134chr1612504 ------
NM_025146chr3--12270 ----
NM_025179chr113905 1498 14146 11455
NM_025191chr112964 ----12183
NM_025195chr81642 11480 1136 --
NM_025214chr1822773 966 ------
NM_025230chr1421778 1338 --1338 --
NM_025235chr101220 ------
NM_025238chr1511515 ------
NM_025248chr1742811 1209 546 104 --12862 --
NM_025251chr841182 939 313 153 --1206 --
NM_030593chr19126 ------
NM_030594chr15133 ----1361
NM_030621chr1433785 3020 631 ------
NM_030625chr1022115 26 --12351 --
NM_030629chr162369 340 ------
NM_030648chr434775 297 103 ------
NM_030650chr224161 4027 ------
NM_030661chr721357 496 11323 ----
NM_030665chr1721147 1060 ------
NM_030674chr1225571 3680 1858 ----
NM_030761chr132695 2588 2143 ------
NM_030762chr12----1439 --
NM_030802chr17--1718 ----
NM_030816chr112509 ------
NM_030885chr312165 --1167 --
NM_030915chr222276 1611 ------
NM_030918chr144552 3975 3344 1755 ------
NM_030962chr112560 472 ------
NM_030964chr523368 341 --22911 2804 --
NM_031157chr121423 ------
NM_031243chr72881 244 ------
NM_031268chr1644932 3445 1809 967 --23365 76 --
NM_031296chr41133 ------
NM_031302chr12----1395 --
NM_031309chr842132 1440 502 434 ------
NM_031371chr111041 ------
NM_031371chr111041 ------
NM_031439chr81740 --1292 --
NM_031442chrX22917 56 12938 --12846
NM_031445chr232698 772 532 --171 --
NM_031453chr10----1160 --
NM_031844chr113365 ------
NM_031889chr411363 ------
NM_032052chr22251 34 ------
NM_032088chr52708 352 ------
NM_032092chr52708 352 ------
NM_032102chr1132035 736 694 12171 ----
NM_032108chr193637 367 199 --121 --
NM_032109chr53596 284 88 ----1397
NM_032121chrX22455 411 21100 562 11839 --
NM_032144chr211125 ------
NM_032160chr1813256 ------
NM_032182chr1031627 1101 384 ------
NM_032199chr103411 230 157 ------
NM_032208chr213562 11225 ----
NM_032228chr112583 345 ------
NM_032239chr441451 1110 560 310 ------
NM_032270chr1135 ------
NM_032281chr1932386 1234 1150 12263 ----
NM_032294chr1731395 500 49 11486 ----
NM_032343chr3----1188 --
NM_032373chr1044044 3910 1521 789 ------
NM_032403chr52708 352 ------
NM_032420chr52665 246 1597 ----
NM_032424chr11--1150 ----
NM_032440chr1022143 404 --1869 --
NM_032446chr5------1920
NM_032457chr413177 ------
NM_032505chr3--1781 --1348
NM_032523chr21553 ------
NM_032557chr4--140 ----
NM_032564chr112999 660 ------
NM_032622chr4--11460 --11599
NM_032682chr32900 366 ------
NM_032737chr1942309 2281 1924 1053 22654 2183 ----
NM_032765chr5----1375 --
NM_032777chr821454 1117 --11576 --
NM_032784chr6154 ------
NM_032827chr251123 970 155 117 107 ------
NM_032840chr122906 151 ------
NM_032905chr1011045 ------
NM_032968chrX22828 2634 ------
NM_032969chrX22828 2634 ------
NM_032973chrY22823 2633 ------
NM_032983chr74563 499 301 175 ------
NM_033012chr13----1771 --
NM_033014chr911515 ------
NM_033018chrX2408 43 ------
NM_033082chr12--174 ----
NM_033089chr201134 ------
NM_033125chr6151 ------
NM_033127chr1----1123 --
NM_033132chr131465 ------
NM_033133chr1733375 3212 2498 --13111 --
NM_033136chr531639 1412 1321 11455 ----
NM_033137chr531639 1412 1321 11455 ----
NM_033141chr1411980 ------
NM_033143chr4150 ------
NM_033181chr62992 328 13364 ----
NM_033211chr521723 44 ------
NM_033224chr745228 5107 1710 721 16886 ----
NM_033225chr82302 227 --1336 --
NM_033272chr21349 ------
NM_033285chr821766 181 ------
NM_033300chr11973 ------
NM_033310chr112299 59 ------
