TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3190-3p
miRNA Sequence: UGUGGAAGGUAGACGGCCAGAGA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000016chr12579 87 ------
NM_000021chr143828 336 134 1926 --11051
NM_000045chr64257 117 101 85 ------
NM_000046chr552725 2524 1931 674 28 --12965 --
NM_000052chrX93179 2619 2547 2233 2166 760 457 223 205 13416 12332 --
NM_000053chr1342033 1807 1698 382 --21545 112 --
NM_000063chr62313 262 --158 1269
NM_000067chr81633 ------
NM_000074chrX4915 779 611 359 ------
NM_000084chrX186963 6595 5972 5838 5809 5096 4298 2345 2100 1901 1772 1704 1470 1163 852 819 748 635 46454 1676 880 89 26683 205 --
NM_000088chr1711118 1119 ----
NM_000089chr72828 614 1718 2709 98 --
NM_000090chr22178 114 --1701 --
NM_000091chr282632 2491 2445 1850 701 560 262 163 22596 887 ----
NM_000093chr952533 1898 1535 958 628 1902 11748 --
NM_000108chr751590 1570 1185 766 526 1422 1570 --
NM_000109chrX51937 1721 931 802 755 12602 ----
NM_000110chr13320 90 33 ------
NM_000111chr72364 270 ------
NM_000112chr585483 5378 4965 4356 3437 1520 1089 821 173 11877 --
NM_000114chr201199 ------
NM_000115chr1322575 276 11905 2898 618 --
NM_000124chr10124 ------
NM_000138chr1592386 2379 2361 2301 2261 1995 329 304 265 --21849 104 --
NM_000141chr1041240 1119 587 555 11474 ----
NM_000142chr441385 1355 1220 1185 ------
NM_000153chr1451643 1566 1400 1247 1112 --11448 --
NM_000161chr1451463 1295 617 611 84 ------
NM_000165chr661617 651 620 486 268 29 ------
NM_000167chrX31324 1212 619 21702 476 2688 339 --
NM_000168chr7103305 3101 2733 2378 2172 2067 1087 1066 963 426 21233 624 1203 --
NM_000173chr171419 ------
NM_000176chr573250 3220 3119 2451 1514 997 688 21164 361 ----
NM_000178chr202136 28 ------
NM_000208chr1964229 4119 3522 1722 831 587 1225 13776 --
NM_000210chr222339 233 --1775 --
NM_000212chr1741941 1749 1609 971 21888 857 ----
NM_000216chrX53592 2851 1037 837 78 ------
NM_000217chr12104577 4302 4188 3852 3454 1789 1769 957 800 187 --15176 --
NM_000222chr442083 1682 296 79 --2227 56 21598 1384
NM_000227chr183363 309 270 ------
NM_000230chr771915 983 717 593 430 146 59 ------
NM_000232chr453001 2481 908 427 282 13171 --1688
NM_000240chrX42182 1484 1449 749 --1675 --
NM_000248chr322029 456 33086 1039 1010 ----
NM_000252chrX2147 55 11033 ----
NM_000259chr15116250 6034 5440 5217 5045 4893 4674 2484 1457 156 64 ----24075 368
NM_000264chr93792 501 64 ------
NM_000266chrX1282 ------
NM_000267chr1763292 2814 2393 2162 1053 720 22927 2196 22750 209 --
NM_000276chrX1574 11818 12135 --
NM_000291chrX4886 752 376 345 1876 190 --
NM_000297chr461891 1859 1559 421 388 356 11490 ----
NM_000303chr1631453 1287 171 --1150 --
NM_000314chr1022082 1179 11116 13011 --
NM_000315chr11189 --1288 --
NM_000321chr132455 261 11771 ----
NM_000325chr4----1202 --
NM_000328chrX1133 ------
NM_000330chrX42270 1799 1397 452 12068 22116 652 --
NM_000332chr686622 6400 5666 4894 4447 1964 1395 181 46887 6095 2144 1798 16129 24763 2431
NM_000335chr362119 787 746 375 319 47 ------
NM_000337chr596493 5895 5791 5429 5062 4875 4828 2128 273 12082 --15815
NM_000340chr33600 448 293 --1471 --
NM_000346chr1731910 530 186 ------
NM_000351chrX104041 3581 2877 1645 1417 1110 937 862 828 546 1835 13994 --
NM_000361chr2081968 1951 1664 1404 715 195 140 134 ------
NM_000362chr2263323 2618 2410 1105 965 223 --13127 --
NM_000368chr974495 4313 3505 1420 1118 457 87 --14102 --
NM_000374chr1152 ------
NM_000378chr1151250 442 279 125 59 ------
NM_000386chr171124 --130 --
NM_000391chr1171670 1496 1272 492 455 328 294 ------
NM_000393chr242107 2019 1680 1610 ------
NM_000396chr13446 413 198 --242 33 --
NM_000399chr101150 1395 ----
NM_000408chr232634 1098 665 23460 566 ----
NM_000411chr2193196 2855 2636 2454 2163 2030 1309 1218 530 12113 ----
NM_000430chr17133363 3252 1518 1484 1458 1333 1312 1081 1019 820 775 751 102 1760 ----
NM_000435chr191110 1682 ----
NM_000439chr582403 2167 2012 1905 1754 1642 973 186 --11766 12559
NM_000441chr732184 2127 137 11578 ----
NM_000448chr11123254 3190 3104 2669 2223 2139 2102 2006 1097 1054 843 435 22789 1186 ----
NM_000461chr363630 3068 747 585 448 58 14012 ----
NM_000462chr1551647 1560 1528 1269 1225 11689 1280 --
NM_000474chr7157 ------
NM_000478chr11748 ------
NM_000486chr1273189 2829 2763 2574 2308 1193 662 11061 ----
NM_000488chr1----176 --
NM_000489chrX63411 3341 3271 3195 2568 1081 12663 --3780 267 126
NM_000493chr621103 426 ------
NM_000516chr201241 ------
NM_000522chr731240 1050 849 --1219 --
NM_000530chr111138 11074 ----
NM_000533chrX31706 1440 797 11230 2585 349 --
NM_000550chr971019 968 887 756 738 412 168 --187 --
NM_000555chrX107886 5901 5735 5115 2630 2594 2536 917 279 99 15584 22407 1328 --
NM_000559chr11128 ------
NM_000575chr221042 935 --1409 --
NM_000586chr42184 40 ------
NM_000597chr21101 ------
NM_000598chr72207 201 ------
NM_000599chr273800 3743 2798 1616 1416 1031 670 13965 2832 409 --
NM_000609chr1083091 2848 2750 2642 2574 723 274 146 --22666 2210 --
NM_000610chr11122656 2255 2225 2108 2099 1090 923 789 444 293 264 131 ----1418
NM_000612chr1152847 706 103 81 70 ----12877
NM_000615chr1182953 2819 2803 2616 719 475 422 67 12783 ----
NM_000618chr12136497 6164 5962 5675 5275 4700 4679 2575 1986 1741 1691 1066 588 3822 656 435 25814 2008 15837
NM_000618chr12136497 6164 5962 5675 5275 4700 4679 2575 1986 1741 1691 1066 588 3822 656 435 25814 2008 15837
NM_000620chr1252041 2004 1954 1582 543 ----11910
NM_000633chr1884480 3967 2035 1670 1185 1112 665 377 13908 35044 3581 3420 1907
NM_000639chr12586 25 1276 ----
NM_000663chr1653083 2699 1025 324 81 12162 12142 --
NM_000668chr44429 410 259 134 ------
NM_000681chr1031315 905 287 11272 1404 --
NM_000684chr1021242 509 ------
NM_000686chrX4531 434 383 158 ------
NM_000693chr1511731 1558 11576 --
NM_000719chr1285002 4140 2632 2248 1920 920 854 457 --22147 691 --
NM_000721chr142705 2462 2309 990 ------
NM_000726chr241379 1052 998 976 ------
NM_000739chr71753 1301 1713 --
NM_000756chr81435 ------
NM_000783chr101170 ----1411
NM_000788chr451414 1357 1062 1037 981 ------
NM_000794chr53723 151 128 ------
NM_000800chr541653 481 212 139 ------
NM_000801chr205783 756 310 170 110 ------
NM_000806chr551221 714 633 538 351 21892 1274 ----
NM_000809chr4128410 8244 7978 7945 7424 7078 6542 6503 6161 3504 2834 116 11807 --12252
NM_000810chr154452 180 103 39 ------
NM_000811chr52786 136 1780 1285 --
NM_000813chr5115107 4752 4644 3996 1986 1635 1381 1187 882 628 203 11571 13946 --
NM_000814chr1573990 3914 3804 3298 3225 3028 2698 --23845 1156 --
NM_000826chr452519 2498 2029 343 266 31941 681 573 --1607
NM_000827chr572567 2435 1871 1698 1592 1028 499 --1200 --
NM_000828chrX92031 1606 1583 1454 840 592 522 136 82 ------
NM_000833chr162968 352 --31159 558 173 --
NM_000834chr1231245 1055 816 31128 1085 199 ----
NM_000838chr642253 1928 1054 967 32164 861 275 11017 --
NM_000844chr331072 1062 353 ------
NM_000855chr113302 277 90 ------
NM_000865chr62193 33 ------
NM_000866chr32674 306 21668 1155 --11170
NM_000868chrX22170 712 ------
NM_000870chr541557 1339 1142 401 11164 ----
NM_000872chr1041445 1366 1006 399 ------
NM_000875chr1586345 5957 4782 4749 4602 1690 1422 1010 11669 21855 512 --
NM_000877chr263088 2641 2320 2233 1928 774 2919 793 11980 12747
NM_000891chr1763538 3427 3197 2368 921 263 ------
NM_000899chr1284050 4005 3826 3773 1548 1434 948 669 11477 ----
NM_000901chr421961 1850 2300 52 ----
NM_000902chr393204 2538 2520 2176 2136 1973 1211 997 484 ------
NM_000903chr1651240 1217 487 55 26 21567 107 --11043
NM_000917chr103877 325 76 ------
NM_000919chr51246 ------
NM_000921chr122219 27 ----1201
NM_000922chr112728 321 ----1182
NM_000926chr11209153 8598 8480 8185 7902 7716 7694 7385 7369 6904 5855 2330 2281 1987 1429 1138 1074 1045 608 418 55918 3569 3251 2304 1591 27943 3437 --
NM_000933chr2041588 1436 1243 148 1484 ----
NM_000941chr71315 ------
NM_000944chr421604 338 21645 681 21694 1557 --
NM_000945chr221296 129 1461 ----
NM_000949chr55873 650 637 314 120 ------
NM_000950chrX82874 2371 2314 1451 1368 1035 774 698 1904 1347 --
NM_000963chr12719 366 11712 1379 --
NM_000964chr1721376 61 ------
NM_000965chr351276 988 482 248 196 --11203 --
NM_001001132chr2141399 1046 321 113 11084 --11343
NM_001001323chr1253113 2685 2673 2370 1977 22576 353 ----
NM_001001330chr105957 508 170 130 60 ------
NM_001001331chr372351 2305 1837 748 346 196 148 11757 --11933
NM_001001342chr1031174 1062 560 1510 ----
NM_001001349chr1741555 1323 1100 282 --122 --
NM_001001389chr11122656 2255 2225 2108 2099 1090 923 789 444 293 264 131 ----1418
NM_001001390chr11122656 2255 2225 2108 2099 1090 923 789 444 293 264 131 ----1418
NM_001001391chr11122656 2255 2225 2108 2099 1090 923 789 444 293 264 131 ----1418
NM_001001392chr11122702 2301 2271 2154 2145 1136 969 835 490 339 310 177 ----1464
NM_001001394chr21462 --1144 --
NM_001001395chr1292798 2760 2293 1881 1848 1130 868 695 358 ------
NM_001001396chr194386 3743 3275 2860 1557 1346 823 325 146 --13851 --
NM_001001419chr594794 4189 3557 3354 2096 1963 1652 1022 405 34384 3218 120 --13464
NM_001001420chr594794 4189 3557 3354 2096 1963 1652 1022 405 34384 3218 120 --13464
NM_001001433chr2093118 3051 3003 2810 1994 1044 727 568 497 12603 11072 --
NM_001001436chr161871 ------
NM_001001481chr853260 3046 2672 869 253 ------
NM_001001483chr11------1431
NM_001001484chr1022424 63 --1596 --
NM_001001520chr191156 ------
NM_001001523chr12929 66 --1999 --
NM_001001549chr752809 2750 2252 1815 1000 31084 933 802 ----
NM_001001550chr752809 2750 2252 1815 1000 31084 933 802 ----
NM_001001552chr1------1332
NM_001001555chr752809 2750 2252 1815 1000 31084 933 802 ----
NM_001001557chr811680 1216 1183 --
NM_001001664chr212590 13622 2363 40 --
NM_001001701chr482201 2009 1827 1648 1495 241 184 131 1108 ----
NM_001001890chr2183842 3649 3478 3168 3000 2839 2700 977 21235 500 11478 --
NM_001001924chr841783 1687 1413 300 --11715 --
NM_001001925chr841783 1687 1413 300 --11715 --
NM_001001931chr841783 1687 1413 300 --11715 --
NM_001001933chr12620 115 ------
NM_001001938chr973981 3553 3119 3078 1281 1139 437 --1981 --
NM_001001971chr1021319 474 --129 --
NM_001001974chr1032302 62 51 21547 710 --12001
NM_001001977chr20136 ------
NM_001001995chrX51589 681 469 298 161 ------
NM_001002233chr852002 1579 605 349 145 --3694 645 47 --
NM_001002257chr243138 3015 2584 1250 1925 12923 12486
NM_001002269chr9------1457
NM_001002295chr102944 908 --1450 --
NM_001002811chr131479 549 165 --1323 --
NM_001002812chr131479 549 165 --1323 --
NM_001002812chr131479 549 165 --1323 --
NM_001002814chr843089 605 349 145 --42670 694 645 47 --
NM_001002838chrX41798 322 310 222 --11677 1526
NM_001002843chr1521228 338 --1347 --
NM_001002857chr152323 48 ------
NM_001002858chr152323 48 ------
NM_001002860chr14104649 4640 4632 3908 3837 3751 3189 2967 1487 401 34454 719 110 --14051
NM_001002906chrY------1461
NM_001002909chr1752142 2024 1538 584 170 1863 11652 --
NM_001002919chr2----1390 1130
NM_001002926chr762650 2584 2289 848 609 255 52032 1849 954 480 287 ----
NM_001003406chr223837 320 190 --22961 1287 --
NM_001003407chr1054075 1261 1181 1031 950 2482 252 23665 1901 --
NM_001003408chr1054075 1261 1181 1031 950 2482 252 23665 1901 --
NM_001003652chr18147665 6986 6642 6109 5700 5337 5277 3266 3011 2333 1642 1051 742 727 33023 2150 1266 38626 2366 940 11004
NM_001003674chr18136904 6658 6389 5914 4407 4349 2647 2426 2010 1788 1418 1015 651 26565 92 1194 --
NM_001003675chr18136904 6658 6389 5914 4407 4349 2647 2426 2010 1788 1418 1015 651 26565 92 1194 --
NM_001003681chr2231366 483 367 --1783 --
NM_001003688chr41772 ------
NM_001003712chr1294068 3759 3689 3434 3299 3154 3146 2733 1403 11619 --14056
NM_001003792chr32244 74 ------
NM_001003793chr32244 74 ------
NM_001003800chr953400 2685 1114 776 297 12656 --1864
NM_001003810chr42198 51 --1724 --
NM_001003940chr1582824 1513 1184 894 865 500 409 361 --23639 429 --
NM_001003942chr1582824 1513 1184 894 865 500 409 361 --23639 429 --
NM_001003943chr1582828 1517 1188 898 869 504 413 365 --23643 433 --
NM_001004065chr943722 2932 2881 551 32570 775 660 ----
NM_001004303chr12767 205 2861 562 ----
NM_001004303chr12767 205 2861 562 ----
NM_001004317chr654385 1633 864 743 374 21757 79 1929 --
NM_001004328chr1242434 1566 691 454 1809 ----
NM_001004346chr41940 198 ----
NM_001004360chr261433 754 585 454 397 332 --11703 --
NM_001004419chr1223946 1465 1342 14161 --
NM_001004441chr541503 1375 1174 236 ------
NM_001004722chr21416 ----177
NM_001005217chr431172 1047 75 1842 ----
NM_001005266chr15----1489 --
NM_001005267chr15----1489 --
NM_001005268chr15----1489 --
NM_001005269chr15----1489 --
NM_001005271chr171263 --1844 --
NM_001005273chr171263 --1844 --
NM_001005340chr75795 745 693 626 251 ------
NM_001005375chrY61789 1384 1204 472 408 153 ------
NM_001005386chr252239 746 475 294 253 1717 1689 12288
NM_001005404chr1784492 4388 4288 3838 3520 1717 1099 94 11444 ----
NM_001005463chr102850 207 1239 --123
NM_001005473chr5116238 6222 5812 4874 4033 2294 564 324 222 91 21 34052 1397 629 15325 --
NM_001005502chr1275008 4296 4284 3530 1922 574 143 1152 --1386
NM_001005609chrX83215 2450 2378 1076 939 791 250 176 --13354 --
NM_001005732chr212640 614 ------
NM_001005733chr212597 571 ------
NM_001005743chr141103 --1547 --
NM_001005744chr141103 --1547 --
NM_001005745chr141103 --1547 --
NM_001005746chr241379 1052 998 976 ------
NM_001005747chr241379 1052 998 976 ------
NM_001005782chr22382 328 ------
NM_001005845chr851564 1307 758 610 168 ------
NM_001006600chr552094 1753 1684 1508 542 12082 ----
NM_001006605chr13994 951 822 2964 291 ----
NM_001006605chr13994 951 822 2964 291 ----
NM_001006610chr16--149 --1771
NM_001006618chr91279 1236 ----
NM_001006623chr252091 2070 2056 1800 249 11794 1134 --
NM_001006626chr71753 1301 1713 --
NM_001006627chr71753 1301 1713 --
NM_001006628chr71753 1301 1713 --
NM_001006629chr71753 1301 1713 --
NM_001006630chr71753 1301 1713 --
NM_001006631chr71753 1301 1713 --
NM_001006632chr71753 1301 1713 --
NM_001006634chr16199 --134 --
NM_001006636chr2156 ------
NM_001006641chr921780 1472 --21632 336 --
NM_001006642chr921780 1472 --21632 336 --
NM_001006643chr921780 1472 --21632 336 --
NM_001006684chrX2225 168 ----1197
NM_001006946chr231539 1244 234 ------
NM_001007024chr1794281 3956 3839 3688 3461 3388 2702 467 301 1370 --141
NM_001007025chr1794281 3956 3839 3688 3461 3388 2702 467 301 1370 --141
NM_001007067chr83793 222 154 ------
NM_001007068chr83793 222 154 ------
NM_001007069chr83793 222 154 ------
NM_001007070chr83793 222 154 ------
NM_001007075chr41187 --1778 --
NM_001007102chr641422 657 390 361 ------
NM_001007156chr1521834 1582 11921 ----
NM_001007214chr12118 55 --21633 372 --
NM_001007226chr1751427 1124 1046 498 35 ------
NM_001007227chr1751427 1124 1046 498 35 ------
NM_001007228chr1751427 1124 1046 498 35 ------
NM_001007229chr1751427 1124 1046 498 35 ------
NM_001007230chr1751427 1124 1046 498 35 ------
NM_001007246chr2121583 275 11612 11549 --
NM_001007267chr22365 134 ------
NM_001007464chr61131 ------
NM_001007466chr684968 4504 3915 3275 1965 364 314 27 23939 3632 ----
NM_001007546chr211274 11583 --11457
NM_001007559chr1862030 1933 1874 838 698 212 2361 205 192 --
NM_001008220chr533824 2562 910 13564 1554 --
NM_001008222chrX11185 --31195 1060 561 --
NM_001008239chr1852814 2579 1355 1018 917 --23258 40 --
NM_001008388chr43411 210 93 1991 ----
NM_001008392chr383531 3372 2918 2700 953 455 345 306 1442 12881 --
NM_001008401chr1911184 21461 1169 ----
NM_001008405chr731589 706 67 21779 661 ----
NM_001008408chr796439 6250 5608 5341 4832 4258 1503 1191 1024 65729 5281 4967 1808 1433 381 ----
NM_001008495chr852197 2015 1975 657 439 ------
NM_001008530chr14126 ------
NM_001008541chr1031972 1716 648 ------
NM_001008541chr1031972 1716 648 ------
NM_001008660chr113987 266 66 --1116 11359
NM_001008738chr562390 1994 1830 1086 1058 981 2704 281 1103 --
NM_001008740chr1126 ------
NM_001008783chr64839 831 748 651 ------
NM_001008801chr1931859 1794 1655 --130 --
NM_001008895chr1321330 562 11268 --1149
NM_001009185chr51583 ------
NM_001009552chr8----1401 --
NM_001009554chr4104262 3891 3258 1871 1830 1509 1410 979 929 696 44093 3369 1385 672 ----
NM_001009554chr4104262 3891 3258 1871 1830 1509 1410 979 929 696 44093 3369 1385 672 ----
NM_001009566chr121047 428 ------
NM_001009571chr751716 1668 1496 658 638 ------
NM_001009814chr13295 59 165 ----
NM_001009881chr12625 464 1561 ----
NM_001009882chr12625 464 1561 ----
NM_001009899chr3136192 6066 5949 5201 5191 5101 4270 4149 2347 2169 1523 244 226 --26018 4436 --
NM_001009909chr1153195 2847 2574 1418 317 21524 107 ----
NM_001009955chr11408 1205 1530 --
NM_001009955chr11408 1205 1530 --
NM_001009958chr71638 ------
NM_001009959chr262532 1679 1607 666 481 129 11709 ----
NM_001009960chr752463 2383 2038 531 332 --12838 11059
NM_001009993chr244428 4363 3011 1570 32831 1815 56 ----
NM_001010000chr18123499 3490 3129 3098 2905 2201 1107 816 687 454 283 241 23278 872 --22525 2210
NM_001010861chr1102664 2496 2088 2057 2049 1863 589 496 373 23 32077 890 568 11827 --
NM_001010862chrX63305 3197 2674 1308 189 72 12796 1545 --
NM_001010888chrX144589 4008 3891 3863 3783 3711 3418 3201 2839 1678 1254 932 606 365 ------
NM_001010891chr5156552 5963 5919 5774 5761 5636 5275 4987 4633 2694 2525 2331 1020 959 940 ----11533
NM_001010895chr951977 1839 1778 1482 698 1436 ----
NM_001010917chr1042024 1744 1485 585 ----1324
NM_001010923chr661699 670 636 392 290 69 2623 534 --11686
NM_001010934chr741134 1108 812 346 11141 --1387
NM_001010942chr121178 1926 ----
NM_001010986chrX52499 2416 1834 750 701 22240 2184 ----
NM_001011537chr32546 495 12386 ----
NM_001011546chr20----132 --
NM_001011551chrX1434 ------
NM_001011553chr72857 725 1689 ----
NM_001011666chr7106004 5690 5590 5053 4352 4096 2114 1736 619 124 35241 1243 816 11438 --
NM_001011708chr292808 2765 2735 1791 1138 936 579 215 36 11918 ----
NM_001011713chr1451304 1123 1031 474 101 1393 ----
NM_001011885chr1541458 499 453 387 ------
NM_001012264chr146774 692 676 193 182 54 ------
NM_001012267chr931714 1528 1520 ----21939 545
NM_001012393chr1195005 4576 4541 3734 1608 1071 512 207 164 23922 3133 23243 628 --
NM_001012398chr161127 2888 410 ----
NM_001012418chr684204 3971 2791 1670 1336 908 635 429 31242 695 515 23978 673 --
NM_001012420chr1532548 2374 1886 1634 1188 --
NM_001012423chr1532548 2374 1886 1634 1188 --
NM_001012454chr72149 113 --1136 --
NM_001012732chr43958 67 46 11235 11030 --
NM_001012751chr1021585 669 --11579 --
NM_001012755chrX155080 4760 4426 4374 4312 3792 3074 2015 1878 1529 1087 1041 998 922 524 21954 436 11640 13148
NM_001012977chrX1472 11431 ----
NM_001012980chrX141 ------
NM_001013031chr10113500 3201 3099 2975 2947 2915 1334 668 485 460 404 1468 ----
NM_001013398chr72207 201 ------
NM_001013406chr731646 1295 387 11522 11753 --
NM_001013415chr4------1625
NM_001013437chr18286 52 ------
NM_001013438chr33878 744 263 --11016 --
NM_001013439chr33724 590 109 --1862 --
NM_001013635chr12----21118 1014 --
NM_001013690chr1252419 2349 1841 1601 1581 11685 ----
NM_001013693chr152797 2765 2475 321 91 ------
NM_001013693chr152797 2765 2475 321 91 ------
NM_001013699chr121116 --1123 --
NM_001013703chr151503 ------
NM_001013843chr152818 786 1710 ----
NM_001014286chr133275 224 69 ------
NM_001014434chr13318 251 100 2760 741 ----
NM_001014435chr16----154 --
NM_001014442chr131123 ------
NM_001014797chr1068038 5199 2043 1499 997 101 46036 1182 833 736 67744 7201 2294 1834 1792 301 17689
NM_001015045chr432214 1561 151 22285 534 ----
NM_001015048chr14113124 3041 2771 2494 2009 1247 469 328 190 69 52 11266 12367 --
NM_001015049chr14113124 3041 2771 2494 2009 1247 469 328 190 69 52 11266 12367 --
NM_001015508chr82172 145 ------
NM_001015877chrX53130 2668 666 523 66 11108 11141 --
NM_001015881chrX41248 1193 1063 58 ------
NM_001015882chr91393 3973 412 233 ----
NM_001015887chr331707 1616 515 ------
NM_001017368chr1742010 1065 329 286 --11840 --
NM_001017369chr441034 806 261 164 --21014 838 --
NM_001017371chr22860 459 1166 --1948
NM_001017395chr383282 3011 2968 2714 2670 2431 1160 460 191 ----
NM_001017423chr103514 258 30 ------
NM_001017424chr111725 11388 ----
NM_001017425chr111725 11388 ----
NM_001017440chr7157583 7101 7048 6667 6109 6040 5885 3300 3242 1523 1438 604 490 399 258 11158 16518 12989
NM_001017922chr141215 1069 622 181 ------
NM_001017923chr1431693 1557 671 ------
NM_001017926chr851334 690 675 618 271 ------
NM_001017962chr103877 325 76 ------
NM_001017992chr531532 1038 77 ------
NM_001017995chr5144569 4225 4045 3737 3678 3462 3007 1631 1459 1277 655 591 526 97 14134 14500 --
NM_001017999chr121455 869 ------
NM_001017999chr121455 869 ------
NM_001018000chr121455 869 ------
