TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3190-5p
miRNA Sequence: UCUGGCCAGCUACGUCCCCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr51581 ------
NM_000084chrX116222 6182 6145 5024 4622 4470 2796 2628 2285 1564 1120 16054 14310 --
NM_000090chr21641 ------
NM_000091chr252702 2208 1965 1764 1165 ------
NM_000092chr244165 4054 3023 29 1309 ----
NM_000115chr1322500 2383 ----11736
NM_000125chr653298 3080 1050 858 137 ----11370
NM_000129chr641209 450 298 54 ----11171
NM_000138chr1521692 279 ----1791
NM_000163chr542290 668 573 303 11549 11712 --
NM_000176chr553263 2985 2791 1459 962 ----11150
NM_000237chr831777 213 187 ------
NM_000248chr322725 2514 ------
NM_000276chrX51968 1580 1573 1496 501 11643 ----
NM_000280chr111334 --1799 --
NM_000289chr121391 --2144 43 --
NM_000297chr411810 ------
NM_000314chr1052223 937 633 448 374 ------
NM_000330chrX31671 906 748 1207 ----
NM_000332chr686223 6196 6049 4664 4571 4540 475 233 15780 16774 12882
NM_000334chr1742164 624 548 138 21720 313 ----
NM_000337chr576317 5677 4286 2153 1973 608 526 --21893 1344 12218
NM_000340chr321196 221 --1432 --
NM_000346chr1741239 257 231 31 --1243 11663
NM_000361chr2041523 702 341 145 ------
NM_000368chr944206 3662 3379 255 ------
NM_000401chr1111060 ------
NM_000408chr223104 593 ------
NM_000430chr1732668 618 247 ------
NM_000437chr131755 784 352 --21705 826 12105
NM_000449chr1187 --11222 --
NM_000489chrX13298 ------
NM_000503chr8----11481 --
NM_000508chr41874 ------
NM_000530chr12929 70 ------
NM_000555chrX87217 6747 5074 4883 3053 2449 1594 703 37693 5388 2148 --15128
NM_000599chr243091 2869 1845 1269 11563 1512 --
NM_000600chr72334 259 ----152
NM_000618chr1266381 4370 2360 1522 1156 941 14544 15499 16569
NM_000618chr1266381 4370 2360 1522 1156 941 14544 15499 16569
NM_000686chrX2581 35 ------
NM_000701chr11319 ------
NM_000719chr1276581 5678 2421 2015 1590 616 535 --15686 16046
NM_000722chr7186 ------
NM_000726chr221386 81 ------
NM_000756chr8----1447 --
NM_000767chr1931191 426 381 --11227 --
NM_000792chr13993 904 232 ------
NM_000793chr1444419 4078 3935 1248 1814 24753 4650 --
NM_000801chr203922 686 326 ------
NM_000807chr41658 ------
NM_000813chr553904 2007 681 547 346 --25604 586 25411 240
NM_000818chr101195 ------
NM_000826chr432290 974 899 ------
NM_000827chr511937 ------
NM_000831chr1104847 3942 2404 1831 1541 1524 1114 750 174 126 34207 1862 415 15211 --
NM_000833chr1631100 361 48 ------
NM_000834chr1231163 867 494 ------
NM_000855chr111232 ------
NM_000875chr15136809 6440 6049 5997 5542 4772 4706 4592 4404 2164 1841 1549 894 25106 1645 12361 14760
NM_000880chr81119 ------
NM_000891chr173552 514 90 --11013 154
NM_000922chr111331 --1379 --
NM_000926chr1167839 7807 3712 3218 2361 1257 26996 889 159 --
NM_000944chr42524 130 ------
NM_000950chrX42861 2453 2283 1341 ------
NM_000983chr121641 1630 ------
NM_001001331chr31831 ------
NM_001001344chrX32448 2221 836 ----1681
NM_001001433chr2032641 2145 649 11165 --13066
NM_001001481chr812843 ------
NM_001001484chr10--1921 ----
NM_001001521chr2137 ------
NM_001001557chr82525 229 --11791 --
NM_001001852chr221679 1795 --147
NM_001001890chr2153953 3438 1568 161 143 1911 --11635
NM_001002257chr213258 1244 --11326
NM_001002269chr92473 207 ------
NM_001002762chr1042127 1980 888 85 1764 --12790
NM_001002860chr1434077 1773 756 ------
NM_001002909chr1721788 30 --1383 11772
NM_001002919chr21480 ------
NM_001003652chr1838583 3178 2970 26854 5870 ----
NM_001003674chr1837057 2809 1438 34581 2246 361 12387 --
NM_001003675chr1837057 2809 1438 34581 2246 361 12387 --
NM_001003676chr113323 295 127 2952 40 ----
NM_001003712chr1233811 768 567 11370 13841 --
NM_001003792chr311063 ------
NM_001003793chr311063 ------
NM_001003800chr933250 2802 1001 1242 --2790 622
NM_001003810chr41773 ------
NM_001003940chr1553329 2863 960 490 459 32895 1195 946 43601 695 605 532 13430
NM_001003942chr1553329 2863 960 490 459 32895 1195 946 43601 695 605 532 13430
NM_001003943chr1553333 2867 964 494 463 32899 1199 950 43605 699 609 536 13434
NM_001004304chr1241145 977 854 573 12395 12713 --
NM_001004419chr122906 724 ----11685
NM_001005353chr131249 197 35 ------
NM_001005353chr131249 197 35 ------
NM_001005404chr1712876 23991 3034 1697 13446
NM_001005473chr566555 5890 5108 4093 2446 536 --15537 --
NM_001005474chr31575 --125 --
NM_001005732chr21--1542 ----
NM_001005746chr221386 81 ------
NM_001005747chr221386 81 ------
NM_001005845chr811213 ------
NM_001005920chr162394 251 11028 1225 11044
NM_001006617chr941431 1131 1049 104 1242 ----
NM_001006619chr941431 1131 1049 104 1242 ----
NM_001006620chr941431 1131 1049 104 1242 ----
NM_001006621chr941431 1131 1049 104 1242 ----
NM_001006623chr232299 208 114 ----12368
NM_001006636chr2------1995
NM_001007023chr1444419 4078 3935 1248 1814 24753 4650 --
NM_001007024chr1774059 3573 1318 1223 1173 1157 1007 13826 1153 --
NM_001007025chr1774059 3573 1318 1223 1173 1157 1007 13826 1153 --
NM_001007097chr954633 4236 1985 1757 1324 ----13135
NM_001007102chr621533 447 ----11036
NM_001007237chr132470 1794 29 1789 ----
NM_001007245chr71227 ------
NM_001007246chr2121475 595 ------
NM_001007466chr664337 3638 1296 1192 916 71 --13806 --
NM_001007559chr18--11586 11824 11916
NM_001008220chr573596 3229 1018 946 853 420 246 12478 2513 131 13464
NM_001008222chrX41306 1143 878 506 1491 1431 --
NM_001008239chr18--12934 13548 --
NM_001008392chr353200 2313 1171 634 131 11109 12826 --
NM_001008541chr1011739 2838 145 ----
NM_001008541chr1011739 2838 145 ----
NM_001008701chr1952433 2228 1006 749 38 12077 --12331
NM_001008707chr143690 318 66 ------
NM_001008738chr512473 --12008 --
NM_001008925chr423286 1350 ------
NM_001009552chr81217 ------
NM_001009554chr444119 3561 2965 1634 ------
NM_001009554chr444119 3561 2965 1634 ------
NM_001009555chr421361 1257 11171 ----
NM_001009899chr355492 5312 2136 1489 432 --12181 25567 2318
NM_001009958chr71173 ------
NM_001009993chr284220 4184 2982 2809 1685 1367 1279 1239 34173 2971 1534 23172 739 --
NM_001010854chr142738 106 ------
NM_001010861chr132516 848 384 ------
NM_001010867chr196366 5712 4434 4366 1822 1250 1157 1014 676 12382 45955 2186 2021 322 --
NM_001010888chrX33562 1429 194 --2618 211 --
NM_001010891chr596783 6417 4933 4385 4189 1754 1747 1484 22 15380 25666 881 --
NM_001010908chr10155 ------
NM_001010924chr101895 ------
NM_001010927chr6------1199
NM_001010942chr1221173 1015 ------
NM_001010986chrX2946 164 --12020 --
NM_001011537chr312087 ------
NM_001011538chr42924 837 --2860 763 --
NM_001011666chr724197 1490 16512 ----
NM_001012426chr662271 1163 842 823 412 133 1806 12750 1427
NM_001012427chr662271 1163 842 823 412 133 1806 12750 1427
NM_001012751chr10------1405
NM_001012756chr1912631 --12541 13176
NM_001012974chr62104 73 ------
NM_001012989chrX--1202 ----
NM_001013031chr1042544 1167 552 522 12839 32491 2364 513 --
NM_001013415chr41321 --11204 --
NM_001013437chr181344 ------
NM_001013439chr31254 ------
NM_001013620chr1257011 6320 3384 2985 679 27944 823 1477 --
NM_001013635chr122837 120 ------
NM_001013693chr152224 2076 494 193 106 --32510 2148 912 --
NM_001013693chr152224 2076 494 193 106 --32510 2148 912 --
NM_001014380chr1321365 1067 --15392 --
NM_001014445chr17--1336 1716 --
NM_001014797chr1067624 2277 859 595 536 59 --17354 22426 479
NM_001015877chrX12069 1464 --12024
NM_001017368chr171200 --170 11009
NM_001017424chr11135 ------
NM_001017425chr11135 ------
NM_001018050chr22123475 3212 3053 2984 2418 1340 1195 934 910 874 567 126 32585 1351 959 33002 1299 53 --
NM_001018052chr22123475 3212 3053 2984 2418 1340 1195 934 910 874 567 126 32585 1351 959 33002 1299 53 --
NM_001018053chr11281 2439 82 ----
NM_001018054chr141354 918 435 271 ------
NM_001018065chr9105707 5650 5242 4986 3881 2342 2082 1441 987 749 ----21329 110
NM_001018066chr9105707 5650 5242 4986 3881 2342 2082 1441 987 749 ----21329 110
NM_001018067chr153753 3684 947 904 462 ------
NM_001018068chr153753 3684 947 904 462 ------
NM_001018069chr153753 3684 947 904 462 ------
NM_001018074chr553263 2985 2791 1459 962 ----11150
NM_001018075chr553263 2985 2791 1459 962 ----11150
NM_001018076chr553263 2985 2791 1459 962 ----11150
NM_001018077chr553263 2985 2791 1459 962 ----11150
NM_001024094chr553263 2985 2791 1459 962 ----11150
NM_001024226chr12157 106 ----1779
NM_001024227chr12157 106 ----1779
NM_001024228chr12157 106 ----1779
NM_001024401chr1632315 2203 1837 12624 12696 --
NM_001024455chrX42226 1060 484 306 ------
NM_001024463chr1521011 210 11074 1223 --
NM_001024680chr211647 11626 ----
NM_001024845chr14414 269 131 73 --1108 --
NM_001024858chr1452933 2543 2066 561 118 21195 797 2824 500 --
NM_001024934chr62227 78 ------
NM_001024935chr62227 78 ------
NM_001024936chr62227 78 ------
NM_001024948chr123181 2308 ------
NM_001025077chr1057111 6634 6492 6138 620 ------
NM_001025105chr511266 ------
NM_001025107chr112477 --32142 197 84 --
NM_001025107chr112477 --32142 197 84 --
NM_001025108chr21985 1257 ----
NM_001025266chr364358 4261 4009 1741 844 567 11874 24455 590 --
NM_001025580chrX23222 3111 ----11116
NM_001025603chr1187 --11222 --
NM_001025780chr911074 ------
NM_001029858chr642436 1138 1088 41 ----12989
NM_001030006chr1732371 624 565 ----12499
NM_001030055chr1421349 658 ----13473
NM_001030272chr111330 ------
NM_001030273chr111330 ------
NM_001030287chr161063 1048 822 456 393 245 ------
NM_001031680chr152043 1676 1598 242 68 31801 925 874 ----
NM_001031695chr2242027 1269 1130 55 ------
NM_001031732chr433032 2831 2695 ------
NM_001031740chr161501 1479 1360 673 456 55 1450 ----
NM_001031812chr532196 1855 1747 ------
NM_001032393chrX----1141 --
NM_001032999chr2094494 4387 3619 2023 2001 883 815 683 410 24617 4133 44624 3348 3258 1568 --
NM_001033047chr432465 383 108 1117 ----
NM_001033081chr121710 390 ------
NM_001033082chr121710 390 ------
NM_001033117chr384456 4448 4192 3775 3681 3674 1431 1244 --14581 --
NM_001033551chr17104010 3469 2896 1628 1398 1359 1216 1110 738 70 13106 13020 --
NM_001033557chr221286 538 ------
NM_001033566chr172865 214 --1172 --
NM_001033568chr172865 214 --1172 --
NM_001033925chr1031859 1722 292 ------
NM_001034954chr1042194 1211 692 472 11169 ----