NM_033315chr1722156 859 ------
NM_033360chr121344 ------
NM_033375chr1741245 1051 999 258 ------
NM_033387chr932447 1031 137 ------
NM_033393chr45880 706 545 411 130 ------
NM_033449chr52357 258 ------
NM_033503chr1542899 2779 1340 1243 ------
NM_033505chr232116 1055 471 16042 ----
NM_033540chr311112 1978 1743 --
NM_033551chr531146 954 688 ------
NM_033624chr1221535 308 --174 --
NM_033626chrX31306 1190 491 ------
NM_033642chrX1481 ------
NM_033644chr51122 171 ----
NM_033645chr51122 171 ----
NM_052820chr92484 393 --1226 --
NM_052832chr812776 ------
NM_052851chr131618 1118 --22038 559
NM_052855chr17290 82 ------
NM_052865chr201335 ------
NM_052876chr1942731 505 476 464 ------
NM_052879chr12--12561 ----
NM_052882chr19----1199 --
NM_052892chr16140 162 ----
NM_052907chr1231507 188 35 ------
NM_052917chr22358 37 ------
NM_052937chr812287 125 ----
NM_052954chr21158 ------
NM_052971chr51141 ------
NM_052996chr162489 332 ----11438
NM_054016chr11640 ------
NM_054016chr11640 ------
NM_054016chr11640 ------
NM_057159chr91576 2997 435 ----
NM_057164chr21591 ------
NM_057165chr21591 ------
NM_057166chr21591 ------
NM_057167chr21591 ------
NM_057169chr1222081 1972 --23025 2045 --
NM_057170chr1222081 1972 --23025 2045 --
NM_057175chr422129 609 ------
NM_057178chr172155 134 12051 ----
NM_058172chr421429 1288 --1636 --
NM_058175chr214332 258 226 101 ------
NM_058241chr2----1301 --
NM_058241chr2----1301 --
NM_058243chr193245 229 200 --1102 --
NM_078469chr102557 442 ------
NM_078485chr6140 ------
NM_080491chr112597 240 ----11365
NM_080546chr921652 658 ------
NM_080599chr10----1193 --
NM_080616chr201598 ------
NM_080629chr11572 --1144 --
NM_080630chr11572 --1144 --
NM_080759chr1311623 ------
NM_080760chr1311623 ------
NM_080792chr2021671 1641 --1787 --
NM_080927chr311258 ------
NM_130387chr311235 ------
NM_130388chrX----132 --
NM_130439chr1031863 1751 313 ------
NM_130439chr1031863 1751 313 ------
NM_130440chr131460 1372 1276 ------
NM_130442chr72837 81 ------
NM_130459chr91253 --1262 --
NM_130787chr191352 --1121 --
NM_130795chr91528 ------
NM_130798chr1511358 1224 ----
NM_130846chr121893 ------
NM_133171chr201266 ------
NM_133172chr5--145 ----
NM_133173chr5--145 ----
NM_133174chr5--145 ----
NM_133264chr1713140 --12408 --
NM_133265chrX11304 ------
NM_133378chr22774 382 ------
NM_133432chr22774 382 ------
NM_133437chr22774 382 ------
NM_133468chr72768 494 ------
NM_133476chr122867 479 ------
NM_133478chr21746 ------
NM_133499chrX1912 ------
NM_133631chr321287 77 --154 --
NM_133637chr21313 ------
NM_133647chr1531512 923 247 ------
NM_134268chr172914 74 ------
NM_134421chr24562 195 152 77 ------
NM_134424chr1241116 1002 432 405 ------
NM_134427chr91528 ------
NM_138277chr6----1175 --
NM_138288chr1411381 ------
NM_138338chr2243368 2660 2345 643 ------
NM_138340chr181227 ------
NM_138353chr191175 ------
NM_138426chr712296 ------
NM_138441chr6185 ------
NM_138444chr1331660 828 745 ------
NM_138473chr1231923 357 234 --13628 --
NM_138558chr111213 ------
NM_138559chr22268 43 ------
NM_138569chr61242 ------
NM_138576chr1424796 3982 ------
NM_138638chr1452086 647 343 260 221 ------
NM_138713chr1612448 17659 11385 --
NM_138714chr1612448 17659 11385 --
NM_138779chr13159 ------
NM_138799chr231358 624 200 ------
NM_138931chr31677 ------
NM_138971chr1142843 2804 1134 131 ------