NM_001018000chr121455 869 ------
NM_001018001chr121455 869 ------
NM_001018003chr82275 215 ------
NM_001018024chrX131 ------
NM_001018025chrX1715 ----1337
NM_001018050chr2222746 1154 --23186 2405 12704
NM_001018052chr2222746 1154 --23186 2405 12704
NM_001018054chr131119 1035 934 ------
NM_001018064chr941678 535 478 221 ------
NM_001018065chr9125117 5107 4999 4830 4728 4384 3939 3741 2187 1407 811 171 35210 4850 1145 13826 24797 142
NM_001018066chr9125117 5107 4999 4830 4728 4384 3939 3741 2187 1407 811 171 35210 4850 1145 13826 24797 142
NM_001018074chr573250 3220 3119 2451 1514 997 688 21164 361 ----
NM_001018075chr573250 3220 3119 2451 1514 997 688 21164 361 ----
NM_001018076chr573250 3220 3119 2451 1514 997 688 21164 361 ----
NM_001018077chr573250 3220 3119 2451 1514 997 688 21164 361 ----
NM_001018090chr1552246 2229 361 165 151 12528 ----
NM_001018091chr1562356 2339 1831 471 275 261 12638 ----
NM_001018100chr153863 639 143 ------
NM_001018102chr1552246 2229 361 165 151 12528 ----
NM_001018108chr1541502 1423 919 789 ------
NM_001018111chr732654 432 392 --1924 13591
NM_001020658chr131549 1529 335 1321 ----
NM_001020658chr131549 1529 335 1321 ----
NM_001024094chr573250 3220 3119 2451 1514 997 688 21164 361 ----
NM_001024226chr121093 191 ------
NM_001024227chr121093 191 ------
NM_001024228chr121093 191 ------
NM_001024401chr1611003 11957 --1403
NM_001024463chr1511096 --1130 --
NM_001024465chr62153 61 ------
NM_001024647chr12137597 7465 5981 5964 4871 3044 1213 981 969 962 421 301 84 47211 6130 6082 2433 14956 12495
NM_001024649chr572158 2105 1979 1925 1868 1047 754 --3860 643 529 --
NM_001024680chr241478 1367 660 253 --21380 1280 --
NM_001024688chr84797 667 530 374 1456 1306 --
NM_001024736chr1551484 1437 1253 412 332 1275 1495 --
NM_001024808chr1292815 2802 2754 2729 2491 2448 384 286 33 12585 22322 406 --
NM_001024809chr1721376 61 ------
NM_001024912chr1951787 1576 1324 539 36 ----11658
NM_001024934chr61614 ------
NM_001024935chr61614 ------
NM_001024936chr61614 ------
NM_001024948chr173276 2489 1002 966 711 459 430 --12154 --
NM_001025068chr321600 489 ------
NM_001025069chr321600 489 ------
NM_001025076chr10145399 5354 5208 4922 4695 4599 4163 4074 4025 2140 1611 1513 1444 462 14534 ----
NM_001025077chr10166757 6712 6566 6280 6053 5957 5521 5432 5383 5047 2969 2871 2802 1820 1013 551 25892 4785 11093 --
NM_001025079chr363134 2701 2677 1451 305 289 12885 1419 --
NM_001025105chr521081 456 --11284 --
NM_001025107chr162275 1014 843 776 329 258 ------
NM_001025107chr162275 1014 843 776 329 258 ------
NM_001025108chr253938 3183 954 497 363 23930 244 13291 --
NM_001025201chr21548 ------
NM_001025233chr122910 409 --11773 --
NM_001025252chr863156 1051 736 630 358 90 1760 ----
NM_001025253chr863156 1051 736 630 358 90 1760 ----
NM_001025266chr3114726 4020 3908 3411 3334 3001 1402 1336 268 95 75 24444 4214 31775 1487 1342 --
NM_001025356chr125928 688 596 468 295 12892 ----
NM_001025366chr611404 11690 ----
NM_001025366chr611404 11690 ----
NM_001025367chr611404 11690 ----
NM_001025367chr611404 11690 ----
NM_001025368chr611404 11690 ----
NM_001025368chr611404 11690 ----
NM_001025369chr611420 11706 ----
NM_001025369chr611420 11706 ----
NM_001025370chr611404 11690 ----
NM_001025370chr611404 11690 ----
NM_001025579chr172867 467 21215 316 ----
NM_001025580chrX64097 3480 3406 2998 2986 802 --23075 2705 14125
NM_001025595chr421598 358 ------
NM_001025616chr471890 1757 1748 1650 1528 1184 338 --11673 --
NM_001029839chr32592 511 --1984 --
NM_001029840chr32592 511 --1984 --
NM_001029858chr662564 2410 2058 882 759 338 ------
NM_001029863chr653117 2375 931 745 308 22665 2219 ----
NM_001029875chr582924 2676 2644 2461 2401 2136 1944 988 1348 1554 --
NM_001029884chr632650 1762 941 1400 ----
NM_001029998chr461206 1062 914 439 389 174 1564 ----
NM_001030006chr1732288 1058 905 2650 292 ----
NM_001030007chr16113836 3678 3566 3134 2623 1114 856 761 750 536 399 32690 1188 250 --11230
NM_001030055chr1453328 1860 1510 1307 579 1553 22973 875 --
NM_001030287chr13861 786 292 1305 ----
NM_001031623chr641700 661 441 129 21527 433 ----
NM_001031679chr1262865 2787 2545 2379 1290 656 --12854 --
NM_001031690chr772692 1939 1228 824 422 377 125 1997 42733 2044 836 28 --
NM_001031694chr13879 861 54 --2312 174 --
NM_001031694chr13879 861 54 --2312 174 --
NM_001031695chr22115236 4215 4004 3399 1516 1422 1221 815 699 481 287 --11644 12146
NM_001031711chr541341 1282 645 457 --1511 --
NM_001031712chr6170 ------
NM_001031732chr443632 2972 1108 948 2735 384 12849 --
NM_001031738chr2159 ------
NM_001031740chr13633 619 171 ------
NM_001031801chr222165 105 ------
NM_001031804chr1674215 2967 2924 2739 717 596 559 ----22918 780
NM_001031812chr53771 299 130 1287 ----
NM_001032280chr671586 1547 1312 1252 1102 1062 572 ------
NM_001032282chr82508 367 --174 --
NM_001032288chr2041492 1330 1125 550 21573 68 ----
NM_001032296chr1342373 1840 915 216 ------
NM_001032380chr1031482 699 319 12014 ----
NM_001032393chrX1732 ------
NM_001032394chr662526 2162 1782 990 881 84 --21842 310 --
NM_001032999chr20145353 5092 4800 4772 4690 4480 4187 3783 3300 1556 1451 1301 744 670 13265 ----
NM_001033045chr274224 4096 3698 2730 1663 1562 1151 --11777 --
NM_001033047chr452631 2082 769 261 51 12303 1246 --
NM_001033049chr2152392 1787 789 310 278 1586 ----
NM_001033059chr641865 1553 1405 505 194 22009 551 --
NM_001033087chr2073208 2734 2529 2366 722 616 238 2919 356 12264 --
NM_001033117chr361944 1494 1468 1446 1094 691 24088 4070 2815 73 --
NM_001033507chr141968 1493 669 162 11557 ----
NM_001033518chr782758 2528 2296 1868 684 571 340 182 --2773 599 --
NM_001033519chr782758 2528 2296 1868 684 571 340 182 --2773 599 --
NM_001033520chr782758 2528 2296 1868 684 571 340 182 --2773 599 --
NM_001033564chr61642 1218 1395 1570
NM_001033566chr173946 696 356 ------
NM_001033568chr173946 696 356 ------
NM_001033576chr1792505 2406 2331 2028 985 599 484 256 191 ----11806
NM_001033578chr83467 148 61 12243 12034 --
NM_001033581chr12298 282 ------
NM_001033581chr12298 282 ------
NM_001033582chr12298 282 ------
NM_001033602chr13102449 2430 2230 2084 1924 1782 1031 686 571 520 --22369 273 --
NM_001033659chr1711477 ------
NM_001033723chr82862 123 12500 32342 1090 485 --
NM_001033756chr611338 11624 ----
NM_001033756chr611338 11624 ----
NM_001033925chr1041450 662 322 165 ------
NM_001034025chr1231029 973 64 --156 --
NM_001034837chr51601 ------
NM_001034838chr51601 ------
NM_001035chr141183 1041 827 373 ------
NM_001035003chr461059 470 459 418 166 48 ----1311
NM_001035004chr461059 470 459 418 166 48 ----1311
NM_001035260chr101645 11477 21267 31 --
NM_001035521chr22705 695 1161 ----
NM_001037132chr751881 1739 677 651 27 21904 859 --12040
NM_001037133chr751881 1739 677 651 27 21904 859 --12040
NM_001037164chr721662 1320 1718 1789 --
NM_001037165chr7108849 7580 6909 5868 5650 2482 1884 979 557 151 28481 2023 36600 1787 1250 --
NM_001037174chr272142 1431 836 406 364 198 172 ------
NM_001037317chr1102664 2496 2088 2057 2049 1863 589 496 373 23 32077 890 568 11827 --
NM_001037331chr18----1373 --
NM_001037332chr592580 2559 2176 2004 1904 1813 732 544 291 31625 946 915 --11941
NM_001037333chr592580 2559 2176 2004 1904 1813 732 544 291 31625 946 915 --11941
NM_001037334chr1861775 1658 451 329 287 107 ------
NM_001037339chr141689 611 486 118 ----1472
NM_001037340chr141689 611 486 118 ----1472
NM_001037341chr141689 611 486 118 ----1472
NM_001037341chr141689 611 486 118 ----1472
NM_001037442chr43511 445 375 ------
NM_001037535chrX41476 1198 489 38 21063 481 ----
NM_001037536chrX41476 1198 489 38 21063 481 ----
NM_001037540chrX41476 1198 489 38 21063 481 ----
NM_001037631chr251125 984 879 261 77 ------
NM_001037872chr2----2647 533 --
NM_001037954chr1143371 3231 2357 254 13241 23273 3097 --
NM_001038640chr15186 --145 --
NM_001038702chr572766 2487 1909 1832 1795 897 280 --12542 --
NM_001038707chr171960 1878 1726 1692 798 521 50 ------
NM_001038707chr171960 1878 1726 1692 798 521 50 ------
NM_001039091chrX61160 1036 316 293 177 154 ------
NM_001039348chr22837 730 ----1803
NM_001039349chr22837 730 ----1803
NM_001039459chr741103 751 157 29 1913 1296 --
NM_001039479chr1442129 1852 1778 904 ------
NM_001039538chr2103217 3147 1459 1306 1243 749 666 363 300 189 1738 11071 --
NM_001039547chr3137271 6649 6328 6182 5964 2924 2003 1265 1228 1216 762 263 226 27827 1117 ----
NM_001039550chr21725 ------
NM_001039569chr223356 2619 12813 13254 --
NM_001039570chr2254457 4278 4182 4125 3084 1699 ----
NM_001039571chr2254457 4278 4182 4125 3084 1699 ----
NM_001039577chr164392 3861 1647 1341 1091 699 13489 ----
NM_001039585chr183426 2760 1688 1669 1578 1423 443 190 13932 199 --
NM_001039590chrX73944 3439 3193 3141 1167 1019 25 ------
NM_001039591chrX73944 3439 3193 3141 1167 1019 25 ------
NM_001039618chr1155691 3966 1657 1511 40 24921 4873 14754 --
NM_001039690chr1652009 686 293 215 194 ------
NM_001039697chr931750 1494 445 --21220 432 --
NM_001039709chr20145353 5092 4800 4772 4690 4480 4187 3783 3300 1556 1451 1301 744 670 13265 ----
NM_001039711chr151145 1053 784 211 87 ------
NM_001039712chr151145 1053 784 211 87 ------
NM_001039762chr1041937 1864 682 68 22080 1606 ----
NM_001039802chr141281 897 542 376 1536 ----
NM_001039840chrX105874 5580 5045 3921 2123 1965 1667 868 849 179 34473 3757 924 16012 --
NM_001039844chr1062737 2508 2452 1210 1061 40 11086 ----
NM_001039937chr13104181 4150 3968 3572 3561 2717 1586 506 144 30 11112 ----
NM_001039960chr1231728 1264 310 ------
NM_001040001chr672052 1928 1921 1407 1309 624 557 --1485 --
NM_001040092chr81288 ------
NM_001040097chr71163 ------
NM_001040098chr71163 ------
NM_001040099chr71163 ------
NM_001040100chr331153 875 798 ------
NM_001040101chr441596 1538 1321 1175 ------
NM_001040102chr1052576 1953 1721 936 373 --21934 1928 --
NM_001040103chr1052576 1953 1721 936 373 --21934 1928 --
NM_001040113chr162793 40 2845 154 1974 --
NM_001040142chr252349 1926 1889 1804 21 42075 722 515 222 ----
NM_001040143chr252349 1926 1889 1804 21 42075 722 515 222 ----
NM_001040144chr1652009 686 293 215 194 ------
NM_001040146chr1652009 686 293 215 194 ------
NM_001040152chr775058 3873 1749 1696 1439 1393 95 --13801 11972
NM_001040153chr131367 ------
NM_001040157chr452621 2140 1828 532 120 ------
NM_001040158chr53167 144 100 ------
NM_001040159chr431420 446 277 131 --1304
NM_001040172chr541557 1339 1142 401 11164 ----
NM_001040173chr541557 1339 1142 401 11164 ----
NM_001040181chr341078 1010 851 207 ------
NM_001040182chr341078 1010 851 207 ------
NM_001040183chr341078 1010 851 207 ------
NM_001040199chr341078 1010 851 207 ------
NM_001040200chr341078 1010 851 207 ------
NM_001040202chr442063 1997 837 587 1776 ----
NM_001040214chr662067 1994 1965 1617 195 38 ------
NM_001040272chr951569 731 551 182 128 12063 ----
NM_001040284chr1695670 5145 5082 4397 3711 2267 1512 1318 1197 24646 1041 14692 --
NM_001040402chr482924 1296 966 949 918 861 805 625 22781 1989 ----
NM_001040409chr23943 882 92 1714 ----
NM_001040429chr1383474 3358 3202 3060 2923 2503 2297 160 1598 1478 --
NM_001040439chr1641160 1013 258 102 --2203 125 --
NM_001040440chr5--1658 1179 1686
NM_001040446chr541002 877 561 526 ------
NM_001040450chr1522485 647 ------
NM_001040453chr1522485 647 ------
NM_001040455chr1121028 842 --1274 --
NM_001040665chr7104817 4776 4166 4121 3514 3411 3364 1426 750 38 34049 1847 166 24587 65 11613
NM_001040666chr72519 478 --1289 --
NM_001040709chr13777 736 62 --21922 540 --
NM_001040712chr983587 2785 2777 2698 1208 1039 633 101 13045 1990 --
NM_001040876chr461651 1431 692 637 438 261 ------
NM_001042355chr1675187 4965 4931 4855 3883 1353 981 ------
NM_001042361chr103459 401 266 --1589 11081
NM_001042364chr103459 401 266 --1589 11081
NM_001042365chr103459 401 266 --1589 11081
NM_001042387chr103459 401 266 --1589 11081
NM_001042393chr103459 401 266 --1589 11081
NM_001042396chr103459 401 266 --1589 11081
NM_001042397chr103459 401 266 --1589 11081
NM_001042403chr121404 --1290 --
NM_001042404chr141259 757 553 175 11389 --1524
NM_001042406chr61829 ------
NM_001042412chr1675187 4965 4931 4855 3883 1353 981 ------
NM_001042413chr973191 2686 2535 1624 1587 1034 136 23500 1273 --12606
NM_001042424chr492853 2835 2745 2298 2235 2095 1286 691 576 21314 882 11096 --
NM_001042425chr671586 1547 1312 1252 1102 1062 572 ------
NM_001042437chr23840 806 731 ------
NM_001042453chrX41509 1091 350 220 21781 694 1536 1302
NM_001042476chr1632018 1636 454 1768 11918 21894 87
NM_001042486chr2021466 124 ------
NM_001042492chr1763292 2814 2393 2162 1053 720 22927 2196 22750 209 --
NM_001042493chr622044 559 1194 1611 1163
NM_001042494chr1573449 2912 1333 1262 755 744 237 13876 ----
NM_001042495chr1573449 2912 1333 1262 755 744 237 13876 ----
NM_001042496chr1573449 2912 1333 1262 755 744 237 13876 ----
NM_001042497chr1573449 2912 1333 1262 755 744 237 13876 ----
NM_001042506chrX31462 1442 472 11393 ----
NM_001042510chr822104 1428 1360 142 --
NM_001042511chr822104 1428 1360 142 --
NM_001042517chr131796 ------
NM_001042537chrX32475 1924 680 ----1238
NM_001042543chr421542 1526 1256 ----
NM_001042555chr1231333 836 313 23964 231 ----
NM_001042599chr2137497 6409 5519 5342 5304 3038 2696 2446 1756 1378 993 584 468 17781 24750 85 12830
NM_001042601chr342844 2443 2307 1165 21215 55 ----
NM_001042603chr1285366 5319 4665 4649 3709 1825 999 99 --21396 464 --
NM_001042604chr394091 3822 3552 3174 3155 1745 1501 791 39 13912 11386 --
NM_001042632chr2012052 ----11655
NM_001042633chr2012052 ----11655
NM_001042635chr14149 ------
NM_001042669chr471890 1757 1748 1650 1528 1184 338 --11673 --
NM_001042681chr192175 1880 1863 1780 991 944 812 599 105 1716 22284 878 1572
NM_001042682chr192175 1880 1863 1780 991 944 812 599 105 1716 22284 878 1572
NM_001042682chr192175 1880 1863 1780 991 944 812 599 105 1716 22284 878 1572
NM_001042683chr651721 1458 186 48 21 ------
NM_001042749chrX41598 1464 1404 759 ------
NM_001042750chrX41598 1464 1404 759 ------
NM_001042751chrX41598 1464 1404 759 ------
NM_001043351chr122132 399 1346 1126 --
NM_001044305chr621346 1084 ----11285
NM_001044385chr243794 3582 2935 869 14021 11269 --
NM_001044722chr53771 299 130 1287 ----
NM_001044723chr53771 299 130 1287 ----
NM_001046chr552790 2466 2155 1862 752 22131 194 42490 468 432 113 --
NM_001048183chr163631 3341 3282 1106 220 153 --13424 --
NM_001071775chr1321708 399 ------
NM_001083620chr452517 2496 2027 342 265 31939 680 572 --1606
NM_001087chr21122 --1247 --
NM_001092chr1741951 366 342 130 --1825 --
NM_001094chr171812 ------
NM_001099678chr354279 2178 2114 1168 249 34678 1276 223 15993 --
NM_001106chr3169224 9152 9129 8878 8641 7684 7261 6960 6714 6062 3326 1602 1473 1390 1141 858 58660 8544 8029 5930 3190 1567 15969
NM_001109977chr43545 177 94 ------
NM_001111chr162275 1014 843 776 329 258 ------
NM_001112808chr12403 79 ------
NM_001113490chrX113660 3429 3375 2815 2790 2492 2448 2275 2263 727 573 32658 2366 326 1840 1915
NM_001116chr1642897 2273 1895 78 13028 --11209
NM_001121chr1031613 464 159 21716 1655 11371 --
NM_001128chr16113836 3678 3566 3134 2623 1114 856 761 750 536 399 32690 1188 250 --11230
NM_001135chr152655 283 ------
NM_001143chrY150 ------
NM_001144chr1611335 --1321 --
NM_001146chr862147 2051 1941 1851 617 108 ------
NM_001148chr451678 1490 749 530 282 ------
NM_001149chr1021208 222 ----1120
NM_001152chrX1171 ------
NM_001153chr24890 279 256 102 4700 320 292 67 ----
NM_001157chr101206 1691 2577 136 --
NM_001167chrX166664 6353 5673 4892 4727 2653 2493 2384 2368 2048 1339 1174 835 828 446 93 12328 14910 --
NM_001173chr1453328 1860 1510 1307 579 1553 22973 875 --
NM_001186chr2153309 3105 2426 981 894 1168 ----
NM_001197chr221404 ------
NM_001200chr2021086 402 ------
NM_001204chr2136746 6341 5858 5755 4739 2715 2103 2065 1970 1597 1472 928 779 67133 6459 6305 4731 2050 1366 12443 32134 580 179
NM_001206chr921972 1033 ----22975 2061
NM_001219chr711605 160 --11745
NM_001232chr11117 ------
NM_001233chr742275 2249 2134 842 ------
NM_001235chr111694 ------
NM_001237chr42949 817 ------
NM_001237chr42949 817 ------
NM_001238chr19------1121
NM_001241chr232407 2371 385 1343 ----
NM_001241chr232407 2371 385 1343 ----
NM_001248chr32809 351 ------
NM_001256chr1742123 2082 1035 136 12341 ----
NM_001257chr1631537 1400 151 21473 40 ----
NM_001259chr7116232 6151 5499 5474 5090 4779 4388 2079 1227 1215 112 25036 3917 11314 --
NM_001260chr131137 ----1244
NM_001262chr11356 ------
NM_001268chr1341038 845 327 33 ------
NM_001270chr54798 454 132 104 ------
NM_001280chr192451 30 ------
NM_001282chr1732288 1058 905 2650 292 ----
NM_001284chr51492 ------
NM_001286chr162791 2571 2439 2219 943 780 --12284 --
NM_001290chr42977 104 --1195 --
NM_001292chr151202 --1131 1894
NM_001293chr112444 103 --165 --
NM_001304chr17143604 3588 3511 3349 3151 3113 2946 2733 2363 938 663 634 581 151 ------
NM_001310chr1292672 2345 1233 792 676 403 350 182 136 12888 --13030
NM_001315chr651899 1772 1725 1427 56 11669 ----
NM_001329chr1011276 21301 650 ----
NM_001331chr1142232 1755 783 152 --11112 --
NM_001332chr521317 629 21218 113 ----
NM_001343chr52305 170 --2322 152 --
NM_001346chr352553 2004 658 615 341 --12858 --
NM_001351chr361771 1662 1358 1152 373 65 ------
NM_001356chrX21631 759 ------
NM_001357chr12113 74 ------
NM_001358chr42299 144 ------
NM_001362chr1411007 ------
NM_001364chr1164445 3659 3449 3149 1827 625 --24602 3133 1939
NM_001387chr5102872 2849 2710 2178 2162 1215 1208 895 728 514 12819 32124 1242 676 --
NM_001390chr1873274 2728 1308 1216 806 758 737 43464 2787 2380 543 21379 986 --
NM_001391chr1821010 964 1955 ----
NM_001392chr18----123 --
NM_001396chr2121975 60 ----1553
NM_001399chrX83215 2450 2378 1076 939 791 250 176 --13354 --
NM_001401chr951345 1146 617 492 413 ------
NM_001406chr1741361 1339 545 417 21454 1249 1470 --
NM_001407chr341733 1500 1218 433 ------
NM_001412chrX63780 3334 2839 589 298 26 ----12599
NM_001417chr1241870 1746 458 394 ------
NM_001419chr1994720 4394 3884 3825 3499 3368 3136 843 490 44823 3876 3473 98 14011 --
NM_001421chrX11742 --1328 11270
NM_001427chr731383 562 278 1397 ----
NM_001430chr231678 448 272 ------
NM_001431chr63983 884 230 --1815 --
NM_001438chr1113647 3190 2761 2677 2341 853 801 508 288 188 152 --33682 2267 263 --
NM_001448chrX41498 495 337 64 ------
NM_001449chrX21102 122 31260 1150 974 ----
NM_001482chr155726 613 379 329 147 ------
NM_001483chr711105 ------
NM_001497chr962645 2086 1926 1893 502 141 ------
NM_001514chr13466 372 85 ------
NM_001518chr741099 329 124 105 1957 --11156
NM_001521chr22705 695 1161 ----
NM_001530chr142366 144 2412 76 ----
NM_001546chr621400 179 1211 ----
NM_001587chrX1574 11818 12135 --
NM_001609chr10114410 3865 3636 3597 3241 3202 3020 2919 1723 1387 239 11453 --1102
NM_001616chr263519 3130 2871 1050 602 558 ------
NM_001617chr231233 485 252 --1270 --
NM_001620chr111763 --2660 558 --
NM_001621chr752956 2896 2428 839 564 1257 --12539
NM_001621chr752956 2896 2428 839 564 1257 --12539
NM_001624chr661620 1497 332 227 213 37 11833 ----
NM_001634chr641865 1553 1405 505 194 22009 551 --
NM_001635chr72964 436 ------
NM_001642chr112477 166 --1295 --
NM_001650chr1852851 2805 1436 1236 264 --2558 61 --
NM_001654chrX2296 152 --1336 --
NM_001655chr1151588 1499 1480 1400 546 11934 ----
NM_001656chr571828 1660 1519 786 747 433 344 ------
NM_001658chr121093 191 ------
NM_001659chr1262485 2170 2142 1070 1007 592 12438 1383 --
NM_001663chr1482447 2040 1967 898 835 374 288 80 1131 ----
NM_001664chr321033 832 ------
NM_001665chr111109 ------
NM_001668chr151974 1655 695 684 586 ------
NM_001674chr13861 786 292 1305 ----
NM_001679chr31145 --172 --
NM_001682chr1242827 2399 2387 2084 22290 67 ----
NM_001683chr372351 2305 1837 748 346 196 148 11757 --11933
NM_001684chr184103 3460 2992 2577 1274 1063 540 42 --13568 --
NM_001690chr352560 2461 2034 1938 813 --12503 --
NM_001693chr841162 1156 1070 1011 1808 ----
NM_001695chr864173 3300 1442 1214 617 312 13361 ----
NM_001701chr93260 248 156 ------
NM_001709chr1122182 341 22015 148 --12202
NM_001711chrX11078 --1749 --
NM_001717chr1521439 1124 21105 138 1225 --
NM_001737chr52275 196 ------
NM_001742chr721568 1396 11484 ----
NM_001743chr21588 ------
NM_001746chr572158 2105 1979 1925 1868 1047 754 --3860 643 529 --
NM_001748chr131062 942 446 1173 --165
NM_001753chr721511 1349 21746 674 ----
NM_001754chr2183842 3649 3478 3168 3000 2839 2700 977 21235 500 11478 --
NM_001755chr1642134 1590 453 98 --2925 350 12304
NM_001759chr1274887 4270 3761 3472 1872 960 714 11758 13505 --
NM_001777chr363134 2701 2677 1451 305 289 12885 1419 --
NM_001781chr121141 ----193
NM_001788chr72857 725 1689 ----
NM_001791chr141281 897 542 376 1536 ----
NM_001797chr16----1567 --