NM_001034955chr1042194 1211 692 472 11169 ----
NM_001034956chr1042194 1211 692 472 11169 ----
NM_001034957chr1042194 1211 692 472 11169 ----
NM_001035chr11406 ------
NM_001035254chr982558 2034 2009 976 763 434 260 251 22070 493 ----
NM_001035260chr1011567 --21416 1081 --
NM_001037164chr711566 ------
NM_001037317chr132516 848 384 ------
NM_001038707chr142159 1998 1842 179 ------
NM_001038707chr142159 1998 1842 179 ------
NM_001039479chr1442405 2392 2269 1647 --22225 841 11892
NM_001039547chr3117465 7443 7377 6337 5548 5480 2484 2429 2142 2126 311 --22819 1307 --
NM_001039569chr272980 2958 2526 1269 1223 1201 1133 12411 12570 --
NM_001039570chr22123967 3272 3034 2973 1442 1420 1354 851 829 739 318 58 23705 461 34136 3833 3442 --
NM_001039571chr22123967 3272 3034 2973 1442 1420 1354 851 829 739 318 58 23705 461 34136 3833 3442 --
NM_001039574chr11858 --2929 825 1833
NM_001039590chrX176 ------
NM_001039591chrX176 ------
NM_001039690chr1652041 675 603 360 163 ----12187
NM_001039709chr2094494 4387 3619 2023 2001 883 815 683 410 24617 4133 44624 3348 3258 1568 --
NM_001039715chr13993 904 232 ------
NM_001039716chr131057 968 296 ------
NM_001039770chr32671 125 21757 885 22229 201 --
NM_001039888chr12298 231 ------
NM_001039937chr1343895 2627 724 105 ------
NM_001040057chr71602 1594 ----
NM_001040110chr741295 1190 1159 583 1644 --1479
NM_001040142chr232413 261 133 --1164 --
NM_001040143chr232413 261 133 --1164 --
NM_001040144chr1652041 675 603 360 163 ----12187
NM_001040146chr1652041 675 603 360 163 ----12187
NM_001040152chr723270 209 125 ----
NM_001040272chr942319 2120 251 34 ----11489
NM_001040402chr412505 22659 2423 1151 --
NM_001040429chr131639 ------
NM_001040441chr175008 4680 4545 4523 868 846 662 11211 14455 --
NM_001040446chr541987 1101 640 252 --1294 --
NM_001040619chr131513 1498 1272 ----11104
NM_001040624chr842395 1921 1872 1017 ------
NM_001040625chr842395 1921 1872 1017 ------
NM_001040626chr842395 1921 1872 1017 ------
NM_001040627chr842395 1921 1872 1017 ------
NM_001040628chr842395 1921 1872 1017 ------
NM_001040629chr842395 1921 1872 1017 ------
NM_001040630chr842395 1921 1872 1017 ------
NM_001040665chr723289 1541 --14410 14175
NM_001040708chr81874 ------
NM_001040712chr922511 1290 12433 ----
NM_001042355chr1634716 3859 1541 ----23285 572
NM_001042361chr1021106 305 ------
NM_001042364chr1021106 305 ------
NM_001042365chr1021106 305 ------
NM_001042371chr1632106 1549 1410 ------
NM_001042387chr1021106 305 ------
NM_001042388chr181677 ------
NM_001042393chr1021106 305 ------
NM_001042396chr1021106 305 ------
NM_001042397chr1021106 305 ------
NM_001042404chr1----298 44 --
NM_001042412chr1634716 3859 1541 ----23285 572
NM_001042414chr13121 ------
NM_001042473chr1021376 521 1653 ----
NM_001042479chrX62153 1395 730 708 642 528 1491 ----
NM_001042480chrX62153 1395 730 708 642 528 1491 ----
NM_001042481chr1421837 532 ------
NM_001042543chr4140 ----11412
NM_001042599chr275086 4980 2342 1279 786 572 96 --37240 5273 239 --
NM_001042601chr31713 11207 ----
NM_001042749chrX21944 1260 ------
NM_001042750chrX21944 1260 ------
NM_001042751chrX21944 1260 ------
NM_001043318chr1452819 1370 1159 1056 260 11129 2846 180 12911
NM_001044305chr6------11380
NM_001044385chr223424 1519 --12587 --
NM_001044722chr532196 1855 1747 ------
NM_001044723chr532196 1855 1747 ------
NM_001079874chr131517 799 591 ----1325
NM_001083620chr432288 973 898 ------
NM_001092chr1732140 939 913 ------
NM_001099678chr344826 4804 4736 4162 13978 15101 --
NM_001111chr112477 --32142 197 84 --
NM_001117chr1832104 1596 1533 --22272 840 --
NM_001149chr1011188 ------
NM_001167chrX56104 6082 5762 5343 2578 --35685 2060 1465 16347
NM_001173chr1421349 658 ----13473
NM_001177chr1232204 1928 1778 ------
NM_001178chr111330 ------
NM_001186chr2132358 2218 674 ------
NM_001191chr2021363 1016 11085 21098 1030 1591
NM_001198chr631843 862 470 ------
NM_001200chr202885 837 ----1296
NM_001204chr287083 6620 6546 5275 4912 4890 2304 625 17365 ----
NM_001206chr91131 ------
NM_001222chr1011402 ------
NM_001237chr42199 114 ------
NM_001237chr42199 114 ------
NM_001241chr222353 803 ------
NM_001241chr222353 803 ------
NM_001271chr1522701 360 12353 1878 --
NM_001278chr101115 ------
NM_001282chr1732371 624 565 ----12499
NM_001304chr1723520 368 1597 ----
NM_001331chr113777 539 517 ------
NM_001356chrX11003 ------
NM_001390chr1842211 1192 1160 99 --12941 12973
NM_001396chr2132302 1968 328 --1790 --
NM_001401chr921438 1133 --1350 --
NM_001402chr641809 1594 315 80 11252 31479 1393 722 --
NM_001408chr131456 1211 560 ----11402
NM_001419chr1953914 3692 3171 1697 593 11438 11254 --
NM_001420chr1983124 2903 2843 2822 2685 2379 887 769 ------
NM_001424chr162747 641 1586 ----
NM_001427chr741371 577 71 21 ------
NM_001432chr411429 ------
NM_001433chr175944 907 885 840 54 --1621 1718
NM_001438chr112530 ------
NM_001448chrX41734 1390 232 127 ------
NM_001478chr121739 1712 ----
NM_001482chr152824 287 ------
NM_001527chr664823 4674 4214 3533 3411 392 --13105 --
NM_001530chr14198 --1292 --
NM_001542chr132470 1794 29 1789 ----
NM_001543chr583833 1890 1728 1358 1333 884 758 479 13861 1425 --
NM_001550chr71227 ------
NM_001552chr1731082 909 769 ------
NM_001587chrX51968 1580 1573 1496 501 11643 ----
NM_001604chr111334 --1799 --
NM_001614chr171273 ----1504
NM_001614chr171273 ----1504
NM_001627chr341807 1752 969 824 ------
NM_001658chr12157 106 ----1779
NM_001674chr161063 1048 822 456 393 245 ------
NM_001677chr11363 --1777 --
NM_001683chr31831 ------
NM_001695chr824145 3035 22915 697 ----
NM_001701chr921185 529 ------
NM_001704chr61167 ------
NM_001709chr1121814 1089 12415 12463 1806
NM_001714chr121569 ----1560
NM_001730chr1321536 183 ------
NM_001730chr1321536 183 ------
NM_001742chr71421 ------
NM_001753chr73721 421 386 ------
NM_001754chr2153953 3438 1568 161 143 1911 --11635
NM_001755chr1622270 1407 ------
NM_001759chr1255173 4842 4560 3886 3586 --15089 --
NM_001760chr65763 688 266 177 27 --1201 --
NM_001773chr151344 375 306 269 219 ------
NM_001796chr16183 ------
NM_001854chr121546 208 ------
NM_001858chr634844 1498 1444 --11628 --
NM_001859chr963654 3632 2709 2575 602 402 1512 ----
NM_001892chr511266 ------
NM_001918chr1129293 7390 7062 6672 2448 2426 2220 1705 1683 1550 386 296 1220 27107 3438 11669
NM_001930chr19----182 --
NM_001939chrX83702 3689 3561 3186 2378 1097 1041 294 13051 ----
NM_001945chr511162 ----1881
NM_001949chr632523 370 252 21217 1089 --12210
NM_001968chr4------1199
NM_001973chr11371 --1389 --
NM_001981chr11483 ------
NM_001987chr1244282 3349 1094 30 --31146 763 466 13342
NM_002009chr1531890 1718 1106 ------
NM_002025chrX68806 8455 3292 2122 1766 65 ------
NM_002035chr1843926 3216 3194 3128 1159 ----
NM_002040chr2112486 --1280 11245
NM_002061chr131791 1769 1294 ------
NM_002063chrX31160 957 853 ------
NM_002077chr91202 ------
NM_002093chr3170 ------
NM_002112chr15----1217 --
NM_002114chr61370 ------
NM_002126chr1733212 2987 2532 --1187 1855
NM_002137chr711939 ----22134 624
NM_002138chr41773 ------
NM_002140chr91356 ------
NM_002146chr17----1363 1123
NM_002147chr171579 1789 --1749
NM_002161chr9128 ------
NM_002165chr201283 ------
NM_002187chr511051 ------
NM_002202chr51411 ------
NM_002203chr522822 147 ----11420
NM_002205chr121103 3623 351 149 --1824
NM_002210chr223462 848 ------
NM_002213chr33495 171 135 2194 49 ----
NM_002221chr162806 1858 892 454 382 253 1649 ----
NM_002222chr3161 ------
NM_002227chr111280 11001 1299 --
NM_002228chr1----1930 --
NM_002249chr1--1327 ----
NM_002254chr21256 ------
NM_002264chr364675 4440 4380 4199 3836 1455 13811 --13899
NM_002265chr17--1319 1344 1820
NM_002267chr13157 ------
NM_002268chr311893 ------
NM_002285chr21985 1257 ----
NM_002293chr152278 2254 618 543 419 --22234 444 --
NM_002309chr2252576 1186 1113 1005 458 1450 2746 143 12636
NM_002310chr586057 5835 4541 4272 2532 1997 1001 401 12054 ----
NM_002336chr1224925 3186 --24937 1747 --
NM_002359chr17123654 3342 3334 3130 2999 2992 2797 1607 1592 1578 1433 401 --23295 216 --
NM_002372chr52444 95 ------
NM_002375chr342178 2072 1812 709 ----12133
NM_002383chr163839 690 580 1659 ----
NM_002387chr564087 1957 1675 1552 1181 168 --11870 --
NM_002399chr1511102 ------
NM_002401chr1742491 2317 630 480 1999 1933 --
NM_002444chrX41834 1747 770 708 ----1255
NM_002493chr91217 ------
NM_002499chr1531975 1895 164 11989 3314 183 130 --
NM_002501chr1984141 3709 3505 1641 1240 1024 886 511 11030 13433 --
NM_002515chr1431425 647 389 --1768 --
NM_002520chr5------1256
NM_002522chr1743334 2409 1049 572 1723 21287 1211 --
NM_002526chr61171 --11634 11264
NM_002576chr1131041 930 203 --11146 --
NM_002577chr3--14064 ----
NM_002583chr12160 ------
NM_002585chr1--191 ----
NM_002607chr71405 ------
NM_002613chr1685285 5101 4310 4228 3596 866 404 61 21576 1340 15390 11846
NM_002618chr21108 ------
NM_002628chr3157 ------
NM_002629chr101647 ------
NM_002643chr2166 ------
NM_002651chr11852 ------
NM_002655chr843596 1749 1552 578 ------
NM_002657chr2013452 --22929 439 13378
NM_002698chr1952041 1159 822 372 302 1702 ----
NM_002703chr43274 62 45 11452 1240 1259
NM_002706chr21569 ------
NM_002709chr223124 2195 --11070 --
NM_002710chr12----184 --
NM_002713chr11936 ------
NM_002715chr51229 ------
NM_002717chr81588 ------
NM_002731chr12420 355 ------
NM_002734chr1752189 1556 684 402 96 ------
NM_002737chr1785823 5652 5550 4634 4112 2505 2407 545 12314 24884 1503 --
NM_002740chr332774 683 661 ----12662
NM_002742chr14157 ------
NM_002745chr2224432 734 13453 ----
NM_002747chr1831944 1270 481 1757 ----
NM_002823chr2191 ------
NM_002833chr152265 197 --131 1163
NM_002834chr1253119 3024 2985 923 532 22692 2481 21098 936 --
NM_002837chr1254501 4401 3613 3339 3204 21809 416 23249 643 24258 438
NM_002839chr922511 1290 12433 ----
NM_002844chr611081 ------
NM_002855chr1133419 2936 145 1466 11065 --
NM_002868chr1211540 --22337 387 --
NM_002874chr911638 --12496 --
NM_002906chr111553 ------
NM_002912chr6----1897 --
NM_002971chr321102 106 ------
NM_003010chr1712446 ----1211
NM_003011chr931311 1296 524 ------
NM_003034chr1247416 5439 1434 76 --26561 2546 --
NM_003045chr13104422 4368 1682 1350 1139 992 869 777 241 195 1586 23227 218 --