NM_138971chr1142843 2804 1134 131 ------
NM_138972chr1142843 2804 1134 131 ------
NM_138972chr1142843 2804 1134 131 ------
NM_138973chr1142843 2804 1134 131 ------
NM_138973chr1142843 2804 1134 131 ------
NM_139058chrX----1313 --
NM_139068chr52256 70 --1102 --
NM_139069chr52256 70 --1102 --
NM_139070chr51125 ------
NM_139135chr12378 195 ------
NM_139159chr191515 --1162 --
NM_139207chr1222149 1579 ------
NM_139316chr71110 ------
NM_144488chr91528 ------
NM_144489chr91528 ------
NM_144568chr141706 ------
NM_144571chr444598 4351 809 427 --11206 --
NM_144578chr1414384 --2449 28 --
NM_144579chr242639 2560 2490 993 11004 ----
NM_144599chr1515043 ------
NM_144618chr141358 1225 1094 366 ------
NM_144633chr31559 ------
NM_144641chr321152 792 --1378 --
NM_144664chr1111824 ------
NM_144728chr12656 180 ------
NM_144729chr12656 180 ------
NM_144778chr131649 ------
NM_144949chr21857 --1563 --
NM_144973chr1213875 11652 ----
NM_144974chr131176 ------
NM_144994chr231500 459 26 --1531 --
NM_145036chr171293 ------
NM_145112chr1411129 --1378 --
NM_145113chr1411401 ------
NM_145185chr19----12020 --
NM_145203chr131882 ------
NM_145206chr1022688 2665 --13276 --
NM_145253chr163675 650 154 --159 --
NM_145276chr192968 325 ------
NM_145279chr121306 398 ------
NM_145296chr191632 --2164 137 --
NM_145307chr1034278 3051 1579 --11875 --
NM_145313chr1041656 1314 402 22 --2488 379 --
NM_145331chr61542 ------
NM_145349chr1742041 1906 1497 51 --1612 --
NM_145350chr1721393 1258 ------
NM_145638chr111856 ------
NM_145698chr1011371 ------
NM_145714chr161346 ------
NM_145716chr1253 21 ------
NM_145733chr22--11082 ----
NM_145739chr21553 ------
NM_145808chr71959 ------
NM_145859chr31254 ------
NM_145860chr31254 ------
NM_145868chr10----1199 --
NM_145869chr10----1199 --
NM_145893chr16126 ------
NM_145912chr2243757 3287 1553 300 --14415 1424
NM_146388chr193927 915 139 ------
NM_147147chr663764 3662 1553 1332 314 226 ------
NM_147156chr10166 ------
NM_147161chr12822 327 ------
NM_147189chr81794 ------
NM_147223chr2145 --1796 --
NM_147233chr2----1613 --
NM_148414chr161429 ------
NM_148415chr161369 ------
NM_148416chr161346 ------
NM_148894chr42327 61 ------
NM_148921chr172843 46 ------
NM_148955chr1585781 5577 4599 4462 4302 2614 1266 36 ------
NM_152221chr222283 181 ------
NM_152236chr221210 ------
NM_152237chr2231704 1398 349 ------
NM_152253chr2222696 25 11735 33345 2668 742 --
NM_152261chr12----1599 --
NM_152271chr81998 ------
NM_152380chr111217 ------
NM_152407chr5--12707 ----
NM_152424chrX33712 3074 1673 ------
NM_152470chr1833809 3658 3337 13525 ----
NM_152519chr211477 ------
NM_152553chr61186 ------
NM_152556chr712270 ------
NM_152594chr15--1165 ----
NM_152605chr1921319 63 ------
NM_152622chr512614 --1679 --
NM_152636chr1122327 1182 ------
NM_152638chr1211145 ------
NM_152660chr1----1676 --
NM_152678chr332374 929 794 12670 ----
NM_152682chr411137 ------
NM_152686chr532331 1979 1746 1269 ----
NM_152688chr61763 ----1791
NM_152699chr333784 2992 1108 ------
NM_152704chr131370 ------
NM_152707chr101186 ------
NM_152722chr1151477 1299 530 414 28 ------
NM_152733chr696356 6117 4636 4134 4091 2273 1734 1687 1294 ------
NM_152745chr71808 ------
NM_152754chr723706 2691 ------
NM_152756chr5----23152 405 --
NM_152758chr8--160 ----
NM_152787chrX21545 641 --32645 2566 677 --
NM_152789chr71147 ------