NM_001806chr1962958 2907 2717 1175 441 97 12817 ----
NM_001810chr203622 607 547 ------
NM_001812chr41326 ------
NM_001822chr21548 ------
NM_001826chr11410 ------
NM_001830chrX143847 3772 3644 3596 3359 3262 3161 3131 2913 2653 1562 1371 1091 917 --23069 872 --
NM_001839chr11785 1491 ----
NM_001844chr12160 ------
NM_001845chr1341195 519 379 204 11074 --1336
NM_001854chr151379 1225 1110 450 423 ------
NM_001855chr91859 --1754 --
NM_001858chr623154 1723 1208 ----
NM_001859chr963498 3422 3394 3082 2878 1141 11458 ----
NM_001874chr1275008 4296 4284 3530 1922 574 143 1152 --1386
NM_001880chr22289 76 ------
NM_001882chr52540 94 ------
NM_001884chr5166 2480 358 ----
NM_001891chr41344 ------
NM_001892chr521081 456 --11284 --
NM_001893chr172336 284 --1356 --
NM_001896chr161337 146 ----
NM_001903chr53709 203 148 1105 ----
NM_001918chr1129282 9271 9040 6375 5917 5833 5731 5605 2674 1140 717 37 38438 8114 2329 --18413
NM_001920chr122256 146 --1649 --
NM_001921chr43958 67 46 11235 11030 --
NM_001938chr121207 30 21797 331 1749 --
NM_001939chrX82923 2677 1104 972 956 407 91 84 11392 1674 --
NM_001945chr521455 1401 1332 31034 542 90 --
NM_001949chr652880 2324 2180 2133 758 --11007 --
NM_001954chr61857 ------
NM_001957chr492229 2221 2107 2005 1848 612 416 324 137 1839 ----
NM_001962chr52577 135 ------
NM_001963chr43780 196 65 199 ----
NM_001968chr42206 113 ------
NM_001969chr1443604 1145 1105 379 53501 3083 1542 1497 1407 ----
NM_001977chr441506 1277 667 218 ------
NM_001978chr82995 913 --1724 --
NM_001980chr1222292 2198 ------
NM_001981chr141877 1572 1501 340 ----12161
NM_001987chr1253115 1502 1382 1340 1074 --33637 3499 292 14074
NM_001992chr532022 1500 751 ------
NM_001995chr421484 223 140 ----
NM_002006chr475035 4159 3635 3598 1627 448 257 55350 3729 1402 1312 31 25427 5324 25272 528
NM_002009chr1532506 2262 684 --12172 --
NM_002015chr1333174 736 324 --21143 85 --
NM_002023chr131112 635 212 ----11226
NM_002024chrX42084 1942 1907 469 31483 686 56 ----
NM_002025chrX239203 8899 8534 8486 7818 7454 7049 6995 6678 6599 6551 6309 6162 5946 5879 3392 3316 3224 2545 1550 1233 1122 247 16437 --17709
NM_002028chr14--1201 2946 869 --
NM_002031chr61279 ------
NM_002032chr111388 ----1410
NM_002035chr1852794 1306 927 713 32 ----23776 410
NM_002037chr62399 64 --1144 --
NM_002040chr2172981 2586 2558 2366 1953 1047 958 22828 1066 ----
NM_002048chr931242 551 134 ------
NM_002051chr102944 908 --1450 --
NM_002054chr21443 ------
NM_002061chr11360 11610 ----
NM_002063chrX31031 970 259 ----1238
NM_002069chr741687 1502 1475 719 ------
NM_002074chr131663 349 232 ------
NM_002077chr931600 1518 1460 21763 240 22068 530 --
NM_002086chr1771913 1885 1589 1556 1513 531 232 12097 1605 --
NM_002089chr41146 2686 514 ----
NM_002092chr465019 4766 4120 4106 1982 142 ----11627
NM_002106chr41337 ------
NM_002107chr13410 179 101 ------
NM_002126chr1783395 2968 2945 1538 806 655 558 379 23343 1037 ----
NM_002128chr1341887 1746 571 439 1697 ----
NM_002135chr121379 ----1417
NM_002138chr42198 51 --1724 --
NM_002139chrX2448 258 ------
NM_002140chr921204 1040 ------
NM_002146chr174560 504 286 194 --1182 --
NM_002147chr171819 --1230 --
NM_002156chr21283 ------
NM_002158chr272857 2793 2565 1494 876 370 117 --32396 2322 31 --
NM_002182chr332512 1960 598 22689 2214 --1273
NM_002184chr52182 159 1146 ----
NM_002193chr231723 404 61 1158 1613 --
NM_002194chr21131 ------
NM_002199chr41668 1858 ----
NM_002203chr583332 3152 2718 1513 1269 855 548 315 13954 1443 21359 621
NM_002207chr3--1602 --2786 64
NM_002214chr7165341 4885 4623 4337 3953 3647 3549 2218 2126 2063 2046 1750 1742 1189 521 514 13737 --15535
NM_002222chr331329 1298 469 ------
NM_002223chr1243437 2899 518 32 13879 --11538
NM_002232chr151280 993 850 431 86 31138 981 892 ----
NM_002234chr122217 173 --1127 --
NM_002235chr1221428 70 --11254 --
NM_002239chr21394 1113 ----
NM_002241chr181944 1121 790 506 464 404 191 49 ------
NM_002247chr1052331 1632 520 167 65 --2837 563 --
NM_002253chr441418 1184 155 77 ------
NM_002264chr374231 3588 3581 3085 1595 1344 198 23855 106 --23124 488
NM_002267chr1362393 2048 1572 964 957 125 1313 ----
NM_002268chr311268 ------
NM_002270chr595087 5061 4839 4602 4542 3886 1853 1400 1268 15100 34646 2169 1670 --
NM_002271chr1361821 866 582 575 184 173 --1837 --
NM_002278chr171192 ----1418
NM_002285chr253938 3183 954 497 363 23930 244 13291 --
NM_002293chr152215 2086 1111 1104 502 --42176 2148 1778 219 --
NM_002310chr5115883 5824 5570 5500 5226 5219 5200 5184 5028 790 491 --21851 748 --
NM_002313chr1054075 1261 1181 1031 950 2482 252 23665 1901 --
NM_002333chr1931225 285 66 ------
NM_002336chr1284795 4305 3522 3404 1310 1057 940 851 23703 3126 ----
NM_002351chrX21684 1543 ----11734
NM_002355chr123947 426 121 1348 11104 --
NM_002356chr641753 1007 864 675 ------
NM_002359chr1763669 3397 2732 1716 1696 1137 --13051 11516
NM_002360chr762481 2400 1922 537 402 321 --12138 --
NM_002372chr52695 607 1722 ----
NM_002373chr152935 415 ------
NM_002374chr2103217 3147 1459 1306 1243 749 666 363 300 189 1738 11071 --
NM_002382chr1431243 190 60 ------
NM_002384chr182837 395 ------
NM_002387chr5155050 4952 4610 3678 3189 3167 2079 2069 1984 1858 1364 511 400 361 279 55198 4500 4329 1469 1279 --1924
NM_002395chr6150 ------
NM_002408chr144632 320 151 31 1782 ----
NM_002409chr2233183 2008 1232 12750 --1765
NM_002442chr1221750 1186 11533 11593 --
NM_002444chrX41575 570 289 237 11390 --11316
NM_002449chr521161 209 ----1231
NM_002451chr933917 2888 102 22408 877 ----
NM_002457chr111130 ------
NM_002479chr12535 234 ------
NM_002480chr1241049 529 503 389 21105 539 ----
NM_002481chr1237947 7853 7684 7622 7479 6746 6674 6641 6582 6465 5509 2747 2688 2437 2431 2046 1313 1223 1021 187 171 78 64 15832 43077 2820 1419 359 15674
NM_002482chr12287 59 ------
NM_002485chr84797 667 530 374 1456 1306 --
NM_002486chr91634 22200 380 21572 102 --
NM_002487chr151305 ------
NM_002489chr7270 45 --1317 --
NM_002500chr23976 940 215 ------
NM_002505chr64542 483 204 71 ------
NM_002506chr1------136
NM_002508chr1127 138 ----
NM_002515chr14----21747 1477 --
NM_002519chr111106 31271 610 266 ----
NM_002522chr1743886 3061 1378 1369 ------
NM_002524chr13886 824 41 --1996 1266
NM_002545chr1195005 4576 4541 3734 1608 1071 512 207 164 23922 3133 23243 628 --
NM_002546chr8185 ------
NM_002547chrX84149 4085 3681 1437 1205 1025 131 43 --11660 --
NM_002556chr1152138 2062 1892 1400 131 1265 ----
NM_002577chr364056 1068 535 349 245 33 142 ----
NM_002581chr964758 4672 3909 3871 1427 606 74745 3648 2103 2081 954 911 68 --25065 1449
NM_002582chr162985 709 1945 ----
NM_002586chr62224 67 11598 ----
NM_002590chr131130 --1421 --
NM_002600chr141689 611 486 118 ----1472
NM_002603chr81135 ------
NM_002605chr152948 86 2979 416 1800 --
NM_002612chr72341 281 ------
NM_002613chr16125335 4936 4610 4594 3690 3606 3453 3293 2105 1920 915 79 --13932 24690 1126
NM_002628chr311072 --1491 --
NM_002643chr21168 ------
NM_002645chr1162969 2056 2031 899 861 697 21965 1174 12224 --
NM_002655chr883957 3635 3343 3237 1344 996 838 455 25302 256 --1847
NM_002657chr2063741 1398 610 481 357 94 --31362 1302 853 --
NM_002658chr102867 753 ----1760
NM_002670chr321556 1337 11106 11252 11444
NM_002677chr832832 915 691 --162 --
NM_002687chr1421252 336 ------
NM_002693chr152152 75 ------
NM_002698chr191889 --12527 --
NM_002702chr122799 401 --1648 --
NM_002703chr441900 635 598 184 21736 374 ----
NM_002707chr21365 ------
NM_002709chr22432 409 13310 --13537
NM_002713chr13413 110 89 --1264 --
NM_002714chr64890 362 299 58 ------
NM_002715chr5--2868 121 2445 340 --
NM_002716chr1183626 3587 3476 3091 2522 2293 993 872 11384 12352 --
NM_002717chr81105 ------
NM_002718chr342244 812 620 239 22560 559 11888 --
NM_002719chr1452280 1837 644 443 375 2879 268 ----
NM_002720chr161214 ------
NM_002731chr152228 1161 1094 391 283 ----12632
NM_002734chr1731690 1485 590 11394 ----
NM_002737chr17116341 5715 4872 4705 4411 4241 2088 2019 1995 1565 819 2326 109 ----
NM_002740chr342360 1820 196 27 ------
NM_002742chr14----1718 --
NM_002744chr12298 282 ------
NM_002745chr2274023 2762 1655 1474 978 565 168 1342 --23212 1049
NM_002752chr52401 215 ------
NM_002753chr43847 345 285 ------
NM_002760chrY95431 5292 4505 4431 2173 1907 1358 298 102 35657 387 46 15582 --
NM_002763chr13561 427 174 ------
NM_002765chrX61160 1036 316 293 177 154 ------
NM_002814chrX3233 213 183 ------
NM_002822chr1251590 1412 1231 131 77 1255 ----
NM_002825chr71627 --1585 --
NM_002828chr183997 673 288 ------
NM_002829chr93942 440 143 ------
NM_002833chr151630 ------
NM_002834chr1263485 3459 2764 1020 666 522 22909 2802 21144 46 13328
NM_002836chr202185 126 ------
NM_002839chr983587 2785 2777 2698 1208 1039 633 101 13045 1990 --
NM_002840chr131312 1264 1152 ------
NM_002841chr31569 1195 --1713
NM_002843chr1131316 494 306 --23001 2429 1543
NM_002844chr631112 459 352 1925 ----
NM_002845chr185627 549 472 57 33 ------
NM_002847chr741492 336 238 85 ------
NM_002849chr124977 947 162 69 1742 ----
NM_002852chr31232 ------
NM_002859chr1241805 1230 622 551 1719 11665 11361
NM_002860chr103514 258 30 ------
NM_002865chr8----153 --
NM_002868chr1282073 2063 1937 1846 818 806 467 250 --11910 --
NM_002869chr1131426 488 61 ----1748
NM_002874chr941921 653 548 294 12168 ----
NM_002880chr34681 606 576 125 --1660 1569
NM_002886chr394976 4836 4803 4210 3454 1304 1229 1143 550 24481 3758 ----
NM_002890chr51310 2215 107 --1268
NM_002892chr1441603 1317 312 125 11287 2608 397 --
NM_002893chrX2341 141 ------
NM_002894chr181180 ------
NM_002906chr1152022 1632 1520 472 229 4748 404 387 243 ----
NM_002911chr1941499 1461 653 95 ----11368
NM_002912chr64767 732 134 83 ------
NM_002924chr14629 447 162 144 1429 1211 --
NM_002926chr431174 327 43 ----11025
NM_002938chr441862 1568 1537 139 --11291 --
NM_002940chr461651 1431 692 637 438 261 ------
NM_002941chr321271 250 11513 ----
NM_002942chr321339 1063 ------
NM_002943chr15123 ------
NM_002956chr1241239 1180 374 209 11363 11214 --
NM_002957chr933723 3576 625 --12838 --
NM_002959chr163471 3299 3123 1252 1191 330 14335 2956 127 --
NM_002968chr161884 1799 ----
NM_002973chr12--2221 213 256 47 --
NM_002977chr252483 2452 1331 1095 722 3636 560 319 ----
NM_002993chr44716 299 209 108 1117 ----
NM_002994chr481661 1494 1317 554 359 323 199 125 1577 --11224
NM_002996chr1681949 1783 1765 1537 1292 1280 682 565 --11858 --
NM_002997chr231539 1244 234 ------
NM_002998chr811798 --1545 --
NM_002999chr2041314 1188 548 273 1764 1160 1413
NM_003010chr173821 367 131 ------
NM_003013chr41200 --1592 --
NM_003026chr951359 1265 1243 958 916 1313 --1414
NM_003028chr963769 3597 2716 1553 749 284 ----31427 1361 1293
NM_003029chr161450 1203 1101 1033 46 22 ----11323
NM_003031chr16--149 --1771
NM_003032chr32407 249 11807 22625 273 --
NM_003034chr12127984 7925 7226 6898 5596 5486 5092 4907 3213 2840 2268 154 27615 1845 --16835
NM_003042chr321882 1758 1875 186 --
NM_003043chr374002 3247 3212 1640 1566 512 261 11723 ----
NM_003051chr141961 1514 462 62 --11297 --
NM_003054chr10154 ------
NM_003059chr51305 ------
NM_003068chr82841 206 ------
NM_003069chrX3562 301 69 ------
NM_003070chr92540 60 ------
NM_003071chr36642 474 295 285 154 101 ------
NM_003072chr19------1134
NM_003074chr351999 1656 1447 370 93 12049 11408 --
NM_003076chr1221184 1160 11382 1175 --
NM_003079chr171732 ------
NM_003081chr204823 746 330 196 1369 ----
NM_003088chr71115 --1719 --
NM_003099chr1556197 6107 2218 1980 1506 34100 2641 2294 --22620 177
NM_003101chr131245 524 71 --11128 --
NM_003106chr31836 ------
NM_003108chr2156786 6374 6125 5939 5772 5288 5008 4471 4410 2108 2072 1821 1025 823 676 47286 5805 5490 1709 25646 1769 --
NM_003110chr173711 313 292 ------
NM_003111chr22860 459 1166 --1948
NM_003112chr763245 2747 2575 2422 1996 995 ------
NM_003113chr23690 606 308 ------
NM_003114chr81611 1164 128 --
NM_003131chr652290 2200 1893 1799 65 ------
NM_003137chr642209 2086 748 620 ----11860
NM_003142chr2----1231 --
NM_003144chr611398 12053 ----
NM_003149chr321677 406 11487 11242 --
NM_003155chr832809 2460 886 ------
NM_003157chr35950 832 723 685 209 ------
NM_003161chr1751426 1121 792 442 364 12929 --11264
NM_003164chr11----1444 --
NM_003174chr103666 593 204 193 ----
NM_003178chr341988 1727 706 112 --11484 1557
NM_003184chr85993 824 741 265 28 ------
NM_003185chr2031289 1233 352 ------
NM_003189chr133046 2805 1102 ------
NM_003199chr1875636 5602 4675 1839 1784 1098 849 1309 11613 --
NM_003200chr1942348 471 336 36 11679 ----
NM_003206chr61164 ------
NM_003211chr1221613 1472 ------
NM_003216chr2233030 851 435 --21193 980 --
NM_003220chr671586 1547 1312 1252 1102 1062 572 ------
NM_003221chr663196 2867 996 803 508 249 ------
NM_003234chr33735 509 110 22325 461 122 1960
NM_003243chr131141 1055 1016 ------
NM_003244chr181394 ------
NM_003246chr1551474 1466 1432 296 221 ------
NM_003250chr17----1338 --
NM_003253chr2151723 1553 1461 1243 380 11672 1476 1419
NM_003257chr151351 ------
NM_003262chr354603 4176 3678 913 585 63293 1615 884 409 381 277 ----
NM_003270chrX21055 257 ------
NM_003272chr12657 127 ------
NM_003274chr21112897 2703 2571 2468 1900 1192 889 520 358 293 72 ------
NM_003275chr9------1381
NM_003286chr2041121 401 314 293 1891 1859 --
NM_003289chr9150 --1194 --
NM_003292chr142255 1744 497 263 ------
NM_003298chr3125718 5228 5222 2262 2189 1896 1889 1388 1057 974 705 41 35780 5703 99 13829 --
NM_003304chr351390 1216 1046 656 570 11029 ----
NM_003320chr1144068 3891 3488 235 14333 23673 100 --
NM_003336chrX51085 933 887 262 122 --1154 --
NM_003337chr521285 241 ------
NM_003338chr1031919 1777 162 ------
NM_003339chr541570 1090 651 74 1244 ----
NM_003340chr421161 179 --1446 --
NM_003342chr1772944 2479 1101 1000 913 518 473 ------
NM_003344chr741560 1436 367 214 21644 1236 ----
NM_003348chr1241706 1312 1148 683 ----11067
NM_003349chr2041492 1330 1125 550 21573 68 ----
NM_003350chr81966 --143 --
NM_003352chr22382 328 ------
NM_003359chr431004 844 295 ------
NM_003363chr31545 ------
NM_003372chrX133 1190 ----
NM_003373chr1041761 627 472 390 --11572 --
NM_003374chr54632 200 185 160 --1777 --
NM_003375chr10160 ------
NM_003376chr611404 11690 ----
NM_003376chr611404 11690 ----
NM_003380chr102271 79 ------
NM_003385chr23925 746 45 ------
NM_003387chr222565 297 12084 --11883
NM_003390chr112243 179 1979 ----
NM_003392chr331080 639 433 13214 ----
NM_003400chr2----1170 --
NM_003403chr142712 44 1334 ----
NM_003404chr2042019 1641 767 398 1121 ----
NM_003405chr222758 489 ------
NM_003406chr851380 1281 629 598 119 --1318 --
NM_003409chr1831475 569 198 --21131 314 --
NM_003410chrX52069 1174 542 330 132 ------
NM_003411chrY71637 1583 1350 592 507 315 127 1385 ----
NM_003412chr342719 963 772 197 1874 11905 --
NM_003413chrX11611 ------
NM_003431chr12657 181 ------
NM_003439chr773442 3153 2653 1409 1030 687 133 23035 243 1968 2958 189
NM_003442chr11297 41 ------
NM_003458chr363792 3394 2804 1411 1320 265 1472 ----
NM_003463chr622750 604 13120 --1105
NM_003468chr273513 2859 2807 1045 1030 351 81 13931 23343 503 --
NM_003469chr2281 28 ------
NM_003470chr1671899 1560 1438 1335 1314 1263 435 --11631 --
NM_003471chr352346 2317 913 657 606 32275 1909 581 11883 --
NM_003472chr621231 1153 11393 ----
NM_003473chr101233 ------
NM_003474chr1092312 2266 2056 1634 1613 959 519 267 52 11481 ----
NM_003477chr112640 617 ------
NM_003478chr1163081 2832 2739 2544 1212 625 ------
NM_003480chr1242111 2044 1982 153 ------
NM_003482chr1232759 1781 581 ------
NM_003483chr12102968 2798 2707 2465 2195 1086 702 624 100 24 12370 ----
NM_003487chr171191 ------
NM_003489chr2183193 3070 2859 2556 1295 861 706 519 --11053 --
NM_003505chr741606 1364 661 162 11866 ----
NM_003507chr241337 612 545 509 ------
NM_003558chr92544 529 ------
NM_003559chr1743854 1368 1026 487 13641 --12759
NM_003563chr1751427 1124 1046 498 35 ------
NM_003566chr1241203 235 198 167 1345 ----
NM_003573chr191247 ------
NM_003576chr1342373 1840 915 216 ------
NM_003583chr123762 447 206 21361 977 ----
NM_003589chr1321330 562 11268 --1149
NM_003590chr293352 2972 1617 1223 1168 574 551 161 98 13378 --11625
NM_003597chr23510 165 49 --21994 1946 --
NM_003603chr452021 1973 1610 1469 104 21495 475 ----
NM_003607chr1103364 2663 1689 1575 1491 1411 1226 257 238 62 11479 11013 33470 967 352
NM_003615chr3113957 3853 3720 2506 2457 1142 972 855 515 397 280 33802 1349 386 23005 997 13060
NM_003618chr211139 1939 ----
NM_003622chr1262438 993 294 219 57 46 11911 ----
NM_003626chr1141399 1376 318 285 ----133
NM_003629chr122739 2726 282 45 22943 2859 11245
NM_003631chr101229 ----1143
NM_003633chr531869 360 71 12572 ----
NM_003644chr17146159 6026 5020 4913 4467 2065 1998 1928 1616 1559 1315 1271 1165 811 --16381 --
NM_003651chr121214 ------
NM_003655chr171754 --2593 201 --
NM_003659chr22914 413 2822 160 ----
NM_003660chr191676 ------
NM_003663chr383410 3306 2769 2548 2142 740 653 567 22558 575 12932 --
NM_003664chr5171 --193 --
NM_003670chr33912 439 424 ------
NM_003671chr91112 23001 1368 33133 820 557 11208
NM_003676chr17954 881 716 634 282 239 190 ------
NM_003688chrX1303 ------
NM_003692chr921032 677 ----2321 208
NM_003693chr172552 128 1793 1285 --
NM_003702chr82775 523 ------
NM_003705chr22825 663 ----1848
NM_003713chr141674 1370 1305 156 1652 21244 1203 --
NM_003714chr593041 2955 2324 2267 1898 1221 776 720 270 ------
NM_003716chr32953 382 1869 ----
NM_003722chr362163 1819 950 697 616 561 --11673 --
NM_003743chr252169 2131 1862 1802 1392 12152 ----
NM_003744chr141103 --1547 --
NM_003750chr104849 751 727 111 ------
NM_003758chr152606 77 ------
NM_003758chr152606 77 ------
NM_003759chr484175 4026 3371 2864 2658 2612 949 364 13586 13233 --
NM_003763chr2093118 3051 3003 2810 1994 1044 727 568 497 12603 11072 --
NM_003764chr61652 --2624 606 --
NM_003766chr172499 172 ------
NM_003774chr1262262 1314 1233 1087 1049 941 22782 197 --12727
NM_003787chr1841489 685 627 46 2640 603 1120 --
NM_003791chr164631 501 477 105 1134 ----
NM_003795chr61440 ------
NM_003796chr191608 ----1428
NM_003799chr1864469 4349 962 804 684 250 34292 3752 317 11578 --
NM_003800chr632402 2057 1948 11739 11829 --
NM_003816chr831178 372 224 ------
NM_003822chr132026 785 28 1247 ----
NM_003825chr1571536 1058 295 196 100 91 38 ------
NM_003831chr183694 465 326 2705 614 ----
NM_003861chr1462719 2498 1954 912 725 147 --22327 593 12574
NM_003872chr252279 891 599 479 393 ------
NM_003873chr1041949 1663 1653 1016 --179 --
NM_003877chr123930 780 319 --1898 --
NM_003884chr331878 1690 377 ------
NM_003885chr1732419 2346 1030 11710 ----
NM_003887chr241839 1590 1514 911 ------
NM_003888chr1561335 1264 1117 1102 423 387 --31608 1328 1316 --
NM_003895chr215748 699 645 347 334 1708 ----
NM_003896chr23840 806 731 ------
NM_003899chr1362332 2190 1674 1595 416 298 22003 490 ----
NM_003901chr1071887 1834 1079 860 837 289 207 --11033 --
NM_003902chr15850 832 753 557 536 --2646 314 --
NM_003909chr862699 1193 924 770 297 76 22336 814 --12480
NM_003913chr674214 4126 3552 1499 1210 1032 197 33730 2758 57 11053 --
NM_003916chrX31283 1142 957 21461 39 ----
NM_003921chr151805 1614 488 240 167 1633 ----
NM_003927chr1841051 935 447 73 ------
NM_003929chr14561 380 351 21 ----1195
NM_003931chr61614 ------
NM_003932chr2221472 741 ------
NM_003934chr921018 470 ------
NM_003936chr23842 785 437 ------
NM_003939chr1084002 3715 2843 2696 1181 1016 435 240 --1292 --
NM_003941chr762443 2305 1969 1716 262 96 1821 ----
NM_003947chr331140 978 892 ------
NM_003949chr1721403 616 --31902 1573 1368 --
NM_003951chrX2286 42 ------
NM_003953chr142191 1130 879 368 21917 229 21859 310 --
NM_003955chr1721470 370 ------
NM_003956chr10------150
NM_003958chr643864 1321 1092 768 --23661 161 --
NM_003971chr172156 100 --1524 --
NM_003980chr641103 1050 1044 240 2424 48 ----
NM_003983chr1663795 3714 3231 3225 2970 1111 13385 13292 13845
NM_003993chr11219 ------
NM_003994chr1284050 4005 3826 3773 1548 1434 948 669 11477 ----
NM_004004chr1351257 911 449 296 252 1365 1237 --
NM_004006chrX51937 1721 931 802 755 12602 ----
NM_004007chrX51937 1721 931 802 755 12602 ----
NM_004009chrX51937 1721 931 802 755 12602 ----
NM_004010chrX51937 1721 931 802 755 12602 ----
NM_004011chrX51937 1721 931 802 755 12602 ----
NM_004012chrX51937 1721 931 802 755 12602 ----
NM_004013chrX51937 1721 931 802 755 12602 ----
NM_004014chrX51937 1721 931 802 755 12602 ----
NM_004015chrX51937 1721 931 802 755 12602 ----
NM_004016chrX51851 1635 845 716 669 12516 ----
NM_004017chrX51937 1721 931 802 755 12602 ----
NM_004018chrX51851 1635 845 716 669 12516 ----
NM_004020chrX51937 1721 931 802 755 12602 ----
NM_004021chrX51851 1635 845 716 669 12516 ----
NM_004022chrX51851 1635 845 716 669 12516 ----
NM_004023chrX51851 1635 845 716 669 12516 ----