NM_003068chr8------1246
NM_003071chr3124 1331 ----
NM_003072chr19--1383 ----
NM_003074chr321694 231 --11854 --
NM_003081chr202896 216 ------
NM_003112chr731002 507 75 --11062 --
NM_003131chr642240 1462 482 423 11829 ----
NM_003136chr14----1354 --
NM_003140chrY2113 22 ------
NM_003150chr1732278 679 657 --11668 21743 272
NM_003156chr1121103 502 1547 1874 11062
NM_003161chr1722238 431 13145 ----
NM_003170chr171128 ------
NM_003189chr183118 2658 2480 2215 1208 1140 621 430 1614 ----
NM_003199chr1824496 2122 --11500 11222
NM_003204chr172651 142 --1467 21530 205
NM_003211chr1211320 ------
NM_003257chr151911 ----1226
NM_003270chrX1921 ------
NM_003320chr1154290 3808 3785 636 496 --24263 657 14395
NM_003339chr51554 ------
NM_003341chr32476 72 ------
NM_003342chr1742423 2153 1253 746 ------
NM_003344chr731123 265 174 ------
NM_003345chr161472 ------
NM_003348chr12--1202 ----
NM_003390chr1111026 ------
NM_003392chr321238 1072 14307 ----
NM_003400chr21193 ------
NM_003404chr2031517 1458 190 ------
NM_003405chr221677 ------
NM_003409chr181410 ------
NM_003410chrX22670 1950 ------
NM_003412chr342244 2084 897 297 ----1935
NM_003439chr762945 2617 2334 2311 2243 419 --13544 --
NM_003458chr363766 2928 2864 2815 2746 1199 --3618 396 243 --
NM_003468chr233473 3423 1203 128 --11697
NM_003483chr1242992 2579 2440 2114 --12406 --
NM_003490chr2221025 800 --1327 --
NM_003508chr71110 ------
NM_003559chr1733521 2702 2685 53744 3355 525 320 85 11427 11528
NM_003562chr171357 ------
NM_003566chr1222878 1350 ------
NM_003574chr181666 24413 2201 ----
NM_003583chr12--1499 23828 3241 13915
NM_003590chr233782 3119 1444 ------
NM_003591chr10198 ------
NM_003603chr41293 ------
NM_003618chr221041 410 ----1847
NM_003629chr143492 2832 1406 153 --11167 12658
NM_003633chr512447 ------
NM_003635chr101343 1506 ----
NM_003637chr111121 ----21565 165
NM_003663chr313229 --13197 --
NM_003673chr173142 119 83 --158 --
NM_003677chr1242085 1403 402 52 --1639 --
NM_003713chr11309 ------
NM_003762chr121452 380 ------
NM_003763chr2032641 2145 649 11165 --13066
NM_003766chr171457 --1212 --
NM_003768chr131476 224 217 11203 ----
NM_003796chr192486 479 ------
NM_003800chr612156 ------
NM_003861chr142846 186 ----11028
NM_003872chr272765 2650 2466 2028 1050 673 212 --12605 --
NM_003913chr612716 1917 1366 --
NM_003916chrX2255 54 ------
NM_003927chr181916 1906 ----
NM_003931chr62227 78 ------
NM_003948chr422589 2267 --12543 --
NM_003972chr1011205 --1480 --
NM_003975chr11300 142 ----
NM_003982chr14------154
NM_003983chr1663466 1688 1651 1581 238 133 1646 ----
NM_004019chrX1380 ------
NM_004050chr1452350 1749 156 41 24 --12110 --
NM_004055chr1182078 2039 2024 1949 1579 1500 843 836 ------
NM_004093chr1362711 2512 857 707 456 392 11288 ----
NM_004099chr91358 1311 21433 658 11536
NM_004102chr13504 459 118 ------
NM_004133chr8----12408 --
NM_004134chr5--1571 ----
NM_004136chr1523078 439 ------
NM_004156chr81217 ------
NM_004157chr31647 --152 --
NM_004161chr21145 1130 ----
NM_004162chr3------11049
NM_004171chr11128751 8587 8154 6643 5839 3707 2453 2408 2102 1894 1886 991 23037 2237 ----
NM_004175chr221221 ------
NM_004183chr112707 699 ------
NM_004193chr10----1424 --
NM_004200chr1153046 2426 2417 654 637 2711 296 1446 --
NM_004227chr792671 2599 2569 2427 2410 2298 2056 2007 1039 ------
NM_004229chrX11704 ------
NM_004235chr91117 ------
NM_004280chr62333 308 ------
NM_004296chr1483140 2553 1426 1072 1018 869 519 102 13717 13128 13590
NM_004326chr1195 ------
NM_004338chr1837057 2809 1438 34581 2246 361 12387 --
NM_004350chr152043 1676 1598 242 68 31801 925 874 ----
NM_004384chr532196 1855 1747 ------
NM_004392chr131799 ----1915
NM_004397chr11--23825 631 ----
NM_004414chr21173 ------
NM_004415chr61602 ------
NM_004420chr1172231 2154 2121 2011 1492 917 535 --1936 --
NM_004428chr11154 ------
NM_004429chrX21139 587 --31282 517 220 --
NM_004430chr842138 189 182 175 --11765 --
NM_004433chr11738 2463 79 ----
NM_004434chr143690 318 66 ------
NM_004442chr161670 1639 1483 1433 680 93 ----1389
NM_004454chr33606 216 23 ----11887
NM_004459chr172158 132 ------
NM_004481chr132277 729 633 41979 714 537 243 1803 12685
NM_004491chr1953643 3281 1692 1434 1378 23564 3372 24215 3394 13109
NM_004496chr1431050 879 376 ------
NM_004504chr22238 42 ------
NM_004514chr1751909 1875 815 724 311 ----12916
NM_004516chr1911094 ------
NM_004540chr211298 ------
NM_004575chr411222 ------
NM_004580chr1551879 1857 1368 748 571 --11791 --
NM_004586chrX85047 4193 3621 3413 1573 1551 1483 1276 ----1620
NM_004588chr1183501 3284 2878 2624 1130 1009 980 762 1699 ----
NM_004609chr20126 1381 --1208
NM_004631chr141354 918 435 271 ------
NM_004654chrY1390 --176 --
NM_004685chr1322549 2407 12417 1565 --
NM_004703chr171506 ------
NM_004709chrX41581 1414 155 71 ------
NM_004726chrX45398 4535 1757 700 25139 4655 12035 --
NM_004741chr101381 ------
NM_004756chr1961440 1124 1102 570 285 213 ------
NM_004760chr741987 1728 807 71 --1856 --
NM_004763chr221002 985 ------
NM_004774chr1733061 2524 510 132 ----
NM_004781chr131663 657 181 --31626 1559 1152 --
NM_004781chr131663 657 181 --31626 1559 1152 --
NM_004788chr1121950 942 ------
NM_004798chr2033541 3338 1300 ------
NM_004799chr11330 ------
NM_004808chr1092997 2974 2517 2377 2242 804 782 716 649 12119 ----
NM_004814chr13477 137 86 ------
NM_004815chr144962 3780 3660 1017 --13492 1577
NM_004824chr6----1309 --
NM_004834chr21682 ----1816
NM_004845chrX43862 3440 2574 2554 --13169 --
NM_004849chr611408 ------
NM_004871chr1774059 3573 1318 1223 1173 1157 1007 13826 1153 --
NM_004888chr921013 397 1950 ----
NM_004896chr1011482 --21331 996 --
NM_004898chr422017 1918 ------
NM_004901chr82222 200 ------
NM_004904chr724197 1490 16512 ----
NM_004921chr11256 ------
NM_004922chr103936 722 34 --1952 --
NM_004926chr1411757 ------
NM_004932chr52336 52 ------
NM_004947chr331899 1780 657 12173 21592 1051 --
NM_004952chr11733 ----1114
NM_004956chr744405 3115 3086 708 ----13262
NM_004958chr11743 ------
NM_004961chrX--11273 --1530
NM_004976chr1164901 4693 3522 3434 1800 931 --53162 3140 1544 1285 997 --
NM_004977chr191582 ------
NM_004978chr131521 463 257 11156 31592 1488 127 11496
NM_004985chr1254394 3178 1002 958 575 --11333 --
NM_004992chrX108222 7671 7632 6595 6489 5663 3390 3203 826 533 32590 1875 232 46425 5938 2743 659 --
NM_004992chrX108222 7671 7632 6595 6489 5663 3390 3203 826 533 32590 1875 232 46425 5938 2743 659 --
NM_004995chr1461367 1189 985 976 488 55 11485 ----
NM_005011chr741295 1190 1159 583 1644 --1479
NM_005020chr71464 ------
NM_005032chrX3959 99 55 ----1437
NM_005045chr71369 ------
NM_005087chr31254 ------
NM_005093chr2094494 4387 3619 2023 2001 883 815 683 410 24617 4133 44624 3348 3258 1568 --
NM_005095chr112042 ------
NM_005099chr121068 408 --21123 978 --
NM_005114chr4------1625
NM_005116chr20124341 3705 2855 1577 1082 751 712 691 581 243 237 27 13620 33614 1601 786 13677
NM_005121chr1713623 ----12815
NM_005134chr181677 ------
NM_005160chr2265920 5732 5441 4297 2576 145 --14575 12359
NM_005164chr1242610 567 474 193 ------
NM_005168chr211719 ------
NM_005171chr1211160 ------
NM_005180chr1021034 138 ------
NM_005188chr11106838 6826 6407 5507 5428 3070 2748 2222 817 363 16677 25055 678 11053
NM_005197chr1465847 4055 3930 2045 1992 604 ------
NM_005206chr1731274 1252 992 --137 --
NM_005215chr181613 ------
NM_005219chr531138 376 102 3648 455 185 ----
NM_005230chr12162 ------
NM_005235chr275086 4980 2342 1279 786 572 96 --37240 5273 239 --
NM_005249chr142846 683 ------
NM_005277chr41523 --1723 --
NM_005279chr21124 ------
NM_005296chrX1898 --1260 --
NM_005302chr7--124 ----
NM_005312chr962488 2388 1719 990 891 141 1850 1125 --
NM_005318chr2211108 --1460 1355
NM_005336chr251773 1680 1518 738 182 --1328 --
NM_005342chrX31967 627 180 --1975 1368
NM_005347chr931643 1454 208 ------
NM_005359chr1856503 6073 5320 4176 2240 25584 5163 26438 2284 15662
NM_005374chr1771720 757 742 721 581 400 238 --2342 302 --
NM_005386chr204756 145 134 60 ------
NM_005398chr101131 --11396 --
NM_005400chr252898 1927 734 580 234 --1553 --
NM_005436chr1022693 793 --13814 24040 987
NM_005443chr4------1389
NM_005450chr171249 ------
NM_005455chr121175 431 ----1188
NM_005461chr2021603 193 ----11692
NM_005475chr1231168 940 769 22936 315 ----
NM_005477chr1542476 1938 486 180 21965 1775 1319 11616
NM_005477chr1542476 1938 486 180 21965 1775 1319 11616
NM_005479chr1051468 1423 1086 344 285 ------
NM_005497chr17105559 5537 5217 5195 5139 4855 4313 4291 3869 425 14741 24225 4114 1831
NM_005502chr921132 621 --21211 378 --
NM_005504chr1232032 1061 96 24875 4208 15216 --
NM_005507chr111458 ------
NM_005520chr51150 ------
NM_005537chr1321043 390 --1837 --
NM_005542chr731240 595 545 ------
NM_005563chr11659 --2285 64 --
NM_005569chr222586 272 ----11438
NM_005595chr11107 --1256 --
NM_005596chr925112 523 16215 ----
NM_005600chr1--1189 ----
NM_005614chr71729 1127 ----
NM_005632chr1661001 869 433 336 296 211 --1199 --
NM_005637chr18--11586 11824 11916
NM_005647chrX52382 1207 1194 1057 136 13001 11168 --
NM_005670chr63500 372 61 11409 1436 --
NM_005690chr121128 ------
NM_005717chr11384 ----1372
NM_005720chr72248 58 ------
NM_005734chr111192 ------
NM_005735chr22562 275 1335 1795 1601
NM_005737chr242783 2634 893 697 1401 ----
NM_005738chr711566 ------
NM_005759chr221420 1403 --44596 3766 1059 743 11481
NM_005780chr131412 ------
NM_005795chr2----11902 --
NM_005808chr353200 2313 1171 634 131 11109 12826 --
NM_005813chr23947 936 406 ------
NM_005828chr17114784 4217 4202 4184 4093 4077 3522 3445 3305 1833 1277 --2155 94 11918
NM_005840chrX67682 5397 5284 5157 4956 302 16831 ----
NM_005853chr161609 ------
NM_005859chr541306 1094 622 408 ------
NM_005868chr712477 ------
NM_005876chr22595 550 --1223 --
NM_005898chr1142445 730 590 558 --146 --
NM_005901chr1838583 3178 2970 26854 5870 ----
NM_005902chr1554448 4211 4199 3016 46 13442 --13596
NM_005907chr611197 ----11442
NM_005920chr162771 1276 1226 908 805 682 23000 997 ----
NM_005933chr1142629 1121 893 404 --12335 --
NM_005941chr814160 13044 ----
NM_005955chr162004 1650 1616 1439 993 503 35066 466 79 35230 2048 862 --
NM_005962chr1011739 2838 145 ----
NM_005962chr1011739 2838 145 ----