NM_152826chr1585781 5577 4599 4462 4302 2614 1266 36 ------
NM_152835chr11478 11906 1851 --
NM_152860chr121167 ------
NM_152868chr22157 ------
NM_152879chr232549 758 83 --1737 --
NM_152924chr1556377 5619 5229 2158 585 --25535 1649 --
NM_152991chr111500 ------
NM_153026chr121431 ------
NM_153029chr1673884 2748 2656 1627 940 849 825 --21509 405 14127
NM_153035chr112410 13013 23147 71 --
NM_153188chr524548 1848 14684 --1370
NM_153208chr161746 ------
NM_153226chr102922 431 ------
NM_153235chr61418 ------
NM_153257chr1911177 ------
NM_153331chr31650 ------
NM_153342chr21382 ------
NM_153346chrX32075 1988 1690 1659 ----
NM_153367chr1043528 1580 1508 52 --13898 --
NM_153464chr19----142 --
NM_153499chr1232712 2425 292 ------
NM_153500chr1232712 2425 292 ------
NM_153613chr15159 ------
NM_153619chr1521153 536 1951 ----
NM_153631chr721357 496 11323 ----
NM_153632chr721357 496 11323 ----
NM_153687chr122550 82 ------
NM_153698chr9158 ------
NM_153712chr253580 2813 2438 1430 393 11340 12823 --
NM_153746chr61808 ------
NM_153809chr91598 ------
NM_153816chr6--1333 ----
NM_153831chr8121 ------
NM_170662chr31489 ------
NM_170665chr1254218 3242 1446 1301 657 --11476 --
NM_170679chr5--11025 ----
NM_170695chr181365 --1434 --
NM_170696chr1521588 39 ------
NM_170697chr1521588 39 ------
NM_170711chr192187 174 --1196 --
NM_170712chr31710 ------
NM_170713chr31710 ------
NM_170714chr31710 ------
NM_170751chr61116 ----11182
NM_170752chr61116 ----11182
NM_172058chr81308 1171 ----
NM_172059chr81308 1171 ----
NM_172060chr81308 1171 ----
NM_172071chr127284 1228 12074 1292 --
NM_172103chr6172 ------
NM_172105chr6172 ------
NM_172115chr41129 ------
NM_172206chr1731395 500 49 11486 ----
NM_172226chr1232712 2425 292 ------
NM_172240chr121507 ------
NM_172375chr142310 36 --1259 --
NM_173074chr2154 ------
NM_173076chr21674 ------
NM_173198chr912825 ------
NM_173199chr91125 ------
NM_173200chr912825 ------
NM_173207chr181365 --1434 --
NM_173208chr181365 --1434 --
NM_173209chr181365 --1434 --
NM_173210chr181365 --1434 --
NM_173211chr181365 --1434 --
NM_173214chr1612448 17659 11385 --
NM_173454chr1511078 ------
NM_173470chrX12860 1797 ----
NM_173505chr1821126 106 ------
NM_173576chr101308 1483 ----
NM_173582chr1166082 5817 5248 5114 4067 1256 ------
NM_173595chr1221985 267 --15072 --
NM_173602chr1213422 --13816 --
NM_173808chr124096 3566 ------
NM_173822chr221731 255 ------
NM_173830chr6--1152 ----
NM_173832chr832957 2864 2464 22637 1369 23770 3416 --
NM_173833chr8193 ------
NM_173834chrX1430 ------
NM_173851chr823950 2721 ------
NM_174886chr181365 --1434 --
NM_174911chr811339 13259 ----
NM_174938chr9167 1437 ----
NM_174963chr12706 208 ------
NM_174964chr12706 208 ------
NM_174965chr12725 227 ------
NM_174966chr12706 208 ------
NM_174967chr12725 227 ------
NM_174968chr12706 208 ------
NM_174969chr12706 208 ------
NM_174970chr12725 227 ------
NM_174971chr12706 208 ------
NM_175038chr121237 ------
NM_175061chr71461 1775 ----
NM_175623chr1275648 5288 5154 2879 2748 2107 22 11490 11224 --
NM_175848chr20------11414
NM_175848chr20------11414
NM_175849chr20------11414
NM_175849chr20------11414
NM_175850chr20------11414
NM_175850chr20------11414
NM_175884chr721405 190 --2297 21 --
NM_175907chr181305 1230 ----
NM_175931chr162307 254 --191 --
NM_177414chr11377 ------
NM_177438chr1433785 3020 631 ------
NM_177452chr1412463 11841 ----