NM_004028chr1852851 2805 1436 1236 264 --2558 61 --
NM_004035chr17134920 4635 4500 3955 3703 3210 1391 1269 1097 668 602 428 405 41016 782 622 331 24869 4341 14877
NM_004036chr21236 --1553 1611
NM_004039chr152323 48 ------
NM_004040chr21324 11133 11242 --
NM_004050chr1442315 905 687 353 ------
NM_004056chr82868 313 1781 ----
NM_004061chr52645 577 1267 ----
NM_004067chr73606 373 94 ----11158
NM_004081chrY61789 1384 1204 472 408 153 ------
NM_004087chr361650 1413 1340 552 475 39 31497 142 32 ----
NM_004089chrX41248 1193 1063 58 ------
NM_004090chr1722137 1218 23171 2823 23021 2674 1493
NM_004093chr1322360 1240 23237 3191 ----
NM_004094chr1462483 951 555 280 231 80 --12092 --
NM_004097chr21321 ------
NM_004098chr1031260 1192 980 ------
NM_004099chr952089 1398 646 466 25 193 22122 275 --
NM_004100chr61536 ----11006
NM_004102chr11590 ------
NM_004105chr22837 730 ----1803
NM_004107chr192182 49 ------
NM_004112chr1751651 1404 1215 604 168 1263 1455 11563
NM_004113chr331967 536 73 ----1698
NM_004114chrX31045 804 65 1304 ----
NM_004117chr632115 660 363 1549 ----
NM_004124chr1463174 2805 2582 2429 2323 1369 1851 ----
NM_004132chr102468 273 11183 1848 --
NM_004133chr832704 1854 240 ----1187
NM_004156chr8----1401 --
NM_004161chr241598 1515 1044 406 11615 11037 --
NM_004162chr321130 93 1498 ----
NM_004170chr951878 1742 1503 1273 1164 ------
NM_004171chr11109632 9572 9227 7367 6027 5849 3713 3285 1861 1112 26716 6552 17820 1559
NM_004172chr551406 654 560 385 62 ------
NM_004215chr81417 ------
NM_004225chr841526 1205 506 23 1425 --11008
NM_004229chrX51738 1406 1380 748 155 ------
NM_004232chr1883887 3221 2925 2691 2459 1067 676 72 23249 1396 ----
NM_004238chr21309 ------
NM_004261chr11787 --191 --
NM_004264chr123862 156 149 11144 1835 --
NM_004268chr1181152 1014 956 500 156 146 92 32 --1894 --
NM_004272chr541529 691 613 160 1681 ----
NM_004274chr14122870 2830 2703 2608 2179 1259 1090 906 664 549 163 106 12228 31029 786 342 --
NM_004277chr6187 1113 1276 --
NM_004279chr742351 745 210 118 12121 ----
NM_004288chr22930 922 3771 114 37 ----
NM_004293chr983676 3082 2470 2358 955 937 846 664 21540 990 1820 23592 1260
NM_004301chr33268 253 123 --122 --
NM_004304chr22345 299 ------
NM_004311chr1022129 91 ------
NM_004319chr1122991 2239 2159 2071 2009 1988 1260 1194 1111 979 608 278 1584 ----
NM_004327chr2282494 2353 2132 964 761 580 509 336 --21895 477 1789
NM_004329chr104435 418 183 149 ------
NM_004330chr15------1988
NM_004331chr832090 2029 1791 1270 ----
NM_004337chr842193 1646 721 239 11537 ----
NM_004338chr18136904 6658 6389 5914 4407 4349 2647 2426 2010 1788 1418 1015 651 26565 92 1194 --
NM_004342chr732223 1733 256 ------
NM_004343chr193450 105 95 ------
NM_004346chr451540 1383 973 264 168 --1132 --
NM_004365chr51312 ------
NM_004370chr652157 1834 1460 822 764 21941 455 ----
NM_004371chr14965 232 146 70 ------
NM_004379chr211282 11071 --1657
NM_004380chr1652221 1918 737 104 30 ------
NM_004384chr53771 299 130 1287 ----
NM_004385chr52489 226 ----1602
NM_004389chr23719 593 66 ------
NM_004392chr1342334 1626 584 182 2575 149 1676 11835
NM_004393chr362340 2086 1705 843 798 472 1643 ----
NM_004397chr1174103 3482 2853 2811 1642 607 196 12802 --13079
NM_004399chr121267 --1665 --
NM_004408chr92477 36 ------
NM_004411chr72639 175 1613 ----
NM_004415chr6152 ------
NM_004417chr51598 ------
NM_004419chr103691 407 241 ------
NM_004420chr1131593 1559 1542 --22176 2066 --
NM_004426chr1261618 1402 704 686 243 205 31763 1717 1354 ----
NM_004427chr14783 445 312 174 ------
NM_004430chr842144 1977 1843 988 --2698 166 --
NM_004437chr192561 2399 2346 1079 988 324 236 171 102 12956 23272 427 12235
NM_004438chr252942 2549 2139 1268 1006 32086 2059 1155 1417 --
NM_004440chr641878 1432 1382 110 --11960 --
NM_004441chr331245 379 120 ----11083
NM_004442chr11406 ------
NM_004447chr121160 31108 1009 925 ----
NM_004450chr14198 ------
NM_004457chr221702 192 ------
NM_004458chrX62264 2045 1799 1054 471 363 12085 ----
NM_004459chr1721384 1340 11847 11262 --
NM_004463chrX1121 1165 1492 --
NM_004464chr484227 4163 3166 3094 3043 3019 995 368 13546 --23355 663
NM_004481chr152554 699 261 117 91 1454 21907 269 --
NM_004482chr22765 270 ------
NM_004485chr1154178 3913 3865 3807 3496 3097 2828 1736 1488 1256 1090 748 488 303 140 --12686 --
NM_004491chr1934152 766 712 13916 1455 --
NM_004499chr52358 165 ------
NM_004500chr1431425 180 74 ------
NM_004501chr123099 721 33292 253 95 12955 --
NM_004504chr242137 516 185 83 ------
NM_004505chr1751373 1309 670 442 206 1542 ----
NM_004514chr1762868 1166 928 867 496 485 1470 23004 247 --
NM_004529chr951408 1245 565 552 492 2925 359 ----
NM_004535chr2011479 ------
NM_004537chr1241514 1496 441 429 ------
NM_004549chr1151443 1383 412 194 29 ------
NM_004571chr212757 158 ----12765
NM_004575chr441581 1199 1179 74 ------
NM_004578chr12826 92 1911 1245 --
NM_004586chrX85118 4150 3839 2145 2049 877 685 652 33336 3329 1333 14801 --
NM_004593chr34922 774 750 304 ------
NM_004598chr5103244 2861 2819 2758 2501 2189 2174 1182 995 284 23071 536 ----
NM_004602chr2031469 1094 565 --21273 1037 --
NM_004612chr964138 3779 3651 3575 1566 78 --24578 596 --
NM_004614chr1652449 2363 912 551 477 --12003 1661
NM_004625chr3163 --1359 --
NM_004631chr131119 1035 934 ------
NM_004635chr31760 ----1357
NM_004637chr351293 1117 1043 907 84 ------
NM_004642chr122597 28 ------
NM_004657chr221060 395 21190 355 ----
NM_004663chr1531458 491 122 1435 11169 --
NM_004664chr12----1222 --
NM_004667chr152638 212 ------
NM_004673chr111159 1102 1480 1520
NM_004677chrY------1461
NM_004684chr4129 ------
NM_004685chr1392773 2573 2140 2093 998 833 630 393 184 ----1870
NM_004687chr1742004 1827 1471 517 ------
NM_004694chr171105 --1357 1241
NM_004705chr112736 190 1582 ----
NM_004709chrX11256 31620 1605 372 147 --
NM_004713chr142760 199 3545 254 92 ----
NM_004717chr751245 985 480 391 262 1239 1528 --
NM_004719chr1282761 2314 2141 1984 1920 1865 1098 336 11890 11114 --
NM_004725chr101293 ------
NM_004726chrX135459 5155 5107 4702 3627 3616 2262 2224 1786 1738 736 398 295 45685 4817 2155 1574 ----
NM_004730chr531565 578 111 11900 1697 --
NM_004734chr1343053 2810 1244 1058 22891 2115 --1845
NM_004736chr151958 1880 751 130 84 --31859 1744 375 --
NM_004742chr321493 1414 ------
NM_004744chr443804 3766 3119 3090 11062 ----
NM_004745chr8216725 6688 6181 6067 5890 5516 5454 5253 5209 5189 5018 4458 2744 2633 1969 1925 1460 1392 1201 1103 870 11349 25804 36 26258 4715
NM_004748chr15104133 4108 4037 3985 3574 3088 2617 944 426 413 --11333 --
NM_004755chr142845 314 --1875 --
NM_004756chr1931337 349 228 11430 ----
NM_004760chr732489 662 429 2256 35 ----
NM_004768chr12860 852 1758 ----
NM_004772chr541047 622 574 333 1212 --1283
NM_004774chr1743035 2745 900 349 --12436 11037
NM_004775chr1841925 930 865 818 21612 1538 ----
NM_004781chr141724 672 390 376 11173 11487 --
NM_004781chr141724 672 390 376 11173 11487 --
NM_004784chr4152 --1127 --
NM_004785chr162402 372 ------
NM_004786chr181149 ------
NM_004788chr1151695 1044 1031 355 259 1739 --1917
NM_004792chr2----125 --
NM_004796chr1432312 2252 2208 2385 34 --1313
NM_004815chr164361 4270 4137 1202 934 740 11719 1489 --
NM_004818chr12182 ------
NM_004822chr1773832 1596 1391 1336 964 541 284 ------
NM_004824chr651148 1018 903 544 398 ------
NM_004831chr191329 --1725 --
NM_004834chr232988 2186 248 ----13030
NM_004845chrX133675 3600 3402 3277 3268 3157 2932 2797 1587 559 552 448 207 --1325 --
NM_004850chr24396 358 245 48 21110 257 ----
NM_004856chr152490 79 ------
NM_004857chr1433772 3564 1674 ------
NM_004859chr1732924 1201 712 2184 177 ----
NM_004863chr1495106 3744 3295 1309 946 621 525 276 180 --34595 3666 440 --
NM_004865chr61324 ------
NM_004866chr594653 3534 3520 3073 1715 1535 1472 1131 347 21064 65 11096 --
NM_004869chr183134 84 44 ------
NM_004871chr1794281 3956 3839 3688 3461 3388 2702 467 301 1370 --141
NM_004873chr14113124 3041 2771 2494 2009 1247 469 328 190 69 52 11266 12367 --
NM_004874chr81429 ------
NM_004888chr91832 1110 1133 --
NM_004893chr53167 144 100 ------
NM_004897chr102649 182 1124 ----
NM_004898chr452917 2282 2138 2010 510 12314 --12084
NM_004902chr201818 ------
NM_004904chr7106004 5690 5590 5053 4352 4096 2114 1736 619 124 35241 1243 816 11438 --
NM_004906chr61538 ------
NM_004907chr19------2713 242
NM_004912chr731646 1295 387 11522 11753 --
NM_004922chr104902 667 214 40 ------
NM_004924chr191759 --1310 --
NM_004925chr92159 102 ----1552
NM_004926chr1431688 1646 1582 11327 11623 11509
NM_004932chr571716 1314 1188 269 178 98 23 31694 1503 363 2664 300 --
NM_004936chr983024 2937 2883 2803 2170 1981 349 240 22012 772 --2848 170
NM_004947chr362375 2222 1029 937 229 144 --2724 554 --
NM_004956chr7124497 4472 4207 4141 4025 3518 3042 1810 1643 1139 882 394 --33128 3110 3050 --
NM_004958chr1----165 --
NM_004961chrX41456 1253 380 343 ------
NM_004972chr91150 2469 61 ----
NM_004973chr611558 11383 ----
NM_004976chr1131765 991 854 --41674 1484 697 637 --
NM_004979chrX41171 1074 919 54 11040 --1237
NM_004984chr12135 ----1535
NM_004985chr12144360 4161 4154 3768 3689 3670 3058 2785 1651 1028 871 556 480 416 33160 1042 671 --11805
NM_004992chrX187894 7731 7435 7406 6417 6313 5709 3374 3335 3126 3010 2142 1891 1561 1310 946 935 128 --55873 2524 1569 1259 1229 --
NM_004992chrX187894 7731 7435 7406 6417 6313 5709 3374 3335 3126 3010 2142 1891 1561 1310 946 935 128 --55873 2524 1569 1259 1229 --
NM_004993chr144439 412 181 37 1349 ----
NM_004995chr142376 239 ------
NM_004996chr1631286 1115 597 ----11684
NM_004998chr153895 821 315 ------
NM_004999chr664298 4104 913 836 504 104 23145 83 11602 11126
NM_005006chr231020 810 749 ------
NM_005010chr751881 1739 677 651 27 21904 859 --12040
NM_005020chr73568 179 124 ----190
NM_005028chr1071953 1681 1476 1437 789 598 592 ------
NM_005032chrX31029 399 64 ------
NM_005054chr251724 1595 1364 1076 58 ------
NM_005056chr1285610 5563 4909 4893 3953 2069 1243 343 --21640 708 --
NM_005060chr12929 66 --1999 --
NM_005063chr1091255 1135 1024 929 886 526 321 242 220 12622 12673 --
NM_005065chr1454184 4082 4033 1662 235 23269 1279 11967 --
NM_005066chr11278 ------
NM_005067chr331008 654 291 182 ----
NM_005076chr133071 2727 1473 --31549 1370 231 --
NM_005077chr91114 ------
NM_005079chr863156 1051 736 630 358 90 1760 ----
NM_005087chr33724 590 109 --1862 --
NM_005088chrX1915 ------
NM_005093chr20145353 5092 4800 4772 4690 4480 4187 3783 3300 1556 1451 1301 744 670 13265 ----
NM_005095chr142130 1664 643 544 1716 ----
NM_005097chr103354 296 107 139 ----
NM_005105chr162227 2026 719 241 147 40 1161 ----
NM_005110chr5135 --2146 135 --
NM_005116chr2084170 3527 3389 3364 3300 3122 951 742 23344 2874 1322 --
NM_005117chr112895 150 --1690 174
NM_005121chr1732705 1308 264 ------
NM_005124chr6153 ------
NM_005126chr321953 1661 ------
NM_005130chr41223 ------
NM_005135chr1573449 2912 1333 1262 755 744 237 13876 ----
NM_005139chr42284 259 ------
NM_005141chr42398 75 ------
NM_005151chr1861775 1658 451 329 287 107 ------
NM_005156chr995297 5140 4787 4779 4466 1462 1380 606 394 1218 13521 198
NM_005164chr1242416 2299 926 677 21918 1667 ----
NM_005171chr123893 247 112 ------
NM_005181chr81724 3353 207 107 ----
NM_005182chr16----154 --
NM_005184chr1931607 485 246 --1234 --
NM_005188chr11157690 5945 5626 5588 5043 2904 2856 2242 2139 2033 1755 1034 1004 922 585 28283 7489 66899 5321 3081 2926 2728 493 --
NM_005191chr311380 21436 926 --11064
NM_005197chr14106196 5471 5340 4477 4363 4249 4240 3905 3847 2453 25407 1209 12239 15084
NM_005202chr132155 2142 1969 11929 2902 628 --
NM_005206chr1731030 550 185 ----1933
NM_005208chr17197 ------
NM_005214chr251088 947 842 224 40 ------
NM_005215chr181241 ----1177
NM_005219chr541804 1396 1283 467 ------
NM_005220chr174562 316 244 153 ------
NM_005222chr72964 224 --1248 --
NM_005229chrX11038 ----1193
NM_005230chr122547 502 ------
NM_005235chr2137497 6409 5519 5342 5304 3038 2696 2446 1756 1378 993 584 468 17781 24750 85 12830
NM_005238chr1153292 3042 1182 101 41 12351 ----
NM_005241chr341352 1069 297 55 ------
NM_005245chr43495 158 86 ------
NM_005249chr141308 ------
NM_005254chr15--31373 1145 887 21078 874 --
NM_005257chr1831272 1117 253 1396 ----
NM_005259chr231280 519 215 21543 486 ----
NM_005261chr83849 271 194 ------
NM_005263chr131162 331 107 ------
NM_005264chr102580 117 ------
NM_005274chr1----1129 --
NM_005276chr1221790 121 ------
NM_005276chr1221790 121 ------
NM_005277chr431330 1271 23 21826 207 ----
NM_005279chr23105 80 63 ------
NM_005281chr12212 74 ------
NM_005308chr102503 174 ------
NM_005311chr752809 2750 2252 1815 1000 31084 933 802 ----
NM_005313chr151337 --140 --
NM_005316chr112913 352 ------
NM_005324chr1741648 1536 702 119 11980 1126 --
NM_005329chr1641747 1471 744 427 12279 ----
NM_005339chr453991 3943 3419 3257 1595 ----13337
NM_005342chrX42518 2356 1106 229 12496 ----
NM_005359chr18105963 5390 4201 2527 2497 2392 1875 1617 545 86 35080 4052 354 34652 1712 1396 --
NM_005378chr22302 98 ------
NM_005381chr2128 ------
NM_005385chr372016 1709 1084 1075 738 354 304 12522 ----
NM_005387chr111640 ------
NM_005388chr951605 1248 1104 693 267 21074 445 ----
NM_005389chr6------129
NM_005397chr732654 432 392 --1924 13591
NM_005398chr1051427 1413 1273 521 290 ------
NM_005399chr173549 3163 2804 1369 956 755 282 44428 3377 2904 570 23481 1449 11101
NM_005402chr711589 --1390 --
NM_005406chr1841611 1200 1075 607 --1357 --
NM_005410chr54619 252 140 54 1700 ----
NM_005417chr2061724 1602 663 535 421 334 ------
NM_005433chr1842570 2493 678 438 166 12753 --
NM_005436chr10114064 3379 3335 3011 1629 1155 1122 1067 490 376 205 1557 11645 --
NM_005443chr43497 477 207 1443 ----
NM_005447chr12130 ------
NM_005455chr141613 1237 409 224 11640 ----
NM_005458chr942345 2162 1953 1773 ------
NM_005461chr2011439 ------
NM_005465chr152057 1691 716 282 104 --1149 --
NM_005475chr1262609 813 379 346 150 92 --22641 505 --
NM_005487chr2231366 483 367 --1783 --
NM_005493chr61193 --1782 1862
NM_005494chr71100 ------
NM_005497chr1795935 5802 2237 1720 1393 949 773 453 243 15440 21647 72 14031
NM_005501chr171990 --11125 1397
NM_005502chr952835 2068 1243 716 174 23157 2992 ----
NM_005504chr12105402 5179 4985 4633 4293 4134 2250 1811 866 762 25056 621 --11280
NM_005509chr511743 1300 --1327
NM_005517chr171196 958 551 505 460 362 232 --21178 938 11448
NM_005520chr51707 ------
NM_005522chr731394 287 89 ------
NM_005523chr731028 596 485 ------
NM_005530chr152455 196 ------
NM_005537chr132688 132 ------
NM_005539chr102987 559 --1502 --
NM_005544chr2158 --1916 --
NM_005563chr13785 675 251 ----1623
NM_005570chr1831140 1029 475 ------
NM_005578chr3115135 4833 4212 3929 3653 3595 2063 1362 1215 1086 855 64031 3943 3499 1611 814 182 13779 1231
NM_005584chr133538 527 86 2664 235 ----
NM_005595chr11225 1326 1879 --
NM_005596chr994882 4311 4079 1801 1785 1443 1332 679 319 35698 4418 4195 ----
NM_005599chr11242 ------
NM_005604chr642109 1903 1744 494 ------
NM_005606chr14126 ------
NM_005607chr81791 1675 158 --
NM_005613chr182188 2087 1947 1624 1608 751 659 240 11876 1147 --
NM_005614chr72439 40 11039 2677 185 --
NM_005625chr83793 222 154 ------
NM_005629chrX31322 871 164 ------
NM_005634chrX1206 --1242 --
NM_005637chr1862030 1933 1874 838 698 212 2361 205 192 --
NM_005638chrX81612 1511 1419 1406 1227 623 510 143 ----179
NM_005639chr1231806 93 85 21699 1428 11556 --
NM_005644chr12419 407 ------
NM_005647chrX53164 673 600 296 234 --23227 772 --
NM_005650chr2231275 1100 245 11314 ----
NM_005652chr163458 395 280 ------
NM_005655chr82508 367 --174 --
NM_005665chr184949 4699 4296 1832 1611 1347 1123 690 13259 1991 --
NM_005668chr594645 3027 2866 1374 1172 1079 1007 852 50 43583 2815 1289 1151 1222 --
NM_005685chr71103 ------
NM_005707chr1561306 827 464 106 98 42 1380 1390 --
NM_005711chr51811 ------
NM_005715chr662618 2079 842 803 672 40 12172 1721 --
NM_005719chr12149 ------
NM_005721chr22963 351 ------
NM_005722chr252239 746 475 294 253 1717 1689 12288
NM_005725chr172100 2066 2028 1874 807 337 38 11899 ----
NM_005730chr1293671 3442 2844 2757 2585 2472 2465 1299 563 1957 ----
NM_005731chr22286 122 ------
NM_005738chr721662 1320 1718 1789 --
NM_005739chr1541651 860 583 179 1787 ----
NM_005742chr2158 ------
NM_005746chr752336 460 427 144 128 2632 265 1832 --
NM_005748chr1273381 3081 2628 2434 2265 275 186 32604 2483 2324 13094 12457
NM_005754chr54997 904 805 392 --1196 --
NM_005756chrX3466 296 217 1544 11367 1444
NM_005759chr293955 3271 3247 1851 1824 1658 1458 965 76 24466 1879 1454 --
NM_005766chr1351384 1224 1081 509 383 124 ----
NM_005775chr82275 215 ------
NM_005776chr141593 1151 ----
NM_005779chr583619 3424 3112 984 854 800 443 113 32947 1268 1014 --12421
NM_005786chr18----1427 --
NM_005789chr1791995 1927 1563 1495 1357 1338 733 344 198 1624 12175 --
NM_005797chr1151368 577 106 88 31 --1374 --
NM_005808chr383531 3372 2918 2700 953 455 345 306 1442 12881 --
NM_005813chr252671 2477 2027 1930 708 ------
NM_005819chr142293 598 350 287 --13058 12938
NM_005822chr642337 2257 1896 1830 11625 12126 --
NM_005826chr11617 ------
NM_005828chr17135019 5012 3909 3767 1439 1415 1124 967 939 924 911 105 86 14849 24725 1791 --
NM_005832chr341227 1221 265 54 ----11037
NM_005839chr14885 824 804 194 ------
NM_005840chrX177639 6860 6472 6460 6278 5843 5233 4900 3010 2314 2159 1949 954 889 505 443 399 46723 4826 710 413 27656 2785 --
NM_005852chr171263 --1844 --
NM_005853chr16167 ------
NM_005857chr171130 1107 1037 958 547 453 436 ------
NM_005859chr531354 1276 1049 ------
NM_005862chr31725 --2933 824 --
NM_005875chr31277 --1125 --
NM_005876chr2----1750 --
NM_005880chr1631646 1256 1233 2207 40 --1249
NM_005885chr511105 ------
NM_005895chr1273234 3052 1491 1116 999 742 409 2434 194 13228 --
NM_005896chr21558 ------
NM_005898chr1183168 3006 2796 2642 2144 2129 482 98 23060 473 --12747
NM_005900chr41772 ------
NM_005901chr18147665 6986 6642 6109 5700 5337 5277 3266 3011 2333 1642 1051 742 727 33023 2150 1266 38626 2366 940 11004
NM_005902chr1584614 3709 2944 2866 1736 1103 714 480 ----14256
NM_005903chr594794 4189 3557 3354 2096 1963 1652 1022 405 34384 3218 120 --13464
NM_005904chr1831492 1046 325 ----11057
NM_005906chr661322 616 539 321 164 91 ------
NM_005907chr621533 540 --11367 --
NM_005909chr5144204 4165 4036 3699 3520 3465 3351 3043 2914 1709 1322 1219 566 43 64304 3194 2961 2604 674 202 14260 11178
NM_005910chr1763636 3533 3314 1364 1054 210 ------
NM_005911chr261503 1417 1385 1215 398 104 ------
NM_005920chr153166 2533 2395 1006 250 13803 13862 --
NM_005927chr521170 794 1524 1315 --
NM_005928chr153686 662 36 ------
NM_005933chr1152839 2797 2463 2304 73 --12229 --
NM_005935chr465186 4877 4295 1123 509 376 11580 ----
NM_005941chr873435 3274 1038 828 650 504 129 13780 32695 894 189 13329
NM_005955chr1105355 5169 4857 4104 4057 3787 1535 1201 337 125 34235 3658 1517 25318 1166 --
NM_005962chr1031972 1716 648 ------
NM_005962chr1031972 1716 648 ------
NM_005966chr242254 2071 1984 1977 ------
NM_005986chr1341051 735 611 391 --11106 --
NM_005990chr552786 2718 2325 2260 557 ----1936
NM_005996chr1261235 1206 1130 1067 411 287 ------
NM_006007chr944470 3841 3710 1356 43575 3206 794 463 1431 --
NM_006016chr642185 1829 1728 118 1521 ----
NM_006022chr1361080 906 336 315 306 148 ------
NM_006036chr262586 1919 1820 1812 296 59 ------
NM_006037chr294844 4804 4476 4255 3554 1881 1684 1430 506 24202 1551 14110 --
NM_006038chr2092165 1889 1652 1643 1614 1346 864 225 57 11832 12221 --
NM_006042chr172467 203 ------
NM_006047chr2043364 2722 1202 79 32223 2145 127 ----
NM_006055chr292021 1018 998 607 510 215 144 82 72 22650 2096 33025 1281 160 --
NM_006060chr7114158 4092 3669 3522 3080 2882 2789 1235 975 821 417 ------
NM_006062chr21938 ----1238
NM_006080chr752198 1189 611 267 138 12901 ----
NM_006091chr1551505 1402 1182 1136 47 ------
NM_006094chr842400 1659 1597 673 --127 --
NM_006095chr473016 1608 1402 952 636 609 602 64033 3647 1705 1598 1379 1106 ----
NM_006106chr1163022 2896 2161 1070 1004 543 2633 70 --1195
NM_006135chr171300 1198 1030 1007 951 394 108 ------
NM_006136chr741054 541 480 263 ------
NM_006139chr222729 2675 12893 22319 2140 --
NM_006141chr1631726 1058 571 ------
NM_006143chr12195 ------
NM_006145chr196930 808 154 132 67 39 ------
NM_006147chr1----1411 --
NM_006153chr32494 254 ------
NM_006154chr1522592 2122 12789 ----
NM_006157chr111131 ------
NM_006159chr122133 46 ------
NM_006160chr1711088 ------
NM_006162chr182642 328 21353 1164 ----
NM_006166chr1272366 1895 1724 1643 1614 1042 790 11756 ----
NM_006177chr141748 ------
NM_006180chr941678 535 478 221 ------
NM_006183chr12------1109
NM_006186chr211024 ------
NM_006187chr1223001 2721 --22175 274 --
NM_006191chr122302 155 1650 1643 --
