TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3187-3p
miRNA Sequence: UUGGCCAUGGGGCUGCGCGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr52826 36 ------
NM_000021chr1431104 962 322 ------
NM_000038chr52772 581 ------
NM_000070chr151540 ------
NM_000084chrX116575 6182 6066 5803 5746 5024 4317 4309 2285 2073 1645 12629 24470 2796 --
NM_000090chr2--1642 ----
NM_000091chr222208 1165 --11764 12703
NM_000092chr213837 24166 30 14054 --
NM_000110chr121106 193 ------
NM_000112chr545120 3745 1765 114 12065 13673 --
NM_000115chr1322500 1733 ----12384
NM_000125chr683702 1368 1238 1125 1050 396 136 120 --13298 --
NM_000129chr61602 155 21169 298 --
NM_000138chr1541934 1023 788 279 ------
NM_000163chr542289 1981 1719 1711 1669 2573 303 --
NM_000176chr533263 2985 2791 11460 21148 962 --
NM_000217chr1253802 3502 1860 1119 734 ------
NM_000232chr462581 2500 2492 2261 1291 135 ------
NM_000237chr821831 1777 2214 188 ----
NM_000248chr322993 2725 ------
NM_000259chr1545003 4263 1750 848 11135 ----
NM_000280chr113798 334 102 ------
NM_000289chr122391 143 --142 --
NM_000297chr411607 --11810 --
NM_000314chr1022883 633 2449 375 ----
NM_000319chr1211148 ------
NM_000321chr1321129 300 --196 --
NM_000332chr687044 5326 5198 4678 2880 2075 1880 800 26224 6050 26773 4571 16197
NM_000337chr5125797 2216 2153 1973 1892 1625 1540 1343 856 803 608 593 36318 4287 527 ----
NM_000338chr1511101 ------
NM_000340chr3----21196 431 --
NM_000346chr1721661 241 2258 232 11239 132
NM_000378chr1131020 905 857 ------
NM_000386chr171661 ------
NM_000391chr1141355 449 414 25 --11645 --
NM_000399chr1031098 953 470 1267 ----
NM_000401chr11--11061 ----
NM_000408chr213236 1594 13104 --
NM_000430chr1742668 2374 382 247 ------
NM_000437chr152103 1755 1696 825 635 --21704 784 --
NM_000448chr1133100 2589 2567 --12070 --
NM_000449chr131221 507 87 ------
NM_000461chr331817 1079 520 ------
NM_000480chr1131116 410 318 41461 1331 69 59 ----
NM_000489chrX13298 ------
NM_000503chr811480 ------
NM_000508chr4--1875 ----
NM_000530chr1----170 --
NM_000555chrX97217 6584 5482 5126 5074 4883 4784 1604 1594 1704 26747 2449 --
NM_000600chr72259 50 ----1335
NM_000609chr1023011 691 --1369 --
NM_000611chr1196944 6526 6049 6036 4931 4699 2373 1898 1791 24546 139 24974 4302 11327
NM_000615chr1132213 2165 1920 ----12681
NM_000618chr1246381 5498 4695 199 21523 942 16567 14371
NM_000618chr1246381 5498 4695 199 21523 942 16567 14371
NM_000621chr1321170 433 ------
NM_000633chr1885162 5048 4222 3414 1996 1861 1356 389 --23257 1312 --
NM_000701chr1----1319 --
NM_000726chr211386 182 ----
NM_000756chr81446 ------
NM_000767chr1921226 69 21192 382 ----
NM_000792chr1----2993 904 --
NM_000801chr202922 715 ----1327
NM_000806chr511982 ------
NM_000807chr4----1658 --
NM_000813chr575603 4041 2007 1162 585 346 238 23905 682 15409 --
NM_000818chr101195 ------
NM_000826chr422585 899 12291 ----
NM_000827chr511937 ------
NM_000831chr144356 1831 749 456 --15210 24848 1542
NM_000834chr12--21164 495 1867 --
NM_000845chr71411 ------
NM_000855chr111232 ------
NM_000868chrX11883 ------
NM_000875chr15126999 6440 6049 5997 4772 4757 4653 2360 2098 1922 893 424 25543 4405 11841 16810
NM_000880chr8------1120
NM_000891chr1731012 514 52 191 ----
NM_000899chr1243362 1631 933 340 ------
NM_000901chr432258 2170 1695 --11886 --
NM_000909chr4121 ----1822
NM_000912chr841354 544 321 133 --12312 --
NM_000926chr11108037 7839 7807 7329 6674 3218 2496 2360 770 58 11258 13712 --
NM_000944chr41957 --1524 --
NM_000950chrX--12862 12453 12284
NM_000965chr31349 ------
NM_000983chr111641 11631 ----
NM_001001132chr2111111 ------
NM_001001323chr1222569 562 ------
NM_001001331chr331884 831 497 ------
NM_001001342chr1041153 389 164 118 ------
NM_001001344chrX12442 22449 837 1679 12222
NM_001001433chr2023064 3026 ------
NM_001001481chr812520 12844 ----
NM_001001484chr1011663 ------
NM_001001557chr841790 611 525 229 ------
NM_001001664chr212838 ----13292
NM_001001668chr1933839 3420 3199 13233 ----
NM_001001684chr1732130 913 279 12039 ----
NM_001001890chr2143953 1633 1568 1415 ------
NM_001002257chr253520 3258 3243 1324 969 ------
NM_001002265chr101275 ------
NM_001002266chr101275 ------
NM_001002843chr1531064 871 457 ------
NM_001002876chr222163 51 1429 ----
NM_001002909chr1741788 1770 705 382 ------
NM_001002919chr2--1481 ----
NM_001003406chr2283257 2681 2605 2498 2159 392 184 174 12843 ----
NM_001003652chr1848010 7685 2788 2174 28584 3179 12970 --
NM_001003674chr1832496 2386 1750 17058 --12810
NM_001003675chr1832496 2386 1750 17058 --12810
NM_001003679chr13626 321 297 ------
NM_001003712chr1223840 1017 1769 13811 1568
NM_001003760chr621391 148 13165 --1222
NM_001003792chr321166 184 ----11064
NM_001003793chr321166 184 ----11064
NM_001003794chr372983 1105 448 436 78 64 29 ------
NM_001003800chr951447 788 710 620 477 13251 ----
NM_001003895chrY174 ------
NM_001003937chr241449 537 513 411 ------
NM_001004304chr1283036 2956 2712 854 797 729 157 74 1978 11145 --
NM_001004342chr194250 4206 2432 2291 2040 1763 1144 974 639 ------
NM_001004360chr22402 338 11228 ----
NM_001004419chr1221683 347 ------
NM_001005375chrY11390 ------
NM_001005404chr1763444 2876 910 695 607 338 ------
NM_001005463chr1031967 1025 313 ------
NM_001005473chr575890 5536 5108 4093 2446 1755 536 --16555 --
NM_001005474chr321140 24 --1575 --
NM_001005505chr331358 1242 124 --1437 --
NM_001005609chrX43708 3403 888 577 --23339 686 --
NM_001005746chr211386 182 ----
NM_001005747chr211386 182 ----
NM_001005781chr2198 ------
NM_001005845chr811832 --11213 --
NM_001006623chr252549 2366 2299 742 356 1209 1114 --
NM_001006634chr161508 ------
NM_001007024chr1733374 1318 1007 --1152 --
NM_001007025chr1733374 1318 1007 --1152 --
NM_001007067chr82968 136 ------
NM_001007068chr82968 136 ------
NM_001007069chr82968 136 ------
NM_001007070chr82968 136 ------
NM_001007098chr11306 --1950 --
NM_001007099chr11245 ------
NM_001007100chr11245 ------
NM_001007102chr611034 1448 ----
NM_001007245chr71227 ------
NM_001007246chr2111673 21476 596 ----
NM_001007466chr623805 1192 24338 72 1916 11297
NM_001007538chr1331745 1474 114 ----1578
NM_001008220chr5103895 3462 2990 2806 2595 819 618 512 440 130 31019 947 854 ----
NM_001008222chrX71306 1240 1143 878 506 430 264 ------
NM_001008239chr1833732 1375 868 --13547 --
NM_001008392chr373283 3161 2825 1322 1295 1171 130 ----13201
NM_001008408chr794702 4659 4095 1785 902 851 800 745 717 15523 12172 --
NM_001008529chr1721301 228 ------
NM_001008541chr1052118 1990 1948 1739 402 ------
NM_001008541chr1052118 1990 1948 1739 402 ------
NM_001008707chr142421 66 --1318 --
NM_001008738chr542473 2007 367 167 ------
NM_001008895chr131584 ------
NM_001008925chr413286 ------
NM_001009554chr434119 2965 1633 --13561 --
NM_001009554chr434119 2965 1633 --13561 --
NM_001009899chr385565 5492 4075 3959 2518 2316 2180 1542 32137 1490 433 ----
NM_001009909chr1153949 3794 2679 2585 1576 ------
NM_001009958chr72231 173 ------
NM_001010861chr111070 1849 ----
NM_001010867chr1156643 6366 5954 2193 2185 2020 1627 1476 1448 1417 1156 1082 1005 321 218 ------
NM_001010888chrX43690 617 522 210 ----23563 1430
NM_001010891chr566783 6417 5665 5578 4189 1484 34934 1748 23 1880 --
NM_001010908chr10------156
NM_001010927chr61197 ------
NM_001010942chr1211015 11174 ----
NM_001010986chrX22019 1951 1947 --1165
NM_001011538chr42859 387 1925 1762 --
NM_001012426chr642749 2380 425 412 11164 12271 --
NM_001012427chr642749 2380 425 412 11164 12271 --
NM_001012751chr1021810 403 ------
NM_001012755chrX45119 1387 626 78 21670 1345 31015 908 454 --
NM_001012756chr1923140 2540 12632 13174 --
NM_001012761chr512530 ------
NM_001012989chrX1637 ------
NM_001013031chr1052490 1167 551 521 512 --12363 --
NM_001013399chr621108 364 ------
NM_001013415chr421203 321 ------
NM_001013437chr18--1345 ----
NM_001013439chr31254 ------
NM_001013620chr12--12986 23384 476 27012 680
NM_001014380chr1335707 5660 5644 11068 15391 11366
NM_001014797chr1067353 6459 5435 2424 2276 477 1860 1536 2596 60
NM_001015877chrX12022 12070 ----
NM_001017395chr342733 2542 709 545 ------
NM_001017396chr221733 388 ------
NM_001018050chr2273475 3062 3001 950 763 595 567 --21298 52 --
NM_001018052chr2273475 3062 3001 950 763 595 567 --21298 52 --
NM_001018054chr11435 11355 1271 --
NM_001018064chr91577 --11748 --
NM_001018065chr985564 5389 3881 2342 1490 1451 1313 108 45708 5651 5243 1442 11327 --
NM_001018066chr985564 5389 3881 2342 1490 1451 1313 108 45708 5651 5243 1442 11327 --
NM_001018067chr144605 3684 947 686 1905 --1463
NM_001018068chr144605 3684 947 686 1905 --1463
NM_001018069chr144605 3684 947 686 1905 --1463
NM_001018074chr533263 2985 2791 11460 21148 962 --
NM_001018075chr533263 2985 2791 11460 21148 962 --
NM_001018076chr533263 2985 2791 11460 21148 962 --
NM_001018077chr533263 2985 2791 11460 21148 962 --
NM_001018108chr1561995 1787 1740 1548 1395 661 1628 ----
NM_001024094chr533263 2985 2791 11460 21148 962 --
NM_001024455chrX31979 1060 306 ----12227
NM_001024463chr151222 21012 211 ----
NM_001024647chr1276386 6343 5147 5135 4778 444 50 25227 1391 ----
NM_001024680chr211568 11648 ----
NM_001024688chr831443 577 118 ------
NM_001024845chr17842 414 301 291 131 107 23 ------
NM_001024858chr1442823 1078 823 537 --1499 --
NM_001024934chr6178 1228 ----
NM_001024935chr6178 1228 ----
NM_001024936chr6178 1228 ----
NM_001024948chr123530 2308 13182 ----
NM_001025077chr1036492 1283 499 1621 --16635
NM_001025105chr5----11266 --
NM_001025107chr142642 2477 2141 196 --183 --
NM_001025107chr142642 2477 2141 196 --183 --
NM_001025108chr232786 1486 47 1986 ----
NM_001025233chr1262683 2278 1923 1908 1785 453 ------
NM_001025266chr364454 3927 1794 1446 588 299 11742 14261 --
NM_001025389chr1131116 410 318 41461 1331 69 59 ----
NM_001025390chr1131116 410 318 41461 1331 69 59 ----
NM_001025579chr172368 281 ------
NM_001025580chrX44256 4188 3162 1114 ------
NM_001025595chr4----1260 --
NM_001025603chr131221 507 87 ------
NM_001025616chr4287 30 ------
NM_001025780chr9--11075 ----
NM_001029858chr662987 1138 1088 1073 937 41 ----12437
NM_001029863chr622287 1979 --12386 --
NM_001029870chr44488 409 332 105 ------
NM_001030006chr1732497 565 279 22372 625 ----
NM_001030007chr1621596 644 --1849 --
NM_001030055chr1453471 1147 1006 788 716 21350 659 ----
NM_001030272chr11----1330 --
NM_001030273chr11----1330 --
NM_001031690chr752894 2274 511 460 49 --1226 1754
NM_001031695chr2232027 1269 55 ------