NM_177952chr141691 ------
NM_177972chr1123621 922 14340 ----
NM_177990chr2021649 817 ------
NM_177996chr2022212 98 ------
NM_178006chr131618 1118 --22038 559
NM_178007chr131618 1118 --22038 559
NM_178034chr152745 276 --1349 --
NM_178037chr1243554 3419 2666 1297 12571 1770 --
NM_178038chr1243554 3419 2666 1297 12571 1770 --
NM_178126chr1741770 513 364 186 ------
NM_178140chr512654 ------
NM_178151chrX21827 858 --15300 --
NM_178152chrX21827 858 --15300 --
NM_178153chrX21827 858 --15300 --
NM_178313chr231463 829 168 11801 ----
NM_178314chr123309 188 27 1769 ----
NM_178426chr122204 833 --12363 --
NM_178427chr122104 733 --12263 --
NM_178441chr142498 390 11297 ----
NM_178526chr1931926 391 252 --1448 --
NM_178566chr911893 ------
NM_178586chr142950 391 --11754 --
NM_178819chr8----1237 --
NM_178860chr173918 168 125 ------
NM_180976chr62196 106 --1258 --
NM_180977chr62196 106 --1258 --
NM_180989chr131313 ------
NM_181054chr141478 ------
NM_181291chr145602 485 158 115 77 ------
NM_181357chr1421778 1338 --1338 --
NM_181358chr11268 ------
NM_181481chr18--15118 15360 --
NM_181482chr18--15118 15360 --
NM_181483chr18--15118 15360 --
NM_181504chr522674 967 13133 1559 --
NM_181523chr522674 967 13133 1559 --
NM_181524chr522674 967 13133 1559 --
NM_181571chr10--1435 ----
NM_181655chr172669 44 ------
NM_181656chr172878 253 ------
NM_181672chrX----11495 --
NM_181673chrX----11495 --
NM_181702chr8--1311 ----
NM_181715chr11129 ----1314
NM_181746chr11967 ------
NM_181782chr61350 ------
NM_181784chr242308 2242 1871 161 --11771 --
NM_181838chr52480 102 ------
NM_182314chrX21512 1360 ------
NM_182509chr1451511 361 296 169 149 11335 ----
NM_182543chr10------1253
NM_182606chr41884 ------
NM_182641chr171337 --1417 --
NM_182643chr822136 975 ------
NM_182649chr20159 ------
NM_182691chr711353 ------
NM_182692chr711353 ------
NM_182697chr711378 ------
NM_182717chr101283 ------
NM_182718chr10--1435 ----
NM_182719chr10--1435 ----
NM_182720chr101283 ------
NM_182721chr101283 ------
NM_182722chr101283 ------
NM_182723chr101283 ------
NM_182724chr10--1435 ----
NM_182725chr10--1435 ----
NM_182763chr112599 ------
NM_182764chr201266 ------
NM_182769chr10--1435 ----
NM_182770chr10--1435 ----
NM_182771chr10--1435 ----
NM_182772chr10--1435 ----
NM_182797chr20----1346 --
NM_182850chr10--1435 ----
NM_182853chr101283 ------
NM_182898chr721485 220 ------
NM_182899chr721485 220 ------
NM_182915chr222234 743 ------
NM_182917chr31284 ------
NM_182943chr3161 ------
NM_183004chr1433578 2617 989 ------
NM_183011chr101283 ------
NM_183012chr101283 ------
NM_183013chr101283 ------
NM_183058chr10166 ------
NM_183060chr10--1435 ----
NM_183373chr62132 114 ------
NM_183393chr32745 395 ------
NM_183394chr32745 395 ------
NM_183416chr12605 499 1330 ----
NM_194278chr1433449 3398 143 ------
NM_194282chr422630 1021 ------
NM_194285chr111248 ------
NM_194317chr2--12720 ----
NM_194356chr1251982 1602 283 217 29 --11695 --
NM_197941chr532544 2057 1963 --1886 --
NM_197966chr221900 ------
NM_197967chr221900 ------
NM_198057chrX----1882 --
NM_198074chr13420 344 317 ------
NM_198089chr191697 ------
NM_198128chr1811634 ------
NM_198158chr32345 202 ------
NM_198159chr32345 202 ------
NM_198177chr32345 202 ------
NM_198178chr32345 202 ------
NM_198240chr1221256 261 ------
NM_198241chr31284 ------
NM_198242chr31284 ------