NM_006192chr2051049 1017 910 361 206 --2227 184 --
NM_006195chr941446 1236 441 414 1302 ----
NM_006202chr1941612 803 410 349 --32006 1402 620 --
NM_006203chr594975 4134 4109 3841 1550 909 901 177 53 22007 1161 13983 24842 821
NM_006209chr81288 ------
NM_006210chr1921045 246 1175 ----
NM_006216chr22230 74 ------
NM_006224chr1762523 2078 1016 980 344 323 --12249 1519
NM_006228chr81315 --1442 --
NM_006237chr1332304 2159 1944 11926 ----
NM_006238chr631866 370 73 --21785 763 --
NM_006241chr342426 2360 2228 972 21959 835 31527 856 649 --
NM_006243chr11764 2383 235 ----
NM_006251chr593220 2928 2873 2488 2166 2132 2062 688 454 33251 2599 1027 169 1487
NM_006252chr197434 7336 6374 6024 5442 4621 2488 828 119 47585 6777 6048 2402 12855 --
NM_006256chr131713 823 649 --12269 --
NM_006258chr1031097 1062 984 --1246 --
NM_006265chr83972 445 143 1547 ----
NM_006267chr221361 612 --11178 --
NM_006275chr2031795 725 571 --21731 64 --
NM_006282chr2073229 2934 2883 1060 744 734 329 ------
NM_006283chr884967 3261 3245 3174 3016 1372 1129 459 23414 1348 14755 --
NM_006287chr2102142 2094 1889 1660 1032 635 307 80 57 31 22531 420 1563 --
NM_006290chr641817 1735 747 416 11958 ----
NM_006293chr1541010 838 663 289 ------
NM_006315chr464485 1571 1447 620 539 325 ------
NM_006317chr51296 --1787 --
NM_006320chr41730 ----159
NM_006321chr34318 184 171 87 1504 11389 --
NM_006323chr42248 213 1240 ----
NM_006327chr10----188 --
NM_006330chr841608 1563 1220 1142 ----11570
NM_006334chr91113 ------
NM_006345chr431095 401 290 1337 --1243
NM_006353chr651432 1378 1258 1173 999 ------
NM_006359chrX32475 1924 680 ----1238
NM_006361chr1742001 1671 693 356 --21634 431 --
NM_006364chr1421316 69 1797 ----
NM_006366chr631191 1173 871 1222 ----
NM_006367chr141034 442 429 312 1220 ----
NM_006372chr61158 ------
NM_006375chrX31745 509 465 21547 1336 ----
NM_006377chr92901 247 2165 43 ----
NM_006378chr951462 1413 1340 1281 576 11231 1467 --
NM_006379chr752195 2153 1999 880 725 21975 1898 130 11782
NM_006380chr1784279 4020 3561 3025 2860 1389 1214 526 --22756 407 --
NM_006386chr2241987 1762 1651 828 11834 ----
NM_006389chr1161405 1311 938 436 373 53 ------
NM_006390chr1221581 736 21605 49 ----
NM_006393chr1063962 3203 1709 1237 1009 450 33112 1139 675 23661 554 --
NM_006403chr63494 359 147 21768 1199 21286 1166 --
NM_006420chr2052476 917 803 246 150 --11127 --
NM_006421chr8----1266 1349
NM_006422chr12------176
NM_006449chr242163 734 722 75 2699 493 ----
NM_006451chr54915 408 318 230 ------
NM_006459chr1051749 1442 1431 1246 113 --1531 --
NM_006464chr294536 4069 4011 2953 1667 1581 1543 937 492 14520 41385 1120 731 284 1839
NM_006469chr111207 ------
NM_006482chr123762 447 206 21361 977 ----
NM_006489chr14----21747 1477 --
NM_006496chr111623 1646 --1547
NM_006497chr171796 --1809 --
NM_006516chr141493 436 318 82 ------
NM_006517chrX31541 856 204 --11964 12161
NM_006519chr6--1315 --1113
NM_006520chrX3348 290 60 ------
NM_006526chr2021879 511 ------
NM_006529chr421533 1517 1247 ----
NM_006532chr1952080 1944 1405 702 121 ------
NM_006534chr2032700 2480 254 1694 12180 --
NM_006537chr152179 49 3481 406 59 ----
NM_006538chr274207 3715 3338 3140 3042 1296 904 --11242 --
NM_006544chr14185345 5205 5128 5087 4915 4259 3946 3725 2036 1805 1522 1407 1272 766 512 389 362 233 36040 3963 2120 ----
NM_006546chr17125811 5752 5686 5652 5556 5492 5221 4562 2018 1557 979 411 1803 --15879
NM_006547chr732111 1946 854 --1363 --
NM_006549chr12112849 2796 2715 2662 2580 2454 2309 2056 922 654 485 32953 936 70 52468 2342 2041 1126 823 --
NM_006557chr931229 418 282 1388 1262 --
NM_006558chr83364 324 201 1341 ----
NM_006561chr10145399 5354 5208 4922 4695 4599 4163 4074 4025 2140 1611 1513 1444 462 14534 ----
NM_006572chr17103338 3171 2469 1370 1203 310 304 236 225 111 ------
NM_006578chr1551786 1639 1579 1290 72 1336 ----
NM_006599chr16178229 8103 7577 7507 7457 5707 5123 5073 5065 2225 2116 1491 882 871 681 249 63 36317 6155 2355 38056 6403 2295 --
NM_006601chr121244 ------
NM_006602chr202550 291 ------
NM_006603chrX41598 1464 1404 759 ------
NM_006609chr272981 2315 2109 1951 1150 972 966 ------
NM_006614chr363689 3675 3070 2850 1108 77 1300 --147
NM_006618chr15612 565 475 371 147 ------
NM_006621chr121494 1487 --21548 409 --
NM_006622chr5140 ------
NM_006624chr1021859 64 ------
NM_006626chr9102001 1869 1854 1711 1064 960 774 750 609 149 --12056 --
NM_006628chr15124650 4351 3984 3977 3628 1875 1281 1148 1023 317 256 82 43950 3776 1439 771 13997 11098
NM_006636chr23943 882 92 1714 ----
NM_006646chr1342322 531 426 403 --21064 996 --
NM_006650chr533824 2562 910 13564 1554 --
NM_006654chr1231333 836 313 23964 231 ----
NM_006662chr16129 ----1286
NM_006675chr1222953 952 11076 22484 1026 --
NM_006698chr2021295 23 --1450 --
NM_006699chr172484 2308 2171 1766 1715 875 175 --12346 12730
NM_006703chr64527 413 103 80 --1464 --
NM_006709chr6------1123
NM_006717chr993241 3156 2900 2834 2468 1262 1128 1057 78 1867 ----
NM_006720chr1054075 1261 1181 1031 950 2482 252 23665 1901 --
NM_006722chr322029 456 33086 1039 1010 ----
NM_006726chr43975 430 255 1361 169 --
NM_006729chrX225581 5545 5374 5140 5030 4824 4565 4473 4451 4066 3528 2157 2147 2018 1443 1061 1054 1043 959 416 312 222 64650 4603 4376 2123 1689 1249 24445 3613 --
NM_006731chr9155372 5328 5125 4800 4286 4191 4144 3880 3777 2183 1968 1689 1085 735 713 34159 2161 819 35346 3999 1230 13711
NM_006732chr1951826 1701 1479 1318 540 ------
NM_006734chr621356 23 131 ----
NM_006736chr221735 102 --1578 --
NM_006738chr1584652 4009 3873 3056 2863 1559 1421 801 ------
NM_006745chr441034 806 261 164 --21014 838 --
NM_006746chrX41476 1198 489 38 21063 481 ----
NM_006750chr16177737 7374 7333 6922 6668 6156 2922 2886 2576 2141 1895 990 923 760 562 276 49 77728 7010 7001 6189 4951 3110 1077 47046 5015 675 520 1170
NM_006751chr23894 362 204 ------
NM_006754chr73890 280 262 11006 ----
NM_006756chr821307 965 1392 ----
NM_006766chr862672 2339 2265 2214 462 90 22110 1789 ----
NM_006769chr11680 ------
NM_006772chr62381 163 --1567 --
NM_006775chr621001 394 ----12003
NM_006777chrX82893 1978 1969 1911 1105 1087 927 628 22283 2032 21934 361 --
NM_006788chr1852116 1788 1678 224 170 12144 --21877 467
NM_006807chr1751117 1054 847 267 67 ------
NM_006810chr3126 ------
NM_006811chr204925 901 838 207 1657 ----
NM_006814chr2042558 2392 2140 524 12671 3436 249 228 1632
NM_006815chr122530 239 --21277 1230 --
NM_006823chr8175 --1254 --
NM_006826chr24842 451 435 68 41143 402 383 134 ----
NM_006827chr1453024 2678 1305 1086 437 --1374 --
NM_006828chr61106 ------
NM_006838chr1231346 1163 643 ------
NM_006851chr1262509 1948 702 496 253 86 22761 2454 --12492
NM_006852chr1782766 2758 2695 2681 2635 2534 2519 299 --12731 11925
NM_006854chr72758 436 12012 22023 416 --
NM_006856chr1241146 940 339 266 ------
NM_006857chr22678 356 ------
NM_006861chr1241861 1450 1400 695 1644 ----
NM_006870chr20----132 --
NM_006873chr272929 2788 2748 1329 1133 816 731 --1713 --
NM_006885chr1694135 3521 3385 2574 1423 1087 1060 734 97 --23041 1569 --
NM_006886chr20136 ------
NM_006888chr14103544 3151 3070 2837 2699 2584 2254 1105 871 271 --12447 --
NM_006902chr142752 997 736 410 21347 1279 12368 --
NM_006908chr711068 1149 ----
NM_006912chr131915 409 231 1968 193 --
NM_006915chrX42176 1906 1737 324 ------
NM_006922chr2112339 2290 2249 2016 1650 1597 1029 982 834 766 387 --1576 1347
NM_006924chr1734360 3148 1210 14192 ----
NM_006939chr142449 436 ------
NM_006940chr1251836 1446 1396 1267 490 1338 ----
NM_006943chr2011275 23317 2401 ----
NM_006948chr2132349 1798 734 21728 74 ----
NM_006951chr103833 637 157 --1630 --
NM_006965chr1821044 238 --11104 --
NM_006981chr922903 1904 12156 --22643 599
NM_006990chr131997 1630 360 ------
NM_006999chr521918 749 1540 ----
NM_007005chr931596 1539 1074 1550 ----
NM_007007chr1274673 3998 1693 1552 1533 1046 27 ------
NM_007011chr15126829 6524 6186 5973 4694 2448 2151 1926 1383 1305 948 438 26049 703 14359 26555 6060
NM_007013chr81170 ----1139
NM_007017chr52872 195 ------
NM_007023chr23896 248 50 21032 101 ----
NM_007030chr554149 3158 1345 379 256 14387 23552 1663 --
NM_007034chr12840 824 11009 ----
NM_007035chr121593 ----1272
NM_007038chr21115804 5212 4863 4623 2310 2058 923 872 514 508 353 75951 4969 3762 1647 1366 1215 897 ----
NM_007039chr1422028 1595 ------
NM_007042chr362683 783 616 462 212 136 ------
NM_007045chr6268 54 1450 1546 --
NM_007050chr20127606 7594 7501 7415 6753 6333 5994 5765 2351 1982 883 144 21361 1349 27028 2577 16807
NM_007067chr1771559 1170 1155 997 515 417 346 --11109 --
NM_007078chr1063054 2186 2055 902 788 519 12217 ----
NM_007084chr1321486 359 ------
NM_007106chr1361716 797 599 538 183 43 2874 446 ----
NM_007107chr352184 929 917 665 524 ------
NM_007109chr62572 497 1479 ----
NM_007114chr352781 2663 1073 629 71 13196 --2641 429
NM_007118chr5----133 --
NM_007124chr641883 1603 136 76 ------
NM_007137chrX94438 3901 2010 1953 1768 1041 720 695 444 1452 25046 3826 11610
NM_007144chr1741178 950 72 26 --282 50 --
NM_007145chr1941327 1154 242 37 ------
NM_007150chrX31712 1363 285 1502 2578 567 --
NM_007159chr32687 199 ------
NM_007166chr113987 266 66 --1116 11359
NM_007174chr1252120 1939 1681 1622 256 1831 ----
NM_007175chr873297 3036 2752 762 705 219 104 --23355 2222 --
NM_007192chr1431046 764 347 ----1443
NM_007195chr1883659 3439 3272 3043 2758 1359 1142 75 13320 13622 --
NM_007197chr121208 1889 ----
NM_007200chr1584652 4009 3873 3056 2863 1559 1421 801 ------
NM_007203chr943722 2932 2881 551 32570 775 660 ----
NM_007204chr13546 415 131 ------
NM_007212chr12615 273 ----1545
NM_007214chr621327 204 ------
NM_007216chr11----1361 --
NM_007222chr851334 690 675 618 271 ------
NM_007231chrX12084 72473 2374 2351 779 407 256 131 ----
NM_007236chr1552449 1668 768 513 445 --2343 65 --
NM_007246chr42383 278 ------
NM_007249chr13157732 7483 7029 6980 3174 2919 2695 2663 1885 1643 1595 1512 1398 1123 642 27534 6500 27463 6164 17757
NM_007269chr13546 457 246 1518 ----
NM_007270chr741526 1383 965 571 ------
NM_007271chr641642 537 198 83 21278 439 --1158
NM_007275chr331117 396 330 --176 --
NM_007282chr311018 1116 1380 --
NM_007286chr541930 1489 1466 609 1462 ----
NM_007287chr393204 2538 2520 2176 2136 1973 1211 997 484 ------
NM_007288chr393204 2538 2520 2176 2136 1973 1211 997 484 ------
NM_007289chr393204 2538 2520 2176 2136 1973 1211 997 484 ------
NM_007292chr17134920 4635 4500 3955 3703 3210 1391 1269 1097 668 602 428 405 41016 782 622 331 24869 4341 14877
NM_007294chr174991 977 237 65 --1102 --
NM_007295chr174991 977 237 65 --1102 --
NM_007296chr174991 977 237 65 --1102 --
NM_007297chr174991 977 237 65 --1102 --
NM_007298chr174991 977 237 65 --1102 --
NM_007299chr174991 977 237 65 --1102 --
NM_007300chr174991 977 237 65 --1102 --
NM_007302chr174991 977 237 65 --1102 --
NM_007303chr174991 977 237 65 --1102 --
NM_007304chr174991 977 237 65 --1102 --
NM_007305chr174991 977 237 65 --1102 --
NM_007308chr4149 --2188 128 --
NM_007325chrX92031 1606 1583 1454 840 592 522 136 82 ------
NM_007332chr861155 1084 1026 176 62 27 ------
NM_007345chr1831577 484 151 ------
NM_007347chr1562921 2253 2031 1122 650 91 ------
NM_007349chr71100 1279 ----
NM_007350chr12114396 3472 3081 2909 2823 1778 1521 1482 512 494 376 11496 11622 --
NM_007357chr13204 119 56 ------
NM_007358chr131443 501 312 ------
NM_007371chr93149 136 92 1684 ----
NM_007372chr173727 576 284 ------
NM_007375chr132636 2424 1783 ------
NM_012064chr1251176 1143 1122 790 172 ------
NM_012073chr541477 383 150 99 11557 11602 --
NM_012074chr1441066 1022 843 241 1277 ----
NM_012081chr5103647 3176 3014 2985 2329 2286 1225 940 899 144 23738 3404 ----
NM_012095chr1083515 3370 2797 2719 1111 509 218 38 1251 13430 1551
NM_012096chr363596 3546 3112 2729 2350 385 33361 1324 460 12570 12487
NM_012097chr272142 1431 836 406 364 198 172 ------
NM_012102chr192175 1880 1863 1780 991 944 812 599 105 1716 22284 878 1572
NM_012105chr214196 179 141 59 ------
NM_012110chr4245 28 196 ----
NM_012115chr61585 1158 ----
NM_012118chr41389 ------
NM_012120chr642999 2747 2232 1896 1431 --12414
NM_012125chr154748 731 615 495 ------
NM_012129chr731971 839 486 1670 31818 757 553 --
NM_012137chr172128 2028 1167 1029 981 956 498 --32862 990 941 12209
NM_012141chr13104181 4150 3968 3572 3561 2717 1586 506 144 30 11112 ----
NM_012153chr1182495 2463 1778 741 557 289 266 135 12559 ----
NM_012154chr86830 775 650 153 141 84 ------
NM_012158chr1361718 1610 1509 1210 180 85 11493 ----
NM_012161chr431184 1166 53 ------
NM_012164chr9227543 7489 7094 6925 6609 6563 6482 6459 6286 6226 6071 5957 5671 5524 5056 4948 2578 2400 1196 1037 928 550 16664 34823 517 492 --
NM_012188chr52902 365 ------
NM_012193chr11105252 4516 4119 3808 1764 1298 591 429 230 68 ------
NM_012199chr1104684 4424 4012 2966 1134 1121 1056 1006 133 43 13240 1755 --
NM_012200chr11186 ------
NM_012207chr1011030 1311 ----
NM_012210chr941150 1005 478 271 ------
NM_012214chr2106439 5844 5236 5014 1971 1838 1659 1083 134 81 ------
NM_012215chr1021848 1484 ----11416
NM_012223chr251326 848 370 175 23 ------
NM_012229chr1041366 466 419 85 --11448 --
NM_012233chr21457 ------
NM_012234chr3123097 3084 3028 2887 1498 955 945 600 439 407 304 207 23760 1073 --12916
NM_012236chr13879 861 54 --2312 174 --
NM_012238chr1061540 1263 1255 522 424 34 ------
NM_012242chr103832 819 133 1654 ----
NM_012243chr12203 29 ----179
NM_012249chr233010 1097 1008 --11002 --
NM_012250chr1131146 934 173 ------
NM_012252chr784709 4696 4121 3483 3476 1819 421 390 34863 3863 577 --1410
NM_012255chr203169 137 30 140 ----
NM_012261chr202544 73 ------
NM_012262chr164905 4546 4350 3759 3612 1125 1736 11551 --
NM_012264chr2242065 1953 350 149 --11710 --
NM_012264chr2242065 1953 350 149 --11710 --
NM_012266chr94961 894 260 248 ------
NM_012281chr772016 1966 1909 1522 801 606 139 ------
NM_012287chr394491 4109 3978 3075 3038 1427 1189 507 90 21789 1036 ----
NM_012288chr685676 5606 5531 4932 4619 4450 3951 364 24972 3650 13670 1186
NM_012290chr231648 1366 42 11230 1635 --
NM_012294chr794077 3899 3817 2738 1452 1399 1289 1197 783 --13252 13400
NM_012297chr452141 1919 902 758 552 32595 2116 175 11857 --
NM_012300chr521591 456 ------
NM_012301chr762254 2100 1885 1683 562 85 11416 ----
NM_012302chr14802 792 782 304 ----11089
NM_012307chr184961 785 356 84 1265 ----
NM_012308chr1162494 2151 1766 1647 1040 839 --11835 --
NM_012309chr1194793 4633 4477 4240 4227 3840 3624 1489 1438 54580 4573 4405 3253 786 24115 4072 14500
NM_012316chr165472 3533 2237 1947 1134 860 14001 --11108
NM_012325chr2051637 1606 1584 164 154 ----1426
NM_012328chr721211 102 2952 553 ----
NM_012330chr101689 ------
NM_012334chr563892 3393 1670 1014 961 216 ------
NM_012338chr721101 488 21015 305 1367 --
NM_012342chr101385 --1537 --
NM_012347chr642266 1171 537 506 --12228 --
NM_012384chr2062000 1838 1773 1642 728 249 ------
NM_012394chr1245 28 ------
NM_012408chr203960 658 96 ------
NM_012416chr931118 383 184 ------
NM_012417chr172626 120 ----1606
NM_012419chr62239 164 ------
NM_012420chr1061775 1713 1492 776 372 255 11446 ----
NM_012425chr105881 369 204 122 29 1266 --11895
NM_012428chr152807 94 1888 ----
NM_012444chr20----1330 --
NM_012446chr52567 398 ------
NM_012463chr1281755 1555 1343 1290 688 402 95 28 --2576 63 --
NM_012464chr472904 2151 1787 1017 574 517 160 32301 1107 770 --12008
NM_012473chr223245 233 146 --2509 64 --
NM_012479chr722649 444 22680 602 ----
NM_012482chr13645 115 33 182 ----
NM_013227chr152655 283 ------
NM_013230chrY41615 465 44 27 1120 1430 --
NM_013231chr1483999 3383 1730 1431 1403 1375 1298 1144 23417 457 ----
NM_013233chr251400 1213 1133 401 271 ------
NM_013236chr2251187 1118 504 480 465 --161 --
NM_013238chr1341701 1324 1317 688 1720 1126 --
NM_013243chr153424 67 28 --1314 --
NM_013245chr161275 ------
NM_013255chr7168777 8451 7896 7837 7571 7370 6806 5842 5772 2399 1434 1163 978 964 443 231 13539 ----
NM_013257chr83467 148 61 12243 12034 --
NM_013261chr453675 3400 3243 2316 436 43690 1450 1355 727 1918 --
NM_013262chr641426 1404 1118 35 ------
NM_013269chr1223873 1392 1269 14088 --
NM_013275chr163814 747 155 ------
NM_013277chr122797 244 ------
NM_013279chr1131824 578 277 ------
NM_013281chr2051191 1151 411 303 77 ------
NM_013283chr53842 748 119 ------
NM_013293chr72296 161 ------
NM_013300chr122215 160 ------
NM_013322chr731255 567 553 ------
NM_013336chr361938 654 579 156 131 125 ------
NM_013341chr292808 2765 2735 1791 1138 936 579 215 36 11918 ----
NM_013354chr841011 366 136 110 --1381 --
NM_013357chr81747 1728 ----
NM_013372chr1553359 2701 2415 2408 1067 ------
NM_013374chr332629 944 415 32554 308 164 ----
NM_013381chr1252444 2073 1896 1823 1513 12286 ----
NM_013390chr961394 1382 606 258 176 104 11169 ----
NM_013396chr2121502 319 --1339 --
NM_013400chr731004 763 198 ----1908
NM_013423chrX31174 1081 187 ----1103
NM_013427chrX31174 1081 187 ----1103
NM_013436chr21117 --1640 --
NM_013441chr12453 435 ------
NM_013443chr93976 920 420 ------
NM_013444chrX2315 93 --11054 --
NM_013445chr2----1147 --
NM_013446chr741192 1106 1093 999 1314 11369 --
NM_013449chr124821 764 70 48 22809 2627 1517 12724
NM_013450chr231245 919 33 ------
NM_013943chr163326 2563 2021 1234 1111 266 1568 --12745
NM_013960chr81737 174 3571 259 150 --
NM_013993chr61857 ------
NM_013994chr61857 ------
NM_013995chrX62618 2533 1619 882 389 185 22259 2167 ----
NM_014000chr1041761 627 472 390 --11572 --
NM_014001chr1751662 1464 1434 1390 450 --1319 --
NM_014005chr542055 1047 925 38 1943 ----
NM_014011chr232344 410 41 ------
NM_014016chr341546 1247 350 41 2439 79 ----
NM_014021chr133032 683 455 33307 544 48 23232 2315 --
NM_014023chr1052719 2276 1109 866 25 22811 134 1512 --
NM_014035chr521018 156 ------
NM_014041chr33337 239 57 ------
NM_014048chr16124760 4254 4241 3470 3241 1893 1709 1633 1170 932 661 633 45142 4188 1482 193 13651 --
NM_014057chr961576 1233 1048 582 535 350 ------
NM_014110chr13413 110 89 --1264 --
NM_014112chr855422 5270 4702 1582 1030 22079 1554 ----
NM_014117chr1652200 2185 1973 1774 950 --1448 --
NM_014141chr7165312 5229 5202 4989 4936 4026 3612 3457 1895 1417 1185 1147 1010 743 442 347 1726 --14764
NM_014154chr351119 1023 562 469 311 ----1609
NM_014155chr11107049 6651 6381 6335 5995 5905 5027 4718 2805 258 1106 36869 5075 552 --
NM_014157chr1693668 3498 3304 3141 3003 2692 2673 2562 1250 23449 170 1866 --
NM_014178chr142471 99 1514 ----
NM_014181chr22780 123 22950 2526 12582 12389
NM_014190chr451887 1758 1604 1184 1159 ------
NM_014213chr2189 ------
NM_014217chr111725 11388 ----
NM_014221chrX131 ------
NM_014232chr173643 627 83 ------
NM_014232chr173643 627 83 ------
NM_014240chr383455 3090 3005 2907 1150 488 193 63 1360 13511 21222 1160
NM_014241chr10130 ------
NM_014243chr432075 766 163 12026 ----
NM_014250chr2231366 483 367 --1783 --
NM_014252chr13----1132 --
NM_014253chrX51663 1593 456 278 133 1849 ----
NM_014264chr4155 ------
NM_014267chr112243 141 ------
NM_014268chr1851446 1353 1275 1123 290 --21383 29 --
NM_014278chr41171 --1301 --
NM_014280chr11597 --2591 84 --
NM_014283chr121546 130 1245 ----
NM_014289chrX41397 1266 460 269 ----11141
NM_014294chr83402 60 49 1311 --11489
NM_014299chr1941773 1468 682 84 --11820 --
NM_014300chr154444 400 330 145 ------
NM_014309chr22115226 4205 3994 3389 1506 1412 1211 805 689 471 277 --11634 12136
NM_014316chr1632018 1636 454 1768 11918 21894 87
NM_014319chr1221781 656 ------
NM_014320chr62131 97 ------
NM_014325chr1221495 119 --12264 --
NM_014329chr161271 ------
NM_014331chr4137766 7518 7434 6366 5430 4938 2656 2525 2211 2145 1984 1187 826 45069 5042 1221 739 ----
NM_014333chr114993 858 767 386 ------
NM_014338chr22140 ------
NM_014342chr1141195 1149 484 159 ------
NM_014352chr1161252 1015 315 271 244 69 1580 ----
NM_014368chr942107 1622 1479 531 ------
NM_014372chr121841 508 11507 11942 11981
NM_014374chr731004 763 198 ----1908
NM_014376chr592580 2559 2176 2004 1904 1813 732 544 291 31625 946 915 --11941
NM_014392chr441596 1538 1321 1175 ------
NM_014393chr841796 956 654 270 1359 --1316
NM_014408chr11129 ------
NM_014415chr351626 1567 1500 1076 137 ------
NM_014421chr45810 747 590 311 205 11302 ----
NM_014423chr5134722 4673 4504 4185 4062 3804 3468 2187 2179 1839 1579 1536 185 75417 5362 3610 2020 1223 642 515 14632 21514 601
NM_014445chr392401 2386 2138 1961 791 727 626 564 25 11681 ----
NM_014447chr421597 358 ------
NM_014454chr61802 1753 ----
NM_014456chr102516 326 2705 588 ----
NM_014469chr113780 564 212 ------
NM_014488chr114641 527 201 192 1650 ----
NM_014491chr731085 924 416 ------
NM_014494chr1652234 1802 712 308 121 --1800 12222
NM_014496chrX2280 268 ------
NM_014517chr321338 1332 --1735 --
NM_014554chr1251584 1559 1431 489 257 --11936 --