NM_006007chr953941 3788 1575 567 81 --1369 --
NM_006011chr1521223 100 --13947 --
NM_006016chr6------1736
NM_006036chr21481 ------
NM_006037chr274665 4659 4246 4117 3534 3327 864 --1787 11373
NM_006047chr2043467 3345 3082 394 ------
NM_006095chr453749 2982 1322 1210 869 ------
NM_006096chr821336 389 1553 1255 21419 382
NM_006108chr1132334 2083 1962 --1287 --
NM_006113chr131517 799 591 ----1325
NM_006133chr115747 660 447 433 381 1645 21895 475 --
NM_006135chr131223 370 56 ------
NM_006164chr21325 ------
NM_006190chr211028 1746 ----
NM_006191chr121319 ------
NM_006196chr2----171 --
NM_006197chr82450 131 ----12202
NM_006203chr5----24150 1089 --
NM_006224chr1742350 2018 1895 41 ------
NM_006237chr1332285 1887 813 --11914 --
NM_006247chr193429 378 67 ----1184
NM_006251chr51269 13093 ----
NM_006275chr201136 --12428 12327
NM_006282chr2044613 3329 1176 616 --1198 24191 1661
NM_006306chrX55687 5037 4523 4214 3611 25406 2234 45096 4849 3881 787 15273
NM_006313chr121349 ------
NM_006315chr494533 4131 3533 3525 1634 1431 1196 1095 1037 11284 23888 3082 --
NM_006317chr5----1725 --
NM_006321chr342103 1785 748 280 1759 --1520
NM_006328chr111411 ------
NM_006333chr21264 ------
NM_006338chr1--174 --1258
NM_006352chr111902 ------
NM_006357chr2----1357 --
NM_006367chr11186 ------
NM_006372chr61488 ------
NM_006377chr951278 1199 891 794 55 11067 1476 --
NM_006380chr1734069 2842 2676 --13602 --
NM_006434chr1042194 1211 692 472 11169 ----
NM_006454chr442921 606 597 162 --1250 --
NM_006460chr172702 323 ------
NM_006465chr1532022 1922 640 1191 11897 1113
NM_006469chr111370 ------
NM_006472chr12463 315 --21177 146 --
NM_006475chr131265 ------
NM_006482chr12--1499 23828 3241 13915
NM_006489chr1431425 647 389 --1768 --
NM_006496chr111651 ----1531
NM_006504chr1022550 1914 --139 --
NM_006526chr201649 ------
NM_006529chr4131 ----11403
NM_006540chr81410 ------
NM_006595chr1121580 480 11544 11572 --
NM_006599chr1665696 3204 2219 1214 942 490 --16879 16804
NM_006603chrX21944 1260 ------
NM_006614chr32597 102 ----1741
NM_006624chr102548 494 ------
NM_006626chr922074 1836 --1703 --
NM_006629chr18------11936
NM_006646chr1322713 271 21079 812 12815 11008
NM_006650chr573596 3229 1018 946 853 420 246 12478 2513 131 13464
NM_006660chr15------1118
NM_006667chrX----11187 --
NM_006682chr742468 418 396 119 ------
NM_006690chr2092210 2155 2091 1673 867 771 309 262 97 --31464 81 38 1456
NM_006699chr121806 253 1315 ----
NM_006703chr61457 ----1348
NM_006706chr5------1660
NM_006717chr9--13193 --11120
NM_006722chr322725 2514 ------
NM_006729chrX45645 4106 1982 786 ------
NM_006738chr1553596 1024 1007 827 495 13374 23930 45 --
NM_006750chr1657680 7086 5825 2588 596 --25735 2153 1186
NM_006759chr2137 ------
NM_006764chr31443 ------
NM_006775chr632031 1176 478 ------
NM_006777chrX32810 2425 781 ----1662
NM_006788chr1861326 752 624 409 389 72 1867 --1523
NM_006805chr52424 30 ------
NM_006808chr91168 ------
NM_006815chr12158 ------
NM_006823chr8----11348 --
NM_006828chr6135 ------
NM_006838chr121568 --11483 --
NM_006852chr173627 392 199 ------
NM_006854chr731896 1876 1681 ------
NM_006856chr1221014 164 1441 ----
NM_006857chr2------148
NM_006861chr1251932 1807 1722 671 454 11873 ----
NM_006875chrX2727 54 ----136
NM_006885chr1623609 3261 ------
NM_006888chr1443384 3056 2143 958 --22346 306 --
NM_006892chr202439 336 ------
NM_006892chr202439 336 ------
NM_006899chr202254 104 ------
NM_006901chr152131 29 ------
NM_006902chr162622 2155 815 720 82 28 --12871 --
NM_006916chr2--1164 ----
NM_006920chr22737 132 --1261 --
NM_006922chr262623 2376 2313 1623 557 251 ------
NM_006924chr1754204 4172 3211 1601 742 ------
NM_006927chr1671853 1831 1375 858 462 275 148 1778 --1413
NM_006930chr51577 ------
NM_006940chr1221352 71 --11257 --
NM_006980chr7--1195 ----
NM_006981chr911015 ------
NM_007008chr2172 ------
NM_007011chr1565472 5383 5302 5252 4979 854 1499 15054 --
NM_007017chr51319 ------
NM_007023chr22807 232 ------
NM_007042chr362268 2216 975 953 427 280 ------
NM_007047chr672395 1905 697 636 256 234 169 ------
NM_007050chr2097189 6779 5522 5498 4945 3185 3101 2310 2161 11568 2713 655 --
NM_007054chr533854 3074 1258 --22851 1168 --
NM_007073chr663721 3621 1654 1590 1581 1391 1936 31547 1525 1512 --
NM_007084chr1331382 171 153 ------
NM_007124chr61566 ----11461
NM_007125chrY1374 ------
NM_007137chrX74857 4600 4588 3753 1438 822 804 --1353 --
NM_007150chrX21340 455 ------
NM_007156chrX132 ------
NM_007170chr12864 111 ------
NM_007172chr2221271 144 --12632 --
NM_007181chr191126 ------
NM_007189chr73996 241 24 --31258 1140 464 --
NM_007200chr1553596 1024 1007 827 495 13374 23930 45 --
NM_007216chr111391 ------
NM_007246chr41795 ------
NM_007249chr1328584 1283 ----1364
NM_007275chr31731 ------
NM_007285chr161357 ------
NM_007286chr541669 670 259 111 ------
NM_007294chr172156 113 ------
NM_007295chr172156 113 ------
NM_007296chr172156 113 ------
NM_007297chr172156 113 ------
NM_007298chr172156 113 ------
NM_007299chr172156 113 ------
NM_007300chr172156 113 ------
NM_007302chr172156 113 ------
NM_007303chr172156 113 ------
NM_007304chr172156 113 ------
NM_007305chr172156 113 ------
NM_007324chr11330 ------
NM_007350chr1224453 1543 --11511 14566
NM_007358chr111311 --11580 --
NM_007365chr141453 826 504 230 --2784 580 --
NM_007375chr132772 2623 824 ------
NM_012062chr121128 --1766 --
NM_012063chr121128 ------
NM_012072chr2064516 3408 764 749 476 310 ----21477 585
NM_012081chr522699 1302 --13073 --
NM_012089chr11382 11171 ----
NM_012098chr971407 1311 1125 958 63 54 31 --11072 --
NM_012104chr1151492 1004 441 242 63 ----197
NM_012104chr1151492 1004 441 242 63 ----197
NM_012120chr632721 1933 1867 ------
NM_012141chr1343895 2627 724 105 ------
NM_012158chr13------1171
NM_012160chr6------1441
NM_012164chr977528 6302 4673 2502 1600 627 154 --22412 251 --
NM_012193chr1143706 2043 1792 1097 --14131 23413 2032
NM_012199chr143706 3089 1163 166 --22991 1386 --
NM_012207chr1011039 ------
NM_012238chr1031509 1466 252 ------
NM_012249chr21462 21135 793 ----
NM_012250chr113539 167 31 --21080 138 --
NM_012252chr71449 11466 ----
NM_012259chr61572 ------
NM_012279chr551723 1334 348 337 34 11373 21992 542 --
NM_012281chr71403 --1857 --
NM_012296chr1163701 3630 1329 838 722 235 ------
NM_012300chr5260 52 ------
NM_012316chr164680 4427 4142 2030 1531 1383 --14614 --
NM_012333chr121463 1331 ------
NM_012399chr222699 645 122 --11257
NM_012402chr1151218 1196 283 212 24 --11130 --
NM_012414chr11166 ------
NM_012421chr11348 ------
NM_012425chr1022188 1901 ------
NM_012433chr21107 ------
NM_012454chr6------1199
NM_012465chr1062321 2226 429 349 334 175 ------
NM_012471chrX11311 11690 1419 --
NM_012479chr72753 191 ------
NM_012482chr11603 ------
NM_013261chr423356 948 ------
NM_013262chr61439 --11149 --
NM_013267chr123406 135 48 --1452 --
NM_013269chr1231814 833 651 ----11612
NM_013277chr121211 ------
NM_013281chr2011544 --11305 --
NM_013309chr151685 ----12086
NM_013313chr2273525 1077 958 450 428 360 115 11419 ----
NM_013372chr1522775 837 1101 12882 11291
NM_013381chr12------198
NM_013386chr11138 ------
NM_013396chr211432 ------
NM_013410chr131249 197 35 ------
NM_013417chr9128 ------
NM_013433chr1951483 459 419 369 298 ----21295 810
NM_013438chr931567 1383 1154 ------
NM_013443chr941178 884 84 67 2474 34 ----
NM_013444chrX----1797 --
NM_013447chr1953504 3413 2452 252 231 23652 1425 21515 1339 --
NM_013989chr1444419 4078 3935 1248 1814 24753 4650 --
NM_013995chrX22359 71 ------
NM_014021chr111367 --13224 --
NM_014043chr32481 147 ------
NM_014048chr1663946 1961 1919 1443 367 63 21071 471 1522 --
NM_014106chr1532871 987 730 1615 1775 --
NM_014110chr11936 ------
NM_014112chr895344 5109 4987 4951 3839 539 396 261 193 --11044 --
NM_014117chr161593 ----11891
NM_014155chr1187451 7101 6978 5215 4980 2417 2098 1305 ------
NM_014159chr3----2555 33 1257
NM_014191chr121735 ------
NM_014217chr11135 ------
NM_014240chr3103743 3647 3537 3423 3413 2975 1646 1563 1490 1320 11484 11293 12562
NM_014243chr432009 1693 810 123 ----
NM_014268chr182472 201 11010 ----
NM_014283chr111017 ------
NM_014309chr2242017 1259 1120 45 ------
NM_014325chr1232235 1453 628 11437 ----
NM_014331chr446516 1000 576 293 ----11839
NM_014352chr1121418 433 --11264 --
NM_014421chr421430 99 --1613 --
NM_014423chr534925 4402 340 --14887 --
NM_014470chr121115 ----1516
NM_014482chr21126 ------
NM_014507chr2211116 ------
NM_014554chr12----2885 502 --
NM_014572chr13143 ------
NM_014573chr1751883 1772 1199 552 334 ------
NM_014574chr1411543 ------
NM_014583chr31197 ------
NM_014615chr161434 11445 23227 989 --
NM_014630chr1563445 1166 1140 856 837 186 13652 21538 28 --
NM_014646chr1833229 523 155 --1980 --
NM_014657chr201316 ------
NM_014659chr1521011 210 11074 1223 --
NM_014661chr1093529 3453 3399 3387 3259 2443 992 400 176 13029 ----
NM_014665chr8123579 3252 3040 1378 1337 1325 1313 1141 749 691 620 581 11408 32662 2336 739 --
NM_014666chr52534 177 ------
NM_014671chr731585 239 176 ------
NM_014674chr312888 --33131 1230 516 --
NM_014682chr811673 ------
NM_014701chr151600 ------
NM_014702chr653251 2867 2142 1180 297 ------
NM_014709chr2----1150 --
NM_014720chr1011630 11263 ----
NM_014730chr1243630 1781 1626 1495 24363 4215 15156 --
NM_014730chr1243630 1781 1626 1495 24363 4215 15156 --
NM_014735chrX31789 1546 804 ------
NM_014739chr61298 --14057 13411
NM_014747chr144800 4720 534 122 13895 34636 766 643 --
NM_014751chr811556 ------
NM_014762chr142467 2222 1587 351 --142 22378 2018
NM_014772chr1873468 3177 3080 2948 2244 741 643 2395 60 1136 --
NM_014787chr132813 664 539 ------
NM_014812chr1----298 44 --
NM_014819chr512513 --11643 1572
NM_014822chr4185 ------
NM_014824chr1141943 741 456 41 --158 --
NM_014828chr1432398 1608 154 ------
NM_014830chr1253247 2966 855 842 484 1638 13216 13075
NM_014840chr1242898 2136 575 133 --1641 1757
NM_014850chr384456 4448 4192 3775 3681 3674 1431 1244 --14581 --
NM_014873chr154752 3001 1362 1015 625 --11407 --
NM_014876chr2251738 731 555 228 222 --1775 11521
NM_014877chr1727145 5573 16937 47399 6110 1594 426 --
NM_014887chr131783 ------
NM_014897chr1722375 476 --12668 --
NM_014903chr1241863 1770 515 452 ------