NM_001031711chr541546 1266 1141 145 ----124
NM_001031716chr211006 ------
NM_001031732chr422810 2793 --23032 2831 --
NM_001031740chr141411 1360 672 55 11502 ----
NM_001031812chr511855 22197 1748 ----
NM_001032293chr171219 ------
NM_001032380chr1021975 358 ------
NM_001032393chrX1140 ------
NM_001032999chr2093700 3619 3347 3257 1567 883 683 240 28 22024 816 24623 4387 --
NM_001033047chr442638 2427 972 849 --22465 383 --
NM_001033081chr121710 1479 ------
NM_001033082chr121710 1479 ------
NM_001033087chr2053126 2661 2324 807 366 1587 ----
NM_001033112chr51213 ------
NM_001033117chr374580 4448 3775 686 286 59 29 11432 14456 --
NM_001033551chr17123438 3300 3018 2896 2566 1516 1216 1110 914 737 279 70 ------
NM_001033557chr231286 1168 22 ------
NM_001033566chr173804 277 171 ----1215
NM_001033568chr173804 277 171 ----1215
NM_001033925chr1011722 --11859 1293
NM_001034954chr1011211 12195 --1693
NM_001034955chr1011211 12195 --1693
NM_001034956chr1011211 12195 --1693
NM_001034957chr1011211 12195 --1693
NM_001035chr1----1406 --
NM_001035254chr932034 763 434 ------
NM_001035260chr1021080 543 --21567 1415 --
NM_001035521chr23616 244 51 ------
NM_001037164chr7----11566 --
NM_001037317chr111070 1849 ----
NM_001037954chr1132173 323 38 --1140 --
NM_001038707chr142159 1998 332 179 ------
NM_001038707chr142159 1998 332 179 ------
NM_001039459chr72421 232 ----1923
NM_001039479chr1442224 1890 782 512 --21647 840 --
NM_001039538chr243621 3288 3257 801 ------
NM_001039547chr376337 6228 5248 2818 2483 2429 1306 27466 2143 ----
NM_001039569chr222569 923 32981 2527 1224 ----
NM_001039570chr22134135 3932 3832 3450 3441 2973 2831 1707 1174 772 739 354 318 43273 1443 852 59 ----
NM_001039571chr22134135 3932 3832 3450 3441 2973 2831 1707 1174 772 739 354 318 43273 1443 852 59 ----
NM_001039590chrX2660 211 177 ----
NM_001039591chrX2660 211 177 ----
NM_001039690chr1692184 2041 1538 800 762 723 585 348 284 ------
NM_001039709chr2093700 3619 3347 3257 1567 883 683 240 28 22024 816 24623 4387 --
NM_001039715chr1----2993 904 --
NM_001039716chr1----21057 968 --
NM_001039770chr352227 719 698 200 125 ------
NM_001039840chrX25294 78 --12047 --
NM_001039937chr1352627 1197 1162 724 105 ----13896
NM_001040142chr21163 12414 1261 --
NM_001040143chr21163 12414 1261 --
NM_001040144chr1692184 2041 1538 800 762 723 585 348 284 ------
NM_001040146chr1692184 2041 1538 800 762 723 585 348 284 ------
NM_001040151chr1131203 512 28 21410 1160 ----
NM_001040152chr733885 3270 1966 1210 ----
NM_001040153chr131684 ------
NM_001040284chr1654908 4713 1551 1239 848 14190 ----
NM_001040429chr131639 ------
NM_001040624chr832705 1016 606 12396 --11922
NM_001040625chr832705 1016 606 12396 --11922
NM_001040626chr832705 1016 606 12396 --11922
NM_001040627chr832705 1016 606 12396 --11922
NM_001040628chr832705 1016 606 12396 --11922
NM_001040629chr832705 1016 606 12396 --11922
NM_001040630chr832705 1016 606 12396 --11922
NM_001040665chr724409 4172 23290 1542 ----
NM_001040708chr81394 1875 ----
NM_001040712chr913442 12512 ----
NM_001042355chr1645049 3859 3283 570 14717 ----
NM_001042371chr1611410 22107 1550 ----
NM_001042388chr181677 ------
NM_001042404chr121374 97 --143 --
NM_001042412chr1645049 3859 3283 570 14717 ----
NM_001042414chr13121 ------
NM_001042473chr10--11377 1521 --
NM_001042481chr1411837 1533 ----
NM_001042498chrX1118 ------
NM_001042543chr411410 ----141
NM_001042550chr91192 ------
NM_001042599chr235272 1002 238 12343 27239 786 1573
NM_001042601chr33713 694 657 ------
NM_001042603chr1233993 1056 112 13248 1934 --
NM_001042669chr4287 30 ------
NM_001042749chrX21944 1260 ------
NM_001042750chrX21944 1260 ------
NM_001042751chrX21944 1260 ------
NM_001044722chr511855 22197 1748 ----
NM_001044723chr511855 22197 1748 ----
NM_001079874chr12323 192 ------
NM_001083620chr422583 898 12289 ----
NM_001099678chr345251 5100 4071 832 14827 ----
NM_001106chr369488 7814 6616 3786 2812 1944 36173 2721 2296 16894 --
NM_001111chr142642 2477 2141 196 --183 --
NM_001117chr1842271 2114 1004 838 21597 1534 12104 --
NM_001122679chr52826 36 ------
NM_001128chr1621596 644 --1849 --
NM_001148chr452229 1937 837 828 427 ------
NM_001149chr1011188 ------
NM_001167chrX56345 5684 5343 2059 1464 26105 2579 ----
NM_001173chr1453471 1147 1006 788 716 21350 659 ----
NM_001177chr1232058 1928 1791 11779 12204 --
NM_001178chr11----1330 --
NM_001186chr2142358 674 531 380 12219 ----
NM_001200chr202914 885 1838 1294 --
NM_001204chr237083 6546 5275 26621 4913 ----
NM_001237chr4--2200 115 ----
NM_001237chr4--2200 115 ----
NM_001241chr221505 374 --1803 --
NM_001241chr221505 374 --1803 --
NM_001259chr776176 5494 5438 4126 1260 1046 526 1625 12311 --
NM_001278chr10----1115 --
NM_001282chr1732497 565 279 22372 625 ----
NM_001299chr191518 ------
NM_001304chr1713520 ----1369
NM_001326chr111337 ------
NM_001329chr10191 --11075 --
NM_001343chr51207 ------
NM_001346chr332819 2443 1047 1422 11747 --
NM_001356chrX1919 11004 ----
NM_001364chr1164714 3640 3387 2914 1876 1037 11187 ----
NM_001390chr1883086 2971 2940 2210 1192 1160 990 98 ------
NM_001391chr1821113 786 ------
NM_001399chrX43708 3403 888 577 --23339 686 --
NM_001401chr921438 349 --11133 --
NM_001402chr651594 1478 1392 721 80 1316 --11810
NM_001419chr1974577 3914 3858 1602 1271 1253 878 13172 ----
NM_001429chr221213 ------
NM_001438chr112262 ----12531
NM_001440chr892770 2503 2454 2347 2331 1081 890 103 50 ------
NM_001460chr153456 2282 603 188 165 --1777 --
NM_001482chr152824 287 ------
NM_001494chr102737 179 ------
NM_001498chr6142 ------
NM_001521chr23616 244 51 ------
NM_001527chr654822 4674 3411 3104 130 24215 393 ----
NM_001530chr142291 98 ------
NM_001550chr71227 ------
NM_001604chr113798 334 102 ------
NM_001620chr11------1779
NM_001627chr31969 11753 --21808 825
NM_001655chr1141841 1788 252 64 1514 ----
NM_001663chr1421770 436 ------
NM_001677chr12776 363 ------
NM_001682chr1222283 276 ------
NM_001683chr331884 831 497 ------
NM_001695chr823857 72 13036 --14146
NM_001709chr1132695 2462 804 ----11090
NM_001730chr1331536 222 183 ------
NM_001730chr1331536 222 183 ------
NM_001742chr71421 ------
NM_001753chr731697 1206 386 --1421 --
NM_001754chr2143953 1633 1568 1415 ------
NM_001755chr1612270 --11407 --
NM_001759chr1265173 5088 4522 3900 1309 873 24843 3587 14560 --
NM_001773chr111224 --11344 --
NM_001796chr16183 ------
NM_001854chr111546 1209 ----
NM_001858chr644844 1646 1627 893 11445 ----
NM_001892chr5----11266 --
NM_001904chr31858 ------
NM_001918chr197106 6672 5926 3672 3437 3057 2349 1666 264 59294 7063 2449 1706 387 12220 --
NM_001930chr19181 ------
NM_001939chrX83702 3689 3534 3322 1097 1056 1041 294 ------
NM_001945chr531349 1069 879 ------
NM_001949chr642957 2208 1064 370 1253 --12524
NM_001968chr42888 197 ------
NM_001969chr1433039 2651 97 --23254 1232 --
NM_001973chr12388 371 ------
NM_001995chr421450 62 ------
NM_001999chr5------21306 182
NM_002006chr464307 4255 4149 1415 1174 694 35372 4434 115 14860 13695
NM_002009chr1532538 852 373 ------
NM_002025chrX78805 8455 7514 2122 1846 1823 1766 13293 165 --
NM_002035chr181634 13217 13926 --
NM_002040chr2132486 845 279 --11243 --
NM_002063chrX21160 853 ------
NM_002069chr72360 193 ------
NM_002071chr182446 140 ------
NM_002072chr91872 ------
NM_002077chr91202 ------
NM_002078chr3141 ------
NM_002092chr474977 4581 4355 1836 1072 832 264 ------
NM_002093chr3170 ------
NM_002112chr151216 ------
NM_002114chr6----1370 --
NM_002126chr1743211 2987 2860 186 --22532 853 --
NM_002137chr722132 622 11940 ----
NM_002140chr91356 ------
NM_002146chr171121 --1362 --
NM_002147chr171747 ------
NM_002165chr20----1283 --
NM_002187chr511188 ----11052
NM_002196chr201360 ------
NM_002196chr201360 ------
NM_002202chr51411 ------
NM_002207chr3------1278
NM_002210chr253462 3314 1354 848 742 ------
NM_002222chr3------162
NM_002264chr354943 4379 4324 3836 1455 14200 13897 14676
NM_002267chr13----157 --
NM_002285chr232786 1486 47 1986 ----
NM_002291chr7122 ------
NM_002293chr162569 2254 2233 657 543 419 12279 1443 --
NM_002309chr2253032 2634 1163 758 142 11114 1745 --
NM_002310chr575835 5139 4541 4464 2532 1997 1001 16058 --14273
NM_002336chr1224936 1746 ----14926
NM_002356chr612695 ----12397
NM_002359chr1774170 3333 1607 1577 1433 400 215 23343 2993 13294 11593
NM_002372chr5195 ----1445
NM_002374chr243621 3288 3257 801 ------
NM_002375chr342257 2131 2092 1492 12073 ----
NM_002380chr81366 ----11000
NM_002387chr564114 3862 3449 1957 1869 168 11676 ----
NM_002399chr15----11102 --
NM_002444chrX31747 708 194 11835 1253 --
NM_002451chr952917 2868 2666 2588 1316 11406 12384 --
NM_002481chr1127848 6604 6104 6046 5574 5192 3170 1984 1692 1452 780 666 26899 2138 11434 --
NM_002485chr831443 577 118 ------
NM_002486chr952221 1805 829 727 404 11742 ----
NM_002493chr91217 ------
NM_002499chr1562442 1975 1895 313 182 129 --1164 --
NM_002505chr621159 479 ------
NM_002515chr1431425 767 647 ------
NM_002520chr51254 ------
NM_002526chr621633 1262 ------
NM_002547chrX74135 3703 3403 2804 2651 1344 652 ------
NM_002576chr1141145 987 930 915 --1203 11042
NM_002577chr3198 ------
NM_002581chr944666 1975 724 91 11986 11402 --
NM_002583chr12------161
NM_002607chr71405 ------
NM_002613chr1685101 4625 4310 1843 1393 1309 621 61 23597 405 15389 14229
NM_002618chr21108 ------
NM_002628chr3----157 --
NM_002629chr101647 ------
NM_002641chrX31597 652 344 ------
NM_002643chr2------167
NM_002651chr11852 ------
NM_002655chr845331 5257 4026 1057 23597 579 ----
NM_002657chr2053452 3376 2928 2696 438 ------
NM_002703chr451763 274 257 239 62 146 ----
NM_002706chr21569 ------
NM_002709chr243059 2528 2195 1069 ----13125
NM_002710chr12183 ------
NM_002713chr1--1937 ----
NM_002715chr5--1230 ----
NM_002719chr1422346 502 ------
NM_002731chr111004 1421 1355 --
NM_002734chr1731556 401 95 --1684 12190
NM_002737chr1755822 4891 4883 4633 599 15653 11502 --
NM_002740chr332774 2660 2027 1684 ----
NM_002745chr221734 ------
NM_002806chr14124 ------
NM_002811chr161545 ------
NM_002823chr2191 ------
NM_002824chr121494 ------
NM_002828chr181206 1812 ----
NM_002833chr153265 161 30 ------
NM_002834chr1273346 2966 1026 963 935 922 518 23025 533 22985 1097 13120
NM_002837chr1264401 4256 4178 3613 3248 642 34502 3340 3205 1436 --
NM_002839chr913442 12512 ----
NM_002858chr121271 345 ------
NM_002865chr81100 ------
NM_002868chr1252336 2058 1961 931 386 ------
NM_002869chr112740 340 ------
NM_002874chr91431 --12495 --
NM_002893chrX1113 ------