NM_014571chr172621 2371 2360 2185 2161 2090 232 ------
NM_014572chr1331725 673 195 21491 345 11800 --
NM_014573chr1751568 1347 1265 596 494 --1172 --
NM_014577chr222909 143 ------
NM_014583chr31329 ------
NM_014584chr1411104 ------
NM_014586chr2154504 3451 772 688 473 21197 790 1268 --
NM_014587chr1641409 1363 268 205 1238 ----
NM_014588chr203686 298 60 ------
NM_014592chr51601 ------
NM_014607chr251675 1667 1396 96 66 21695 1552 ----
NM_014612chr921283 1254 1427 ----
NM_014615chr1663349 3292 2790 2545 1278 80 33180 3142 2922 12345 --
NM_014616chr372901 2785 2575 2310 579 387 99 --23060 1324 --
NM_014620chr121658 ------
NM_014623chr6188 ------
NM_014630chr1583800 3502 3133 2811 1559 1405 958 270 13398 152 --
NM_014635chr231702 1567 1332 ------
NM_014636chr974392 4332 4004 1145 1138 756 327 14086 ----
NM_014637chr81256 1285 ----
NM_014644chr121031 663 ------
NM_014646chr1853019 2962 2925 1145 372 --22895 291 12834
NM_014647chr163671 658 153 --2568 354 --
NM_014659chr1511096 --1130 --
NM_014660chr71954 ------
NM_014666chr521306 220 ------
NM_014667chr332264 1719 1698 1796 1414 --
NM_014670chr231579 270 120 --1254 1299
NM_014676chr131549 1529 335 1321 ----
NM_014677chr821324 953 11002 ----
NM_014682chr831654 1601 400 --1549 --
NM_014683chr1792000 1841 1738 1477 837 697 588 578 379 --12128 --
NM_014686chr1942526 2251 2142 2078 ----1823
NM_014690chr772692 1939 1228 824 422 377 125 1997 42733 2044 836 28 --
NM_014701chr1533256 2629 956 --11355 11003
NM_014702chr693356 3193 2887 2812 2440 2150 216 120 93 ------
NM_014707chr731856 280 92 31693 891 412 ----
NM_014711chr1632100 2086 1354 11377 ----
NM_014713chr22513 367 ------
NM_014720chr1031124 114 38 ------
NM_014721chr6117360 6908 6754 6735 6555 6446 5671 4695 1805 1346 570 16665 1684 --
NM_014729chr852107 1576 330 51 24 1510 --11658
NM_014730chr1295273 4681 4328 4309 4163 3879 1933 1322 1023 182 25225 5039 24965 4858
NM_014730chr1295273 4681 4328 4309 4163 3879 1933 1322 1023 182 25225 5039 24965 4858
NM_014732chr1664392 4278 4034 3816 2194 1223 25752 4211 --15038
NM_014733chr552117 1671 838 810 688 ------
NM_014735chrX52091 1820 1344 709 642 21875 125 --1545
NM_014738chr1721108 93 ------
NM_014739chr644063 3832 1388 822 23003 2558 --13309
NM_014741chr1142164 1825 860 807 --11901 --
NM_014743chr472956 2878 2329 2280 2137 538 321 32259 1058 801 --12043
NM_014747chr185556 4611 4418 4131 1586 1108 728 472 --44066 4051 3984 3653 --
NM_014752chr112753 607 ------
NM_014755chr232862 1692 904 1858 ----
NM_014757chr542159 2046 1703 585 --12318 --
NM_014761chr162823 177 --139 --
NM_014764chr122466 141 --1508 --
NM_014765chr132233 943 480 12338 ----
NM_014766chr772972 1043 900 723 635 417 151 --1677 --
NM_014774chr173216 3030 2712 2289 1177 1006 360 ------
NM_014776chr1262937 2597 2317 2049 1101 309 186 11989 12730
NM_014779chr32787 71 1143 ----
NM_014782chrX2115 86 ------
NM_014786chr111219 --1278 --
NM_014790chr5125 ------
NM_014791chr9------1270
NM_014795chr241270 1194 105 38 ------
NM_014800chr741103 751 157 29 1913 1296 --
NM_014803chr1072883 2577 2563 904 605 416 87 --1366 --
NM_014810chr142961 1201 1102 462 12530 22630 543 --
NM_014812chr141259 757 553 175 11389 --1524
NM_014819chr551929 1782 1538 445 56 11555 --1866
NM_014820chr361913 1663 1406 1399 600 453 11818 11896 --
NM_014822chr44640 569 121 34 1525 ----
NM_014824chr111761 11781 --1600
NM_014826chr1103364 2663 1689 1575 1491 1411 1226 257 238 62 11479 11013 33470 967 352
NM_014828chr1462473 1740 1640 628 209 127 ------
NM_014830chr1243892 3456 743 398 11449 13755 --
NM_014832chr1341676 1380 468 258 11426 ----
NM_014835chr2072027 2015 1974 1845 482 304 179 --1746 --
NM_014836chr1031482 699 319 12014 ----
NM_014839chr152458 2226 2067 1602 55 11658 ----
NM_014840chr1273300 2545 2442 2234 1338 1192 692 ------
NM_014841chr62516 132 --1969 --
NM_014844chr1444166 1612 518 140 13517 --1392
NM_014848chr1572531 2519 2254 1758 1132 609 502 32659 2017 735 ----
NM_014850chr361944 1494 1468 1446 1094 691 24088 4070 2815 73 --
NM_014858chr111102 11077 1871 --
NM_014860chr21900 21690 196 2859 706 --
NM_014868chr121180 1135 ----
NM_014872chr942212 2097 789 90 --21937 863 --
NM_014873chr1104569 4540 4313 4128 3266 1395 1188 925 419 51 ------
NM_014875chr121075 752 11023 ----
NM_014876chr222598 380 11764 ----
NM_014877chr17177198 6927 6098 5342 5331 4943 3001 2834 2667 2581 2163 1566 1217 1155 1146 501 175 37662 4706 2461 22884 2491 15623
NM_014880chr232108 2090 978 --12045 --
NM_014883chr432214 1561 151 22285 534 ----
NM_014893chrY72252 1945 1677 717 342 315 175 ------
NM_014897chr1762656 2322 2004 987 843 733 1485 ----
NM_014900chr231116 1014 297 1795 136 --
NM_014901chr522102 122 ------
NM_014902chr2021466 124 ------
NM_014903chr1231792 887 68 ------
NM_014904chr1053795 3706 3054 2500 1458 --11255 --
NM_014905chr231540 1533 1482 1768 21669 280 --
NM_014906chr1783749 3689 3610 3565 3157 800 327 195 12702 ----
NM_014912chr1033289 3081 2447 ------
NM_014918chr1541112 1069 512 396 1388 ----
NM_014920chr673438 2984 1152 1113 1050 763 72 1362 ----
NM_014932chr331377 397 72 ----11938
NM_014938chr1262436 2413 1772 1625 946 544 ------
NM_014942chr642442 1939 928 43 21022 132 ----
NM_014944chr121047 428 ------
NM_014947chr121106 512 12997 --1788
NM_014949chr12673 322 ------
NM_014950chr1421357 609 11668 1124 --
NM_014951chr1072551 1691 1054 991 611 308 263 22092 91 ----
NM_014959chr19143068 2975 2915 2324 2184 1347 1325 1284 1224 1075 877 806 234 132 ----11173
NM_014961chr491751 1645 1441 1377 775 563 553 501 462 12038 1750 --
NM_014962chr2031858 286 180 12673 --21966 653
NM_014969chr12739 179 2981 170 1188 --
NM_014974chr1041725 1571 537 523 ------
NM_014977chr141480 ----1107
NM_014978chr1041804 1790 1377 1358 ------
NM_014982chr1474609 4508 3740 3520 1760 1506 1442 24991 1848 ----
NM_014988chr482740 2560 2329 1753 1745 816 777 443 12077 12574 --
NM_014989chr691718 812 734 675 666 574 504 487 240 31871 1506 360 11936 --
NM_014990chr1441120 834 239 44 1422 ----
NM_014991chr452524 1245 1011 641 607 12123 12306 12333
NM_014997chr732220 2146 343 --1991 --
NM_014999chr1241262 1245 639 428 1202 ----
NM_015000chr121929 1133 --1463
NM_015002chr1242150 1805 1403 45 1778 --22200 667
NM_015008chr383282 3011 2968 2714 2670 2431 1160 460 191 ----
NM_015009chr31252 ----1315
NM_015020chr1643557 3239 2769 301 1521 ----
NM_015025chr242426 1014 859 208 11967 ----
NM_015026chr12134670 4591 4570 4022 3765 3130 3075 3066 1705 1661 1213 941 132 23258 451 1874 --
NM_015032chr1332569 808 704 12156 ----
NM_015033chr973042 2512 2446 2298 1267 1150 900 --33288 584 351 --
NM_015035chr2076742 5380 2389 1752 1712 257 130 ----24944 485
NM_015039chr183694 3538 3498 3422 1516 1291 1224 1027 24303 172 ----
NM_015040chr252785 1016 996 588 500 11026 ----
NM_015042chr1583868 3396 3215 2985 1681 1504 918 124 1568 ----
NM_015044chr1693260 2865 2811 2651 2555 2238 573 509 383 ------
NM_015045chr1042282 2070 1425 243 --11511 --
NM_015046chr972399 2042 1904 935 455 259 189 --11781 12180
NM_015050chr631297 1175 378 ------
NM_015051chr941264 808 372 30 43043 1371 523 471 ----
NM_015052chr73399 173 109 11080 1351 --
NM_015057chr131591 ------
NM_015060chr71194 ------
NM_015061chr94910 783 238 138 --1218 --
NM_015063chr191282 --11144 --
NM_015068chr763910 2725 601 548 291 245 --12653 1824
NM_015071chr556551 5675 5273 4491 1279 25691 5444 12320 11479
NM_015072chr141405 --1179 --
NM_015074chr193778 1933 1823 1804 1771 1504 1429 1017 599 11000 ----
NM_015075chrX2407 141 --41478 845 454 198 --
NM_015076chr654006 2930 2825 1329 228 1475 11817 --
NM_015077chr1734033 3419 3298 --21678 37 --
NM_015080chr1121014 809 ------
NM_015090chr195971 5113 3842 2188 1789 1240 923 567 293 24881 2242 11131 --
NM_015092chr1694371 3946 3529 3157 1018 880 751 710 358 --24135 3264 --
NM_015093chr631612 392 77 ------
NM_015097chr321549 690 1273 ----
NM_015100chr111646 21340 653 --11495
NM_015102chr1----1100 --
NM_015107chrX82038 2000 1837 638 601 265 241 165 --1185 --
NM_015110chr932235 1553 164 32354 1730 875 ----
NM_015111chr522667 401 ----13873
NM_015115chr482924 1296 966 949 918 861 805 625 22781 1989 ----
NM_015116chr131156 --2647 92 --
NM_015129chrX3284 248 208 21194 155 ----
NM_015130chr421254 972 1560 ----
NM_015132chr751689 1525 1314 1281 511 --1278 --
NM_015133chr1641160 1013 258 102 --2203 125 --
NM_015137chr872340 2141 2079 271 261 186 66 1301 ----
NM_015138chr1532674 2413 541 ------
NM_015143chr421132 327 ------
NM_015144chr1673883 3747 3427 3409 2795 2546 394 13819 1855 --
NM_015149chr131690 1420 1349 11605 ----
NM_015155chr1062955 2895 2733 1269 1048 258 11218 1530 --
NM_015156chr14114006 3669 3408 2789 1477 1302 1056 916 445 395 135 ------
NM_015158chr91860 1625 --1150
NM_015163chr1421430 172 --2209 203 --
NM_015172chr121571 1188 ------
NM_015176chr151792 1696 1473 110 102 ----1536
NM_015178chr832055 1061 427 1471 --2547 69
NM_015185chrX72196 1981 830 529 326 294 264 12609 ----
NM_015191chr1142657 2557 1097 417 12429 ----
NM_015192chr2073011 2913 1996 1964 728 445 247 --12990 11107
NM_015199chr382437 2329 2104 2089 897 694 618 185 ----12074
NM_015200chr421943 347 1161 ----
NM_015206chr1552999 2981 1298 969 321 2442 123 ----
NM_015209chr121455 869 ------
NM_015215chr172442 2399 974 821 747 464 207 22965 2533 22695 2131 12588
NM_015216chr531567 443 388 11416 ----
NM_015221chr1041184 983 394 42 --11197 --
NM_015225chr932132 927 95 1361 22098 254 11203
NM_015231chr113953 694 323 ------
NM_015233chr13102449 2430 2230 2084 1924 1782 1031 686 571 520 --22369 273 --
NM_015246chr162678 234 1187 ----
NM_015247chr1675187 4965 4931 4855 3883 1353 981 ------
NM_015256chr51583 ------
NM_015265chr242598 2324 2141 54 ----11716
NM_015267chr1231759 877 599 21729 560 ----
NM_015269chr12625 464 1561 ----
NM_015270chr1252010 1818 604 462 256 ------
NM_015271chr4134253 4033 3963 1586 1576 1560 1382 1333 656 448 371 182 122 1848 43835 3172 209 28 --
NM_015275chr124738 562 182 167 1797 --1820
NM_015277chr1841466 1251 601 467 21810 636 ----
NM_015278chr663046 2852 2339 2164 700 354 --144 1657
NM_015282chr252965 824 656 618 142 --1706 1458
NM_015285chr1872516 2339 1803 1694 1633 1582 663 --12086 --
NM_015286chr1542085 1709 868 174 1666 ----
NM_015288chr583819 3420 3024 2692 2460 997 968 76 1160 32478 1294 208 --
NM_015291chr162837 1186 1144 510 480 118 --32947 2414 2282 12490
NM_015296chr131185 1864 ----
NM_015305chr1451957 1616 1368 348 33 1786 1273 --
NM_015310chr8118155 7996 7705 6976 6814 6642 6442 6191 5890 1988 663 --27183 882 22804 2680
NM_015313chr1143552 3394 1648 1571 11289 1793 13164
NM_015314chr742145 710 581 376 ----11791
NM_015315chr563391 3265 2913 2684 747 240 ------
NM_015317chr222528 746 ------
NM_015323chr661769 1412 666 331 304 214 41690 263 252 227 ----
NM_015326chr1102810 2170 2029 1967 1851 1818 891 742 613 385 --12014 --
NM_015328chr783035 2500 2480 2123 1944 972 929 802 2461 353 21224 624 --
NM_015335chr121232 ----1218
NM_015336chr1232481 1685 827 1293 ----
NM_015338chr2021529 1376 11255 1392 --
NM_015344chr832156 866 369 32122 219 160 ----
NM_015345chr632766 2634 1879 22260 751 12676 --
NM_015346chr142592 242 --1172 --
NM_015347chr1252474 2369 1839 1096 715 --12172 --
NM_015349chr672478 2459 1044 779 727 683 127 ------
NM_015353chr1752561 2155 1730 404 229 12074 ----
NM_015355chr1741503 1270 353 156 1651 ----
NM_015358chr2131066 304 57 11041 ----
NM_015359chr882860 2750 2496 2463 1931 840 745 692 ----22213 1056
NM_015361chr21176 --1695 --
NM_015365chrX64097 3480 3406 2998 2986 802 --23075 2705 14125
NM_015375chr174535 4132 4024 3282 639 329 315 14878 123 --
NM_015378chr132516 1947 412 ------
NM_015381chr2231762 1332 463 ----1815
NM_015382chr142771 116 ------
NM_015387chr231919 1503 762 1351 ----
NM_015394chr1261640 1547 836 828 753 100 ------
NM_015396chr32459 82 31121 559 450 ----
NM_015397chr911789 --140 --
NM_015404chr9158 ------
NM_015439chr63441 137 59 ----190
NM_015443chr1731278 946 183 21164 101 1960 --
NM_015455chr5104102 3893 3167 3091 3051 2928 2621 1311 235 118 13203 1267 1390
NM_015460chr361690 1534 1468 362 255 93 --1726 --
NM_015461chr183759 661 79 ------
NM_015464chr71234 ----1689
NM_015465chr53591 500 297 --154 --
NM_015477chr152338 95 ------
NM_015484chr12789 166 3700 663 180 1657 --
NM_015497chr152459 349 11132 ----
NM_015508chr321456 1227 ----11372
NM_015509chr1211417 ------
NM_015511chr2041150 1062 862 146 2369 252 11125 --
NM_015514chr143507 437 399 ----1104
NM_015532chr1552246 2229 361 165 151 12528 ----
NM_015541chr31966 ----11287
NM_015542chr1031044 504 196 11201 ----
NM_015549chr141461 ------
NM_015550chr753011 2984 2460 1005 306 21252 912 33553 3511 2972 --
NM_015554chr1542433 1917 168 151 --12703 11993
NM_015555chr641700 661 441 129 21527 433 ----
NM_015557chr142677 2505 282 40 ----1231
NM_015564chr5103323 2701 2546 2342 2309 1186 1157 553 321 108 --12578 --
NM_015565chr2141629 1429 898 811 11706 ----
NM_015568chr2054286 3542 3341 2984 1008 --34191 1194 993 --
NM_015569chr164726 4706 4518 4092 1426 560 24349 1407 ----
NM_015570chr741695 1450 1439 361 1629 ----
NM_015571chr681057 525 280 221 198 142 49 26 ------
NM_015575chr262808 2429 2371 2302 1467 371 --12327 --
NM_015576chr352578 2403 2170 198 169 12316 ----
NM_015578chr1951735 782 625 615 146 ------
NM_015584chr1721430 413 --11151 --
NM_015601chr1031032 801 220 ------
NM_015605chr103459 401 266 --1589 11081
NM_015610chr782758 2528 2296 1868 684 571 340 182 --2773 599 --
NM_015634chr104557 404 389 74 ------
NM_015641chr741135 826 298 57 2359 233 11296 11225
NM_015646chr121178 1926 ----
NM_015657chr24821 425 307 173 ----178
NM_015668chr81158 ------
NM_015676chr142360 295 ------
NM_015678chr134660 380 176 115 11153 ----
NM_015686chrX31991 1923 988 12295 12223 --
NM_015691chrX52946 2626 2310 1958 1935 --12786 --
NM_015695chr621660 235 ------
NM_015719chr192305 155 ------
NM_015833chr2152392 1787 789 310 278 1586 ----
NM_015840chr162275 1014 843 776 329 258 ------
NM_015841chr162275 1014 843 776 329 258 ------
NM_015844chr182837 395 ------
NM_015846chr182837 395 ------
NM_015847chr182837 395 ------
NM_015878chr842229 1685 1452 160 --1388 --
NM_015879chr18187994 6904 6677 6471 6036 5966 3081 2984 2888 2844 2727 2517 2128 1489 1426 1222 780 458 1730 17891 --
NM_015886chr8105758 5362 5065 5051 4857 4698 4559 4549 1531 596 32211 2087 1702 1674 14312
NM_015888chr142282 2162 1279 74 32972 2501 2254 1518 --
NM_015892chr1032057 674 86 11949 ----
NM_015902chr8160 ------
NM_015904chr21149 --1677 --
NM_015906chr1124487 4274 4020 3261 1883 1873 1659 963 875 732 610 492 11455 ----
NM_015915chr141301 --189 --
NM_015941chr81136 ------
NM_015948chr63370 184 63 ------
NM_015952chr61131 ------
NM_015960chr101387 1127 --1247
NM_015975chrX41791 1239 533 278 1313 ----
NM_015982chr172132 58 ------
NM_015984chr13545 534 230 ------
NM_015986chr1741419 1387 1234 921 --1290 --
NM_015990chr41187 --1778 --
NM_015995chr1595296 5175 4767 4507 4201 1960 889 268 120 14175 11751 --
NM_015999chr11174 ----1151
NM_016003chr782758 2528 2296 1868 684 571 340 182 --2773 599 --
NM_016009chr1164926 4919 4871 4799 4727 4685 4447 4206 3856 3759 1052 528 487 292 239 192 34844 3301 1757 33812 256 86 --
NM_016018chr852796 2708 2695 2278 1941 22831 440 --12421
NM_016019chr71261 ------
NM_016025chr1641937 1700 1491 432 --11409 --
NM_016027chr82206 38 1494 ----
NM_016028chr111984 140 21020 437 --
NM_016032chrX11185 --31195 1060 561 --
NM_016040chr152521 2309 2301 1980 650 22683 2433 --12057
NM_016057chr1221321 831 --1525 --
NM_016061chr261585 1253 1062 667 420 180 11597 ----
NM_016072chr1242183 1822 867 415 1286 1183 --
NM_016076chr153022 2792 2069 879 648 11054 1602 --
NM_016078chr1741134 442 176 113 1257 ----
NM_016083chr643609 3039 2456 1266 21471 161 1347 --
NM_016087chr73697 563 553 11237 ----
NM_016090chr11----1187 --
NM_016096chr822104 1428 1360 142 --
NM_016100chr201163 ------
NM_016104chr61131 ------
NM_016125chr171105 ------
NM_016129chr4260 39 ------
NM_016131chr252359 2038 1889 1503 147 --11660 --
NM_016132chr1563250 2341 2249 2145 679 590 ------
NM_016133chr221549 1206 ------
NM_016141chr31778 1193 ----
NM_016147chr1151083 1003 948 458 181 1894 ----
NM_016152chr351276 988 482 248 196 --11203 --
NM_016156chr1161758 1667 1550 957 789 710 11565 --1523
NM_016169chr1083026 2812 1249 1152 891 880 835 58 --11082 --
NM_016179chr13------1202
NM_016194chr1551786 1639 1579 1290 72 1336 ----
NM_016201chr342008 1788 1431 392 ------
NM_016205chr42300 117 11269 11040 --
NM_016206chr3228763 8699 7840 7773 7717 7580 7187 7158 6926 6774 6676 6124 6075 5505 3023 2877 2286 1520 835 689 363 77 48421 6092 5826 2990 57800 7213 3202 1916 1508 --
NM_016216chr33286 224 57 --1565 --
NM_016217chr663345 3063 2342 2317 957 855 ------
NM_016224chr641530 1360 480 374 1198 1526 --
NM_016226chr122480 377 ------
NM_016227chr121546 130 1245 ----
NM_016231chr1731274 1224 44 ------
NM_016234chr103979 805 297 ------
NM_016242chr4158 ----1112
NM_016248chr1363582 2971 2748 2445 635 214 13297 11406 13228
NM_016252chr21640 ------
NM_016260chr2106458 5026 3058 2875 1923 1876 1430 1161 1055 270 47135 4950 2823 703 35865 1978 848 --
NM_016261chr172771 326 ----1626
NM_016271chr1881787 1775 1755 1693 805 666 228 152 22268 1483 ----
NM_016272chr2251945 681 575 185 122 ------
NM_016277chr631550 1415 1332 ----1434
NM_016279chr52335 93 ------
NM_016281chr1241034 913 233 203 ------
NM_016282chr951509 591 431 127 84 1336 11309 --
NM_016287chr141905 1316 642 324 21621 1583 ----
NM_016297chr243732 3183 2753 662 13216 1221 --
NM_016308chr162022 1938 1773 610 394 92 ------
NM_016312chr121549 1583 192 --
NM_016316chr2----2647 533 --
NM_016322chr943171 3137 2640 935 1804 32929 798 37 --
NM_016328chr71103 ------
NM_016337chr141314 ------
NM_016338chr521253 32 ------
NM_016358chr5274 64 ------
NM_016373chr16180 ----1806
NM_016374chr141078 393 274 207 --1251 --
NM_016374chr141078 393 274 207 --1251 --
NM_016376chr1794151 3916 3709 3242 2780 2727 1423 329 208 1169 ----
NM_016396chr1563025 2839 2754 2337 2111 717 --22565 2493 --
NM_016410chr92147 70 ------
NM_016418chr2223697 2409 12792 ----
NM_016422chr1182774 2633 2431 2388 2268 2217 307 297 13025 1175 --
NM_016436chr2021944 757 1912 1833 --
NM_016441chr252002 1799 850 835 693 12346 ----
NM_016442chr542204 2109 570 377 2628 423 1314 --
NM_016448chr151267 1195 730 494 176 ------
NM_016454chr152333 242 ------
NM_016475chr1421080 407 ------
NM_016499chr113520 437 179 1486 --1213
NM_016507chr1773174 2917 2636 2598 2161 1168 627 --150 --
NM_016513chr673438 2984 1152 1113 1050 763 72 1362 ----
NM_016519chr41175 ------
NM_016529chr131301 --21065 822 --
NM_016530chr1543859 3758 1250 625 13925 ----
NM_016531chr434105 3637 520 ----1151
NM_016542chrX41509 1091 350 220 21781 694 1536 1302
NM_016545chr1----1920 --
NM_016569chr1261235 1206 1130 1067 411 287 ------
NM_016577chr344437 3901 1147 597 34480 2809 386 11283 --
NM_016578chr112217 35 ------
NM_016598chr341513 1168 1087 325 ----11484
NM_016603chr521542 306 21411 200 ----
NM_016604chr561299 1256 1071 1020 996 955 --2148 43 --
NM_016605chr562129 2121 1974 951 826 324 12383 ----
NM_016612chr81662 --1578 --
NM_016614chr62318 51 ------
NM_016618chr21113 ------
NM_016620chr121218 974 11023 ----
NM_016621chr1164262 3963 3722 3418 1711 508 ------
NM_016623chr82663 212 ------
NM_016626chr1851791 1259 1141 613 418 ------
NM_016628chr101581 ------
NM_016631chr212884 667 1378 --1352
NM_016654chr15--31373 1145 887 21078 874 --
NM_016823chr174900 473 420 55 ------
NM_016824chr1031613 464 159 21716 1655 11371 --
NM_016830chr121434 --1521 --
NM_016834chr1763636 3533 3314 1364 1054 210 ------
NM_016835chr1763636 3533 3314 1364 1054 210 ------
NM_016841chr1763636 3533 3314 1364 1054 210 ------
NM_016929chr694491 3928 3357 1845 1825 1519 1347 376 158 24254 1618 1674 --
NM_016930chr4271 61 ------
NM_016936chr1611641 11581 ----
NM_016946chr163300 2917 2790 2286 1452 294 22673 84 1498 1107
NM_016950chr431420 446 277 131 --1304
NM_016952chr1173489 3086 3060 2886 2730 1550 416 12720 1278 1826
NM_016953chr285071 4923 4781 4136 1742 1575 1308 672 36079 1915 479 1140 11214
NM_017409chr122816 144 --1180 --
NM_017410chr123979 925 873 --1964 --
NM_017412chr84970 464 335 103 1928 ----
NM_017415chr564011 3980 3533 3508 2956 1667 1274 ----
NM_017416chrX1156 ------
NM_017420chr1473524 2639 1119 1081 1059 792 557 23383 921 ----
NM_017423chr482012 1814 1699 1580 832 811 550 398 12083 ----
NM_017424chr2262114 1998 1534 526 307 229 11313 ----
NM_017437chr1421694 197 1519 12380 --
NM_017440chr124454 275 123 103 ------
NM_017447chr21124125 4039 3713 3701 3333 3184 1179 871 803 756 585 176 33894 1096 566 14066 --
NM_017449chr11406 ------
NM_017452chr2031469 1094 565 --21273 1037 --