NM_014912chr1023299 739 ------
NM_014917chr12666 344 ------
NM_014921chr1952433 2228 1006 749 38 12077 --12331
NM_014924chr1452860 1195 1173 903 345 --22069 275 --
NM_014925chr121328 --1624 --
NM_014932chr321707 1695 ------
NM_014935chr153437 1281 1186 399 253 --23143 1115 1673
NM_014939chr1821027 488 --11210 --
NM_014946chr222196 220 ------
NM_014949chr12808 384 1698 1313 1726
NM_014951chr1032568 927 319 --1818 --
NM_014953chr1343550 3482 1299 1223 ------
NM_014964chr1752387 2125 2097 2084 669 ------
NM_014988chr432712 1981 278 --11060 --
NM_014991chr453074 3032 848 776 676 ----1885
NM_015032chr133229 161 65 ------
NM_015033chr942578 2518 2311 234 --11162 --
NM_015035chr2046044 5900 5335 4296 25983 5793 36380 1170 32 16198
NM_015039chr131735 1473 1331 11726 13531 --
NM_015040chr232883 1161 1139 --21036 510 --
NM_015042chr1554237 4131 3804 1224 151 13042 ----
NM_015046chr961935 1703 879 530 154 23 1276 ----
NM_015064chr1273491 3483 3401 3032 1056 630 342 --32868 2601 2399 22353 2211
NM_015069chr162474 128 ------
NM_015073chr1981974 1479 1361 1325 814 774 662 170 --11703 --
NM_015075chrX92157 1467 1422 1396 1385 558 499 231 166 ------
NM_015076chr622897 24 --12942 --
NM_015077chr1744354 3197 1625 1549 11787 34443 1709 1604 --
NM_015079chr1531136 630 370 1548 31093 797 73 --
NM_015091chr141118 ------
NM_015092chr1633063 1868 1602 140 --14150
NM_015093chr611266 ------
NM_015094chr22114514 4278 3426 3117 3104 2849 1475 1328 391 356 349 34578 1703 989 --13063
NM_015097chr312265 ------
NM_015100chr131810 420 225 --21966 1662 --
NM_015107chrX21624 744 1684 ----
NM_015115chr412505 22659 2423 1151 --
NM_015132chr732002 1854 377 ------
NM_015138chr1522691 304 --22505 904 --
NM_015155chr1073190 3003 2247 2062 688 490 443 ------
NM_015156chr1413582 ------
NM_015170chr821480 662 ------
NM_015171chr16193 ------
NM_015192chr2042611 2284 2046 35 ------
NM_015206chr1563467 3194 933 785 766 708 --12688 --
NM_015208chr1863950 3892 3870 3799 1060 563 ------
NM_015215chr142077 1252 985 190 --1964 --
NM_015231chr11------1778
NM_015236chr42477 168 1376 ----
NM_015247chr1634716 3859 1541 ----23285 572
NM_015271chr423804 2905 ------
NM_015284chr141825 1604 1490 496 --1768 --
NM_015288chr5123717 3327 3318 3221 2791 2608 1042 1033 890 870 784 384 12699 13732 1289
NM_015291chr141231 596 552 393 11224 --1132
NM_015299chr1433076 1444 1236 --12863 23384 398
NM_015310chr857455 6450 2890 2253 30 ------
NM_015313chr1154337 3878 1116 1081 478 --23335 3230 1666
NM_015315chr522317 359 ----11025
NM_015326chr162578 2453 2260 759 547 368 1641 ----
NM_015328chr752741 2277 1142 749 308 --1452 --
NM_015336chr1222071 384 --12258 12251
NM_015339chr202666 126 ----1321
NM_015347chr12181 1834 --1496
NM_015355chr1711733 ------
NM_015358chr2121335 146 ------
NM_015365chrX23222 3111 ----11116
NM_015385chr1042194 1211 692 472 11169 ----
NM_015393chr42611 234 23569 255 --1925
NM_015396chr311419 1375 --21000 584
NM_015455chr563668 2830 1565 575 361 78 ------
NM_015485chr11321 ------
NM_015497chr15132 ------
NM_015526chr192507 234 11347 ----
NM_015534chr11326 ------
NM_015535chr233815 1481 1173 --1510 --
NM_015550chr723444 3112 ------
NM_015564chr522530 2274 --11095 12786
NM_015569chr122975 709 ------
NM_015575chr242737 1194 464 22 ----12799
NM_015576chr332701 688 483 ------
NM_015584chr1761247 1074 1063 573 329 34 11027 --11014
NM_015601chr101768 ------
NM_015605chr1021106 305 ------
NM_015622chr73204 73 55 ------
NM_015630chr21975 ------
NM_015640chr153753 3684 947 904 462 ------
NM_015646chr1221173 1015 ------
NM_015670chr171460 ------
NM_015678chr1311136 ------
NM_015686chrX41860 1725 1551 721 --11681 1181
NM_015695chr651687 1319 682 628 116 --31745 1597 89 --
NM_015726chr141639 1508 674 378 1398 ----
NM_015840chr112477 --32142 197 84 --
NM_015841chr112477 --32142 197 84 --
NM_015850chr851897 1671 972 571 444 ------
NM_015878chr82601 54 ------
NM_015879chr18107366 7039 6843 5912 5202 3247 1447 1339 864 374 12083 11097 15552
NM_015904chr2----1189 --
NM_015906chr113995 ------
NM_015912chr841950 1743 1710 1024 --1933 --
NM_015995chr15104189 4114 3769 1939 1825 1739 1414 786 373 276 --1411 --
NM_015999chr11209 ------
NM_016010chr81146 ------
NM_016018chr842042 396 107 72 ------
NM_016019chr7--1119 ----
NM_016021chr612724 ------
NM_016032chrX41306 1143 878 506 1491 1431 --
NM_016075chr1332210 1145 978 ------
NM_016083chr643311 1568 1001 274 ------
NM_016125chr17146 ------
NM_016129chr41262 ------
NM_016132chr1523176 207 12919 ----
NM_016169chr1052266 813 459 235 212 12871 22068 26 --
NM_016221chr51428 1949 ----
NM_016227chr111017 ------
NM_016231chr1721685 1660 ------
NM_016252chr22749 377 ------
NM_016257chr153158 2734 1247 549 44 ----2237 31
NM_016272chr2251833 1721 746 606 24 ------
NM_016284chr163822 663 204 ------
NM_016287chr1158 --1301 --
NM_016315chr231797 1670 1229 --1338 --
NM_016322chr913055 ----11134
NM_016374chr1--1320 ----
NM_016374chr1--1320 ----
NM_016413chr13------1390
NM_016424chr1711240 ------
NM_016441chr212152 --1343 11488
NM_016519chr4------1147
NM_016531chr423239 763 1202 1158 --
NM_016577chr374522 4337 4089 3254 1454 1217 1197 --33483 1381 64 33381 3294 605
NM_016588chr61663 ------
NM_016598chr321104 22 ----11118
NM_016603chr51610 ------
NM_016604chr5----1117 --
NM_016605chr521709 50 --42480 1760 370 178 --
NM_016620chr121311 1183 ------
NM_016626chr1821701 711 --11391 --
NM_016628chr101306 ------
NM_016631chr211246 ------
NM_016733chr222586 272 ----11438
NM_016734chr952006 1683 1658 1319 237 --11258 11329
NM_016829chr35612 328 315 271 61 --1291 --
NM_016848chr9139 ------
NM_016929chr684326 3412 3293 3219 498 270 235 168 1575 13680 --
NM_016936chr1631727 566 437 1492 --1373
NM_017420chr1422655 1440 12752 ----
NM_017447chr2144197 3763 3596 102 11432 ----
NM_017449chr161670 1639 1483 1433 680 93 ----1389
NM_017488chr231523 1055 102 --11286 --
NM_017519chr61546 ------
NM_017522chr141354 918 435 271 ------
NM_017544chrX1852 ------
NM_017548chr31283 ------
NM_017553chr152927 440 143 ----
NM_017563chr354709 3952 684 644 383 1758 35383 969 133 --
NM_017582chr131495 1386 149 ------
NM_017590chr22101757 1747 1673 1662 928 643 513 86 76 37 2569 56 --22272 1958
NM_017596chr144184 1772 858 663 21317 587 14178 23672 1206
NM_017628chr445297 4884 4256 364 ------
NM_017633chr6--12926 ----
NM_017635chr111317 ------
NM_017637chr988020 6650 6422 6173 6104 6040 1065 138 28567 2860 2943 650 18975
NM_017650chr745085 4880 3778 121 ------
NM_017684chr1511574 1231 1616 --
NM_017693chr1321538 631 ------
NM_017704chr111672 ------
NM_017709chr154221 3920 1593 995 46 ------
NM_017719chr3--21740 1612 12474 --
NM_017737chr111890 ------
NM_017739chr11559 --154 --
NM_017744chr172169 2126 1973 620 587 420 316 --1255 --
NM_017752chrX--11898 ----
NM_017753chr9----1191 --
NM_017754chr674675 4607 3700 3253 1902 806 475 ----14454
NM_017758chr1711242 21390 1053 3972 270 181 --
NM_017762chr1532027 1606 926 1500 ----
NM_017768chr11628 ------
NM_017772chr641459 570 90 64 ------
NM_017778chr811338 ------
NM_017780chr81171 ------
NM_017787chr1022651 665 1302 --22826 2278
NM_017810chr16139 ------
NM_017813chr835851 3725 1593 --22148 1980 --
NM_017830chr42879 57 ------
NM_017848chrX33371 2840 207 11511 23324 1737 --
NM_017856chrX62153 1395 730 708 642 528 1491 ----
NM_017873chr993047 2562 2394 2034 1998 807 578 366 46 23134 2998 ----
NM_017913chr9160 ------
NM_017919chr975731 4972 4881 4618 2093 1553 108 ------
NM_017921chr1741670 1509 1484 1466 --123 --
NM_017929chr2251217 984 517 341 46 --1495 --
NM_017938chrX2492 128 --1181 --
NM_017944chr1132696 2564 1117 ----185
NM_017955chr142993 893 ------
NM_017974chr231267 1233 833 ------
NM_017994chr762902 2682 2671 2333 1950 310 --12937 --
NM_018003chr1552452 2278 2231 463 375 11603 ----
NM_018014chr2------11326
NM_018027chr1041092 617 409 390 ------
NM_018030chr18128 ------
NM_018085chr1127829 7459 6101 5080 2815 2765 2553 1661 1260 1252 1182 38 15966 16190 15522
NM_018092chr161596 ------
NM_018096chr17--1336 1716 --
NM_018116chr1------1492
NM_018121chr101781 --12817 12050
NM_018133chr33886 524 304 --11507 --
NM_018157chr1242737 2582 1277 1126 --12692 1104
NM_018171chr121816 ------
NM_018184chr322167 35 1340 11703 --
NM_018196chrX2875 44 --1273 --
NM_018197chr201257 ------
NM_018201chr941728 1597 381 262 22457 391 ----
NM_018202chr11954 ------
NM_018206chr162572 310 ------
NM_018217chr20164 ------
NM_018222chr1111206 1772 ----
NM_018247chr632858 2735 45 ----12705
NM_018254chr1----11938 --
NM_018266chr31438 1786 1365 --
NM_018299chr812843 ------
NM_018307chr172865 214 --1172 --
NM_018312chr1132129 1397 69 --11809 --
NM_018315chr41321 --11204 --
NM_018330chr101311 ------
NM_018340chr1664043 1621 1531 669 428 331 ------
NM_018351chr1244582 3627 1364 1342 13912 1528 1222
NM_018364chr133536 2684 677 ------
NM_018368chr61118 ------
NM_018374chr744617 3446 3404 1089 ----14950
NM_018393chr11185 ------
NM_018440chr8107820 7408 6628 6228 6206 6138 5352 3323 2489 1652 ----18469
NM_018445chr151196 ------
NM_018452chr6_random----11327 --
NM_018462chr31823 ------
NM_018471chr22228 175 ------
NM_018553chr1731741 1424 477 ------
NM_018557chr21447 ------
NM_018566chr124361 1626 --23132 1773 --
NM_018644chr1142133 2126 1928 1821 --1244 --
NM_018660chr862915 2812 2686 505 130 60 --1966 --
NM_018689chr155856 559 525 388 219 12135 12297 11060
NM_018717chr422040 481 21801 281 ----
NM_018718chr722045 739 --2863 794 --
NM_018847chr921218 153 ------
NM_018898chr52419 402 1825 ----
NM_018899chr52419 402 1825 ----
NM_018900chr52419 402 1825 ----
NM_018901chr52419 402 1825 ----
NM_018902chr52419 402 1825 ----
NM_018903chr52419 402 1825 ----
NM_018904chr52419 402 1825 ----
NM_018905chr52419 402 1825 ----
NM_018906chr52419 402 1825 ----
NM_018907chr52419 402 1825 ----
NM_018908chr52419 402 1825 ----
NM_018909chr52419 402 1825 ----
NM_018910chr52419 402 1825 ----
NM_018911chr52419 402 1825 ----
NM_018945chr632864 2716 1401 ------
NM_018947chr784966 4221 4199 3411 3389 3232 1786 1131 11657 23226 1751 --
NM_018963chr211335 ------
NM_018970chr743174 904 898 253 12278 ----
NM_018983chr41110 ------
NM_018999chr1031306 1136 137 --11199 --
NM_019032chr12727 528 --1172 --