NM_002906chr111727 --1553 --
NM_002912chr61896 ------
NM_002942chr31546 ------
NM_002971chr3--1107 11102 --
NM_002979chr11245 ------
NM_003011chr921296 581 11312 ----
NM_003016chr1751734 1333 802 320 200 ------
NM_003026chr911059 ------
NM_003028chr953242 3109 1210 1050 547 ----13557
NM_003034chr1248067 6560 1781 1434 --37416 5439 2545 177
NM_003045chr1375062 3485 3366 3225 241 217 195 24369 870 21682 1139 --
NM_003068chr8----1244 --
NM_003069chrX1517 ------
NM_003070chr91693 ------
NM_003074chr321694 231 --11853 --
NM_003079chr172193 156 ------
NM_003081chr202443 216 --1896 --
NM_003136chr141353 ------
NM_003140chrY122 1114 ----
NM_003150chr1752278 2145 2072 1667 270 1680 11741 --
NM_003156chr1141200 1060 873 195 11104 ----
NM_003161chr1762891 2517 2238 1243 1060 962 1432 ----
NM_003179chrX61350 1068 1044 1023 1016 942 ------
NM_003183chr22592 117 ------
NM_003194chr61532 ------
NM_003199chr1843812 2122 1827 1499 14497 11220 --
NM_003211chr1221748 1320 ------
NM_003236chr252969 2771 2737 2503 25 ----13272
NM_003239chr142361 132 ------
NM_003247chr6146 ----11949
NM_003253chr211579 ------
NM_003255chr1752164 2024 1626 584 453 127 ----
NM_003257chr154911 381 224 168 ------
NM_003262chr374705 4170 3572 1483 681 635 319 33713 3557 2068 12054 24075 1826
NM_003270chrX------1922
NM_003292chr112100 --11936 --
NM_003304chr311269 ------
NM_003320chr1164393 3629 3493 656 636 376 1497 24262 3808 --
NM_003339chr511544 1555 ----
NM_003390chr11--11027 ----
NM_003392chr343779 2745 1604 1072 11239 ----
NM_003404chr201190 ------
NM_003405chr221677 ------
NM_003409chr18------1411
NM_003410chrX21950 813 12671 ----
NM_003439chr723543 2617 22335 420 --12946
NM_003442chr111785 ------
NM_003455chr1141530 1287 1209 495 1380 ----
NM_003457chr171219 ------
NM_003478chr1133201 1338 707 1491 12664 --
NM_003483chr1232405 2151 94 32993 2580 2441 ----
NM_003489chr211841 ------
NM_003564chr11633 1588 ----
NM_003566chr1212878 ----11351
NM_003574chr1865327 5274 4949 2089 892 90 --1666 --
NM_003589chr131584 ------
NM_003590chr213782 ----11445
NM_003591chr10198 ------
NM_003603chr4------1294
NM_003615chr323825 2540 ------
NM_003618chr22845 410 ----11042
NM_003629chr173083 2656 1391 1284 1166 997 398 23493 2833 ----
NM_003633chr522447 2025 ------
NM_003637chr121121 163 --11563 --
NM_003663chr333229 3196 2999 ------
NM_003677chr1241403 638 402 29 --12085 153
NM_003688chrX190 ------
NM_003693chr171571 1347 ----
NM_003704chr41628 ------
NM_003757chr12404 396 ------
NM_003759chr453979 3774 3633 1314 245 ------
NM_003762chr111452 ------
NM_003763chr2023064 3026 ------
NM_003766chr172457 211 ------
NM_003774chr1232839 1129 245 11155 ----
NM_003829chr91358 ------
NM_003850chr13122 ------
NM_003872chr222604 1050 32766 2467 213 12028 --
NM_003877chr121833 ------
NM_003884chr311232 --21408 1340 --
NM_003885chr1732243 2032 23 1688 ----
NM_003895chr213865 817 622 --11451 --
NM_003913chr623869 489 12717 1365 --
NM_003916chrX11052 --154 --
NM_003930chr722390 2361 ------
NM_003931chr6178 1228 ----
NM_003945chr53408 332 115 ------
NM_003953chr151776 1155 531 471 380 11927 ----
NM_003972chr1031205 866 479 ------
NM_003974chr83316 61 22 --1343 --
NM_003975chr1196 1301 ----
NM_003980chr631334 1321 233 ------
NM_003982chr14152 ------
NM_003983chr1621651 996 11582 33466 1688 238 --
NM_003994chr1243362 1631 933 340 ------
NM_004019chrX1380 ------
NM_004077chr123992 231 169 ------
NM_004081chrY11390 ------
NM_004086chr141224 ------
NM_004093chr1332855 2711 2512 ------
NM_004094chr1422108 222 --32588 2508 2185 --
NM_004099chr942079 1534 1432 657 1359 ----
NM_004100chr622504 198 1350 ----
NM_004102chr11504 ----1460
NM_004132chr1021137 1081 11213 --168
NM_004133chr8----12407 --
NM_004161chr211415 ----1146
NM_004162chr3----11047 --
NM_004171chr1198751 8154 6643 3707 2453 2190 2154 1288 991 22103 1895 ----
NM_004180chr21598 ------
NM_004183chr113725 707 699 ------
NM_004193chr101423 ------
NM_004227chr773108 2671 2056 965 272 228 135 22570 2299 ----
NM_004232chr182700 417 ------
NM_004235chr9------1118
NM_004261chr11860 ------
NM_004273chr1095042 4058 3505 3266 3170 1526 1367 1343 847 --24930 918 --
NM_004280chr62333 308 ------
NM_004296chr1483946 3587 3127 2950 2553 1426 518 102 --1869 --
NM_004326chr1195 ------
NM_004338chr1832496 2386 1750 17058 --12810
NM_004380chr1632479 1691 599 ------
NM_004384chr511855 22197 1748 ----
NM_004385chr51524 ------
NM_004392chr132913 799 ------
NM_004415chr6--1603 ----
NM_004434chr142421 66 --1318 --
NM_004454chr311885 124 1606 --
NM_004459chr171132 1159 ----
NM_004474chr12992 335 1781 ----
NM_004491chr19103572 3392 3107 1631 1423 1412 1378 861 344 249 13644 14214 11693
NM_004496chr1411049 --1879 1377
NM_004516chr19--11095 ----
NM_004540chr21--1299 ----
NM_004560chr9----1251 --
NM_004575chr441659 1498 1222 287 ------
NM_004580chr1521790 35 11880 21368 571 --
NM_004582chr11418 ------
NM_004586chrX35047 3843 3643 11574 21276 618 14194
NM_004606chrX125 ------
NM_004631chr11435 11355 1271 --
NM_004654chrY175 1391 ----
NM_004661chr521232 240 ------
NM_004663chr151202 ------
NM_004680chrY174 ------
NM_004709chrX11580 21415 72 --1156
NM_004718chr22167 96 ------
NM_004726chrX35421 4990 2034 25399 701 ----
NM_004734chr1342934 2363 1160 1071 ------
NM_004741chr1021284 381 ------
NM_004742chr321775 156 ----11134
NM_004745chr866626 6286 5904 4679 4620 228 ------
NM_004760chr731987 855 807 172 11728 --
NM_004768chr11468 ------
NM_004774chr1732524 510 125 --13061 --
NM_004779chr521212 275 --1868 --
NM_004781chr161663 1625 1557 1164 1151 706 --1657 --
NM_004781chr161663 1625 1557 1164 1151 706 --1657 --
NM_004796chr142601 372 --11750 --
NM_004798chr2043541 3502 1300 123 13339 ----
NM_004799chr1----1330 --
NM_004808chr1052517 2458 2409 2377 1337 32998 2243 805 ----
NM_004815chr154962 3660 3491 811 295 --1575 --
NM_004824chr61308 ------
NM_004834chr212415 1683 1814 --
NM_004842chr621781 228 ------
NM_004845chrX63862 3440 3168 1293 1207 871 ----12575
NM_004849chr6--11409 ----
NM_004859chr1723042 1222 ------
NM_004863chr1485298 4658 4461 974 634 133 92 55 34749 1607 314 1681 --
NM_004871chr1733374 1318 1007 --1152 --
NM_004896chr103995 591 458 --21482 1330 --
NM_004898chr422017 45 ------
NM_004901chr8--1223 ----
NM_004905chr11128 ------
NM_004921chr12673 256 ------
NM_004926chr1411757 ------
NM_004932chr52119 52 ------
NM_004947chr311050 --11591 --
NM_004956chr754405 3260 3086 812 156 --13115 --
NM_004958chr1--1744 ----
NM_004961chrX1528 ------
NM_004965chr211706 ------
NM_004973chr641631 1583 471 276 ------
NM_004976chr1163160 3138 1327 1284 720 406 --21543 996 14694
NM_004978chr161591 1493 1487 214 148 126 ------
NM_004985chr1224394 1332 --23178 575 --
NM_004992chrX136595 6423 5937 5903 5663 2859 2742 2654 1659 1640 740 720 533 --1658 --
NM_004992chrX136595 6423 5937 5903 5663 2859 2742 2654 1659 1640 740 720 533 --1658 --
NM_005020chr71464 ------
NM_005025chr31185 ------
NM_005032chrX3959 99 82 --1435 --
NM_005045chr72923 369 ------
NM_005056chr1254237 3436 1300 356 115 13492 11178 --
NM_005057chr131855 64 47 11388 ----
NM_005066chr13813 701 138 ------
NM_005087chr31254 ------
NM_005093chr2093700 3619 3347 3257 1567 883 683 240 28 22024 816 24623 4387 --
NM_005095chr112042 ------
NM_005105chr121523 543 --11582 --
NM_005114chr41623 ------
NM_005116chr20134483 4341 3749 3675 3612 1600 1576 785 691 581 237 27 21 1752 23705 243 --
NM_005119chr13959 188 55 ------
NM_005121chr1743677 3623 2813 371 ------
NM_005124chr61306 ------
NM_005134chr181677 ------
NM_005160chr2255920 5441 4574 4297 2483 25733 2577 12357 --
NM_005164chr1212423 22611 475 --1568
NM_005168chr2--11720 ----
NM_005171chr12--11161 ----
NM_005173chr1731214 1109 1034 --1149 --
NM_005180chr1021034 138 ------
NM_005188chr11126903 6825 5704 5428 5054 3310 3069 2222 1264 1051 817 362 12749 26838 677 --
NM_005190chr621108 364 ------
NM_005215chr18--1614 ----
NM_005235chr235272 1002 238 12343 27239 786 1573
NM_005241chr3149 ------
NM_005245chr42728 118 ------
NM_005249chr142846 683 ------
NM_005256chr112681 38 ------
NM_005279chr22124 32 ------
NM_005329chr162161 116 11889 ----
NM_005359chr1886437 5660 5320 5148 4237 4176 2283 207 26504 2241 ----
NM_005374chr175847 580 495 400 238 --2341 301 --
NM_005376chr121153 927 ------
NM_005386chr20--1757 ----
NM_005387chr111659 ------
NM_005398chr1041395 928 323 131 ------
NM_005400chr232313 1927 552 22899 735 --1581
NM_005402chr731651 236 182 ------
NM_005406chr1821546 1328 ------
NM_005407chr1441501 1006 490 181 ------
NM_005436chr1054038 3813 2693 1056 624 --1985 1794
NM_005443chr41387 ------
NM_005455chr121175 186 1432 ----
NM_005475chr1262854 2655 2462 1168 1039 768 ------
NM_005479chr1051468 1423 1400 343 285 ------
NM_005493chr61605 ------
NM_005502chr921095 214 1622 31210 1132 377 --
NM_005504chr1246477 2571 702 96 12033 25215 1061 --
NM_005507chr111458 ------
NM_005509chr51528 149 ----
NM_005520chr5--1151 ----
NM_005578chr321852 325 --11826 --
NM_005594chr12193 ------
NM_005595chr12739 255 ----1108
NM_005596chr945551 5379 5112 1706 ------
NM_005607chr8------1336
NM_005614chr7--1730 ----
NM_005625chr82968 136 ------
NM_005627chr61621 ------
NM_005639chr121718 ------
NM_005644chr11298 ------
NM_005647chrX62794 2519 2402 1167 320 136 --11057 --
NM_005652chr161299 ------
NM_005670chr63513 435 372 162 --1501
NM_005688chr321230 867 --11254 --
NM_005690chr122193 128 ------
NM_005708chr13------151
NM_005717chr11370 ------
NM_005720chr71248 ------
NM_005721chr2178 ------
NM_005730chr1293012 2656 2263 1453 924 597 581 417 274 ------
NM_005734chr111192 ------
NM_005738chr7----11566 --
NM_005748chr1233063 2686 2135 ------
NM_005749chr172254 219 ------
NM_005754chr5------11230
NM_005759chr294595 4559 3765 3337 1914 1479 1403 524 421 --21058 742 --
NM_005785chr1241642 1582 500 488 ------
NM_005795chr231901 1895 350 ------
NM_005797chr1111616 11693 ----
NM_005807chr11243 ------
NM_005808chr373283 3161 2825 1322 1295 1171 130 ----13201
NM_005813chr211835 1407 ----
NM_005828chr1774201 3491 1997 1916 1833 154 92 13306 --14185
NM_005840chrX47682 7292 2706 1110 25398 5158 --14957
NM_005859chr521306 1094 ----1409
NM_005868chr7143 12478 ----
NM_005898chr112558 45 22446 591 1730 --
NM_005899chr17--1338 ----
NM_005901chr1848010 7685 2788 2174 28584 3179 12970 --
NM_005909chr541215 1149 740 622 ------
NM_005920chr173135 2771 2711 1276 1226 1081 908 ------
NM_005935chr454249 3545 3526 1273 284 14459 2516 124 1929