NM_017453chr2031469 1094 565 --21273 1037 --
NM_017454chr2031469 1094 565 --21273 1037 --
NM_017455chr152807 94 1888 ----
NM_017483chr231233 485 252 --1270 --
NM_017522chr131119 1035 934 ------
NM_017544chrX--1116 --1758
NM_017545chr203523 213 129 ------
NM_017548chr321759 236 ------
NM_017551chr1042496 2088 1766 123 22645 2131 ----
NM_017553chr152339 327 --1398 --
NM_017558chr161408 ------
NM_017569chr133312 261 106 ------
NM_017577chr331023 481 141 1322 1195 --
NM_017580chr1082068 1678 911 694 438 407 357 253 --21929 444 --
NM_017594chr992972 2775 2618 2317 2283 1228 1148 1133 827 22331 155 --13091
NM_017595chr1741555 1323 1100 282 --122 --
NM_017596chr163612 2930 1447 961 192 31 --23539 3456 --
NM_017610chr1521333 648 ------
NM_017628chr4215151 4929 4739 4638 4602 4054 3886 3560 3533 3276 2092 1894 1739 1397 1386 1368 1303 1204 1108 918 118 24922 351 --12004
NM_017629chr121842 1356 --1109 --
NM_017632chr42316 108 ----185
NM_017633chr623173 2766 11333 ----
NM_017634chr841654 1446 1302 781 21351 181 ----
NM_017635chr1121640 97 2500 289 ----
NM_017637chr9249011 8683 8353 8220 7968 7574 7100 6709 6487 6088 5960 5916 3273 3180 3158 2314 2264 2069 2015 1963 1309 1107 1011 205 --18739 17216
NM_017643chr1763027 2581 2313 2174 1255 253 32284 2014 1041 ----
NM_017644chr345026 1526 1273 154 24816 2025 --11545
NM_017650chr7115692 5374 5006 4986 3713 2105 1409 1255 1247 1000 464 31931 1535 1138 11520 --
NM_017658chr1464026 4001 3929 3429 3132 1343 13817 --11756
NM_017661chr1521228 338 --1347 --
NM_017666chrX51696 1503 526 174 150 1903 ----
NM_017668chr162106 22 --1116 --
NM_017684chr153604 508 153 --1209 --
NM_017693chr1331662 460 216 1252 ----
NM_017694chr231987 245 119 11491 ----
NM_017709chr1104094 3598 3170 3018 1432 1252 1076 881 255 74 23643 24 ----
NM_017719chr352483 1849 845 126 72 ------
NM_017728chr1742191 2140 321 293 --42812 1144 1021 168 1690
NM_017730chr31121 ----158
NM_017734chr11204 --1638 --
NM_017737chr121985 582 1164 1863 --
NM_017739chr11540 ------
NM_017740chr1641837 533 326 40 --11473 --
NM_017742chr1851575 1365 1322 1226 548 --2759 422 --
NM_017748chr173782 339 39 ----195
NM_017752chrX3789 565 470 1280 --1596
NM_017753chr92872 43 --11006 --
NM_017754chr6124718 4546 4280 3809 1924 1764 1344 658 629 421 318 153 11315 13944 --
NM_017758chr1741165 1122 1002 375 ------
NM_017769chr1463139 2531 2179 1168 772 65 ------
NM_017784chr33986 355 25 ------
NM_017787chr1032678 92 82 --12323 --
NM_017791chr141395 1356 ----
NM_017799chr142256 41 --21808 265 --
NM_017805chr19----150 --
NM_017811chr972698 2294 2224 2139 2000 1171 362 1750 1235 --
NM_017812chr71154 --1629 --
NM_017813chr8115773 5522 5260 4950 4596 1967 1572 1253 1014 945 347 21350 314 ----
NM_017816chr4----151 --
NM_017824chr1042452 2152 614 66 --1768 --
NM_017845chr41659 ------
NM_017847chr13844 732 204 ------
NM_017848chrX104189 3949 3733 3725 3639 3011 1805 1454 1269 506 --11145 --
NM_017849chr242934 2638 2471 880 22667 1981 ----
NM_017866chr82738 129 --1804 --
NM_017873chr951021 922 793 451 191 --12081 --
NM_017896chr2042508 2400 2162 269 23551 468 23516 2876 --
NM_017902chr10115503 5127 4338 4274 4139 4019 1843 1649 1020 765 398 --34722 4385 4209 --
NM_017910chr2------180
NM_017915chr1211042 1185 ----
NM_017919chr9155695 5429 5410 5087 4868 4710 4311 3752 2101 2044 1590 1560 786 706 587 --35172 4046 2080 1350
NM_017921chr1731748 833 490 1721 ----
NM_017922chr141634 ------
NM_017935chr42280 49 ------
NM_017938chrX52016 1639 1531 748 320 ------
NM_017944chr1153145 1006 807 424 270 11224 ----
NM_017945chr35939 859 292 149 76 145 ----
NM_017953chr13951 784 35 1280 ----
NM_017954chr751716 1668 1496 658 638 ------
NM_017958chr232925 2037 1154 22851 1947 12587 --
NM_017964chr23852 647 47 ------
NM_017974chr221182 390 --11058 1282
NM_017988chr122166 95 ------
NM_017994chr782966 2916 2867 2178 773 445 325 272 1724 12750 --
NM_018003chr152402 350 11880 ----
NM_018027chr1022203 1060 12388 ----
NM_018030chr182136 83 --1800 --
NM_018045chr122273 763 --22917 794 --
NM_018046chr561910 1801 1758 1615 1225 565 ------
NM_018054chr16199 --134 --
NM_018061chr151779 1418 663 182 161 ------
NM_018070chr11408 1205 1530 --
NM_018084chr232614 2549 1296 21333 683 ----
NM_018086chr251684 1532 1405 317 83 11749 31561 1515 1508 --
NM_018092chr1651597 1365 1225 575 72 --11069 --
NM_018107chr143712 679 295 --2723 66 --
NM_018120chr83236 138 52 ------
NM_018121chr1092696 2672 2528 2191 1195 875 860 219 55 ------
NM_018133chr311732 ------
NM_018137chr11430 --11054 --
NM_018155chr35914 855 704 582 310 1453 --1884
NM_018156chr132516 1947 412 ------
NM_018157chr1272874 2705 2210 960 952 840 241 12041 ----
NM_018167chr144975 785 618 48 ------
NM_018171chr123859 845 328 ------
NM_018178chr131711 771 277 1415 1202 --
NM_018179chr12139 ------
NM_018181chr1841763 1707 698 124 ------
NM_018182chr1751725 699 537 276 89 ------
NM_018184chr351414 836 807 319 21 11855 ----
NM_018191chr1341956 1909 838 203 21591 121 ----
NM_018195chr1182170 1954 1928 1511 1324 690 484 148 125 ----
NM_018200chr1532634 2568 272 22145 32 ----
NM_018206chr16289 30 ----175
NM_018211chr121671 198 ------
NM_018221chr22409 384 ------
NM_018227chr472709 2023 1967 1101 914 770 106 --11251 --
NM_018240chr1------153
NM_018243chr493864 3632 3464 2528 1344 1115 915 839 786 43477 2506 951 806 22976 1615 --
NM_018247chr662150 1913 1014 428 291 167 ------
NM_018254chr152262 1994 1662 555 35 11623 ----
NM_018266chr33996 333 178 ------
NM_018272chr12----1208 --
NM_018279chr1242670 917 122 64 22431 139 ----
NM_018287chr1031360 393 42 ------
NM_018293chr382676 2287 2067 2032 1984 1910 581 220 21940 421 ----
NM_018299chr853260 3046 2672 869 253 ------
NM_018307chr173946 696 356 ------
NM_018315chr4------1625
NM_018322chr651122 1051 983 841 130 --21284 875 --
NM_018327chr2081384 1307 519 443 393 317 225 215 1547 --11860
NM_018330chr1021544 1378 176 ----
NM_018339chr921776 364 ------
NM_018343chr51121 ------
NM_018351chr1284569 4233 3923 3870 3792 3237 902 726 1412 23175 535 13317
NM_018362chr1153364 2505 1085 594 450 12457 33955 2767 880 --
NM_018364chr12708 529 2434 133 23657 3466 --
NM_018368chr62294 97 ------
NM_018371chr811287 ----21137 85
NM_018373chr1476390 5849 4491 3985 1850 1194 44 24752 2574 ----
NM_018374chr784496 4337 4185 4170 1915 1285 1175 118 34257 653 620 --11959
NM_018388chrX31143 85 33 1326 ----
NM_018403chr363976 3903 1588 483 177 145 13271 1329 --
NM_018409chr452933 2683 2582 2125 572 2861 511 ----
NM_018424chr951479 1379 618 497 52 1683 124 --
NM_018425chr1062462 2392 2239 1004 262 147 ----1674
NM_018426chr63396 146 118 ------
NM_018427chr1651295 1153 442 413 135 ------
NM_018429chr53455 184 47 22623 787 ----
NM_018439chr1852655 2479 2040 948 505 42580 1914 1615 54 1741 --
NM_018440chr8118450 8317 7228 6676 6475 5658 2170 1907 1471 830 810 47939 6730 3293 490 ----
NM_018444chr832130 692 88 11476 ----
NM_018448chr123936 904 110 21236 196 1153 --
NM_018452chr6_random53265 2773 2635 1533 1363 12529 12688 1913
NM_018469chr173437 403 151 21507 540 --1431
NM_018471chr2172 ------
NM_018482chr852572 2136 1952 707 435 32525 1761 269 11580 --
NM_018486chrX2133 25 ------
NM_018489chr1----11472 --
NM_018490chr1131762 530 75 ------
NM_018509chr172381 328 21725 1243 1605 --
NM_018557chr231091 634 370 21756 1696 ----
NM_018566chr194643 4285 3842 3470 3183 1387 1371 1222 63 35047 4006 1124 11610 --
NM_018569chr431284 458 296 ------
NM_018590chr102484 269 --165 --
NM_018602chr1561687 1504 1312 1068 648 300 ------
NM_018638chr12145567 5527 5059 4991 4711 4379 3820 3440 1997 1940 1685 1300 836 337 ------
NM_018640chr1292798 2760 2293 1881 1848 1130 868 695 358 ------
NM_018644chr1132222 2067 1938 --150 --
NM_018649chr101210 ------
NM_018650chr121986 1511 21501 899 11702 --
NM_018652chr15186 --145 --
NM_018667chr1621945 939 1254 12361 1239
NM_018683chr2021675 590 21200 318 145 --
NM_018686chr123329 271 80 ------
NM_018689chr1572288 2241 2234 2157 2075 1779 572 22377 663 ----
NM_018695chr552094 1753 1684 1508 542 12082 ----
NM_018700chr531717 1214 213 ----1185
NM_018704chr151831 1766 581 136 35 ------
NM_018713chr161116 863 840 716 364 192 ------
NM_018715chr162162 1934 1464 353 191 53 --11715 --
NM_018718chr752255 1530 1476 471 80 21789 1612 ----
NM_018834chr54864 414 399 359 ------
NM_018840chr201457 1475 ----
NM_018841chr183594 2847 2597 2535 1344 598 215 152 ------
NM_018844chr721831 309 12021 ----
NM_018890chr711068 1149 ----
NM_018898chr542288 1780 1537 835 ------
NM_018899chr542288 1780 1537 835 ------
NM_018900chr542288 1780 1537 835 ------
NM_018901chr542288 1780 1537 835 ------
NM_018902chr542288 1780 1537 835 ------
NM_018903chr542288 1780 1537 835 ------
NM_018904chr542288 1780 1537 835 ------
NM_018905chr542288 1780 1537 835 ------
NM_018906chr542288 1780 1537 835 ------
NM_018907chr542288 1780 1537 835 ------
NM_018908chr542288 1780 1537 835 ------
NM_018909chr542288 1780 1537 835 ------
NM_018910chr542288 1780 1537 835 ------
NM_018911chr542288 1780 1537 835 ------
NM_018945chr673166 2252 1335 1131 1061 982 482 ------
NM_018948chr13544 519 58 11174 11183 --
NM_018951chr721202 29 ------
NM_018958chr1573479 2976 2946 856 570 328 83 13810 ----
NM_018959chr191532 ------
NM_018963chr2131467 465 271 ------
NM_018970chr721139 710 --11008 --
NM_018976chr1282282 1856 1843 1000 695 256 93 74 22002 536 ----
NM_018979chr1242276 1868 918 811 12427 12076 --
NM_018981chr231235 1036 909 ------
NM_018992chr1641259 1172 643 259 ------
NM_018999chr1094420 4245 4172 4140 3513 1112 823 591 545 34596 3654 1621 1865 --
NM_019001chr394091 3822 3552 3174 3155 1745 1501 791 39 13912 11386 --
NM_019004chr752308 1981 1650 1545 583 42356 919 562 282 --1476
NM_019006chr152643 168 ------
NM_019008chr2253806 3583 3487 1474 1027 23129 879 12838 13772
NM_019022chr1873120 2506 2404 1165 1140 825 479 12070 1918 12342
NM_019027chr472092 2067 1907 1682 243 210 158 --1951 --
NM_019028chr11------1431
NM_019035chr481966 1950 1836 1694 783 514 422 29 ------
NM_019036chr61829 ------
NM_019042chr741244 1104 1060 987 ------
NM_019049chr13662 632 187 ------
NM_019050chr432268 2159 581 ----11819
NM_019059chr72444 373 ------
NM_019060chr1----1315 --
NM_019063chr231474 722 115 ------
NM_019071chr7199 ------
NM_019072chr5104264 3539 3284 3224 3192 2939 2705 1686 284 271 --23775 3457 --
NM_019074chr154750 383 317 297 1979 1637 1180
NM_019079chr11636 1900 185 --
NM_019080chr1341479 1010 344 49 1456 ----
NM_019084chr101357 1480 --11923
NM_019088chr191322 --185 --
NM_019091chr22879 797 ------
NM_019094chr1263605 3438 3032 2608 500 151 33122 2364 600 ----
NM_019095chr201191 ------
NM_019098chr861697 1163 716 425 301 241 ------
NM_019106chr2241255 878 730 223 --12176 1904
NM_019114chr952573 2400 2364 2235 1007 ------
NM_019116chr1683534 3299 3137 2753 1386 1199 938 815 --1165 --
NM_019117chrX22823 154 22793 1230 11136 12814
NM_019555chr321342 265 163 ----
NM_019556chrX41259 1249 1136 77 ----11275
NM_019590chr1041485 1431 1243 509 174 --1596
NM_019591chr125834 820 729 320 154 ------
NM_019593chr2053048 2626 990 621 567 22368 2000 1138 --
NM_019597chrX1732 ------
NM_019610chr162169 1664 836 727 267 140 1862 --31841 1816 345
NM_019848chrX2121 21 ------
NM_019859chr1041476 1397 1037 430 ------
NM_019860chr1041524 1445 1085 478 ------
NM_019862chr1631286 1115 597 ----11684
NM_019884chr19--1552 230 24 --
NM_019885chr252968 2958 2891 2350 1858 ------
NM_019891chr131097 949 313 ------
NM_019895chr341078 1010 851 207 ------
NM_019898chr1631286 1115 597 ----11684
NM_019899chr1631286 1115 597 ----11684
NM_019900chr1631286 1115 597 ----11684
NM_019903chr1031613 464 159 21716 1655 11371 --
NM_020066chr12645 371 ----146
NM_020116chr421665 85 11146 ----
NM_020122chr285759 4078 2150 1783 1616 1508 186 165 15038 --11239
NM_020123chr101160 ------
NM_020130chr841267 519 261 238 ------
NM_020141chr151984 1745 1470 525 428 11990 ----
NM_020143chr2----1121 --
NM_020144chr741804 1695 1593 493 --11745 --
NM_020148chr1893121 3086 3073 2365 2334 2321 2206 1909 415 22247 147 11949 --
NM_020150chr1052004 1645 1442 1388 655 ------
NM_020151chr261809 1561 738 588 115 35 ------
NM_020152chr213904 240 155 ------
NM_020156chr71558 ----1132
NM_020157chr202823 633 ------
NM_020159chr441231 640 489 333 2564 117 1361 --
NM_020177chr552728 2353 888 438 411 ------
NM_020179chr112420 77 ------
NM_020180chr182965 393 ------
NM_020182chr2073377 3244 2925 2847 1418 1019 341 33056 3045 271 13406 --
NM_020184chr222004 427 --32120 1518 1458 --
NM_020193chr1131214 1026 344 ------
NM_020194chr23595 461 128 ------
NM_020198chr1721022 213 11312 ----
NM_020204chr13318 251 100 2760 741 ----
NM_020226chr42572 24 ------
NM_020228chr1152390 2060 1932 835 223 2702 639 ----
NM_020235chr31384 ------
NM_020239chr171960 1878 1726 1692 798 521 50 ------
NM_020240chr572766 2487 1909 1832 1795 897 280 --12542 --
NM_020245chr674874 4410 3821 3181 1871 270 220 23845 3538 ----
NM_020309chr195950 407 273 46 31 ------
NM_020336chr2043369 3265 2798 1133 13456 32703 2553 485 --
NM_020337chr422723 782 12941 1765 --
NM_020338chr1092719 2507 2449 2305 1054 894 386 359 68 --1380 --
NM_020340chr631826 815 150 21637 1452 1883 --
NM_020341chr2021635 808 11474 11610 --
NM_020342chr222427 2196 22148 269 ----
NM_020346chr1131221 195 187 --1667 --
NM_020348chr1042327 2044 1954 1937 1253 1125 --
NM_020357chr31232 ------
NM_020362chr13748 623 280 ------
NM_020381chr62724 202 --174 11784
NM_020382chr1241219 456 179 147 ----1615
NM_020390chr3104078 3764 3121 1740 1562 1223 1114 905 858 454 13205 14210 --
NM_020403chr1331773 671 102 11639 ----
NM_020416chr432694 374 296 ------
NM_020420chrY61789 1384 1204 472 408 153 ------
NM_020423chr12620 214 1538 ----
NM_020425chr622044 559 1194 1611 1163
NM_020429chr792580 2391 2309 2258 2236 2173 1232 529 413 21040 492 22180 223 --
NM_020440chr183070 2739 2516 2427 2411 2255 2075 643 --1420 --
NM_020443chr1196737 6285 5429 5330 5160 4723 2576 2434 2408 2209 1895 1519 1449 972 951 911 775 464 83 11348 22045 1284 --
NM_020449chrX2747 687 4704 656 254 212 ----
NM_020455chr662526 2162 1782 990 881 84 --21842 310 --
NM_020465chr1651977 1563 1448 1395 660 ------
NM_020466chr633212 1849 913 14868 24071 788 --
NM_020474chr1861770 1583 1488 801 392 161 11275 11544 --
NM_020482chr63795 773 680 1525 --1587
NM_020526chr121249 245 ------
NM_020640chr341768 464 198 174 1679 ----
NM_020644chr114752 333 309 101 1627 ----
NM_020645chr112627 539 --1115 --
NM_020666chr52915 675 ------
NM_020673chr20146549 6354 6345 6160 5429 5230 2562 2544 2463 2108 1467 970 190 87 15519 24766 1107 --
NM_020679chr173442 124 101 --145 --
NM_020686chr1653083 2699 1025 324 81 12162 12142 --
NM_020689chr2031385 532 253 --1565 --
NM_020692chr142418 287 194 --1750
NM_020697chr841314 1145 1114 209 --1507 --
NM_020698chr1262934 2643 2238 2030 1978 31 12359 1663 --
NM_020699chr144220 3439 1127 56 24952 195 11162 --
NM_020703chr1------1434
NM_020711chr262532 1679 1607 666 481 129 11709 ----
NM_020713chr2023184 601 ------
NM_020715chr1451777 1742 1419 699 511 ------
NM_020717chrX115035 4434 3967 3930 3707 3258 1978 1897 1603 802 55 --44151 3069 1725 198 --
NM_020718chr1696113 4643 4154 4048 2381 2319 1236 1152 907 46134 2514 2363 2273 1704 --
NM_020727chr21113993 3897 3805 3715 3518 2585 1476 1325 1079 1031 288 23743 1580 ----
NM_020728chr763165 3073 2575 2454 840 428 ------
NM_020734chr1221142 178 11073 ----
NM_020737chr6184 ------
NM_020739chr15104133 4108 4037 3985 3574 3088 2617 944 426 413 --11333 --
NM_020740chr17----1130 --
NM_020742chrX42322 699 333 193 12479 ----
NM_020748chr1721556 247 1633 ----
NM_020749chr841783 1687 1413 300 --11715 --
NM_020750chr64949 267 247 100 ------
NM_020752chr1062766 2442 1160 1039 1013 239 21955 792 ----
NM_020754chr31463 ----21356 1014
NM_020760chr271395 1328 525 257 225 128 55 ------
NM_020766chrX42914 1270 986 822 14405 ----
NM_020768chr533167 2281 482 21110 999 23011 353 --
NM_020769chrX2389 74 --2927 174 --
NM_020772chr17158060 7975 6908 5602 5378 5309 5292 2945 2633 2610 2344 1878 1759 1157 649 38423 5257 696 15937 28208 2525
NM_020774chr18136004 5781 5353 4346 4315 2348 2179 2052 1629 1058 979 845 252 --11867 --
NM_020776chr1873002 2884 2754 2189 1048 866 378 12218 2730 100 --
NM_020791chr1721336 27 ----11404
NM_020792chr351716 985 651 457 351 2840 134 11957 --
NM_020794chr161397 1358 1316 1249 1202 1160 21477 633 ----
NM_020796chr552825 2151 1162 1026 744 --12917 --
NM_020799chr10181 ------
NM_020803chr431674 468 80 ----11506
NM_020804chr65786 770 601 502 274 11007 2528 323 --
NM_020805chr1831731 1430 646 11484 1225 --
NM_020809chr1151740 1704 812 765 414 ------
NM_020821chr153604 508 153 --1209 --
NM_020824chr10----1483 --
NM_020825chr1643809 2846 2502 812 ------
NM_020830chr252421 2043 1998 896 390 12162 12848 11068
NM_020832chr1----1502 --
NM_020839chr381045 1021 488 454 425 251 136 102 11329 ----
NM_020841chr1294068 3759 3689 3434 3299 3154 3146 2733 1403 11619 --14056
NM_020844chr8106795 5572 5013 4826 4800 3023 2199 1993 1671 1040 17256 46735 2853 1397 514 --
NM_020845chr1262028 1008 858 786 776 695 --1737 --
NM_020853chr1261913 965 660 559 484 404 ----12598
NM_020854chr1841536 1123 544 252 ------
NM_020856chr1931572 375 339 21255 571 11222 --
NM_020858chr1541902 1502 914 225 ------
NM_020860chr42468 119 1402 1720 --
NM_020868chr261433 754 585 454 397 332 --11703 --
NM_020870chr431865 1590 90 1896 ----
NM_020871chrX31818 1571 426 12108 ----
NM_020872chr371761 1570 1341 1185 351 113 60 11314 ----
NM_020888chr121474 695 11927 ----
NM_020899chr1732195 788 450 12449 51020 611 594 256 26 --
NM_020917chr1923362 137 12931 1769 --
NM_020921chr14113152 2932 1374 1305 1236 1149 1029 727 577 188 120 --11332 --
NM_020922chrX41798 322 310 222 --11677 1526
NM_020925chr14942 912 563 546 ------
NM_020935chr233030 493 93 ------
NM_020940chr1041909 305 70 50 ------
NM_020943chr2----1198 --
NM_020947chr16142012 1962 1502 693 513 494 475 456 437 418 399 380 361 333 1824 11526 --
NM_020948chr1103399 3328 2999 2893 2240 1306 947 810 660 357 43563 3482 2312 620 ----
NM_020951chr1952409 1823 602 539 502 140 ----
NM_020964chr18104603 3992 3697 3562 3197 2957 2931 624 344 263 34748 4376 1045 34305 4295 3317 --
NM_020967chr203399 301 129 ------
NM_020977chr451678 1490 749 530 282 ------
NM_020981chr25791 726 507 257 71 1817 ----
NM_020983chr1252010 1818 604 462 256 ------
NM_020987chr1021208 222 ----1120
NM_020988chr1631111 1070 453 ------
NM_020993chr1292815 2802 2754 2729 2491 2448 384 286 33 12585 22322 406 --
NM_021003chr143839 629 607 ------
NM_021005chr151378 ------
NM_021007chr252349 1926 1889 1804 21 42075 722 515 222 ----
NM_021032chr331967 536 73 ----1698
NM_021033chr1363056 2813 2373 1032 463 193 12174 --1721
NM_021038chr373215 3045 2690 2216 1093 1036 435 --12767 12951
NM_021045chr1052637 1754 1052 789 126 32175 596 508 ----
NM_021069chr452021 1973 1610 1469 104 21495 475 ----
NM_021072chr542251 636 525 427 ------
NM_021076chr224545 529 429 84 ------
NM_021079chr1773293 3176 1103 1069 863 365 221 185 1749 --
NM_021096chr223837 320 190 --22961 1287 --
NM_021101chr362363 2275 1573 1550 551 223 1409 12470 --
NM_021109chrX--138 --1134
NM_021109chrX--138 --1134
NM_021110chr83769 641 261 ------
NM_021111chr921291 952 11130 ----
NM_021116chr7189052 8927 8612 7876 7864 7620 7027 6990 5959 5577 2415 2062 1948 1753 801 661 298 232 15562 28250 6667 --
NM_021120chrX42058 1261 1231 680 --12300 --
NM_021132chr102399 245 21190 96 ----
NM_021136chr141473 ------
NM_021140chrX2228 126 11022 ----
NM_021145chr721079 902 ------
NM_021148chr731977 860 240 ------
NM_021155chr1942203 2161 1979 596 --3528 492 349 --
NM_021156chr2041116 1099 316 176 ------
NM_021177chr62291 32 ------
NM_021183chrX22509 726 1738 ----
NM_021190chr12284 131 ------
NM_021202chr2052626 2576 1903 1021 352 22889 1148 32855 2330 296 --
NM_021215chr2041684 548 275 77 --31836 429 103 --
NM_021238chr123520 270 159 --21970 1317 --
NM_021249chr1421233 1210 11356 ----
NM_021252chr1041870 1412 574 436 1462 ----
NM_021255chr1483839 3778 3424 3192 2670 1228 1010 270 1685 ----
NM_021574chr2282494 2353 2132 964 761 580 509 336 --21895 477 1789
NM_021622chr1032302 62 51 21547 710 --12001
NM_021627chr31995 156 --144
NM_021629chr394338 3767 1831 1189 844 655 606 135 79 ------
NM_021633chr141324 504 452 75 ----1962
NM_021637chrX31382 1025 31 --1872 --
NM_021638chr4114985 4977 4839 4517 4448 3760 3741 3264 1536 356 174 11473 1315 --
NM_021639chr1----1337 --
NM_021644chr1011030 1311 ----
NM_021647chr4104262 3891 3258 1871 1830 1509 1410 979 929 696 44093 3369 1385 672 ----
NM_021648chr642532 1831 914 252 1386 2244 86 --
NM_021705chr64542 483 204 71 ------
NM_021738chr103666 593 204 193 ----