NM_198244chr31284 ------
NM_198268chr11268 ------
NM_198269chr11268 ------
NM_198317chr1391 70 39 ------
NM_198334chr112376 360 ------
NM_198335chr112376 360 ------
NM_198390chr162369 340 ------
NM_198391chr20----1210 --
NM_198392chr61420 --22089 1768 --
NM_198395chr52978 945 ------
NM_198399chr311461 ------
NM_198521chr12152 ------
NM_198595chr445009 1882 1840 1348 --1189 11186
NM_198597chr101979 ------
NM_198793chr311464 --1297 --
NM_198829chr731276 998 51 ------
NM_198880chr32737 578 ------
NM_198902chr151333 ------
NM_198935chr2052696 2533 2259 158 119 ------
NM_198965chr12--1374 ----
NM_198966chr12--1374 ----
NM_198968chr1323274 3097 --13311 --
NM_198971chr11----196 --
NM_198993chr172382 41 ------
NM_199000chr73612 504 97 ------
NM_199003chr811066 ------
NM_199040chr1211391 13843 31379 224 87 --
NM_199131chr1042385 953 604 33 --182 --
NM_199133chr52325 286 ------
NM_199138chr131370 ------
NM_199144chr2031208 543 92 ------
NM_199188chr12--12561 ----
NM_199189chr51861 ------
NM_199190chr12--12561 ----
NM_199203chr2031208 543 92 ------
NM_199262chr173435 411 68 --12036 --
NM_199320chr412149 ------
NM_199320chr412149 ------
NM_199324chr422918 476 ------
NM_199334chr171360 --1462 --
NM_199368chr20159 ------
NM_199436chr211184 ------
NM_199478chrX--1241 ----
NM_199482chr221498 237 ------
NM_201280chr621582 1234 ------
NM_201378chr8--178 1947 --
NM_201379chr8--178 1947 --
NM_201380chr8--178 1947 --
NM_201381chr8--178 1947 --
NM_201382chr8--178 1947 --
NM_201383chr8--178 1947 --
NM_201384chr8--178 1947 --
NM_201403chr121306 398 ------
NM_201413chr2111038 --1157 --
NM_201414chr2111038 --1157 --
NM_201432chr1766111 5006 4641 696 614 80 11662 11610 --
NM_201433chr1766111 5006 4641 696 614 80 11662 11610 --
NM_201516chr71930 ------
NM_201526chr151726 ------
NM_201567chr33209 188 130 ------
NM_201591chr411280 ------
NM_201592chr411280 ------
NM_201630chr13508 497 78 ------
NM_201999chr41836 ------
NM_203290chr61170 ------
NM_203303chrX1196 ------
NM_203305chr93999 439 115 --1373 --
NM_203327chr2043762 3600 2991 468 11148 --14306
NM_203341chr11431 ------
NM_203346chr24797 492 147 108 ------
NM_203350chr11115 ------
NM_203351chr171361 --11599 --
NM_203364chr1121223 483 1382 ----
NM_203372chr22593 126 ------
NM_203391chrX--1735 ----
NM_203399chr1----1646 --
NM_203401chr1----1646 --
NM_203446chr211219 ------
NM_203456chr12130 47 ------
NM_203487chr1311298 ------
NM_205836chr5----1187 --
NM_206594chr123643 614 ------
NM_206595chr123643 614 ------
NM_206853chr623859 1242 ------
NM_206854chr625120 3407 ------
NM_206855chr656085 4372 4200 947 858 --1910 --
NM_206866chr2112519 12408 ----
NM_206909chr822884 433 ------
NM_206925chr1532265 2245 1800 ----12333
NM_207042chr11444 --135 --
NM_207045chr11444 --135 --
NM_207046chr11444 --135 --
NM_207171chr121738 199 11816 ----
NM_207303chr1022828 359 ------
NM_207304chr131536 ------
NM_207306chr134106 345 162 --11616 --
NM_207313chr171804 ------
NM_207321chr1021071 710 ------
NM_207325chr1911628 ------
NM_207343chr11----1444 --
NM_207351chr32252 40 ------
NM_207396chr131554 1440 382 --21734 234 --
NM_207397chr11813 --1700 --
NM_207518chr1911124 1376 ----
NM_212460chr71140 --1543 --
NM_212464chr1531562 704 237 21744 264 ----
NM_212469chr111915 ------
NM_212551chr11905 ------
NM_213606chr1021791 477 --11925 --
NM_213613chr44951 933 862 297 --158 --