NM_005941chr834160 3651 2568 ------
NM_005955chr165229 3764 3748 2047 1616 1447 12005 1861 --
NM_005962chr1052118 1990 1948 1739 402 ------
NM_005962chr1052118 1990 1948 1739 402 ------
NM_005967chr121750 ------
NM_006007chr953689 1752 977 567 368 23942 3789 21575 81 --
NM_006011chr1513946 --11223 --
NM_006015chr11350 ------
NM_006016chr641776 896 734 336 ------
NM_006030chr331358 1242 124 --1437 --
NM_006036chr21481 ------
NM_006037chr294659 3534 3445 3327 3312 1371 1290 785 516 ----14247
NM_006038chr2052038 1657 645 507 188 ------
NM_006043chr162761 596 ------
NM_006047chr2033450 3345 394 --13467 --
NM_006067chr16--1824 ----
NM_006095chr4--1870 33749 2982 1322 --
NM_006108chr1142334 659 286 54 12084 --11963
NM_006113chr12323 192 ------
NM_006133chr1191893 1683 1579 1539 747 504 474 447 46 ------
NM_006135chr1156 --1370 --
NM_006164chr2--1326 ----
NM_006167chr82655 240 11850 --1472
NM_006180chr91577 --11748 --
NM_006190chr221028 878 ------
NM_006191chr12--1320 ----
NM_006194chr1411212 ------
NM_006196chr2170 ------
NM_006197chr822200 131 ------
NM_006203chr514789 --24149 1088 --
NM_006216chr21193 ------
NM_006244chr112581 400 ------
NM_006245chr63808 207 167 ------
NM_006275chr2012325 1137 12427 --
NM_006282chr2064189 3994 1658 616 197 60 13330 --11177
NM_006287chr222447 212 ------
NM_006301chr121567 1221 ----
NM_006306chrX75270 5101 5095 5037 4848 3880 786 14524 13611 --
NM_006307chrX1235 ------
NM_006313chr1231532 388 349 ------
NM_006315chr474131 3887 3674 3109 3080 1431 1037 23534 1635 23525 1196 14534
NM_006317chr51724 ------
NM_006320chr4------1936
NM_006321chr361973 1604 791 748 657 518 --1280 --
NM_006352chr131902 1759 292 ------
NM_006357chr2----1356 --
NM_006372chr61488 ------
NM_006379chr721488 196 --1457 11840
NM_006407chr311380 ------
NM_006434chr1011211 12195 --1693
NM_006460chr1721762 702 1324 ----
NM_006469chr1--11371 ----
NM_006472chr131176 327 145 1464 ----
NM_006475chr13--1266 ----
NM_006489chr1431425 767 647 ------
NM_006496chr1--11652 1529 --
NM_006504chr1042550 2268 2008 1914 --138 --
NM_006529chr411401 ----132
NM_006540chr8--1411 ----
NM_006572chr1741341 904 795 232 1712 ----
NM_006587chr441717 1560 337 50 ------
NM_006595chr1131725 1580 1571 ----1481
NM_006599chr1688099 6873 6802 3204 2218 1214 942 418 1491 ----
NM_006603chrX21944 1260 ------
NM_006621chr12554 179 11755 --11363
NM_006625chr11375 ------
NM_006625chr11375 ------
NM_006625chr11375 ------
NM_006628chr1553942 3639 3415 966 516 ------
NM_006629chr1822638 1934 ------
NM_006646chr1362814 2713 2641 2047 1006 271 ------
NM_006650chr5103895 3462 2990 2806 2595 819 618 512 440 130 31019 947 854 ----
NM_006660chr15----1116 --
NM_006667chrX11186 ------
NM_006690chr2072210 1463 640 454 309 80 37 11674 1867 --
NM_006699chr132601 369 253 ------
NM_006717chr932161 1271 906 --11118 --
NM_006722chr322993 2725 ------
NM_006729chrX44673 2213 1875 1489 24107 1983 25645 786 --
NM_006734chr621409 1325 ------
NM_006738chr1583929 3596 3514 1429 1263 827 274 44 1496 ----
NM_006750chr1677086 5734 2152 1143 596 293 184 37681 5826 2589 ----
NM_006763chr141909 1531 319 198 1851 11540 --
NM_006766chr8------1861
NM_006775chr61350 --11176 --
NM_006777chrX42911 2425 781 660 12811 ----
NM_006788chr1851425 1326 624 521 408 1753 ----
NM_006805chr52424 30 ------
NM_006808chr9------1169
NM_006823chr831347 1279 104 ------
NM_006826chr211031 ------
NM_006827chr1433228 2689 809 12646 ----
NM_006838chr1221760 1482 1569 ----
NM_006851chr1242824 949 612 51 ------
NM_006852chr171627 ------
NM_006854chr721896 1876 ------
NM_006857chr2146 ------
NM_006861chr1241932 1886 1722 732 1672 ----
NM_006885chr1633261 954 462 13610 ----
NM_006888chr143544 527 305 23057 2144 23384 2345 --
NM_006892chr201439 ----1337
NM_006892chr201439 ----1337
NM_006899chr201254 --1104 --
NM_006901chr15129 ----1132
NM_006902chr122870 720 22156 816 128 22623 83
NM_006922chr232313 589 392 32624 2377 1624 2557 251 --
NM_006924chr1734172 3434 1601 24205 743 --13212
NM_006930chr531822 1812 577 ------
NM_006940chr1241352 1256 1180 326 172 ----
NM_006947chr42676 177 --1519 --
NM_006981chr931015 765 586 ------
NM_007007chr1233525 3093 280 --14774 --
NM_007011chr1556362 5692 5052 4591 2311 25473 5303 15252 --
NM_007023chr22807 232 ------
NM_007030chr5105062 4988 4521 4209 3352 1576 1383 1366 1210 981 11003 ----
NM_007042chr322669 280 1976 12268 --
NM_007047chr652395 777 734 636 21 21906 257 ----
NM_007050chr20108069 7794 7635 7188 6627 6413 1089 712 654 133 12311 14945 15523
NM_007073chr6103721 3002 1590 1581 1546 1524 1511 1212 781 78 ----11655
NM_007074chr16199 ------
NM_007084chr133545 494 382 21383 172 ----
NM_007124chr631459 566 97 ------
NM_007125chrY1374 ------
NM_007137chrX85077 4588 4488 4293 4261 1985 1658 804 44858 4601 1439 823 1352 --
NM_007156chrX--133 ----
NM_007170chr12798 57 1865 ----
NM_007175chr843149 3142 2681 1166 --13088 --
NM_007181chr191126 ------
NM_007200chr1583929 3596 3514 1429 1263 827 274 44 1496 ----
NM_007216chr111391 ------
NM_007245chr161895 ------
NM_007246chr42909 795 ------
NM_007249chr1323208 2020 18585 1362 --
NM_007275chr331148 1134 801 ------
NM_007283chr372983 1105 448 436 78 64 29 ------
NM_007285chr16------1358
NM_007324chr1----1330 --
NM_007332chr821376 1359 ------
NM_007350chr1234343 1510 1458 --14564 --
NM_007358chr131967 1579 1311 ------
NM_007364chr15--1605 ----
NM_007365chr162270 2038 826 783 579 503 ------
NM_007375chr132649 2623 1749 12773 ----
NM_012062chr122193 128 --1765 --
NM_012063chr122193 128 ------
NM_012082chr81120 ------
NM_012090chr11849 ------
NM_012098chr951311 1071 63 54 30 --11125 --
NM_012104chr1172577 1317 1237 1004 242 94 63 1442 ----
NM_012104chr1172577 1317 1237 1004 242 94 63 1442 ----
NM_012120chr632721 1933 1867 ------
NM_012141chr1352627 1197 1162 724 105 ----13896
NM_012158chr1321459 169 ------
NM_012160chr6----1439 --
NM_012193chr1175188 5077 4130 3411 2030 1996 1314 11793 13706 11098
NM_012199chr143643 3057 2990 1385 ----11164
NM_012207chr1011022 11040 ----
NM_012214chr245927 4172 2472 2285 44321 4200 4035 1349 ----
NM_012215chr1021810 1285 1559 ----
NM_012232chr1722127 2065 --1708 1236
NM_012238chr1021509 685 1253 11466 --
NM_012250chr1121079 137 --1167 1540
NM_012257chr71939 ------
NM_012259chr6--1573 ----
NM_012262chr165164 5064 4639 4005 3640 3619 1210 ----
NM_012279chr531748 1334 455 --21991 541 --
NM_012287chr343211 1438 635 116 23165 1799 ----
NM_012288chr674578 4359 1738 1112 717 333 295 11450 ----
NM_012290chr211261 ------
NM_012296chr1123630 1387 --1235 1723
NM_012297chr42785 710 ------
NM_012300chr532097 60 52 ------
NM_012302chr11350 ------
NM_012309chr1173537 1008 637 628 457 288 161 2807 739 ----
NM_012316chr195362 4613 4518 4405 2188 2030 1559 1426 1390 14143 11531 --
NM_012333chr121685 1463 11332 ----
NM_012382chr574276 3633 3337 3311 3250 770 228 ------
NM_012399chr2211255 --1645 --
NM_012402chr1131129 212 24 21219 284 ----
NM_012414chr1--1167 ----
NM_012419chr61135 ------
NM_012433chr21107 ------
NM_012454chr61197 ------
NM_012465chr1053044 3017 2919 445 349 2430 176 --12227
NM_012482chr11603 ------
NM_013230chrY11821 --21581 1541 --
NM_013262chr611148 --1439 --
NM_013267chr123451 417 48 --1406 --
NM_013269chr1221610 274 --11814 --
NM_013277chr121211 ------
NM_013281chr2031396 1304 456 11545 ----
NM_013309chr1542083 2028 734 685 ------
NM_013336chr341615 1586 618 595 1751 11905 --
NM_013357chr81802 149 ----
NM_013372chr1542881 2775 1289 837 ------
NM_013386chr1----1138 --
NM_013396chr21----1432 --
NM_013444chrX2796 50 ------
NM_013447chr1951514 1337 911 252 239 --23504 3413 --
NM_013995chrX21972 1651 172 ----
NM_014016chr31177 ------
NM_014021chr133223 1367 106 ------
NM_014038chr71420 ------
NM_014043chr3----1147 1482
NM_014106chr153782 774 287 22872 731 ----
NM_014110chr1--1937 ----
NM_014112chr845344 1043 539 396 24952 262 25109 3839 1194
NM_014117chr1632632 1888 186 --1593 --
NM_014155chr1187101 6978 6958 6669 6646 6196 4980 669 22099 1306 17451 --
NM_014159chr33554 255 32 ------
NM_014191chr1211045 ------
NM_014225chr191110 ------
NM_014240chr383474 3413 3144 2975 2559 1292 519 69 13424 13537 --
NM_014243chr41810 --12009 --
NM_014283chr111017 ------
NM_014309chr2232017 1259 45 ------
NM_014319chr121756 ------
NM_014323chr223922 855 169 ------
NM_014331chr436566 6516 293 --21837 1000 --
NM_014338chr222878 22 ------
NM_014372chr121295 132 ------
NM_014382chr3----1250 --
NM_014409chr11392 ------
NM_014415chr321546 1405 1155 ----
NM_014421chr4----1612 1100
NM_014447chr4----1260 --
NM_014469chr113847 601 288 1717 ----
NM_014491chr72884 284 ----1848
NM_014515chr122855 49 ------
NM_014554chr121884 --1501 --
NM_014573chr1721199 648 21884 1773 --1335
NM_014608chr151402 ------
NM_014614chr21414 ------
NM_014615chr161988 --13226 --
NM_014630chr1553250 1537 856 292 226 --127 11141
NM_014646chr1822484 979 ----13230
NM_014647chr1621493 761 --11987 --
NM_014659chr151222 21012 211 ----
NM_014661chr10103453 3399 3387 3258 2708 2471 2443 992 782 176 13530 ----
NM_014665chr882661 2600 2335 1336 1140 737 581 346 --31325 1313 620 --
NM_014666chr5------1535
NM_014670chr221194 1111 ------
NM_014671chr73617 239 176 ----11586
NM_014674chr373130 2888 2544 1229 802 753 515 ------
NM_014682chr811673 ------
NM_014686chr1912071 1863 1831 --
NM_014690chr752894 2274 511 460 49 --1226 1754
NM_014702chr653270 3251 2866 1180 755 --22142 297 --
NM_014705chr71201 ------
NM_014707chr72748 515 ------
NM_014729chr831745 863 384 ------
NM_014735chrX11546 ------
NM_014739chr674056 3409 2576 1508 1128 753 664 ----1299
NM_014747chr1125782 4800 4635 4492 4339 1630 1624 920 765 642 534 122 14721 ----
NM_014751chr8----11556 --
NM_014755chr254190 3429 1663 961 519 ------
NM_014757chr531974 886 97 ------
NM_014762chr1102595 2560 2467 2376 2222 2192 2015 461 351 41 ------
NM_014774chr132942 2814 689 ------
NM_014786chr113448 186 172 --1914 --
NM_014787chr111062 32814 665 540 ----
NM_014800chr72421 232 ----1923
NM_014807chr112826 728 ------
NM_014812chr121374 97 --143 --
NM_014819chr542513 1642 734 570 ------
NM_014820chr321864 278 ------
NM_014824chr113456 140 57 1742 ----
NM_014828chr1432398 2152 114 --11608 --
NM_014830chr1253072 2966 855 842 772 --13215 --
NM_014836chr1021975 358 ------
NM_014840chr1273279 2400 2136 942 755 640 532 1134 22898 575 --
NM_014841chr621331 1107 ------
NM_014850chr374580 4448 3775 686 286 59 29 11432 14456 --
NM_014871chr124553 459 82 68 ------
NM_014873chr144752 4416 3001 1406 11363 ----