NM_019045chrX------1191
NM_019046chr102616 225 ------
NM_019063chr21870 --12148 --
NM_019072chr544120 800 741 44 11373 ----
NM_019084chr102988 652 --11036 --
NM_019089chr1102869 2801 2362 2331 2315 1321 1063 503 410 103 1127 12685 --
NM_019091chr21418 --1326 --
NM_019096chr651031 730 372 102 61 --1174 --
NM_019106chr2243070 2742 2363 2346 1570 ----
NM_019594chr931068 613 286 21021 149 ----
NM_019597chrX----1141 --
NM_019842chr62427 174 ------
NM_019857chrX--1642 11706 11561
NM_019860chr10------11614
NM_019885chr222578 896 21930 85 12191 --
NM_020122chr244787 4702 4122 1193 --25721 5352 --
NM_020123chr101251 ------
NM_020137chrX1342 1131 --1458
NM_020144chr721899 1856 --11879 --
NM_020151chr231245 730 496 21324 287 2634 415 --
NM_020159chr4----1622 --
NM_020168chr152275 160 31304 936 166 1851 --
NM_020177chr553190 2760 1143 589 125 ------
NM_020178chr1711212 ------
NM_020179chr111362 ------
NM_020198chr171406 ------
NM_020225chr41142 ------
NM_020239chr142159 1998 1842 179 ------
NM_020315chr225943 904 864 838 817 ------
NM_020336chr2023578 1055 11377 12871 11183
NM_020337chr432808 945 682 ------
NM_020341chr201205 ------
NM_020342chr22994 321 ------
NM_020346chr111242 ------
NM_020381chr61692 --1736 --
NM_020384chrX2166 134 ----11268
NM_020403chr1311292 ------
NM_020405chr17104020 2903 2808 2728 1270 1052 865 736 483 345 --23524 962 11748
NM_020429chr753106 2725 398 270 37 21207 1195 ----
NM_020443chr176335 4790 4740 2753 2540 1435 959 15510 25940 1271 --
NM_020463chr221356 417 ------
NM_020466chr643404 3220 743 366 --2389 243 --
NM_020526chr131541 197 169 ----11620
NM_020532chr2172 ------
NM_020640chr322289 435 11407 ----
NM_020651chr2198 ------
NM_020654chr321407 1312 ------
NM_020682chr103197 175 107 ----1905
NM_020692chr14125 ----1981
NM_020713chr20112882 1254 1220 1129 1109 1085 1016 965 570 372 65 ------
NM_020717chrX74772 4750 4684 3449 3062 1932 1506 --41769 997 660 425 --
NM_020732chr61546 ------
NM_020738chr221440 1202 1310 ----
NM_020748chr1711971 ----11477
NM_020755chr621213 240 11350 ----
NM_020760chr21640 ------
NM_020766chrX44117 1397 442 100 --141 --
NM_020772chr1738192 7310 1857 12279 --16422
NM_020774chr1844971 1946 1166 759 --11465 --
NM_020783chr1831765 934 523 ------
NM_020791chr1711459 ----1317
NM_020801chr512373 --1438 --
NM_020805chr1831229 1200 483 1666 ----
NM_020807chr1641536 1299 491 453 21138 212 ----
NM_020808chr1----1718 --
NM_020809chr1131674 1472 525 1276 ----
NM_020819chr611234 ------
NM_020821chr1511574 1231 1616 --
NM_020841chr1233811 768 567 11370 13841 --
NM_020845chr1261817 727 684 511 363 43 --21706 52 --
NM_020850chr1662913 2786 2385 2207 2096 930 11200 1833 23080 1286
NM_020854chr1811529 ------
NM_020870chr41879 --199 --
NM_020871chrX22501 2200 ------
NM_020895chr19--1324 ----
NM_020899chr1751733 1596 869 249 143 1852 ----
NM_020925chr111177 ------
NM_020940chr10--1455 ----
NM_020948chr11576 ------
NM_020956chr19154686 4560 4324 4238 3611 3557 3512 3298 3038 2880 1359 1347 830 803 27 34108 3964 3292 ----
NM_020962chr1542156 1836 302 67 1331 1352 --
NM_020981chr21175 1206 1635 --
NM_020987chr1011188 ------
NM_021005chr15--1231 ----
NM_021007chr232413 261 133 --1164 --
NM_021033chr1322554 1021 ------
NM_021069chr41293 ------
NM_021097chr211915 ------
NM_021120chrX42917 893 774 748 22187 786 --12484
NM_021132chr101550 ------
NM_021140chrX2434 390 ------
NM_021148chr721891 991 --12400 --
NM_021183chrX31668 283 24 ------
NM_021190chr111292 ------
NM_021191chr1222262 1003 ------
NM_021194chr11110 ------
NM_021229chr121848 ------
NM_021614chr5149 ------
NM_021627chr31390 ----11182
NM_021629chr344910 3278 3256 1784 1640 13190 --
NM_021644chr1011039 ------
NM_021647chr444119 3561 2965 1634 ------
NM_021728chr141883 ------
NM_021813chr655488 4101 3846 845 611 ------
NM_021814chr611254 ------
NM_021911chr553904 2007 681 547 346 --25604 586 25411 240
NM_021914chr143948 825 373 ----1367
NM_021940chr6------11380
NM_021943chr651781 1735 517 494 479 --1260 --
NM_021945chr693123 2814 2552 2407 2298 1083 1013 871 246 --1365 --
NM_021947chr1731240 494 108 ------
NM_021949chrX52743 2516 1870 1131 62 ----1976
NM_021956chr611032 ------
NM_021959chr62681 59 ------
NM_021961chr1132858 2388 2183 16398 16922 11530
NM_021962chr1732140 939 913 ------
NM_021965chr941375 891 466 292 11038 ----
NM_021984chrX--11273 --1530
NM_021987chrX--11273 --1530
NM_021990chrX--11273 --1530
NM_022048chr15116198 5884 5238 4432 2494 2404 1600 1344 856 185 151 --12089 --
NM_022062chr1161963 1551 1468 1438 777 240 ----1522
NM_022079chr101768 ------
NM_022123chr142103 27 1207 ----
NM_022166chr1654189 2306 761 149 124 11042 12357 --
NM_022334chr221002 985 ------
NM_022455chr51272 ------
NM_022469chr112112 --1967 13153
NM_022474chr1432384 2186 1057 ------
NM_022483chr531743 1721 681 ------
NM_022497chr363798 3124 3027 1434 608 212 22739 577 1427 --
NM_022552chr2--21059 286 ----
NM_022648chr233455 444 24 11249 33868 3435 3382 1890
NM_022716chr142466 1999 659 564 --12715 --
NM_022719chr2263260 2852 1368 1298 1017 754 51423 1304 1218 156 103 43452 1529 1272 954 --
NM_022726chr61505 ------
NM_022728chr7128 ------
NM_022731chr1198 ------
NM_022739chr171909 ------
NM_022749chr82405 314 11098 2392 325 --
NM_022763chr332895 1125 435 ------
NM_022781chr922605 2394 --12569 --
NM_022821chr12434 358 --1110 --
NM_022823chr2159 ------
NM_022842chr352921 2888 2639 2588 1108 ------
NM_022893chr22862 386 ------
NM_022912chr21790 ----11217
NM_022918chr1131859 1505 551 ------
NM_023016chr242319 2282 1765 151 1514 ----
NM_023071chr123785 763 234 ------
NM_023076chr1662681 2644 2540 1043 1021 791 --22773 2243 --
NM_023105chr851897 1671 972 571 444 ------
NM_023106chr851897 1671 972 571 444 ------
NM_023110chr851897 1671 972 571 444 ------
NM_023111chr851897 1671 972 571 444 ------
NM_023927chr5------196
NM_023929chr822377 414 ------
NM_024007chr512634 ------
NM_024025chr82120 21 ------
NM_024054chr71325 ------
NM_024061chr71173 ------
NM_024090chr421337 651 --11734 --
NM_024107chr174828 682 273 85 --1746 167
NM_024117chr941431 1131 1049 104 1242 ----
NM_024293chr24801 584 526 249 --2861 49 --
NM_024295chr831633 494 81 ------
NM_024306chr163745 338 289 --2210 98 1957
NM_024332chrX31547 1124 451 ------
NM_024336chr161351 ------
NM_024345chr985231 4184 2163 1609 1543 856 266 158 --12067 --
NM_024348chr91275 ------
NM_024430chr1821459 31 --21826 1505 --
NM_024511chr443384 3362 3297 2453 --22295 522 --
NM_024524chr312589 11100 ----
NM_024563chr531820 1312 81 ------
NM_024567chr8--1249 --1558
NM_024607chr874195 1672 1650 1039 1017 951 81 ------
NM_024612chr171947 --1101 --
NM_024613chr8135 ------
NM_024617chr9131 ----1889
NM_024631chr112238 129 1166 ----
NM_024639chr622224 1947 1934 ----
NM_024646chr164020 3700 3144 2801 2735 876 1315 11336 23288 2703
NM_024657chrX2604 204 1236 ----
NM_024659chr2------1995
NM_024674chr152919 2833 2520 1085 92 11114 ----
NM_024685chr121212 ------
NM_024721chr812443 1425 ----
NM_024740chr111140 --23745 3135 --
NM_024770chr246450 1980 1915 644 ----16385
NM_024785chr241435 574 516 277 1338 1263 11466
NM_024798chr1552606 2507 2469 2427 2326 --1665 11795
NM_024834chr1021303 539 1326 11953 --
NM_024873chr441071 1063 771 129 --1794 --
NM_024881chr1963095 1140 1118 1052 577 287 13555 23141 461 --
NM_024884chr1421836 1083 --21129 360 14225
NM_024887chr151484 712 239 151 139 ------
NM_024947chr327461 679 17009 38257 8212 7506 --
NM_024949chr434711 1974 680 ------
NM_024953chr1222139 1914 --1618 --
NM_024979chr134651 453 368 120 ----11391
NM_024989chr256677 2746 2338 1563 47 --12383 --
NM_024991chr1042194 1211 692 472 11169 ----
NM_025054chr853227 2923 1445 726 159 ------
NM_025073chr143540 3344 3206 1093 --14065 11659
NM_025076chr21578 ------
NM_025079chr1--1215 ----
NM_025133chr221167 129 ------
NM_025134chr1622071 578 ------
NM_025146chr322682 1028 ------
NM_025160chr1--12808 --23014 820
NM_025219chr2062163 1527 845 361 327 44 1415 --22270 23
NM_025222chr33886 628 43 1551 ----
NM_025243chr262058 1906 1780 1483 1348 784 1853 11393 --
NM_030594chr15150 ------
NM_030627chr523600 822 ------
NM_030648chr474492 2098 2078 2065 1944 957 711 --1383 --
NM_030650chr254077 4006 1340 1081 907 ------
NM_030664chr10--1921 ----
NM_030670chr1231542 1524 168 --11617 --
NM_030671chr1231542 1524 168 --11617 --
NM_030756chr101121 ------
NM_030759chr101271 ------
NM_030761chr122030 350 12160 --12533
NM_030786chr111313 1682 --1182
NM_030791chr1411205 182 ----
NM_030803chr231267 1233 833 ------
NM_030806chr1159109 8412 8108 7464 7267 7091 7078 6960 6877 6857 3101 2756 2151 1897 1744 17231 12797 --
NM_030884chr342178 2072 1812 709 ----12133
NM_030885chr322080 1454 --12128 --
NM_030918chr195361 5166 5107 4589 1984 1020 811 661 122 ----14817
NM_030949chr611373 ------
NM_030962chr112305 189 ------
NM_030964chr542695 2517 997 614 180 13115 --
NM_031216chr1812149 ------
NM_031243chr711939 ----22134 624
NM_031262chr92454 299 ------
NM_031263chr91356 ------
NM_031268chr1685285 5101 4310 4228 3596 866 404 61 21576 1340 15390 11846
NM_031283chr2186 ------
NM_031362chr242628 2134 1891 1091 ------
NM_031365chr242764 2270 2027 1826 ------
NM_031366chr242764 2270 2027 1826 ------
NM_031369chr41773 ------
NM_031370chr41773 ------
NM_031371chr1--1320 ----
NM_031371chr1--1320 ----
NM_031411chr52419 402 1825 ----
NM_031417chr1952480 2401 2151 346 180 22630 689 --11924
NM_031419chr31575 --125 --
NM_031431chr131248 ----11839
NM_031442chrX12677 --12859 --
NM_031445chr273392 2725 2100 842 322 48 38 ------
NM_031452chr15176 ------
NM_031461chr822147 783 ------
NM_031469chr633332 1061 153 ------
NM_031476chr161641 1553 12257 1536
NM_031483chr2062392 2281 1144 1087 740 618 --12787 --
NM_031849chr52419 402 1825 ----
NM_031857chr52419 402 1825 ----
NM_031860chr52419 402 1825 ----
NM_031890chr2282763 2587 2501 2372 1865 872 385 127 --12323 --
NM_031936chr12144 41 1661 191 --
NM_031954chr12----42063 1896 1835 1111 --
NM_032012chr954188 3417 2071 2001 1584 --23660 1416 --
NM_032041chr842395 1921 1872 1017 ------
NM_032047chr332252 1917 461 ------
NM_032052chr22----21308 1241 --
NM_032116chr1321365 1067 --15392 --
NM_032121chrX42615 1036 1014 342 ------