NM_021813chr695791 5138 4849 4775 3749 2204 1274 1078 393 35524 5445 5190 15050 --
NM_021814chr62551 133 ------
NM_021818chr1431430 1311 212 151 ----
NM_021828chr101321 --149 --
NM_021830chr103888 866 596 1141 ----
NM_021905chr652150 1478 1461 1415 154 ----12247
NM_021911chr5115107 4752 4644 3996 1986 1635 1381 1187 882 628 203 11571 13946 --
NM_021912chr1573990 3914 3804 3298 3225 3028 2698 --23845 1156 --
NM_021914chr1461855 1570 911 659 119 106 11733 21794 41 --
NM_021931chr2031098 895 287 ------
NM_021935chr31118 1297 1426 --
NM_021940chr621346 1084 ----11285
NM_021945chr673330 2923 2900 1278 694 202 147 ------
NM_021951chr94906 715 57 51 ------
NM_021954chr1363557 3283 2618 1456 1443 825 12438 23108 1469 --
NM_021956chr631572 1410 45 ------
NM_021959chr6----1365 --
NM_021960chr12789 572 --21693 1016 --
NM_021961chr11187071 6565 6414 6404 6224 5596 5408 5275 2775 2545 2291 2237 1937 1721 1690 1561 1478 415 12867 36446 4857 2041 --
NM_021962chr1741951 366 342 130 --1825 --
NM_021963chrX----1765 --
NM_021964chr3106633 6314 5793 5785 2361 2300 1621 867 662 253 36612 6004 4291 14029 --
NM_021970chr42707 119 ------
NM_021980chr1051213 974 505 479 86 ------
NM_021984chrX41456 1253 380 343 ------
NM_021987chrX41456 1253 380 343 ------
NM_021988chr2041492 1330 1125 550 21573 68 ----
NM_021990chrX41456 1253 380 343 ------
NM_021999chr132758 96 ------
NM_022037chr21325 ------
NM_022041chr1632610 2207 442 ------
NM_022048chr15105418 5186 4924 4903 3891 2104 2075 1713 1588 1194 14206 34200 4110 1305 15425
NM_022068chr181637 ------
NM_022073chr1451477 1406 1361 1255 465 --11160 --
NM_022079chr1031032 801 220 ------
NM_022085chr621034 151 ------
NM_022091chr642391 1736 898 828 1837 ----
NM_022096chr20174 ------
NM_022105chr202178 115 1597 ----
NM_022114chr144752 3982 3046 147 --13880 --
NM_022118chr13--1123 1257 --
NM_022130chr531342 286 228 ------
NM_022131chr321383 1268 ------
NM_022133chr841909 1204 753 708 11528 ----
NM_022143chr721458 1103 21312 432 ----
NM_022144chrX------1158
NM_022166chr1664248 4091 4083 3964 1029 283 14269 35634 2403 1832 --
NM_022170chr741588 597 469 411 1564 21485 229 --
NM_022171chr331570 1369 1270 --21437 335 153
NM_022173chr21325 ------
NM_022336chr252085 935 692 204 164 12034 1846 --
NM_022351chr853275 3176 2867 1381 136 ------
NM_022365chr10294 35 ------
NM_022366chr12374 86 ------
NM_022442chr2041492 1330 1125 550 21573 68 ----
NM_022454chr82354 247 ------
NM_022456chr12137597 7465 5981 5964 4871 3044 1213 981 969 962 421 301 84 47211 6130 6082 2433 14956 12495
NM_022458chr752603 354 312 209 84 --12167 --
NM_022459chr1376378 5495 5424 5223 4830 2183 1510 46279 5836 5149 266 11458 11401
NM_022461chr351095 892 276 47 24 --11220 --
NM_022465chr1252640 2456 1226 377 344 ------
NM_022467chr192441 385 ------
NM_022469chr153111 2706 2631 1048 340 22875 877 11202 12719
NM_022473chr1543898 1237 973 681 33436 2847 49 --13067
NM_022474chr1472391 1878 618 447 292 263 249 11807 ----
NM_022475chr42283 133 ------
NM_022476chr161127 2888 410 ----
NM_022477chr2021288 668 --1196 --
NM_022482chr2052377 936 451 435 404 21774 961 12130 --
NM_022484chr751311 1140 942 437 253 ------
NM_022490chr9166 ------
NM_022491chr12103280 2797 2691 2455 2386 929 585 240 207 173 ------
NM_022552chr23931 872 301 --1905 --
NM_022571chr14138 ------
NM_022650chr51310 2215 107 --1268
NM_022659chr81411 ------
NM_022716chr142596 841 580 254 21191 1123 12212 --
NM_022720chr221326 ------
NM_022728chr73782 744 227 ------
NM_022735chr121689 1565 ----1691
NM_022739chr1731002 283 61 1303 ----
NM_022748chr742551 2382 1798 138 ------
NM_022750chr7----128 --
NM_022753chr112309 1112 --1394
NM_022755chr912043 22547 606 --1701
NM_022756chr12546 26 --21490 1347 --
NM_022758chr622905 2287 22837 1082 1832 --
NM_022763chr342222 2147 815 302 ------
NM_022771chr12----1184 --
NM_022781chr943133 955 860 88 12982 11091 --
NM_022782chr12--1358 1406 --
NM_022802chr1011276 21301 650 ----
NM_022810chrX2286 42 ------
NM_022817chr241510 874 382 84 1536 1902 --
NM_022823chr22536 146 --1460 --
NM_022824chr531489 526 323 21852 715 1393 11381
NM_022826chr22954 485 ----11033
NM_022828chr531670 1530 67 1501 11387 --
NM_022831chr131854 1347 640 ----1706
NM_022838chrX198 ------
NM_022843chr1351437 1213 975 489 266 ------
NM_022844chr162793 40 2845 154 1974 --
NM_022845chr1642088 1544 407 52 --2879 304 12258
NM_022875chr51515 ------
NM_022877chr51515 ------
NM_022893chr252657 2029 765 435 50 ------
NM_022894chr241431 583 451 285 ------
NM_022898chr1484360 4296 3581 1576 1418 1261 743 650 34230 3509 3089 ----
NM_022900chr75831 442 326 272 256 ------
NM_022910chr1651977 1563 1448 1395 660 ------
NM_022912chr22874 648 2763 324 1206 --
NM_022918chr1112122 21877 391 --1764
NM_022965chr441385 1355 1220 1185 ------
NM_022970chr1041240 1119 587 555 11474 ----
NM_022977chrX62264 2045 1799 1054 471 363 12085 ----
NM_023000chr1441603 1317 312 125 11287 2608 397 --
NM_023001chr1441603 1317 312 125 11287 2608 397 --
NM_023016chr272807 2744 2553 2468 1135 688 395 ------
NM_023071chr124389 348 281 240 ------
NM_023079chr1731723 1621 1296 --11636 --
NM_023914chr351367 1175 275 44 25 1358 11266 1576
NM_023923chr163631 3341 3282 1106 220 153 --13424 --
NM_023929chr842533 1931 569 532 11731 ----
NM_023948chr71163 ------
NM_024007chr542765 2348 2127 1003 1903 13025 23160 2072
NM_024019chr43999 915 93 11053 --1434
NM_024052chr1752829 2336 2003 1948 687 1874 42663 2619 2545 1098 1289
NM_024055chr53631 578 479 ------
NM_024061chr71638 ------
NM_024076chr1932018 1887 254 21562 348 ----
NM_024077chr92762 627 ------
NM_024087chrX3625 604 521 ------
NM_024090chr411947 ----11628
NM_024095chr1231365 1213 390 ------
NM_024294chr622905 2287 22837 1082 1832 --
NM_024297chr173374 368 28 ----1396
NM_024345chr9105907 5197 5167 5048 5026 4069 3947 2079 2054 1196 14090 ----
NM_024408chr1113531 3276 2477 1242 1149 1098 1041 652 272 172 109 1376 --11312
NM_024416chr961576 1233 1048 582 535 350 ------
NM_024424chr1151250 442 279 125 59 ------
NM_024425chr1151250 442 279 125 59 ------
NM_024426chr1151250 442 279 125 59 ------
NM_024490chr151426 --1621 --
NM_024492chr651511 1493 1163 510 168 ------
NM_024503chr1256 33 ------
NM_024509chr191164 ------
NM_024511chr442444 926 642 510 1869 12376 --
NM_024524chr393021 2536 2189 1237 895 777 509 274 250 12262 ----
NM_024529chr131128 864 195 --1901 --
NM_024539chrX1864 1182 ----
NM_024545chr2179 ------
NM_024548chr341716 303 285 52 ------
NM_024551chr1222542 672 11008 12414 --
NM_024551chr1222542 672 11008 12414 --
NM_024561chr1321329 63 ------
NM_024567chr82515 292 ------
NM_024569chr132268 956 445 21994 306 21936 387 --
NM_024582chr441122 1027 848 749 ------
NM_024586chr13664 261 101 ------
NM_024595chr11238 ------
NM_024607chr894316 3984 3631 3571 3117 2868 821 801 522 --2809 105 1598
NM_024612chr1731093 840 804 --2870 57 --
NM_024613chr821361 664 2690 148 --1194
NM_024624chr271661 1462 1405 1363 1242 601 397 ----1515
NM_024626chr151540 1320 1298 570 66 1457 11445 --
NM_024631chr113571 547 140 ------
NM_024636chr742570 2021 971 746 1283 --12890
NM_024646chr153581 2560 1116 341 245 2278 238 --13904
NM_024659chr2156 ------
NM_024664chr1180 ------
NM_024665chr354327 3897 3350 3096 548 44589 3715 3641 1889 ----
NM_024670chr1081437 1269 1206 1170 670 515 508 98 ------
NM_024689chrX81489 740 728 587 494 421 244 46 ------
NM_024700chr121011 303 1920 ----
NM_024702chr175643 608 557 511 52 --1204 192
NM_024704chr2031050 395 227 1153 2447 413 --
NM_024719chr13152 --177 --
NM_024740chr1174132 3955 3578 1662 1656 992 534 ----11095
NM_024744chr232167 2095 606 1158 ----
NM_024751chr432020 1609 273 ------
NM_024753chr22591 56 ------
NM_024755chr152818 786 1710 ----
NM_024757chr941141 1039 815 738 180 ----
NM_024761chr9115231 4097 3963 3894 3494 2075 1354 1191 1182 489 377 34478 3462 3294 --24755 291
NM_024770chr2126078 5571 5065 4845 4770 4722 4588 4282 4259 1743 1618 440 36498 6481 4549 15644 --
NM_024785chr22455 370 ------
NM_024786chr51957 --141 --
NM_024792chr1741229 375 157 59 ------
NM_024824chr1431675 1357 111 --1416 --
NM_024830chr56865 797 684 587 493 338 --1722 11865
NM_024834chr1031656 647 422 ------
NM_024837chr1561932 1883 1562 560 488 37 21570 1550 ----
NM_024838chr104953 757 446 269 ------
NM_024852chr13592 563 66 ------
NM_024900chr432092 1729 896 ------
NM_024900chr432092 1729 896 ------
NM_024909chr62288 130 11143 1626 1512
NM_024913chr741270 449 425 361 2578 223 ----
NM_024920chr421510 288 ----1208
NM_024926chr72247 62 --133 --
NM_024930chr582722 2425 2144 2068 2034 1102 1006 161 ------
NM_024944chr211337 --1331 --
NM_024947chr3179318 8991 8486 8417 8245 7836 7421 6477 5808 3829 3347 2725 2578 1648 1125 917 395 38580 7159 7064 19642 1153
NM_024948chr103711 673 235 ------
NM_024949chr4104910 4817 4793 4645 4393 4362 3509 3378 1229 457 34662 3312 139 13364 --
NM_024953chr1232657 1721 778 1469 1380 12094
NM_024960chr20156 ----136
NM_024989chr2117900 6926 5926 5778 2994 2371 2055 1461 1370 1360 1282 45958 2013 1338 390 ----
NM_024993chr221312 28 11417 21028 643 --
NM_025004chr111636 ------
NM_025027chr192964 179 ------
NM_025047chr34397 373 362 64 ------
NM_025054chr8104242 3681 3417 3365 2839 1425 1077 621 302 283 1860 --1243
NM_025057chr1451362 1253 844 552 347 --1321 --
NM_025073chr194654 3116 1502 1229 907 862 430 365 204 3834 456 295 ----
NM_025074chr463054 2671 2233 567 521 472 --32475 2268 2160 --
NM_025076chr21528 ------
NM_025083chr151606 ------
NM_025134chr1672188 1942 1654 907 859 515 142 ------
NM_025146chr352524 2206 2124 1962 162 ----1323
NM_025147chr231107 986 944 ------
NM_025151chr852002 1579 605 349 145 --3694 645 47 --
NM_025154chr741280 590 429 372 ------
NM_025160chr133273 2762 482 21363 630 23609 1659 13441
NM_025164chr1141806 1627 888 328 --11570 --
NM_025179chr1114281 4140 3742 3677 3486 1910 1239 1066 913 703 504 14192 21981 462 --
NM_025191chr152914 2173 990 873 377 --11256 1801
NM_025195chr831342 724 48 2393 263 ----
NM_025208chr11102378 2214 2056 2034 1763 891 857 596 564 190 12315 ----
NM_025211chr9142 --1273 --
NM_025221chr461059 470 459 418 166 48 ----1311
NM_025235chr1041989 1791 790 27 12241 ----
NM_025237chr1761565 1301 1022 543 316 140 --11416 --
NM_025238chr1541255 296 250 184 ------
NM_025239chr92381 355 ------
NM_025248chr1712712 --1325 12945
NM_025256chr6------1123
NM_030579chr16103194 2894 1257 1201 1096 979 719 399 331 253 1274 32306 939 170 11153
NM_030594chr151473 ------
NM_030621chr1483831 3689 3653 1271 1155 986 735 516 23856 2829 ----
NM_030625chr1052409 1057 1008 737 476 ------
NM_030627chr574004 3976 3812 3548 3482 2820 510 13889 ----
NM_030629chr1611933 ------
NM_030640chr122336 24 ------
NM_030647chr7176188 5942 5556 5445 5089 4977 4885 4859 4776 4684 4645 2399 1693 1444 1428 988 151 12154 21304 70 25647 5307
NM_030648chr4115289 5016 4967 4757 3660 1831 1645 1486 608 557 545 24052 362 ----
NM_030650chr253874 3705 3224 2892 2753 ------
NM_030653chr121267 --1665 --
NM_030660chr144439 412 181 37 1349 ----
NM_030664chr1022424 63 --1596 --
NM_030674chr1234727 1691 1612 35408 1972 260 15339 --
NM_030755chr1472925 2623 2466 2297 2116 999 391 21189 569 ----
NM_030758chr2261482 1264 1219 1137 453 400 11041 ----
NM_030759chr103585 506 290 ------
NM_030763chrX2899 229 ------
NM_030766chr122763 107 --1933 --
NM_030786chr161754 1222 450 428 280 86 11523 ----
NM_030791chr1431811 1702 572 21419 1285 ----
NM_030795chr8125 --1466 --
NM_030802chr17----2571 124 --
NM_030803chr221182 390 --11058 1282
NM_030806chr1179344 8061 7841 7706 6815 6524 5881 2441 2269 1827 1375 1078 988 402 385 294 252 58132 5732 1920 1224 124 22053 887 13499
NM_030808chr172781 381 21129 230 ----
NM_030809chr1232377 1592 935 ----1659
NM_030810chr621034 151 ------
NM_030816chr183374 3286 2776 2407 1001 836 738 88 13336 ----
NM_030817chr1243543 2826 2339 1129 23413 2708 11150 --
NM_030820chr62791 377 1322 ----
NM_030821chr42608 600 1319 ----
NM_030881chr2241987 1762 1651 828 11834 ----
NM_030885chr382352 2323 1979 1933 1848 1488 642 70 12021 --11442
NM_030915chr292407 2354 2305 1752 932 895 686 569 548 ------
NM_030918chr1135376 5289 4989 4763 4433 3721 1527 868 779 767 607 546 41 --64167 3988 1932 1310 1097 135 --
NM_030925chr1331948 779 581 11811 --11336
NM_030938chr1731107 282 93 ------
NM_030939chr621170 81 ------
NM_030953chr551309 1038 472 448 232 11401 --11558
NM_030958chr81382 --1503 --
NM_030959chr63359 93 42 1169 ----
NM_030962chr1121404 430 1177 1520 --
NM_030981chr1131218 916 260 ------
NM_031208chr162985 911 ------
NM_031216chr1851891 1857 1382 876 775 ------
NM_031217chr112132 68 ------
NM_031262chr921147 983 ------
NM_031263chr921204 1040 ------
NM_031266chr52358 165 ------
NM_031268chr16125335 4936 4610 4594 3690 3606 3453 3293 2105 1920 915 79 --13932 24690 1126
NM_031271chr871603 1109 611 583 458 208 45 2639 598 ----
NM_031305chr471890 1757 1748 1650 1528 1184 338 --11673 --
NM_031314chr1431425 180 74 ------
NM_031362chr282558 2417 2371 1776 627 486 188 89 22522 813 ----
NM_031365chr282694 2553 2507 1912 763 622 324 225 22658 949 ----
NM_031366chr282694 2553 2507 1912 763 622 324 225 22658 949 ----
NM_031369chr42198 51 --1724 --
NM_031370chr42198 51 --1724 --
NM_031371chr141078 393 274 207 --1251 --
NM_031371chr141078 393 274 207 --1251 --
NM_031411chr542288 1780 1537 835 ------
NM_031412chr1231082 840 795 1159 ----
NM_031417chr1912532 --2592 203 2329 234
NM_031418chr1162819 2764 2051 1913 675 344 --32624 1844 290 --
NM_031427chr1475814 5004 2333 1902 602 574 523 24094 1998 25502 4589 15353
NM_031431chr1331805 1553 1331 1440 ----
NM_031435chr1242332 1367 856 778 ----1801
NM_031442chrX73235 2497 2380 1028 542 397 235 13155 ----
NM_031445chr2113231 3205 3094 3029 1242 1204 1196 1168 478 127 96 ------
NM_031461chr851802 1766 1423 480 286 1258 11904 21996 1964
NM_031468chr7157583 7101 7048 6667 6109 6040 5885 3300 3242 1523 1438 604 490 399 258 11158 16518 12989
NM_031469chr684091 3611 2650 2597 1607 895 719 613 13040 ----
NM_031483chr2083389 3306 1303 1250 969 261 175 163 12777 ----
NM_031492chr112160 94 --1206 --
NM_031844chr123099 721 33292 253 95 12955 --
NM_031845chr2103217 3147 1459 1306 1243 749 666 363 300 189 1738 11071 --
NM_031847chr2103217 3147 1459 1306 1243 749 666 363 300 189 1738 11071 --
NM_031849chr542288 1780 1537 835 ------
NM_031857chr542288 1780 1537 835 ------
NM_031860chr542288 1780 1537 835 ------
NM_031866chr102366 298 ------
NM_031889chr461944 1781 1677 1244 696 373 1327 1495 1205
NM_031890chr2272921 2357 2072 794 781 451 425 12114 160 --
NM_031892chrX3325 252 162 ------
NM_031935chr12737 66 21057 25 ----
NM_031992chr741588 597 469 411 1564 21485 229 --
NM_032012chr9165051 4532 4236 4057 3914 3723 3671 3493 3374 1982 1345 1216 1063 773 295 82 34110 3639 1042 2501 457 --
NM_032013chr2021288 668 --1196 --
NM_032015chr112860 787 ------
NM_032027chr1155 ------
NM_032042chr592883 2274 1901 995 954 819 462 455 435 1527 ----
NM_032047chr332431 1697 27 12331 ----
NM_032102chr1152903 2894 1245 752 128 ------
NM_032121chrX22687 2195 ------
NM_032138chr13131 ----1538
NM_032139chr191318 11053 196 --
NM_032144chr221284 1159 ----1600
NM_032145chr611783 11752 ----
NM_032147chr121404 --1290 --
NM_032149chr42183 27 ------
NM_032153chr342324 1095 1061 815 --22204 693 --
NM_032160chr1864234 4011 3804 3575 1728 411 12858 32750 1471 744 --
NM_032174chr141140 589 511 370 ------
NM_032181chr21211 ------
NM_032186chr121218 974 11023 ----
NM_032189chr1354585 1979 1471 1328 633 --24019 3268 --
NM_032192chr171125 --1475 --
NM_032193chr1121918 71 --1271 --
NM_032195chr211325 ------
NM_032199chr10103785 3228 3055 2884 2663 2416 599 480 219 100 1748 12969 --
NM_032208chr293510 2873 2776 2539 1216 914 625 618 64 11391 ----
NM_032217chr441323 889 554 92 ------
NM_032228chr1163272 3205 2721 2308 1346 942 2778 512 ----
NM_032229chr1321148 1002 ------
NM_032231chr151131 ------
NM_032239chr441186 990 945 395 ------
NM_032246chr153901 365 338 11301 ----
NM_032268chr1652960 2675 2450 2219 136 12032 ----
NM_032270chr1----139 --
NM_032271chr1621420 301 --21314 1126 --
NM_032272chr82482 313 ------
NM_032288chr32546 495 12386 ----
NM_032291chr141834 1567 193 137 ------
NM_032295chr721431 573 41235 1093 262 31 1524 --
NM_032312chr22854 327 ------
NM_032321chr283276 2753 2708 2465 2417 1099 865 170 11059 12597 --
NM_032352chr1421022 918 2949 358 1997 --
NM_032353chr173444 51 42 ------
NM_032358chr125716 538 488 482 254 ------
NM_032360chr1183 --146 --
NM_032373chr10125898 4947 4839 4694 4461 2124 2115 1649 1608 1495 1046 781 35266 4294 376 25132 1233 11040
NM_032410chr851273 871 452 198 106 21283 851 1964 --
NM_032420chr54798 350 292 191 ------
NM_032434chr241524 1404 145 90 ------
NM_032435chr111846 --11931 --
NM_032436chr133873 284 119 127 1682 --
NM_032438chr641422 657 390 361 ------
NM_032439chr1051080 464 199 141 90 11657 ----
NM_032440chr1022784 2617 12016 ----
NM_032445chr1561721 945 815 692 670 590 ------
NM_032446chr573828 3811 3787 2685 1134 84 39 ------
NM_032449chr152303 1816 652 253 188 --1564 11954
NM_032457chr473652 3029 1504 1118 770 755 175 21467 699 --1324
NM_032458chrX53460 2998 996 853 396 ------
NM_032466chr821699 1271 1559 ----
NM_032468chr821699 1271 1559 ----
NM_032488chr19131 ------
NM_032491chr122329 299 11310 1910 --
NM_032494chr21566 ----1153
NM_032505chr352550 2426 1080 788 591 22570 846 1977 --
NM_032510chr1831757 1635 133 22416 832 12345 --
NM_032517chr101156 ------
NM_032547chr421182 1174 --1440 1161
NM_032552chr91287 11746 11546 --
NM_032557chr42884 205 ------
NM_032558chr941095 564 438 351 --1926 --
NM_032569chr1681931 1766 1589 1498 1386 686 387 360 ------
NM_032578chr1041532 449 197 77 --1501 --
NM_032581chr731427 778 82 ------
NM_032582chr1741396 1328 453 218 1553 1686 --
NM_032590chr123132 116 78 ------
NM_032595chr1751189 1096 1015 450 90 ------
NM_032599chr72461 152 --1568 --
NM_032631chr191156 ------
NM_032632chr1431616 1580 1508 --11661 --
NM_032663chr1251346 589 507 362 105 --2649 462 --
NM_032682chr3103603 2765 2586 2522 1084 973 780 516 196 117 --1623 --
NM_032711chr1763669 3397 2732 1716 1696 1137 --13051 11516
NM_032728chr92918 342 ------
NM_032737chr1952675 2618 2539 585 566 1411 ----
NM_032765chr54721 345 184 55 ------
NM_032772chr10----1203 --
NM_032777chr811181 ----11418
NM_032784chr62799 199 ------
NM_032786chr121599 ------
NM_032796chrX2304 183 --1152 --
NM_032800chr161909 896 585 354 219 44 ------
NM_032801chr1121980 1973 1992 --12308
NM_032804chr103970 909 385 21958 1728 1275 --
NM_032810chr101557 ------
NM_032829chr1211141 --1752 --
NM_032833chr172472 2130 1046 705 642 628 313 1617 --22597 2211
NM_032837chr1782099 1756 814 687 630 444 420 317 12046 11996 --
NM_032839chr31421 ------
NM_032840chr1221044 1000 --1738 --
NM_032842chr741480 574 186 39 --11208 --
NM_032859chr1373112 1532 822 677 425 211 189 --13254 --
NM_032864chr121501 455 ------
NM_032866chr1553203 3088 2848 2540 709 23067 284 --12012
NM_032867chr113491 431 176 ------
NM_032870chr62503 407 ------
NM_032873chr1184529 4159 3357 3142 3111 3035 1823 441 13629 --22807 128
NM_032875chr17149 ------
NM_032880chr11100 ------
NM_032892chr151261 ------
NM_032900chr1042934 1196 531 318 --23560 741 --
NM_032905chr1031029 807 123 ------
NM_032906chr43606 164 138 --1272 --
NM_032927chr4124 --1444 --
NM_032932chr1786128 5637 5108 1673 1517 1246 498 347 25468 5444 21148 396 --
NM_032936chr71160 ------
NM_032949chr131130 --1421 --
NM_032968chrX73688 2968 2688 1690 1319 590 330 ----23821 1466
NM_032969chrX73688 2968 2688 1690 1319 590 330 ----23821 1466
NM_032971chrY3955 62 52 ------
NM_032972chrY3955 62 52 ------
NM_032975chr1873274 2728 1308 1216 806 758 737 43464 2787 2380 543 21379 986 --
NM_032978chr1821010 964 1955 ----
NM_032979chr1821010 964 1955 ----
NM_032980chr1873274 2728 1308 1216 806 758 737 43464 2787 2380 543 21379 986 --
NM_032981chr1821010 964 1955 ----
NM_032983chr773376 3157 2729 2200 2125 736 21 --12338 --
NM_032991chr451540 1383 973 264 168 --1132 --
NM_032998chr151145 1053 784 211 87 ------
NM_032999chr741099 329 124 105 1957 --11156
NM_033000chr741099 329 124 105 1957 --11156
NM_033001chr741099 329 124 105 1957 --11156
NM_033014chr961576 1233 1048 582 535 350 ------
NM_033020chr1124487 4274 4020 3261 1883 1873 1659 963 875 732 610 492 11455 ----
NM_033025chr193844 638 171 1973 ----
NM_033027chr341067 768 253 216 21032 452 ----
NM_033030chr241270 634 446 147 41116 285 264 195 11163 --
NM_033055chr14845 176 76 51 ------
NM_033058chr84790 762 694 354 2618 259 ----
NM_033081chr2051155 1131 361 278 208 1158 ----
NM_033082chr12140 ------
NM_033087chr951374 1188 1038 1020 246 ------
NM_033121chr1251726 1498 1377 553 252 21504 691 --1563
NM_033122chr42227 76 ------
NM_033128chr71573 ------