NM_014876chr2261738 1519 1488 774 228 61 1732 1555 --
NM_014877chr1777398 7145 6117 6109 5573 1593 1290 --1425 --
NM_014887chr13----1783 --
NM_014892chr6165 ------
NM_014897chr1722667 476 ----12376
NM_014903chr121452 ------
NM_014906chr1732750 1412 115 11397 --13325
NM_014917chr12666 344 ------
NM_014924chr1472944 2860 2068 903 895 273 172 11196 ----
NM_014925chr121623 1329 ----
NM_014927chrX1140 ------
NM_014932chr331707 1695 482 ------
NM_014935chr1103792 3677 3437 3142 1519 1419 1114 1029 671 399 ------
NM_014937chr102495 29 ------
NM_014939chr1821209 488 ------
NM_014946chr211237 12197 1220 --
NM_014949chr13808 724 312 1385 ----
NM_014950chr1411597 ------
NM_014961chr412222 --11831 --
NM_014969chr11859 ------
NM_014974chr1021540 1281 ----11320
NM_014982chr1455229 4918 4285 1811 1590 --12172 --
NM_014989chr61164 11963 ----
NM_014991chr442579 883 776 31 23075 849 --13033
NM_015008chr342733 2542 709 545 ------
NM_015020chr1633194 776 312 ------
NM_015032chr132510 161 166 1229 --
NM_015035chr2076258 6195 6044 4296 1698 1169 31 --16379 --
NM_015039chr154163 3530 3340 3168 31 ------
NM_015040chr222883 2139 11162 21035 509 --
NM_015042chr1584237 4131 3804 1224 684 310 266 151 ------
NM_015051chr923394 2657 ------
NM_015059chr1563210 2834 2827 1232 630 37 --23677 918 12669
NM_015064chr1293032 2890 2867 2624 2600 2398 2351 971 630 23492 343 12209 --
NM_015068chr722737 818 ------
NM_015069chr163599 474 128 ------
NM_015074chr164713 4245 3321 3172 818 222 23933 1164 11042 1585
NM_015075chrX51467 1385 863 464 245 11423 2558 231 --
NM_015076chr622941 827 12898 ----
NM_015079chr1552468 1076 857 370 72 --31092 796 630 --
NM_015087chr1331974 1917 608 ------
NM_015091chr14----1118 --
NM_015092chr1644148 3063 1868 201 11603 ----
NM_015097chr3----12265 --
NM_015100chr151999 1965 1810 1661 225 1421 ----
NM_015129chrX21728 1573 ------
NM_015132chr712002 1378 11854 --
NM_015138chr1532504 2266 304 --1903 --
NM_015170chr81256 --1662 11481
NM_015171chr16193 ------
NM_015192chr2022611 2284 --135 12047
NM_015206chr1543821 2687 2511 1000 13468 1785 1934
NM_015208chr1833949 3651 1060 13893 --1564
NM_015215chr141252 985 963 190 ------
NM_015231chr111776 ------
NM_015234chr631196 1004 585 ------
NM_015247chr1645049 3859 3283 570 14717 ----
NM_015251chr1632102 2069 1932 11644 ----
NM_015252chr21617 ------
NM_015265chr221661 662 ------
NM_015271chr443804 1369 252 32 ------
NM_015275chr1231464 1392 490 ------
NM_015288chr593730 3318 2791 2608 2455 1206 1042 890 287 23328 3222 13717 --
NM_015291chr132961 1231 596 1553 1130 --
NM_015299chr1493382 3342 3175 3124 2861 2710 1444 1236 812 --1396 --
NM_015310chr842924 2890 1915 30 ----17456
NM_015313chr1133878 3229 664 --23334 1081 --
NM_015317chr212335 ------
NM_015326chr162453 2332 2260 759 547 368 ------
NM_015328chr752277 1961 1142 545 307 --22741 451 --
NM_015336chr12--22072 385 22257 2249 --
NM_015358chr212994 146 ----11336
NM_015359chr821810 385 1459 ----
NM_015365chrX44256 4188 3162 1114 ------
NM_015385chr1011211 12195 --1693
NM_015387chr211870 ------
NM_015396chr32998 582 ------
NM_015455chr534029 2830 1506 23669 1566 178 --
NM_015461chr182308 235 ------
NM_015475chr211065 ------
NM_015481chr122871 353 ------
NM_015484chr11290 --1766 --
NM_015485chr1--1322 ----
NM_015534chr11326 ------
NM_015535chr241552 1480 509 182 13816 ----
NM_015550chr723175 3112 13445 ----
NM_015564chr532784 2274 1094 ------
NM_015569chr124356 2975 1710 ----
NM_015575chr273128 2861 2797 1194 752 416 22 1465 ----
NM_015576chr31483 ------
NM_015578chr19149 ------
NM_015601chr101768 ------
NM_015622chr73204 73 55 ------
NM_015630chr21975 ------
NM_015640chr144605 3684 947 686 1905 --1463
NM_015646chr1211015 11174 ----
NM_015670chr17--1461 ----
NM_015678chr13----11136 --
NM_015686chrX42049 1860 1680 486 --1179 1722
NM_015726chr141508 1168 378 243 ------
NM_015840chr142642 2477 2141 196 --183 --
NM_015841chr142642 2477 2141 196 --183 --
NM_015878chr8--155 ----
NM_015879chr1896842 5550 5498 3247 1339 1096 863 741 29 37367 1448 375 17039 --
NM_015904chr21188 ------
NM_015906chr154283 3340 3305 3283 669 13996 ----
NM_015912chr852471 1743 1710 1024 931 11951 ----
NM_015963chr22184 37 ------
NM_015995chr1594189 4114 3964 3769 3523 1738 1476 1451 410 11940 11825 --
NM_015999chr1------1210
NM_016009chr144857 4722 1913 1699 23447 1122 ----
NM_016010chr81146 ------
NM_016018chr81107 1397 12042 173
NM_016021chr622724 1091 ------
NM_016023chr832009 881 244 11850 11879 1441
NM_016032chrX71306 1240 1143 878 506 430 264 ------
NM_016037chr14998 441 419 282 1941 ----
NM_016075chr1332782 2210 153 21146 979 ----
NM_016076chr142784 2388 468 105 ------
NM_016083chr623454 274 21569 1002 13311 --
NM_016120chrX1319 ------
NM_016125chr17146 ------
NM_016129chr4--1263 ----
NM_016132chr1522360 207 ----13177
NM_016141chr31740 1608 ----
NM_016144chr51122 ------
NM_016152chr31349 ------
NM_016227chr111017 ------
NM_016231chr1721685 259 11661 ----
NM_016252chr21377 ----1750
NM_016257chr142779 1247 235 29 --33158 549 44 --
NM_016260chr236900 2588 801 ------
NM_016264chr19--1199 ----
NM_016272chr225746 739 697 606 325 ------
NM_016277chr631385 390 109 ------
NM_016287chr121946 1335 --1300 --
NM_016289chr241816 1587 1516 263 ------
NM_016308chr142087 1506 803 168 ------
NM_016315chr221797 1669 --1337 11230
NM_016338chr521237 825 ------
NM_016376chr1754275 1297 1163 617 37 ------
NM_016377chr621781 228 ------
NM_016396chr1532970 2370 915 --2598 438 --
NM_016413chr131388 ------
NM_016418chr2263360 3327 3124 2459 1061 42 11498 ----
NM_016436chr2031894 1709 635 12240 ----
NM_016441chr231486 389 342 --12152 --
NM_016467chr21127 1569 ----
NM_016480chr51213 ------
NM_016488chr1211691 --199 --
NM_016507chr1741960 524 358 113 ------
NM_016519chr41145 ------
NM_016530chr1553977 3822 3810 3593 165 ----1464
NM_016531chr421409 460 13240 1157 --
NM_016577chr393538 3482 3292 3231 1380 1308 1217 1197 63 24523 1455 23379 603 --
NM_016578chr111228 ------
NM_016588chr6----1663 --
NM_016598chr321116 138 --21104 22 --
NM_016603chr51610 ------
NM_016605chr562479 2190 1759 1709 369 177 --150 --
NM_016620chr111183 ----11312
NM_016623chr81634 ------
NM_016626chr18----21390 711 11702
NM_016631chr211879 --1246 --
NM_016829chr34517 328 315 290 --2271 61 1613
NM_016952chr1144001 1427 494 411 12979 11036 --
NM_017447chr2123763 3596 --24197 102 --
NM_017488chr211285 1103 11523 --
NM_017522chr11435 11355 1271 --
NM_017548chr321434 283 ------
NM_017563chr395382 4805 4709 4572 1877 684 383 132 81 13953 1968 --
NM_017582chr111495 --1149 11387
NM_017590chr22112535 2270 2041 1956 1756 1746 1662 971 928 849 513 ------
NM_017594chr91459 ----12164
NM_017596chr184599 4177 3798 3723 3670 3172 857 689 14185 11204 --
NM_017610chr151502 ------
NM_017628chr445297 4884 4795 856 1365 ----
NM_017637chr9178972 8019 6650 6509 6104 6040 3357 3153 1947 1371 1065 942 936 708 649 138 43 ------
NM_017644chr32745 717 ------
NM_017650chr724946 3778 15086 ----
NM_017658chr1454005 3170 1101 1029 64 ------
NM_017661chr1531064 871 457 ------
NM_017670chr11187 ------
NM_017693chr13--1632 11538 --
NM_017704chr11--1673 ----
NM_017709chr164221 3054 1593 995 886 842 ------
NM_017719chr332473 506 159 ------
NM_017738chr931138 904 215 --1407 --
NM_017739chr12559 53 ------
NM_017748chr171870 1637 ----
NM_017753chr91190 ------
NM_017754chr664451 3861 3788 3253 3146 475 34676 4608 1903 13700 --
NM_017768chr1------1629
NM_017778chr8----11338 --
NM_017780chr81171 ------
NM_017786chr81553 ------
NM_017813chr855851 3725 3654 2147 1979 11594 ----
NM_017830chr43879 639 57 ------
NM_017848chrX53323 1851 1735 652 437 23372 208 12840 --
NM_017870chr112178 21 ------
NM_017873chr982826 2707 2583 2033 1988 807 591 366 13048 ----
NM_017893chr103427 410 146 --11364 --
NM_017896chr2083225 1392 1378 1137 895 737 511 155 13137 ----
NM_017902chr10115765 5359 4907 4611 4567 1939 1532 1144 1109 978 129 --24680 571 --
NM_017913chr9160 ------
NM_017926chr141888 ------
NM_017938chrX41831 579 180 117 1493 ----
NM_017972chr141888 ------
NM_017988chr121668 --1360 --
NM_017994chr732319 860 310 --12936 11951
NM_017998chr921342 934 ------
NM_018000chr23589 487 236 ------
NM_018014chr211324 ------
NM_018018chr1221866 1335 ----1538
NM_018024chr82582 382 ------
NM_018028chr1921327 252 ------
NM_018030chr18--129 ----
NM_018045chr141231 1209 488 53 22168 258 ----
NM_018054chr161508 ------
NM_018110chr164899 888 246 171 ------
NM_018121chr1042816 2029 781 686 --12048 --
NM_018133chr331506 886 524 --1304 --
NM_018155chr333393 1386 1252 ------
NM_018157chr1262582 2473 1277 845 367 102 11127 12691 --
NM_018171chr121816 ------
NM_018184chr331494 570 35 --11702 --
NM_018192chr33938 261 227 --11000 --
NM_018196chrX2272 44 ------
NM_018197chr20--1258 ----
NM_018200chr1512030 ------
NM_018206chr161310 ----1573
NM_018217chr20164 ------
NM_018222chr11--11207 ----
NM_018247chr622703 1992 12736 ----
NM_018254chr111937 ------
NM_018287chr1011271 ------
NM_018299chr812520 12844 ----
NM_018307chr173804 277 171 ----1215
NM_018312chr1152129 1881 1839 769 312 --11808 11398
NM_018315chr421203 321 ------
NM_018330chr1021350 311 ------
NM_018340chr1644740 4043 669 428 11622 --1332
NM_018351chr1244629 4582 3627 1427 11365 2527 220 --
NM_018362chr1123613 71 12820 ----
NM_018364chr173924 3651 3536 2684 1144 693 677 ------
NM_018368chr6----1118 --
NM_018374chr734948 1690 749 24618 1090 13404 --
NM_018388chrX21156 52 --11320 --
NM_018400chr1131203 512 28 21410 1160 ----
NM_018440chr888466 6628 3323 2678 2489 1924 969 547 16229 27820 7408 15353
NM_018445chr151196 ------
NM_018471chr21175 --1228 --
NM_018553chr17----11424 --
NM_018557chr2------1448
NM_018566chr143703 3438 3131 1625 --24361 1772 --
NM_018590chr101644 ------
NM_018650chr121507 811 12029 ----
NM_018660chr842915 964 657 505 22687 131 12812 --
NM_018682chr71454 ------
NM_018689chr1592295 2120 1058 955 559 525 407 388 76 1220 ----
NM_018698chrX21914 444 ------
NM_018699chr42289 275 ------
NM_018704chr121454 186 --11879 --
NM_018718chr731957 793 739 --1862 --
NM_018841chr163767 3457 3333 2821 337 231 ----11386
NM_018847chr931288 1218 129 1154 ----
NM_018945chr643671 3398 2716 2419 12865 11401 --
NM_018970chr72898 62 1254 23174 904 --
NM_018976chr1232838 2120 1113 ------
NM_018983chr41110 ------
NM_018999chr1024542 1198 1138 11136 --
NM_019006chr151449 ------
NM_019027chr411706 ----12330
NM_019032chr11171 --1727 --
NM_019041chr62823 196 ------
NM_019045chrX----1189 --