NM_032124chr181166 ------
NM_032139chr191300 1840 ----
NM_032144chr211477 1458 ----
NM_032153chr312767 ------
NM_032160chr181282 --13816 --
NM_032186chr121311 1183 ------
NM_032189chr1394140 4011 3966 2005 1707 1659 738 440 105 14131 14236 --
NM_032193chr1141801 1455 698 604 --31871 770 401 --
NM_032199chr1021541 37 --23356 331 11236
NM_032213chr221021 279 1382 21094 328 --
NM_032281chr1983124 2903 2843 2822 2685 2379 887 769 ------
NM_032288chr312087 ------
NM_032289chr541726 1359 259 52 --11410 --
NM_032312chr2--1199 ----
NM_032329chr273875 3254 3147 2762 1308 672 297 --33768 3701 119 13157
NM_032373chr1043960 3892 2050 1930 15856 ----
NM_032374chr1481678 1579 1290 1271 1246 1203 669 197 --21612 305 --
NM_032438chr621533 447 ----11036
NM_032445chr1522094 889 --22387 915 12059
NM_032449chr142568 2546 1920 757 --32627 1828 306 --
NM_032457chr423944 432 ------
NM_032458chrX12399 1794 12207 12354
NM_032505chr342608 2120 2067 811 --1882 --
NM_032557chr4129 ------
NM_032560chr14----1316 --
NM_032582chr1721520 1466 --1646 --
NM_032590chr121987 ------
NM_032682chr333492 2462 1247 --12342 --
NM_032711chr17123654 3342 3334 3130 2999 2992 2797 1607 1592 1578 1433 401 --23295 216 --
NM_032786chr12149 --1416 --
NM_032804chr101712 1197 ----
NM_032810chr103963 948 180 ------
NM_032818chr952275 1938 1916 475 179 --11785 --
NM_032846chr141607 --1594 --
NM_032859chr1321241 509 11549 ----
NM_032873chr1143079 1575 1334 996 ------
NM_032876chr1441762 888 348 70 22117 137 151 --
NM_032924chr7--1729 ----
NM_032975chr1842211 1192 1160 99 --12941 12973
NM_032980chr1842211 1192 1160 99 --12941 12973
NM_032993chr41110 ------
NM_033020chr113995 ------
NM_033082chr12162 ------
NM_033133chr1743139 2879 2513 441 1890 11372 --
NM_033136chr5----21595 413 1140
NM_033137chr5----21595 413 1140
NM_033161chr971822 1690 1668 770 222 41 28 1622 ----
NM_033181chr643311 1568 1001 274 ------
NM_033222chr91956 ------
NM_033224chr765157 5147 5089 2582 1082 1001 --16800 153
NM_033225chr842729 2317 2077 1997 ------
NM_033274chr582339 1304 1129 983 346 329 91 63 ----12599
NM_033281chr5----1174 --
NM_033285chr831392 1362 403 --14341 --
NM_033290chrX31467 686 622 ------
NM_033300chr141354 918 435 271 ------
NM_033326chr11----12402 --
NM_033360chr1254515 3299 1123 1079 696 --11454 --
NM_033389chr173974 467 107 11890 43907 3766 3057 607 --
NM_033429chr1542386 2092 1252 883 1452 1948 --
NM_033449chr521671 483 --11388 --
NM_033495chrX--1864 ----
NM_033503chr1553329 2863 960 490 459 32895 1195 946 43601 695 605 532 13430
NM_033551chr522317 359 ----11025
NM_033631chr133369 3309 83 13774 --1167
NM_033632chr41321 --11204 --
NM_033644chr5260 52 ------
NM_033645chr5260 52 ------
NM_033656chr2175828 4377 2128 2117 1267 562 529 ------
NM_033668chr10149 ------
NM_052832chr811055 ----12859
NM_052864chr42475 367 12148 ----
NM_052879chr1223555 59 13938 ----
NM_052899chr53964 220 199 2728 381 ----
NM_052900chr811714 ------
NM_052906chr22124617 3956 3806 3746 3196 1920 1496 1472 1242 934 302 74 33328 1565 366 14105 11212
NM_052910chr131434 --21618 761 --
NM_052918chr1042743 1366 751 721 13038 32690 2563 712 --
NM_052934chr121562 259 --21521 671 1787
NM_052937chr822576 925 --1940 --
NM_052961chr6--127 ----
NM_052978chr142704 177 --1628 1755
NM_053016chr957872 7103 6670 2067 886 16584 ----
NM_053024chr31379 ------
NM_053042chr42593 516 12331 ----
NM_054016chr11555 ------
NM_054016chr11555 ------
NM_054016chr11555 ------
NM_054025chr1142133 2126 1928 1821 --1244 --
NM_057159chr921438 1133 --1350 --
NM_057178chr171200 --170 11009
NM_057749chr811082 ------
NM_058241chr222253 703 ------
NM_058241chr222253 703 ------
NM_078625chr651298 1021 228 170 143 ------
NM_080491chr1163701 3630 1329 838 722 235 ------
NM_080597chr18128 ------
NM_080629chr121546 208 ------
NM_080630chr121546 208 ------
NM_080738chr131858 1731 1444 ----1507
NM_080759chr131799 ----1915
NM_080760chr131799 ----1915
NM_080867chr1433269 3259 651 --13767 23204 714
NM_080872chr843874 2623 1254 383 --134 --
NM_100264chr101306 ------
NM_100486chr101306 ------
NM_130385chr1153141 2623 2583 2553 2494 ------
NM_130391chr922511 1290 12433 ----
NM_130392chr922511 1290 12433 ----
NM_130393chr922511 1290 12433 ----
NM_130434chr15138 ------
NM_130435chr1022550 1914 --139 --
NM_130436chr2132302 1968 328 --1790 --
NM_130438chr2142879 2545 905 234 --11367 --
NM_130439chr1011739 2838 145 ----
NM_130439chr1011739 2838 145 ----
NM_130446chr364177 3442 1270 610 588 181 14204 11315 --
NM_130811chr202896 216 ------
NM_130847chr1145712 1863 1544 1277 --25797 1801 --
NM_133170chr2097189 6779 5522 5498 4945 3185 3101 2310 2161 11568 2713 655 --
NM_133264chr1753751 3743 3161 2836 1529 ------
NM_133329chr221691 500 ----11161
NM_133370chr433032 2831 2695 ------
NM_133372chr512473 --12008 --
NM_133634chr2121453 1184 --11657 1190
NM_134447chr192486 479 ------
NM_138270chrX13298 ------
NM_138286chr1944306 3854 3300 1403 12678 23955 1313 12747
NM_138338chr22123475 3212 3053 2984 2418 1340 1195 934 910 874 567 126 32585 1351 959 33002 1299 53 --
NM_138457chr662271 1163 842 823 412 133 1806 12750 1427
NM_138473chr121511 ------
NM_138479chr12664 235 21902 763 11918 --
NM_138558chr11936 ------
NM_138559chr2------11316
NM_138578chr2021363 1016 11085 21098 1030 1591
NM_138638chr143948 825 373 ----1367
NM_138713chr1665696 3204 2219 1214 942 490 --16879 16804
NM_138714chr1665696 3204 2219 1214 942 490 --16879 16804
NM_138727chr172169 2126 1973 620 587 420 316 --1255 --
NM_138728chr172169 2126 1973 620 587 420 316 --1255 --
NM_138811chr721130 834 ------
NM_138927chr213768 373 117 ------
NM_138971chr1151492 1004 441 242 63 ----197
NM_138971chr1151492 1004 441 242 63 ----197
NM_138972chr1151492 1004 441 242 63 ----197
NM_138972chr1151492 1004 441 242 63 ----197
NM_138973chr1151492 1004 441 242 63 ----197
NM_138973chr1151492 1004 441 242 63 ----197
NM_138992chr2111104 ----1182
NM_139276chr1732278 679 657 --11668 21743 272
NM_139283chr1222448 945 --1109 12494
NM_139321chr2043617 3382 613 268 ------
NM_139323chr2031517 1458 190 ------
NM_144568chr141488 ------
NM_144571chr497031 6044 6033 1667 1313 1247 1124 636 86 ------
NM_144579chr242715 2698 2608 1010 22454 904 32535 491 460 --
NM_144582chr272539 2465 2398 2048 1032 370 285 1784 11668 12149
NM_144599chr1555409 3548 1448 1322 57 1924 11726 14223
NM_144609chr172276 127 ------
NM_144610chr17130 ------
NM_144642chr32260 217 ------
NM_144664chr1111944 ------
NM_144703chr2061146 876 822 798 490 96 1989 ----
NM_144726chr511042 ------
NM_144767chr1553596 1024 1007 827 495 13374 23930 45 --
NM_144775chr1744934 4340 3753 1324 24452 905 ----
NM_144778chr1311681 ------
NM_144967chrX1136 ------
NM_144973chr1231721 1699 873 --11302 --
NM_144982chr123671 529 86 ------
NM_145052chrX1412 --1818 --
NM_145055chr18--12934 13548 --
NM_145113chr1441085 1025 291 268 1576 11393 --
NM_145185chr19111928 1714 1697 1589 1411 312 293 200 69 45 34 ----11258
NM_145206chr1042853 2199 679 66 ----12232
NM_145207chr485016 4674 4480 3487 1289 907 584 457 11170 14816 --
NM_145307chr101856 13788 ----
NM_145320chr723444 3112 ------
NM_145321chr723444 3112 ------
NM_145322chr723444 3112 ------
NM_145349chr1791911 1740 1603 1528 1470 880 791 574 270 ----1906
NM_145350chr1751263 1092 410 232 143 1510 --1258
NM_145686chr21682 ----1816
NM_145687chr21682 ----1816
NM_145698chr1021376 521 1653 ----
NM_145799chrX42584 882 214 207 11055 21231 331 --
NM_145808chr712024 ------
NM_145861chr131858 1731 1444 ----1507
NM_147147chr663721 3621 1654 1590 1581 1391 1936 31547 1525 1512 --
NM_147156chr10----1141 --
NM_148174chr82601 54 ------
NM_148912chr72115 93 --125 1429
NM_148921chr1752387 2125 2097 2084 669 ------
NM_152253chr2264039 3794 3577 3252 2944 631 --13038 --
NM_152261chr1221824 1777 ----1873
NM_152265chr11201 ------
NM_152275chr21371 --1626 --
NM_152277chr521681 291 ------
NM_152280chr123424 3161 --23140 431 --
NM_152330chr1421837 532 ------
NM_152344chr1741435 364 124 75 ----11392
NM_152371chr191718 1640 1565 1426 656 610 537 425 404 21993 713 11466 --
NM_152380chr13538 214 133 ----161
NM_152384chr2131622 1606 1573 1557 1524 1446 1398 1382 1271 1255 425 195 175 --1585 --
NM_152388chr223424 1519 --12587 --
NM_152409chr552682 987 965 263 23 ----13127
NM_152414chr8----1413 --
NM_152446chr142689 348 --1288 --
NM_152450chr1541910 1802 1428 48 ------
NM_152484chr1911337 ------
NM_152520chr2131 ----1300
NM_152574chr91122 ------
NM_152588chr1211846 ------
NM_152594chr1532117 700 247 ------
NM_152621chr4--1358 ----
NM_152622chr531233 777 734 --12897 --
NM_152624chr546715 6069 5195 5007 --25261 1913 --
NM_152660chr11329 ------
NM_152678chr342721 2204 866 401 --11697 11789
NM_152699chr343419 2393 823 676 13446 32888 2303 1125 13693
NM_152713chr111226 ------
NM_152721chr181175 ------
NM_152724chr1022188 1901 ------
NM_152749chr72871 428 ------
NM_152789chr71602 1594 ----
NM_152838chr2043467 3345 3082 394 ------
NM_152854chr202610 187 ----1213
NM_152860chr122600 137 ----1535
NM_152890chr13831 359 112 --138 --
NM_152919chr1953504 3413 2452 252 231 23652 1425 21515 1339 --
NM_152924chr1565472 5383 5302 5252 4979 854 1499 15054 --
NM_152989chr1221352 71 --11257 --
NM_152996chr131465 1322 268 ------
NM_152999chr723289 1541 --14410 14175
NM_153038chr21724 ------
NM_153184chr3158 ------
NM_153223chr531592 551 262 ------
NM_153234chr522152 2128 22841 43 ----
NM_153341chr11119 ------
NM_153365chr422734 250 22350 173 12436 --
NM_153456chr1375287 4417 3870 2085 1228 1093 883 25891 1249 ----
NM_153464chr191687 ------
NM_153487chr6114528 4084 3876 3863 3756 3615 3194 3125 3078 169 107 --21828 857 1482
NM_153607chr521162 1029 ----22719 26
NM_153619chr1531457 1355 409 ------
NM_153645chr2221271 144 --12632 --
NM_153759chr2--21059 286 ----
NM_153810chr1024325 4218 --14801 --
NM_153812chr152174 1565 824 645 595 12242 12236 --
NM_153828chr2172 ------
NM_153836chr231387 286 181 --11847 1560
NM_170674chr1511102 ------
NM_170675chr151778 ------
NM_170676chr151778 ------
NM_170677chr1511102 ------
NM_170706chr131735 1473 1331 11726 13531 --
NM_170731chr1121814 1089 12415 12463 1806
NM_170732chr1121814 1089 12415 12463 1806
NM_170733chr1121814 1089 12415 12463 1806