NM_019046chr10--1617 ----
NM_019063chr2--1871 12147 --
NM_019072chr514120 --2741 44 --
NM_019084chr1031604 1034 252 --1652 --
NM_019091chr2----2418 325 --
NM_019094chr1252905 2823 1439 959 882 23458 1397 ----
NM_019106chr2213070 ------
NM_019555chr311804 11765 ----
NM_019597chrX1140 ------
NM_019842chr6----1427 1175
NM_019857chrX51786 1705 1574 1559 1388 ------
NM_020123chr10------1252
NM_020144chr711899 --21878 1856 --
NM_020151chr23633 496 414 --11245 --
NM_020159chr41621 ------
NM_020177chr513190 2590 126 12760 --
NM_020178chr1711002 --11212 --
NM_020182chr2063381 2681 2537 2518 763 112 11156 ----
NM_020239chr142159 1998 332 179 ------
NM_020336chr2063248 2870 1180 1070 1055 696 13579 ----
NM_020337chr432808 2406 453 2946 683 ----
NM_020338chr1022621 1501 13528 ----
NM_020341chr201205 ------
NM_020342chr242469 1687 994 321 ------
NM_020344chr9139 ------
NM_020346chr1111100 1243 ----
NM_020403chr13--11293 ----
NM_020420chrY11390 ------
NM_020429chr752725 2703 1111 398 270 --137 --
NM_020443chr186335 5939 4790 4740 4392 2540 2106 1269 11436 ----
NM_020463chr221356 417 ------
NM_020465chr1611955 11674 ----
NM_020466chr634252 624 388 13405 1242 13221
NM_020473chrX31597 652 344 ------
NM_020651chr221180 98 ------
NM_020654chr3----11407 --
NM_020713chr2081253 1182 1085 964 570 372 319 162 21130 1017 ----
NM_020717chrX93449 3062 1768 1304 1093 996 857 659 423 14773 --11507
NM_020727chr2123458 552 ------
NM_020728chr732605 1079 310 22697 163 ----
NM_020734chr1222924 318 ----1860
NM_020738chr21178 --11202 --
NM_020760chr21597 ----1641
NM_020766chrX2100 40 --1442 --
NM_020772chr1738143 6420 6018 --18192 --
NM_020774chr1844812 4610 1464 759 11947 14971 11167
NM_020776chr1833097 2916 1011 ----12163
NM_020783chr183768 729 523 --21765 934 --
NM_020791chr172365 315 11460 ----
NM_020801chr542521 1857 437 261 12374 ----
NM_020808chr12717 704 ------
NM_020809chr1141674 1603 744 524 --11472 --
NM_020819chr61464 --11234 --
NM_020826chr1162496 2388 1320 1062 657 128 11416 ----
NM_020841chr1223840 1017 1769 13811 1568
NM_020850chr1653088 3077 2913 1284 832 12097 22786 2385 1931
NM_020854chr1821529 217 ------
NM_020859chr483802 2978 2782 2686 1555 1515 1284 353 13592 ----
NM_020868chr22402 338 11228 ----
NM_020870chr411675 --2879 98 --
NM_020871chrX22501 2116 --12200 --
NM_020899chr1761733 1565 838 646 461 229 ------
NM_020925chr111177 ------
NM_020951chr1911530 11835 1126 --
NM_020956chr19103611 3556 3512 1816 1738 1660 1267 830 408 264 23039 804 14238 --
NM_020962chr1572155 1950 551 351 302 289 66 11837 ----
NM_020977chr452229 1937 837 828 427 ------
NM_020981chr22634 175 ------
NM_020987chr1011188 ------
NM_021007chr21163 12414 1261 --
NM_021020chr893489 3326 2646 2543 1197 927 485 334 150 12874 1670 --
NM_021033chr1322554 2190 11022 ----
NM_021061chr834158 1641 843 1800 ----
NM_021069chr4------1294
NM_021072chr542246 870 565 129 ------
NM_021088chr221733 388 ------
NM_021090chr2283710 3199 1583 1262 1216 1161 366 336 2825 30 13130 --
NM_021096chr2283257 2681 2605 2498 2159 392 184 174 12843 ----
NM_021097chr232533 1915 998 ------
NM_021120chrX33184 2917 748 --12482 1894
NM_021132chr1031339 1248 432 1551 ----
NM_021140chrX1390 1435 ----
NM_021148chr732399 2274 1987 1992 11891 --
NM_021183chrX----124 1284
NM_021190chr111150 --11292 --
NM_021191chr1221003 646 --12262 --
NM_021194chr11110 ------
NM_021229chr12--1849 ----
NM_021255chr1432937 830 516 --13962 --
NM_021614chr5------150
NM_021627chr321180 390 ------
NM_021643chr231859 1495 614 1420 ----
NM_021644chr1011022 11040 ----
NM_021647chr434119 2965 1633 --13561 --
NM_021648chr632496 309 238 168 ----
NM_021705chr621159 479 ------
NM_021728chr14--1884 ----
NM_021813chr634101 1839 325 25489 3847 1611 1846
NM_021814chr6--11255 ----
NM_021911chr575603 4041 2007 1162 585 346 238 23905 682 15409 --
NM_021914chr142948 365 --1825 1374
NM_021943chr651781 540 517 494 398 --2479 259 --
NM_021945chr643123 2490 2298 246 12815 31013 871 364 --
NM_021947chr1741240 933 493 108 ------
NM_021949chrX12737 32744 1871 1132 2974 62 12517
NM_021956chr611032 ------
NM_021959chr62681 59 ------
NM_021961chr1146921 2985 1527 829 ----12184
NM_021984chrX1528 ------
NM_021987chrX1528 ------
NM_021990chrX1528 ------
NM_022048chr1586198 5884 4672 4432 4082 2088 1599 185 12495 ----
NM_022062chr1151468 1438 1350 519 316 11964 11551 --
NM_022079chr101768 ------
NM_022118chr131608 ------
NM_022166chr1675127 2356 2305 2109 635 207 124 ----1762
NM_022351chr812804 11493 ----
NM_022455chr5----1272 --
NM_022456chr1276386 6343 5147 5135 4778 444 50 25227 1391 ----
NM_022469chr143151 2679 2355 966 ------
NM_022473chr1564138 3266 3117 2997 1276 1144 11369 1917 --
NM_022474chr1432642 2101 204 12385 11057 --
NM_022483chr531846 681 32 11744 ----
NM_022497chr333027 660 426 21435 213 13798 --
NM_022716chr122714 564 22000 660 --12467
NM_022719chr2263260 3111 1528 1271 953 754 --13451 --
NM_022726chr6------1506
NM_022728chr7128 ------
NM_022731chr1198 ------
NM_022735chr121161 505 ------
NM_022766chr2252628 2182 825 546 299 1433 ----
NM_022768chr11318 ------
NM_022771chr122947 726 ------
NM_022776chr321339 1220 ------
NM_022781chr922605 2568 12395 ----
NM_022802chr10191 --11075 --
NM_022817chr221521 77 2683 594 11809 1767
NM_022832chr44880 358 123 91 ----12503
NM_022841chr151880 ------
NM_022893chr222538 2222 --2862 386 --
NM_022898chr1464684 3011 1414 983 916 846 ------
NM_022910chr1611955 11674 ----
NM_022912chr231215 520 186 ------
NM_023009chr11212 ----1656
NM_023016chr212319 22283 1766 ----
NM_023927chr52474 94 ------
NM_023929chr822377 2308 ------
NM_023931chr1631384 1104 381 11418 --1412
NM_024007chr522868 820 ------
NM_024052chr173811 490 167 ------
NM_024054chr7----1325 --
NM_024061chr72231 173 ------
NM_024076chr1962343 2325 1667 1551 798 743 ------
NM_024086chr1793740 3409 3065 2612 1219 1145 222 199 53 22703 1529 ----
NM_024090chr411733 11338 ----
NM_024293chr22860 48 1527 ----
NM_024295chr831632 1304 494 182 ----
NM_024332chrX----11547 11125
NM_024336chr16--1352 ----
NM_024344chr151540 ------
NM_024345chr942066 856 266 158 12164 --14185
NM_024424chr1131020 905 857 ------
NM_024425chr1131020 905 857 ------
NM_024426chr1131020 905 857 ------
NM_024430chr1821825 1504 11460 ----
NM_024524chr331031 712 550 12590 ----
NM_024539chrX2791 150 ------
NM_024554chr131133 455 157 ------
NM_024556chr111419 ------
NM_024563chr531820 1349 81 ----11313
NM_024567chr81556 ------
NM_024569chr141853 608 548 457 12004 ----
NM_024586chr11549 ------
NM_024612chr171100 ------
NM_024613chr8135 ------
NM_024639chr612172 --11947 --
NM_024646chr154020 3286 2700 876 535 13145 23700 1335 --
NM_024664chr1176 --1326 --
NM_024665chr32701 624 --1101 --
NM_024670chr1021606 715 11078 ----
NM_024721chr811978 --12443 --
NM_024770chr266036 5961 5457 1637 1281 655 16451 16383 --
NM_024785chr241464 1435 516 262 1575 ----
NM_024873chr42793 129 --21071 1063 --
NM_024884chr1444223 4117 1128 358 21837 1084 ----
NM_024944chr21181 ------
NM_024949chr464813 4352 3901 1974 878 680 14712 ----
NM_024953chr1221734 617 ----12140
NM_024989chr267681 7448 6677 2746 2382 1563 12339 ----
NM_024991chr1011211 12195 --1693
NM_025027chr191249 ----11032
NM_025054chr852990 2923 1445 1225 159 23228 727 ----
NM_025073chr124064 3240 11094 33344 3206 1657 13541
NM_025076chr21578 ------
NM_025133chr2----11167 --
NM_025134chr161578 ----12072
NM_025146chr331027 782 273 ----12683
NM_025160chr133455 3012 59 --1818 --
NM_025176chr202685 151 --1678 --
NM_025191chr132150 1382 1310 ------
NM_025208chr1122320 2268 ----1383
NM_025219chr2072473 2268 1654 1588 1526 44 21 12164 ----
NM_025243chr232058 1392 721 31781 1484 1349 ----
NM_025244chr21202 ------
NM_030583chr81366 ----11000
NM_030627chr513600 1823 ----
NM_030648chr454492 2098 2025 1657 509 --1382 --
NM_030664chr1011663 ------
NM_030670chr1221616 168 --21542 1524 --
NM_030671chr1221616 168 --21542 1524 --
NM_030756chr101121 ------
NM_030790chr16131 ------
NM_030791chr1411205 ------
NM_030806chr179109 8599 8461 7078 2795 2756 2683 37465 1898 1745 28412 2151 --
NM_030808chr172282 195 ------
NM_030884chr342257 2131 2092 1492 12073 ----
NM_030885chr332127 2080 1454 ------
NM_030918chr155166 4815 4325 810 122 21985 662 --15362
NM_030939chr61337 ------
NM_030962chr111524 1190 1305 --
NM_030964chr532784 2517 997 --13114 --
NM_031216chr1821657 779 12150 ----
NM_031243chr722132 622 11940 ----
NM_031262chr92454 299 ------
NM_031263chr91356 ------
NM_031268chr1685101 4625 4310 1843 1393 1309 621 61 23597 405 15389 14229
NM_031283chr21738 187 ----
NM_031305chr4287 30 ------
NM_031362chr222134 1091 ----12629
NM_031365chr212270 --11826 12765
NM_031366chr212270 --11826 12765
NM_031419chr321140 24 --1575 --
NM_031426chr962691 2389 2020 656 476 104 12603 11967 --
NM_031431chr1311837 --1248 --
NM_031442chrX----12858 --
NM_031445chr263392 3335 2100 842 322 37 --148 --
NM_031452chr15176 ------
NM_031476chr1662256 1124 743 655 534 139 --1641 --
NM_031483chr2052786 2391 2281 618 94 11145 ----
NM_031845chr243621 3288 3257 801 ------
NM_031847chr243621 3288 3257 801 ------
NM_031858chr17--1338 ----
NM_031862chr17--1338 ----
NM_031914chr141156 ------
NM_031954chr1272213 2062 1895 1834 1109 978 613 ------
NM_032012chr984370 3659 3290 2001 1584 1415 247 69 23418 2072 --14189
NM_032041chr832705 1016 606 12396 --11922
NM_032050chr223922 855 169 ------
NM_032052chr2241307 1240 554 74 ------
NM_032102chr1162653 2534 2015 715 628 337 12599 ----
NM_032116chr1335707 5660 5644 11068 15391 11366
NM_032121chrX1342 22616 1037 ----
NM_032128chr41326 ------
NM_032139chr191300 ------
NM_032144chr22592 190 ------
NM_032145chr611919 ------
NM_032153chr332767 2675 2306 ------
NM_032160chr1813815 ------
NM_032186chr111183 ----11312
NM_032189chr1384235 3966 2005 1706 1268 305 146 105 ------
NM_032193chr11111870 1801 1769 1665 1492 1299 769 686 604 399 177 --1698 --
NM_032199chr1043669 3355 1234 1193 --1330 21542 38
NM_032213chr251093 1021 770 457 327 1280 ----
NM_032221chr2021741 1265 ------
NM_032246chr15------11223
NM_032283chr161795 1769 1677 1333 1140 405 1547 ----
NM_032329chr2103767 3700 3623 3254 3173 3155 3146 2762 671 117 --11308 --
NM_032373chr1042308 1814 1768 348 --12050 --
NM_032374chr1451611 1579 669 304 129 21291 1247 ----
NM_032438chr611034 1448 ----
NM_032439chr101335 ------
NM_032440chr101196 ------
NM_032445chr151914 12095 22386 2057 --
NM_032449chr132625 2216 1827 22569 1921 1305 --
NM_032457chr4--1433 --13945