NM_170734chr1121814 1089 12415 12463 1806
NM_170735chr1121814 1089 12415 12463 1806
NM_170751chr6----1309 --
NM_170752chr6----1309 --
NM_170775chr5149 ------
NM_170782chr1--1327 ----
NM_172058chr8----11481 --
NM_172059chr8----11481 --
NM_172060chr8----11481 --
NM_172070chr21231 ------
NM_172071chr122902 1692 1104 ----
NM_172127chr41652 ------
NM_172169chr1011402 ------
NM_172170chr1011402 ------
NM_172171chr1011402 ------
NM_172173chr1011402 ------
NM_172315chr1511102 ------
NM_172316chr1511102 ------
NM_172337chr141883 ------
NM_172344chr221691 500 ----11161
NM_172349chr51272 ------
NM_173054chr71369 ------
NM_173065chr1103070 2745 2574 1033 990 383 371 351 309 42 2942 671 33383 3117 693 --
NM_173172chr2248 42 ------
NM_173177chr21264 ------
NM_173198chr911015 ------
NM_173200chr911015 ------
NM_173214chr1665696 3204 2219 1214 942 490 --16879 16804
NM_173359chr321178 103 ------
NM_173468chr426107 2281 ------
NM_173470chrX22381 1957 12118 22214 1139 --
NM_173473chr1062146 1848 1826 1663 386 318 ------
NM_173495chrX42426 1857 1804 598 ------
NM_173500chr1511342 ------
NM_173508chr131239 1049 100 --1832 --
NM_173511chr211085 ----1788
NM_173543chr33674 193 48 ----126
NM_173552chr3147 --1951 --
NM_173582chr1165096 1657 1539 1326 144 107 16063 15850 1154
NM_173602chr1283328 3196 3118 2456 2385 1128 105 64 ------
NM_173642chr1128998 8186 8045 6204 3253 2795 2773 2702 2452 2198 1647 769 18207 12429 --
NM_173666chr511148 ------
NM_173694chrX21012 230 --12086 --
NM_173797chr5----11126 --
NM_173800chr531409 955 320 11425 ----
NM_173822chr22794 96 ------
NM_174856chr202254 104 ------
NM_174890chr101753 ------
NM_174911chr853687 3585 2899 2490 780 1420 12553 --
NM_174916chr1522210 2117 11667 11820 --
NM_174934chr1152729 1416 673 648 250 22690 1235 21389 204 --
NM_175061chr721812 1767 ------
NM_175610chr151911 ----1226
NM_175629chr2--21059 286 ----
NM_175736chr12116358 5855 1243 1151 1034 930 922 743 260 249 73 47572 7041 4766 2552 23039 389 --
NM_175748chr1432015 1578 526 ------
NM_175848chr202439 336 ------
NM_175848chr202439 336 ------
NM_175849chr202439 336 ------
NM_175849chr202439 336 ------
NM_175850chr202439 336 ------
NM_175850chr202439 336 ------
NM_175852chr162873 2773 2408 2265 2197 153 12373 2612 454 --
NM_175854chr1322569 32 ------
NM_175856chr51621 ------
NM_175859chrX--1642 11706 11561
NM_175861chr1235110 2402 1592 ------
NM_175863chr61546 ------
NM_175876chr13883 526 262 ------
NM_175898chr152497 447 --11376 11162
NM_176792chr1051171 1039 550 415 184 1191 1543 --
NM_176815chr322111 147 --11078 --
NM_177402chr11704 1854 ----
NM_177414chr11309 ------
NM_177441chr174828 682 273 85 --1746 167
NM_177969chr21569 ------
NM_177972chr1154290 3808 3785 636 496 --24263 657 14395
NM_177990chr201205 ------
NM_177999chr9103610 3125 2957 2597 2561 1370 1141 929 609 444 23697 3561 ----
NM_178010chr1221352 71 --11257 --
NM_178013chr1422560 2030 --2913 171 129
NM_178037chr1273491 3483 3401 3032 1056 630 342 --32868 2601 2399 22353 2211
NM_178038chr1273491 3483 3401 3032 1056 630 342 --32868 2601 2399 22353 2211
NM_178140chr531943 214 87 --22448 879 --
NM_178151chrX87217 6747 5074 4883 3053 2449 1594 703 37693 5388 2148 --15128
NM_178152chrX87217 6747 5074 4883 3053 2449 1594 703 37693 5388 2148 --15128
NM_178153chrX87217 6747 5074 4883 3053 2449 1594 703 37693 5388 2148 --15128
NM_178424chr5156 ------
NM_178439chr23454 423 83 ------
NM_178498chr1113689 --1659 11259
NM_178505chr1033015 2899 1012 129 --12414
NM_178539chr12----11513 --
NM_178554chr323581 1356 23200 43 1929 --
NM_178582chr2051279 1257 1193 1116 47 --11028 --
NM_178585chr453074 3032 848 776 676 ----1885
NM_178812chr821072 186 ------
NM_178818chr1632019 276 161 21975 282 21733 679 --
NM_181054chr141244 --1438 --
NM_181349chr753106 2725 398 270 37 21207 1195 ----
NM_181353chr202540 88 135 ----
NM_181358chr153517 3415 2787 2730 33 --1417 --
NM_181442chr202666 126 ----1321
NM_181481chr1837057 2809 1438 34581 2246 361 12387 --
NM_181482chr1837057 2809 1438 34581 2246 361 12387 --
NM_181483chr1837057 2809 1438 34581 2246 361 12387 --
NM_181504chr514055 --11479 --
NM_181507chr111391 ------
NM_181508chr111391 ------
NM_181521chr1686800 6300 6044 5981 5057 4942 1754 384 26756 5063 26514 5460 --
NM_181523chr514055 --11479 --
NM_181524chr514055 --11479 --
NM_181689chr204756 145 134 60 ------
NM_181705chr585004 3816 2301 1907 1526 1504 758 433 ------
NM_181706chr1122123 447 --2960 829 --
NM_181782chr622146 823 ------
NM_181784chr211059 1800 ----
NM_181838chr51554 ------
NM_181839chr8----11348 --
NM_181844chr1731601 685 195 ----1173
NM_182485chr4----31321 1183 979 --
NM_182488chr132904 610 ------
NM_182501chr242481 782 698 606 12310 21272 692 --
NM_182551chr213258 1244 --11326
NM_182557chr1152086 2060 1769 742 378 22002 844 21841 552 11470
NM_182641chr172158 132 ------
NM_182646chr4----31321 1183 979 --
NM_182666chr32476 72 ------
NM_182678chr2----1357 --
NM_182685chr11154 ------
NM_182691chr711068 ------
NM_182692chr711068 ------
NM_182697chr731123 265 174 ------
NM_182734chr2042858 2531 2293 282 ------
NM_182830chr142635 255 ------
NM_182898chr724197 1490 16512 ----
NM_182899chr724197 1490 16512 ----
NM_182907chr631843 862 470 ------
NM_182948chr12420 355 ------
NM_182970chr2041498 970 940 211 14049 1229 --
NM_183061chr3141 ------
NM_183234chr1551879 1857 1368 748 571 --11791 --
NM_183235chr1551879 1857 1368 748 571 --11791 --
NM_183236chr1551879 1857 1368 748 571 --11791 --
NM_183238chr1221354 954 1598 ----
NM_183397chr2084794 4751 4054 1800 1705 1536 478 412 --24454 1197 15027
NM_194259chr161472 ------
NM_194260chr161472 ------
NM_194261chr161472 ------
NM_194278chr1452819 1370 1159 1056 260 11129 2846 180 12911
NM_194285chr1132794 2623 1379 --22704 627 --
NM_194286chr1265928 5898 5134 2421 771 510 21826 1656 46141 4521 930 333 --
NM_194298chr1031399 761 544 ------
NM_194328chr922605 2394 --12569 --
NM_194329chr922605 2394 --12569 --
NM_194330chr922605 2394 --12569 --
NM_194332chr922605 2394 --12569 --
NM_194434chr181666 24413 2201 ----
NM_197941chr532535 747 411 --1132 --
NM_198066chr1442717 2701 946 547 12172 ----
NM_198081chr622004 1057 ------
NM_198086chr1441762 888 348 70 22117 137 151 --
NM_198097chr73204 73 55 ------
NM_198098chr761720 1646 1282 1243 140 102 11396 21713 1616 --
NM_198123chr811714 ------
NM_198124chr811714 ------
NM_198158chr322725 2514 ------
NM_198159chr322725 2514 ------
NM_198177chr322725 2514 ------
NM_198178chr322725 2514 ------
NM_198217chr1321043 390 --1837 --
NM_198218chr1321043 390 --1837 --
NM_198219chr1321043 390 --1837 --
NM_198268chr153517 3415 2787 2730 33 --1417 --
NM_198269chr153517 3415 2787 2730 33 --1417 --
NM_198270chrX43237 3117 3055 514 ------
NM_198273chr522620 31 ------
NM_198336chr731152 507 457 ------
NM_198353chr41417 --185 --
NM_198391chr2011544 --11305 --
NM_198392chr63697 639 89 ----1360
NM_198468chr634515 582 435 ------
NM_198504chr32375 203 ------
NM_198513chr81573 ------
NM_198560chr322659 2633 --23256 2710 --
NM_198562chr351480 731 663 453 76 12188 22118 363 12094
NM_198581chr237105 5343 984 --26616 5763 --
NM_198597chr103936 722 34 --1952 --
NM_198679chr962488 2388 1719 990 891 141 1850 1125 --
NM_198834chr1721775 794 149 1232 --
NM_198836chr1721775 794 149 1232 --
NM_198837chr1721775 794 149 1232 --
NM_198838chr1721775 794 149 1232 --
NM_198839chr1721775 794 149 1232 --
NM_198859chr364671 3870 1662 1219 247 238 14998 --11440
NM_198900chr12116358 5855 1243 1151 1034 930 922 743 260 249 73 47572 7041 4766 2552 23039 389 --
NM_198965chr121153 ------
NM_198966chr121153 ------
NM_199044chr172871 2647 2622 2554 2181 617 325 ----12939
NM_199050chr2163395 3327 3286 2652 2418 1249 ------
NM_199133chr521081 259 --11113 --
NM_199185chr5------1256
NM_199188chr1223555 59 13938 ----
NM_199190chr1223555 59 13938 ----
NM_199229chr2--1164 ----
NM_199320chr452557 2408 876 850 833 ------
NM_199320chr452557 2408 876 850 833 ------
NM_199324chr413138 ------
NM_199421chr1433269 3259 651 --13767 23204 714
NM_199426chr201257 ------
NM_199436chr222196 220 ------
NM_201253chr12447 418 ------
NM_201266chr272765 2650 2466 2028 1050 673 212 --12605 --
NM_201269chr121311 1183 ------
NM_201279chr272765 2650 2466 2028 1050 673 212 --12605 --
NM_201545chr1--11188 ----
NM_201591chr41523 --1723 --
NM_201592chr41523 --1723 --
NM_201630chr1--174 --1258
NM_203301chr141272 ------
NM_203305chr982558 2034 2009 976 763 434 260 251 22070 493 ----
NM_203327chr20124341 3705 2855 1577 1082 751 712 691 581 243 237 27 13620 33614 1601 786 13677
NM_203346chr251773 1680 1518 738 182 --1328 --
NM_203350chr11326 ----183
NM_203351chr1742491 2317 630 480 1999 1933 --
NM_203364chr11--1400 1825 1418
NM_203399chr11659 --2285 64 --
NM_203401chr11659 --2285 64 --
NM_203403chr91313 ------
NM_203406chr511949 ------
NM_203417chr21173 ------
NM_203418chr21173 ------
NM_203446chr2142261 1107 498 434 ------
NM_203458chr123598 1551 --11223 --
NM_203464chr131249 197 35 ------
NM_203487chr1311292 ------
NM_203494chr151189 ------
NM_205768chr111902 ------
NM_205848chr122320 1795 ----22566 297
NM_205861chr151484 712 239 151 139 ------
NM_206594chr112530 ------
NM_206595chr112530 ------
NM_206809chr64915 893 351 264 --1827 1776
NM_206853chr644037 3260 2981 761 --14020 --
NM_206854chr645298 4521 4242 2022 1415 15281 --
NM_206855chr636263 5486 5207 11380 16246 --
NM_206866chr2132358 2218 674 ------
NM_206876chr223124 2195 --11070 --
NM_206907chr51269 13093 ----
NM_206909chr857455 6450 2890 2253 30 ------
NM_207043chr152296 2205 2120 1732 242 ----11525
NM_207044chr152296 2205 2120 1732 242 ----11525
NM_207047chr152296 2205 2120 1732 242 ----11525
NM_207122chr1111060 ------
NM_207171chr131810 420 225 --21966 1662 --
NM_207299chr9----1191 --
NM_207325chr1921755 1652 ------
NM_207406chr455104 5077 2164 1580 1094 ----15091
NM_207435chr123827 244 40 ------
NM_207481chr211317 ------
NM_207520chr2172 ------
NM_207521chr2172 ------
NM_212460chr711566 ------
NM_212471chr1752189 1556 684 402 96 ------
NM_212472chr1752189 1556 684 402 96 ------
NM_213593chr13993 904 232 ------
NM_213606chr1041861 1839 446 239 11958 ----
NM_213609chr31118 ------
NM_213651chr11138 ------