NM_032458chrX12352 12400 12206 --
NM_032468chr8167 ------
NM_032505chr332608 2120 767 12068 2881 811 --
NM_032514chr201406 ------
NM_032557chr42309 29 ------
NM_032560chr141315 ------
NM_032582chr173750 645 117 --11520 --
NM_032590chr12----1987 --
NM_032682chr353492 2462 2341 1155 671 ----11248
NM_032711chr1774170 3333 1607 1577 1433 400 215 23343 2993 13294 11593
NM_032727chr1021250 431 11173 ----
NM_032786chr121415 ------
NM_032801chr1122203 1950 1133 ----
NM_032802chr151217 ------
NM_032810chr101963 1181 --1949
NM_032818chr93623 475 437 11939 22275 1784 --
NM_032826chr745187 1137 1110 329 2837 495 ----
NM_032838chr192503 46 --1410 --
NM_032857chr151154 ------
NM_032859chr131509 --11241 --
NM_032873chr1153089 3066 1575 1346 1111 --23079 1334 --
NM_032875chr171219 ------
NM_032900chr1063694 3298 3210 3181 1304 26 ------
NM_032961chr4189 ----1145
NM_032975chr1883086 2971 2940 2210 1192 1160 990 98 ------
NM_032978chr1821113 786 ------
NM_032979chr1821113 786 ------
NM_032980chr1883086 2971 2940 2210 1192 1160 990 98 ------
NM_032981chr1821113 786 ------
NM_032993chr41110 ------
NM_033020chr154283 3340 3305 3283 669 13996 ----
NM_033044chr11849 ------
NM_033082chr12162 ------
NM_033133chr1742879 1371 854 574 13140 1441 --
NM_033135chr1122320 2268 ----1383
NM_033136chr531594 588 412 --1138 --
NM_033137chr531594 588 412 --1138 --
NM_033143chr454544 2869 2861 1781 97 14031 ----
NM_033161chr931512 171 40 31691 1669 29 ----
NM_033181chr623454 274 21569 1002 13311 --
NM_033211chr52638 49 ------
NM_033222chr911203 --1956 --
NM_033224chr766799 3076 2928 2582 1082 51 ----11002
NM_033240chr1551687 1508 1079 469 359 11597 11441 --
NM_033274chr582703 2339 1304 1129 561 517 206 91 --32597 983 63 --
NM_033281chr51173 ------
NM_033285chr81520 --14340 --
NM_033300chr11435 11355 1271 --
NM_033326chr1121992 115 --12401 --
NM_033360chr1224515 1453 --23299 696 --
NM_033364chr321966 1616 ------
NM_033389chr1723056 107 --43906 3765 974 606 --
NM_033393chr462893 2524 2512 2146 1030 551 ------
NM_033394chr211545 ------
NM_033425chr1132173 323 38 --1140 --
NM_033429chr153883 872 859 11253 32386 2092 947 --
NM_033505chr266469 6389 6331 6178 4551 532 14772 26131 4635 15755
NM_033631chr143369 2681 1381 165 ------
NM_033632chr421203 321 ------
NM_033644chr532097 60 52 ------
NM_033645chr532097 60 52 ------
NM_033656chr2175441 5071 4377 2128 2117 562 529 --11267 --
NM_033668chr10--150 ----
NM_052875chr1142145 2113 649 564 11353 ----
NM_052879chr1243554 3294 483 59 ------
NM_052885chr1261824 1617 1572 1533 435 407 ------
NM_052900chr811714 ------
NM_052910chr1351839 1617 523 434 422 --1760 --
NM_052918chr1052689 1366 750 720 711 --12562 --
NM_052937chr82939 908 12577 ----
NM_052958chr82623 208 ------
NM_052978chr1441385 704 627 169 --1753 --
NM_053016chr956319 5665 2067 886 583 17104 ----
NM_053024chr3----1379 --
NM_053043chr794702 4659 4095 1785 902 851 800 745 717 15523 12172 --
NM_057159chr921438 349 --11133 --
NM_058241chr21274 --1703 --
NM_058241chr21274 --1703 --
NM_080491chr1123630 1387 --1235 1723
NM_080597chr18--129 ----
NM_080629chr111546 1209 ----
NM_080630chr111546 1209 ----
NM_080676chr2053126 2661 2324 807 366 1587 ----
NM_080738chr11505 21859 1732 ----
NM_080759chr132913 799 ------
NM_080760chr132913 799 ------
NM_080867chr1464714 4191 3766 3279 3202 711 23270 652 --13260
NM_080872chr853793 3020 2910 2623 459 --33874 1254 33 --
NM_080927chr362869 2543 638 401 346 45 ------
NM_130391chr913442 12512 ----
NM_130392chr913442 12512 ----
NM_130393chr913442 12512 ----
NM_130434chr15138 ------
NM_130435chr1042550 2268 2008 1914 --138 --
NM_130439chr1052118 1990 1948 1739 402 ------
NM_130439chr1052118 1990 1948 1739 402 ------
NM_130442chr72421 232 ----1923
NM_130811chr202443 216 --1896 --
NM_130847chr1145796 4778 1863 1800 --15712 --
NM_133170chr20108069 7794 7635 7188 6627 6413 1089 712 654 133 12311 14945 15523
NM_133264chr1763743 3402 3161 2836 2531 60 13752 11529 --
NM_133329chr221691 1159 1501 ----
NM_133334chr4146128 5986 5808 4957 4909 4079 4032 3906 1493 1382 1258 1190 973 323 1241 14793 --
NM_133370chr422810 2793 --23032 2831 --
NM_133372chr542473 2007 367 167 ------
NM_133638chr521425 194 ------
NM_138270chrX13298 ------
NM_138285chr21409 ------
NM_138338chr2273475 3062 3001 950 763 595 567 --21298 52 --
NM_138396chr122872 62 --1397 --
NM_138426chr722450 497 --1467 --
NM_138453chr5166 ------
NM_138457chr642749 2380 425 412 11164 12271 --
NM_138468chr234763 2537 28 55282 5023 4596 2277 1448 --11866
NM_138473chr1233316 543 511 ------
NM_138479chr131917 664 235 ------
NM_138558chr1--1937 ----
NM_138559chr211314 ------
NM_138576chr1464684 3011 1414 983 916 846 ------
NM_138633chr621781 228 ------
NM_138638chr142948 365 --1825 1374
NM_138713chr1688099 6873 6802 3204 2218 1214 942 418 1491 ----
NM_138714chr1688099 6873 6802 3204 2218 1214 942 418 1491 ----
NM_138731chr1433412 1580 354 ------
NM_138811chr711130 1835 ----
NM_138923chrX125 ------
NM_138927chr21--1374 --1118
NM_138970chr142601 372 --11750 --
NM_138971chr1172577 1317 1237 1004 242 94 63 1442 ----
NM_138971chr1172577 1317 1237 1004 242 94 63 1442 ----
NM_138972chr1172577 1317 1237 1004 242 94 63 1442 ----
NM_138972chr1172577 1317 1237 1004 242 94 63 1442 ----
NM_138973chr1172577 1317 1237 1004 242 94 63 1442 ----
NM_138973chr1172577 1317 1237 1004 242 94 63 1442 ----
NM_138980chr41547 ------
NM_138982chr41547 ------
NM_138992chr2131104 822 180 ------
NM_139035chrX1517 ------
NM_139045chr91693 ------
NM_139131chr111659 ------
NM_139135chr11350 ------
NM_139166chr8139 ------
NM_139167chr81107 ------
NM_139169chr1041569 919 461 180 --1528 1748
NM_139246chr991971 1716 934 920 823 394 382 279 115 ------
NM_139276chr1752278 2145 2072 1667 270 1680 11741 --
NM_139279chr242199 1130 983 332 1848 12669 --
NM_139283chr1232492 945 829 --1108 --
NM_139321chr2043617 552 409 87 ------
NM_139323chr201190 ------
NM_144571chr455716 5515 5209 1667 1313 26045 637 37031 1124 86 --
NM_144579chr272698 2608 2534 2212 588 502 458 12716 1490 --
NM_144582chr2102465 2398 2258 2146 1904 1667 1618 622 388 369 --12539 --
NM_144595chr131684 ------
NM_144599chr1554995 4661 4221 150 57 15410 21725 1322 --
NM_144609chr172441 276 ----1128
NM_144610chr17130 ------
NM_144642chr311115 --1260 1218
NM_144664chr1111944 ------
NM_144726chr5----11042 --
NM_144767chr1583929 3596 3514 1429 1263 827 274 44 1496 ----
NM_144778chr13--11682 ----
NM_144973chr1234108 1301 873 11722 ----
NM_144982chr12--2672 87 1529 --
NM_145021chr101275 ------
NM_145052chrX1412 --1817 --
NM_145055chr1833732 1375 868 --13547 --
NM_145175chr241188 363 330 130 --1351 --
NM_145203chr131730 ------
NM_145206chr1042853 2230 1074 679 --166 --
NM_145207chr433487 498 471 24675 1290 14815 25017 585
NM_145284chrX32011 1763 346 ------
NM_145320chr723175 3112 13445 ----
NM_145321chr723175 3112 13445 ----
NM_145322chr723175 3112 13445 ----
NM_145349chr1751965 903 880 551 542 21912 1741 ----
NM_145350chr1731317 255 232 21264 1093 ----
NM_145647chr81172 ------
NM_145686chr212415 1683 1814 --
NM_145687chr212415 1683 1814 --
NM_145698chr10--11377 1521 --
NM_145714chr161360 ------
NM_145733chr221859 ------
NM_145799chrX63059 2904 1230 1215 421 207 1215 1330 --
NM_145861chr11505 21859 1732 ----
NM_147147chr6103721 3002 1590 1581 1546 1524 1511 1212 781 78 ----11655
NM_147156chr1021547 140 ------
NM_147192chr12282 189 11542 ----
NM_148174chr8--155 ----
NM_148415chr161383 ------
NM_148416chr161360 ------
NM_148898chr72884 284 ----1848
NM_148899chr72884 284 ----1848
NM_148904chr11549 ------
NM_148905chr11549 ------
NM_148906chr11549 ------
NM_148907chr11549 ------
NM_148908chr11549 ------
NM_148909chr11549 ------
NM_152253chr2254038 3577 2900 1667 1169 13253 23794 3037 --
NM_152261chr1222457 871 11825 11777 --
NM_152265chr1--1202 ----
NM_152275chr23625 371 33 ------
NM_152277chr511681 --1291 --
NM_152280chr123139 430 --23424 3161 --
NM_152289chr1921704 1282 ------
NM_152330chr1411837 1533 ----
NM_152332chr1422634 767 11020 ----
NM_152344chr1741435 1390 545 364 ------
NM_152371chr151769 1565 1465 656 596 --11718 --
NM_152375chr162470 2355 2251 1784 564 109 --11678 --
NM_152409chr533125 447 93 1988 22682 263 --
NM_152414chr821424 412 ------
NM_152423chrX21187 1044 11314 11545 --
NM_152440chr122415 204 ------
NM_152446chr141287 2690 349 ----
NM_152450chr1531910 1485 1428 11803 ----
NM_152484chr1911337 ------
NM_152520chr21298 ------
NM_152574chr9--1123 ----
NM_152588chr12--11847 ----
NM_152594chr1542117 1490 700 247 ------
NM_152622chr541233 777 734 402 --12896 --
NM_152624chr586069 5260 5195 5122 4924 1993 1912 1488 15008 --16716
NM_152660chr11329 ------
NM_152665chr11837 --1362 --
NM_152678chr341900 1787 1696 401 1867 22721 2204 --
NM_152695chrX22250 1956 ------
NM_152699chr353691 2887 2623 2302 1194 22394 824 11124 --
NM_152713chr111214 1227 ----
NM_152721chr18--1176 ----
NM_152733chr666316 5675 5121 4946 4449 2611 1889 ----
NM_152734chr6125385 5330 5320 3861 1509 1270 1263 732 470 228 220 162 --1344 --
NM_152774chr722010 420 ------
NM_152787chrX43639 415 326 129 11125 ----
NM_152838chr2033450 3345 394 --13467 --
NM_152890chr1137 2360 113 ----
NM_152919chr1951514 1337 911 252 239 --23504 3413 --
NM_152924chr1556362 5692 5052 4591 2311 25473 5303 15252 --
NM_152989chr1241352 1256 1180 326 172 ----
NM_152990chr61288 2848 26 ----
NM_152999chr724409 4172 23290 1542 ----
NM_153028chr162264 183 ------
NM_153029chr1663900 3665 3534 3042 911 761 12764 --11552
NM_153038chr2------1725
NM_153050chr2283710 3199 1583 1262 1216 1161 366 336 2825 30 13130 --
NM_153051chr2283710 3199 1583 1262 1216 1161 366 336 2825 30 13130 --
NM_153184chr321696 58 ------
NM_153223chr521592 551 ----1263
NM_153341chr11119 ------
NM_153365chr432734 2435 158 1251 ----
NM_153367chr1051570 1444 1366 1028 354 ----13708
NM_153464chr19--1688 ----
NM_153607chr542717 1161 832 24 ------
NM_153619chr1521457 174 11356 1409 --
NM_153810chr1054540 4218 4169 3332 701 14326 14800 --
NM_153812chr132235 687 644 22175 1566 ----
NM_153831chr8------1336
NM_153836chr242037 1846 558 181 1287 11387 --
NM_170674chr15----11102 --
NM_170675chr15----1778 --
NM_170676chr15----1778 --
NM_170677chr15----11102 --
NM_170679chr521127 1117 ------
NM_170706chr154163 3530 3340 3168 31 ------
NM_170731chr1132695 2462 804 ----11090
NM_170732chr1132695 2462 804 ----11090
NM_170733chr1132695 2462 804 ----11090
NM_170734chr1132695 2462 804 ----11090
NM_170735chr1132695 2462 804 ----11090
NM_170751chr61308 ------
NM_170752chr61308 ------
NM_170774chr2073500 3135 1636 1405 943 935 921 --1776 --
NM_170775chr5------150
NM_172058chr811480 ------
NM_172059chr811480 ------
NM_172060chr811480 ------
NM_172070chr221418 231 ------
NM_172071chr134701 2902 2814 11693 ----
NM_172103chr622504 198 1350 ----
NM_172105chr622504 198 1350 ----
NM_172128chr421759 833 1609 ----
NM_172225chr12282 189 11542 ----
NM_172315chr15----11102 --
NM_172316chr15----11102 --
NM_172337chr14--1884 ----
NM_172344chr221691 1159 1501 ----
NM_172349chr5----1272 --
NM_173054chr72923 369 ------
NM_173065chr133382 3116 351 13071 1692 --
NM_173087chr151540 ------
NM_173088chr151540 ------
NM_173089chr151540 ------
NM_173090chr151540 ------
NM_173163chr16----1477 --
NM_173165chr16----1358 --
NM_173172chr2142 --148 --
NM_173198chr931015 765 586 ------
NM_173200chr931015 765 586 ------
NM_173214chr1688099 6873 6802 3204 2218 1214 942 418 1491 ----
NM_173353chr12196 1103 ----
NM_173359chr3--1104 11178 --
NM_173470chrX62810 2213 1957 1138 417 136 ------
NM_173495chrX31857 597 478 12427 11804 --
NM_173508chr13850 279 100 11240 1831 --
NM_173511chr243216 1024 786 493 ------
NM_173552chr31950 148 ----
NM_173582chr1135849 187 152 41540 1327 145 108 ----
NM_173595chr1255296 3230 1833 1139 810 ------
NM_173602chr1223196 2385 33329 2457 65 1105 --
NM_173642chr1118568 8312 7973 6027 3582 3216 2452 2427 768 332 157 36205 3254 2796 ----
NM_173666chr511148 ------
NM_173694chrX22085 2017 11013 --1231
NM_173797chr511125 ------
NM_173809chr1041153 389 164 118 ------
NM_173822chr22717 96 1795 ----
NM_174856chr201254 --1104 --
NM_174890chr10----1753 --
NM_174909chr51817 ------
NM_174916chr1522210 2079 --11819 --
NM_174934chr1152729 2429 1388 673 648 --1203 --
NM_174953chr1731214 1109 1034 --1149 --
NM_174957chr1731214 1109 1034 --1149 --
NM_175061chr721767 1673 ------
NM_175610chr154911 381 224 168 ------
NM_175623chr1276386 6343 5147 5135 4778 444 50 25227 1391 ----
NM_175624chr1276481 6438 5242 5230 4873 539 145 25322 1486 ----
NM_175625chr1276481 6438 5242 5230 4873 539 145 25322 1486 ----
NM_175767chr521227 737 ------
NM_175848chr201439 ----1337
NM_175848chr201439 ----1337
NM_175849chr201439 ----1337
NM_175849chr201439 ----1337
NM_175850chr201439 ----1337
NM_175850chr201439 ----1337
NM_175854chr1332569 950 190 ----133
NM_175856chr51621 ------
NM_175859chrX51786 1705 1574 1559 1388 ------
NM_175861chr1215721 12403 15110 --
NM_175876chr1----1262 1884
NM_175907chr1842531 619 484 257 ----1215
NM_176792chr1021128 542 21172 551 ----
NM_176815chr352111 2081 2034 1077 147 ------
NM_177553chr112681 38 ------
NM_177969chr21569 ------
NM_177972chr1164393 3629 3493 656 636 376 1497 24262 3808 --
NM_177990chr201205 ------
NM_177999chr9103389 3270 3146 2596 2551 1370 1154 929 469 443 13611 ----
NM_178010chr1241352 1256 1180 326 172 ----
NM_178013chr144912 388 170 27 12031 ----
NM_178031chr112178 21 ------
NM_178037chr1293032 2890 2867 2624 2600 2398 2351 971 630 23492 343 12209 --
NM_178038chr1293032 2890 2867 2624 2600 2398 2351 971 630 23492 343 12209 --
NM_178135chr411110 ------
NM_178151chrX97217 6584 5482 5126 5074 4883 4784 1604 1594 1704 26747 2449 --
NM_178152chrX97217 6584 5482 5126 5074 4883 4784 1604 1594 1704 26747 2449 --
NM_178153chrX97217 6584 5482 5126 5074 4883 4784 1604 1594 1704 26747 2449 --
NM_178424chr51231 ------
NM_178439chr2199 2455 424 ----
NM_178454chr12607 556 ------
NM_178470chrX21313 239 186 ----
NM_178498chr1153689 2956 1311 1256 658 ------
NM_178505chr1033636 2412 958 12900 --23016 1013
NM_178539chr1261796 1773 1730 1512 444 144 ------
NM_178585chr442579 883 776 31 23075 849 --13033
NM_178586chr1422346 502 ------
NM_178812chr81623 11073 ----
NM_178818chr1631732 1626 678 ----12020
NM_180976chr63808 207 167 ------
NM_180977chr63808 207 167 ------
NM_181054chr142437 244 ------
NM_181349chr752725 2703 1111 398 270 --137 --
NM_181351chr1132213 2165 1920 ----12681
NM_181353chr20188 --1540 --
NM_181358chr143702 3517 3415 416 22788 2731 133 --
NM_181459chr22869 421 ------
NM_181460chr22916 468 ------
NM_181481chr1832496 2386 1750 17058 --12810
NM_181482chr1832496 2386 1750 17058 --12810
NM_181483chr1832496 2386 1750 17058 --12810
NM_181504chr533012 1478 987 ------
NM_181507chr111391 ------
NM_181508chr111391 ------
NM_181509chr201406 ------
NM_181521chr1676513 6407 6044 5981 5459 553 150 ----16801
NM_181523chr533012 1478 987 ------
NM_181524chr533012 1478 987 ------
NM_181689chr20--1757 ----
NM_181705chr563827 795 758 696 671 474 21527 434 25004 2301 --
NM_181784chr211059 ------
NM_181828chr2263360 3327 3124 2459 1061 42 11498 ----
NM_181829chr2263360 3327 3124 2459 1061 42 11498 ----
NM_181830chr2263360 3327 3124 2459 1061 42 11498 ----
NM_181832chr2263375 3342 3139 2474 1076 57 11513 ----
NM_181838chr511544 1555 ----
NM_181839chr831347 1279 104 ------
NM_182485chr42978 701 --21320 1182 --
NM_182488chr13--2905 611 ----
NM_182501chr262481 1302 791 698 691 594 --11271 --
NM_182529chr7126 ------
NM_182551chr253520 3258 3243 1324 969 ------
NM_182557chr1131468 551 84 --32086 1840 742 --
NM_182641chr171132 1159 ----
NM_182646chr42978 701 --21320 1182 --
NM_182663chr111901 --11955 --
NM_182664chr112031 --12085 --
NM_182665chr111901 --11955 --
NM_182678chr2----1356 --
NM_182691chr711068 ------
NM_182692chr711068 ------
NM_182734chr2022858 2531 --1282 12294
NM_182767chr1221700 641 ------
NM_182830chr142413 362 1256 --1636
NM_182896chr31439 ------
NM_182911chr21202 ------
NM_182931chr71454 ------
NM_182948chr111004 1421 1355 --
NM_182972chr152626 2560 2253 1936 120 ------
NM_183004chr1433039 2651 97 --23254 1232 --
NM_183061chr3141 ------
NM_183227chr631385 390 109 ------
NM_183234chr1521790 35 11880 21368 571 --
NM_183235chr1521790 35 11880 21368 571 --
NM_183236chr1521790 35 11880 21368 571 --
NM_183353chrX1319 ------
NM_183376chr1542381 1626 447 195 --1554 --
NM_183397chr2064751 4453 4053 3438 1652 1196 34795 1801 413 15025 --
NM_194282chr411156 ------
NM_194285chr1142703 2495 1379 626 12795 ----
NM_194291chr8--13042 ----
NM_194317chr242623 2563 1724 51 ------
NM_194328chr922605 2568 12395 ----
NM_194329chr922605 2568 12395 ----
NM_194330chr922605 2568 12395 ----
NM_194332chr922605 2568 12395 ----
NM_194358chr1241642 1582 500 488 ------
NM_194359chr1241642 1582 500 488 ------
NM_194434chr1865327 5274 4949 2089 892 90 --1666 --
NM_194449chr181325 ------
NM_194463chrX2791 150 ------
NM_197939chr171459 ----1295
NM_197941chr522033 131 2748 412 12535 --
NM_198081chr6--11058 12004 --
NM_198097chr73204 73 55 ------
NM_198098chr731646 1615 1243 1103 11712 1141
NM_198123chr811714 ------
NM_198124chr811714 ------
NM_198158chr322993 2725 ------
NM_198159chr322993 2725 ------
NM_198177chr322993 2725 ------
NM_198178chr322993 2725 ------
NM_198225chr1021975 358 ------
NM_198268chr143702 3517 3415 416 22788 2731 133 --
NM_198269chr143702 3517 3415 416 22788 2731 133 --
NM_198270chrX32811 2401 788 33238 3056 515 ----
NM_198273chr532620 950 31 ------
NM_198324chr123992 231 169 ------
NM_198353chr4----2417 84 --
NM_198391chr2031396 1304 456 11545 ----
NM_198392chr63697 358 89 --1639 --
NM_198395chr5------11230
NM_198468chr641656 1535 1173 435 1583 14515 --
NM_198504chr3--1204 ----
NM_198513chr81573 ------
NM_198530chr1731241 484 168 ------
NM_198567chr51196 ------
NM_198581chr256615 5762 1829 1636 984 15344 ----
NM_198859chr374671 4288 3870 1661 1438 547 247 ------
NM_198896chr112740 340 ------
NM_198947chr111416 ----1332
NM_198965chr121153 ------
NM_198966chr121153 ------
NM_199040chr1252905 2823 1439 959 882 23458 1397 ----
NM_199044chr132871 617 510 22648 326 12937 --
NM_199050chr2143395 3327 3285 2578 11250 ----
NM_199129chr2011124 ------
NM_199131chr1032801 2577 87 12888 ----
NM_199133chr521112 317 --21081 259 --
NM_199169chr2063381 2681 2537 2518 763 112 11156 ----
NM_199170chr2063381 2681 2537 2518 763 112 11156 ----
NM_199171chr2063381 2681 2537 2518 763 112 11156 ----
NM_199185chr51254 ------
NM_199188chr1243554 3294 483 59 ------
NM_199190chr1243554 3294 483 59 ------
NM_199324chr423138 734 ------
NM_199421chr1464714 4191 3766 3279 3202 711 23270 652 --13260
NM_199426chr20--1258 ----
NM_199436chr211237 12197 1220 --
NM_199482chr211870 ------
NM_201253chr12534 418 1448 ----
NM_201266chr222604 1050 32766 2467 213 12028 --
NM_201269chr111183 ----11312
NM_201279chr222604 1050 32766 2467 213 12028 --
NM_201628chr163348 3243 3012 1109 669 63 ------
NM_203301chr14--1273 ----
NM_203305chr932034 763 434 ------
NM_203307chr1931490 1378 1115 11582 ----
NM_203327chr20134483 4341 3749 3675 3612 1600 1576 785 691 581 237 27 21 1752 23705 243 --
NM_203329chr1196944 6526 6049 6036 4931 4699 2373 1898 1791 24546 139 24974 4302 11327
NM_203330chr1196944 6526 6049 6036 4931 4699 2373 1898 1791 24546 139 24974 4302 11327
NM_203331chr1196944 6526 6049 6036 4931 4699 2373 1898 1791 24546 139 24974 4302 11327
NM_203349chr1531604 608 214 ------
NM_203350chr1181 1327 ----
NM_203406chr51504 --11949 --
NM_203446chr212469 434 --12261 --
NM_203458chr123598 1222 ------
NM_203487chr13--11293 ----
NM_203494chr151189 ------
NM_203504chr42785 710 ------
NM_203505chr42785 710 ------
NM_205768chr131902 1759 292 ------
NM_206594chr112262 ----12531
NM_206595chr112262 ----12531
NM_206809chr62826 329 2916 265 1774 --
NM_206853chr654037 4019 3260 2900 761 --12981 --
NM_206854chr665298 5280 4521 4161 2022 1243 --14242 --
NM_206855chr656263 6245 5486 5126 2208 --15207 --
NM_206866chr2142358 674 531 380 12219 ----
NM_206876chr243059 2528 2195 1069 ----13125
NM_206909chr842924 2890 1915 30 ----17456
NM_207043chr152296 2205 2120 1732 1523 ------
NM_207044chr152296 2205 2120 1732 1523 ------
NM_207047chr152296 2205 2120 1732 1523 ------
NM_207122chr11--11061 ----
NM_207170chr11290 --1766 --
NM_207171chr151999 1965 1810 1661 225 1421 ----
NM_207299chr91190 ------
NM_207303chr1043641 2542 445 70 1154 22960 191 --
NM_207356chr12667 585 ------
NM_207396chr151628 1214 1195 600 296 1388 ----
NM_207406chr465104 5088 4524 4013 2299 1580 --12164 11095
NM_207481chr2----11317 --
NM_212460chr7----11566 --
NM_212464chr1512104 ------
NM_212465chr151540 ------
NM_212471chr1731556 401 95 --1684 12190
NM_212472chr1731556 401 95 --1684 12190
NM_213589chr225517 4121 --14685 --
NM_213593chr1----2993 904 --
NM_213606chr1011781 21862 240 ----
NM_213609chr31118 ------
NM_213651chr1----1138 --
NM_213662chr1752372 2239 2166 1761 364 1774 11835 --